WorldWideScience

Sample records for incoherent motion diffusion

  1. Intravoxel Incoherent Motion in Normal Pituitary Gland: Initial Study with Turbo Spin-Echo Diffusion-Weighted Imaging.

    Science.gov (United States)

    Kamimura, K; Nakajo, M; Fukukura, Y; Iwanaga, T; Saito, T; Sasaki, M; Fujisaki, T; Takemura, A; Okuaki, T; Yoshiura, T

    2016-12-01

    DWI with conventional single-shot EPI of the pituitary gland is hampered by strong susceptibility artifacts. Our purpose was to evaluate the feasibility of intravoxel incoherent motion assessment by using DWI based on TSE of the normal anterior pituitary lobe. The intravoxel incoherent motion parameters, including the true diffusion coefficient (D), the perfusion fraction (f), and the pseudo-diffusion coefficient (D*), were obtained with TSE-DWI in 5 brain regions (the pons, the WM and GM of the vermis, and the genu and splenium of the corpus callosum) in 8 healthy volunteers, and their agreement with those obtained with EPI-DWI was evaluated by using the intraclass correlation coefficient. The 3 intravoxel incoherent motion parameters in the anterior pituitary lobe were compared with those in the brain regions by using the Dunnett test. The agreement between TSE-DWI and EPI-DWI was moderate (intraclass correlation coefficient = 0.571) for D, substantial (0.699) for f', but fair (0.405) for D*. D in the anterior pituitary lobe was significantly higher than in the 5 brain regions (P anterior pituitary lobe was significantly higher than in the 5 brain regions (P pituitary D* was not significantly different from that in the 5 brain regions. Our results demonstrated the feasibility of intravoxel incoherent motion assessment of the normal anterior pituitary lobe by using TSE-DWI. High D and f values in the anterior pituitary lobe were thought to reflect its microstructural and perfusion characteristics. © 2016 by American Journal of Neuroradiology.

  2. Intravoxel Incoherent Motion MR Imaging in the Differentiation of Benign and Malignant Sinonasal Lesions: Comparison with Conventional Diffusion-Weighted MR Imaging.

    Science.gov (United States)

    Xiao, Z; Tang, Z; Qiang, J; Wang, S; Qian, W; Zhong, Y; Wang, R; Wang, J; Wu, L; Tang, W; Zhang, Z

    2018-01-25

    Intravoxel incoherent motion is a promising method for the differentiation of sinonasal lesions. This study aimed to evaluate the value of intravoxel incoherent motion in the differentiation of benign and malignant sinonasal lesions and to compare the diagnostic performance of intravoxel incoherent motion with that of conventional DWI. One hundred thirty-one patients with histologically proved solid sinonasal lesions (56 benign and 75 malignant) who underwent conventional DWI and intravoxel incoherent motion were recruited in this study. The diffusion coefficient ( D ), pseudodiffusion coefficient ( D *), and perfusion fraction ( f ) values derived from intravoxel incoherent motion and ADC values derived from conventional DWI were measured and compared between the 2 groups using the Student t test. Receiver operating characteristic curve analysis, logistic regression analysis, and 10-fold cross-validation were performed to evaluate the diagnostic performance of single-parametric and multiparametric models. The mean ADC and D values were significantly lower in malignant sinonasal lesions than in benign sinonasal lesions (both P benign and malignant sinonasal lesions. © 2018 by American Journal of Neuroradiology.

  3. Variability of non-Gaussian diffusion MRI and intravoxel incoherent motion (IVIM) measurements in the breast.

    Science.gov (United States)

    Iima, Mami; Kataoka, Masako; Kanao, Shotaro; Kawai, Makiko; Onishi, Natsuko; Koyasu, Sho; Murata, Katsutoshi; Ohashi, Akane; Sakaguchi, Rena; Togashi, Kaori

    2018-01-01

    We prospectively examined the variability of non-Gaussian diffusion magnetic resonance imaging (MRI) and intravoxel incoherent motion (IVIM) measurements with different numbers of b-values and excitations in normal breast tissue and breast lesions. Thirteen volunteers and fourteen patients with breast lesions (seven malignant, eight benign; one patient had bilateral lesions) were recruited in this prospective study (approved by the Internal Review Board). Diffusion-weighted MRI was performed with 16 b-values (0-2500 s/mm2 with one number of excitations [NEX]) and five b-values (0-2500 s/mm2, 3 NEX), using a 3T breast MRI. Intravoxel incoherent motion (flowing blood volume fraction [fIVIM] and pseudodiffusion coefficient [D*]) and non-Gaussian diffusion (theoretical apparent diffusion coefficient [ADC] at b value of 0 sec/mm2 [ADC0] and kurtosis [K]) parameters were estimated from IVIM and Kurtosis models using 16 b-values, and synthetic apparent diffusion coefficient (sADC) values were obtained from two key b-values. The variabilities between and within subjects and between different diffusion acquisition methods were estimated. There were no statistical differences in ADC0, K, or sADC values between the different b-values or NEX. A good agreement of diffusion parameters was observed between 16 b-values (one NEX), five b-values (one NEX), and five b-values (three NEX) in normal breast tissue or breast lesions. Insufficient agreement was observed for IVIM parameters. There were no statistical differences in the non-Gaussian diffusion MRI estimated values obtained from a different number of b-values or excitations in normal breast tissue or breast lesions. These data suggest that a limited MRI protocol using a few b-values might be relevant in a clinical setting for the estimation of non-Gaussian diffusion MRI parameters in normal breast tissue and breast lesions.

  4. Chronic kidney disease: Pathological and functional evaluation with intravoxel incoherent motion diffusion-weighted imaging.

    Science.gov (United States)

    Mao, Wei; Zhou, Jianjun; Zeng, Mengsu; Ding, Yuqin; Qu, Lijie; Chen, Caizhong; Ding, Xiaoqiang; Wang, Yaqiong; Fu, Caixia

    2018-05-01

    Because chronic kidney disease (CKD) is a worldwide problem, accurate pathological and functional evaluation is required for planning treatment and follow-up. Intravoxel incoherent motion diffusion-weighted imaging (IVIM-DWI) can assess both capillary perfusion and tissue diffusion and may be helpful in evaluating renal function and pathology. To evaluate functional and pathological alterations in CKD by applying IVIM-DWI. Prospective study. In all, 72 CKD patients who required renal biopsy and 20 healthy volunteers. 1.5T. All subjects underwent IVIM-DWI of the kidneys, and image analysis was performed by two radiologists. The mean values of true diffusion coefficient (D), pseudo diffusion coefficient (D*), and perfusion fraction (f) were acquired from renal parenchyma. Correlation between IVIM-DWI parameters and estimated glomerular filtration rate (eGFR), as well as pathological damage, were assessed. One-way analysis of variance (ANOVA), paired sample t-test and Spearman correlation analysis. The paired sample t-test revealed that IVIM-DWI parameters were significantly lower in medulla than cortex for both patients and controls (P Imaging 2018;47:1251-1259. © 2017 International Society for Magnetic Resonance in Medicine.

  5. Intravoxel Incoherent Motion MR Imaging in the Head and Neck: Correlation with Dynamic Contrast-Enhanced MR Imaging and Diffusion-Weighted Imaging.

    Science.gov (United States)

    Xu, Xiao Quan; Choi, Young Jun; Sung, Yu Sub; Yoon, Ra Gyoung; Jang, Seung Won; Park, Ji Eun; Heo, Young Jin; Baek, Jung Hwan; Lee, Jeong Hyun

    2016-01-01

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D(*)), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D(*) and model-free parameters from the DCE-MRI (wash-in, Tmax, Emax, initial AUC60, whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D(*) and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D(*) (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck.

  6. Intravoxel Incoherent Motion Diffusion-weighted Imaging: Evaluation of the Differentiation of Solid Hepatic Lesions

    Directory of Open Access Journals (Sweden)

    Ma Luo

    2017-10-01

    Full Text Available PURPOSE: To evaluate whether intravoxel incoherent motion (IVIM–related parameters could be used to differentiate malignant from benign focal liver lesions (FLLs and to improve diagnostic efficiency. METHODS: Seventy-four patients with 75 lesions, including 51 malignant FLLs and 24 benign FLLs, underwent liver 3.0-T magnetic resonance imaging for routine examination sequences. IVIM diffusion-weighted imaging (DWI with 11 b values (0-800 s/mm2 was also acquired concurrently. Apparent diffusion coefficient (ADCtotal and IVIM-derived parameters, such as the pure diffusion coefficient (D, the pseudodiffusion coefficient (D⁎, and the perfusion fraction (f, were calculated and compared between the two groups. A receiver operating characteristic curve analysis was performed to assess their diagnostic value. RESULTS: ADCtotal, D, and f were significantly lower in the malignant group than in the benign group, whereas D⁎ did not show a statistical difference. D had a larger area under the curve value (0.968 and higher sensitivity (92.30% for differentiation. CONCLUSION: IVIM is a useful method to differentiate malignant and benign FLLs. The D value showed higher efficacy to detect hepatic solid lesions.

  7. Use of intravoxel incoherent motion diffusion-weighted imaging in identifying the vascular and avascular zones of human meniscus.

    Science.gov (United States)

    Guo, Tan; Chen, Juan; Wu, Bing; Zheng, Dandan; Jiao, Sheng; Song, Yan; Chen, Min

    2017-04-01

    To investigate the hypothesis that the intravoxel incoherent motion (IVIM) diffusion-weighted imaging may depict microcirculation of meniscus and the perfusion changes in meniscal disorder. Fifty patients received diffusion-weighted MRI with multiple b-values ranging from 0 to 400 s/mm 2 . The four horns of the menisci were divided into normal, degenerated, and torn groups. IVIM parameters including perfusion fraction (f), pseudo-diffusion coefficient (D*), true diffusion coefficient (D), and the product of f and D* (f D*) of normal meniscal red zone and white zone were derived and compared for microcirculation changes of normal, degenerated, and torn posterior horn of the medial meniscus (PMM). The parameters between red and white zones among the groups were compared. Significant differences were considered when P meniscus and the perfusion changes in meniscal disorder. 3 J. Magn. Reson. Imaging 2017;45:1090-1096. © 2016 International Society for Magnetic Resonance in Medicine.

  8. Intravoxel incoherent motion diffusion-weighted imaging in stroke patients: initial clinical experience

    International Nuclear Information System (INIS)

    Yao, Y.; Zhang, S.; Tang, X.; Zhang, S.; Shi, J.; Zhu, W.; Zhu, W.

    2016-01-01

    Aim: To evaluate the feasibility of using intravoxel incoherent motion (IVIM) to measure diffusion and perfusion parameter variations in stroke. Materials and methods: Thirty-eight stroke patients were enrolled in the study. IVIM imaging was performed using 15 b-values from 0 to 1000 s/mm"2. Arterial spin labelling (ASL) magnetic resonance perfusion was also undertaken. Relations between the IVIM parameters (including apparent diffusion coefficient [ADC], diffusion coefficient D_s_l_o_w [D], pseudo-diffusion coefficient D_f_a_s_t [D*], fractional perfusion-related volume [f]) and fD* (the multiplication of the first two parameters) and the ASL-derived parameter, cerebral blood flow (CBF), were analysed using paired t-tests. Comparisons of all the parameters between lesions and contralateral normal regions, as well as between acute and subacute groups were analysed using Student's t-test. Results: There were positive correlations between f and CBF as well as fD* and CBF (r=0.472 and 0.653). Quantitative analysis showed a significant decrease in ADC, D, D*, f, fD*, and CBF of the lesions compared with the contralateral side, in which the decrease of fD* (68.6%) was highest. The values of ADC, f, and fD* increased in the subacute period group compared with the acute period group. Conclusions: IVIM analysis allowed separation of perfusion contribution from true diffusion and thus provided an evaluation of the perfusion and diffusion variations during stroke, which might further elucidate the mechanisms of ischaemic stroke. - Highlights: • There exist positive correlations between fractional perfusion-related volume (f) and cerebral blood flow (CBF) as well as fD"∗ and CBF. • A significant decrease in ADC, diffusion coefficient D_s_l_o_w (D), pseudo-diffusion coefficient D_f_a_s_t (D"∗), f, fD"∗ and CBF of the lesions compared with the contralateral normal regions. • The values of ADC, f and fD"∗ increase significantly in the subacute period compared with

  9. Nasopharyngeal carcinoma: comparison of diffusion and perfusion characteristics between different tumour stages using intravoxel incoherent motion MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Lai, Vincent; Li, Xiao; Huang, Bingsheng; Khong, Pek Lan [University of Hong Kong, Queen Mary Hospital, Department of Diagnostic Radiology, Li Ka Shing Faculty of Medicine, Hong Kong (China); Lee, Victor Ho Fun; Lam, Ka On [University of Hong Kong, Queen Mary Hospital, Department of Clinical Oncology, Li Ka Shing Faculty of Medicine, Hong Kong (China); Fong, Daniel Yee Tak [University of Hong Kong, School of Nursing, Li Ka Shing Faculty of Medicine, Hong Kong (China); Chan, Queenie [Philips Healthcare, Hong Kong, New Territories (China)

    2014-01-15

    To explore intravoxel incoherent motion (IVIM) characteristics of nasopharyngeal carcinoma (NPC) and relationships with different tumour stages. We prospectively recruited 80 patients with newly diagnosed undifferentiated NPC. Diffusion-weighted MR imaging was performed and IVIM parameters (D, pure diffusion; f, perfusion fraction; D*, pseudodiffusion coefficient) were calculated. Patients were stratified into low and high tumour stage groups based on American Joint Committee on Cancer (AJCC) and TNM staging for determination of the predictive powers of IVIM parameters using t test, multiple logistic regression and ROC curve analyses. D, f and D* were all statistically significantly lower in high-stage groups in AJCC, T and N staging. D, f and D* were all independent predictors of AJCC staging, f and D* were independent predictors of T staging, and D was an independent predictor of N staging. D was most powerful for AJCC and N staging, whereas f was most powerful for T staging. Optimal cut-off values (area under the curve, sensitivity, specificity, positive likelihood ratio, negative likelihood ratio) were as follows: AJCC stage, D = 0.782 x 10{sup -3} mm{sup 2}/s (0.915, 93.3 %, 76.2 %, 3.92, 0.09); T staging, f = 0.133 (0.905, 80.5 %, 92.5 %, 10.73, 0.21); N staging, D = 0.761 x 10{sup -3} mm{sup 2}/s (0.848, 87.5 %, 66.7 %, 2.62, 0.19). Multivariate analysis showed no diagnostic improvement. Nasopharyngeal carcinoma has distinctive intravoxel incoherent motion characteristics parameters in different tumour staging, potentially helping pretreatment staging. (orig.)

  10. Intravoxel Incoherent Motion MR Imaging in the Head and Neck: Correlation with Dynamic Contrast-Enhanced MR Imaging and Diffusion-Weighted Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xiao Quan [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Department of Radiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Choi, Young Jun; Sung, Yu Sub [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Yoon, Ra Gyoung [Department of Radiology, Catholic Kwandong University International St. Mary' s Hospital, Catholic Kwandong University College of Medicine, Incheon 22711 (Korea, Republic of); Jang, Seung Won; Park, Ji Eun [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Heo, Young Jin [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Department of Radiology, Busan Paik Hospital, Inje University College of Medicine, Busan 47392 (Korea, Republic of); Baek, Jung Hwan; Lee, Jeong Hyun [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of)

    2016-11-01

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D{sup *}), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D{sup *} and model-free parameters from the DCE-MRI (wash-in, T{sub max}, E{sub max}, initial AUC{sub 60}, whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D{sup *} and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p < 0.001, r = 0.980) and muscles (p = 0.013, r = 0.542), despite its significantly higher value than D. The difference between ADC and D showed significant correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D{sup *} (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck.

  11. Perfusion and diffusion characteristics of cervical cancer based on intravoxel incoherent motion MR imaging-a pilot study

    International Nuclear Information System (INIS)

    Lee, Elaine Yuen Phin; Yu, Xue; Khong, Pek-Lan; Chu, Mandy Man Yee; Ngan, Hextan Yuen Sheung; Siu, Steven Wai Kwan; Soong, Inda Sung; Chan, Queenie

    2014-01-01

    To investigate the tissue characteristics of cervical cancer based on the intravoxel incoherent motion (IVIM) model and to assess the IVIM parameters in tissue differentiation in the female pelvis. Sixteen treatment-naive cervical cancer and 17 age-matched healthy subjects were prospectively recruited for diffusion-weighted (b = 0-1,000 s/mm 2 ) and standard pelvic MRI. Bi-exponential analysis was performed to derive the perfusion parameters f (perfusion fraction) and D* (pseudodiffusion coefficient) as well as the diffusion parameter D (true molecular diffusion coefficient) in cervical cancer (n = 16), normal cervix (n = 17), myometrium (n = 33) and leiomyoma (n = 14). Apparent diffusion coefficient (ADC) was calculated. Kruskal-Wallis test and receiver operating characteristics (ROC) curves were used. Cervical cancer had the lowest f (14.9 ± 2.6 %) and was significantly different from normal cervix and leiomyoma (p -3 mm2/s) was lowest in cervical cancer and was significantly different from normal cervix and myometrium (p -3 mm 2 /s and ADC -3 mm 2 /s could differentiate cervical cancer from non-malignant tissues (AUC 0.773-0.908). Cervical cancer has low perfusion and diffusion IVIM characteristics with promising potential for tissue differentiation. (orig.)

  12. [Value of intravoxel incoherent motion diffusion-weighted imaging in differential diagnosis of benign and malignant hepatic lesions and blood perfusion evaluation].

    Science.gov (United States)

    Ying, M L; Xiao, W W; Xu, S L; Shu, J E; Pan, J F; Fu, J F; Lu, J H; Pan, Y H; Jiang, Y

    2016-11-20

    Objective: To investigate the value of intravoxel incoherent motion diffusion-weighted imaging (IVIM-DWI) in the differential diagnosis and blood perfusion evaluation of benign and malignant hepatic lesions. Methods: A retrospective analysis was performed for 86 patients (96 lesions) with pathologically or clinically confirmed hepatic lesions or hepatic lesions diagnosed based on follow-up results, among whom 48 had malignant lesions (53 lesions) and 38 had benign lesions (43 lesions). The patients underwent conventional magnetic resonance (MR) plain scan, contrast-enhanced scan, and diffusion-weighted imaging (DWI) with different b values (b = 0, 50, 100, 150, 200, 400, 600, 800, 1 000, and 1 200 s/mm 2 ) to determine the parameters of the double exponential model for intravoxel incoherent motion (IVIM): fast diffusion coefficient Dfast, slow diffusion coefficient Dslow, and percentage of fast-diffusion constituent F value. The patients were divided into groups according to the blood supply to lesions on conventional MR plain scan and contrast-enhanced scan, and there were 47 lesions in abundant blood supply group and 49 in poor blood supply group. The data for analysis were Dfast, Dslow, and F values of benign/malignant lesion groups and abundant/poor blood supply groups. The independent samples t-test was used for statistical analysis; the independent samples non-parametric test Mann-Whitney U test was used for the comparison of F value; the receiver operating characteristic (ROC) curve was used to evaluate the value of above parameters in the differentiation of benign and malignant lesions and blood supply evaluation. Results: Compared with the malignant lesion group, the benign lesion group had significantly higher Dslow, and F values ( P benign and malignant hepatic lesions, and F value can show blood perfusion in benign and malignant hepatic lesions without the need for contrast-enhanced scan, which provides a reference for the qualitative diagnosis of liver

  13. Comparison of Turbo Spin Echo and Echo Planar Imaging for intravoxel incoherent motion and diffusion tensor imaging of the kidney at 3 Tesla

    Energy Technology Data Exchange (ETDEWEB)

    Hilbert, Fabian; Wech, Tobias; Neubauer, Henning; Veldhoen, Simon; Bley, Thorsten Alexander; Koestler, Herbert [Wuerzburg Univ. (Germany). Inst. fuer Diagnostische und Interventionelle Radiologie

    2017-10-01

    Echo Planar Imaging (EPI) is most commonly applied to acquire diffusion-weighted MR-images. EPI is able to capture an entire image in very short time, but is prone to distortions and artifacts. In diffusion-weighted EPI of the kidney severe distortions may occur due to intestinal gas. Turbo Spin Echo (TSE) is robust against distortions and artifacts, but needs more time to acquire an entire image compared to EPI. Therefore, TSE is more sensitive to motion during the readout. In this study we compare diffusion-weighted TSE and EPI of the human kidney with regard to intravoxel incoherent motion (IVIM) and diffusion tensor imaging (DTI). Images were acquired with b-values between 0 and 750 s/mm{sup 2} with TSE and EPI. Distortions were observed with the EPI readout in all volunteers, while the TSE images were virtually distortion-free. Fractional anisotropy of the diffusion tensor was significantly lower for TSE than for EPI. All other parameters of DTI and IVIM were comparable for TSE and EPI. Especially the main diffusion directions yielded by TSE and EPI were similar. The results demonstrate that TSE is a worthwhile distortion-free alternative to EPI for diffusion-weighted imaging of the kidney at 3 Tesla.

  14. Incoherent neutron scattering functions for random jump diffusion in bounded and infinite media

    International Nuclear Information System (INIS)

    Hall, P.L.; Ross, D.K.

    1981-01-01

    The incoherent neutron scattering function for unbounded jump diffusion is calculated from random walk theory assuming a gaussian distribution of jump lengths. The method is then applied to calculate the scattering function for spatially bounded random jumps in one dimension. The dependence on momentum transfer of the quasi-elastic energy broadenings predicted by this model and a previous model for bounded one-dimensional continuous diffusion are calculated and compared with the predictions of models for diffusion in unbounded media. The one-dimensional solutions can readily be generalized to three dimensions to provide a description of quasi-elastic scattering of neutrons by molecules undergoing localized random motions. (author)

  15. Perfusion and diffusion characteristics of cervical cancer based on intravoxel incoherent motion MR imaging-a pilot study

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Elaine Yuen Phin; Yu, Xue; Khong, Pek-Lan [The University of Hong Kong, Department of Diagnostic Radiology, Queen Mary Hospital, Hong Kong (China); Chu, Mandy Man Yee; Ngan, Hextan Yuen Sheung [The University of Hong Kong, Department of Obstetrics and Gynaecology, Queen Mary Hospital, Hong Kong (China); Siu, Steven Wai Kwan [Queen Mary Hospital, Department of Clinical Oncology, Hong Kong (China); Soong, Inda Sung [Pamela Youde Nethersole Eastern Hospital, Department of Clinical Oncology, Hong Kong (China); Chan, Queenie [Philips Healthcare, Hong Kong (China)

    2014-07-15

    To investigate the tissue characteristics of cervical cancer based on the intravoxel incoherent motion (IVIM) model and to assess the IVIM parameters in tissue differentiation in the female pelvis. Sixteen treatment-naive cervical cancer and 17 age-matched healthy subjects were prospectively recruited for diffusion-weighted (b = 0-1,000 s/mm{sup 2}) and standard pelvic MRI. Bi-exponential analysis was performed to derive the perfusion parameters f (perfusion fraction) and D* (pseudodiffusion coefficient) as well as the diffusion parameter D (true molecular diffusion coefficient) in cervical cancer (n = 16), normal cervix (n = 17), myometrium (n = 33) and leiomyoma (n = 14). Apparent diffusion coefficient (ADC) was calculated. Kruskal-Wallis test and receiver operating characteristics (ROC) curves were used. Cervical cancer had the lowest f (14.9 ± 2.6 %) and was significantly different from normal cervix and leiomyoma (p < 0.05). The D (0.86 ± 0.16 x 10{sup -3} mm2/s) was lowest in cervical cancer and was significantly different from normal cervix and myometrium (p < 0.05) but not leiomyoma. No difference was observed in D*. D was consistently lower than ADC in all tissues. ROC curves indicated that f < 16.38 %, D < 1.04 x 10{sup -3} mm{sup 2}/s and ADC < 1.13 x 10{sup -3} mm{sup 2}/s could differentiate cervical cancer from non-malignant tissues (AUC 0.773-0.908). Cervical cancer has low perfusion and diffusion IVIM characteristics with promising potential for tissue differentiation. (orig.)

  16. Compensation for incoherent ground motion

    International Nuclear Information System (INIS)

    Shigeru, Takeda; Hiroshi, Matsumoto; Masakazu, Yoshioka; Yasunori, Takeuchi; Kikuo, Kudo; Tsuneya, Tsubokawa; Mitsuaki, Nozaki; Kiyotomo, Kawagoe

    1999-01-01

    The power spectrum density and coherence function for ground motions are studied for the construction of the next generation electron-positron linear collider. It should provide a center of mass energy between 500 GeV-1 TeV with luminosity as high as 10 33 to 10 34 cm -2 sec -1 . Since the linear collider has a relatively slow repetition rate, large number of particles and small sizes of the beam should be generated and preserved in the machine to obtain the required high luminosity. One of the most critical parameters is the extremely small vertical beam size at the interaction point, thus a proper alignment system for the focusing and accelerating elements of the machine is necessary to achieve the luminosity. We describe recent observed incoherent ground motions and an alignment system to compensate the distortion by the ground motions. (authors)

  17. Intravoxel incoherent motion diffusion-weighted magnetic resonance imaging of focal vertebral bone marrow lesions: initial experience of the differentiation of nodular hyperplastic hematopoietic bone marrow from malignant lesions

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sunghoon; Kwack, Kyu-Sung; Kim, Jae Ho [Ajou University School of Medicine, Division of Musculoskeletal Radiology, Department of Radiology, Suwon, Gyeonggi-do (Korea, Republic of); Ajou University Medical Center, Musculoskeletal Imaging Laboratory, Suwon (Korea, Republic of); Chung, Nam-Su [Ajou University School of Medicine, Department of Orthopaedic Surgery, Suwon (Korea, Republic of); Hwang, Jinwoo [Philips Healthcare, Department of Clinical Science, Seoul (Korea, Republic of); Lee, Hyun Young [Ajou University Medical Center, Regional Clinical Trial Center, Suwon (Korea, Republic of); Yonsei University College of Medicine, Department of Biostatistics, Seoul (Korea, Republic of)

    2017-05-15

    To evaluate the ability of intravoxel incoherent motion (IVIM) diffusion-weighted magnetic resonance imaging (MRI) parameters to differentiate nodular hyperplastic hematopoietic bone marrow (HHBM) from malignant vertebral bone marrow lesions (VBMLs). A total of 33 patients with 58 VBMLs, including 9 nodular HHBM lesions, 39 bone metastases, and 10 myelomas, were retrospectively assessed. All diagnoses were confirmed either pathologically or via image assessment. IVIM diffusion-weighted MRI with 11 b values (from 0 to 800 s/mm{sup 2}) were obtained using a 3.0-T MR imager. The apparent diffusion coefficient (ADC), pure diffusion coefficient (D), perfusion fraction (f), and pseudodiffusion coefficient (D*) were calculated. ADC and IVIM parameters were compared using the Mann-Whitney U test. Receiver operating characteristic (ROC) curve analysis was performed to assess the diagnostic performances of ADC, D, f, and D* in terms of VBML characterization. The diagnostic performance of morphological MR sequences was also assessed for comparison. The ADC and D values of nodular HHBM were significantly lower than those of malignant VBML (both p values < 0.001), whereas the f value was significantly higher (p < 0.001). However, there were no significant differences in D* between the two groups (p = 0.688). On ROC analysis, the area under the curve (AUC) for D was 1.000, which was significantly larger than that for ADC (AUC = 0.902). Intravoxel incoherent motion diffusion-weighted MRI can be used to differentiate between nodular HHBM and malignant VBML. The D value was significantly lower for nodular HHBM, and afforded a better diagnostic performance than the ADC, f, and D* values in terms of such differentiation. (orig.)

  18. Intravoxel incoherent motion (IVIM histogram biomarkers for prediction of neoadjuvant treatment response in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Gene Y. Cho

    Full Text Available Objective: To examine the prognostic capabilities of intravoxel incoherent motion (IVIM metrics and their ability to predict response to neoadjuvant treatment (NAT. Additionally, to observe changes in IVIM metrics between pre- and post-treatment MRI. Methods: This IRB-approved, HIPAA-compliant retrospective study observed 31 breast cancer patients (32 lesions. Patients underwent standard bilateral breast MRI along with diffusion-weighted imaging before and after NAT. Six patients underwent an additional IVIM-MRI scan 12–14 weeks after initial scan and 2 cycles of treatment. In addition to apparent diffusion coefficients (ADC from monoexponential decay, IVIM mean values (tissue diffusivity Dt, perfusion fraction fp, and pseudodiffusivity Dp and histogram metrics were derived using a biexponential model. An additional filter identified voxels of highly vascular tumor tissue (VTT, excluding necrotic or normal tissue. Clinical data include histology of biopsy and clinical response to treatment through RECIST assessment. Comparisons of treatment response were made using Wilcoxon rank-sum tests. Results: Average, kurtosis, and skewness of pseudodiffusion Dp significantly differentiated RECIST responders from nonresponders. ADC and Dt values generally increased (∼70% and VTT% values generally decreased (∼20% post-treatment. Conclusion: Dp metrics showed prognostic capabilities; slow and heterogeneous pseudodiffusion offer poor prognosis. Baseline ADC/Dt parameters were not significant predictors of response. This work suggests that IVIM mean values and heterogeneity metrics may have prognostic value in the setting of breast cancer NAT. Keywords: Breast cancer, Diffusion weighted MRI, Intravoxel incoherent motion, Neoadjuvant treatment, Response evaluation criteria in solid tumors

  19. MRI assessment of the thigh musculature in dermatomyositis and healthy subjects using diffusion tensor imaging, intravoxel incoherent motion and dynamic DTI.

    Science.gov (United States)

    Sigmund, E E; Baete, S H; Luo, T; Patel, K; Wang, D; Rossi, I; Duarte, A; Bruno, M; Mossa, D; Femia, A; Ramachandran, S; Stoffel, D; Babb, J S; Franks, A; Bencardino, J

    2018-06-04

    Dermatomyositis (DM) is an idiopathic inflammatory myopathy involving severe debilitation in need of diagnostics. We evaluated the proximal lower extremity musculature with diffusion tensor imaging (DTI), intravoxel incoherent motion (IVIM) and dynamic DTI in DM patients and controls and compared with standard clinical workup.  METHODS: In this IRB-approved, HIPAA-compliant study with written informed consent, anatomical, Dixon fat/water and diffusion imaging were collected in bilateral thigh MRI of 22 controls and 27 DM patients in a 3T scanner. Compartments were scored on T1/T2 scales. Single voxel dynamic DTI metrics in quadriceps before and after 3-min leg exercise were measured. Spearman rank correlation and mixed model analysis of variance/covariance (ANOVA/ANCOVA) were used to correlate with T1 and T2 scores and to compare patients with controls. DM patients showed significantly lower pseudo-diffusion and volume in quadriceps than controls. All subjects showed significant correlation between T1 score and signal-weighted fat fraction; tissue diffusion and pseudo-diffusion varied significantly with T1 and T2 score in patients. Radial and mean diffusion exercise response in patients was significantly higher than controls. Static and dynamic diffusion imaging metrics show correlation with conventional imaging scores, reveal spatial heterogeneity, and provide means to differentiate dermatomyositis patients from controls. • Diffusion imaging shows regional differences between thigh muscles of dermatomyositis patients and controls. • Signal-weighted fat fraction and diffusion metrics correlate with T1/T2 scores of disease severity. • Dermatomyositis patients show significantly higher radial diffusion exercise response than controls.

  20. Seismic soil-structure interaction with consideration of spatial incoherence of seismic ground motions: A case study

    Energy Technology Data Exchange (ETDEWEB)

    Tseng, Wen S., E-mail: wen.tseng@rizzoassoc.com [Paul C. Rizzo Associates, Inc., Western Region, 2201 Broadway, Suite 400, Oakland, CA 94612 (United States); Lilhanand, Kiat; Hamasaki, Don; Garcia, Julio A. [Paul C. Rizzo Associates, Inc., Western Region, 2201 Broadway, Suite 400, Oakland, CA 94612 (United States); Srinivasan, Ram [AREVA, NP, Inc., 6399 San Ignacio Avenue, San Jose, CA 95119 (United States)

    2014-04-01

    This paper presents a case study of seismic soil-structure interaction (SSI) analysis with consideration of spatial incoherence of seismic input ground motions. The SSI analyses were performed using the SASSI computer program for the Auxiliary Control Building (ACB) structure of an existing nuclear power plant on a hard rock site located in the Center and Eastern United States (CEUS) region. The incoherent seismic input motions for the hard rock site used for the analyses were generated using the computer program INCOH that works together with SASSI. The objective of the analyses was to generate maximum seismic response parameters for assessment of potential impact of newly developed site-specific (ground motion) response spectra (SSRS) on the seismic design of the ACB and potential benefits that could be gained by considering spatial incoherence of seismic input motions. Maximum seismic response values for selected response parameters of interest were generated with both SSRS-compatible coherent and incoherent seismic input motions. Comparisons were made of the corresponding maximum response parameter values and in-structure (acceleration) response spectra (ISRS) generated for both the coherent and incoherent motion inputs. These comparisons indicate that, by incorporating incoherence of ground motions in the seismic input, the maximum response values reduces and the ISRS peak amplitudes in the high frequency range (>10 Hz) also reduce from the corresponding response values resulting from the coherent motion input. The amount of ISRS-amplitude reduction increases as the spectral frequency increases, as expected. Such reductions can be as much as 20–50%. This case study demonstrates that, for a CEUS hard rock site where relatively high high-frequency in the seismic input response spectra exist, consideration of spatial incoherence of input motions would result in substantial benefits in reducing the high-frequency seismic responses. Such benefits are especially

  1. Repeatability of apparent diffusion coefficient and intravoxel incoherent motion parameters at 3.0 Tesla in orbital lesions

    Energy Technology Data Exchange (ETDEWEB)

    Lecler, Augustin [Fondation Ophtalmologique Adolphe de Rothschild, Department of Radiology, Paris (France); Cardiovascular Research Centre - PARCC, Universite Paris Descartes Sorbonne Paris Cite, INSERM UMR-S970, Paris (France); Savatovsky, Julien; Sadik, Jean-Claude; Charbonneau, Frederique; Berges, Olivier [Fondation Ophtalmologique Adolphe de Rothschild, Department of Radiology, Paris (France); Balvay, Daniel [Cardiovascular Research Centre - PARCC, Universite Paris Descartes Sorbonne Paris Cite, INSERM UMR-S970, Paris (France); Zmuda, Mathieu; Galatoire, Olivier [Fondation Ophtalmologique Adolphe de Rothschild, Department of Orbitopalpebral Surgery, Paris (France); Picard, Herve [Fondation Ophtalmologique Adolphe de Rothschild, Clinical Research Unit, Paris (France); Fournier, Laure [Cardiovascular Research Centre - PARCC, Universite Paris Descartes Sorbonne Paris Cite, INSERM UMR-S970, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Assistance Publique-Hopitaux de Paris, Hopital Europeen Georges Pompidou, Radiology Department, Paris (France)

    2017-12-15

    To evaluate repeatability of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) parameters in the orbit. From December 2015 to March 2016, 22 patients were scanned twice using an IVIM sequence with 15b values (0-2,000 s/mm{sup 2}) at 3.0T. Two readers independently delineated regions of interest in an orbital mass and in different intra-orbital and extra-orbital structures. Short-term test-retest repeatability and inter-observer agreement were assessed using the intra-class correlation coefficient (ICC), the coefficient of variation (CV) and Bland-Altman limits of agreements (BA-LA). Test-retest repeatability of IVIM parameters in the orbital mass was satisfactory for ADC and D (mean CV 12% and 14%, ICC 95% and 93%), poor for f and D*(means CV 43% and 110%, ICC 90% and 65%). Inter-observer repeatability agreement was almost perfect in the orbital mass for all the IVIM parameters (ICC = 95%, 93%, 94% and 90% for ADC, D, f and D*, respectively). IVIM appeared to be a robust tool to measure D in orbital lesions with good repeatability, but this approach showed a poor repeatability of f and D*. (orig.)

  2. Repeatability of apparent diffusion coefficient and intravoxel incoherent motion parameters at 3.0 Tesla in orbital lesions

    International Nuclear Information System (INIS)

    Lecler, Augustin; Savatovsky, Julien; Sadik, Jean-Claude; Charbonneau, Frederique; Berges, Olivier; Balvay, Daniel; Zmuda, Mathieu; Galatoire, Olivier; Picard, Herve; Fournier, Laure

    2017-01-01

    To evaluate repeatability of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) parameters in the orbit. From December 2015 to March 2016, 22 patients were scanned twice using an IVIM sequence with 15b values (0-2,000 s/mm 2 ) at 3.0T. Two readers independently delineated regions of interest in an orbital mass and in different intra-orbital and extra-orbital structures. Short-term test-retest repeatability and inter-observer agreement were assessed using the intra-class correlation coefficient (ICC), the coefficient of variation (CV) and Bland-Altman limits of agreements (BA-LA). Test-retest repeatability of IVIM parameters in the orbital mass was satisfactory for ADC and D (mean CV 12% and 14%, ICC 95% and 93%), poor for f and D*(means CV 43% and 110%, ICC 90% and 65%). Inter-observer repeatability agreement was almost perfect in the orbital mass for all the IVIM parameters (ICC = 95%, 93%, 94% and 90% for ADC, D, f and D*, respectively). IVIM appeared to be a robust tool to measure D in orbital lesions with good repeatability, but this approach showed a poor repeatability of f and D*. (orig.)

  3. Determination of malignancy and characterization of hepatic tumor type with diffusion-weighted magnetic resonance imaging: comparison of apparent diffusion coefficient and intravoxel incoherent motion-derived measurements.

    Science.gov (United States)

    Doblas, Sabrina; Wagner, Mathilde; Leitao, Helena S; Daire, Jean-Luc; Sinkus, Ralph; Vilgrain, Valérie; Van Beers, Bernard E

    2013-10-01

    The objective of this study was to compare the value of the apparent diffusion coefficient (ADC) determined with 3 b values and the intravoxel incoherent motion (IVIM)-derived parameters in the determination of malignancy and characterization of hepatic tumor type. Seventy-six patients with 86 solid hepatic lesions, including 8 hemangiomas, 20 lesions of focal nodular hyperplasia, 9 adenomas, 30 hepatocellular carcinomas, 13 metastases, and 6 cholangiocarcinomas, were assessed in this prospective study. Diffusion-weighted images were acquired with 11 b values to measure the ADCs (with b = 0, 150, and 500 s/mm) and the IVIM-derived parameters, namely, the pure diffusion coefficient and the perfusion-related diffusion fraction and coefficient. The diffusion parameters were compared between benign and malignant tumors and between tumor types, and their diagnostic value in identifying tumor malignancy was assessed. The apparent and pure diffusion coefficients were significantly higher in benign than in malignant tumors (benign: 2.32 [0.87] × 10 mm/s and 1.42 [0.37] × 10 mm/s vs malignant: 1.64 [0.51] × 10 mm/s and 1.14 [0.28] × 10 mm/s, respectively; P coefficients provided similar accuracy in assessing tumor malignancy (areas under the receiver operating characteristic curve of 0.770 and 0.723, respectively). In the multigroup analysis, the ADC was found to be significantly higher in hemangiomas than in hepatocellular carcinomas, metastases, and cholangiocarcinomas. In the same manner, it was higher in lesions of focal nodular hyperplasia than in metastases and cholangiocarcinomas. However, the pure diffusion coefficient was significantly higher only in hemangiomas versus hepatocellular and cholangiocellular carcinomas. Compared with the ADC, the diffusion parameters derived from the IVIM model did not improve the determination of malignancy and characterization of hepatic tumor type.

  4. Diffusion parameter mapping with the combined intravoxel incoherent motion and kurtosis model using artificial neural networks at 3 T.

    Science.gov (United States)

    Bertleff, Marco; Domsch, Sebastian; Weingärtner, Sebastian; Zapp, Jascha; O'Brien, Kieran; Barth, Markus; Schad, Lothar R

    2017-12-01

    Artificial neural networks (ANNs) were used for voxel-wise parameter estimation with the combined intravoxel incoherent motion (IVIM) and kurtosis model facilitating robust diffusion parameter mapping in the human brain. The proposed ANN approach was compared with conventional least-squares regression (LSR) and state-of-the-art multi-step fitting (LSR-MS) in Monte-Carlo simulations and in vivo in terms of estimation accuracy and precision, number of outliers and sensitivity in the distinction between grey (GM) and white (WM) matter. Both the proposed ANN approach and LSR-MS yielded visually increased parameter map quality. Estimations of all parameters (perfusion fraction f, diffusion coefficient D, pseudo-diffusion coefficient D*, kurtosis K) were in good agreement with the literature using ANN, whereas LSR-MS resulted in D* overestimation and LSR yielded increased values for f and D*, as well as decreased values for K. Using ANN, outliers were reduced for the parameters f (ANN, 1%; LSR-MS, 19%; LSR, 8%), D* (ANN, 21%; LSR-MS, 25%; LSR, 23%) and K (ANN, 0%; LSR-MS, 0%; LSR, 15%). Moreover, ANN enabled significant distinction between GM and WM based on all parameters, whereas LSR facilitated this distinction only based on D and LSR-MS on f, D and K. Overall, the proposed ANN approach was found to be superior to conventional LSR, posing a powerful alternative to the state-of-the-art method LSR-MS with several advantages in the estimation of IVIM-kurtosis parameters, which might facilitate increased applicability of enhanced diffusion models at clinical scan times. Copyright © 2017 John Wiley & Sons, Ltd.

  5. Use of intravoxel incoherent motion diffusion-weighted MR imaging for assessment of treatment response to invasive fungal infection in the lung

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Chenggong; Xiong, Wei; Wu, Yuankui; Li, Caixia; Xu, Yikai [Southern Medical University, Department of Medical Imaging Center, Nanfang Hospital, Guangzhou (China); Xu, Jun; Wei, Qi; Feng, Ru; Liu, Qifa [Southern Medical University, Department of Hematology, Nanfang Hospital, Guangzhou (China); Chan, Queenie [Philips Healthcare, New Territories, Hon Kong (China)

    2017-01-15

    The purpose of this study was to determine whether intravoxel incoherent motion (IVIM) -derived parameters and apparent diffusion coefficient (ADC) could act as imaging biomarkers for predicting antifungal treatment response. Forty-six consecutive patients (mean age, 33.9 ± 13.0 y) with newly diagnosed invasive fungal infection (IFI) in the lung according to EORTC/MSG criteria were prospectively enrolled. All patients underwent diffusion-weighted magnetic resonance (MR) imaging at 3.0 T using 11 b values (0-1000 sec/mm{sup 2}). ADC, pseudodiffusion coefficient D*, perfusion fraction f, and the diffusion coefficient D were compared between patients with favourable (n=32) and unfavourable response (n=14). f values were significantly lower in the unfavourable response group (12.6%±4.4%) than in the favourable response group (30.2%±8.6%) (Z=4.989, P<0.001). However, the ADC, D, and D* were not significantly different between the two groups (P>0.05). Receiver operating characteristic curve analyses showed f to be a significant predictor for differentiation, with a sensitivity of 93.8% and a specificity of 92.9%. IVIM-MRI is potentially useful in the prediction of antifungal treatment response to patients with IFI in the lung. Our results indicate that a low perfusion fraction f may be a noninvasive imaging biomarker for unfavourable response. (orig.)

  6. Intravoxel incoherent motion perfusion imaging in acute stroke: initial clinical experience

    International Nuclear Information System (INIS)

    Federau, C.; Becce, F.; Maeder, P.; Meuli, R.; Sumer, S.; Wintermark, M.; O'Brien, K.

    2014-01-01

    Intravoxel incoherent motion (IVIM) imaging is an MRI perfusion technique that uses a diffusion-weighted sequence with multiple b values and a bi-compartmental signal model to measure the so-called pseudo-diffusion of blood caused by its passage through the microvascular network. The goal of the current study was to assess the feasibility of IVIM perfusion fraction imaging in patients with acute stroke. Images were collected in 17 patients with acute stroke. Exclusion criteria were onset of symptoms to imaging >5 days, hemorrhagic transformation, infratentorial lesions, small lesions 2 . Image quality was assessed by two radiologists, and quantitative analysis was performed in regions of interest placed in the stroke area, defined by thresholding the apparent diffusion coefficient maps, as well as in the contralateral region. IVIM perfusion fraction maps showed an area of decreased perfusion fraction f in the region of decreased apparent diffusion coefficient. Quantitative analysis showed a statistically significant decrease in both IVIM perfusion fraction f (0.026 ± 0.019 vs. 0.056 ± 0.025, p = 2.2 . 10 -6 ) and diffusion coefficient D compared with the contralateral side (3.9 ± 0.79 . 10 -4 vs. 7.5 ± 0.86 . 10 -4 mm 2 /s, p = 1.3 . 10 -20 ). IVIM perfusion fraction imaging is feasible in acute stroke. IVIM perfusion fraction is significantly reduced in the visible infarct. Further studies should evaluate the potential for IVIM to predict clinical outcome and treatment response. (orig.)

  7. Comparison of intravoxel incoherent motion diffusion-weighted imaging between turbo spin-echo and echo-planar imaging of the head and neck

    Energy Technology Data Exchange (ETDEWEB)

    Mikayama, Ryoji; Yabuuchi, Hidetake; Nagatomo, Kazuya; Kimura, Mitsuhiro; Kumazawa, Seiji [Kyushu University, Department of Health Sciences, Graduate School of Medical Sciences, Fukuoka (Japan); Sonoda, Shinjiro; Kobayashi, Koji [Kyushu University Hospital, Division of Radiology, Department of Medical Technology, Fukuoka (Japan); Kawanami, Satoshi; Kamitani, Takeshi; Honda, Hiroshi [Kyushu University, Department of Clinical Radiology, Graduate School of Medical Sciences, Fukuoka (Japan)

    2018-01-15

    To compare image quality, apparent diffusion coefficient (ADC), and intravoxel incoherent motion (IVIM)-derived parameters between turbo spin-echo (TSE)-diffusion-weighted imaging (DWI) and echo-planar imaging (EPI)-DWI of the head and neck. Fourteen volunteers underwent head and neck imaging using TSE-DWI and EPI-DWI. Distortion ratio (DR), signal-to-noise ratio (SNR), contrast-to-noise ratio (CNR), ADC and IVIM-derived parameters were compared between the two techniques. Bland-Altman analysis was performed to analyse reproducibility between the quantitative parameters of TSE-DWI and EPI-DWI. DR of TSE-DWI was significantly smaller than that of EPI-DWI. SNR and CNR of TSE-DWI were significantly higher than those of EPI-DWI. ADC and IVIM-derived parameters of TSE-DWI showed higher values than those of EPI-DWI, although the difference was not significant. Bland-Altman analysis showed wide limits of agreement between the two sequences. TSE-DWI can produce better image quality than EPI-DWI, while TSE-DWI possibly exhibits different values of quantitative parameters. Therefore, TSE-DWI could be a good alternative to EPI-DWI for patients sensitive to distortion. However, it is not recommended to use both TSE-DWI and EPI-DWI on follow-up. (orig.)

  8. Intravoxel incoherent motion diffusion-weighted imaging in the liver: comparison of mono-, bi- and tri-exponential modelling at 3.0-T

    International Nuclear Information System (INIS)

    Cercueil, Jean-Pierre; Petit, Jean-Michel; Nougaret, Stephanie; Pierredon-Foulongne, Marie-Ange; Schembri, Valentina; Delhom, Elisabeth; Guiu, Boris; Soyer, Philippe; Fohlen, Audrey; Schmidt, Sabine; Denys, Alban; Aho, Serge

    2015-01-01

    To determine whether a mono-, bi- or tri-exponential model best fits the intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) signal of normal livers. The pilot and validation studies were conducted in 38 and 36 patients with normal livers, respectively. The DWI sequence was performed using single-shot echoplanar imaging with 11 (pilot study) and 16 (validation study) b values. In each study, data from all patients were used to model the IVIM signal of normal liver. Diffusion coefficients (D i ± standard deviations) and their fractions (f i ± standard deviations) were determined from each model. The models were compared using the extra sum-of-squares test and information criteria. The tri-exponential model provided a better fit than both the bi- and mono-exponential models. The tri-exponential IVIM model determined three diffusion compartments: a slow (D 1 = 1.35 ± 0.03 x 10 -3 mm 2 /s; f 1 = 72.7 ± 0.9 %), a fast (D 2 = 26.50 ± 2.49 x 10 -3 mm 2 /s; f 2 = 13.7 ± 0.6 %) and a very fast (D 3 = 404.00 ± 43.7 x 10 -3 mm 2 /s; f 3 = 13.5 ± 0.8 %) diffusion compartment [results from the validation study]. The very fast compartment contributed to the IVIM signal only for b values ≤15 s/mm 2 The tri-exponential model provided the best fit for IVIM signal decay in the liver over the 0-800 s/mm 2 range. In IVIM analysis of normal liver, a third very fast (pseudo)diffusion component might be relevant. (orig.)

  9. Whole-body intravoxel incoherent motion imaging

    Energy Technology Data Exchange (ETDEWEB)

    Filli, Lukas; Wurnig, Moritz C.; Eberhardt, Christian; Guggenberger, Roman; Boss, Andreas [University Hospital Zurich, Department of Radiology, Zurich (Switzerland); Luechinger, Roger [University and ETH Zurich, Institute of Biomedical Technology, Zurich (Switzerland)

    2015-07-15

    To investigate the technical feasibility of whole-body intravoxel incoherent motion (IVIM) imaging. Whole-body MR images of eight healthy volunteers were acquired at 3T using a spin-echo echo-planar imaging sequence with eight b-values. Coronal parametrical whole-body maps of diffusion (D), pseudodiffusion (D*), and the perfusion fraction (F{sub p}) were calculated. Image quality was rated qualitatively by two independent radiologists, and inter-reader reliability was tested with intra-class correlation coefficients (ICCs). Region of interest (ROI) analysis was performed in the brain, liver, kidney, and erector spinae muscle. Depiction of anatomic structures was rated as good on D maps and good to fair on D* and F{sub p} maps. Exemplary mean D (10{sup -3} mm{sup 2}/s), D* (10{sup -3} mm{sup 2}/s) and F{sub p} (%) values (± standard deviation) of the renal cortex were as follows: 1.7 ± 0.2; 15.6 ± 6.5; 20.9 ± 4.4. Inter-observer agreement was ''substantial'' to ''almost perfect'' (ICC = 0.80 - 0.92). The coefficient of variation of D* was significantly lower with the proposed algorithm compared to the conventional algorithm (p < 0.001), indicating higher stability. The proposed IVIM protocol allows computation of parametrical maps with good to fair image quality. Potential future clinical applications may include characterization of widespread disease such as metastatic tumours or inflammatory myopathies. (orig.)

  10. Full counting statistics of multiple Andreev reflections in incoherent diffusive superconducting junctions

    International Nuclear Information System (INIS)

    Samuelsson, P.

    2007-01-01

    We present a theory for the full distribution of current fluctuations in incoherent diffusive superconducting junctions, subjected to a voltage bias. This theory of full counting statistics of incoherent multiple Andreev reflections is valid for an arbitrary applied voltage. We present a detailed discussion of the properties of the first four cumulants as well as the low and high voltage regimes of the full counting statistics. (orig.)

  11. Intravoxel incoherent motion diffusion imaging of the liver: Optimal b-value subsampling and impact on parameter precision and reproducibility

    International Nuclear Information System (INIS)

    Dyvorne, Hadrien; Jajamovich, Guido; Kakite, Suguru; Kuehn, Bernd; Taouli, Bachir

    2014-01-01

    Highlights: • We assess the precision and reproducibility of liver IVIM diffusion parameters. • Liver IVIM DWI can be performed with 4 b-values with good parameter precision. • Liver IVIM DWI can be performed with 4 b-values with good parameter reproducibility. - Abstract: Purpose: To increase diffusion sampling efficiency in intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) of the liver by reducing the number of diffusion weightings (b-values). Materials and methods: In this IRB approved HIPAA compliant prospective study, 53 subjects (M/F 38/15, mean age 52 ± 13 y) underwent IVIM DWI at 1.5 T using 16 b-values (0–800 s/mm 2 ), with 14 subjects having repeat exams to assess IVIM parameter reproducibility. A biexponential diffusion model was used to quantify IVIM hepatic parameters (PF: perfusion fraction, D: true diffusion and D*: pseudo diffusion). All possible subsets of the 16 b-values were probed, with number of b values ranging from 4 to 15, and corresponding parameters were quantified for each subset. For each b-value subset, global parameter estimation error was computed against the parameters obtained with all 16 b-values and the subsets providing the lowest error were selected. Interscan estimation error was also evaluated between repeat exams to assess reproducibility of the IVIM technique in the liver. The optimal b-values distribution was selected such that the number of b-values was minimal while keeping parameter estimation error below interscan reproducibility error. Results: As the number of b-values decreased, the estimation error increased for all parameters, reflecting decreased precision of IVIM metrics. Using an optimal set of 4 b-values (0, 15, 150 and 800 s/mm 2 ), the errors were 6.5, 22.8 and 66.1% for D, PF and D* respectively. These values lie within the range of test–retest reproducibility for the corresponding parameters, with errors of 12.0, 32.3 and 193.8% for D, PF and D* respectively. Conclusion: A set

  12. The histogram analysis of diffusion-weighted intravoxel incoherent motion (IVIM) imaging for differentiating the gleason grade of prostate cancer.

    Science.gov (United States)

    Zhang, Yu-Dong; Wang, Qing; Wu, Chen-Jiang; Wang, Xiao-Ning; Zhang, Jing; Liu, Hui; Liu, Xi-Sheng; Shi, Hai-Bin

    2015-04-01

    To evaluate histogram analysis of intravoxel incoherent motion (IVIM) for discriminating the Gleason grade of prostate cancer (PCa). A total of 48 patients pathologically confirmed as having clinically significant PCa (size > 0.5 cm) underwent preoperative DW-MRI (b of 0-900 s/mm(2)). Data was post-processed by monoexponential and IVIM model for quantitation of apparent diffusion coefficients (ADCs), perfusion fraction f, diffusivity D and pseudo-diffusivity D*. Histogram analysis was performed by outlining entire-tumour regions of interest (ROIs) from histological-radiological correlation. The ability of imaging indices to differentiate low-grade (LG, Gleason score (GS) ≤6) from intermediate/high-grade (HG, GS > 6) PCa was analysed by ROC regression. Eleven patients had LG tumours (18 foci) and 37 patients had HG tumours (42 foci) on pathology examination. HG tumours had significantly lower ADCs and D in terms of mean, median, 10th and 75th percentiles, combined with higher histogram kurtosis and skewness for ADCs, D and f, than LG PCa (p Histogram D showed relatively higher correlations (ñ = 0.641-0.668 vs. ADCs: 0.544-0.574) with ordinal GS of PCa; and its mean, median and 10th percentile performed better than ADCs did in distinguishing LG from HG PCa. It is feasible to stratify the pathological grade of PCa by IVIM with histogram metrics. D performed better in distinguishing LG from HG tumour than conventional ADCs. • GS had relatively higher correlation with tumour D than ADCs. • Difference of histogram D among two-grade tumours was statistically significant. • D yielded better individual features in demonstrating tumour grade than ADC. • D* and f failed to determine tumour grade of PCa.

  13. Role of spin diffusion in current-induced domain wall motion for disordered ferromagnets

    KAUST Repository

    Akosa, Collins Ashu; Kim, Won-Seok; Bisig, André ; Klä ui, Mathias; Lee, Kyung-Jin; Manchon, Aurelien

    2015-01-01

    Current-induced spin transfer torque and magnetization dynamics in the presence of spin diffusion in disordered magnetic textures is studied theoretically. We demonstrate using tight-binding calculations that weak, spin-conserving impurity scattering dramatically enhances the nonadiabaticity. To further explore this mechanism, a phenomenological drift-diffusion model for incoherent spin transport is investigated. We show that incoherent spin diffusion indeed produces an additional spatially dependent torque of the form ∼∇2[m×(u⋅∇)m]+ξ∇2[(u⋅∇)m], where m is the local magnetization direction, u is the direction of injected current, and ξ is a parameter characterizing the spin dynamics (precession, dephasing, and spin-flip). This torque, which scales as the inverse square of the domain wall width, only weakly enhances the longitudinal velocity of a transverse domain wall but significantly enhances the transverse velocity of vortex walls. The spatial-dependent spin transfer torque uncovered in this study is expected to have significant impact on the current-driven motion of abrupt two-dimensional textures such as vortices, skyrmions, and merons.

  14. Role of spin diffusion in current-induced domain wall motion for disordered ferromagnets

    KAUST Repository

    Akosa, Collins Ashu

    2015-03-12

    Current-induced spin transfer torque and magnetization dynamics in the presence of spin diffusion in disordered magnetic textures is studied theoretically. We demonstrate using tight-binding calculations that weak, spin-conserving impurity scattering dramatically enhances the nonadiabaticity. To further explore this mechanism, a phenomenological drift-diffusion model for incoherent spin transport is investigated. We show that incoherent spin diffusion indeed produces an additional spatially dependent torque of the form ∼∇2[m×(u⋅∇)m]+ξ∇2[(u⋅∇)m], where m is the local magnetization direction, u is the direction of injected current, and ξ is a parameter characterizing the spin dynamics (precession, dephasing, and spin-flip). This torque, which scales as the inverse square of the domain wall width, only weakly enhances the longitudinal velocity of a transverse domain wall but significantly enhances the transverse velocity of vortex walls. The spatial-dependent spin transfer torque uncovered in this study is expected to have significant impact on the current-driven motion of abrupt two-dimensional textures such as vortices, skyrmions, and merons.

  15. Use of intravoxel incoherent motion diffusion-weighted imaging to detect early changes in diabetic kidneys.

    Science.gov (United States)

    Deng, Yi; Yang, Biran; Peng, Yan; Liu, Zhiqiang; Luo, Jinwen; Du, Guoxin

    2018-03-14

    The purpose of the study was to examine differences in kidney intravoxel incoherent motion diffusion-weighted imaging (IVIM-DWI) parameters in early-stage diabetic patients versus healthy controls. Nineteen type 2 diabetic patients (group A) with a urinary albumin-to-creatinine ratio (ACR) diabetic kidney changes was determined by receiver operating characteristic analysis. Three radiologists independently measured the parameters derived from IVIM-DWI in the two groups by free-hand placing regions of interest, and the interclass coefficients (ICCs) were analyzed by SPSS.16.0 software. The f values of the kidneys were significantly higher in diabetic patients than in healthy volunteers. The D value of the kidneys was significantly lower in diabetic patients than in healthy volunteers. No significant differences in the D* values of the kidneys were observed between diabetic patients and healthy volunteers. The D values of the right kidneys were significantly higher than those of the left kidneys in both groups. The results of the receiver operating characteristic analysis were as follows: left kidney-f value AUC = 0.650 (cutoff point ≥ 27.49%) and D value AUC = 0.752 (cutoff point ≤ 1.68 × 10 -3  mm 2 /s); and right kidney-f value AUC = 0.650 (cutoff point ≥ 28.24%) and D value AUC = 0.752 (cutoff point ≤ 1.81 × 10 -3 mm 2 /s). The diagnostic performance of the D* value was very low (AUC  0.05). The ICCs of the f value and D value were between 0.637 and 0.827. The ICC of the D* value was less than 0.3. The results of our study suggest that changes in kidneys detected by IVIM-DWI may serve as indicators of early diabetic kidney disease.

  16. Simulation of spatially varying ground motions including incoherence, wave‐passage and differential site‐response effects

    DEFF Research Database (Denmark)

    Konakli, Katerina; Der Kiureghian, Armen

    2012-01-01

    A method is presented for simulating arrays of spatially varying ground motions, incorporating the effects of incoherence, wave passage, and differential site response. Non‐stationarity is accounted for by considering the motions as consisting of stationary segments. Two approaches are developed....

  17. Intravoxel incoherent motion (IVIM) DWI of the liver. Pre-and postprandial comparison

    International Nuclear Information System (INIS)

    Hirose, Junji; Satou, Yuuichi; Amemiya, Ryoji; Yoda, Yoshioki; Motosugi, Utaroh

    2013-01-01

    We evaluated if meal intake changes the diffusivity result calculated using the intravoxel incoherent motion (IVIM) model and the portal flow velocity measured by phase contrast magnetic resonance (MR) imaging. We asked 3 healthy volunteers to eat 794-kcal meals and acquired MR images before and 20 minutes after the meal using a 1.5-tesla clinical MR scanner. We acquired 2-dimensional (2D) phase contrast (PC) gradient echo MR images to measure portal flow and diffusion-weighted images to calculate diffusivity results using the IVIM model and b-values of 0, 10, 20, 30, 40, 50, 70, 100, 200, 400, and 800 s/mm 2 . Portal flow was greater after the meal than (before): Volunteer A, 16.1 cm/s (9.7 cm/s); B, 18.0 cm/s (12.8 cm/s); and C, 18.3 cm/s (11.7 cm/s). The diffusivity results of D * and f were also increased after the meal in all 3 volunteers. D * and f values before and (after) the meal were: Volunteer A, 97.1 and 0.14 (149.6 and 0.20); Volunteer B, 79.4 and 0.20 (183.4 and 0.21); and Volunteer C, 29.4 and 0.19 (132.7 and 0.20). The trend in apparent diffusion coefficient (ADC) and D values were inconsistent among the 3 volunteers. The higher D * and f values in the liver after eating calculated using the IVIM model indicated increased portal flow due to the meal. (author)

  18. Structure and motion of junctions between coherent and incoherent twin boundaries in copper

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J.A. [Mechanical and Aerospace Engineering, University of California, Los Angeles, CA 90095 (United States); Ghoniem, N.M., E-mail: ghoniem@ucla.edu [Mechanical and Aerospace Engineering, University of California, Los Angeles, CA 90095 (United States)

    2009-09-15

    The atomic mechanisms of twin boundary migration in copper under externally applied mechanical loads and during thermal annealing are investigated utilizing molecular dynamics computer simulations. The migration dynamics of the incoherent {Sigma}=3[110](112) twin boundary (ITB), pinned between two {Sigma}=3[110](111) twin boundaries, is determined. A three-dimensional structural model is described for the junction between intersecting coherent and incoherent twin boundaries, and migration velocities are calculated under thermal annealing conditions. It is shown that the coherent twin boundary (CTB)/ITB junction results in breaking the crystal symmetry by creation of either an edge dislocation or a mixed (edge/screw) at the intersection. These two types of defects can lead to pronounced differences in the observed migration (and hence annealing) rates of ICT/CTB junctions. The annealing rate resulting from the migration of ITBs with a mixed dislocation is found to be more than twice that of the edge dislocation. The mechanism of ITB motion is shown to be governed by successive kink-like motion of neighboring atomic columns, each of which is shifted by 1/4[1 1 0], followed by structural relaxation to accommodate boundary motion.

  19. Structure and motion of junctions between coherent and incoherent twin boundaries in copper

    International Nuclear Information System (INIS)

    Brown, J.A.; Ghoniem, N.M.

    2009-01-01

    The atomic mechanisms of twin boundary migration in copper under externally applied mechanical loads and during thermal annealing are investigated utilizing molecular dynamics computer simulations. The migration dynamics of the incoherent Σ=3[110](112) twin boundary (ITB), pinned between two Σ=3[110](111) twin boundaries, is determined. A three-dimensional structural model is described for the junction between intersecting coherent and incoherent twin boundaries, and migration velocities are calculated under thermal annealing conditions. It is shown that the coherent twin boundary (CTB)/ITB junction results in breaking the crystal symmetry by creation of either an edge dislocation or a mixed (edge/screw) at the intersection. These two types of defects can lead to pronounced differences in the observed migration (and hence annealing) rates of ICT/CTB junctions. The annealing rate resulting from the migration of ITBs with a mixed dislocation is found to be more than twice that of the edge dislocation. The mechanism of ITB motion is shown to be governed by successive kink-like motion of neighboring atomic columns, each of which is shifted by 1/4[1 1 0], followed by structural relaxation to accommodate boundary motion.

  20. Feasibility of Intravoxel Incoherent Motion for Differentiating Benign and Malignant Thyroid Nodules.

    Science.gov (United States)

    Tan, Hui; Chen, Jun; Zhao, Yi Ling; Liu, Jin Huan; Zhang, Liang; Liu, Chang Sheng; Huang, Dongjie

    2018-06-13

    This study aimed to preliminarily investigate the feasibility of intravoxel incoherent motion (IVIM) theory in the differential diagnosis of benign and malignant thyroid nodules. Forty-five patients with 56 confirmed thyroid nodules underwent preoperative routine magnetic resonance imaging and IVIM diffusion-weighted imaging. The histopathologic diagnosis was confirmed by surgery. Apparent diffusion coefficient (ADC), perfusion fraction f, diffusivity D, and pseudo-diffusivity D* were quantified. Independent samples t test of IVIM-derived metrics were conducted between benign and malignant nodules. Receiver-operating characteristic analyses were performed to determine the optimal thresholds as well as the sensitivity and specificity for differentiating. Significant intergroup difference was observed in ADC, D, D*, and f (p < 0.001). Malignant tumors featured significantly lower ADC, D and D* values and a higher f value than that of benign nodules. The ADC, D, and D* could distinguish the benign from malignant thyroid nodules, and parameter f differentiate the malignant tumors from benign nodules. The values of the area under the curve for parameter ADC, D, and D* were 0.784 (p = 0.001), 0.795 (p = 0.001), and 0.850 (p < 0.001), separately, of which the area under the curve of f value was the maximum for identifying the malignant from benign nodules, which was 0.841 (p < 0.001). This study suggested that ADC and IVIM-derived metrics, including D, D*, and f, could potentially serve as noninvasive predictors for the preoperative differentiating of thyroid nodules, and f value performed best in identifying the malignant from benign nodules among these parameters. Copyright © 2018 Academic Radiology. Published by Elsevier Inc. All rights reserved.

  1. Subtype differentiation of renal tumors using voxel-based histogram analysis of intravoxel incoherent motion parameters.

    Science.gov (United States)

    Gaing, Byron; Sigmund, Eric E; Huang, William C; Babb, James S; Parikh, Nainesh S; Stoffel, David; Chandarana, Hersh

    2015-03-01

    The aim of this study was to determine if voxel-based histogram analysis of intravoxel incoherent motion imaging (IVIM) parameters can differentiate various subtypes of renal tumors, including benign and malignant lesions. A total of 44 patients with renal tumors who underwent surgery and had histopathology available were included in this Health Insurance Portability and Accountability Act-compliant, institutional review board-approved, single-institution prospective study. In addition to routine renal magnetic resonance imaging examination performed on a 1.5-T system, all patients were imaged with axial diffusion-weighted imaging using 8 b values (range, 0-800 s/mm). A biexponential model was fitted to the diffusion signal data using a segmented algorithm to extract the IVIM parameters perfusion fraction (fp), tissue diffusivity (Dt), and pseudodiffusivity (Dp) for each voxel. Mean and histogram measures of heterogeneity (standard deviation, skewness, and kurtosis) of IVIM parameters were correlated with pathology results of tumor subtype using unequal variance t tests to compare subtypes in terms of each measure. Correction for multiple comparisons was accomplished using the Tukey honestly significant difference procedure. A total of 44 renal tumors including 23 clear cell (ccRCC), 4 papillary (pRCC), 5 chromophobe, and 5 cystic renal cell carcinomas, as well as benign lesions, 4 oncocytomas (Onc) and 3 angiomyolipomas (AMLs), were included in our analysis. Mean IVIM parameters fp and Dt differentiated 8 of 15 pairs of renal tumors. Histogram analysis of IVIM parameters differentiated 9 of 15 subtype pairs. One subtype pair (ccRCC vs pRCC) was differentiated by mean analysis but not by histogram analysis. However, 2 other subtype pairs (AML vs Onc and ccRCC vs Onc) were differentiated by histogram distribution parameters exclusively. The standard deviation of Dt [σ(Dt)] differentiated ccRCC (0.362 ± 0.136 × 10 mm/s) from AML (0.199 ± 0.043 × 10 mm/s) (P = 0

  2. Intravoxel incoherent motion magnetic resonance imaging to predict vesicoureteral reflux in children with urinary tract infection

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jeong Woo; Lee, Chang Hee; Park, Yang Shin; Kim, Kyeong Ah; Park, Cheol Min [Korea University College of Medicine, Departments of Radiology, Korea University Guro Hospital, 80 Guro-dong, Guro-gu, Seoul (Korea, Republic of); Yoo, Kee Hwan [Korea University College of Medicine, Departments of Pediatrics, Korea University Guro Hospital, Seoul (Korea, Republic of); Je, Bo-Kyung [Korea University College of Medicine, Department of Radiology, Korea University Ansan Hospital, Seoul (Korea, Republic of); Kiefer, Berthold [Oncology Application Development, Siemens Healthcare, Erlangen (Germany)

    2016-06-15

    To compare the diffusion parameters of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) between the ''reflux'' and the ''non-reflux'' kidneys, and to evaluate the feasibility of using IVIM DWI to predict vesicoureteral reflux (VUR) in children with a urinary tract infection (UTI). Eighty-three kidneys from 57 pediatric patients with a UTI were classified into ''reflux'' and ''non-reflux'' groups according to voiding cystourethrography (VCUG) results. The apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (PF) were measured and compared in the renal pelvis of both groups. Four indices (D*/ADC, PF/ADC, D*/D, and PF/D) were calculated and receiver operating characteristic (ROC) curve analyses were performed. VURs were detected on VCUG in 21 kidneys. PF and D* were significantly higher in the ''reflux'' group than in the ''non-reflux'' group. The indices were all significantly higher. The PF/D index showed the best diagnostic performance in predicting VUR in children with UTI (A{sub z} = 0.864). PF and D* were significantly higher in the ''reflux'' kidney than in the ''non-reflux'' kidney. Our new index (PF/D) could prove useful for predicting VUR. (orig.)

  3. Intravoxel incoherent motion magnetic resonance imaging to predict vesicoureteral reflux in children with urinary tract infection

    International Nuclear Information System (INIS)

    Kim, Jeong Woo; Lee, Chang Hee; Park, Yang Shin; Kim, Kyeong Ah; Park, Cheol Min; Yoo, Kee Hwan; Je, Bo-Kyung; Kiefer, Berthold

    2016-01-01

    To compare the diffusion parameters of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) between the ''reflux'' and the ''non-reflux'' kidneys, and to evaluate the feasibility of using IVIM DWI to predict vesicoureteral reflux (VUR) in children with a urinary tract infection (UTI). Eighty-three kidneys from 57 pediatric patients with a UTI were classified into ''reflux'' and ''non-reflux'' groups according to voiding cystourethrography (VCUG) results. The apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (PF) were measured and compared in the renal pelvis of both groups. Four indices (D*/ADC, PF/ADC, D*/D, and PF/D) were calculated and receiver operating characteristic (ROC) curve analyses were performed. VURs were detected on VCUG in 21 kidneys. PF and D* were significantly higher in the ''reflux'' group than in the ''non-reflux'' group. The indices were all significantly higher. The PF/D index showed the best diagnostic performance in predicting VUR in children with UTI (A z = 0.864). PF and D* were significantly higher in the ''reflux'' kidney than in the ''non-reflux'' kidney. Our new index (PF/D) could prove useful for predicting VUR. (orig.)

  4. TU-F-CAMPUS-I-01: Head and Neck Squamous Cell Carcinoma: Short-Term Repeatability of Apparent Diffusion Coefficient and Intravoxel Incoherent Motion Parameters at 3.0T

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Y; Fuller, C; Mohamed, A; Wang, J; Hazle, J [UT MD Anderson Cancer Center, Houston, TX (United States)

    2015-06-15

    Purpose: Many published studies have recently demonstrated the potential value of intravoxel incoherent motion (IVIM) analysis for disease evaluation. However, few have questioned its measurement repeatability/reproducibility when applied. The purpose of this study was to determine the short-term measurement repeatability of apparent diffusion coefficient ADC, true diffusion coefficient D, pseudodiffusion coefficient D* and perfusion fraction f, in head and neck squamous cell carcinoma (HNSCC) primary tumors and metastatic nodes. Methods: Ten patients with known HNSCC were examined twice using echo-planar DW-MRI with 12 b values (0 to 800 s/mm2) 1hour to 24 hours apart before radiation treatment. All patients were scanned with the customized radiation treatment immobilization devices to reduce motion artifacts and to improve image registration in repeat scans. Regions of interests were drawn in primary tumor and metastases node in each patient (Fig. 1). ADC and IVIM parameters D, D* and f were calculated by least squares data fitting. Short-term test–retest repeatability of ADC and IVIM parameters were assessed by measuring Bland–Altman limits of agreements (BA-LA). Results: Sixteen HNSCC lesions were assessed in 10 patients. Repeatability of perfusion-sensitive parameters, D* and f, in HNSCC lesions was poor (BA-LA: -144% to 88% and −57% to 96% for D* and f, respectively); a lesser extent was observed for the diffusion-sensitive parameters of ADC and D (BA-LA: −34% to 39% and −37% to 40%, for ADC and D, respectively) (Fig. 2). Conclusion: Poor repeatability of D*/f and good repeatability for ADC/D were observed in HNSCC primary tumors and metastatic nodes. Efforts should be made to improve the measurement repeatability of perfusion-sensitive IVIM parameters.

  5. Probabilistic and deterministic soil structure interaction analysis including ground motion incoherency effects

    International Nuclear Information System (INIS)

    Elkhoraibi, T.; Hashemi, A.; Ostadan, F.

    2014-01-01

    Soil-structure interaction (SSI) is a major step for seismic design of massive and stiff structures typical of the nuclear facilities and civil infrastructures such as tunnels, underground stations, dams and lock head structures. Currently most SSI analyses are performed deterministically, incorporating limited range of variation in soil and structural properties and without consideration of the ground motion incoherency effects. This often leads to overestimation of the seismic response particularly the In-Structure-Response Spectra (ISRS) with significant impositions of design and equipment qualification costs, especially in the case of high-frequency sensitive equipment at stiff soil or rock sites. The reluctance to incorporate a more comprehensive probabilistic approach is mainly due to the fact that the computational cost of performing probabilistic SSI analysis even without incoherency function considerations has been prohibitive. As such, bounding deterministic approaches have been preferred by the industry and accepted by the regulatory agencies. However, given the recently available and growing computing capabilities, the need for a probabilistic-based approach to the SSI analysis is becoming clear with the advances in performance-based engineering and the utilization of fragility analysis in the decision making process whether by the owners or the regulatory agencies. This paper demonstrates the use of both probabilistic and deterministic SSI analysis techniques to identify important engineering demand parameters in the structure. A typical nuclear industry structure is used as an example for this study. The system is analyzed for two different site conditions: rock and deep soil. Both deterministic and probabilistic SSI analysis approaches are performed, using the program SASSI, with and without ground motion incoherency considerations. In both approaches, the analysis begins at the hard rock level using the low frequency and high frequency hard rock

  6. Probabilistic and deterministic soil structure interaction analysis including ground motion incoherency effects

    Energy Technology Data Exchange (ETDEWEB)

    Elkhoraibi, T., E-mail: telkhora@bechtel.com; Hashemi, A.; Ostadan, F.

    2014-04-01

    Soil-structure interaction (SSI) is a major step for seismic design of massive and stiff structures typical of the nuclear facilities and civil infrastructures such as tunnels, underground stations, dams and lock head structures. Currently most SSI analyses are performed deterministically, incorporating limited range of variation in soil and structural properties and without consideration of the ground motion incoherency effects. This often leads to overestimation of the seismic response particularly the In-Structure-Response Spectra (ISRS) with significant impositions of design and equipment qualification costs, especially in the case of high-frequency sensitive equipment at stiff soil or rock sites. The reluctance to incorporate a more comprehensive probabilistic approach is mainly due to the fact that the computational cost of performing probabilistic SSI analysis even without incoherency function considerations has been prohibitive. As such, bounding deterministic approaches have been preferred by the industry and accepted by the regulatory agencies. However, given the recently available and growing computing capabilities, the need for a probabilistic-based approach to the SSI analysis is becoming clear with the advances in performance-based engineering and the utilization of fragility analysis in the decision making process whether by the owners or the regulatory agencies. This paper demonstrates the use of both probabilistic and deterministic SSI analysis techniques to identify important engineering demand parameters in the structure. A typical nuclear industry structure is used as an example for this study. The system is analyzed for two different site conditions: rock and deep soil. Both deterministic and probabilistic SSI analysis approaches are performed, using the program SASSI, with and without ground motion incoherency considerations. In both approaches, the analysis begins at the hard rock level using the low frequency and high frequency hard rock

  7. Assessing hepatic fibrosis: comparing the intravoxel incoherent motion in MRI with acoustic radiation force impulse imaging in US

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Chih-Horng; Liang, Po-Chin; Shih, Tiffany Ting-Fang [National Taiwan University Hospital, Department of Medical Imaging, Taipei (China); National Taiwan University College of Medicine, Department of Radiology, Taipei (China); Ho, Ming-Chih; Hu, Rey-Heng; Lai, Hong-Shiee [National Taiwan University Hospital and College of Medicine, Department of Surgery, Taipei (China); Jeng, Yung-Ming [National Taiwan University Hospital and College of Medicine, Department of Pathology, Taipei (China)

    2015-12-15

    This study compared the diagnostic performance of intravoxel incoherent motion (IVIM) in magnetic resonance imaging (MRI) and acoustic radiation force impulse imaging (ARFI) in ultrasound (US) for liver fibrosis (LF) evaluation. A total of 49 patients scheduled for liver surgery were recruited. LF in the non-tumorous liver parenchyma at the right lobe was estimated using a slow diffusion coefficient, fast diffusion coefficient (D{sub fast}), perfusion fraction (f) of the IVIM parameters, the total apparent diffusion coefficient of conventional diffusion-weighted imaging and the shear wave velocity (Vs) of ARFI. LF was graded using the Metavir scoring system on histological examination. The Spearman rank correlation coefficient for correlation and analysis of variance was used for determining difference. The diagnostic performance was compared using receiver operating characteristic curve analysis. LF exhibited significant correlation with the three parameters D{sub fast}, f, and Vs (r = -0.528, -0.337, and 0.481, respectively, P < 0.05). The D{sub fast} values in the F4 group were significantly lower than those in the F0, F1 and F2 groups. D{sub fast} exhibited a non-inferior performance for diagnosing all fibrosis grades compared with that of Vs. Both IVIM and ARFI provide reliable estimations for the noninvasive assessment of LF. (orig.)

  8. Histological Grading of Hepatocellular Carcinomas with Intravoxel Incoherent Motion Diffusion-weighted Imaging: Inconsistent Results Depending on the Fitting Method.

    Science.gov (United States)

    Ichikawa, Shintaro; Motosugi, Utaroh; Hernando, Diego; Morisaka, Hiroyuki; Enomoto, Nobuyuki; Matsuda, Masanori; Onishi, Hiroshi

    2018-04-10

    To compare the abilities of three intravoxel incoherent motion (IVIM) imaging approximation methods to discriminate the histological grade of hepatocellular carcinomas (HCCs). Fifty-eight patients (60 HCCs) underwent IVIM imaging with 11 b-values (0-1000 s/mm 2 ). Slow (D) and fast diffusion coefficients (D * ) and the perfusion fraction (f) were calculated for the HCCs using the mean signal intensities in regions of interest drawn by two radiologists. Three approximation methods were used. First, all three parameters were obtained simultaneously using non-linear fitting (method A). Second, D was obtained using linear fitting (b = 500 and 1000), followed by non-linear fitting for D * and f (method B). Third, D was obtained by linear fitting, f was obtained using the regression line intersection and signals at b = 0, and non-linear fitting was used for D * (method C). A receiver operating characteristic analysis was performed to reveal the abilities of these methods to distinguish poorly-differentiated from well-to-moderately-differentiated HCCs. Inter-reader agreements were assessed using intraclass correlation coefficients (ICCs). The measurements of D, D * , and f in methods B and C (Az-value, 0.658-0.881) had better discrimination abilities than did those in method A (Az-value, 0.527-0.607). The ICCs of D and f were good to excellent (0.639-0.835) with all methods. The ICCs of D * were moderate with methods B (0.580) and C (0.463) and good with method A (0.705). The IVIM parameters may vary depending on the fitting methods, and therefore, further technical refinement may be needed.

  9. Intravoxel Incoherent Motion Metrics as Potential Biomarkers for Survival in Glioblastoma.

    Directory of Open Access Journals (Sweden)

    Josep Puig

    Full Text Available Intravoxel incoherent motion (IVIM is an MRI technique with potential applications in measuring brain tumor perfusion, but its clinical impact remains to be determined. We assessed the usefulness of IVIM-metrics in predicting survival in newly diagnosed glioblastoma.Fifteen patients with glioblastoma underwent MRI including spin-echo echo-planar DWI using 13 b-values ranging from 0 to 1000 s/mm2. Parametric maps for diffusion coefficient (D, pseudodiffusion coefficient (D*, and perfusion fraction (f were generated for contrast-enhancing regions (CER and non-enhancing regions (NCER. Regions of interest were manually drawn in regions of maximum f and on the corresponding dynamic susceptibility contrast images. Prognostic factors were evaluated by Kaplan-Meier survival and Cox proportional hazards analyses.We found that fCER and D*CER correlated with rCBFCER. The best cutoffs for 6-month survival were fCER>9.86% and D*CER>21.712 x10-3mm2/s (100% sensitivity, 71.4% specificity, 100% and 80% positive predictive values, and 80% and 100% negative predictive values; AUC:0.893 and 0.857, respectively. Treatment yielded the highest hazard ratio (5.484; 95% CI: 1.162-25.88; AUC: 0.723; P = 0.031; fCER combined with treatment predicted survival with 100% accuracy.The IVIM-metrics fCER and D*CER are promising biomarkers of 6-month survival in newly diagnosed glioblastoma.

  10. Assessment of cervical cancer with a parameter-free intravoxel incoherent motion imaging algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Becker, Anton S.; Wurnig, Moritz C.; Boss, Andreas; Ghafoor, Soleen [Institute of Diagnostic and Interventional Radiology, University Hospital of Zurich, Zurich (Switzerland); Perucho, Jose A.; Khong, Pek Lan; Lee, Elaine Y. P. [Dept. of Diagnostic Radiology, The University of Hong Kong, Hong Kong (China)

    2017-06-15

    To evaluate the feasibility of a parameter-free intravoxel incoherent motion (IVIM) approach in cervical cancer, to assess the optimal b-value threshold, and to preliminarily examine differences in the derived perfusion and diffusion parameters for different histological cancer types. After Institutional Review Board approval, 19 female patients (mean age, 54 years; age range, 37–78 years) gave consent and were enrolled in this prospective magnetic resonance imaging study. Clinical staging and biopsy results were obtained. Echo-planar diffusion weighted sequences at 13 b-values were acquired at 3 tesla field strength. Single-sliced region-of-interest IVIM analysis with adaptive b-value thresholds was applied to each tumor, yielding the optimal fit and the optimal parameters for pseudodiffusion (D*), perfusion fraction (Fp) and diffusion coefficient (D). Monoexponential apparent diffusion coefficient (ADC) was calculated for comparison with D. Biopsy revealed squamous cell carcinoma in 10 patients and adenocarcinoma in 9. The b-value threshold (median [interquartile range]) depended on the histological type and was 35 (22.5–50) s/mm{sup 2} in squamous cell carcinoma and 150 (100–150) s/mm{sup 2} in adenocarcinoma (p < 0.05). Comparing squamous cell vs. adenocarcinoma, D* (45.1 [25.1–60.4] × 10{sup −3} mm{sup 2}/s vs. 12.4 [10.5–21.2] × 10{sup −3} mm{sup 2}/s) and Fp (7.5% [7.0–9.0%] vs. 9.9% [9.0–11.4%]) differed significantly between the subtypes (p < 0.02), whereas D did not (0.89 [0.75–0.94] × 10{sup −3} mm{sup 2}/s vs. 0.90 [0.82–0.97] × 10{sup −3} mm{sup 2}/s, p = 0.27). The residuals did not differ (0.74 [0.60–0.92] vs. 0.94 [0.67–1.01], p = 0.32). The ADC systematically underestimated the magnitude of diffusion restriction compared to D (p < 0.001). The parameter-free IVIM approach is feasible in cervical cancer. The b-value threshold and perfusion-related parameters depend on the tumor histology type.

  11. Intravoxel incoehrent motion MR imaging in the head and neck: Correlation with dynamic contrast-enhanced MR imaging and diffusion-weighted imaging

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xiao Quan; Choi, Young Jun; Sung, Yu Sub; Jang, Seung Won; Park, Ji Eun; Heo, Young Jin; Beak, Jung Hwan; Lee, Jeong Hyun [Dept. of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of); Yoon, Ra Gyoung [Dept. of Radiology, Catholic Kwandong University International St. Mary' s Hospital, Catholic Kwandong University College of Medicine, Incheon (Korea, Republic of)

    2016-09-15

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D{sup *}), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D{sup *} and model-free parameters from the DCE-MRI (wash-in, T{sub max}, E{sub max}, initial AUC{sub 60}, whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D{sup *} and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p < 0.001, r = 0.980) and muscles (p = 0.013, r = 0.542), despite its significantly higher value than D. The difference between ADC and D showed significant correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D{sup *} (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck.

  12. Intravoxel incoehrent motion MR imaging in the head and neck: Correlation with dynamic contrast-enhanced MR imaging and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Xu, Xiao Quan; Choi, Young Jun; Sung, Yu Sub; Jang, Seung Won; Park, Ji Eun; Heo, Young Jin; Beak, Jung Hwan; Lee, Jeong Hyun; Yoon, Ra Gyoung

    2016-01-01

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D * ), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D * and model-free parameters from the DCE-MRI (wash-in, T max , E max , initial AUC 60 , whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D * and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p < 0.001, r = 0.980) and muscles (p = 0.013, r = 0.542), despite its significantly higher value than D. The difference between ADC and D showed significant correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D * (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck

  13. Quasielastic neutron scattering study of large amplitude motions in molecular systems

    International Nuclear Information System (INIS)

    Bee, M.

    1996-01-01

    This lecture aims at giving some illustrations of the use of Incoherent Quasielastic Neutron Scattering in the investigation of motions of atoms or molecules in phases with dynamical disorder. The general incoherent scattering function is first recalled. Then the Elastic Incoherent Structure Factor is introduced. It is shown how its determination permits to deduce a particular dynamical model. Long-range translational diffusion is illustrated by some experiments carried out with liquids or with different chemical species intercalated in porous media. Examples of rotational motions are provided by solid phases where an orientational disorder of the molecules exists. The jump model is the most commonly used and yields simple scattering laws which can be easily handled. Highly disordered crystals require a description in terms of the isotropic rotational diffusion model. Many of the present studies are concerned with rather complicated systems. Considerable help is obtained either by using selectively deuterated samples or by carrying out measurements with semi-oriented samples. (author) 5 figs., 14 refs

  14. Angular distribution of diffuse reflectance from incoherent multiple scattering in turbid media.

    Science.gov (United States)

    Gao, M; Huang, X; Yang, P; Kattawar, G W

    2013-08-20

    The angular distribution of diffuse reflection is elucidated with greater understanding by studying a homogeneous turbid medium. We modeled the medium as an infinite slab and studied the reflection dependence on the following three parameters: the incident direction, optical depth, and asymmetry factor. The diffuse reflection is produced by incoherent multiple scattering and is solved through radiative transfer theory. At large optical depths, the angular distribution of the diffuse reflection with small incident angles is similar to that of a Lambertian surface, but, with incident angles larger than 60°, the angular distributions have a prominent reflection peak around the specular reflection angle. These reflection peaks are found originating from the scattering within one transport mean free path in the top layer of the medium. The maximum reflection angles for different incident angles are analyzed and can characterize the structure of angular distributions for different asymmetry factors and optical depths. The properties of the angular distribution can be applied to more complex systems for a better understanding of diffuse reflection.

  15. Temporally resolved electrocardiogram-triggered diffusion-weighted imaging of the human kidney: correlation between intravoxel incoherent motion parameters and renal blood flow at different time points of the cardiac cycle.

    Science.gov (United States)

    Wittsack, Hans-Jörg; Lanzman, Rotem S; Quentin, Michael; Kuhlemann, Julia; Klasen, Janina; Pentang, Gael; Riegger, Caroline; Antoch, Gerald; Blondin, Dirk

    2012-04-01

    To evaluate the influence of pulsatile blood flow on apparent diffusion coefficients (ADC) and the fraction of pseudodiffusion (F(P)) in the human kidney. The kidneys of 6 healthy volunteers were examined by a 3-T magnetic resonance scanner. Electrocardiogram (ECG)-gated and respiratory-triggered diffusion-weighted imaging (DWI) and phase-contrast flow measurements were performed. Flow imaging of renal arteries was carried out to quantify the dependence of renal blood flow on the cardiac cycle. ECG-triggered DWI was acquired in the coronal plane with 16 b values in the range of 0 s/mm(2) and 750 s/mm(2) at the time of minimum (MIN) (20 milliseconds after R wave) and maximum renal blood flow (MAX) (197 ± 24 milliseconds after R wave). The diffusion coefficients were calculated using the monoexponential approach as well as the biexponential intravoxel incoherent motion model and correlated to phase-contrast flow measurements. Flow imaging showed pulsatile renal blood flow depending on the cardiac cycle. The mean flow velocity at MIN was 45 cm/s as compared with 61 cm/s at MAX. F(p) at MIN (0.29) was significantly lower than at MAX (0.40) (P = 0.001). Similarly, ADC(mono), derived from the monoexponential model, also showed a significant difference (P renal blood flow and F(p) (r = 0.85) as well as ADC(mono) (r = 0.67) was statistically significant. Temporally resolved ECG-gated DWI enables for the determination of the diffusion coefficients at different time points of the cardiac cycle. ADC(mono) and FP vary significantly among acquisitions at minimum (diastole) and maximum (systole) renal blood flow. Temporally resolved ECG-gated DWI might therefore serve as a novel technique for the assessment of pulsatility in the human kidney.

  16. Intravoxel incoherent motion magnetic resonance imaging of the knee joint in children with juvenile idiopathic arthritis

    Energy Technology Data Exchange (ETDEWEB)

    Hilbert, Fabian; Sauer, Alexander; Koestler, Herbert [University Hospital Wuerzburg, Department of Diagnostic and Interventional Radiology, Wuerzburg (Germany); Holl-Wieden, Annette [University Hospital Wuerzburg, Department of Paediatrics, Wuerzburg (Germany); Neubauer, Henning [University Hospital Wuerzburg, Department of Diagnostic and Interventional Radiology, Wuerzburg (Germany); University Hospital Ulm, Department of Diagnostic and Interventional Radiology, Ulm (Germany)

    2017-05-15

    MRI of synovitis relies on use of a gadolinium-based contrast agent. Diffusion-weighted MRI (DWI) visualises thickened synovium but is of limited use in the presence of joint effusion. To investigate the feasibility and diagnostic accuracy of diffusion-weighted MRI with intravoxel incoherent motion (IVIM) for diagnosing synovitis in the knee joint of children with juvenile idiopathic arthritis. Twelve consecutive children with confirmed or suspected juvenile idiopathic arthritis (10 girls, median age 11 years) underwent MRI with contrast-enhanced T1-weighted imaging and DWI at 1.5 T. Read-out segmented multi-shot DWI was acquired at b values of 0 s/mm{sup 2}, 200 s/mm{sup 2}, 400 s/mm{sup 2} and 800 s/mm{sup 2}. We calculated the IVIM parameters perfusion fraction (f) and tissue diffusion coefficient (D). Diffusion-weighted images at b=800 s/mm{sup 2}, f parameter maps and post-contrast T1-weighted images were retrospectively assessed by two independent readers for synovitis using the Juvenile Arthritis MRI Scoring system. Seven (58%) children showed synovial hypertrophy on contrast-enhanced imaging. Diagnostic ratings for synovitis on DWI and on f maps were fully consistent with contrast-enhanced imaging, the diagnostic reference. Two children had equivocal low-confidence assessments on DWI. Median f was 6.7±2.0% for synovitis, 2.1±1.2% for effusion, 5.0±1.0% for muscle and 10.6±5.7% for popliteal lymph nodes. Diagnostic confidence was higher based on f maps in three (25%) children and lower in one child (8%), as compared to DWI. DWI with IVIM reliably visualises synovitis of the knee joint. Perfusion fraction maps differentiate thickened synovium from joint effusion and hence increase diagnostic confidence. (orig.)

  17. Evaluation of breast cancer using intravoxel incoherent motion (IVIM) histogram analysis: comparison with malignant status, histological subtype, and molecular prognostic factors.

    Science.gov (United States)

    Cho, Gene Young; Moy, Linda; Kim, Sungheon G; Baete, Steven H; Moccaldi, Melanie; Babb, James S; Sodickson, Daniel K; Sigmund, Eric E

    2016-08-01

    To examine heterogeneous breast cancer through intravoxel incoherent motion (IVIM) histogram analysis. This HIPAA-compliant, IRB-approved retrospective study included 62 patients (age 48.44 ± 11.14 years, 50 malignant lesions and 12 benign) who underwent contrast-enhanced 3 T breast MRI and diffusion-weighted imaging. Apparent diffusion coefficient (ADC) and IVIM biomarkers of tissue diffusivity (Dt), perfusion fraction (fp), and pseudo-diffusivity (Dp) were calculated using voxel-based analysis for the whole lesion volume. Histogram analysis was performed to quantify tumour heterogeneity. Comparisons were made using Mann-Whitney tests between benign/malignant status, histological subtype, and molecular prognostic factor status while Spearman's rank correlation was used to characterize the association between imaging biomarkers and prognostic factor expression. The average values of the ADC and IVIM biomarkers, Dt and fp, showed significant differences between benign and malignant lesions. Additional significant differences were found in the histogram parameters among tumour subtypes and molecular prognostic factor status. IVIM histogram metrics, particularly fp and Dp, showed significant correlation with hormonal factor expression. Advanced diffusion imaging biomarkers show relationships with molecular prognostic factors and breast cancer malignancy. This analysis reveals novel diagnostic metrics that may explain some of the observed variability in treatment response among breast cancer patients. • Novel IVIM biomarkers characterize heterogeneous breast cancer. • Histogram analysis enables quantification of tumour heterogeneity. • IVIM biomarkers show relationships with breast cancer malignancy and molecular prognostic factors.

  18. Optimization of intra-voxel incoherent motion imaging at 3.0 Tesla for fast liver examination.

    Science.gov (United States)

    Leporq, Benjamin; Saint-Jalmes, Hervé; Rabrait, Cecile; Pilleul, Frank; Guillaud, Olivier; Dumortier, Jérôme; Scoazec, Jean-Yves; Beuf, Olivier

    2015-05-01

    Optimization of multi b-values MR protocol for fast intra-voxel incoherent motion imaging of the liver at 3.0 Tesla. A comparison of four different acquisition protocols were carried out based on estimated IVIM (DSlow , DFast , and f) and ADC-parameters in 25 healthy volunteers. The effects of respiratory gating compared with free breathing acquisition then diffusion gradient scheme (simultaneous or sequential) and finally use of weighted averaging for different b-values were assessed. An optimization study based on Cramer-Rao lower bound theory was then performed to minimize the number of b-values required for a suitable quantification. The duration-optimized protocol was evaluated on 12 patients with chronic liver diseases No significant differences of IVIM parameters were observed between the assessed protocols. Only four b-values (0, 12, 82, and 1310 s.mm(-2) ) were found mandatory to perform a suitable quantification of IVIM parameters. DSlow and DFast significantly decreased between nonadvanced and advanced fibrosis (P < 0.05 and P < 0.01) whereas perfusion fraction and ADC variations were not found to be significant. Results showed that IVIM could be performed in free breathing, with a weighted-averaging procedure, a simultaneous diffusion gradient scheme and only four optimized b-values (0, 10, 80, and 800) reducing scan duration by a factor of nine compared with a nonoptimized protocol. Preliminary results have shown that parameters such as DSlow and DFast based on optimized IVIM protocol can be relevant biomarkers to distinguish between nonadvanced and advanced fibrosis. © 2014 Wiley Periodicals, Inc.

  19. Intravoxel Incoherent Motion and Quantitative Non-Gaussian Diffusion MR Imaging: Evaluation of the Diagnostic and Prognostic Value of Several Markers of Malignant and Benign Breast Lesions.

    Science.gov (United States)

    Iima, Mami; Kataoka, Masako; Kanao, Shotaro; Onishi, Natsuko; Kawai, Makiko; Ohashi, Akane; Sakaguchi, Rena; Toi, Masakazu; Togashi, Kaori

    2018-05-01

    Purpose To investigate the performance of integrated approaches that combined intravoxel incoherent motion (IVIM) and non-Gaussian diffusion parameters compared with the Breast Imaging and Reporting Data System (BI-RADS) to establish multiparameter thresholds scores or probabilities by using Bayesian analysis to distinguish malignant from benign breast lesions and their correlation with molecular prognostic factors. Materials and Methods Between May 2013 and March 2015, 411 patients were prospectively enrolled and 199 patients (allocated to training [n = 99] and validation [n = 100] sets) were included in this study. IVIM parameters (flowing blood volume fraction [fIVIM] and pseudodiffusion coefficient [D*]) and non-Gaussian diffusion parameters (theoretical apparent diffusion coefficient [ADC] at b value of 0 sec/mm 2 [ADC 0 ] and kurtosis [K]) by using IVIM and kurtosis models were estimated from diffusion-weighted image series (16 b values up to 2500 sec/mm 2 ), as well as a synthetic ADC (sADC) calculated by using b values of 200 and 1500 (sADC 200-1500 ) and a standard ADC calculated by using b values of 0 and 800 sec/mm 2 (ADC 0-800 ). The performance of two diagnostic approaches (combined parameter thresholds and Bayesian analysis) combining IVIM and diffusion parameters was evaluated and compared with BI-RADS performance. The Mann-Whitney U test and a nonparametric multiple comparison test were used to compare their performance to determine benignity or malignancy and as molecular prognostic biomarkers and subtypes of breast cancer. Results Significant differences were found between malignant and benign breast lesions for IVIM and non-Gaussian diffusion parameters (ADC 0 , K, fIVIM, fIVIM · D*, sADC 200-1500, and ADC 0-800 ; P < .05). Sensitivity and specificity for the validation set by radiologists A and B were as follows: sensitivity, 94.7% and 89.5%, and specificity, 75.0% and 79.2% for sADC 200-1500 , respectively; sensitivity, 94.7% and 96.1%, and

  20. Apparent diffusive motion of centrin foci in living cells: implications for diffusion-based motion in centriole duplication

    Science.gov (United States)

    Rafelski, Susanne M.; Keller, Lani C.; Alberts, Jonathan B.; Marshall, Wallace F.

    2011-04-01

    The degree to which diffusion contributes to positioning cellular structures is an open question. Here we investigate the question of whether diffusive motion of centrin granules would allow them to interact with the mother centriole. The role of centrin granules in centriole duplication remains unclear, but some proposed functions of these granules, for example, in providing pre-assembled centriole subunits, or by acting as unstable 'pre-centrioles' that need to be captured by the mother centriole (La Terra et al 2005 J. Cell Biol. 168 713-22), require the centrin foci to reach the mother. To test whether diffusive motion could permit such interactions in the necessary time scale, we measured the motion of centrin-containing foci in living human U2OS cells. We found that these centrin foci display apparently diffusive undirected motion. Using the apparent diffusion constant obtained from these measurements, we calculated the time scale required for diffusion to capture by the mother centrioles and found that it would greatly exceed the time available in the cell cycle. We conclude that mechanisms invoking centrin foci capture by the mother, whether as a pre-centriole or as a source of components to support later assembly, would require a form of directed motility of centrin foci that has not yet been observed.

  1. Prediction of the treatment outcome using intravoxel incoherent motion and diffusional kurtosis imaging in nasal or sinonasal squamous cell carcinoma patients

    Energy Technology Data Exchange (ETDEWEB)

    Fujima, Noriyuki; Yoshida, Daisuke; Tsukahara, Akiko; Shimizu, Yukie; Kudo, Kohsuke [Hokkaido University Hospital, Department of Diagnostic and Interventional Radiology, Sapporo, Hokkaido (Japan); Sakashita, Tomohiro; Homma, Akihiro [Hokkaido University Graduate School of Medicine, Department of Otolaryngology-Head and Neck Surgery, Sapporo (Japan); Tha, Khin Khin; Shirato, Hiroki [Hokkaido University Graduate School of Medicine, Department of Radiation Medicine, Sapporo (Japan); Global Institution for Collaborative Research and Education, The Global Station for Quantum Medical Science and Engineering, Sapporo (Japan)

    2017-03-15

    To evaluate the diagnostic value of intravoxel incoherent motion (IVIM) and diffusional kurtosis imaging (DKI) parameters in nasal or sinonasal squamous cell carcinoma (SCC) patients to determine local control/failure. Twenty-eight patients were evaluated. MR acquisition used single-shot spin-echo EPI with 12 b-values. Quantitative parameters (mean value, 25th, 50th and 75th percentiles) of IVIM (perfusion fraction f, pseudo-diffusion coefficient D*, and true-diffusion coefficient D), DKI (kurtosis value K, kurtosis corrected diffusion coefficient D{sub k}) and apparent diffusion coefficient (ADC) were calculated. Parameter values at both the pretreatment and early-treatment period, and the percentage change between these two periods were obtained. Multivariate logistic regression analysis: the percentage changes of D (mean, 25th, 50th, 75th), K (mean, 50th, 75th), Dk (mean, 25th, 50th), and ADC (mean, 25th, 50th) were predictors of local control. ROC curve analysis: the parameter with the highest accuracy = the percentage change of D value with the histogram 25th percentile (0.93 diagnostic accuracy). Multivariate Cox regression analyses: the percentage changes of D (mean, 25th, 50th), K (mean, 50th, 75th), Dk (mean, 25th, 50th) and ADC (mean, 25th, 50th) are predictors. IVIM and DKI parameters, especially the D-value's histogram 25th percentile, are useful for predicting local control. (orig.)

  2. Apparent diffusive motion of centrin foci in living cells: implications for diffusion-based motion in centriole duplication

    International Nuclear Information System (INIS)

    Rafelski, Susanne M; Keller, Lani C; Marshall, Wallace F; Alberts, Jonathan B

    2011-01-01

    The degree to which diffusion contributes to positioning cellular structures is an open question. Here we investigate the question of whether diffusive motion of centrin granules would allow them to interact with the mother centriole. The role of centrin granules in centriole duplication remains unclear, but some proposed functions of these granules, for example, in providing pre-assembled centriole subunits, or by acting as unstable 'pre-centrioles' that need to be captured by the mother centriole (La Terra et al 2005 J. Cell Biol. 168 713–22), require the centrin foci to reach the mother. To test whether diffusive motion could permit such interactions in the necessary time scale, we measured the motion of centrin-containing foci in living human U2OS cells. We found that these centrin foci display apparently diffusive undirected motion. Using the apparent diffusion constant obtained from these measurements, we calculated the time scale required for diffusion to capture by the mother centrioles and found that it would greatly exceed the time available in the cell cycle. We conclude that mechanisms invoking centrin foci capture by the mother, whether as a pre-centriole or as a source of components to support later assembly, would require a form of directed motility of centrin foci that has not yet been observed

  3. Simultaneous multi-slice echo planar diffusion weighted imaging of the liver and the pancreas: Optimization of signal-to-noise ratio and acquisition time and application to intravoxel incoherent motion analysis

    Energy Technology Data Exchange (ETDEWEB)

    Boss, Andreas, E-mail: andreas.boss@usz.ch [Institute of Diagnostic and Interventional Radiology, University Hospital Zurich (Switzerland); Barth, Borna; Filli, Lukas; Kenkel, David; Wurnig, Moritz C. [Institute of Diagnostic and Interventional Radiology, University Hospital Zurich (Switzerland); Piccirelli, Marco [Institute of Neuroradiology, University Hospital of Zurich (Switzerland); Reiner, Caecilia S. [Institute of Diagnostic and Interventional Radiology, University Hospital Zurich (Switzerland)

    2016-11-15

    Purpose: To optimize and test a diffusion-weighted imaging (DWI) echo-planar imaging (EPI) sequence with simultaneous multi-slice (SMS) excitation in the liver and pancreas regarding acquisition time (TA), number of slices, signal-to-noise ratio (SNR), image quality (IQ), apparent diffusion coefficient (ADC) quantitation accuracy, and feasibility of intravoxel incoherent motion (IVIM) analysis. Materials and methods: Ten healthy volunteers underwent DWI of the upper abdomen at 3T. A SMS DWI sequence with CAIPIRINHA unaliasing technique (acceleration factors 2/3, denoted AF2/3) was compared to standard DWI-EPI (AF1). Four schemes were evaluated: (i) reducing TA, (ii) keeping TA identical with increasing number of averages, (iii) increasing number of slices with identical TA (iv) increasing number of b-values for IVIM. Acquisition schemes i-iii were evaluated qualitatively (reader score) and quantitatively (ADC values, SNR). Results: In scheme (i) no differences in SNR were observed (p = 0.321 − 0.038) with reduced TA (AF2 increase in SNR/time 75.6%, AF3 increase SNR/time 102.4%). No SNR improvement was obtained in scheme (ii). Increased SNR/time could be invested in acquisition of more and thinner slices or higher number of b-values. Image quality scores were stable for AF2 but decreased for AF3. Only for AF3, liver ADC values were systematically lower. Conclusion: SMS-DWI of the liver and pancreas provides substantially higher SNR/time, which either may be used for shorter scan time, higher slice resolution or IVIM measurements.

  4. Simultaneous multi-slice echo planar diffusion weighted imaging of the liver and the pancreas: Optimization of signal-to-noise ratio and acquisition time and application to intravoxel incoherent motion analysis

    International Nuclear Information System (INIS)

    Boss, Andreas; Barth, Borna; Filli, Lukas; Kenkel, David; Wurnig, Moritz C.; Piccirelli, Marco; Reiner, Caecilia S.

    2016-01-01

    Purpose: To optimize and test a diffusion-weighted imaging (DWI) echo-planar imaging (EPI) sequence with simultaneous multi-slice (SMS) excitation in the liver and pancreas regarding acquisition time (TA), number of slices, signal-to-noise ratio (SNR), image quality (IQ), apparent diffusion coefficient (ADC) quantitation accuracy, and feasibility of intravoxel incoherent motion (IVIM) analysis. Materials and methods: Ten healthy volunteers underwent DWI of the upper abdomen at 3T. A SMS DWI sequence with CAIPIRINHA unaliasing technique (acceleration factors 2/3, denoted AF2/3) was compared to standard DWI-EPI (AF1). Four schemes were evaluated: (i) reducing TA, (ii) keeping TA identical with increasing number of averages, (iii) increasing number of slices with identical TA (iv) increasing number of b-values for IVIM. Acquisition schemes i-iii were evaluated qualitatively (reader score) and quantitatively (ADC values, SNR). Results: In scheme (i) no differences in SNR were observed (p = 0.321 − 0.038) with reduced TA (AF2 increase in SNR/time 75.6%, AF3 increase SNR/time 102.4%). No SNR improvement was obtained in scheme (ii). Increased SNR/time could be invested in acquisition of more and thinner slices or higher number of b-values. Image quality scores were stable for AF2 but decreased for AF3. Only for AF3, liver ADC values were systematically lower. Conclusion: SMS-DWI of the liver and pancreas provides substantially higher SNR/time, which either may be used for shorter scan time, higher slice resolution or IVIM measurements.

  5. Incoherent SSI Analysis of Reactor Building using 2007 Hard-Rock Coherency Model

    International Nuclear Information System (INIS)

    Kang, Joo-Hyung; Lee, Sang-Hoon

    2008-01-01

    Many strong earthquake recordings show the response motions at building foundations to be less intense than the corresponding free-field motions. To account for these phenomena, the concept of spatial variation, or wave incoherence was introduced. Several approaches for its application to practical analysis and design as part of soil-structure interaction (SSI) effect have been developed. However, conventional wave incoherency models didn't reflect the characteristics of earthquake data from hard-rock site, and their application to the practical nuclear structures on the hard-rock sites was not justified sufficiently. This paper is focused on the response impact of hard-rock coherency model proposed in 2007 on the incoherent SSI analysis results of nuclear power plant (NPP) structure. A typical reactor building of pressurized water reactor (PWR) type NPP is modeled classified into surface and embedded foundations. The model is also assumed to be located on medium-hard rock and hard-rock sites. The SSI analysis results are obtained and compared in case of coherent and incoherent input motions. The structural responses considering rocking and torsion effects are also investigated

  6. Motions in the relativistic fields of a charged dust

    International Nuclear Information System (INIS)

    Fonseca Teixeira, A.F. da.

    1980-04-01

    The general relativistic motion of arbitrarily charged test particles is investigated, in the spherically symmetric fields of a charged, static, incoherent matter with T 0 0 = const. The condition for existence of stable circular orbits is established, inside and outside the diffused source. The null geodesics are also investigated, as a limiting case. (Author) [pt

  7. Incoherent neutron scattering in acetanilide and three deuterated derivatives

    Science.gov (United States)

    Barthes, Mariette; Almairac, Robert; Sauvajol, Jean-Louis; Moret, Jacques; Currat, Roland; Dianoux, José

    1991-03-01

    Incoherent-neutron-scattering measurements of the vibrational density of states of acetanilide and three deuterated derivatives are presented. These data allow one to identify an intense maximum, assigned to the N-H out-of-plane bending mode. The data display the specific behavior of the methyl torsional modes: large isotopic shift and strong low-temperature intensity; confirm our previous inelastic-neutron-scattering studies, indicating no obvious anomalies in the range of frequency of the acoustic phonons. In addition, the data show the existence of thermally activated quasielastic scattering above 100 K, assigned to the random diffusive motion of the methyl protons. These results are discussed in the light of recent theoretical models proposed to explain the anomalous optical properties of this crystal.

  8. Initial experience of correlating parameters of intravoxel incoherent motion and dynamic contrast-enhanced magnetic resonance imaging at 3.0 T in nasopharyngeal carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Qian-Jun; Zhang, Shui-Xing; Chen, Wen-Bo; Liang, Long; Zhou, Zheng-Gen; Liu, Zai-Yi; Zeng, Qiong-Xin; Liang, Chang-Hong [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, Guangzhou, Guangdong Province (China); Qiu, Qian-Hui [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Otolaryngology, Guangzhou, Guangdong Province (China)

    2014-12-15

    To determine the correlation between intravoxel incoherent motion (IVIM) and dynamic contrast-enhanced (DCE) magnetic resonance imaging (MRI) parameters. Thirty-eight newly diagnosed NPC patients were prospectively enrolled. Diffusion-weighted images (DWI) at 13 b-values were acquired using a 3.0-T MRI system. IVIM parameters including the pure molecular diffusion (D), perfusion-related diffusion (D*), perfusion fraction (f), DCE-MRI parameters including maximum slope of increase (MSI), enhancement amplitude (EA) and enhancement ratio (ER) were calculated by two investigators independently. Intra- and interobserver agreement were evaluated using the intraclass correlation coefficient (ICC) and Bland-Altman analysis. Relationships between IVIM and DCE-MRI parameters were evaluated by calculation of Spearman's correlation coefficient. Intra- and interobserver reproducibility were excellent to relatively good (ICC = 0.887-0.997; narrow width of 95 % limits of agreement). The highest correlation was observed between f and EA (r = 0.633, P < 0.001), with a strong correlation between f and MSI (r = 0.598, P = 0.001). No correlation was observed between f and ER (r = -0.162; P = 0.421) or D* and DCE parameters (r = 0.125-0.307; P > 0.119). This study suggests IVIM perfusion imaging using 3.0-T MRI is feasible in NPC, and f correlates significantly with EA and MSI. (orig.)

  9. Intravoxel Incoherent Motion Diffusion Weighted MR Imaging for Monitoring the Instantly Therapeutic Efficacy of Radiofrequency Ablation in Rabbit VX2 Tumors without Evident Links between Conventional Perfusion Weighted Images.

    Directory of Open Access Journals (Sweden)

    Ziyi Guo

    Full Text Available To investigate the intravoxel incoherent motion diffusion weighted imaging (IVIM-DWI as a potential valuable marker to monitor the therapy responses of VX2 to radiofrequency ablation (RF Ablation.The institutional animal care and use committee approved this study. In 10 VX2 tumor-bearing rabbits, IVIM-DWI examinations were performed with a 3.0T imaging unit by using 16 b values from 0 to 800 sec/mm2. The true diffusion coefficient (D, pseudodiffusion coefficient (D* and perfusion fraction (f of tumors were compared between before and instantly after RF Ablation treatment. The differences of D, D* and f and conventional perfusion parameters (from perfusion CT and dynamic enhanced magnetic resonance imaging, DCE-MRI in the coagulation necrosis area, residual unablated area, untreated area, and normal control had been calculated by compared t-test. The correlation between f or D* with perfusion weighted CT including blood flow, BF (milliliter per 100 mL/min, blood volume, BV (milliliter per 100 mL/min, and capillary permeability-surface area, PMB (as a fraction or from DCE-MRI: transfer constant (Ktrans, extra-vascular extra-cellular volume fraction (Ve and reflux constant (Kep values had been analyzed by region-of-interest (ROI methods to calculate Pearson's correlation coefficients.In the ablated necrosis areas, f and D* significantly decreased and D significantly increased, compared with residual unblazed areas or untreated control groups and normal control groups (P < 0.001. The IVIM-DWI derived f parameters showed significant increases in the residual unablated tumor area. There was no significant correlations between f or D* and conventional perfusion parameters.The IVIM-DW derived f, D and D* parameters have the potential to indicate therapy response immediately after RF Ablation treatment, while no significant correlations with classical tumor perfusion metrics were derived from DCE-MRI and perfusion-CT measurements.

  10. Liver fibrosis: in vivo evaluation using intravoxel incoherent motion-derived histogram metrics with histopathologic findings at 3.0 T.

    Science.gov (United States)

    Hu, Fubi; Yang, Ru; Huang, Zixing; Wang, Min; Zhang, Hanmei; Yan, Xu; Song, Bin

    2017-12-01

    To retrospectively determine the feasibility of intravoxel incoherent motion (IVIM) imaging based on histogram analysis for the staging of liver fibrosis (LF) using histopathologic findings as the reference standard. 56 consecutive patients (14 men, 42 women; age range, 15-76, years) with chronic liver diseases (CLDs) were studied using IVIM-DWI with 9 b-values (0, 25, 50, 75, 100, 150, 200, 500, 800 s/mm 2 ) at 3.0 T. Fibrosis stage was evaluated using the METAVIR scoring system. Histogram metrics including mean, standard deviation (Std), skewness, kurtosis, minimum (Min), maximum (Max), range, interquartile (Iq) range, and percentiles (10, 25, 50, 75, 90th) were extracted from apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (f) maps. All histogram metrics among different fibrosis groups were compared using one-way analysis of variance or nonparametric Kruskal-Wallis test. For significant parameters, receivers operating characteristic curve (ROC) analyses were further performed for the staging of LF. Based on their METAVIR stage, the 56 patients were reclassified into three groups as follows: F0-1 group (n = 25), F2-3 group (n = 21), and F4 group (n = 10). The mean, Iq range, percentiles (50, 75, and 90th) of D* maps between the groups were significant differences (all P histogram metrics of ADC, D, and f maps demonstrated no significant difference among the groups (all P > 0.05). Histogram analysis of D* map derived from IVIM can be used to stage liver fibrosis in patients with CLDs and provide more quantitative information beyond the mean value.

  11. The effect of, within the sphere confined, particle diffusion on the line shape of incoherent cold neutron scattering spectra

    International Nuclear Information System (INIS)

    Cvikl, B.; Dahlborg, U.; Calvo-Dahlborg, M.

    1999-01-01

    Based upon the model of particles diffusion within the sphere of partially absorbing boundaries, the possibilities of the detection, by the incoherent cold neutron scattering method, of particle precipitation on the boundary walls, has been investigated. The calculated scattering law as a function of the boundary absorption properties exhibits distinct characteristic which might, under favorable conditions, make such an experimental attempt feasible.(author)

  12. On the response of large dams to incoherent seismic excitation

    International Nuclear Information System (INIS)

    Ramadan, O.; Novak, M.

    1993-01-01

    An intensive parametric study was conducted to investigate the response of concrete gravity dams to horizontal, spatially variable seismic ground motions. Both segmented dams consisting of separate blocks, or monoliths, and continuous monolithic dams are considered. The study includes the effects of various parameters on system natural frequencies, vibration modes, modal displacement ratios, as well as dam displacements and internal stresses due to spatially variable ground motions. The dam analytical model, and dam response to incoherent ground motions are described. The results show that the dam vibrates almost as a rigid body under the fully correlated waves, but bends and twists significantly under the spatially correlated motions. Dam-foundation interaction magnifies the low frequency components of the dam response, more so for a full reservoir, but decreases the high frequency components. For long dams, the effects of spatially incoherent ground motions are qualitatively different and can be much greater than those due to surface travelling waves. 3 refs., 3 figs

  13. Assessment of the link between quantitative biexponential diffusion-weighted imaging and contrast-enhanced MRI in the liver

    NARCIS (Netherlands)

    Dijkstra, Hildebrand; Oudkerk, Matthijs; Kappert, Peter; Sijens, Paul E.

    Purpose: To investigate if intravoxel incoherent motion (IVIM) modeled diffusion-weighted imaging (DWI) can be linked to contrast-enhanced (CE-)MRI in liver parenchyma and liver lesions. Methods: Twenty-five patients underwent IVIM-DWI followed by multiphase CE-MRI using Gd-EOB-DTPA (n = 20) or

  14. Early evaluation of irradiated parotid glands with intravoxel incoherent motion MR imaging: correlation with dynamic contrast-enhanced MR imaging

    International Nuclear Information System (INIS)

    Zhou, Nan; Chu, Chen; Dou, Xin; Li, Ming; Liu, Song; Zhu, Lijing; Liu, Baorui; Guo, Tingting; Chen, Weibo; He, Jian; Yan, Jing; Zhou, Zhengyang; Yang, Xiaofeng; Liu, Tian

    2016-01-01

    Radiation-induced parotid damage is one of the most common complications in patients with nasopharyngeal carcinoma (NPC) undergoing radiotherapy (RT). Intravoxel incoherent motion (IVIM) magnetic resonance (MR) imaging has been reported for evaluating irradiated parotid damage. However, the changes of IVIM perfusion-related parameters in irradiated parotid glands have not been confirmed by conventional perfusion measurements obtained from dynamic contrast-enhanced (DCE) MR imaging. The purposes of this study were to monitor radiation-induced parotid damage using IVIM and DCE MR imaging and to investigate the correlations between changes of these MR parameters. Eighteen NPC patients underwent bilateral parotid T1-weighted, IVIM and DCE MR imaging pre-RT (2 weeks before RT) and post-RT (4 weeks after RT). Parotid volume; IVIM MR parameters, including apparent diffusion coefficient (ADC), pure diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (f); and DCE MR parameters, including maximum relative enhancement (MRE), time to peak (TTP), Wash in Rate, and the degree of xerostomia were recorded. Correlations of parotid MR parameters with mean radiation dose, atrophy rate and xerostomia degree, as well as the relationships between IVIM and DCE MR parameters, were investigated. From pre-RT to post-RT, all of the IVIM and DCE MR parameters increased significantly (p < 0.001 for ADC, D, f, MRE, Wash in Rate; p = 0.024 for D*; p = 0.037 for TTP). Change rates of ADC, f and MRE were negatively correlated with atrophy rate significantly (all p < 0.05). Significant correlations were observed between the change rates of D* and MRE (r = 0.371, p = 0.026) and between the change rates of D* and TTP (r = 0.396, p = 0.017). The intra- and interobserver reproducibility of IVIM and DCE MR parameters was good to excellent (intraclass correlation coefficient, 0.633–0.983). Early radiation-induced changes of parotid glands could be evaluated by IVIM and

  15. Diffusion-advection within dynamic biological gaps driven by structural motion

    Science.gov (United States)

    Asaro, Robert J.; Zhu, Qiang; Lin, Kuanpo

    2018-04-01

    To study the significance of advection in the transport of solutes, or particles, within thin biological gaps (channels), we examine theoretically the process driven by stochastic fluid flow caused by random thermal structural motion, and we compare it with transport via diffusion. The model geometry chosen resembles the synaptic cleft; this choice is motivated by the cleft's readily modeled structure, which allows for well-defined mechanical and physical features that control the advection process. Our analysis defines a Péclet-like number, AD, that quantifies the ratio of time scales of advection versus diffusion. Another parameter, AM, is also defined by the analysis that quantifies the full potential extent of advection in the absence of diffusion. These parameters provide a clear and compact description of the interplay among the well-defined structural, geometric, and physical properties vis-a ̀-vis the advection versus diffusion process. For example, it is found that AD˜1 /R2 , where R is the cleft diameter and hence diffusion distance. This curious, and perhaps unexpected, result follows from the dependence of structural motion that drives fluid flow on R . AM, on the other hand, is directly related (essentially proportional to) the energetic input into structural motion, and thereby to fluid flow, as well as to the mechanical stiffness of the cleftlike structure. Our model analysis thus provides unambiguous insight into the prospect of competition of advection versus diffusion within biological gaplike structures. The importance of the random, versus a regular, nature of structural motion and of the resulting transient nature of advection under random motion is made clear in our analysis. Further, by quantifying the effects of geometric and physical properties on the competition between advection and diffusion, our results clearly demonstrate the important role that metabolic energy (ATP) plays in this competitive process.

  16. Brownian Motion of 2D Vacancy Islands by Adatom Terrace Diffusion

    International Nuclear Information System (INIS)

    Morgenstern, Karina; Laegsgaard, Erik; Besenbacher, Flemming

    2001-01-01

    We have studied the Brownian motion of two-dimensional (2D) vacancy islands on Ag(110) at temperatures between 175 and 215K. While the detachment of adatoms from the island and their diffusion on the terrace are permitted in this temperature range, the periphery diffusion of single adatoms is prohibited. The present scanning tunneling microscopy results provide the first direct experimental proof that the Brownian motion of the islands follows a simple scaling law with terrace diffusion being the rate limiting process. The activation energy of the vacancy island motion is determined to 0.41eV

  17. Toward a non-invasive screening tool for differentiation of pancreatic lesions based on intra-voxel incoherent motion derived parameters

    Energy Technology Data Exchange (ETDEWEB)

    Graf, Markus; Simon, Dirk; Mang, Sarah [Deutsches Krebsforschungszentrum (DKFZ), Heidelberg (Germany). Software Development for Integrated Therapy and Diagnostics; Lemke, Andreas [Heidelberg Univ., Mannheim (Germany). Dept. of Computer Assisted Clinical Medicine; Gruenberg, Katharina [Deutsches Krebsforschungszentrum (DKFZ), Heidelberg (Germany). Dept. of Radiology

    2013-03-01

    Early recognition of and differential diagnosis between pancreatic cancer and chronic pancreatitis is an important step in successful therapy. Parameters of the IVIM (intra-voxel incoherent motion) theory can be used to differentiate between those lesions. The objective of this work is to evaluate the effects of rigid image registration on IVIM derived parameters for differentiation of pancreatic lesions such as pancreatic cancer and solid mass forming pancreatitis. The effects of linear image registration methods on reproducibility and accuracy of IVIM derived parameters were quantified on MR images of ten volunteers. For this purpose, they were evaluated statistically by comparison of registered and unregistered parameter data. Further, the perfusion fraction f was used to differentiate pancreatic lesions on eleven previously diagnosed patient data sets. Its diagnostic power with and without rigid registration was evaluated using receiver operating curves (ROC) analysis. The pancreas was segmented manually on MR data sets of healthy volunteers as well as the patients showing solid pancreatic lesions. Diffusion weighted imaging was performed in 10 blocks of breath-hold phases. Linear registration of the weighted image stack leads to a 3.7% decrease in variability of the IVIM derived parameter f due to an improved anatomical overlap of 5%. Consequently, after registration the area under the curve in the ROC-analysis for the differentiation approach increased by 2.7%. In conclusion, rigid registration improves the differentiation process based on f-values. (orig.)

  18. Toward a non-invasive screening tool for differentiation of pancreatic lesions based on intra-voxel incoherent motion derived parameters

    International Nuclear Information System (INIS)

    Graf, Markus; Simon, Dirk; Mang, Sarah; Lemke, Andreas; Gruenberg, Katharina

    2013-01-01

    Early recognition of and differential diagnosis between pancreatic cancer and chronic pancreatitis is an important step in successful therapy. Parameters of the IVIM (intra-voxel incoherent motion) theory can be used to differentiate between those lesions. The objective of this work is to evaluate the effects of rigid image registration on IVIM derived parameters for differentiation of pancreatic lesions such as pancreatic cancer and solid mass forming pancreatitis. The effects of linear image registration methods on reproducibility and accuracy of IVIM derived parameters were quantified on MR images of ten volunteers. For this purpose, they were evaluated statistically by comparison of registered and unregistered parameter data. Further, the perfusion fraction f was used to differentiate pancreatic lesions on eleven previously diagnosed patient data sets. Its diagnostic power with and without rigid registration was evaluated using receiver operating curves (ROC) analysis. The pancreas was segmented manually on MR data sets of healthy volunteers as well as the patients showing solid pancreatic lesions. Diffusion weighted imaging was performed in 10 blocks of breath-hold phases. Linear registration of the weighted image stack leads to a 3.7% decrease in variability of the IVIM derived parameter f due to an improved anatomical overlap of 5%. Consequently, after registration the area under the curve in the ROC-analysis for the differentiation approach increased by 2.7%. In conclusion, rigid registration improves the differentiation process based on f-values. (orig.)

  19. Elements of sub-quantum thermodynamics: quantum motion as ballistic diffusion

    International Nuclear Information System (INIS)

    Groessing, G; Fussy, S; Pascasio, J Mesa; Schwabl, H

    2011-01-01

    By modelling quantum systems as emerging from a (classical) sub-quantum thermodynamics, the quantum mechanical 'decay of the wave packet' is shown to simply result from sub-quantum diffusion with a specific diffusion coefficient varying in time due to a particle's changing thermal environment. It is thereby proven that free quantum motion strictly equals ballistic diffusion. The exact quantum mechanical trajectory distributions and the velocity field of the Gaussian wave packet are thus derived solely from classical physics. Moreover, also quantum motion in a linear (e.g., gravitational) potential is shown to equal said ballistic diffusion. Quantitative statements on the trajectories' characteristic behaviours are obtained which provide a detailed 'micro-causal' explanation in full accordance with momentum conservation.

  20. Basic consideration of diffusion/perfusion imaging

    International Nuclear Information System (INIS)

    Tamagawa, Yoichi; Kimura, Hirohiko; Matsuda, Tsuyoshi; Kawamura, Yasutaka; Nakatsugawa, Shigekazu; Ishii, Yasushi; Sakuma, Hajime; Tsukamoto, Tetsuji.

    1990-01-01

    In magnetic resonance imaging (MRI), microscopic motion of biological system such as molecular diffusion of water and microcirculation of blood in the capillary network (perfusion) has been proposed to cause signal attenuation as an intravoxel incoherent motion (IVIM). Quantitative imaging of the IVIM phenomenon was attempted to generate from a set of spin-echo (SE) sequences with or without sensitization by motion probing gradient (MPG). The IVIM imaging is characterized by a parameter, apparent diffusion coefficient (ADC), which is an integration of both the diffusion and the perfusion factor on voxel-by-voxel basis. Hard ware was adjusted to avoid image artifact mainly produced by eddy current. Feasibility of the method was tested using bottle phantom filled with water at different temperature and acetone, and the calculated ADC values of these media corresponded well with accepted values of diffusion. The method was then applied to biological system to investigate mutual participation of diffusion/perfusion on the ADC value. The result of tumor model born on nude mouse suggested considerable participation of perfusion factor which immediately disappeared after sacrificing the animal. Meanwhile, lower value of sacrificed tissue without microcirculation was suggested to have some restriction of diffusion factor by biological tissue. To substantiate the restriction effect on the diffusion, a series of observation have made on a fiber phantom, stalk of celory with botanical fibers and human brain with nerve fibers, in applying unidirectional MPG along the course of these banch of fiber system. The directional restriction effect of diffusion along the course of fiber (diffusion anisotrophy) was clearly visualized as directional change of ADC value. The present method for tissue characterization by diffusion/perfusion on microscopic level will provide a new insight for evaluation of functional derangement in human brain and other organs. (author)

  1. Diffusion-Weighted MRI for the Assessment of Liver Fibrosis: Principles and Applications

    Directory of Open Access Journals (Sweden)

    Stefano Palmucci

    2015-01-01

    Full Text Available The importance of an early identification of hepatic fibrosis has been emphasized, in order to start therapy and obtain fibrosis regression. Biopsy is the gold-standard method for the assessment of liver fibrosis in chronic liver diseases, but it is limited by complications, interobserver variability, and sampling errors. Several noninvasive methods have been recently introduced into clinical routine, in order to detect liver fibrosis early. One of the most diffuse approaches is represented by diffusion-weighted liver MRI. In this review, the main technical principles are briefly reported in order to explain the rationale for clinical applications. In addition, roles of apparent diffusion coefficient, intravoxel incoherent motion, and relative apparent diffusion coefficient are also reported, showing their advantages and limits.

  2. Differentiating between benign and malignant sinonasal lesions using dynamic contrast-enhanced MRI and intravoxel incoherent motion.

    Science.gov (United States)

    Jiang, Jingxuan; Xiao, Zebin; Tang, Zuohua; Zhong, Yufeng; Qiang, Jinwei

    2018-01-01

    To explore the value of dynamic contrast-enhanced MRI (DCE-MRI) and intravoxel incoherent motion (IVIM) for distinguishing between benign and malignant sinonasal lesions and investigate the correlations between the two methods. Patients with sinonasal lesions (42 benign and 31 malignant) who underwent DCE-MRI and IVIM before confirmation by histopathology were enrolled in this prospective study. Parameters derived from DCE-MRI and IVIM were measured, the optimal cut-off values for differential diagnosis were determined, and the correlations between the two methods were evaluated. Statistical analyses were performed using the Wilcoxon rank sum test, receiver operating characteristic (ROC) curve analysis, and Spearman's rank correlation. Significantly higher K trans and K ep values but lower D and f values were found in malignant lesions than in benign lesions (all pbenign and malignant sinonasal lesions. IVIM findings correlate with DCE-MRI results and may represent an alternative to DCE-MRI. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Modeling single-file diffusion with step fractional Brownian motion and a generalized fractional Langevin equation

    International Nuclear Information System (INIS)

    Lim, S C; Teo, L P

    2009-01-01

    Single-file diffusion behaves as normal diffusion at small time and as subdiffusion at large time. These properties can be described in terms of fractional Brownian motion with variable Hurst exponent or multifractional Brownian motion. We introduce a new stochastic process called Riemann–Liouville step fractional Brownian motion which can be regarded as a special case of multifractional Brownian motion with a step function type of Hurst exponent tailored for single-file diffusion. Such a step fractional Brownian motion can be obtained as a solution of the fractional Langevin equation with zero damping. Various kinds of fractional Langevin equations and their generalizations are then considered in order to decide whether their solutions provide the correct description of the long and short time behaviors of single-file diffusion. The cases where the dissipative memory kernel is a Dirac delta function, a power-law function and a combination of these functions are studied in detail. In addition to the case where the short time behavior of single-file diffusion behaves as normal diffusion, we also consider the possibility of a process that begins as ballistic motion

  4. Spatiotemporal Diffusive Evolution and Fractal Structure of Ground Motion

    Science.gov (United States)

    Suwada, Tsuyoshi

    2018-02-01

    The spatiotemporal diffusive evolution and fractal structure of ground motion have been investigated at the in-ground tunnel of the KEK B-Factory (KEKB) injector linear accelerator (linac). The slow dynamic fluctuating displacements of the tunnel floor are measured in real time with a new remote-controllable sensing system based on a laser-based alignment system. Based on spatiotemporal analyses with linear-regression models, which were applied in both the time and frequency domains to time-series data recorded over a period of approximately 8 months, both coherent and stochastic components in the displacements of the tunnel floor were clearly observed along the entire length of the linac. In particular, it was clearly observed that the stochastic components exhibited characteristic spatiotemporal diffusive evolution with the fractal structure and fractional dimension. This report describes in detail the experimental techniques and analyses of the spatiotemporal diffusive evolution of ground motion observed at the in-ground tunnel of the injector linac using a real-time remote-controllable sensing system.

  5. Localized diffusive motion on two different time scales in solid alkane nanoparticles

    International Nuclear Information System (INIS)

    Wang, S.-K.; Mamontov, Eugene; Bai, M.; Hansen, F.Y.; Taub, H.; Copley, J.R.D.; Garcia Sakai, V.; Gasparovic, Goran; Jenkins, Timothy; Tyagi, M.; Herwig, Kenneth W.; Neumann, D.A.; Montfrooij, W.; Volkmann, U.G.

    2010-01-01

    High-energy-resolution quasielastic neutron scattering on three complementary spectrometers has been used to investigate molecular diffusive motion in solid nano- to bulk-sized particles of the alkane n-C32H66. The crystalline-to-plastic and plastic-to-fluid phase transition temperatures are observed to decrease as the particle size decreases. In all samples, localized molecular diffusive motion in the plastic phase occurs on two different time scales: a 'fast' motion corresponding to uniaxial rotation about the long molecular axis; and a 'slow' motion attributed to conformational changes of the molecule. Contrary to the conventional interpretation in bulk alkanes, the fast uniaxial rotation begins in the low-temperature crystalline phase.

  6. Apparent diffusion coefficient measurement in a moving phantom simulating linear respiratory motion.

    Science.gov (United States)

    Kwee, Thomas C; Takahara, Taro; Muro, Isao; Van Cauteren, Marc; Imai, Yutaka; Nievelstein, Rutger A J; Mali, Willem P T M; Luijten, Peter R

    2010-10-01

    The aim of this study was to examine the effect of simulated linear respiratory motion on apparent diffusion coefficient (ADC) measurements. Six rectangular test tubes (14 × 92 mm) filled with either water, tomato ketchup, or mayonnaise were positioned in a box containing agarose gel. This box was connected to a double-acting pneumatic cylinder, capable of inducing periodic linear motion in the long-axis direction of the magnetic bore (23-mm stroke). Diffusion-weighted magnetic resonance imaging was performed for both the static and moving phantoms, and ADC measurements were made in the six test tubes in both situations. In the three test tubes whose long axes were parallel to the direction of motion, ADCs agreed well between the moving and static phantom situations. However, in two test tubes that were filled with fluids that had a considerably lower diffusion coefficient than the surrounding agarose gel, and whose long axes were perpendicular to the direction of motion, the ADCs agreed poorly between the moving and static phantom situations. ADC measurements of large homogeneous structures are not affected by linear respiratory motion. However, ADC measurements of inhomogeneous or small structures are affected by linear respiratory motion due to partial volume effects.

  7. Apparent diffusion coefficient measurement in a moving phantom simulating linear respiratory motion

    International Nuclear Information System (INIS)

    Kwee, T.C.; Takahara, Taro; Nievelstein, R.A.J.; Mali, W.P.T.M.; Luijten, P.R.; Muro, Isao; Imai, Yutaka; Cauteren, M. Van

    2010-01-01

    The aim of this study was to examine the effect of simulated linear respiratory motion on apparent diffusion coefficient (ADC) measurements. Six rectangular test tubes (14 x 92 mm) filled with either water, tomato ketchup, or mayonnaise were positioned in a box containing agarose gel. This box was connected to a double-acting pneumatic cylinder, capable of inducing periodic linear motion in the long-axis direction of the magnetic bore (23-mm stroke). Diffusion-weighted magnetic resonance imaging was performed for both the static and moving phantoms, and ADC measurements were made in the six test tubes in both situations. In the three test tubes whose long axes were parallel to the direction of motion, ADCs agreed well between the moving and static phantom situations. However, in two test tubes that were filled with fluids that had a considerably lower diffusion coefficient than the surrounding agarose gel, and whose long axes were perpendicular to the direction of motion, the ADCs agreed poorly between the moving and static phantom situations. ADC measurements of large homogeneous structures are not affected by linear respiratory motion. However, ADC measurements of inhomogeneous or small structures are affected by linear respiratory motion due to partial volume effects. (author)

  8. Diffusion in one dimensional random medium and hyperbolic Brownian motion

    International Nuclear Information System (INIS)

    Comtet, A.; Monthus, C.; Paris-6 Univ., 75

    1995-03-01

    Classical diffusion in a random medium involves an exponential functional of Brownian motion. This functional also appears in the study of Brownian diffusion on a Riemann surface of constant negative curvature. This relationship is analyzed in detail and various distributions are studied using stochastic calculus and functional integration. (author) 17 refs

  9. Quantum diffusion of light interstitials in metals

    International Nuclear Information System (INIS)

    McMullen, T.; Bergersen, B.

    1978-01-01

    A quantum theory of diffusion of self-trapped light interstitials in metals is presented. The theory encompasses both coherent and incoherent tunneling, but the approximation used neglects the dependence of the interstitial transfer matrix element on the vibrational state of the crystal. The coherent tunneling contribution is estimated by fitting the incoherent diffusion rate to experimental data for hydrogen and muon diffusion. It is predicted that coherent diffusion should be dominant below approximately 80 K for H in Nb and below approximately 190 K for μ + in Cu. Experimental verifications of these predictions would require high purity strain free samples and low concentrations of the diffusing species. (author)

  10. Diffusion, confusion and functional MRI

    International Nuclear Information System (INIS)

    Le Bihan, Denis

    2012-01-01

    Diffusion MRI has been introduced in 1985 and has had a very successful life on its own. While it has become a standard for imaging stroke and white matter disorders, the borders between diffusion MRI and the general field of fMRI have always remained fuzzy. First, diffusion MRI has been used to obtain images of brain function, based on the idea that diffusion MRI could also be made sensitive to blood flow, through the intra-voxel incoherent motion (IVIM) concept. Second, the IVIM concept helped better understand the contribution from different vasculature components to the BOLD fMRI signal. Third, it has been shown recently that a genuine fMRI signal can be obtained with diffusion MRI. This 'DfMRI' signal is notably different from the BOLD fMRI signal, especially for its much faster response to brain activation both at onset and offset, which points out to structural changes in the neural tissues, perhaps such as cell swelling, occurring in activated neural tissue. This short article reviews the major steps which have paved the way for this exciting development, underlying how technical progress with MRI equipment has each time been instrumental to expand the horizon of diffusion MRI toward the field of fMRI. (authors)

  11. Correction of Gradient Nonlinearity Bias in Quantitative Diffusion Parameters of Renal Tissue with Intra Voxel Incoherent Motion.

    Science.gov (United States)

    Malyarenko, Dariya I; Pang, Yuxi; Senegas, Julien; Ivancevic, Marko K; Ross, Brian D; Chenevert, Thomas L

    2015-12-01

    Spatially non-uniform diffusion weighting bias due to gradient nonlinearity (GNL) causes substantial errors in apparent diffusion coefficient (ADC) maps for anatomical regions imaged distant from magnet isocenter. Our previously-described approach allowed effective removal of spatial ADC bias from three orthogonal DWI measurements for mono-exponential media of arbitrary anisotropy. The present work evaluates correction feasibility and performance for quantitative diffusion parameters of the two-component IVIM model for well-perfused and nearly isotropic renal tissue. Sagittal kidney DWI scans of a volunteer were performed on a clinical 3T MRI scanner near isocenter and offset superiorly. Spatially non-uniform diffusion weighting due to GNL resulted both in shift and broadening of perfusion-suppressed ADC histograms for off-center DWI relative to unbiased measurements close to isocenter. Direction-average DW-bias correctors were computed based on the known gradient design provided by vendor. The computed bias maps were empirically confirmed by coronal DWI measurements for an isotropic gel-flood phantom. Both phantom and renal tissue ADC bias for off-center measurements was effectively removed by applying pre-computed 3D correction maps. Comparable ADC accuracy was achieved for corrections of both b -maps and DWI intensities in presence of IVIM perfusion. No significant bias impact was observed for IVIM perfusion fraction.

  12. A diffusion approximation based on renewal processes with applications to strongly biased run–tumble motion

    DEFF Research Database (Denmark)

    Thygesen, Uffe Høgsbro

    2016-01-01

    We consider organisms which use a renewal strategy such as run–tumble when moving in space, for example to perform chemotaxis in chemical gradients. We derive a diffusion approximation for the motion, applying a central limit theorem due to Anscombe for renewal-reward processes; this theorem has ....... The proposed technique for obtaining diffusion approximations is conceptually and computationally simple, and applicable also when statistics of the motion is obtained empirically or through Monte Carlo simulation of the motion....

  13. Incoherent and coherent backscattering of light by a layer of densely packed random medium

    Energy Technology Data Exchange (ETDEWEB)

    Tishkovets, Victor P. [Institute of Radio Astronomy of NASU, 4 Chervonopraporna Street, Kharkiv 61002 (Ukraine)], E-mail: tishkovets@ira.kharkov.ua

    2007-12-15

    The problem of light scattering by a layer of densely packed discrete random medium is considered. The theory of light scattering by systems of nonspherical particles is applied to derive equations corresponding to incoherent (diffuse) and interference parts of radiation reflected from the medium. A solution of the system of linear equations describing light scattering by a system of particles is represented by iteration. It is shown that the symmetry properties of the T-matrices and of the translation coefficients for the vector Helmholtz harmonics lead to the reciprocity relation for an arbitrary iteration. This relation is applied to consider the backscattering enhancement phenomenon. Equations expressing the incoherent and interference parts of reflected light from statistically homogeneous and isotropic plane-parallel layer of medium are given. In the exact backscattering direction the relation between incoherent and interference parts is identical to that of sparse media.

  14. Comparison of non-Gaussian and Gaussian diffusion models of diffusion weighted imaging of rectal cancer at 3.0 T MRI.

    Science.gov (United States)

    Zhang, Guangwen; Wang, Shuangshuang; Wen, Didi; Zhang, Jing; Wei, Xiaocheng; Ma, Wanling; Zhao, Weiwei; Wang, Mian; Wu, Guosheng; Zhang, Jinsong

    2016-12-09

    Water molecular diffusion in vivo tissue is much more complicated. We aimed to compare non-Gaussian diffusion models of diffusion-weighted imaging (DWI) including intra-voxel incoherent motion (IVIM), stretched-exponential model (SEM) and Gaussian diffusion model at 3.0 T MRI in patients with rectal cancer, and to determine the optimal model for investigating the water diffusion properties and characterization of rectal carcinoma. Fifty-nine consecutive patients with pathologically confirmed rectal adenocarcinoma underwent DWI with 16 b-values at a 3.0 T MRI system. DWI signals were fitted to the mono-exponential and non-Gaussian diffusion models (IVIM-mono, IVIM-bi and SEM) on primary tumor and adjacent normal rectal tissue. Parameters of standard apparent diffusion coefficient (ADC), slow- and fast-ADC, fraction of fast ADC (f), α value and distributed diffusion coefficient (DDC) were generated and compared between the tumor and normal tissues. The SEM exhibited the best fitting results of actual DWI signal in rectal cancer and the normal rectal wall (R 2  = 0.998, 0.999 respectively). The DDC achieved relatively high area under the curve (AUC = 0.980) in differentiating tumor from normal rectal wall. Non-Gaussian diffusion models could assess tissue properties more accurately than the ADC derived Gaussian diffusion model. SEM may be used as a potential optimal model for characterization of rectal cancer.

  15. Higher derivative corrections to incoherent metallic transport in holography

    Energy Technology Data Exchange (ETDEWEB)

    Baggioli, Matteo [Institut de Física d’Altes Energies (IFAE), Universitat Autónoma de Barcelona,The Barcelona Institute of Science and Technology,Campus UAB, 08193 Bellaterra (Barcelona) (Spain); Crete Center for Theoretical Physics and I.P.P., Department of Physics, University of Crete,71003 Heraklion (Greece); Goutéraux, Blaise [Nordita, KTH Royal Institute of Technology and Stockholm University,Roslagstullsbacken 23, SE-106 91 Stockholm (Sweden); Stanford Institute for Theoretical Physics, Department of Physics, Stanford University,Varian Laboratory of Physics, 382 Via Pueblo Mall, Stanford, CA 94305-4060 (United States); APC, Université Paris 7, CNRS/IN2P3, CEA/IRFU, Obs. de Paris,Sorbonne Paris Cité (UMR du CNRS 7164),Bâtiment Condorcet, 10, rue Alice Domon et Léonie Duquet, F-75205, Paris Cedex 13 (France); Kiritsis, Elias [APC, Université Paris 7, CNRS/IN2P3, CEA/IRFU, Obs. de Paris,Sorbonne Paris Cité (UMR du CNRS 7164),Bâtiment Condorcet, 10, rue Alice Domon et Léonie Duquet, F-75205, Paris Cedex 13 (France); Crete Center for Theoretical Physics and I.P.P., Department of Physics, University of Crete,71003 Heraklion (Greece); Crete Center for Quantum Complexity and Nanotechnology, University of Crete,71003 Heraklion (Greece); Li, Wei-Jia [Institute of Theoretical Physics, School of Physics and Optoelectronic Technology,Dalian University of Technology, 214 School of Physics,2 Linggong road, Ganjingzi District, Dalian 116024, Liaoning Province (China); Crete Center for Theoretical Physics and I.P.P., Department of Physics, University of Crete,71003 Heraklion (Greece)

    2017-03-31

    Transport in strongly-disordered, metallic systems is governed by diffusive processes. Based on quantum mechanics, it has been conjectured that these diffusivities obey a lower bound D/v{sup 2}≳ℏ/k{sub B}T, the saturation of which provides a mechanism for the T-linear resistivity of bad metals. This bound features a characteristic velocity v, which was later argued to be the butterfly velocity v{sub B}, based on holographic models of transport. This establishes a link between incoherent metallic transport, quantum chaos and Planckian timescales. Here we study higher derivative corrections to an effective holographic action of homogeneous disorder. The higher derivative terms involve only the charge and translation symmetry breaking sector. We show that they have a strong impact on the bound on charge diffusion D{sub c}/v{sub B}{sup 2}≳ℏ/k{sub B}T, by potentially making the coefficient of its right-hand side arbitrarily small. On the other hand, the bound on energy diffusion is not affected.

  16. Impact of Microwaves on the Electron Cloud and Incoherent Effects

    CERN Document Server

    Decker, Franz Josef; Zimmermann, Frank

    2002-01-01

    We consider the use of microwaves for manipulating the electron cloud, describing an exploratory experiment at PEP-II as well as computer simulations of the electron cloud build-up in the presence of a microwave for an LHC dipole. We then show that the incoherent effects of the electron cloud - energy loss and transverse emittance growth due to scattering of the electrons - are negligible. This suggests that the disturbance of the coherent motion may be another possible application of microwaves, which could prevent beam emittance growth and beam loss.

  17. Direct comparison of in vivo versus postmortem second-order motion-compensated cardiac diffusion tensor imaging.

    Science.gov (United States)

    Stoeck, Christian T; von Deuster, Constantin; Fleischmann, Thea; Lipiski, Miriam; Cesarovic, Nikola; Kozerke, Sebastian

    2018-04-01

    To directly compare in vivo versus postmortem second-order motion-compensated spin-echo diffusion tensor imaging of the porcine heart. Second-order motion-compensated spin-echo cardiac diffusion tensor imaging was performed during systolic contraction in vivo and repeated upon cardiac arrest by bariumchloride without repositioning of the study animal or replaning of imaging slices. In vivo and postmortem reproducibility was assessed by repeat measurements. Comparison of helix, transverse, and sheet (E2A) angulation as well as mean diffusivity and fractional anisotropy was performed. Intraclass correlation coefficients for repeated measurements (postmortem/in vivo) were 0.95/0.96 for helix, 0.70/0.66 for transverse, and 0.79/0.72 for E2A angulation; 0.83/0.72 for mean diffusivity; and 0.78/0.76 for fractional anisotropy. The corresponding 95% levels of agreement across the left ventricle were: helix 14 to 18°/12 to 15°, transverse 9 to 10°/10 to 11°, E2A 15 to 20°/16 to 18°. The 95% levels of agreement across the left ventricle for the comparison of postmortem versus in vivo were 20 to 22° for helix, 13 to 19° for transverse, and 24 to 31° for E2A angulation. Parameters derived from in vivo second-order motion-compensated spin-echo diffusion tensor imaging agreed well with postmortem imaging, indicating sufficient suppression of motion-induced signal distortions of in vivo cardiac diffusion tensor imaging. Magn Reson Med 79:2265-2276, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  18. Charged-particle incoherent-motion damping in storage rings by means of dissipative elements

    International Nuclear Information System (INIS)

    Derbenev, Ya.S.; Khejfets, S.A.

    1979-01-01

    In consecutive order a possibility of damping of beam incoherent oscillations in a storage ring was studied by means of an external dissipative system in a sufficient common case. It is shown, that a useful effect, as for the case of electron cooling, is one-particle effect of particle oscillations damping due to nonconservatism of its interaction with an external system. Each other mutual influence through the external system becomes significant with increasing beam density and results in the limitation to achievable damping decrements

  19. A Diffusion Approximation Based on Renewal Processes with Applications to Strongly Biased Run-Tumble Motion.

    Science.gov (United States)

    Thygesen, Uffe Høgsbro

    2016-03-01

    We consider organisms which use a renewal strategy such as run-tumble when moving in space, for example to perform chemotaxis in chemical gradients. We derive a diffusion approximation for the motion, applying a central limit theorem due to Anscombe for renewal-reward processes; this theorem has not previously been applied in this context. Our results extend previous work, which has established the mean drift but not the diffusivity. For a classical model of tumble rates applied to chemotaxis, we find that the resulting chemotactic drift saturates to the swimming velocity of the organism when the chemical gradients grow increasingly steep. The dispersal becomes anisotropic in steep gradients, with larger dispersal across the gradient than along the gradient. In contrast to one-dimensional settings, strong bias increases dispersal. We next include Brownian rotation in the model and find that, in limit of high chemotactic sensitivity, the chemotactic drift is 64% of the swimming velocity, independent of the magnitude of the Brownian rotation. We finally derive characteristic timescales of the motion that can be used to assess whether the diffusion limit is justified in a given situation. The proposed technique for obtaining diffusion approximations is conceptually and computationally simple, and applicable also when statistics of the motion is obtained empirically or through Monte Carlo simulation of the motion.

  20. On the distribution of estimators of diffusion constants for Brownian motion

    International Nuclear Information System (INIS)

    Boyer, Denis; Dean, David S

    2011-01-01

    We discuss the distribution of various estimators for extracting the diffusion constant of single Brownian trajectories obtained by fitting the squared displacement of the trajectory. The analysis of the problem can be framed in terms of quadratic functionals of Brownian motion that correspond to the Euclidean path integral for simple Harmonic oscillators with time dependent frequencies. Explicit analytical results are given for the distribution of the diffusion constant estimator in a number of cases and our results are confirmed by numerical simulations.

  1. Localization and Ballistic Diffusion for the Tempered Fractional Brownian-Langevin Motion

    Science.gov (United States)

    Chen, Yao; Wang, Xudong; Deng, Weihua

    2017-10-01

    This paper discusses the tempered fractional Brownian motion (tfBm), its ergodicity, and the derivation of the corresponding Fokker-Planck equation. Then we introduce the generalized Langevin equation with the tempered fractional Gaussian noise for a free particle, called tempered fractional Langevin equation (tfLe). While the tfBm displays localization diffusion for the long time limit and for the short time its mean squared displacement (MSD) has the asymptotic form t^{2H}, we show that the asymptotic form of the MSD of the tfLe transits from t^2 (ballistic diffusion for short time) to t^{2-2H}, and then to t^2 (again ballistic diffusion for long time). On the other hand, the overdamped tfLe has the transition of the diffusion type from t^{2-2H} to t^2 (ballistic diffusion). The tfLe with harmonic potential is also considered.

  2. Synthesis of Cyclic Polymers and Characterization of Their Diffusive Motion in the Melt State at the Single Molecule Level

    KAUST Repository

    Habuchi, Satoshi

    2016-09-26

    We demonstrate a method for the synthesis of cyclic polymers and a protocol for characterizing their diffusive motion in a melt state at the single molecule level. An electrostatic self-assembly and covalent fixation (ESA-CF) process is used for the synthesis of the cyclic poly(tetrahydrofuran) (poly(THF)). The diffusive motion of individual cyclic polymer chains in a melt state is visualized using single molecule fluorescence imaging by incorporating a fluorophore unit in the cyclic chains. The diffusive motion of the chains is quantitatively characterized by means of a combination of mean-squared displacement (MSD) analysis and a cumulative distribution function (CDF) analysis. The cyclic polymer exhibits multiple-mode diffusion which is distinct from its linear counterpart. The results demonstrate that the diffusional heterogeneity of polymers that is often hidden behind ensemble averaging can be revealed by the efficient synthesis of the cyclic polymers using the ESA-CF process and the quantitative analysis of the diffusive motion at the single molecule level using the MSD and CDF analyses.

  3. The crossover from collective motion to periphery diffusion for two-dimensional adatom-islands on Cu(111)

    International Nuclear Information System (INIS)

    Karim, Altaf; Kara, Abdelkader; Rahman, Talat S; Trushin, Oleg

    2011-01-01

    The diffusion of two-dimensional adatom-islands (up to 100 atoms) on Cu(111) has been studied, using the self-learning kinetic Monte Carlo method (Trushin et al 2005 Phys. Rev. B 72 115401). A variety of multiple- and single-atom processes are revealed in the simulations, and the size dependences of the diffusion coefficients and effective diffusion barriers are calculated for each. From the tabulated frequencies of events found in the simulation, we show a crossover from diffusion due to the collective motion of the island to a regime in which the island diffuses through periphery-dominated mass transport. This crossover occurs for island sizes between 13 and 19 atoms. For islands containing 19-100 atoms the scaling exponent is 1.5, which is in good agreement with previous work. The diffusion of islands containing 2-13 atoms can be explained primarily on the basis of a linear increase of the barrier for the collective motion with the size of the island. (fast track communication)

  4. Molecular rotations and diffusion in solids, in particular hydrogen in metals

    International Nuclear Information System (INIS)

    Springer, T.

    1977-01-01

    The chapter deals mainly with problems related to physical chemistry. The author treats diffusion in solids, in particular of hydrogen in metals, and studies of molecular rotations, in particular studies of tunneling transitions which is a relatively new and rapidly developing field of high resolution neutron spectroscopy. Typical neutron spectra to be discussed appear in energy ranges of a few 10 -6 to a few 10 -3 eV, or 10 -5 to 10 -2 cm -1 . The discussion is restricted to scattering from the protons which is predominantly incoherent. This means that only the motions, or excitations, of individual protons or protonic groups are discussed, ignoring collective excitations and interference. (HPOE) [de

  5. Diffusion limit of Lévy-Lorentz gas is Brownian motion

    Science.gov (United States)

    Magdziarz, Marcin; Szczotka, Wladyslaw

    2018-07-01

    In this paper we analyze asymptotic behaviour of a stochastic process called Lévy-Lorentz gas. This process is aspecial kind of continuous-time random walk in which walker moves in the fixed environment composed of scattering points. Upon each collision the walker performs a flight to the nearest scattering point. This type of dynamics is observed in Lévy glasses or long quenched polymers. We show that the diffusion limit of Lévy-Lorentz gas with finite mean distance between scattering centers is the standard Brownian motion. Thus, for long times the behaviour of the Lévy-Lorentz gas is close to the diffusive regime.

  6. Spectral long-range interaction of temporal incoherent solitons.

    Science.gov (United States)

    Xu, Gang; Garnier, Josselin; Picozzi, Antonio

    2014-02-01

    We study the interaction of temporal incoherent solitons sustained by a highly noninstantaneous (Raman-like) nonlinear response. The incoherent solitons exhibit a nonmutual interaction, which can be either attractive or repulsive depending on their relative initial distance. The analysis reveals that incoherent solitons exhibit a long-range interaction in frequency space, which is in contrast with the expected spectral short-range interaction described by the usual approach based on the Raman-like spectral gain curve. Both phenomena of anomalous interaction and spectral long-range behavior of incoherent solitons are described in detail by a long-range Vlasov equation.

  7. Modeling Incoherent Electron Cloud Effects

    International Nuclear Information System (INIS)

    Vay, Jean-Luc; Benedetto, E.; Fischer, W.; Franchetti, G.; Ohmi, K.; Schulte, D.; Sonnad, K.; Tomas, R.; Vay, J.-L.; Zimmermann, F.; Rumolo, G.; Pivi, M.; Raubenheimer, T.

    2007-01-01

    Incoherent electron effects could seriously limit the beam lifetime in proton or ion storage rings, such as LHC, SPS, or RHIC, or blow up the vertical emittance of positron beams, e.g., at the B factories or in linear-collider damping rings. Different approaches to modeling these effects each have their own merits and drawbacks. We describe several simulation codes which simplify the descriptions of the beam-electron interaction and of the accelerator structure in various different ways, and present results for a toy model of the SPS. In addition, we present evidence that for positron beams the interplay of incoherent electron-cloud effects and synchrotron radiation can lead to a significant increase in vertical equilibrium emittance. The magnitude of a few incoherent e+e- scattering processes is also estimated. Options for future code development are reviewed

  8. Novel type of chimera spiral waves arising from decoupling of a diffusible component

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Xiaodong; Yang, Tao; Liu, Yang; Zhao, Yuemin; Gao, Qingyu, E-mail: epstein@brandeis.edu, E-mail: gaoqy@cumt.edu.cn [College of Chemical Engineering, China University of Mining and Technology, Xuzhou 221008 (China); Epstein, Irving R., E-mail: epstein@brandeis.edu, E-mail: gaoqy@cumt.edu.cn [Department of Chemistry and Volen Center for Complex Systems, MS 015, Brandeis University, Waltham, Massachusetts 02454-9110 (United States)

    2014-07-14

    Spiral waves composed of coherent traveling waves surrounding a core containing stochastically distributed stationary areas are found in numerical simulations of a three-variable reaction-diffusion system with one diffusible species. In the spiral core, diffusion of this component (w) mediates transitions between dynamic states of the subsystem formed by the other two components, whose dynamics is more rapid than that of w. Diffusive coupling between adjacent sites can be “on” or “off” depending on the subsystem state. The incoherent structures in the spiral core are produced by this decoupling of the slow diffusive component from the fast non-diffusing subsystem. The phase diagram reveals that the region of incoherent behavior in chimera spirals grows drastically, leading to modulation and breakup of the spirals, in the transition zones between 1{sup n-1} and 1{sup n} local mixed-mode oscillations.

  9. Motion-robust diffusion tensor acquisition at routine 3T magnetic resonance imaging

    International Nuclear Information System (INIS)

    Yasmin, Hasina; Abe, Osamu; Masutani, Yoshitaka; Hayashi, Naoto; Ohtomo, Kuni; Kabasawa, Hiroyuki; Aoki, Shigeki

    2010-01-01

    We compared different acquisition and reconstruction methods in phantom and human studies in the clinical setting to validate our hypothesis that optimizing the k-space acquisition and reconstruction method could decrease motion artifacts. Diffusion tensor images of a water phantom were obtained with three table displacement magnitudes: 1 mm, 2 mm, and 3 mm. Images were reconstructed using homodyne and zero-fill reconstruction. Overscanning in 8- and 16-k y lines was tested. We performed visual assessment of the artifacts using reconstructed coronal images and analyzed them with Wilcoxon signed-ranks test both for phantom and human studies. Also, fractional anisotropy (FA) changes between acquisition methods were compared. Artifacts due to smaller displacement (1 and 2 mm) were significantly reduced in 16-k y overscan with zero filling. The Wilcoxon signed-ranks test showed significant differences (P<0.031 for reconstruction methods and P<0.016 for overscanning methods). FA changes were statistically significant (P<0.037; Student's t-test). The Wilcoxon signed-ranks test showed significant reductions (P<0.005) in the human study. Motion-induced artifacts can be reduced by optimizing acquisition and reconstruction methods. The techniques described in this study offer an effective method for robust estimation of diffusion tensor in the presence of motion-related artifactual data points. (author)

  10. Effect of spatial variability of ground motion on non-linear dynamic behavior of cable stayed bridges

    Directory of Open Access Journals (Sweden)

    Ouanani Mouloud

    2018-01-01

    Full Text Available This present paper summarizes the main results of incoherence of Spatial Variability of Ground Motion (SVGM component on the non-linear dynamic behavior of a Mila cable stayed bridge. The Hindy and Novack coherence model is developed for the present study in order to examine the SVGM on bridge responses, Nonlinear bridge responses are investigated in terms of transverse displacements and bending moments along the superstructure and substructure of the study bridge, as well as temporal variations of rotational ductility demands at the bridge piers ends under the incoherence SVGM component. The results are systematically compared with those obtained assuming uniform ground motion. As a general trend, it may be concluded that incoherence component of SVGM should be considered for the earthquake response assessments of cable-stayed bridges.

  11. Value of magnetic resonance imaging in diffuse liver diseases; Stellenwert der MRT bei diffusen Lebererkrankungen

    Energy Technology Data Exchange (ETDEWEB)

    Schramm, N.; D' Anastasi, M.; Reiser, M.F.; Zech, C.J. [Klinikum der Ludwig-Maximilians-Universitaet Muenchen, Campus Grosshadern, Institut fuer Klinische Radiologie, Muenchen (Germany)

    2012-08-15

    Diffuse liver diseases show an increasing prevalence. The diagnostic gold standard of liver biopsy has several disadvantages. There is a clinical demand for non-invasive imaging-based techniques to qualitatively and quantitatively evaluate the entire liver. Ultrasound, computed tomography (CT) and magnetic resonance imaging (MRI) are routinely used. Steatosis: chemical shift and frequency selective imaging, MR spectroscopy (MRS). Hemochromatosis: MR-based iron quantification. Fibrosis: MR elastography, diffusion, intravoxel incoherent motion (IVIM) and MR perfusion. T1-weighted in and opposed phase imaging is the clinically most frequently used MR technique to noninvasively detect and quantify steatosis. New methods for quantification that are not influenced by confounders like iron overload are under investigation. The most sensitive method to measure the fat content of the liver is MRS. As data acquisition and analysis remain complex and there is no whole organ coverage, MRS of the liver is not a routine method. With an optimized protocol incorporating T2* sequences, MRI is the modality of choice to quantify iron overload in hemochromatosis. Standard MR sequences cannot depict early stages of liver fibrosis. Advanced MR techniques (e.g. elastography, diffusion, IVIM and perfusion) for noninvasive assessment of liver fibrosis appear promising but their role has to be further investigated. (orig.) [German] Die Praevalenz diffuser Lebererkrankungen nimmt zu. Der klinische Goldstandard, die Leberbiopsie, hat zahlreiche Nachteile. Es besteht ein Bedarf an bildgebenden Verfahren zur nichtinvasiven qualitativen und quantitativen Beurteilung der gesamten Leber bei diesen Erkrankungen. Hier sind Ultraschall, CT und MRT zu nennen. Steatosis: Chemical-shift- und frequenzselektive Bildgebung, MR-Spektroskopie (MRS) zur Fettquantifizierung. Haemochromatose: MR-basierte Eisenquantifizierung. Fibrose: MR-Elastographie, Diffusion, ''intravoxel incoherent motion

  12. A generalized mean-squared displacement from inelastic fixed window scans of incoherent neutron scattering as a model-free indicator of anomalous diffusion confinement

    International Nuclear Information System (INIS)

    Roosen-Runge, F.; Seydel, T.

    2015-01-01

    Elastic fixed window scans of incoherent neutron scattering are an established and frequently employed method to study dynamical changes, usually over a broad temperature range or during a process such as a conformational change in the sample. In particular, the apparent mean-squared displacement can be extracted via a model-free analysis based on a solid physical interpretation as an effective amplitude of molecular motions. Here, we provide a new account of elastic and inelastic fixed window scans, defining a generalized mean-squared displacement for all fixed energy transfers. We show that this generalized mean-squared displacement in principle contains all information on the real mean-square displacement accessible in the instrumental time window. The derived formula provides a clear understanding of the effects of instrumental resolution on the apparent mean-squared displacement. Finally, we show that the generalized mean-square displacement can be used as a model-free indicator on confinement effects within the instrumental time window. (authors)

  13. Anomalous diffusion due to hindering by mobile obstacles undergoing Brownian motion or Orstein-Ulhenbeck processes.

    Science.gov (United States)

    Berry, Hugues; Chaté, Hugues

    2014-02-01

    In vivo measurements of the passive movements of biomolecules or vesicles in cells consistently report "anomalous diffusion," where mean-squared displacements scale as a power law of time with exponent αmovement hindrance by obstacles is often invoked. However, our understanding of how hindered diffusion leads to subdiffusion is based on diffusion amidst randomly located immobile obstacles. Here, we have used Monte Carlo simulations to investigate transient subdiffusion due to mobile obstacles with various modes of mobility. Our simulations confirm that the anomalous regimes rapidly disappear when the obstacles move by Brownian motion. By contrast, mobile obstacles with more confined displacements, e.g., Orstein-Ulhenbeck motion, are shown to preserve subdiffusive regimes. The mean-squared displacement of tracked protein displays convincing power laws with anomalous exponent α that varies with the density of Orstein-Ulhenbeck (OU) obstacles or the relaxation time scale of the OU process. In particular, some of the values we observed are significantly below the universal value predicted for immobile obstacles in two dimensions. Therefore, our results show that subdiffusion due to mobile obstacles with OU type of motion may account for the large variation range exhibited by experimental measurements in living cells and may explain that some experimental estimates are below the universal value predicted for immobile obstacles.

  14. Weak Ergodicity Breaking of Receptor Motion in Living Cells Stemming from Random Diffusivity

    Science.gov (United States)

    Manzo, Carlo; Torreno-Pina, Juan A.; Massignan, Pietro; Lapeyre, Gerald J.; Lewenstein, Maciej; Garcia Parajo, Maria F.

    2015-01-01

    Molecular transport in living systems regulates numerous processes underlying biological function. Although many cellular components exhibit anomalous diffusion, only recently has the subdiffusive motion been associated with nonergodic behavior. These findings have stimulated new questions for their implications in statistical mechanics and cell biology. Is nonergodicity a common strategy shared by living systems? Which physical mechanisms generate it? What are its implications for biological function? Here, we use single-particle tracking to demonstrate that the motion of dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN), a receptor with unique pathogen-recognition capabilities, reveals nonergodic subdiffusion on living-cell membranes In contrast to previous studies, this behavior is incompatible with transient immobilization, and, therefore, it cannot be interpreted according to continuous-time random-walk theory. We show that the receptor undergoes changes of diffusivity, consistent with the current view of the cell membrane as a highly dynamic and diverse environment. Simulations based on a model of an ordinary random walk in complex media quantitatively reproduce all our observations, pointing toward diffusion heterogeneity as the cause of DC-SIGN behavior. By studying different receptor mutants, we further correlate receptor motion to its molecular structure, thus establishing a strong link between nonergodicity and biological function. These results underscore the role of disorder in cell membranes and its connection with function regulation. Because of its generality, our approach offers a framework to interpret anomalous transport in other complex media where dynamic heterogeneity might play a major role, such as those found, e.g., in soft condensed matter, geology, and ecology.

  15. Correlation between intravoxel incoherent motion magnetic resonance imaging derived metrics and serum soluble CD40 ligand level in an embolic canine stroke model

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xiao Quan; Wu, Chen Jiang; Lu, Shan Shan; Gao, Qian Qian; Zu, Qing Quan; Liu, Xing Long; Shi, Hai Bin; Liu, Sheng [Dept. of Radiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing (China)

    2017-09-15

    To determine the relationship between intravoxel incoherent motion (IVIM) imaging derived quantitative metrics and serum soluble CD40 ligand (sCD40L) level in an embolic canine stroke model. A middle cerebral artery occlusion model was established in 24 beagle dogs. Experimental dogs were divided into low- and high-sCD40L group according to serum sCD40L level at 4.5 hours after establishing the model. IVIM imaging was scanned at 4.5 hours after model establishment using 10 b values ranging from 0 to 900 s/mm{sup 2}. Quantitative metrics diffusion coefficient (D), pseudodiffusion coefficient (D{sup *}), and perfusion fraction (f) of ischemic lesions were calculated. Quantitative metrics of ischemic lesions were normalized by contralateral hemisphere using the following formula: normalized D = D{sub stroke} / D{sub contralateral}. Differences in IVIM metrics between the low- and high-sCD40L groups were compared using t test. Pearson's correlation analyses were performed to determine the relationship between IVIM metrics and serum sCD40L level. The high-sCD40L group showed significantly lower f and normalized f values than the low-sCD40L group (f, p < 0.001; normalized f, p < 0.001). There was no significant difference in D{sup *}, normalized D{sup *}, D, or normalized D value between the two groups (All p > 0.05). Both f and normalized f values were negatively correlated with serum sCD40L level (f, r = −0.789, p < 0.001; normalized f, r = −0.823, p < 0.001). However, serum sCD40L level had no significant correlation with D{sup *}, normalized D{sup *}, D, or normalized D (All p > 0.05). The f value derived from IVIM imaging was negatively correlated with serum sCD40L level. f value might serve as a potential imaging biomarker to assess the formation of microvascular thrombosis in hyperacute period of ischemic stroke.

  16. Preliminary evaluation of the apparent diffusion coefficient of the kidney with a spiral IVIM sequence

    International Nuclear Information System (INIS)

    Tsuda, Kyo; Murakami, Takamichi; Sakurai, Kousuke

    1997-01-01

    We examined the usefulness of the spiral intravoxel incoherent motion (IVIM) sequence in measuring the apparent diffusion coefficient (ADC) of the kidneys. Five volunteers and five patients with chronic renal failure underwent diffusion-sensitive magnetic resonance imaging of the kidneys with the spiral IVIM sequence. The ADC values in patients with chronic renal failure were significantly lower than those in the renal cortex of volunteers. The mean value of ADC in patients with chronic renal failure was lower than that in volunteers, although there was no statistically significant difference. In volunteers, the ADC of the renal cortex was significantly higher than that of the renal medulla. The phantom study indicated that the accuracy of ADC depended on the signal to noise ratio. A spiral IVIM sequence with a high enough signal to noise ratio may be useful in evaluating renal function, especially that of the cortex. (author)

  17. Incidental experiences of affective coherence and incoherence influence persuasion.

    Science.gov (United States)

    Huntsinger, Jeffrey R

    2013-06-01

    When affective experiences are inconsistent with activated evaluative concepts, people experience what is called affective incoherence; when affective experiences are consistent with activated evaluative concepts, people experience affective coherence. The present research asked whether incidental feelings of affective coherence and incoherence would regulate persuasion. Experiences of affective coherence and incoherence were predicted and found to influence the processing of persuasive messages when evoked prior to receipt of such messages (Experiments 1 and 3), and to influence the confidence with which thoughts generated by persuasive messages were held when evoked after presentation of such messages (Experiments 2 and 3). These results extend research on affective coherence and incoherence by showing that they exert a broader impact on cognitive activity than originally assumed.

  18. Steady motion of skyrmions and domains walls under diffusive spin torques

    KAUST Repository

    Elías, Ricardo Gabriel

    2017-03-09

    We explore the role of the spin diffusion of conducting electrons in two-dimensional magnetic textures (domain walls and skyrmions) with spatial variation of the order of the spin precession length λex. The effect of diffusion reflects in four additional torques that are third order in spatial derivatives of magnetization and bilinear in λex and in the nonadiabatic parameter β′. In order to study the dynamics of the solitons when these diffusive torques are present, we derive the Thiele equation in the limit of steady motion and we compare the results with the nondiffusive limit. When considering a homogenous current these torques increase the longitudinal velocity of transverse domain walls of width Δ by a factor (λex/Δ)2(α/3), α being the magnetic damping constant. In the case of single skyrmions with core radius r0 these new contributions tend to increase the Magnus effect in an amount proportional to (λex/r0)2(1+2αβ′).

  19. Steady motion of skyrmions and domains walls under diffusive spin torques

    KAUST Repository

    Elí as, Ricardo Gabriel; Vidal-Silva, Nicolas; Manchon, Aurelien

    2017-01-01

    We explore the role of the spin diffusion of conducting electrons in two-dimensional magnetic textures (domain walls and skyrmions) with spatial variation of the order of the spin precession length λex. The effect of diffusion reflects in four additional torques that are third order in spatial derivatives of magnetization and bilinear in λex and in the nonadiabatic parameter β′. In order to study the dynamics of the solitons when these diffusive torques are present, we derive the Thiele equation in the limit of steady motion and we compare the results with the nondiffusive limit. When considering a homogenous current these torques increase the longitudinal velocity of transverse domain walls of width Δ by a factor (λex/Δ)2(α/3), α being the magnetic damping constant. In the case of single skyrmions with core radius r0 these new contributions tend to increase the Magnus effect in an amount proportional to (λex/r0)2(1+2αβ′).

  20. Acetylene diffusion in Na-Y zeolite

    Indian Academy of Sciences (India)

    ideal guest molecule to start with. Here we ... In that case the incoherent scattering law, Sinc(Q, ω), alone describes the dynamics. Q(=k−k0) is the .... The results of QENS measurements to study the diffusion of acetylene gas in zeolite. Na-Y at ...

  1. New developments in neutron scattering for the study of molecular systems: structure and diffusive motions

    International Nuclear Information System (INIS)

    Volino, F.

    1976-01-01

    After a short review of the main concepts concerning the neutron and its interaction with matter, the authors focus their attention on the study of molecular systems by means of neutron scattering. Instead of reviewing the subject yet again, they limit themselves to the new kind of work which can be done now, with the combined help of high flux reactors and novel instruments. As examples, a few experiments performed at the Institut Laue-Langevin in Grenoble are described: a neutron diffraction study of liquid acetonitrile using a powder diffractometer installed at the hot source; three high-resolution quasi-elastic studies of molecular motions - in an organic solid, (PAA), an organic liquid (C 3 H 6 ) and a liquid crystal (TBBA) - made by combining measurements with high and ultra-high energy resolution spectrometers installed at the cold source. The concept of elastic incoherent structure factor (EISF) is extensively used for the analysis. Finally some prospects on possible future developments are presented. (orig./HK) [de

  2. Pattern formation, social forces, and diffusion instability in games with success-driven motion

    Science.gov (United States)

    Helbing, Dirk

    2009-02-01

    A local agglomeration of cooperators can support the survival or spreading of cooperation, even when cooperation is predicted to die out according to the replicator equation, which is often used in evolutionary game theory to study the spreading and disappearance of strategies. In this paper, it is shown that success-driven motion can trigger such local agglomeration and may, therefore, be used to supplement other mechanisms supporting cooperation, like reputation or punishment. Success-driven motion is formulated here as a function of the game-theoretical payoffs. It can change the outcome and dynamics of spatial games dramatically, in particular as it causes attractive or repulsive interaction forces. These forces act when the spatial distributions of strategies are inhomogeneous. However, even when starting with homogeneous initial conditions, small perturbations can trigger large inhomogeneities by a pattern-formation instability, when certain conditions are fulfilled. Here, these instability conditions are studied for the prisoner’s dilemma and the snowdrift game. Furthermore, it is demonstrated that asymmetrical diffusion can drive social, economic, and biological systems into the unstable regime, if these would be stable without diffusion.

  3. Intravoxel incoherent motion MR imaging for breast lesions: comparison and correlation with pharmacokinetic evaluation from dynamic contrast-enhanced MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chunling; Liu, Zaiyi; Zhang, Jine; He, Hui; Zhang, Shuixing; Liang, Changhong [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, GuangZhou (China); Wang, Kun [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Breast Cancer, Cancer Center, GuangZhou (China); Chan, Queenie [Philips Healthcare, 6/F, Core Building 1, 1 Science Park East Avenue, Hong Kong Science Park, Shatin, New Territories, Hong Kong (China)

    2016-11-15

    To compare diagnostic performance for breast lesions by quantitative parameters derived from intravoxel incoherent motion (IVIM) and dynamic contrast-enhanced (DCE) magnetic resonance imaging (MRI) and to explore whether correlations exist between these parameters. IVIM and DCE MRI were performed on a 1.5-T MRI scanner in patients with suspicious breast lesions. Thirty-six breast cancers and 23 benign lesions were included in the study. Quantitative parameters from IVIM (D, f and D*) and DCE MRI (K{sup trans}, K{sub ep}, V{sub e} and V{sub p}) were calculated and compared between malignant and benign lesions. Spearman correlation test was used to evaluate correlations between them. D, f, D* from IVIM and K{sup trans}, K{sub ep}, V{sub p} from DCE MRI were statistically different between breast cancers and benign lesions (p < 0.05, respectively) and D demonstrated the largest area under the receiver-operating characteristic curve (AUC = 0.917) and had the highest specificity (83 %). The f value was moderately statistically correlated with V{sub p} (r = 0.692) and had a poor correlation with K{sup trans} (r = 0.456). IVIM MRI is useful in the differentiation of breast lesions. Significant correlations were found between perfusion-related parameters from IVIM and DCE MRI. IVIM may be a useful adjunctive tool to standard MRI in diagnosing breast cancer. (orig.)

  4. Biological growth in bodies with incoherent interfaces

    Science.gov (United States)

    Swain, Digendranath; Gupta, Anurag

    2018-01-01

    A general theory of thermodynamically consistent biomechanical-biochemical growth in a body, considering mass addition in the bulk and at an incoherent interface, is developed. The incoherency arises due to incompatibility of growth and elastic distortion tensors at the interface. The incoherent interface therefore acts as an additional source of internal stress besides allowing for rich growth kinematics. All the biochemicals in the model are essentially represented in terms of nutrient concentration fields, in the bulk and at the interface. A nutrient balance law is postulated which, combined with mechanical balances and kinetic laws, yields an initial-boundary-value problem coupling the evolution of bulk and interfacial growth, on the one hand, and the evolution of growth and nutrient concentration on the other. The problem is solved, and discussed in detail, for two distinct examples: annual ring formation during tree growth and healing of cutaneous wounds in animals.

  5. A fractional motion diffusion model for grading pediatric brain tumors.

    Science.gov (United States)

    Karaman, M Muge; Wang, He; Sui, Yi; Engelhard, Herbert H; Li, Yuhua; Zhou, Xiaohong Joe

    2016-01-01

    To demonstrate the feasibility of a novel fractional motion (FM) diffusion model for distinguishing low- versus high-grade pediatric brain tumors; and to investigate its possible advantage over apparent diffusion coefficient (ADC) and/or a previously reported continuous-time random-walk (CTRW) diffusion model. With approval from the institutional review board and written informed consents from the legal guardians of all participating patients, this study involved 70 children with histopathologically-proven brain tumors (30 low-grade and 40 high-grade). Multi- b -value diffusion images were acquired and analyzed using the FM, CTRW, and mono-exponential diffusion models. The FM parameters, D fm , φ , ψ (non-Gaussian diffusion statistical measures), and the CTRW parameters, D m , α , β (non-Gaussian temporal and spatial diffusion heterogeneity measures) were compared between the low- and high-grade tumor groups by using a Mann-Whitney-Wilcoxon U test. The performance of the FM model for differentiating between low- and high-grade tumors was evaluated and compared with that of the CTRW and the mono-exponential models using a receiver operating characteristic (ROC) analysis. The FM parameters were significantly lower ( p  < 0.0001) in the high-grade ( D fm : 0.81 ± 0.26, φ : 1.40 ± 0.10, ψ : 0.42 ± 0.11) than in the low-grade ( D fm : 1.52 ± 0.52, φ : 1.64 ± 0.13, ψ : 0.67 ± 0.13) tumor groups. The ROC analysis showed that the FM parameters offered better specificity (88% versus 73%), sensitivity (90% versus 82%), accuracy (88% versus 78%), and area under the curve (AUC, 93% versus 80%) in discriminating tumor malignancy compared to the conventional ADC. The performance of the FM model was similar to that of the CTRW model. Similar to the CTRW model, the FM model can improve differentiation between low- and high-grade pediatric brain tumors over ADC.

  6. Towards sub-{Angstrom} resolution through incoherent imaging

    Energy Technology Data Exchange (ETDEWEB)

    Pennycook, S.J.; Chisholm, M.F. [Oak Ridge National Lab., TN (United States); Nellist, P.D. [Cavendish Lab., Cambridge, (United Kingdom)

    1997-04-01

    As first pointed out by Lord Rayleigh a century ago, incoherent imaging offers a substantial resolution enhancement compared to coherent imaging, together with freedom from phase contrast interference effects and contrast oscillations. In the STEM configuration, with a high angle annular detector to provide the transverse incoherence, the image also shows strong Z-contrast, sufficient in the case of a 300 kV STEM to image single Pt and Rh atoms on a {gamma}-alumina support. The annular detector provides complementarity to a bright field detector of the same size. For weakly scattering specimens, it shows greater contrast than the incoherent bright field image, and also facilitates EELS analysis at atomic resolution, using the Z-contrast image to locate the probe with sub-{angstrom} precision. The inner radius of the annular detector can be chosen to reduce the transverse coherence length to well below the spacings needed to resolve the object, a significant advantage compared to light microscopy.

  7. The Diffusion Process in Small Particles and Brownian Motion

    Science.gov (United States)

    Khoshnevisan, M.

    Albert Einstein in 1926 published his book entitled ''INVESTIGATIONS ON THE THEORY OF THE BROWNIAN MOVEMENT''. He investigated the process of diffusion in an undissociated dilute solution. The diffusion process is subject to Brownian motion. Furthermore, he elucidated the fact that the heat content of a substance will change the position of the single molecules in an irregular fashion. In this paper, I have shown that in order for the displacement of the single molecules to be proportional to the square root of the time, and for v/2 - v 1 Δ =dv/dx , (where v1 and v2 are the concentrations in two cross sections that are separated by a very small distance), ∫ - ∞ ∞ Φ (Δ) dΔ = I and I/τ ∫ - ∞ ∞Δ2/2 Φ (Δ) dΔ = D conditions to hold, then equation (7a) D =√{ 2 D }√{ τ} must be changed to Δ =√{ 2 D }√{ τ} . I have concluded that D =√{ 2 D }√{ τ} is an unintended error, and it has not been amended for almost 90 years in INVESTIGATIONS ON THE THEORY OF THE BROWNIAN MOVEMENT, 1926 publication.

  8. Use of the temporal median and trimmed mean mitigates effects of respiratory motion in multiple-acquisition abdominal diffusion imaging

    International Nuclear Information System (INIS)

    Jerome, N P; Orton, M R; D’Arcy, J A; Leach, M O; Collins, D J; Feiweier, T; Tunariu, N; Koh, D-M

    2015-01-01

    Respiratory motion commonly confounds abdominal diffusion-weighted magnetic resonance imaging, where averaging of successive samples at different parts of the respiratory cycle, performed in the scanner, manifests the motion as blurring of tissue boundaries and structural features and can introduce bias into calculated diffusion metrics. Storing multiple averages separately allows processing using metrics other than the mean; in this prospective volunteer study, median and trimmed mean values of signal intensity for each voxel over repeated averages and diffusion-weighting directions are shown to give images with sharper tissue boundaries and structural features for moving tissues, while not compromising non-moving structures. Expert visual scoring of derived diffusion maps is significantly higher for the median than for the mean, with modest improvement from the trimmed mean. Diffusion metrics derived from mono- and bi-exponential diffusion models are comparable for non-moving structures, demonstrating a lack of introduced bias from using the median. The use of the median is a simple and computationally inexpensive alternative to complex and expensive registration algorithms, requiring only additional data storage (and no additional scanning time) while returning visually superior images that will facilitate the appropriate placement of regions-of-interest when analysing abdominal diffusion-weighted magnetic resonance images, for assessment of disease characteristics and treatment response. (note)

  9. Charge diffusion and the butterfly effect in striped holographic matter

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, Andrew [Department of Physics, Harvard University,Cambridge, MA 02138 (United States); Department of Physics, Stanford University,Stanford, CA 94305 (United States); Steinberg, Julia [Department of Physics, Harvard University,Cambridge, MA 02138 (United States)

    2016-10-26

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

  10. Charge diffusion and the butterfly effect in striped holographic matter

    International Nuclear Information System (INIS)

    Lucas, Andrew; Steinberg, Julia

    2016-01-01

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

  11. Discrimination of malignant versus benign mediastinal lymph nodes using diffusion MRI with an IVIM model

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Li-Ping [Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Peking University Cancer Hospital and Institute, Department of Radiology, Beijing (China); University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); Yan, Wan-Pu; Chen, Ke-Neng [Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Peking University Cancer Hospital and Institute, Department of Thoracic Oncosurgery, Beijing (China); Zhong, Zheng [University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Bioengineering, Chicago, IL (United States); Li, Xiao-Ting; Sun, Ying-Shi [Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Peking University Cancer Hospital and Institute, Department of Radiology, Beijing (China); Cai, Kejia [University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Bioengineering, Chicago, IL (United States); University of Illinois, Department of Radiology, Chicago, IL (United States); Zhou, Xiaohong Joe [University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Bioengineering, Chicago, IL (United States); University of Illinois, Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Neurosurgery, Chicago, IL (United States)

    2018-03-15

    To investigate the value of an intravoxel incoherent motion (IVIM) diffusion model for discriminating malignant versus benign mediastinal lymph nodes (MLN). Thirty-five subjects with enlarged MLN were scanned at 1.5 Tesla. Diffusion-weighted imaging was performed with eight b-values. IVIM parameters D, D*, and f, as well as apparent diffusion coefficient (ADC) from a mono-exponential model were obtained. 91 nodes (49 malignant and 42 benign) were analysed with pathologic (n=90) or radiologic (n=1) confirmations. Receiver operating characteristic (ROC) analysis was used to evaluate the diagnostic performance. The mean values of D, ADC, and f for the malignant group were significantly lower than those for the benign group (p<0.001), while D* showed no significant difference (p=0.281). In the ROC analysis, the combination of D and f produced the largest area under the curve (0.953) compared to ADC or other individual IVIM parameters, leading to the best specificity (92.9%) and diagnostic accuracy (90.1%). This study demonstrates that the combination of IVIM parameters can improve differentiation between malignant and benign MLN as compared to using ADC alone. (orig.)

  12. Rupture dynamics and ground motions from earthquakes in 2-D heterogeneous media

    KAUST Repository

    Bydlon, Samuel A.; Dunham, Eric M.

    2015-01-01

    become appreciable beyond ∼3km from the fault. Near-fault scattering extends the duration of incoherent, high-frequency ground motions and, at least in our 2-D simulations, elevates root-mean-square accelerations (i.e., Arias intensity) with negligible

  13. Diffusing diffusivity: Rotational diffusion in two and three dimensions

    Science.gov (United States)

    Jain, Rohit; Sebastian, K. L.

    2017-06-01

    We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

  14. Diffuse correlation tomography in the transport regime: A theoretical study of the sensitivity to Brownian motion

    Science.gov (United States)

    Tricoli, Ugo; Macdonald, Callum M.; Durduran, Turgut; Da Silva, Anabela; Markel, Vadim A.

    2018-02-01

    Diffuse correlation tomography (DCT) uses the electric-field temporal autocorrelation function to measure the mean-square displacement of light-scattering particles in a turbid medium over a given exposure time. The movement of blood particles is here estimated through a Brownian-motion-like model in contrast to ordered motion as in blood flow. The sensitivity kernel relating the measurable field correlation function to the mean-square displacement of the particles can be derived by applying a perturbative analysis to the correlation transport equation (CTE). We derive an analytical expression for the CTE sensitivity kernel in terms of the Green's function of the radiative transport equation, which describes the propagation of the intensity. We then evaluate the kernel numerically. The simulations demonstrate that, in the transport regime, the sensitivity kernel provides sharper spatial information about the medium as compared with the correlation diffusion approximation. Also, the use of the CTE allows one to explore some additional degrees of freedom in the data such as the collimation direction of sources and detectors. Our results can be used to improve the spatial resolution of DCT, in particular, with applications to blood flow imaging in regions where the Brownian motion is dominant.

  15. Motion of channeling particles in a bent crystal

    International Nuclear Information System (INIS)

    Avakian, A.R.; Harutyunian, A.S.; Hovanessian, A.G.; Shahinian, S.M.; Yang, C.

    1990-01-01

    The motion of high-energy charged particles in a bent crystal is investigated in the approximation of the model of continuous potential of crystallographic planes and with account of incoherent scattering on the atoms of media. Angular distribution of charged particle beams is investigated at the exit of the bent region of the crystal in dependence with the maximum deflection angle and energy of particles. The dependence of the fraction of channeling particles on crystal thickness, crystal curvature and particle energy is found in a simple model approximation. The influence of crystal curvature on incoherent scattering of particles in the crystal is analyzed. The concept of an optimal thickness for the maximum number of particles deflected at a given angle is considered. 8 refs.; 8 figs

  16. Optical image encryption method based on incoherent imaging and polarized light encoding

    Science.gov (United States)

    Wang, Q.; Xiong, D.; Alfalou, A.; Brosseau, C.

    2018-05-01

    We propose an incoherent encoding system for image encryption based on a polarized encoding method combined with an incoherent imaging. Incoherent imaging is the core component of this proposal, in which the incoherent point-spread function (PSF) of the imaging system serves as the main key to encode the input intensity distribution thanks to a convolution operation. An array of retarders and polarizers is placed on the input plane of the imaging structure to encrypt the polarized state of light based on Mueller polarization calculus. The proposal makes full use of randomness of polarization parameters and incoherent PSF so that a multidimensional key space is generated to deal with illegal attacks. Mueller polarization calculus and incoherent illumination of imaging structure ensure that only intensity information is manipulated. Another key advantage is that complicated processing and recording related to a complex-valued signal are avoided. The encoded information is just an intensity distribution, which is advantageous for data storage and transition because information expansion accompanying conventional encryption methods is also avoided. The decryption procedure can be performed digitally or using optoelectronic devices. Numerical simulation tests demonstrate the validity of the proposed scheme.

  17. Hepatocellular carcinoma: IVIM diffusion quantification for prediction of tumor necrosis compared to enhancement ratios

    International Nuclear Information System (INIS)

    Kakite, Suguru; Dyvorne, Hadrien A.; Lee, Karen M.; Jajamovich, Guido H.; Knight-Greenfield, Ashley; Taouli, Bachir

    2015-01-01

    To correlate intra voxel incoherent motion (IVIM) diffusion parameters of liver parenchyma and hepatocellular carcinoma (HCC) with degree of liver/tumor enhancement and necrosis; and to assess the diagnostic performance of diffusion parameters vs. enhancement ratios (ER) for prediction of complete tumor necrosis. In this IRB approved HIPAA compliant study, we included 46 patients with HCC who underwent IVIM diffusion-weighted (DW) MRI in addition to routine sequences at 3.0 T. True diffusion coefficient (D), pseudo-diffusion coefficient (D*), perfusion fraction (PF) and apparent diffusion coefficient (ADC) were quantified in tumors and liver parenchyma. Tumor ER were calculated using contrast-enhanced imaging, and degree of tumor necrosis was assessed using post-contrast image subtraction. IVIM parameters and ER were compared between HCC and background liver and between necrotic and viable tumor components. ROC analysis for prediction of complete tumor necrosis was performed. 79 HCCs were assessed (mean size 2.5 cm). D, PF and ADC were significantly higher in HCC vs. liver (p < 0.0001). There were weak significant negative/positive correlations between D/PF and ER, and significant correlations between D/PF/ADC and tumor necrosis (for D, r 0.452, p < 0.001). Among diffusion parameters, D had the highest area under the curve (AUC 0.811) for predicting complete tumor necrosis. ER outperformed diffusion parameters for prediction of complete tumor necrosis (AUC > 0.95, p < 0.002). D has a reasonable diagnostic performance for predicting complete tumor necrosis, however lower than that of contrast-enhanced imaging

  18. Correlation between intravoxel incoherent motion MR parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome: A pilot study

    International Nuclear Information System (INIS)

    Chu, Chen; Zhou, Nan; Zhang, Huayong; Dou, Xin; Li, Ming; Liu, Song; Zhu, Yun; Chen, Weibo; Chan, Queenie; He, Jian; Sun, Lingyun; Zhou, Zhengyang

    2017-01-01

    Highlights: • Parotid glands at grade 0–3 had significant values from those in healthy glands. • Parotid D and f values were correlated with MR nodule grade significantly. • There were significant differences of D, f, and D * values among glands at grade 0–3. - Abstract: Purpose: To explore the correlation between intravoxel incoherent motion (IVIM) magnetic resonance (MR) parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome (SS). Materials and methods: A total of 31 consecutive patients with SS and 28 gender- and age-matched healthy volunteers underwent bilateral parotid 3.0T MR examination including the IVIM sequence (9 b values, 0–800 s/mm 2 ). The apparent diffusion coefficient (ADC), diffusion coefficient D, pseudo-diffusion coefficient D * , and perfusion fraction f of bilateral parotid glands were obtained, and the nodular grade of each parotid gland was evaluated according to the MR morphological appearance. Results: Sixty-two parotid glands in 31 patients with SS consisted of 32, 14, 8, and 8 parotid glands at MR nodular grades 0, 1, 2, and 3, respectively. In parotid glands of grade 0, 1, 2, 3 and healthy volunteers, the ADC values were (1.13 ± 0.25, 1.11 ± 0.17, 1.05 ± 0.24, 0.89 ± 0.04 and 1.00 ± 0.21) × 10 −3 mm 2 /s, D values were (0.92 ± 0.13, 0.90 ± 0.19, 0.90 ± 0.03, 0.67 ± 0.03, 0.81 ± 0.03) × 10 −3 mm 2 /s, f values were 0.20 ± 0.04, 0.18 ± 0.02, 0.15 ± 0.01, 0.11 ± 0.01, 0.15 ± 0.06, and D * values were (53.89 ± 28.26, 41.78 ± 16.35, 51.24 ± 18.69, 31.83 ± 18.03, 36.83 ± 16.14) × 10 −3 mm 2 /s respectively. The ADC, D, f, and D * values of parotid glands in patients with SS at grade 0 were significantly higher than those in healthy volunteers (all P < 0.05). Significant differences were observed in the D and f values of parotid glands in patients with SS among different grades (P = 0.003, < 0.001, respectively). The IVIM parameters (D, f) of parotid glands at early

  19. Correlation between intravoxel incoherent motion MR parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome: A pilot study

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Chen, E-mail: chuchen19920905@163.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhou, Nan, E-mail: snscorpion@163.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhang, Huayong, E-mail: 13770560567@163.com [Department of Rheumatology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Dou, Xin, E-mail: douxin125@126.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Li, Ming, E-mail: lm069393@163.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Liu, Song, E-mail: liusongnj@126.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhu, Yun, E-mail: qqt111@hotmail.com [Department of Rheumatology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Chen, Weibo, E-mail: Weibo.Chen@philips.com [Philips Healthcare, Shanghai, 200233 (China); Chan, Queenie, E-mail: queenie.chan@philips.com [Philips Healthcare, Hong Kong (China); He, Jian, E-mail: hjxueren@126.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Sun, Lingyun, E-mail: lysun_nju@163.com [Department of Rheumatology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhou, Zhengyang, E-mail: zyzhou@nju.edu.cn [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China)

    2017-01-15

    Highlights: • Parotid glands at grade 0–3 had significant values from those in healthy glands. • Parotid D and f values were correlated with MR nodule grade significantly. • There were significant differences of D, f, and D{sup *} values among glands at grade 0–3. - Abstract: Purpose: To explore the correlation between intravoxel incoherent motion (IVIM) magnetic resonance (MR) parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome (SS). Materials and methods: A total of 31 consecutive patients with SS and 28 gender- and age-matched healthy volunteers underwent bilateral parotid 3.0T MR examination including the IVIM sequence (9 b values, 0–800 s/mm{sup 2}). The apparent diffusion coefficient (ADC), diffusion coefficient D, pseudo-diffusion coefficient D{sup *}, and perfusion fraction f of bilateral parotid glands were obtained, and the nodular grade of each parotid gland was evaluated according to the MR morphological appearance. Results: Sixty-two parotid glands in 31 patients with SS consisted of 32, 14, 8, and 8 parotid glands at MR nodular grades 0, 1, 2, and 3, respectively. In parotid glands of grade 0, 1, 2, 3 and healthy volunteers, the ADC values were (1.13 ± 0.25, 1.11 ± 0.17, 1.05 ± 0.24, 0.89 ± 0.04 and 1.00 ± 0.21) × 10{sup −3} mm{sup 2}/s, D values were (0.92 ± 0.13, 0.90 ± 0.19, 0.90 ± 0.03, 0.67 ± 0.03, 0.81 ± 0.03) × 10{sup −3} mm{sup 2}/s, f values were 0.20 ± 0.04, 0.18 ± 0.02, 0.15 ± 0.01, 0.11 ± 0.01, 0.15 ± 0.06, and D{sup *}values were (53.89 ± 28.26, 41.78 ± 16.35, 51.24 ± 18.69, 31.83 ± 18.03, 36.83 ± 16.14) × 10{sup −3} mm{sup 2}/s respectively. The ADC, D, f, and D{sup *} values of parotid glands in patients with SS at grade 0 were significantly higher than those in healthy volunteers (all P < 0.05). Significant differences were observed in the D and f values of parotid glands in patients with SS among different grades (P = 0.003, < 0.001, respectively). The IVIM

  20. Optical bistability via quantum interference from incoherent pumping and spontaneous emission

    International Nuclear Information System (INIS)

    Sahrai, M.; Asadpour, S.H.; Sadighi-Bonabi, R.

    2011-01-01

    We theoretically investigate the optical bistability (OB) in a V-type three-level atomic system confined in a unidirectional ring cavity via incoherent pumping field. It is shown that the threshold of optical bistability can be controlled by the rate of an incoherent pumping field and by interference mechanism arising from the spontaneous emission and incoherent pumping field. We demonstrate that the optical bistability converts to optical multi-stability (OM) by the quantum interference mechanism. - Highlights: → We modulate the optical bistability (OB) in a four-level N-type atomic system. → The threshold of optical bistability can be controlled by the quantum interferences. → OB converts to optical multi-stability (OM) by the quantum interferences. → We discuss the effect of an incoherent pumping field on reduction of OB threshold.

  1. Diffusion of chlorine in single-crystal (Sr,Y)Cl2.03

    International Nuclear Information System (INIS)

    Goff, J.P.; Hayes, W.; Ward, R.C.C; Hull, S.; Hutchings, M.T.

    1992-01-01

    Quasielastic energy broadening of the incoherent neutron scattering from single-crystal (Sr,Y)Cl 2.03 has been studied at elevated temperatures using the time-of-flight spectrometer IRIS at the Rutherford-Appleton Laboratory. Incoherent spectra measured at temperatures of 923 and 973 K have been fitted by a Chudley-Elliott model, in which individual anions occupy sites for a mean residence time τ before hopping to adjacent regular lattice sites. These results obtained from an anion-excess system are compared with a previous investigation of chlorine diffusion in pure SrCl 2 . (orig.)

  2. Differentiation of prostate cancer lesions with high and with low Gleason score by diffusion-weighted MRI

    Energy Technology Data Exchange (ETDEWEB)

    Barbieri, Sebastiano; Broennimann, Michael; Vermathen, Peter; Thoeny, Harriet C. [Inselspital University Hospital, Institute of Diagnostic, Pediatric, and Interventional Radiology, Bern (Switzerland); Boxler, Silvan [Inselspital, Inselspital University Hospital, Department of Urology, Bern (Switzerland)

    2017-04-15

    To differentiate prostate cancer lesions with high and with low Gleason score by diffusion-weighted-MRI (DW-MRI). This prospective study was approved by the responsible ethics committee. DW-MRI of 84 consenting prostate and/or bladder cancer patients scheduled for radical prostatectomy were acquired and used to compute apparent diffusion coefficient (ADC), intravoxel incoherent motion (IVIM: the pure diffusion coefficient D{sub t}, the pseudo-diffusion fraction F{sub p} and the pseudo-diffusion coefficient D{sub p}), and high b value (as acquired and Hessian filtered) parameters within the index lesion. These parameters (separately and combined in a logistic regression model) were used to differentiate lesions depending on whether whole-prostate histopathological analysis after prostatectomy determined a high (≥7) or low (6) Gleason score. Mean ADC and D{sub t} differed significantly (p of independent two-sample t test < 0.01) between high- and low-grade lesions. The highest classification accuracy was achieved by the mean ADC (AUC 0.74) and D{sub t} (AUC 0.70). A logistic regression model based on mean ADC, mean F{sub p} and mean high b value image led to an AUC of 0.74 following leave-one-out cross-validation. Classification by IVIM parameters was not superior to classification by ADC. DW-MRI parameters correlated with Gleason score but did not provide sufficient information to classify individual patients. (orig.)

  3. Acoustic Holography With Incoherent Sources

    NARCIS (Netherlands)

    Druyvesteyn, W.F.; Raangs, R.

    2005-01-01

    In near field acoustic holography the sound field is scanned near the surface of the vibrating object; from these measurements the vibration of the structure can be calculated. In the case of correlated sources one reference signal is sufficient. When incoherent sources are present the separation of

  4. Annealing characteristics of SiO2-Si structures after incoherent light pulse processing

    International Nuclear Information System (INIS)

    Sieber, N.; Klabes, R.; Voelskow, M.; Fenske, F.

    1982-01-01

    The behaviour of oxide charges and interface charges in boron implanted and non-implanted SiO 2 -Si structures as well as the electrical activation of the dopants by the action of incoherent light pulses was studied. Depth profiles of electrically active boron ions are presented for different annealing conditions as measured by the pulsed C-V method. It can be concluded that exposure of MOS structures to intense radiation of flash lamps does not increase the fixed charge and the fast state density at the SiO 2 -Si interface if optimal annealing conditions (energy densities) are employed. Low dose boron implanted silicon can be electrically activated without diffusion or segregation of dopants

  5. Incoherent transport for phases that spontaneously break translations

    Science.gov (United States)

    Donos, Aristomenis; Gauntlett, Jerome P.; Griffin, Tom; Ziogas, Vaios

    2018-04-01

    We consider phases of matter at finite charge density which spontaneously break spatial translations. Without taking a hydrodynamic limit we identify a boost invariant incoherent current operator. We also derive expressions for the small frequency behaviour of the thermoelectric conductivities generalising those that have been derived in a translationally invariant context. Within holographic constructions we show that the DC conductivity for the incoherent current can be obtained from a solution to a Stokes flow for an auxiliary fluid on the black hole horizon combined with specific thermodynamic quantities associated with the equilibrium black hole solutions.

  6. Single-shot self-interference incoherent digital holography using off-axis configuration.

    Science.gov (United States)

    Hong, Jisoo; Kim, Myung K

    2013-12-01

    We propose a single-shot incoherent holographic imaging technique that adopts self-interference incoherent digital holography (SIDH) with slight tilt of the plane mirror in the optical configuration. The limited temporal coherence length of the illumination leads the guide-star hologram of the proposed system to have a Gaussian envelope of elliptical ring shape. The observation shows that the reconstruction by cross correlation with the guide-star hologram achieves better quality than the usual propagation methods. Experimentally, we verify that the hologram and 3D reconstruction can be implemented incoherently with the proposed single-shot off-axis SIDH.

  7. Diffusion-weighted imaging of the pancreas; Diffusionsbildgebung des Pankreas

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, K. [Deutsches Krebsforschungszentrum (DKFZ) Heidelberg, Abteilung Radiologie, E010, Heidelberg (Germany); Grenacher, L.; Klauss, M. [Universitaetsklinikum Heidelberg, Abt. Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)

    2011-03-15

    Diffusion-weighted imaging (DWI) has increasingly gained in importance over the last 10 years especially in cancer imaging for differentiation of malignant and benign lesions. Through development of fast magnetic resonance imaging (MRI) sequences DWI is not only applicable in neuroradiology but also in abdominal imaging. As a diagnostic tool of the pancreas DWI enables a differentiation between normal tissue, cancer and chronic pancreatitis. The ADC values (apparent diffusion coefficient, the so-called effective diffusion coefficient) reported in the literature for healthy pancreatic tissue are in the range from 1.49 to 1.9 x 10{sup -3} mm{sup 2}/s, for pancreatic cancer in the range from 1.24 to 1.46 x 10{sup -3} mm{sup 2}/s and for autoimmune pancreatitis an average ADC value of 1.012 x 10{sup -3} mm{sup 2}/s. There are controversial data in the literature concerning the differentiation between chronic pancreatitis and pancreatic cancer. Using DWI-derived IVIM (intravoxel incoherent motion) the parameter f (perfusion fraction) seems to be advantageous but it is important to use several b values. In the literature the mean f value in chronic pancreatitis is around 16%, in pancreatic cancer 8% and in healthy pancreatic tissue around 25%. So far, DWI has not been helpful for differentiating cystic lesions of the pancreas. There are many references with other tumor entities and in animal models which indicate that there is a possible benefit of DWI in monitoring therapy of pancreatic cancer but so far no original work has been published. (orig.) [German] Die Diffusionsbildgebung (''diffusion-weighted imaging'', DWI) gewann in den letzten 10 Jahren insbesondere in der Tumorbildgebung zur Unterscheidung zwischen malignen und benignen Laesionen zunehmend an Bedeutung. Durch Entwicklung schnellerer MR-Sequenzen ist sie nicht nur in der Neuroradiologie, sondern auch in der Abdomenbildgebung einsetzbar. In der Pankreasdiagnostik ermoeglicht sie

  8. Simultaneous assessment of cerebral blood volume and diffusion heterogeneity using hybrid IVIM and DK MR imaging: initial experience with brain tumors

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Wen-Chau [National Taiwan University, Graduate Institute of Oncology, Taipei (China); National Taiwan University, Graduate Institute of Clinical Medicine, Taipei (China); National Taiwan University, Graduate Institute of Biomedical Electronics and Bioinformatics, Taipei (China); National Taiwan University Hospital, Department of Medical Imaging, Taipei (China); Yang, Shun-Chung; Chen, Ya-Fang; My, Pei-Chi [National Taiwan University Hospital, Department of Medical Imaging, Taipei (China); Tseng, Han-Min [National Taiwan University Hospital, Department of Neurology, Taipei (China)

    2017-01-15

    To investigate the feasibility of simultaneously assessing cerebral blood volume and diffusion heterogeneity using hybrid diffusion-kurtosis (DK) and intravoxel-incoherent-motion (IVIM) MR imaging. Fifteen healthy volunteers and 30 patients with histologically proven brain tumours (25 WHO grade II-IV gliomas and five metastases) were recruited. On a 3-T system, diffusion-weighted imaging was performed with six b-values ranging from 0 to 1,700 s/mm{sup 2}. Nonlinear least-squares fitting was employed to extract diffusion coefficient (D), diffusion kurtosis coefficient (K, a measure of the degree of non-Gaussian and heterogeneous diffusion) and intravascular volume fraction (f, a measure proportional to cerebral blood volume). Repeated-measures multivariate analysis of variance and receiver operating characteristic analysis were performed to assess the ability of D/K/f in differentiating contrast-enhanced tumour from peritumoral oedema and normal-appearing white matter. Based on our imaging setting (baseline signal-to-noise ratio = 32-128), coefficient of variation was 14-20 % for K, ∝6 % for D and 26-44 % for f. The indexes were able to differentiate contrast-enhanced tumour (Wilks' λ = 0.026, p < 10{sup -3}), and performance was greatest with K, followed by f and D. Hybrid DK IVIM imaging is capable of simultaneously measuring cerebral perfusion and diffusion indexes that together may improve brain tumour diagnosis. (orig.)

  9. Quasi-elastic neutron scattering studies of the diffusion of hydrogen in metals

    Energy Technology Data Exchange (ETDEWEB)

    Ross, D K [Birmingham Univ. (UK). School of Physics and Space Research

    1989-01-01

    Quasi-elastic neutron scattering provides a uniquely detailed way of investigating microscopic models for diffusion in lattice gases. In the present paper we discuss extensions of the original Chudley-Elliott model to cover systems containing high concentrations of interacting particles for both the incoherent and coherent cases. In the former case, the peak width is changed by site blocking and by interactions and its shape is altered by correlation effects between successive jumps. In the coherent case, although interactions introduce different correlation effects, the most important changes are due to the short-range order caused by the interactions. A simple Mean Field theory is described which predicts peak narrowing where the diffuse scattering is at a maximum. Experimental tests of both coherent and incoherent theories are described for the case of {alpha}'NbD{sub x}. (orig.).

  10. Quasi-elastic neutron scattering studies of the diffusion of hydrogen in metals

    International Nuclear Information System (INIS)

    Ross, D.K.

    1989-01-01

    Quasi-elastic neutron scattering provides a uniquely detailed way of investigating microscopic models for diffusion in lattice gases. In the present paper we discuss extensions of the original Chudley-Elliott model to cover systems containing high concentrations of interacting particles for both the incoherent and coherent cases. In the former case, the peak width is changed by site blocking and by interactions and its shape is altered by correlation effects between successive jumps. In the coherent case, although interactions introduce different correlation effects, the most important changes are due to the short-range order caused by the interactions. A simple Mean Field theory is described which predicts peak narrowing where the diffuse scattering is at a maximum. Experimental tests of both coherent and incoherent theories are described for the case of α'NbD x . (orig.)

  11. Interplay between total thickness and period thickness in the phonon thermal conductivity of superlattices from the nanoscale to the microscale: Coherent versus incoherent phonon transport

    Science.gov (United States)

    Cheaito, Ramez; Polanco, Carlos A.; Addamane, Sadhvikas; Zhang, Jingjie; Ghosh, Avik W.; Balakrishnan, Ganesh; Hopkins, Patrick E.

    2018-02-01

    We report on the room temperature thermal conductivity of AlAs-GaAs superlattices (SLs), in which we systematically vary the period thickness and total thickness between 2 -24 nm and 20.1 -2 ,160 nm , respectively. The thermal conductivity increases with the SL thickness and plateaus at a thickness around 200 nm, showing a clear transition from a quasiballistic to a diffusive phonon transport regime. These results demonstrate the existence of classical size effects in SLs, even at the highest interface density samples. We use harmonic atomistic Green's function calculations to capture incoherence in phonon transport by averaging the calculated transmission over several purely coherent simulations of independent SL with different random mixing at the AlAs-GaAs interfaces. These simulations demonstrate the significant contribution of incoherent phonon transport through the decrease in the transmission and conductance in the SLs as the number of interfaces increases. In spite of this conductance decrease, our simulations show a quasilinear increase in thermal conductivity with the superlattice thickness. This suggests that the observation of a quasilinear increase in thermal conductivity can have important contributions from incoherent phonon transport. Furthermore, this seemingly linear slope in thermal conductivity versus SL thickness data may actually be nonlinear when extended to a larger number of periods, which is a signature of incoherent effects. Indeed, this trend for superlattices with interatomic mixing at the interfaces could easily be interpreted as linear when the number of periods is small. Our results reveal that the change in thermal conductivity with period thickness is dominated by incoherent (particlelike) phonons, whose properties are not dictated by changes in the AlAs or GaAs phonon dispersion relations. This work demonstrates the importance of studying both period and sample thickness dependencies of thermal conductivity to understand the

  12. Intramolecular diffusive motion in alkane monolayers studied by high-resolution quasielastic neutron scattering and molecular dynamics simulations

    DEFF Research Database (Denmark)

    Hansen, Flemming Yssing; Criswell, L.; Fuhrmann, D

    2004-01-01

    Molecular dynamics simulations of a tetracosane (n-C24H50) monolayer adsorbed on a graphite basal-plane surface show that there are diffusive motions associated with the creation and annihilation of gauche defects occurring on a time scale of similar to0.1-4 ns. We present evidence...... that these relatively slow motions are observable by high-energy-resolution quasielastic neutron scattering (QNS) thus demonstrating QNS as a technique, complementary to nuclear magnetic resonance, for studying conformational dynamics on a nanosecond time scale in molecular monolayers....

  13. On the enhancement of Er{sup 3+} diffusion in LiNbO{sub 3} crystals by Er{sup 3+}/Ti{sup 4+} co-diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, José Manuel Marques Martins de, E-mail: jmmma@utad.pt [INESC-TEC, Rua do Campo Alegre, 687, Porto 4169-007 (Portugal); Department of Physics, School of Science and Technology, University of Trás-os-Montes e Alto Douro, PO. Box 1013, 5001-801 Vila Real (Portugal); Sada, Cinzia [Dipartimento di Fisica e Astronomia G. Galilei, Università di Padova, Via Marzolo 8, 35131 Padova (Italy)

    2016-02-15

    Highlights: • Enhancement of the diffusion of erbium ions (Er{sup 3+}) in lithium niobate crystals. • Incoherence on published results lead to need for systematic revision of literature. • Further insight into the topic of co-diffusion of Er{sup 3+}/Ti{sup 4+} ions into LiNbO{sub 3}. - Abstract: After carrying out a revision of the literature on the enhancement of Er{sup 3+} diffusion in LiNbO{sub 3} crystals by Er{sup 3+}/Ti{sup 4+} co-diffusion and analyzing our own experimental results, we conclude that no reproducible results were reported, meaning that further research on this subject is necessary.

  14. Modeling persistence of motion in a crowded environment: The diffusive limit of excluding velocity-jump processes

    Science.gov (United States)

    Gavagnin, Enrico; Yates, Christian A.

    2018-03-01

    Persistence of motion is the tendency of an object to maintain motion in a direction for short time scales without necessarily being biased in any direction in the long term. One of the most appropriate mathematical tools to study this behavior is an agent-based velocity-jump process. In the absence of agent-agent interaction, the mean-field continuum limit of the agent-based model (ABM) gives rise to the well known hyperbolic telegraph equation. When agent-agent interaction is included in the ABM, a strictly advective system of partial differential equations (PDEs) can be derived at the population level. However, no diffusive limit of the ABM has been obtained from such a model. Connecting the microscopic behavior of the ABM to a diffusive macroscopic description is desirable, since it allows the exploration of a wider range of scenarios and establishes a direct connection with commonly used statistical tools of movement analysis. In order to connect the ABM at the population level to a diffusive PDE at the population level, we consider a generalization of the agent-based velocity-jump process on a two-dimensional lattice with three forms of agent interaction. This generalization allows us to take a diffusive limit and obtain a faithful population-level description. We investigate the properties of the model at both the individual and population levels and we elucidate some of the models' key characteristic features. In particular, we show an intrinsic anisotropy inherent to the models and we find evidence of a spontaneous form of aggregation at both the micro- and macroscales.

  15. New diffusion imaging method with a single acquisition sequence

    International Nuclear Information System (INIS)

    Melki, Ph.S.; Bittoun, J.; Lefevre, J.E.

    1987-01-01

    The apparent diffusion coefficient (ADC) is related to the molecular diffusion coefficient and to physiologic information: microcirculation in the capillary network, incoherent slow flow, and restricted diffusion. The authors present a new MR imaging sequence that yields computed ADC images in only one acquisition of 9-minutes with a 1.5-T imager (GE Signa). Compared to the previous method, this sequence is at least two times faster and thus can be used as a routine examination to supplement T1-, T2-, and density-weighted images. The method was assessed by measurement of the molecular diffusion in liquids, and the first clinical images obtained in neurologic diseases demonstrate its efficiency for clinical investigation. The possibility of separately imaging diffusion and perfusion is supported by an algorithm

  16. Understanding quantum tunneling using diffusion Monte Carlo simulations

    Science.gov (United States)

    Inack, E. M.; Giudici, G.; Parolini, T.; Santoro, G.; Pilati, S.

    2018-03-01

    In simple ferromagnetic quantum Ising models characterized by an effective double-well energy landscape the characteristic tunneling time of path-integral Monte Carlo (PIMC) simulations has been shown to scale as the incoherent quantum-tunneling time, i.e., as 1 /Δ2 , where Δ is the tunneling gap. Since incoherent quantum tunneling is employed by quantum annealers (QAs) to solve optimization problems, this result suggests that there is no quantum advantage in using QAs with respect to quantum Monte Carlo (QMC) simulations. A counterexample is the recently introduced shamrock model (Andriyash and Amin, arXiv:1703.09277), where topological obstructions cause an exponential slowdown of the PIMC tunneling dynamics with respect to incoherent quantum tunneling, leaving open the possibility for potential quantum speedup, even for stoquastic models. In this work we investigate the tunneling time of projective QMC simulations based on the diffusion Monte Carlo (DMC) algorithm without guiding functions, showing that it scales as 1 /Δ , i.e., even more favorably than the incoherent quantum-tunneling time, both in a simple ferromagnetic system and in the more challenging shamrock model. However, a careful comparison between the DMC ground-state energies and the exact solution available for the transverse-field Ising chain indicates an exponential scaling of the computational cost required to keep a fixed relative error as the system size increases.

  17. Coherent and incoherent (μ-, e-) conversion in nuclei

    International Nuclear Information System (INIS)

    Chiang, H.C.; Oset, E.; Kosmas, T.S.; Faessler, A.; Vergados, J.D.

    1993-01-01

    Coherent and incoherent (μ - , e - ) conversion in nuclei is studied within the framework of several theories which violate flavour lepton number. A useful approach is followed which allows a factorization of the conversion widths into nuclear factors and other factors which depend only on the elementary process. The nuclear factors are evaluated in a wide range of nuclei allowing simple calculations of the conversion rates throughout the periodic table for a given theory with a minimum of work in the elementary sector. The coherent conversion is found to dominate the process. The results obtained modify appreciable previous results in the literature, particularly in the incoherent process. (orig.)

  18. A robust post-processing workflow for datasets with motion artifacts in diffusion kurtosis imaging.

    Science.gov (United States)

    Li, Xianjun; Yang, Jian; Gao, Jie; Luo, Xue; Zhou, Zhenyu; Hu, Yajie; Wu, Ed X; Wan, Mingxi

    2014-01-01

    The aim of this study was to develop a robust post-processing workflow for motion-corrupted datasets in diffusion kurtosis imaging (DKI). The proposed workflow consisted of brain extraction, rigid registration, distortion correction, artifacts rejection, spatial smoothing and tensor estimation. Rigid registration was utilized to correct misalignments. Motion artifacts were rejected by using local Pearson correlation coefficient (LPCC). The performance of LPCC in characterizing relative differences between artifacts and artifact-free images was compared with that of the conventional correlation coefficient in 10 randomly selected DKI datasets. The influence of rejected artifacts with information of gradient directions and b values for the parameter estimation was investigated by using mean square error (MSE). The variance of noise was used as the criterion for MSEs. The clinical practicality of the proposed workflow was evaluated by the image quality and measurements in regions of interest on 36 DKI datasets, including 18 artifact-free (18 pediatric subjects) and 18 motion-corrupted datasets (15 pediatric subjects and 3 essential tremor patients). The relative difference between artifacts and artifact-free images calculated by LPCC was larger than that of the conventional correlation coefficient (pworkflow improved the image quality and reduced the measurement biases significantly on motion-corrupted datasets (pworkflow was reliable to improve the image quality and the measurement precision of the derived parameters on motion-corrupted DKI datasets. The workflow provided an effective post-processing method for clinical applications of DKI in subjects with involuntary movements.

  19. Continuous diffusion signal, EAP and ODF estimation via Compressive Sensing in diffusion MRI.

    Science.gov (United States)

    Merlet, Sylvain L; Deriche, Rachid

    2013-07-01

    In this paper, we exploit the ability of Compressed Sensing (CS) to recover the whole 3D Diffusion MRI (dMRI) signal from a limited number of samples while efficiently recovering important diffusion features such as the Ensemble Average Propagator (EAP) and the Orientation Distribution Function (ODF). Some attempts to use CS in estimating diffusion signals have been done recently. However, this was mainly an experimental insight of CS capabilities in dMRI and the CS theory has not been fully exploited. In this work, we also propose to study the impact of the sparsity, the incoherence and the RIP property on the reconstruction of diffusion signals. We show that an efficient use of the CS theory enables to drastically reduce the number of measurements commonly used in dMRI acquisitions. Only 20-30 measurements, optimally spread on several b-value shells, are shown to be necessary, which is less than previous attempts to recover the diffusion signal using CS. This opens an attractive perspective to measure the diffusion signals in white matter within a reduced acquisition time and shows that CS holds great promise and opens new and exciting perspectives in diffusion MRI (dMRI). Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Synthesis of Cyclic Polymers and Characterization of Their Diffusive Motion in the Melt State at the Single Molecule Level

    KAUST Repository

    Habuchi, Satoshi; Yamamoto, Takuya; Tezuka, Yasuyuki

    2016-01-01

    We demonstrate a method for the synthesis of cyclic polymers and a protocol for characterizing their diffusive motion in a melt state at the single molecule level. An electrostatic self-assembly and covalent fixation (ESA-CF) process is used

  1. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.

    2017-06-06

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  2. Conserved linear dynamics of single-molecule Brownian motion

    Science.gov (United States)

    Serag, Maged F.; Habuchi, Satoshi

    2017-06-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  3. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.; Habuchi, Satoshi

    2017-01-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  4. Incoherent imaging using dynamically scattered coherent electrons

    International Nuclear Information System (INIS)

    Nellist, P.D.; Pennycook, S.J.

    1999-01-01

    We use a Bloch wave approach to show that, even for coherent dynamical scattering from a stationary lattice with no absorption, annular dark-field imaging in a scanning transmission electron microscope gives a direct incoherent structure image of the atomic-column positions of a zone-axis-aligned crystal. Although many Bloch waves may be excited by the probe, the detector provides a filtering effect so that the 1s-type bound states are found to dominate the image contrast for typical experimental conditions. We also find that the column intensity is related to the transverse kinetic energy of the 1s states, which gives atomic number, Z, contrast. The additional effects of phonon scattering are discussed, in particular the reasons why phonon scattering is not a prerequisite for transverse incoherence. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  5. Incoherences of Brazilian labour laws face to present radioprotection concepts

    International Nuclear Information System (INIS)

    Borges, J.C.

    1996-01-01

    The Brazilian labour legislation establishes, since 1950, some privileges for people working in activities which imply exposure to ionizing radiations. Comparing the present legal framework with technical radioprotection knowledge, one can detect several incoherences covering: classification of such activities; additional payments; reduced labour journey; more vacations; medical surveillance; early retirements; special norms for women. An analysis of these incoherences lead us to propose a new frame of labour rights and radioprotection norms, coupling Brazilian juridical principles and modern radioprotection knowledge. (author)

  6. The relationship between ventilatory lung motion and pulmonary perfusion shown by ventilatory lung motion imaging

    International Nuclear Information System (INIS)

    Fujii, Tadashige; Tanaka, Masao; Nakatsuka, Tatsuya; Yoshimura, Kazuhiko; Hirose, Yoshiki; Hirayama, Jiro; Kobayashi, Toshio; Handa, Kenjiro

    1991-01-01

    Using ventilatory lung motion imaging, which was obtained from two perfusion lung scintigrams with 99m Tc-macroaggregated albumin taken in maximal inspiration and maximal expiration, the lung motion (E-I/I) of the each unilateral lung was studied in various cardiopulmonary diseases. The sum of (E-I)/I(+) of the unilateral lung was decreased in the diseased lung for localized pleuropulmonary diseases, including primary lung cancer and pleural thickening, and in both lungs for heart diseases, and diffuse pulmonary diseases including diffuse interstitial pneumonia and diffuse panbronchiolitis. The sum of (E-I)/I(+) of the both lungs, which correlated with vital capacity and PaO 2 , was decreased in diffuse interstitial pneumonia, pulmonary emphysema, diffuse panbronchiolitis, primary lung cancer, pleural diseases and so on. (E-I)/I(+), correlated with pulmonary perfusion (n=49, r=0.51, p 81m Kr or 133 Xe (n=49, r=0.61, p<0.001) than pulmonary perfusion. The ventilatory lung motion imaging, which demonstrates the motion of the intra-pulmonary areas and lung edges, appears useful for estimating pulmonary ventilation of the perfused area as well as pulmonary perfusion. (author)

  7. Critical exponents of the transition from incoherence to partial oscillation death in the Winfree model

    International Nuclear Information System (INIS)

    Basnarkov, Lasko; Urumov, Viktor

    2009-01-01

    We consider an analytically solvable version of the Winfree model of synchronization of phase oscillators (proposed by Ariaratnam and Strogatz 2001 Phys. Rev. Lett. 86 4278). It is obtained that the transition from incoherence to a partial death state is characterized by third-order or higher phase transitions according to the Ehrenfest classification. The order of the transition depends on the shape of the distribution function for natural frequencies of oscillators in the vicinity of their lowest frequency. The corresponding critical exponents are found analytically and verified with numerical simulations of equations of motion. We also consider the generalized Winfree model with the interaction strength proportional to a power of the Kuramoto order parameter and find the domain where the critical exponent remains unchanged by this modification

  8. Coherent vs Incoherent Emission from Semiconductor Structures after Resonant Femtosecond Excitation

    Science.gov (United States)

    Gurioli, Massimo; Bogani, Franco; Ceccherini, Simone; Colocci, Marcello

    1997-04-01

    We show that an interferometric correlation measurement with fs time resolution provides an unambiguous discrimination between coherent and incoherent emission after resonant femtosecond excitation. The experiment directly probes the most important difference between the two emissions, that is, the phase correlation with the excitation pulse. The comparison with cw frequency resolved measurements demonstrates that the relationship between coherent and incoherent emission is similar under femtosecond and steady-state excitation.

  9. From coherent to incoherent mismatched interfaces: A generalized continuum formulation of surface stresses

    Science.gov (United States)

    Dingreville, Rémi; Hallil, Abdelmalek; Berbenni, Stéphane

    2014-12-01

    The equilibrium of coherent and incoherent mismatched interfaces is reformulated in the context of continuum mechanics based on the Gibbs dividing surface concept. Two surface stresses are introduced: a coherent surface stress and an incoherent surface stress, as well as a transverse excess strain. The coherent surface stress and the transverse excess strain represent the thermodynamic driving forces of stretching the interface while the incoherent surface stress represents the driving force of stretching one crystal while holding the other fixed and thereby altering the structure of the interface. These three quantities fully characterize the elastic behavior of coherent and incoherent interfaces as a function of the in-plane strain, the transverse stress and the mismatch strain. The isotropic case is developed in detail and particular attention is paid to the case of interfacial thermo-elasticity. This exercise provides an insight on the physical significance of the interfacial elastic constants introduced in the formulation and illustrates the obvious coupling between the interface structure and its associated thermodynamics quantities. Finally, an example based on atomistic simulations of Cu/Cu2O interfaces is given to demonstrate the relevance of the generalized interfacial formulation and to emphasize the dependence of the interfacial thermodynamic quantities on the incoherency strain with an actual material system.

  10. Is the Precautionary Principle Really Incoherent?

    Science.gov (United States)

    Boyer-Kassem, Thomas

    2017-11-01

    The Precautionary Principle has been an increasingly important principle in international treaties since the 1980s. Through varying formulations, it states that when an activity can lead to a catastrophe for human health or the environment, measures should be taken to prevent it even if the cause-and-effect relationship is not fully established scientifically. The Precautionary Principle has been critically discussed from many sides. This article concentrates on a theoretical argument by Peterson (2006) according to which the Precautionary Principle is incoherent with other desiderata of rational decision making, and thus cannot be used as a decision rule that selects an action among several ones. I claim here that Peterson's argument fails to establish the incoherence of the Precautionary Principle, by attacking three of its premises. I argue (i) that Peterson's treatment of uncertainties lacks generality, (ii) that his Archimedian condition is problematic for incommensurability reasons, and (iii) that his explication of the Precautionary Principle is not adequate. This leads me to conjecture that the Precautionary Principle can be envisaged as a coherent decision rule, again. © 2017 Society for Risk Analysis.

  11. Polymer and Water Dynamics in Poly(vinyl alcohol/Poly(methacrylate Networks. A Molecular Dynamics Simulation and Incoherent Neutron Scattering Investigation

    Directory of Open Access Journals (Sweden)

    Ester Chiessi

    2011-10-01

    Full Text Available Chemically cross-linked polymer networks of poly(vinyl alcohol/poly(methacrylate form monolitic hydrogels and microgels suitable for biomedical applications, such as in situ tissue replacement and drug delivery. In this work, molecular dynamics (MD simulation and incoherent neutron scattering methods are used to study the local polymer dynamics and the polymer induced modification of water properties in poly(vinyl alcohol/poly(methacrylate hydrogels. This information is particularly relevant when the diffusion of metabolites and drugs is a requirement for the polymer microgel functionality. MD simulations of an atomic detailed model of the junction domain at the experimental hydration degree were carried out at 283, 293 and 313 K. The polymer-water interaction, the polymer connectivity and the water dynamics were investigated as a function of temperature. Simulation results are compared with findings of elastic and quasi-elastic incoherent neutron scattering measurements, experimental approaches which sample the same space-time window of MD simulations. This combined analysis shows a supercooled water component and an increase of hydrophilicity and mobility with temperature of these amphiphilic polymer networks.

  12. Diffusion tensor magnetic resonance imaging of the pancreas.

    Directory of Open Access Journals (Sweden)

    Noam Nissan

    Full Text Available To develop a diffusion-tensor-imaging (DTI protocol that is sensitive to the complex diffusion and perfusion properties of the healthy and malignant pancreas tissues.Twenty-eight healthy volunteers and nine patients with pancreatic-ductal-adenocacinoma (PDAC, were scanned at 3T with T2-weighted and DTI sequences. Healthy volunteers were also scanned with multi-b diffusion-weighted-imaging (DWI, whereas a standard clinical protocol complemented the PDAC patients' scans. Image processing at pixel resolution yielded parametric maps of three directional diffusion coefficients λ1, λ2, λ3, apparent diffusion coefficient (ADC, and fractional anisotropy (FA, as well as a λ1-vector map, and a main diffusion-direction map.DTI measurements of healthy pancreatic tissue at b-values 0,500 s/mm² yielded: λ1 = (2.65±0.35×10⁻³, λ2 = (1.87±0.22×10⁻³, λ3 = (1.20±0.18×10⁻³, ADC = (1.91±0.22×10⁻³ (all in mm²/s units and FA = 0.38±0.06. Using b-values of 100,500 s/mm² led to a significant reduction in λ1, λ2, λ3 and ADC (p<.0001 and a significant increase (p<0.0001 in FA. The reduction in the diffusion coefficients suggested a contribution of a fast intra-voxel-incoherent-motion (IVIM component at b≤100 s/mm², which was confirmed by the multi-b DWI results. In PDACs, λ1, λ2, λ3 and ADC in both 0,500 s/mm² and 100,500 s/mm² b-values sets, as well as the reduction in these diffusion coefficients between the two sets, were significantly lower in comparison to the distal normal pancreatic tissue, suggesting higher cellularity and diminution of the fast-IVIM component in the cancer tissue.DTI using two reference b-values 0 and 100 s/mm² enabled characterization of the water diffusion and anisotropy of the healthy pancreas, taking into account a contribution of IVIM. The reduction in the diffusion coefficients of PDAC, as compared to normal pancreatic tissue, and the smaller change in these coefficients in PDAC

  13. Brownian Motion of Boomerang Colloidal Particles

    Science.gov (United States)

    Wei, Qi-Huo; Konya, Andrew; Wang, Feng; Selinger, Jonathan V.; Sun, Kai; Chakrabarty, Ayan

    2014-03-01

    We present experimental and theoretical studies on the Brownian motion of boomerang colloidal particles confined between two glass plates. Our experimental observations show that the mean displacements are biased towards the center of hydrodynamic stress (CoH), and that the mean-square displacements exhibit a crossover from short-time faster to long-time slower diffusion with the short-time diffusion coefficients dependent on the points used for tracking. A model based on Langevin theory elucidates that these behaviors are ascribed to the superposition of two diffusive modes: the ellipsoidal motion of the CoH and the rotational motion of the tracking point with respect to the CoH.

  14. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Small-polaron model of light atom diffusion

    International Nuclear Information System (INIS)

    Emin, D.

    1977-01-01

    A number of researchers have treated the diffusion of light interstitials in metals in strict analogy with the theory for the hopping diffusion of electrons in low-mobility insulators. In other words, these authors view the diffusion of light atoms as simply being an example of small-polaron hopping motion. In this paper the motion of a small polaron is introduced, and the mechanism of its motion is described. The experimental results are then succinctly presented. Next the physical assumptions implicit in the theory are compared with the situation which is believed to characterize the existence and motion of light interstitial atoms in metals. Concomitantly, the modifications of the small-polaron theory required in applying it to light atom diffusion are ennumerated

  16. Simultaneous assessment of cerebral blood volume and diffusion heterogeneity using hybrid IVIM and DK MR imaging: initial experience with brain tumors.

    Science.gov (United States)

    Wu, Wen-Chau; Yang, Shun-Chung; Chen, Ya-Fang; Tseng, Han-Min; My, Pei-Chi

    2017-01-01

    To investigate the feasibility of simultaneously assessing cerebral blood volume and diffusion heterogeneity using hybrid diffusion-kurtosis (DK) and intravoxel-incoherent-motion (IVIM) MR imaging. Fifteen healthy volunteers and 30 patients with histologically proven brain tumours (25 WHO grade II-IV gliomas and five metastases) were recruited. On a 3-T system, diffusion-weighted imaging was performed with six b-values ranging from 0 to 1,700 s/mm 2 . Nonlinear least-squares fitting was employed to extract diffusion coefficient (D), diffusion kurtosis coefficient (K, a measure of the degree of non-Gaussian and heterogeneous diffusion) and intravascular volume fraction (f, a measure proportional to cerebral blood volume). Repeated-measures multivariate analysis of variance and receiver operating characteristic analysis were performed to assess the ability of D/K/f in differentiating contrast-enhanced tumour from peritumoral oedema and normal-appearing white matter. Based on our imaging setting (baseline signal-to-noise ratio = 32-128), coefficient of variation was 14-20 % for K, ~6 % for D and 26-44 % for f. The indexes were able to differentiate contrast-enhanced tumour (Wilks' λ = 0.026, p DK IVIM imaging is capable of simultaneously measuring cerebral perfusion and diffusion indexes that together may improve brain tumour diagnosis. • Hybrid DK-IVIM imaging allows simultaneous measurement of K, D and f. • Combined K/D/f better demarcates contrast-enhanced tumour than they do separately. • f correlates better with contrast-leakage-corrected CBV DSC than with uncorrected CBV DSC.

  17. Resolution of coherent and incoherent imaging systems reconsidered : Classical criteria and a statistical alternative

    NARCIS (Netherlands)

    Van Aert, S.; Van Dyck, D.; Den Dekker, A.J.

    2006-01-01

    The resolution of coherent and incoherent imaging systems is usually evaluated in terms of classical resolution criteria, such as Rayleigh’s. Based on these criteria, incoherent imaging is generally concluded to be ‘better’ than coherent imaging. However, this paper reveals some misconceptions in

  18. Electromagnetically induced two-dimensional grating assisted by incoherent pump

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yu-Yuan; Liu, Zhuan-Zhuan; Wan, Ren-Gang, E-mail: wrg@snnu.edu.cn

    2017-04-25

    We propose a scheme for realizing electromagnetically induced two-dimensional grating in a double-Λ system driven simultaneously by a coherent field and an incoherent pump field. In such an atomic configuration, the absorption is suppressed owing to the incoherent pumping process and the probe can be even amplified, while the refractivity is mainly attributed to the dynamically induced coherence. With the help of a standing-wave pattern coherent field, we obtain periodically modulated refractive index without or with gain, and therefore phase grating or gain-phase grating which diffracts a probe light into high-order direction efficiently can be formed in the medium via appropriate manipulation of the system parameters. The diffraction efficiency attainable by the present gratings can be controlled by tuning the coherent field intensity or the interaction length. Hence, the two-dimensional grating can be utilized as all-optical splitter or router in optical networking and communication. - Highlights: • Two-dimensional grating is coherently induced in four-level atoms. • Phase and gain-phase gratings are obtained assisted by incoherent pump. • The diffraction power is improved due to the enhanced refraction modulation. • The gratings can be utilized as multi-channel all-optical splitter and router.

  19. A new look at Op art: towards a simple explanation of illusory motion

    Science.gov (United States)

    Zanker, Johannes M.; Walker, Robin

    Vivid motion illusions created by some Op art paintings are at the centre of a lively scientific debate about possible mechanisms that might underlie these phenomena. Here we review emerging evidence from a new approach that combines perceptual judgements of the illusion and observations of eye movements with simulations of the induced optic flow. This work suggests that the small involuntary saccades which participants make when viewing such Op art patterns would generate an incoherent distribution of motion signals that resemble the perceptual effects experienced by the observers. The combined experimental and computational evidence supports the view that the illusion is indeed caused by involuntary image displacements picked up by low-level motion detectors, and further suggests that coherent motion signals are crucial to perceive a stable world.

  20. The Precautionary Principle Has Not Been Shown to Be Incoherent: A Reply to Peterson.

    Science.gov (United States)

    Boyer-Kassem, Thomas

    2017-11-01

    In this journal, I have objected to Peterson's 2006 claim that the precautionary principle is an incoherent decision rule. I defend my objections to Peterson's recent replies, and I still claim that the precautionary principle has not been shown to be incoherent. © 2017 Society for Risk Analysis.

  1. Coherent and Incoherent Neutral Current Scattering for Supernova Detection

    Directory of Open Access Journals (Sweden)

    P. C. Divari

    2012-01-01

    Full Text Available The total cross sections as well as the neutrino event rates are calculated in the neutral current neutrino scattering off 40Ar and 132Xe isotopes at neutrino energies (Ev<100 MeV. The individual contribution coming from coherent and incoherent channels is taking into account. An enhancement of the neutral current component is achieved via the coherent (0gs+→0gs+ channel which is dominant with respect to incoherent (0gs+→Jf one. The response of the above isotopes as a supernova neutrino detection has been considered, assuming a two parameter Fermi-Dirac distribution for the supernova neutrino energy spectra. The calculated total cross sections are tested on a gaseous spherical TPC detector dedicated for supernova neutrino detection.

  2. Neutron scattering in disordered alloys: coherent and incoherent intensities

    International Nuclear Information System (INIS)

    Mookerjee, A.; Yussouff, M.

    1985-02-01

    A priori it is not clear how to split the total intensity of thermal neutron scattering from disordered alloys into a coherent and an incoherent part. We present here a formalism to do this. The formalism is based on the augmented space technique introduced earlier by one of the authors. It includes disorder in mass, force constants and scattering lengths. A self-consistent CCPA which is tractable for realistic calculations is presented for the coherent and incoherent intensities. This is expected to prove useful in theoretically analysis data for alloys (e.g. Nisub(x)Ptsub(1-x), Nisub(x)Pdsub(1-x), Nisub(x)Crsub(1-x)) for which it is necessary to go beyond the usual single site CPAs for reliable accuracy. (author)

  3. Parameter estimation in fractional diffusion models

    CERN Document Server

    Kubilius, Kęstutis; Ralchenko, Kostiantyn

    2017-01-01

    This book is devoted to parameter estimation in diffusion models involving fractional Brownian motion and related processes. For many years now, standard Brownian motion has been (and still remains) a popular model of randomness used to investigate processes in the natural sciences, financial markets, and the economy. The substantial limitation in the use of stochastic diffusion models with Brownian motion is due to the fact that the motion has independent increments, and, therefore, the random noise it generates is “white,” i.e., uncorrelated. However, many processes in the natural sciences, computer networks and financial markets have long-term or short-term dependences, i.e., the correlations of random noise in these processes are non-zero, and slowly or rapidly decrease with time. In particular, models of financial markets demonstrate various kinds of memory and usually this memory is modeled by fractional Brownian diffusion. Therefore, the book constructs diffusion models with memory and provides s...

  4. Derivatization and diffusive motion of molecular fullerenes: Ab initio and atomistic simulations

    Energy Technology Data Exchange (ETDEWEB)

    Berdiyorov, G., E-mail: gberdiyorov@qf.org.qa; Tabet, N. [Qatar Environment and Energy Research Institute (QEERI), Hamad Ben Khalifa University (HBKU), Qatar Foundation, P.O. Box 5825, Doha (Qatar); Harrabi, K. [Department of Physics, King Fahd University of Petroleum and Minerals, 31261 Dhahran (Saudi Arabia); Mehmood, U.; Hussein, I. A. [Department of Chemical Engineering, King Fahd University of Petroleum and Minerals, 31261 Dharan (Saudi Arabia); Peeters, F. M. [Departement Fysica, Universiteit Antwerpen, Groenenborgerlaan 171, B-2020 Antwerpen (Belgium); Zhang, J. [Department of Materials and London Centre for Nanotechnology, Imperial College London, SW7 2AZ London (United Kingdom); McLachlan, M. A. [Department of Materials and Centre for Plastic Electronics, Imperial College London, SW7 2AZ London (United Kingdom)

    2015-07-14

    Using first principles density functional theory in combination with the nonequilibrium Green's function formalism, we study the effect of derivatization on the electronic and transport properties of C{sub 60} fullerene. As a typical example, we consider [6,6]-phenyl-C{sub 61}-butyric acid methyl ester (PCBM), which forms one of the most efficient organic photovoltaic materials in combination with electron donating polymers. Extra peaks are observed in the density of states (DOS) due to the formation of new electronic states localized at/near the attached molecule. Despite such peculiar behavior in the DOS of an isolated molecule, derivatization does not have a pronounced effect on the electronic transport properties of the fullerene molecular junctions. Both C{sub 60} and PCBM show the same response to finite voltage biasing with new features in the transmission spectrum due to voltage induced delocalization of some electronic states. We also study the diffusive motion of molecular fullerenes in ethanol solvent and inside poly(3-hexylthiophene) lamella using reactive molecular dynamics simulations. We found that the mobility of the fullerene reduces considerably due to derivatization; the diffusion coefficient of C{sub 60} is an order of magnitude larger than the one for PCBM.

  5. Time-stretch microscopy based on time-wavelength sequence reconstruction from wideband incoherent source

    International Nuclear Information System (INIS)

    Zhang, Chi; Xu, Yiqing; Wei, Xiaoming; Tsia, Kevin K.; Wong, Kenneth K. Y.

    2014-01-01

    Time-stretch microscopy has emerged as an ultrafast optical imaging concept offering the unprecedented combination of the imaging speed and sensitivity. However, dedicated wideband and coherence optical pulse source with high shot-to-shot stability has been mandated for time-wavelength mapping—the enabling process for ultrahigh speed wavelength-encoded image retrieval. From the practical point of view, exploiting methods to relax the stringent requirements (e.g., temporal stability and coherence) for the source of time-stretch microscopy is thus of great value. In this paper, we demonstrated time-stretch microscopy by reconstructing the time-wavelength mapping sequence from a wideband incoherent source. Utilizing the time-lens focusing mechanism mediated by a narrow-band pulse source, this approach allows generation of a wideband incoherent source, with the spectral efficiency enhanced by a factor of 18. As a proof-of-principle demonstration, time-stretch imaging with the scan rate as high as MHz and diffraction-limited resolution is achieved based on the wideband incoherent source. We note that the concept of time-wavelength sequence reconstruction from wideband incoherent source can also be generalized to any high-speed optical real-time measurements, where wavelength is acted as the information carrier

  6. Flux motion and dissipation in high-temperature superconductors

    International Nuclear Information System (INIS)

    Gray, K.E.; Kim, D.H.

    1991-08-01

    The effects on flux motion and dissipation of interlayer coupling of the Cu-O planes along the c-axis are considered for the high- temperature superconductors (HTS). It is argued that for the highly-anisotropic HTS, the weak interlayer coupling plays a dominant role that can be described by incoherent Josephson tunneling between superconducting Cu-O bi- or tri-layers. In YBa 2 Cu 3 O 7 , the layers are strongly coupled, presumably because the conducting Cu-O chains short circuit the Josephson tunneling, so that these effects are weak or missing

  7. Incoherent control of locally controllable quantum systems

    International Nuclear Information System (INIS)

    Dong Daoyi; Zhang Chenbin; Rabitz, Herschel; Pechen, Alexander; Tarn, T.-J.

    2008-01-01

    An incoherent control scheme for state control of locally controllable quantum systems is proposed. This scheme includes three steps: (1) amplitude amplification of the initial state by a suitable unitary transformation, (2) projective measurement of the amplified state, and (3) final optimization by a unitary controlled transformation. The first step increases the amplitudes of some desired eigenstates and the corresponding probability of observing these eigenstates, the second step projects, with high probability, the amplified state into a desired eigenstate, and the last step steers this eigenstate into the target state. Within this scheme, two control algorithms are presented for two classes of quantum systems. As an example, the incoherent control scheme is applied to the control of a hydrogen atom by an external field. The results support the suggestion that projective measurements can serve as an effective control and local controllability information can be used to design control laws for quantum systems. Thus, this scheme establishes a subtle connection between control design and controllability analysis of quantum systems and provides an effective engineering approach in controlling quantum systems with partial controllability information.

  8. Experimental photonic generation of chirped pulses using nonlinear dispersion-based incoherent processing.

    Science.gov (United States)

    Rius, Manuel; Bolea, Mario; Mora, José; Ortega, Beatriz; Capmany, José

    2015-05-18

    We experimentally demonstrate, for the first time, a chirped microwave pulses generator based on the processing of an incoherent optical signal by means of a nonlinear dispersive element. Different capabilities have been demonstrated such as the control of the time-bandwidth product and the frequency tuning increasing the flexibility of the generated waveform compared to coherent techniques. Moreover, the use of differential detection improves considerably the limitation over the signal-to-noise ratio related to incoherent processing.

  9. Diffusion, quantum theory, and radically elementary mathematics (MN-47)

    CERN Document Server

    Faris, William G

    2014-01-01

    Diffusive motion--displacement due to the cumulative effect of irregular fluctuations--has been a fundamental concept in mathematics and physics since Einstein''s work on Brownian motion. It is also relevant to understanding various aspects of quantum theory. This book explains diffusive motion and its relation to both nonrelativistic quantum theory and quantum field theory. It shows how diffusive motion concepts lead to a radical reexamination of the structure of mathematical analysis. The book''s inspiration is Princeton University mathematics professor Edward Nelson''s influential work in

  10. The Precautionary Principle Has Not Been Shown to Be Incoherent: A Reply to Peterson : Response

    NARCIS (Netherlands)

    Boyer-Kassem, Thomas

    2017-01-01

    In this journal, I have objected to Peterson's 2006 claim that the precautionary principle is an incoherent decision rule. I defend my objections to Peterson's recent replies, and I still claim that the precautionary principle has not been shown to be incoherent.

  11. Elucidating fluctuating diffusivity in center-of-mass motion of polymer models with time-averaged mean-square-displacement tensor

    Science.gov (United States)

    Miyaguchi, Tomoshige

    2017-10-01

    There have been increasing reports that the diffusion coefficient of macromolecules depends on time and fluctuates randomly. Here a method is developed to elucidate this fluctuating diffusivity from trajectory data. Time-averaged mean-square displacement (MSD), a common tool in single-particle-tracking (SPT) experiments, is generalized to a second-order tensor with which both magnitude and orientation fluctuations of the diffusivity can be clearly detected. This method is used to analyze the center-of-mass motion of four fundamental polymer models: the Rouse model, the Zimm model, a reptation model, and a rigid rodlike polymer. It is found that these models exhibit distinctly different types of magnitude and orientation fluctuations of diffusivity. This is an advantage of the present method over previous ones, such as the ergodicity-breaking parameter and a non-Gaussian parameter, because with either of these parameters it is difficult to distinguish the dynamics of the four polymer models. Also, the present method of a time-averaged MSD tensor could be used to analyze trajectory data obtained in SPT experiments.

  12. Comparison of bi-exponential and mono-exponential models of diffusion-weighted imaging for detecting active sacroiliitis in ankylosing spondylitis.

    Science.gov (United States)

    Sun, Haitao; Liu, Kai; Liu, Hao; Ji, Zongfei; Yan, Yan; Jiang, Lindi; Zhou, Jianjun

    2018-04-01

    Background There has been a growing need for a sensitive and effective imaging method for the differentiation of the activity of ankylosing spondylitis (AS). Purpose To compare the performances of intravoxel incoherent motion (IVIM)-derived parameters and the apparent diffusion coefficient (ADC) for distinguishing AS-activity. Material and Methods One hundred patients with AS were divided into active (n = 51) and non-active groups (n = 49) and 21 healthy volunteers were included as control. The ADC, diffusion coefficient ( D), pseudodiffusion coefficient ( D*), and perfusion fraction ( f) were calculated for all groups. Kruskal-Wallis tests and receiver operator characteristic (ROC) curve analysis were performed for all parameters. Results There was good reproducibility of ADC /D and relatively poor reproducibility of D*/f. ADC, D, and f were significantly higher in the active group than in the non-active and control groups (all P  0.050). In the ROC analysis, ADC had the largest AUC for distinguishing between the active group and the non-active group (0.988) and between the active and control groups (0.990). Multivariate logistic regression analysis models showed no diagnostic improvement. Conclusion ADC provided better diagnostic performance than IVIM-derived parameters in differentiating AS activity. Therefore, a straightforward and effective mono-exponential model of diffusion-weighted imaging may be sufficient for differentiating AS activity in the clinic.

  13. Nonlinear dispersion-based incoherent photonic processing for microwave pulse generation with full reconfigurability.

    Science.gov (United States)

    Bolea, Mario; Mora, José; Ortega, Beatriz; Capmany, José

    2012-03-12

    A novel all-optical technique based on the incoherent processing of optical signals using high-order dispersive elements is analyzed for microwave arbitrary pulse generation. We show an approach which allows a full reconfigurability of a pulse in terms of chirp, envelope and central frequency by the proper control of the second-order dispersion and the incoherent optical source power distribution, achieving large values of time-bandwidth product.

  14. Vibronic dephasing model for coherent-to-incoherent crossover in DNA

    Science.gov (United States)

    Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas

    2018-05-01

    In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.

  15. Anisotropic diffusion within human white matter

    International Nuclear Information System (INIS)

    Chenevert, T.L.; Brunberg, J.A.; Pipe, J.G.

    1990-01-01

    This paper reports on measurements performed to assess the impact of fiber orientation on the apparent diffusion coefficient of human white matter in vivo. Orthogonal section selection pulses and strong motion sensitization gradient pulses were used for localized diffusion measurement along an anteroposteriorly oriented 1 x 1 cm tissue column in the left cerebral hemisphere. This region was selected since white matter fiber orientations are reasonably well defined. Independent acquisitions with motion sensitivity along anteroposterior and right-left directions allowed study of diffusion anisotropy. Motion artifacts were minimized by magnitude summation after one-dimensional Fourier transform of frequency-encoded echoes; consequently, cardiac gating was not required. Five normal volunteers were studied on a 1.5-T clinical MR system

  16. Coherence Inherent in an Incoherent Synchrotron Radio Source ...

    Indian Academy of Sciences (India)

    It is well known that synchrotron radiation mechanism does not allow MASER type coherent emission (Pacholczyk 1970). Here we show that coherence can naturally occur in a synchrotron ... cally thick region (Fig. 1), then divides the synchrotron spectrum into an incoherent. 1A thin flat circular unleavened Indian bread.

  17. Incoherent-scatter computed tomography with monochromatic synchrotron x ray: feasibility of multi-CT imaging system for simultaneous measurement-of fluorescent and incoherent scatter x rays

    Science.gov (United States)

    Yuasa, T.; Akiba, M.; Takeda, T.; Kazama, M.; Hoshino, A.; Watanabe, Y.; Hyodo, K.; Dilmanian, F. A.; Akatsuka, T.; Itai, Y.

    1997-10-01

    We describe a new system of incoherent scatter computed tomography (ISCT) using monochromatic synchrotron X rays, and we discuss its potential to be used in in vivo imaging for medical use. The system operates on the basis of computed tomography (CT) of the first generation. The reconstruction method for ISCT uses the least squares method with singular value decomposition. The research was carried out at the BLNE-5A bending magnet beam line of the Tristan Accumulation Ring in KEK, Japan. An acrylic cylindrical phantom of 20-mm diameter containing a cross-shaped channel was imaged. The channel was filled with a diluted iodine solution with a concentration of 200 /spl mu/gI/ml. Spectra obtained with the system's high purity germanium (HPGe) detector separated the incoherent X-ray line from the other notable peaks, i.e., the iK/sub /spl alpha// and K/sub /spl beta/1/ X-ray fluorescent lines and the coherent scattering peak. CT images were reconstructed from projections generated by integrating the counts In the energy window centering around the incoherent scattering peak and whose width was approximately 2 keV. The reconstruction routine employed an X-ray attenuation correction algorithm. The resulting image showed more homogeneity than one without the attenuation correction.

  18. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  19. Holographic fluorescence microscopy with incoherent digital holographic adaptive optics.

    Science.gov (United States)

    Jang, Changwon; Kim, Jonghyun; Clark, David C; Lee, Seungjae; Lee, Byoungho; Kim, Myung K

    2015-01-01

    Introduction of adaptive optics technology into astronomy and ophthalmology has made great contributions in these fields, allowing one to recover images blurred by atmospheric turbulence or aberrations of the eye. Similar adaptive optics improvement in microscopic imaging is also of interest to researchers using various techniques. Current technology of adaptive optics typically contains three key elements: a wavefront sensor, wavefront corrector, and controller. These hardware elements tend to be bulky, expensive, and limited in resolution, involving, for example, lenslet arrays for sensing or multiactuator deformable mirrors for correcting. We have previously introduced an alternate approach based on unique capabilities of digital holography, namely direct access to the phase profile of an optical field and the ability to numerically manipulate the phase profile. We have also demonstrated that direct access and compensation of the phase profile are possible not only with conventional coherent digital holography, but also with a new type of digital holography using incoherent light: selfinterference incoherent digital holography (SIDH). The SIDH generates a complex—i.e., amplitude plus phase—hologram from one or several interferograms acquired with incoherent light, such as LEDs, lamps, sunlight, or fluorescence. The complex point spread function can be measured using guide star illumination and it allows deterministic deconvolution of the full-field image. We present experimental demonstration of aberration compensation in holographic fluorescence microscopy using SIDH. Adaptive optics by SIDH provides new tools for improved cellular fluorescence microscopy through intact tissue layers or other types of aberrant media.

  20. Coherent imaging with incoherent light in digital holographic microscopy

    Science.gov (United States)

    Chmelik, Radim

    2012-01-01

    Digital holographic microscope (DHM) allows for imaging with a quantitative phase contrast. In this way it becomes an important instrument, a completely non-invasive tool for a contrast intravital observation of living cells and a cell drymass density distribution measurement. A serious drawback of current DHMs is highly coherent illumination which makes the lateral resolution worse and impairs the image quality by a coherence noise and a parasitic interference. An uncompromising solution to this problem can be found in the Leith concept of incoherent holography. An off-axis hologram can be formed with arbitrary degree of light coherence in systems equipped with an achromatic interferometer and thus the resolution and the image quality typical for an incoherent-light wide-field microscopy can be achieved. In addition, advanced imaging modes based on limited coherence can be utilized. The typical example is a coherence-gating effect which provides a finite axial resolution and makes DHM image similar to that of a confocal microscope. These possibilities were described theoretically using the formalism of three-dimensional coherent transfer functions and proved experimentally by the coherence-controlled holographic microscope which is DHM based on the Leith achromatic interferometer. Quantitative-phase-contrast imaging is demonstrated with incoherent light by the living cancer cells observation and their motility evaluation. The coherence-gating effect was proved by imaging of model samples through a scattering layer and living cells inside an opalescent medium.

  1. Selected clinically established and scientific techniques of diffusion-weighted MRI. In the context of imaging in oncology; Ausgewaehlte klinisch etablierte und wissenschaftliche Techniken der diffusionsgewichteten MRT. Im Kontext der onkologischen Bildgebung

    Energy Technology Data Exchange (ETDEWEB)

    Freitag, M.T.; Bickelhaupt, S.; Ziener, C.; Mosebach, J.; Schlemmer, H.P. [Deutsches Krebsforschungszentrum, Abteilung fuer Radiologie, Heidelberg (Germany); Meier-Hein, K. [Deutsches Krebsforschungszentrum, Abteilung fuer medizinische Informatik, Heidelberg (Germany); Radtke, J.P. [Deutsches Krebsforschungszentrum, Abteilung fuer Radiologie, Heidelberg (Germany); Universitaetsklinik Heidelberg, Abteilung fuer Urologie, Heidelberg (Germany); Kuder, T.A.; Laun, F.B. [Deutsches Krebsforschungszentrum, Abteilung fuer Medizinische Physik in der Radiologie, Heidelberg (Germany)

    2016-02-15

    Diffusion-weighted imaging (DWI) is a magnetic resonance imaging (MRI) technique that was established in the clinical routine primarily for the detection of brain ischemia. In the past 15 years its clinical use has been extended to oncological radiology, as tumor and metastases can be depicted in DWI due to their hypercellular nature. The basis of DWI is the Stejskal-Tanner experiment. The diffusion properties of tissue can be visualized after acquisition of at least two diffusion-weighted series using echo planar imaging and a specific sequence of gradient pulses. The use of DWI in prostate MRI was reported to be one of the first established applications that found its way into internationally recognized clinical guidelines of the European Society of Urological Radiology (ESUR) and the prostate imaging reporting and data system (PI-RADS) scale. Due to recently reported high specificity and negative predictive values of 94 % and 92 %, respectively, its regular use for breast MRI is expected in the near future. Furthermore, DWI can also reliably be used for whole-body imaging in patients with multiple myeloma or for measuring the extent of bone metastases. New techniques in DWI, such as intravoxel incoherent motion imaging, diffusion kurtosis imaging and histogram-based analyses represent promising approaches to achieve a more quantitative evaluation for tumor detection and therapy response. (orig.) [German] Die diffusionsgewichtete Bildgebung (''diffusion-weighted imaging'', DWI), ein Verfahren aus der Magnetresonanztomographie (MRT), wurde in der klinischen Routine primaer fuer die Detektion von Schlaganfaellen etabliert. Der Einsatz dieser Methode hat in den letzten 15 Jahren auch fuer die onkologische Diagnostik stark zugenommen, da Tumoren und Metastasen aufgrund ihrer hochzellulaeren Zusammensetzung in der DWI sehr gut sichtbar gemacht werden koennen. Basis der diffusionsgewichteten Bildgebung ist das Experiment nach Stejskal-Tanner. Hier

  2. SFERXS, Photoabsorption, Coherent, Incoherent Scattering Cross-Sections Function for Shielding

    International Nuclear Information System (INIS)

    Legarda, F.; Mtz de la Fuente, O.; Herranz, M.

    2002-01-01

    Description of program or function: The use of electromagnetic radiation cross-sections in radiation shielding calculations and more generally in transport theory applications actually requires an interpolation between values which are tabulated for certain values of the energy. In order to facilitate this process and to reduce the computer memory requirements, we have developed, by a least squares method, a set of functions which represents the cross-sections for the photoelectric absorption, the coherent (Rayleigh) and the incoherent (Compton) scattering (1). For this purpose we have accepted as true values the ones tabulated by Storm and Israel (2) for the photoeffect, by Hubbell et Al. (3) for the incoherent scattering and by Hubbell and Overbo (4) for the coherent scattering

  3. Incoherently combining logarithmic aspheric lenses for extended depth of field.

    Science.gov (United States)

    Chu, Kaiqin; George, Nicholas; Chi, Wanli

    2009-10-01

    We describe a method for combining concentric logarithmic aspheric lenses in order to obtain an extended depth of field. Substantial improvement in extending the depth of field is obtained by carefully controlling the optical path difference among the concentric lenses so that their outputs combine incoherently. The system is analyzed through diffraction theory and the point spread function is shown to be highly invariant over a long range of object distances. After testing the image performance on a three-dimensional scene, we found that the incoherently combined logarithmic aspheres can provide a high-quality image over an axial distance corresponding to a defocus of +/- 14(lambda/4). Studies of the images of two-point objects are presented to illustrate the resolution of these lenses.

  4. Intermittent Motion, Nonlinear Diffusion Equation and Tsallis Formalism

    Directory of Open Access Journals (Sweden)

    Ervin K. Lenzi

    2017-01-01

    Full Text Available We investigate an intermittent process obtained from the combination of a nonlinear diffusion equation and pauses. We consider the porous media equation with reaction terms related to the rate of switching the particles from the diffusive mode to the resting mode or switching them from the resting to the movement. The results show that in the asymptotic limit of small and long times, the spreading of the system is essentially governed by the diffusive term. The behavior exhibited for intermediate times depends on the rates present in the reaction terms. In this scenario, we show that, in the asymptotic limits, the distributions for this process are given by in terms of power laws which may be related to the q-exponential present in the Tsallis statistics. Furthermore, we also analyze a situation characterized by different diffusive regimes, which emerges when the diffusive term is a mixing of linear and nonlinear terms.

  5. Ultrafast Dephasing and Incoherent Light Photon Echoes in Organic Amorphous Systems

    Science.gov (United States)

    Yano, Ryuzi; Matsumoto, Yoshinori; Tani, Toshiro; Nakatsuka, Hiroki

    1989-10-01

    Incoherent light photon echoes were observed in organic amorphous systems (cresyl violet in polyvinyl alcohol and 1,4-dihydroxyanthraquinone in polymethacrylic acid) by using temporally-incoherent nanosecond laser pulses. It was found that an echo decay curve of an organic amorphous system is composed of a sharp peak which decays very rapidly and a slowly decaying wing at the tail. We show that the persistent hole burning (PHB) spectra were reproduced by the Fourier-cosine transforms of the echo decay curves. We claim that in general, we must take into account the multi-level feature of the system in order to explain ultrafast dephasing at very low temperatures.

  6. Nonlinear propagation of a spatially incoherent laser beam: self-induced smoothing and reduction of scattering instabilities

    International Nuclear Information System (INIS)

    Maximov, A.V.; Ourdev, I.G.; Rozmus, W.; Capjack, C.E.; Mounaix, Ph.; Huller, S.; Pesme, D.; Tikhonchuk, V.T.; Divol, L.

    2000-01-01

    It is shown that plasma-induced angular spreading and spectral broadening of a spatially incoherent laser beam correspond to increased spatial and temporal incoherence of the laser light. The spatial incoherence is characterized by an effective beam f-number, decreasing in space along the direction of light propagation. Plasma-induced beam smoothing can influence laser-plasma interaction physics. In particular, decreasing the correlation time of the propagating laser light may dramatically reduce the levels of backward stimulated Brillouin and Raman scattering inside the plasma. Also, the decrease of the laser beam effective f-number reduces the reflectivity of backward stimulated Brillouin scattering. (authors)

  7. Measurement of the perfusion fraction in brain tumors with intravoxel incoherent motion MR imaging: validation with histopathological vascular density in meningiomas.

    Science.gov (United States)

    Togao, Osamu; Hiwatashi, Akio; Yamashita, Koji; Kikuchi, Kazufumi; Momosaka, Daichi; Yoshimoto, Koji; Kuga, Daisuke; Mizoguchi, Masahiro; Suzuki, Satoshi O; Iwaki, Toru; Van Cauteren, Marc; Iihara, Koji; Honda, Hiroshi

    2018-05-01

    To evaluate the quantification performance of the perfusion fraction (f) measured with intravoxel incoherent motion (IVIM) MR imaging in a comparison with the histological vascular density in meningiomas. 29 consecutive patients with meningioma (59.0 ± 16.8 years old, 8 males and 21 females) who underwent a subsequent surgical resection were examined with both IVIM imaging and a histopathological analysis. IVIM imaging was conducted using a single-shot SE-EPI sequence with 13 b-factors (0, 10, 20, 30, 50, 80, 100, 200, 300, 400, 600, 800, 1000 s mm - 2 ) at 3T. The perfusion fraction (f) was calculated by fitting the IVIM bi-exponential model. The 90-percentile f-value in the tumor region-of-interest (ROI) was defined as the maximum f-value (f-max). Histopathological vascular density (%Vessel) was measured on CD31-immunostainted histopathological specimens. The correlation and agreement between the f-values and %Vessel was assessed. The f-max (15.5 ± 5.5%) showed excellent agreement [intraclass correlation coefficient (ICC) = 0.754] and a significant correlation (r = 0.69, p < 0.0001) with the %Vessel (12.9 ± 9.4%) of the tumors. The Bland-Altman plot analysis showed excellent agreement between the f-max and %Vessel (bias, -2.6%; 95% limits of agreement, from -16.0 to 10.8%). The f-max was not significantly different among the histological subtypes of meningioma. An excellent agreement and a significant correlation were observed between the f-values and %Vessel. The f-value can be used as a noninvasive quantitative imaging measure to directly assess the vascular volume fraction in brain tumors. Advances in knowledge: The f-value measured by IVIM imaging showed a significant correlation and an excellent agreement with the histological vascular density in the meningiomas. The f-value can be used as a noninvasive and quantitative imaging measure to directly assess the volume fraction of capillaries in brain tumors.

  8. Basic principles of diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Bammer, Roland.

    2003-01-01

    In diffusion-weighted MRI (DWI), image contrast is determined by the random microscopic motion of water protons. During the last years, DWI has become an important modality in the diagnostic work-up of acute ischemia in the CNS. There are also a few promising reports about the application of DWI to other regions in the human body, such as the vertebral column or the abdomen. This manuscript provides an introduction into the basics of DWI and Diffusion Tensor imaging. The potential of various MR sequences in concert with diffusion preparation are discussed with respect to acquisition speed, spatial resolution, and sensitivity to bulk physiologic motion. More advanced diffusion measurement techniques, such as high angular resolution diffusion imaging, are also addressed

  9. Phase diagram of incoherently driven strongly correlated photonic lattices

    Science.gov (United States)

    Biella, Alberto; Storme, Florent; Lebreuilly, José; Rossini, Davide; Fazio, Rosario; Carusotto, Iacopo; Ciuti, Cristiano

    2017-08-01

    We explore theoretically the nonequilibrium photonic phases of an array of coupled cavities in presence of incoherent driving and dissipation. In particular, we consider a Hubbard model system where each site is a Kerr nonlinear resonator coupled to a two-level emitter, which is pumped incoherently. Within a Gutzwiller mean-field approach, we determine the steady-state phase diagram of such a system. We find that, at a critical value of the intercavity photon hopping rate, a second-order nonequilibrium phase transition associated with the spontaneous breaking of the U(1 ) symmetry occurs. The transition from an incompressible Mott-like photon fluid to a coherent delocalized phase is driven by commensurability effects and not by the competition between photon hopping and optical nonlinearity. The essence of the mean-field predictions is corroborated by finite-size simulations obtained with matrix product operators and corner-space renormalization methods.

  10. O'Connell's process as a vicious Brownian motion

    International Nuclear Information System (INIS)

    Katori, Makoto

    2011-01-01

    Vicious Brownian motion is a diffusion scaling limit of Fisher's vicious walk model, which is a system of Brownian particles in one dimension such that if two motions meet they kill each other. We consider the vicious Brownian motions conditioned never to collide with each other and call it noncolliding Brownian motion. This conditional diffusion process is equivalent to the eigenvalue process of the Hermitian-matrix-valued Brownian motion studied by Dyson [J. Math. Phys. 3, 1191 (1962)]. Recently, O'Connell [Ann. Probab. (to be published)] introduced a generalization of the noncolliding Brownian motion by using the eigenfunctions (the Whittaker functions) of the quantum Toda lattice in order to analyze a directed polymer model in 1 + 1 dimensions. We consider a system of one-dimensional Brownian motions with a long-ranged killing term as a generalization of the vicious Brownian motion and construct the O'Connell process as a conditional process of the killing Brownian motions to survive forever.

  11. Incoherent scatter studies of upper atmosphere dynamics and coding technique

    International Nuclear Information System (INIS)

    Haeggstroem, Ingemar.

    1990-09-01

    Observations by the EISCAT incoherent scatter radar are used to study the dynamics of the auroral upper atmosphere. The study describes some effects of the strong plasma convection occurring at these latitudes and a new coding technique for incoherent scatter radars. A technique to determine the thermospheric neutral wind from incoherent scatter measurements is described. Simultaneous Fabry-Perot interferometer measurements of the wind are compared with those derived from the radar data. F-region electron density depletions in the afternoon/evening sector of the auroral zone, identified as the main ionospheric trough, are investigated. In a statistical study, based on wide latitude scanning experiment made at solar minimum, the trough appearance at a given latitude is compared to the geomagnetic index K p , and an empirical model predicting the latitude of the trough is proposed. Detailed studies, using different experiment modes, show that the equatorward edge of the auroral oval is co-located of up to 1 degree poleward of the trough minimum, which in turn is co-located with the peak convective electric field, with its boundary 1 degree - 2 degree equatorward of the trough minimum. It is shown that the F-region ion composition changes from pure 0 + to molecular ion dominated (NO + /O 2 + ) as the trough moves into the region probed by the radar. In a special case, where a geomagnetic sudden impulse caused an expansion of the plasma convection pattern, the equatorward trough progression is studied together with ionosonde measurements. A new coding technique for incoherent scatter radar measurement is introduced and described. The method, called alternating codes, provides significantly more accurate estimates of the plasma parameters than can be obtained by frequency commutated multipulse measurements. Simple explanations of the method are given as well as a precise definition. Two examples of application of the alternating codes are presented, showing the high

  12. Coherence and incoherence collective behavior in financial market

    Science.gov (United States)

    Zhao, Shangmei; Xie, Qiuchao; Lu, Qing; Jiang, Xin; Chen, Wei

    2015-10-01

    Financial markets have been extensively studied as highly complex evolving systems. In this paper, we quantify financial price fluctuations through a coupled dynamical system composed of phase oscillators. We find that a Financial Coherence and Incoherence (FCI) coexistence collective behavior emerges as the system evolves into the stable state, in which the stocks split into two groups: one is represented by coherent, phase-locked oscillators, the other is composed of incoherent, drifting oscillators. It is demonstrated that the size of the coherent stock groups fluctuates during the economic periods according to real-world financial instabilities or shocks. Further, we introduce the coherent characteristic matrix to characterize the involvement dynamics of stocks in the coherent groups. Clustering results on the matrix provides a novel manifestation of the correlations among stocks in the economic periods. Our analysis for components of the groups is consistent with the Global Industry Classification Standard (GICS) classification and can also figure out features for newly developed industries. These results can provide potentially implications on characterizing the inner dynamical structure of financial markets and making optimal investment into tragedies.

  13. Investigations of homologous disaccharides by elastic incoherent neutron scattering and wavelet multiresolution analysis

    Energy Technology Data Exchange (ETDEWEB)

    Magazù, S.; Migliardo, F. [Dipartimento di Fisica e di Scienze della Terra dell’, Università degli Studi di Messina, Viale F. S. D’Alcontres 31, 98166 Messina (Italy); Vertessy, B.G. [Institute of Enzymology, Hungarian Academy of Science, Budapest (Hungary); Caccamo, M.T., E-mail: maccamo@unime.it [Dipartimento di Fisica e di Scienze della Terra dell’, Università degli Studi di Messina, Viale F. S. D’Alcontres 31, 98166 Messina (Italy)

    2013-10-16

    Highlights: • Innovative multiresolution wavelet analysis of elastic incoherent neutron scattering. • Elastic Incoherent Neutron Scattering measurements on homologues disaccharides. • EINS wavevector analysis. • EINS temperature analysis. - Abstract: In the present paper the results of a wavevector and thermal analysis of Elastic Incoherent Neutron Scattering (EINS) data collected on water mixtures of three homologous disaccharides through a wavelet approach are reported. The wavelet analysis allows to compare both the spatial properties of the three systems in the wavevector range of Q = 0.27 Å{sup −1} ÷ 4.27 Å{sup −1}. It emerges that, differently from previous analyses, for trehalose the scalograms are constantly lower and sharper in respect to maltose and sucrose, giving rise to a global spectral density along the wavevector range markedly less extended. As far as the thermal analysis is concerned, the global scattered intensity profiles suggest a higher thermal restrain of trehalose in respect to the other two homologous disaccharides.

  14. Ion motion and conductivity in rubidium and cesium hexafluorotitanates

    International Nuclear Information System (INIS)

    Moskvich, Yu.N.; Cherkasov, B.I.; Sukhovskij, A.A.; Davidovich, R.L.; AN SSSR, Vladivostok. Inst. Khimii)

    1988-01-01

    Relaxation times for 19 F nuclei and electric conductivity in Rb 2 TiF 6 and Cs 2 TiF 6 polycrystals are measured. The parameters of reoriented anion motion and diffusion cation motion are determined according to the NMR data. The effect of phase transition to the cubic phase on the parameters of these motions are studied. High conductivity reaching values σ∼10 -2 -10 -3 Ohm -1 xm -1 is detected at high temperatures. The electric conductivity observed is shown to be caused by the diffusion motion of Rb + and Cs + cations

  15. The effect of the precipitation of coherent and incoherent precipitates on the ductility and toughness of high-strength steel

    International Nuclear Information System (INIS)

    Hamano, R.

    1993-01-01

    The effect of the coexistence of coherent and incoherent precipitates, such as M 2 C and NiAl, on the ductility and plane strain fracture toughness of 5 wt pct Ni-2 wt pct Al-based high-strength steels was studied. In order to disperse coherent and incoherent precipitates, the heat treatments were carried out as follows: (a) austenitizing at 1373 K, (b) tempering at 1023 or 923 K for dispersing the incoherent precipitates of M 2 C and NiAl, and then (c) aging at 843 K for 2.4 ks to disperse the coherent precipitate of NiAl into the matrix, which contains incoherent precipitates, such as M 2 C and NiAl. The results were obtained as follows: (a) when the strengthening precipitates consist of coherent ones, such as M 2 C and/or NiAl, the ductility and toughness are extremely low, and (b) when the strengthening precipitates consist of coherent and incoherent precipitates, such as M 2 C and NiAl, the ductility and fracture toughness significantly increase with no loss in strength. It is shown that the coexistence of coherent and incoherent precipitates increases homogeneous deformation, thus preventing local strain concentration and early cleavage cracking. Accordingly, the actions of coherent precipitates in strengthening the matrix and of incoherent precipitates in promoting, homogeneous deformation can be expected to increase both the strength and toughness of the material

  16. Self-diffusion in dense granular shear flows.

    Science.gov (United States)

    Utter, Brian; Behringer, R P

    2004-03-01

    Diffusivity is a key quantity in describing velocity fluctuations in granular materials. These fluctuations are the basis of many thermodynamic and hydrodynamic models which aim to provide a statistical description of granular systems. We present experimental results on diffusivity in dense, granular shear flows in a two-dimensional Couette geometry. We find that self-diffusivities D are proportional to the local shear rate gamma; with diffusivities along the direction of the mean flow approximately twice as large as those in the perpendicular direction. The magnitude of the diffusivity is D approximately gamma;a(2), where a is the particle radius. However, the gradient in shear rate, coupling to the mean flow, and strong drag at the moving boundary lead to particle displacements that can appear subdiffusive or superdiffusive. In particular, diffusion appears to be superdiffusive along the mean flow direction due to Taylor dispersion effects and subdiffusive along the perpendicular direction due to the gradient in shear rate. The anisotropic force network leads to an additional anisotropy in the diffusivity that is a property of dense systems and has no obvious analog in rapid flows. Specifically, the diffusivity is suppressed along the direction of the strong force network. A simple random walk simulation reproduces the key features of the data, such as the apparent superdiffusive and subdiffusive behavior arising from the mean velocity field, confirming the underlying diffusive motion. The additional anisotropy is not observed in the simulation since the strong force network is not included. Examples of correlated motion, such as transient vortices, and Lévy flights are also observed. Although correlated motion creates velocity fields which are qualitatively different from collisional Brownian motion and can introduce nondiffusive effects, on average the system appears simply diffusive.

  17. Optically transparent multiple access networks employing incoherent spectral codes

    NARCIS (Netherlands)

    Huiszoon, B.

    2008-01-01

    This Ph.D. thesis is divided into 7 chapters to provide the reader an overview of the main results achieved in di®erent sub-topics of the study towards optically transparent multiple access networks employing incoherent spectral codes taking into account wireless transmission aspects. The work

  18. String-like collective motion in the α- and β-relaxation of a coarse-grained polymer melt

    Science.gov (United States)

    Pazmiño Betancourt, Beatriz A.; Starr, Francis W.; Douglas, Jack F.

    2018-03-01

    Relaxation in glass-forming liquids occurs as a multi-stage hierarchical process involving cooperative molecular motion. First, there is a "fast" relaxation process dominated by the inertial motion of the molecules whose amplitude grows upon heating, followed by a longer time α-relaxation process involving both large-scale diffusive molecular motion and momentum diffusion. Our molecular dynamics simulations of a coarse-grained glass-forming polymer melt indicate that the fast, collective motion becomes progressively suppressed upon cooling, necessitating large-scale collective motion by molecular diffusion for the material to relax approaching the glass-transition. In each relaxation regime, the decay of the collective intermediate scattering function occurs through collective particle exchange motions having a similar geometrical form, and quantitative relationships are derived relating the fast "stringlet" collective motion to the larger scale string-like collective motion at longer times, which governs the temperature-dependent activation energies associated with both thermally activated molecular diffusion and momentum diffusion.

  19. Yes, The Precautionary Principle Is Incoherent.

    Science.gov (United States)

    Peterson, Martin

    2017-11-01

    This article is a reply to Thomas Boyer-Kassem's discussion of my criticism of the precautionary principle published in this journal about a decade ago. Boyer-Kassem does not question the logical validity of the theorem proved in my original article, but he brings up important questions about its scope. He also challenges the plausibility of some of the assumptions on which it is based. In this comment, I argue that each objection can be adequately dealt with. As a decision rule, the precautionary principle is (still) incoherent. © 2017 Society for Risk Analysis.

  20. Optimal Exercise Boundary of American Fractional Lookback Option in a Mixed Jump-Diffusion Fractional Brownian Motion Environment

    Directory of Open Access Journals (Sweden)

    Zhaoqiang Yang

    2017-01-01

    Full Text Available A new framework for pricing the American fractional lookback option is developed in the case where the stock price follows a mixed jump-diffusion fraction Brownian motion. By using Itô formula and Wick-Itô-Skorohod integral a new market pricing model is built. The fundamental solutions of stochastic parabolic partial differential equations are estimated under the condition of Merton assumptions. The explicit integral representation of early exercise premium and the critical exercise price are also given. Numerical simulation illustrates some notable features of American fractional lookback options.

  1. Drift motions of small-scale irregularities in the high-latitude F region: An experimental comparison with plasma drift motions

    International Nuclear Information System (INIS)

    Ruohoniemi, J.M.; Greenwald, R.A.; Baker, K.B.; Villain, J.P.; McCready, M.A.

    1987-01-01

    On the evening of January 6, 1986, coordinated observations were carried out with the Johns Hopkins University Applied Physics Laboratory HF coherent scatter radar at Goose Bay, Labrador, and the SRI International incoherent scatter radar at Sondre Stromfjord, Greenland. The common field of view comprised a section of high-latitude F region ionosphere centered on the great circle plane between the radar sites. Over a 40-min period, the HF radar observed strong backscatter from small-scale (13.9 m) field-aligned irregularities. The bulk line-of-sight drift velocity of the irregularities is deduced from the backscatter data. The returns collected simultaneously with the incoherent scatter radar are processed for estimates of the mean line-of-sight ion velocity. Approximately 100 distinct comparisons are possible between the two sets of velocity estimates. Reversals exceeding 1,000 m/s are present in both. In this paper, the authors demonstrate a correspondence between the measured irregularity and ion drifts that is consistent with the supposition that the motion of the irregularities is dominated by convective drift of the ambient plasma. This indicates that the small-scale irregularities detected by HF radars in the high-latitude F region can serve as tracers of ionospheric convective drift

  2. Are Ascriptions of Intentionality to the Brain Incoherent?

    DEFF Research Database (Denmark)

    Presskorn-Thygesen, Thomas

    The ascriptions of ‘agency’ or ‘intentionality’ to the brain has long been regarded with suspicion from social scientists and philosophers. In the talk, I will argue that this suspicion is perfectly legitimate and that the standard response from the defenders of cognitive neuroscience is illegiti...... to the brain are conceptually incoherent because it commits a mereological fallacy (Bennett&Hacker 2001, 2007)....

  3. Phase correction of MR perfusion/diffusion images

    International Nuclear Information System (INIS)

    Chenevert, T.L.; Pipe, J.G.; Brunberg, J.A.; Yeung, H.N.

    1989-01-01

    Apparent diffusion coefficient (ADC) and perfusion MR sequences are exceptionally sensitive to minute motion and, therefore, are prone to bulk motions that hamper ADC/perfusion quantification. The authors have developed a phase correction algorithm to substantially reduce this error. The algorithm uses a diffusion-insensitive data set to correct data that are diffusion sensitive but phase corrupt. An assumption of the algorithm is that bulk motion phase shifts are uniform in one dimension, although they may be arbitrarily large and variable from acquisition to acquisition. This is facilitated by orthogonal section selection. The correction is applied after one Fourier transform of a two-dimensional Fourier transform reconstruction. Imaging experiments on rat and human brain demonstrate significant artifact reduction in ADC and perfusion measurements

  4. Strong motion modeling at the Paducah Diffusion Facility for a large New Madrid earthquake

    International Nuclear Information System (INIS)

    Herrmann, R.B.

    1991-01-01

    The Paducah Diffusion Facility is within 80 kilometers of the location of the very large New Madrid earthquakes which occurred during the winter of 1811-1812. Because of their size, seismic moment of 2.0 x 10 27 dyne-cm or moment magnitude M w = 7.5, the possible recurrence of these earthquakes is a major element in the assessment of seismic hazard at the facility. Probabilistic hazard analysis can provide uniform hazard response spectra estimates for structure evaluation, but a deterministic modeling of a such a large earthquake can provide strong constraints on the expected duration of motion. The large earthquake is modeled by specifying the earthquake fault and its orientation with respect to the site, and by specifying the rupture process. Synthetic time histories, based on forward modeling of the wavefield, from each subelement are combined to yield a three component time history at the site. Various simulations are performed to sufficiently exercise possible spatial and temporal distributions of energy release on the fault. Preliminary results demonstrate the sensitivity of the method to various assumptions, and also indicate strongly that the total duration of ground motion at the site is controlled primarily by the length of the rupture process on the fault

  5. Seismic Response of Power Transmission Tower-Line System Subjected to Spatially Varying Ground Motions

    Directory of Open Access Journals (Sweden)

    Li Tian

    2010-01-01

    Full Text Available The behavior of power transmission tower-line system subjected to spatially varying base excitations is studied in this paper. The transmission towers are modeled by beam elements while the transmission lines are modeled by cable elements that account for the nonlinear geometry of the cables. The real multistation data from SMART-1 are used to analyze the system response subjected to spatially varying ground motions. The seismic input waves for vertical and horizontal ground motions are also generated based on the Code for Design of Seismic of Electrical Installations. Both the incoherency of seismic waves and wave travel effects are accounted for. The nonlinear time history analytical method is used in the analysis. The effects of boundary conditions, ground motion spatial variations, the incident angle of the seismic wave, coherency loss, and wave travel on the system are investigated. The results show that the uniform ground motion at all supports of system does not provide the most critical case for the response calculations.

  6. Selection for biopsy of kidney transplant patients by diffusion-weighted MRI

    Energy Technology Data Exchange (ETDEWEB)

    Steiger, Philipp; Barbieri, Sebastiano; Ith, Michael; Thoeny, Harriet C. [Inselspital, Bern University Hospital, University of Bern, Inselspital, Department of Radiology, Neuroradiology, and Nuclear Medicine, Institute of Diagnostic, Pediatric, and Interventional Radiology, Bern (Switzerland); Kruse, Anja [Inselspital, Bern University Hospital, University of Bern, Inselspital, Department of Nephrology and Hypertension, Bern (Switzerland)

    2017-10-15

    To assess retrospectively whether diffusion-weighted magnetic resonance imaging (DW-MRI) allows physicians to determine the severity of histopathologic findings in biopsies of renal allograft patients with deteriorating renal function. Forty consecutive kidney transplant patients underwent DW-MRI and biopsy. Patients were assigned to one group with severe and to another group with normal or mild histopathologic findings. These two groups were compared based on a qualitative DW-MRI assessment (homo-/heterogeneity) and the combination of qualitative and quantitative DW-MRI parameters (ADC, and intravoxel incoherent motion, IVIM, parameters: D, f, D*). Sensitivity, specificity, and accuracy were determined for each parameter. Biopsy findings were severe in 25 patients and normal or mild in 15 patients. Qualitative DW-MRI led to a sensitivity of 44.0% and a specificity of 93.3%. Combined qualitative and quantitative DW-MRI led to an accuracy of 80% for both the minimal ADC (ADCmin) and the minimal perfusion fraction (fmin) with a sensitivity of 84.0% and 92.0% and a specificity of 73.3% and 60.0%, respectively. Combined qualitative and quantitative DW-MRI might allow physicians to determine the severity of histopathologic findings in biopsies of a high number of kidney transplant patients. (orig.)

  7. Motion discrimination under uncertainty and ambiguity.

    NARCIS (Netherlands)

    Kalisvaart, J.P.; Klaver, I.; Goossens, J.

    2011-01-01

    Speed and accuracy of visual motion discrimination depend systematically on motion strength. This behavior is traditionally explained by diffusion models that assume accumulation of sensory evidence over time to a decision bound. However, how does the brain decide when sensory evidence is ambiguous,

  8. Using intravoxel incoherent motion MR imaging to study the renal pathophysiological process of contrast-induced acute kidney injury in rats: Comparison with conventional DWI and arterial spin labelling

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Long; Zhang, Bin [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, Guangzhou, Guangdong Province (China); Southern Medical University, Graduate College, Guangzhou (China); Chen, Wen-bo; Liang, Chang-hong; Zhang, Shui-xing [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, Guangzhou, Guangdong Province (China); Chan, Kannie W.Y.; Li, Yu-guo; Liu, Guan-shu [The Johns Hopkins University School of Medicine, Russell H. Morgan Department of Radiology and Radiological Sciences, Division of MR Research, Baltimore, MD (United States)

    2016-06-15

    To investigate the potential of intravoxel incoherent motion (IVIM) to assess the renal pathophysiological process in contrast-induced acute kidney injury (CIAKI). Twenty-seven rats were induced with CIAKI model, six rats were imaged longitudinally at 24 h prior to and 30 min, 12, 24, 48, 72 and 96 h after administration; three rats were randomly chosen from the rest for serum creatinine and histological studies. D, f, D* and ADC were calculated from IVIM, and renal blood flow (RBF) was obtained from arterial spin labelling (ASL). A progressive reduction in D and ADC was observed in cortex (CO) by 3.07 and 8.62 % at 30 min, and by 25.77 and 28.16 % at 48 h, respectively. A similar change in outer medulla (OM) and inner medulla (IM) was observed at a later time point (12-72 h). D values were strongly correlated with ADC (r = 0.885). As perfusion measurement, a significant decrease was shown for f in 12-48 h and an increase in 72-96 h. A slightly different trend was found for D*, which was decreased by 26.02, 21.78 and 10.19 % in CO, OM and IM, respectively, at 30 min. f and D* were strongly correlated with RBF in the cortex (r = 0.768, r = 0.67), but not in the medulla. IVIM is an effective imaging tool for monitoring progress in renal pathophysiology undergoing CIAKI. (orig.)

  9. Measuring nanoparticle diffusion in an ABELtrap

    Science.gov (United States)

    Dienerowitz, M.; Dienerowitz, F.; Börsch, M.

    2018-03-01

    Monitoring the Brownian motion of individual nanoscopic objects is key to investigate their transport properties and interactions with their close environment. Most techniques rely on transient diffusion through a detection volume or immobilisation, which restrict observation times or motility. We measure the diffusion coefficient and surface charge of individual nanoparticles and DNA molecules in an anti-Brownian electrokinetic trap (ABELtrap). This instrument is an active feedback trap confining the Brownian motion of a nanoparticle to the detection site by applying an electric field based on the particle’s current position. We simulate the Brownian motion of nanospheres in our sample geometry, including wall effects, due to partial confinement in the third dimension. The theoretically predicted values are in excellent agreement with our diffusion measurements in the ABELtrap. We also demonstrate the ABELtrap’s ability to measure varying sizes of DNA origami structures during denaturation.

  10. Incoherently Coupled Grey-Grey Spatial Soliton Pairs in Biased Two-Photon Photovoltaic Photorefractive Crystals

    International Nuclear Information System (INIS)

    Su Yanli; Jiang Qichang; Ji Xuanmang

    2010-01-01

    The incoherently coupled grey-grey screening-photovoltaic spatial soliton pairs are predicted in biased two-photon photovoltaic photorefractive crystals under steady-state conditions. These grey-grey screening-photovoltaic soliton pairs can be established provided that the incident beams have the same polarization, wavelength, and are mutually incoherent. The grey-grey screening-photovoltaic soliton pairs can be considered as the united form of grey-grey screening soliton pairs and open or closed-circuit grey-grey photovoltaic soliton pairs. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  11. Depth-resolved incoherent and coherent wide-field high-content imaging (Conference Presentation)

    Science.gov (United States)

    So, Peter T.

    2016-03-01

    Recent advances in depth-resolved wide-field imaging technique has enabled many high throughput applications in biology and medicine. Depth resolved imaging of incoherent signals can be readily accomplished with structured light illumination or nonlinear temporal focusing. The integration of these high throughput systems with novel spectroscopic resolving elements further enable high-content information extraction. We will introduce a novel near common-path interferometer and demonstrate its uses in toxicology and cancer biology applications. The extension of incoherent depth-resolved wide-field imaging to coherent modality is non-trivial. Here, we will cover recent advances in wide-field 3D resolved mapping of refractive index, absorbance, and vibronic components in biological specimens.

  12. Investigating the effect of poly-l-lactic acid nanoparticles carrying hypericin on the flow-biased diffusive motion of HeLa cell organelles.

    Science.gov (United States)

    Penjweini, Rozhin; Deville, Sarah; Haji Maghsoudi, Omid; Notelaers, Kristof; Ethirajan, Anitha; Ameloot, Marcel

    2017-07-19

    In this study, we investigate in human cervical epithelial HeLa cells the intracellular dynamics and the mutual interaction with the organelles of the poly-l-lactic acid nanoparticles (PLLA NPs) carrying the naturally occurring hydrophobic photosensitizer hypericin. Temporal and spatiotemporal image correlation spectroscopy was used for the assessment of the intracellular diffusion and directed motion of the nanocarriers by tracking the hypericin fluorescence. Using image cross-correlation spectroscopy and specific fluorescent labelling of endosomes, lysosomes and mitochondria, the NPs dynamics in association with the cell organelles was studied. Static colocalization experiments were interpreted according to the Manders' overlap coefficient. Nanoparticles associate with a small fraction of the whole-organelle population. The organelles moving with NPs exhibit higher directed motion compared to those moving without them. The rate of the directed motion drops substantially after the application of nocodazole. The random component of the organelle motions is not influenced by the NPs. Image correlation and cross-correlation spectroscopy are most appropriate to unravel the motion of the PLLA nanocarrier and to demonstrate that the rate of the directed motion of organelles is influenced by their interaction with the nanocarriers. Not all PLLA-hypericin NPs are associated with organelles. © 2017 Royal Pharmaceutical Society.

  13. Seeded Supercontinuum Generation - Modulation Instability Gain, Coherent and Incoherent Rogue Waves

    DEFF Research Database (Denmark)

    Sørensen, Simon Toft; Larsen, Casper; Møller, Uffe Visbech

    2012-01-01

    Deterministic supercontinuum can be generated by seeding the modulation instability-induced pulse break-up. We investigate the influence of the modulation instability gain on seeding and demonstrate the generation of coherent and incoherent rogue waves....

  14. Diffusion by extrinsic noise in the kicked Harper map

    International Nuclear Information System (INIS)

    Park, Gunyoung; Chang, C. S.

    2001-01-01

    A significantly improved analytic understanding of the extrinsically driven diffusion process is presented in a nonlinear dynamical system in which the phase space is divided into periodic two-dimensional tiles of regular motion, separated by a connected separatrix network (web) [previously studied by A. J. Lichtenberg and Blake P. Wood, Phys. Rev. Lett. >62, 2213 (1989)]. The system is represented by the usual 'kicked Harper map' with added extrinsic noise terms. Three different diffusion regimes are found depending upon the strength of the extrinsic perturbation l relative to the web and regular motions. When the extrinsic noise is dominant over the intrinsic stochasticity and the regular rotation motions in the tile, diffusion obeys the random phase scaling l 2 . When the extrinsic noise is dominant over the intrinsic stochasticity, but weaker than the regular rotation motion, the diffusion scales as lK 1/2 , where K is the strength of the intrinsic kick. These findings agree well with numerical simulation results. When the extrinsic noise process is weaker than the stochastic web process, we analytically reproduce the well-known numerical result: The web diffusion is reduced by the ratio of phase-space areas of intrinsic to extrinsic stochasticity

  15. Thermal diffuse scattering in transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Forbes, B.D.; D' Alfonso, A.J. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Findlay, S.D. [School of Physics, Monash University, Victoria 3800 (Australia); Van Dyck, D. [EMAT, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); LeBeau, J.M. [North Carolina State University, Raleigh, NC 27695-7907 (United States); Stemmer, S. [Materials Department, University of California, Santa Barbara, CA 93106-5050 (United States); Allen, L.J., E-mail: lja@unimelb.edu.au [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia)

    2011-12-15

    In conventional transmission electron microscopy, thermal scattering significantly affects the image contrast. It has been suggested that not accounting for this correctly is the main cause of the Stobbs factor, the ubiquitous, large contrast mismatch found between theory and experiment. In the case where a hard aperture is applied, we show that previous conclusions drawn from work using bright field scanning transmission electron microscopy and invoking the principle of reciprocity are reliable in the presence of thermal scattering. In the aperture-free case it has been suggested that even the most sophisticated mathematical models for thermal diffuse scattering lack in their numerical implementation, specifically that there may be issues in sampling, including that of the contrast transfer function of the objective lens. We show that these concerns can be satisfactorily overcome with modest computing resources; thermal scattering can be modelled accurately enough for the purpose of making quantitative comparison between simulation and experiment. Spatial incoherence of the source is also investigated. Neglect or inadequate handling of thermal scattering in simulation can have an appreciable effect on the predicted contrast and can be a significant contribution to the Stobbs factor problem. -- Highlights: Black-Right-Pointing-Pointer We determine the numerical requirements for accurate simulation of TDS in CTEM. Black-Right-Pointing-Pointer TDS can be simulated to high precision using the Born-Oppenheimer model. Black-Right-Pointing-Pointer Such calculations establish the contribution of TDS to the Stobbs factor problem. Black-Right-Pointing-Pointer Treating spatial incoherence using envelope functions increases image contrast. Black-Right-Pointing-Pointer Rigorous treatment of spatial incoherence significantly reduces image contrast.

  16. Incoherent neutron-scattering determination of hydrogen content : Theory and modeling

    NARCIS (Netherlands)

    Perego, R.C.; Blaauw, M.

    2005-01-01

    Hydrogen concentrations of 0 up to 350?mg/kg in a titanium alloy have been determined at National Institute of Standards and Technology (NIST) with neutron incoherent scattering (NIS) and with cold neutron prompt gamma activation analysis. The latter is a well-established technique, while the former

  17. Edgeworth expansion for functionals of continuous diffusion processes

    DEFF Research Database (Denmark)

    Podolskij, Mark; Yoshida, Nakahiro

    This paper presents new results on the Edgeworth expansion for high frequency functionals of continuous diffusion processes. We derive asymptotic expansions for weighted functionals of the Brownian motion and apply them to provide the Edgeworth expansion for power variation of diffusion processes....... Our methodology relies on martingale embedding, Malliavin calculus and stable central limit theorems for semimartingales. Finally, we demonstrate the density expansion for studentized statistics of power variations.......This paper presents new results on the Edgeworth expansion for high frequency functionals of continuous diffusion processes. We derive asymptotic expansions for weighted functionals of the Brownian motion and apply them to provide the Edgeworth expansion for power variation of diffusion processes...

  18. Atomic form factors, incoherent scattering functions, and photon scattering cross sections

    International Nuclear Information System (INIS)

    Hubbell, J.H.; Veigele, W.J.; Briggs, E.A.; Brown, R.T.; Cromer, D.T.; Howerton, R.J.

    1975-01-01

    Tabulations are presented of the atomic form factor, F (α,Z), and the incoherent scattering function, S (x,Z), for values of x (=sin theta/2)/lambda) from 0.005 A -1 to 10 9 A -1 , for all elements A=1 to 100. These tables are constructed from available state-of-the-art theoretical data, including the Pirenne formulas for Z=1, configuration-into action results by Brown using Brown-Fontana and Weiss correlated wavefunctions for Z=2 to 6 non-relativistic Hartree-Fock results by Cromer for Z=7 to 100 and a relativistic K-shell analytic expression for F (x,Z) by Bethe Levinger for x>10 A -1 for all elements Z=2 to 100. These tabulated values are graphically compared with available photon scattering angular distribution measurements. Tables of coherent (Rayleigh) and incoherent (Compton) total scattering cross sections obtained by nummerical integration over combinations of F 2 (x,Z) with the Thomson formula and S (x,Z) with the Klum-Nishina Formual, respectively, are presented for all elements Z=1 to 100, for photon energies 100 eV (lambda=124 A) to 100 MeV (0.000124 A). The incoherent scattering cross sections also include the radiative and double-Compton corrections as given by Mork. Similar tables are presented for the special cases of terminally-bonded hydrogen and for the H 2 molecule, interpolated and extrapolated from values calculated by Stewart et al., and by Bentley and Stewart using Kolos-Roothaan wavefunctions

  19. QR code optical encryption using spatially incoherent illumination

    Science.gov (United States)

    Cheremkhin, P. A.; Krasnov, V. V.; Rodin, V. G.; Starikov, R. S.

    2017-02-01

    Optical encryption is an actively developing field of science. The majority of encryption techniques use coherent illumination and suffer from speckle noise, which severely limits their applicability. The spatially incoherent encryption technique does not have this drawback, but its effectiveness is dependent on the Fourier spectrum properties of the image to be encrypted. The application of a quick response (QR) code in the capacity of a data container solves this problem, and the embedded error correction code also enables errorless decryption. The optical encryption of digital information in the form of QR codes using spatially incoherent illumination was implemented experimentally. The encryption is based on the optical convolution of the image to be encrypted with the kinoform point spread function, which serves as an encryption key. Two liquid crystal spatial light modulators were used in the experimental setup for the QR code and the kinoform imaging, respectively. The quality of the encryption and decryption was analyzed in relation to the QR code size. Decryption was conducted digitally. The successful decryption of encrypted QR codes of up to 129  ×  129 pixels was demonstrated. A comparison with the coherent QR code encryption technique showed that the proposed technique has a signal-to-noise ratio that is at least two times higher.

  20. Molecular Dynamics Simulation of Salt Diffusion in Polyelectrolyte Assemblies.

    Science.gov (United States)

    Zhang, Ran; Duan, Xiaozheng; Ding, Mingming; Shi, Tongfei

    2018-06-05

    The diffusion of salt ions and charged probe molecules in polyelectrolyte assemblies is often assumed to follow a theoretical hopping model, in which the diffusing ion is hopping between charged sites of chains based on electroneutrality. However, experimental verification of diffusing pathway at such microscales is difficult, and the corresponding molecular mechanisms remain elusive. In this study, we perform all-atom molecular dynamics (MD) simulations of salt diffusion in polyelectrolyte (PE) assembly of poly (sodium 4-styrenesulfonate) (PSS) and poly (diallyldimethylammonium chloride) (PDAC). Besides the ion hopping mode, the diffusing trajectories are found presenting common features of a jump process, i.e., subjecting to PE relaxation, water pockets in the structure open and close, thus the ion can move from one pocket to another. Anomalous subdiffusion of ions and water is observed due to the trapping scenarios in these water pockets. The jump events are much rarer compared with ion hopping but significantly increases salt diffusion with increasing temperature. Our result strongly indicates that salt diffusion in hydrated PDAC/PSS is a combined process of ion hopping and jump motion. This provides new molecular explanation for the coupling of salt motion with chain motion and the nonlinear increase of salt diffusion at glass transition temperature.

  1. Interfacial Energy and Fine Defect Structures for Incoherent Films

    OpenAIRE

    Cermelli, Paolo; Gurtin, Morton E.; Leoni, Giovanni

    1999-01-01

    This note summarizes recent results in which modern techniques of the calculus of variations are used to obtain qualitative features of film-substrate interfaces for a broad class of interfacial energies. In particular, we show that the existence of a critical thickness for incoherency and the formation of interfacial dislocations depend strongly on the convexity and smoothness of the interfacial energy function.

  2. Determination of the thermospheric neutral wind from incoherent scatter radar measurements

    International Nuclear Information System (INIS)

    Haeggstroem, I.; Murdin, J.; Rees, D.

    1984-11-01

    Measurements made by the EISCAT UHF incoherent scatter radar are used to derive thermospheric winds. The derived wind is compared to Fabry-Perot interferometer measurements of the neutral wind made simultaneously. The uncertainties in the radar derived wind are discussed. (author)

  3. Motion of 1/3<111> dislocations on Σ3 (112) twin boundaries in nanotwinned copper

    Energy Technology Data Exchange (ETDEWEB)

    Lu, N.; Du, K., E-mail: kuidu@imr.ac.cn [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China); Beijing National Center for Electron Microscopy, Tsinghua University, Beijing 100084 (China); Lu, L.; Ye, H. Q. [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, Shenyang 110016 (China)

    2014-01-14

    The atomic structure of Σ3 (112) ITBs in nanotwinned Cu is investigated by using aberration-corrected high resolution transmission electron microscopy (HRTEM) and in situ HRTEM observations. The Σ3 (112) ITBs are consisted of periodically repeated three partial dislocations. The in situ HRTEM results show that 1/3[111] partial dislocation moves on the Σ3 (112) incoherent twin boundary (ITB), which was accompanied by a migration of the ITB. A dislocation reaction mechanism is proposed for the motion of 1/3[111] Frank partial dislocation, in which the 1/3[111] partial dislocation exchanges its position with twin boundary dislocations in sequence. In this way, the 1/3[111] dislocation can move on the incoherent twin boundary in metals with low stacking fault energy. Meanwhile, the ITB will migrate in its normal direction accordingly. These results provide insight into the reaction mechanism of 1/3[111] dislocations and ITBs and the associated migration of ITBs.

  4. CINCH (confocal incoherent correlation holography) super resolution fluorescence microscopy based upon FINCH (Fresnel incoherent correlation holography).

    Science.gov (United States)

    Siegel, Nisan; Storrie, Brian; Bruce, Marc; Brooker, Gary

    2015-02-07

    FINCH holographic fluorescence microscopy creates high resolution super-resolved images with enhanced depth of focus. The simple addition of a real-time Nipkow disk confocal image scanner in a conjugate plane of this incoherent holographic system is shown to reduce the depth of focus, and the combination of both techniques provides a simple way to enhance the axial resolution of FINCH in a combined method called "CINCH". An important feature of the combined system allows for the simultaneous real-time image capture of widefield and holographic images or confocal and confocal holographic images for ready comparison of each method on the exact same field of view. Additional GPU based complex deconvolution processing of the images further enhances resolution.

  5. Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures

    Science.gov (United States)

    Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.

    2018-05-01

    Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.

  6. Controlling the light propagation in one-dimensional photonic crystal via incoherent pump and interdot tunneling

    Science.gov (United States)

    Abbasabadi, Majid; Sahrai, Mostafa

    2018-01-01

    We investigated the propagation of an electromagnetic pulse through a one-dimensional photonic crystal doped with quantum-dot (QD) molecules in a defect layer. The QD molecules behave as a three-level quantum system and are driven by a coherent probe laser field and an incoherent pump field. No coherent coupling laser fields were introduced, and the coherence was created by the interdot tunnel effect. Further studied was the effect of tunneling and incoherent pumping on the group velocity of the transmitted and reflected probe pulse.

  7. Resolving Fast, Confined Diffusion in Bacteria with Image Correlation Spectroscopy.

    Science.gov (United States)

    Rowland, David J; Tuson, Hannah H; Biteen, Julie S

    2016-05-24

    By following single fluorescent molecules in a microscope, single-particle tracking (SPT) can measure diffusion and binding on the nanometer and millisecond scales. Still, although SPT can at its limits characterize the fastest biomolecules as they interact with subcellular environments, this measurement may require advanced illumination techniques such as stroboscopic illumination. Here, we address the challenge of measuring fast subcellular motion by instead analyzing single-molecule data with spatiotemporal image correlation spectroscopy (STICS) with a focus on measurements of confined motion. Our SPT and STICS analysis of simulations of the fast diffusion of confined molecules shows that image blur affects both STICS and SPT, and we find biased diffusion rate measurements for STICS analysis in the limits of fast diffusion and tight confinement due to fitting STICS correlation functions to a Gaussian approximation. However, we determine that with STICS, it is possible to correctly interpret the motion that blurs single-molecule images without advanced illumination techniques or fast cameras. In particular, we present a method to overcome the bias due to image blur by properly estimating the width of the correlation function by directly calculating the correlation function variance instead of using the typical Gaussian fitting procedure. Our simulation results are validated by applying the STICS method to experimental measurements of fast, confined motion: we measure the diffusion of cytosolic mMaple3 in living Escherichia coli cells at 25 frames/s under continuous illumination to illustrate the utility of STICS in an experimental parameter regime for which in-frame motion prevents SPT and tight confinement of fast diffusion precludes stroboscopic illumination. Overall, our application of STICS to freely diffusing cytosolic protein in small cells extends the utility of single-molecule experiments to the regime of fast confined diffusion without requiring advanced

  8. Microscopic theory of coherent and incoherent optical properties of semiconductor heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, Martin

    2008-09-02

    An important question is whether there is a regime in which lasing from indirect semiconductors is possible. Thus, we discuss this question in this thesis. It is shown that under incoherent emission conditions it is possible to create an exciton condensate in multiple-quantum-well (MQW) systems. The influence of a MQW structure on the exciton lifetime is investigated. For the description of the light-matter interaction of a QW in the coherent excitation regime, the semiconductor Bloch equation (SBE) are used. The incoherent regime is described by the semiconductor luminescence equations (SLE). In principle it is even possible to couple SBE and SLE. The resulting theory is able to describe interactions between coherent and incoherent processes we investigate both, the coherent and the incoherent light-emission regime. Thus we define the investigated system and introduce the many-body Hamiltonian that describes consistently the light-matter interaction in the classical and the quantum limit. We introduce the SBE that allow to compute the light-matter interaction in the coherent scenario. The extended scattering model is used to investigate the absorption of a Ge QW for different time delays after the excitations. In this context, we analyze whether there is a regime in which optical gain can be realized. Then we apply a transfer-matrix method to include into our calculations the influence of the dielectric environment on the optical response. Thereafter the SLE for a MQW system are introduced. We derive a scheme that allows for decoupling environmental effects from the pure PL-emission properties of the QW. The PL of the actual QW system is obtained by multiplying this filter function and the free-space PL that describes the quantum emission into a medium with spatially constant background-refractive index. It is studied how the MQW-Bragg structure influences the PL-emission properties compared to the emission of a single QW device. As a last feature, it is shown

  9. Plasma wakefields driven by an incoherent combination of laser pulses: a path towards high-average power laser-plasma accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Benedetti, C.; Schroeder, C.B.; Esarey, E.; Leemans, W.P.

    2014-05-01

    he wakefield generated in a plasma by incoherently combining a large number of low energy laser pulses (i.e.,without constraining the pulse phases) is studied analytically and by means of fully-self-consistent particle-in-cell simulations. The structure of the wakefield has been characterized and its amplitude compared with the amplitude of the wake generated by a single (coherent) laser pulse. We show that, in spite of the incoherent nature of the wakefield within the volume occupied by the laser pulses, behind this region the structure of the wakefield can be regular with an amplitude comparable or equal to that obtained from a single pulse with the same energy. Wake generation requires that the incoherent structure in the laser energy density produced by the combined pulses exists on a time scale short compared to the plasma period. Incoherent combination of multiple laser pulses may enable a technologically simpler path to high-repetition rate, high-average power laser-plasma accelerators and associated applications.

  10. Coherent Forward Stimulated-Brillouin Scattering of a Spatially Incoherent Laser Beam in a Plasma and Its Effect on Beam Spray

    International Nuclear Information System (INIS)

    Grech, M.; Riazuelo, G.; Pesme, D.; Weber, S.; Tikhonchuk, V. T.

    2009-01-01

    A statistical model for forward stimulated-Brillouin scattering is developed for a spatially incoherent, monochromatic, laser beam propagating in a plasma. The threshold above which the laser beam spatial incoherence cannot prevent the coherent growth of forward stimulated-Brillouin scattering is computed. It is found to be well below the threshold for self-focusing. Three-dimensional simulations confirm its existence and reveal the onset of beam spray above it. From these results, we propose a new figure of merit for the control of propagation through a plasma of a spatially incoherent laser beam

  11. Wavevector and energy resolution of the polarized diffuse scattering spectrometer D7

    Energy Technology Data Exchange (ETDEWEB)

    Fennell, T., E-mail: tom.fennell@psi.ch [Laboratory for Neutron Scattering and Imaging, Paul Scherrer Institut, 5232 Villigen PSI (Switzerland); Mangin-Thro, L., E-mail: mangin-throl@ill.fr [Institut Laue-Langevin, 71 avenue des Martyrs, CS 20156 - 38042 Grenoble Cedex 9 (France); Mutka, H., E-mail: mutka@ill.fr [Institut Laue-Langevin, 71 avenue des Martyrs, CS 20156 - 38042 Grenoble Cedex 9 (France); Nilsen, G.J., E-mail: goran.nilsen@stfc.ac.uk [ISIS Neutron and Muon Source, Rutherford Appleton Laboratory, Didcot OX11 0QX (United Kingdom); Wildes, A.R., E-mail: wildes@ill.fr [Institut Laue-Langevin, 71 avenue des Martyrs, CS 20156 - 38042 Grenoble Cedex 9 (France)

    2017-06-11

    The instrumental divergence parameters and resolution for the D7 neutron diffuse scattering spectrometer at the Institut Laue-Langevin, France, are presented. The resolution parameters are calibrated against measurements of powders, single crystals, and the incoherent scattering from vanadium. We find that the powder diffraction resolution is well described by the Cagliotti function, the single crystal resolution function can be parameterized using the Cooper-Nathans formalism, and that in time-of-flight mode the energy resolution is consistent with monochromatic focussing.

  12. The study of diffusion in network-forming liquids under pressure and temperature

    Energy Technology Data Exchange (ETDEWEB)

    Hung, P.K. [Department of Computational Physics, Hanoi University of Technology, 1Dai Co Viet, Hanoi (Viet Nam); Kien, P.H., E-mail: phkien80@gmail.com [Department of Physics, Thainguyen University of Education, 20 Luong Ngoc Quyen, Thainguyen (Viet Nam); San, L.T.; Hong, N.V. [Department of Computational Physics, Hanoi University of Technology, 1Dai Co Viet, Hanoi (Viet Nam)

    2016-11-15

    In this paper, the molecular dynamics simulation is applied to investigate the diffusion in silica liquids under different temperature and pressure. We show that the diffusion is controlled by the rate of effective SiO{sub x}→SiO{sub x±1} and OSi{sub y}→OSi{sub y±1} reaction. With increasing the pressure, the rate of reaction increases and the Si–O bond is weaker. Moreover, the reactions are not uniformly distributed in the space, but instead they happen frequently or rarely in separate regions. We also reveal two motion types: free and correlation motion. The correlation motion concerns the moving of a group of atoms which is similar to that of the diffusion of a super-molecule in the liquid. A detailed analysis of the movement of atoms from specified set shows the clustering of them which indicates structure and dynamics heterogeneity. Further, we find that the correlation motion is very important for the diffusion in network-forming liquid. The observed phenomena such as diffusion anomaly, dynamics heterogeneity and dynamical slowdown are originated from the correlation motion of atom.

  13. Continuum random-phase approximation study of the incoherent μ--e- conversion rate and its spurious 1- admixture

    International Nuclear Information System (INIS)

    Papakonstantinou, P.; Wambach, J.; Kosmas, T.S.; Faessler, A.

    2006-01-01

    The incoherent transition strength of the exotic μ - -e - conversion in the 208 Pb nucleus is investigated by utilizing the continuum random-phase-approximation method, appropriate for the evaluation of the rate that goes to the continuum of the nuclear spectrum. We find that the contribution of resonances lying high in the continuum is not negligible. Special attention is paid to the detailed study of the pronounced 1 - contribution that according to previous calculations, dominates the overall incoherent rate in about all the nuclear targets. The spurious center-of-mass admixture to the partial rate originating from the 1 - excitations is explored, and its elimination is performed by correcting properly the dipole operators. The results found this way show that the greatest portion of the total 1 - contribution to the incoherent rate is spurious

  14. Coherent quantum dynamics launched by incoherent relaxation in a quantum circuit simulator of a light-harvesting complex

    Science.gov (United States)

    Chin, A. W.; Mangaud, E.; Atabek, O.; Desouter-Lecomte, M.

    2018-06-01

    Engineering and harnessing coherent excitonic transport in organic nanostructures has recently been suggested as a promising way towards improving manmade light-harvesting materials. However, realizing and testing the dissipative system-environment models underlying these proposals is presently very challenging in supramolecular materials. A promising alternative is to use simpler and highly tunable "quantum simulators" built from programmable qubits, as recently achieved in a superconducting circuit by Potočnik et al. [A. Potočnik et al., Nat. Commun. 9, 904 (2018), 10.1038/s41467-018-03312-x]. We simulate the real-time dynamics of an exciton coupled to a quantum bath as it moves through a network based on the quantum circuit of Potočnik et al. Using the numerically exact hierarchical equations of motion to capture the open quantum system dynamics, we find that an ultrafast but completely incoherent relaxation from a high-lying "bright" exciton into a doublet of closely spaced "dark" excitons can spontaneously generate electronic coherences and oscillatory real-space motion across the network (quantum beats). Importantly, we show that this behavior also survives when the environmental noise is classically stochastic (effectively high temperature), as in present experiments. These predictions highlight the possibilities of designing matched electronic and spectral noise structures for robust coherence generation that do not require coherent excitation or cold environments.

  15. The Trouble with Diffusion

    Directory of Open Access Journals (Sweden)

    R.T. DeHoff

    2002-09-01

    Full Text Available The phenomenological formalism, which yields Fick's Laws for diffusion in single phase multicomponent systems, is widely accepted as the basis for the mathematical description of diffusion. This paper focuses on problems associated with this formalism. This mode of description of the process is cumbersome, defining as it does matrices of interdiffusion coefficients (the central material properties that require a large experimental investment for their evaluation in three component systems, and, indeed cannot be evaluated for systems with more than three components. It is also argued that the physical meaning of the numerical values of these properties with respect to the atom motions in the system remains unknown. The attempt to understand the physical content of the diffusion coefficients in the phenomenological formalism has been the central fundamental problem in the theory of diffusion in crystalline alloys. The observation by Kirkendall that the crystal lattice moves during diffusion led Darken to develop the concept of intrinsic diffusion, i.e., atom motion relative to the crystal lattice. Darken and his successors sought to relate the diffusion coefficients computed for intrinsic fluxes to those obtained from the motion of radioactive tracers in chemically homogeneous samples which directly report the jump frequencies of the atoms as a function of composition and temperature. This theoretical connection between tracer, intrinsic and interdiffusion behavior would provide the basis for understanding the physical content of interdiffusion coefficients. Definitive tests of the resulting theoretical connection have been carried out for a number of binary systems for which all three kinds of observations are available. In a number of systems predictions of intrinsic coefficients from tracer data do not agree with measured values although predictions of interdiffusion coefficients appear to give reasonable agreement. Thus, the complete

  16. Analysis of clad motion during a loss of flow (LOF) accident in a fast sodium cooled reactor

    International Nuclear Information System (INIS)

    Henkel, P.

    1985-10-01

    A new model describing clad motion during a Loss of Flow (LOF) accident in a Liquid Metal Cooled Fast (Breeder) Reactor (LMFBR) is presented. Its special features are Clad motion is treated within a fuel pin bundle. The bundle geometry is represented by an equivalent annular geometry which serves as the descriptional basis for the clad motion analysis; Several flow regimes are considered. These include a wave or film flow along the fuel pin surfaces as well as a drop flow within the coolant channels. A new entrainment criterion is successfully applied to describe the entrainment of molten cladding and the coolant flow is modelled as a two-dimensional, monstationary flow. Therefore, radial cross flows in a pin bundle can be calculated. Especially, thermal incoherency effects can be treated consistently. The analysis of clad motion in the two experiments STAR1 and STAR2 using the subsequently presented SANDCMOT model gives good agreement with the experimental data. (orig.) [de

  17. Coherent and incoherent J /ψ photonuclear production in an energy-dependent hot-spot model

    Science.gov (United States)

    Cepila, J.; Contreras, J. G.; Krelina, M.

    2018-02-01

    In a previous publication, we have presented a model for the photoproduction of J /ψ vector mesons off protons, where the proton structure in the impact-parameter plane is described by an energy-dependent hot-spot profile. Here we extend this model to study the photonuclear production of J /ψ vector mesons in coherent and incoherent interactions of heavy nuclei. We study two methods to extend the model to the nuclear case: using the standard Glauber-Gribov formalism and using geometric scaling to obtain the nuclear saturation scale. We find that the incoherent cross section changes sizably with the inclusion of subnucleonic hot spots and that this change is energy dependent. We propose to search for this behavior by measuring the ratio of the incoherent to coherent cross sections at different energies. We compare the results of our model to results from the Relativistic Heavy-Ion Collider (RHIC) and from run 1 at the Large Hadron Collider (LHC), finding satisfactory agreement. We also present predictions for the LHC at the new energies reached in run 2. The predictions include J /ψ production in ultraperipheral collisions, as well as the recently observed photonuclear production in peripheral collisions.

  18. Diffusion effects in undulator radiation

    Directory of Open Access Journals (Sweden)

    Ilya Agapov

    2014-11-01

    Full Text Available Quantum diffusion effects in undulator radiation in semiclassical approximation are considered. Short-term effects on the electron beam motion are discussed and it is shown that approaches based on diffusion approximation with drift-diffusion coefficients derived from undulator or bending magnet radiation spectrum, and on Poisson statistics with radiation spectrum defined by the local beding field, all lead to similar results in terms of electron energy spread for cases of practical interest. An analytical estimate of the influence of quantum diffusion on the undulator radiation spectrum is derived.

  19. Quantum imaging with incoherently scattered light from a free-electron laser

    Science.gov (United States)

    Schneider, Raimund; Mehringer, Thomas; Mercurio, Giuseppe; Wenthaus, Lukas; Classen, Anton; Brenner, Günter; Gorobtsov, Oleg; Benz, Adrian; Bhatti, Daniel; Bocklage, Lars; Fischer, Birgit; Lazarev, Sergey; Obukhov, Yuri; Schlage, Kai; Skopintsev, Petr; Wagner, Jochen; Waldmann, Felix; Willing, Svenja; Zaluzhnyy, Ivan; Wurth, Wilfried; Vartanyants, Ivan A.; Röhlsberger, Ralf; von Zanthier, Joachim

    2018-02-01

    The advent of accelerator-driven free-electron lasers (FEL) has opened new avenues for high-resolution structure determination via diffraction methods that go far beyond conventional X-ray crystallography methods. These techniques rely on coherent scattering processes that require the maintenance of first-order coherence of the radiation field throughout the imaging procedure. Here we show that higher-order degrees of coherence, displayed in the intensity correlations of incoherently scattered X-rays from an FEL, can be used to image two-dimensional objects with a spatial resolution close to or even below the Abbe limit. This constitutes a new approach towards structure determination based on incoherent processes, including fluorescence emission or wavefront distortions, generally considered detrimental for imaging applications. Our method is an extension of the landmark intensity correlation measurements of Hanbury Brown and Twiss to higher than second order, paving the way towards determination of structure and dynamics of matter in regimes where coherent imaging methods have intrinsic limitations.

  20. Improved BER based on intensity noise alleviation using developed detection technique for incoherent SAC-OCDMA systems

    Science.gov (United States)

    Al-Khafaji, Hamza M. R.; Aljunid, S. A.; Fadhil, Hilal A.

    2012-06-01

    The major drawback of incoherent spectral-amplitude coding optical code-division multiple-access (SAC-OCDMA) systems is their inherent intensity noise originating due to the incoherency of the broadband light sources. In this paper, we propose a developed detection technique named the modified-AND subtraction detection for incoherent SAC-OCDMA systems. This detection technique is based upon decreasing the received signal strength during the decoding process by dividing the spectrum of the utilized code sequence. The proposed technique is capable of mitigating the intensity noise effect, as well as suppressing the multiple-access interference impact. Based on modified quadratic congruence (MQC) code, the analytical results reveal that the modified-AND detection offer best bit-error rate (BER) performance and enables MQC code to support higher transmission rate up to 1.25 Gb/s compared to conventional AND detection. Furthermore, we ascertained that the proposed technique enhances the system performance using a simulation experiment.

  1. Evidence of strong proton shape fluctuations from incoherent diffraction

    International Nuclear Information System (INIS)

    Mantysaari, H.; Schenke, B.

    2016-01-01

    We show within the saturation framework that measurements of exclusive vector meson production at high energy provide evidence for strong geometric fluctuations of the proton. In comparison, the effect of saturation scale and color charge fluctuations is weak. This knowledge will allow detailed future measurements of the incoherent cross section to tightly constrain the fluctuating geometry of the proton as a function of the parton momentum fraction x.

  2. Support vector machine for breast cancer classification using diffusion-weighted MRI histogram features: Preliminary study.

    Science.gov (United States)

    Vidić, Igor; Egnell, Liv; Jerome, Neil P; Teruel, Jose R; Sjøbakk, Torill E; Østlie, Agnes; Fjøsne, Hans E; Bathen, Tone F; Goa, Pål Erik

    2018-05-01

    Diffusion-weighted MRI (DWI) is currently one of the fastest developing MRI-based techniques in oncology. Histogram properties from model fitting of DWI are useful features for differentiation of lesions, and classification can potentially be improved by machine learning. To evaluate classification of malignant and benign tumors and breast cancer subtypes using support vector machine (SVM). Prospective. Fifty-one patients with benign (n = 23) and malignant (n = 28) breast tumors (26 ER+, whereof six were HER2+). Patients were imaged with DW-MRI (3T) using twice refocused spin-echo echo-planar imaging with echo time / repetition time (TR/TE) = 9000/86 msec, 90 × 90 matrix size, 2 × 2 mm in-plane resolution, 2.5 mm slice thickness, and 13 b-values. Apparent diffusion coefficient (ADC), relative enhanced diffusivity (RED), and the intravoxel incoherent motion (IVIM) parameters diffusivity (D), pseudo-diffusivity (D*), and perfusion fraction (f) were calculated. The histogram properties (median, mean, standard deviation, skewness, kurtosis) were used as features in SVM (10-fold cross-validation) for differentiation of lesions and subtyping. Accuracies of the SVM classifications were calculated to find the combination of features with highest prediction accuracy. Mann-Whitney tests were performed for univariate comparisons. For benign versus malignant tumors, univariate analysis found 11 histogram properties to be significant differentiators. Using SVM, the highest accuracy (0.96) was achieved from a single feature (mean of RED), or from three feature combinations of IVIM or ADC. Combining features from all models gave perfect classification. No single feature predicted HER2 status of ER + tumors (univariate or SVM), although high accuracy (0.90) was achieved with SVM combining several features. Importantly, these features had to include higher-order statistics (kurtosis and skewness), indicating the importance to account for heterogeneity. Our

  3. Incoherent scattering of gamma photons for non-destructive tomographic inspection of pipeline

    International Nuclear Information System (INIS)

    Sharma, Amandeep; Sandhu, B.S.; Singh, Bhajan

    2010-01-01

    A scanner system, operating in a non-destructive and non-invasive way, is presented for pipeline to determine its location in land soil, wall thickness, type of liquid flowing and crack/blockage position. The present experiment simulates a real case where pipe corrosion (wall thinning) under insulation can be known from the study of incoherent scattering of 662 keV gamma photons. The incoherent scattered intensity, obtained by unfolding (deconvolution) the experimental pulse-height distribution of NaI(Tl) scintillation detector with the help of inverse response matrix, provides the desired information. The method is quite sensitive for small change (∼1 mm) in the thickness of pipe wall, locating a defect of 1 mm width under insulation and a small change (∼0.1 gm cm -3 ) in the density of liquid flowing through pipe.

  4. Mechanism and kinetics of hydrated electron diffusion

    International Nuclear Information System (INIS)

    Tay, Kafui A.; Coudert, Francois-Xavier; Boutin, Anne

    2008-01-01

    Molecular dynamics simulations are used to study the mechanism and kinetics of hydrated electron diffusion. The electron center of mass is found to exhibit Brownian-type behavior with a diffusion coefficient considerably greater than that of the solvent. As previously postulated by both experimental and theoretical works, the instantaneous response of the electron to the librational motions of surrounding water molecules constitutes the principal mode of motion. The diffusive mechanism can be understood within the traditional framework of transfer diffusion processes, where the diffusive step is akin to the exchange of an extramolecular electron between neighboring water molecules. This is a second-order process with a computed rate constant of 5.0 ps -1 at 298 K. In agreement with experiment the electron diffusion exhibits Arrhenius behavior over the temperature range of 298-400 K. We compute an activation energy of 8.9 kJ mol -1 . Through analysis of Arrhenius plots and the application of a simple random walk model it is demonstrated that the computed rate constant for exchange of an excess electron is indeed the phenomenological rate constant associated with the diffusive process

  5. Turbulent diffusion of small particles

    International Nuclear Information System (INIS)

    Margolin, L.G.

    1977-11-01

    The diffusion of small, spherical, rigid particles suspended in an incompressible turbulent fluid, but not interacting with each other, was studied. As a stochastic process, the turbulent fluid velocity field is assumed to be homogeneous, isotropic and stationary. Assuming the Stokes regime, a particle of equation of motion is used which includes only the effects of Stokes drag and a virtual mass force and an exact solution is found for the particle velocity correlation function, for all times and initial conditions, in terms of a fluid velocity correlation function measured along the motion of the particle. This shows that for times larger than a certain time scale, the particle velocity correlation becomes stationary. The effect of small shears in the fluid velocity was considered, under the additional restrictions of a certain high frequency regime for the turbulence. The shears convected past the particle much faster than the growth of the boundary layer. New force terms due to the presence of such shears are calculated and incorporated into the equation of motion. A perturbation solution to this equation is constructed, and the resultant particle velocity correlation function and diffusion coefficient are calculated. To lowest order, the particle diffusivity is found to be unaltered by the presence of small mean flow shears. The last model treated is one in which particles traverse a turbulent fluid with a large mean velocity. Among other restrictions, linearized form drag is assumed. The diffusion coefficient for such particles was calculated, and found to be much smaller than the passive scalar diffusion coefficient. This agrees within 5 percent with the experimental results of Snyder and Lumley

  6. On the application of the theory of the translational Brownian movement to the calculation of the differential cross-sections for the incoherent scattering of slow neutrons

    International Nuclear Information System (INIS)

    Coffey, W.T.

    1978-01-01

    It is shown how three models (based on the theory of the Brownian movement) for the translational motion of an atom in a fluid may be used to calculate explicitly the intermediate scattering functions and differential cross-sections for the incoherent scattering of slow neutrons. In the first model the translational motion of the atom is represented by the motion of a particle in space subjected to no forces other than those arising from the thermal motion of its surroundings. The differential scattering cross-section for this model is then obtained as a continued fraction similar to that given by Sack (Proc. Phys. Soc.; B70:402 and 414 (1957)) for the electric polarisability in his investigation of the role of inertial effects in dielectric relaxation. The second model is a corrected version of the itinerant oscillator model of Sears (Proc. Phys. Soc.; 86:953 (1965)). Here the differential cross-section is obtained in the form of a series and a closed-form expression is found for the intermediate scattering function. The last model to be considered is the harmonically bound particle where again a closed form expression is obtained for the intermediate scattering function. In each case the intermediate scattering function has a mathematical form which is similar to the after-effect function describing the decay of electric polarisation for the rotational versions of the models. (author)

  7. Motion of 1/3⟨111⟩ dislocations on Σ3 {112} twin boundaries in nanotwinned copper

    Science.gov (United States)

    Lu, N.; Du, K.; Lu, L.; Ye, H. Q.

    2014-01-01

    The atomic structure of Σ3 {112} ITBs in nanotwinned Cu is investigated by using aberration-corrected high resolution transmission electron microscopy (HRTEM) and in situ HRTEM observations. The Σ3 {112} ITBs are consisted of periodically repeated three partial dislocations. The in situ HRTEM results show that 1/3[111] partial dislocation moves on the Σ3 {112} incoherent twin boundary (ITB), which was accompanied by a migration of the ITB. A dislocation reaction mechanism is proposed for the motion of 1/3[111] Frank partial dislocation, in which the 1/3[111] partial dislocation exchanges its position with twin boundary dislocations in sequence. In this way, the 1/3[111] dislocation can move on the incoherent twin boundary in metals with low stacking fault energy. Meanwhile, the ITB will migrate in its normal direction accordingly. These results provide insight into the reaction mechanism of 1/3[111] dislocations and ITBs and the associated migration of ITBs.

  8. Mechanisms underlying anomalous diffusion in the plasma membrane.

    Science.gov (United States)

    Krapf, Diego

    2015-01-01

    The plasma membrane is a complex fluid where lipids and proteins undergo diffusive motion critical to biochemical reactions. Through quantitative imaging analyses such as single-particle tracking, it is observed that diffusion in the cell membrane is usually anomalous in the sense that the mean squared displacement is not linear with time. This chapter describes the different models that are employed to describe anomalous diffusion, paying special attention to the experimental evidence that supports these models in the plasma membrane. We review models based on anticorrelated displacements, such as fractional Brownian motion and obstructed diffusion, and nonstationary models such as continuous time random walks. We also emphasize evidence for the formation of distinct compartments that transiently form on the cell surface. Finally, we overview heterogeneous diffusion processes in the plasma membrane, which have recently attracted considerable interest. Copyright © 2015. Published by Elsevier Inc.

  9. Electron and ion temperatures: a comparison of ground-based incoherent scatter and AE-C satellite measurements

    International Nuclear Information System (INIS)

    Benson, R.F.; Bauer, P.; Brace, L.H.; Carlson, H.C.; Hagen, J.; Hanson, W.B.; Hoegy, W.R.; Torr, M.R.; Wickwar, V.B.

    1977-01-01

    The Atmosphere Exploere-C satellite (AE-C) is uniquely suited for correlative studies with ground-based stations because its on-board propulsion system enables a desired ground station overflight condition to be maintained for a period of several weeks. It also provides the first low-altitude (below 260 km) comparison of satellite and incoherent scatter electron and ion temperatures. More than 40 comparisons of remote and in situ measurements were made by using data from AE-C and four incoherent scatter stations (Arecibo, Chatanika, Millstone Hill, and St. Santin). The results indicate very good agreement between satellite and ground measurements of the ion temperature, the average satellite retarding potential analyzer temperatures differing from the average incoherent scatter temperatures by -2% at St. Santin, +3% at Millstone Hill, and +2% at Arecibo. The electron temperatures also agree well, the average satellite temperatures exceeding the average incoherent scatter temperatures by 3% at St. Santin, 2% at Arecibo, and 11% at Millstone Hill. Several temperature comparisons were made between AE-C and Chatanika. In spite of the highly variable ionosphere often encountered at this high-latitude location, good agreement was obtained between the in situ and remote measurements of electron and ion temperatures. Longitudinal variations are found to be very important in the comparisons of electron temperature in some locations. The agreement between the electron temperatures is considerably better than that found in some earlier comparisons involving satellities at higher altitudes

  10. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  11. Velocity-Autocorrelation Function in Liquids, Deduced from Neutron Incoherent Scattering Results

    DEFF Research Database (Denmark)

    Carneiro, Kim

    1976-01-01

    The Fourier transform p(ω) of the velocity-autocorrelation function is derived from neutron incoherent scattering results, obtained from the two liquids Ar and H2. The quality and significance of the results are discussed with special emphasis on the long-time t-3/2 tail, found in computer simula...

  12. Production of flat KrF laser focal profiles with echelon free-induced spatial incoherence

    International Nuclear Information System (INIS)

    Deniz, A.V.; Obenschain, S.P.; Pronko, M.; Lehmberg, R.H.

    1990-01-01

    High gain direct-drive laser fusion requires a uniform spherical pellet implosion. This in turn requires that the focal profile of each driving beam be sufficiently uniform and controlled. Several methods for producing uniform beams have been proposed. One promising technique, echelon free-induced spatial incoherence (ISI), consists of propagating a broadband spatially incoherent beam through an entire laser system. This technique will be used in the Nike laser, which is a twenty-four- to forty-eight-beam multikilojoule KrF system currently under construction at the Naval Research Laboratory (NRL). This paper presents measurements of focal profiles of laser light smoothed by echelon free ISI from a KrF oscillator and amplifier. The initial implementation is shown

  13. Measurement of differential incoherent scattering cross-sections of 145 keV photons from K-shell electrons

    Energy Technology Data Exchange (ETDEWEB)

    Acharya, V B; Ghumman, B S [Punjabi Univ., Patiala (India). Dept. of Physics

    1980-06-01

    Differential cross-sections for incoherent scattering of 145 keV photons from K-shell electrons of tin, silver and molybdenum have been measured at 110deg to investigate the effect of electron binding on differential cross-sections in the low energy region. The incoherent scattered photons are selected in coincidence with X-rays which follow the vacancies caused by the ejection of the electrons. NaI(Tl) scintillators are used for the detection of scattered photons and emitted X-rays. The experimental results are compared with the available theoretical data.

  14. Anomalous diffusion of fermions in superlattices

    International Nuclear Information System (INIS)

    Drozdz, S.; Okolowicz, J.; Srokowski, T.; Ploszajczak, M.

    1996-03-01

    Diffusion of fermions in the periodic two-dimensional lattice of fermions is studied. It is shown that effects connected with antisymmetrization of the wave function increase chaoticness of motion. Various types of anomalous diffusion, characterized by a power spectral analysis are found. The nonlocality of the Pauli potential destroys cantori in the phase space. Consequently, the diffusion process is dominated by long free paths and the power spectrum is logarithmic at small frequency limit. (author)

  15. Diffusion of multiple species with excluded-volume effects

    KAUST Repository

    Bruna, Maria; Chapman, S. Jonathan

    2012-01-01

    Stochastic models of diffusion with excluded-volume effects are used to model many biological and physical systems at a discrete level. The average properties of the population may be described by a continuum model based on partial differential equations. In this paper we consider multiple interacting subpopulations/species and study how the inter-species competition emerges at the population level. Each individual is described as a finite-size hard core interacting particle undergoing Brownian motion. The link between the discrete stochastic equations of motion and the continuum model is considered systematically using the method of matched asymptotic expansions. The system for two species leads to a nonlinear cross-diffusion system for each subpopulation, which captures the enhancement of the effective diffusion rate due to excluded-volume interactions between particles of the same species, and the diminishment due to particles of the other species. This model can explain two alternative notions of the diffusion coefficient that are often confounded, namely collective diffusion and self-diffusion. Simulations of the discrete system show good agreement with the analytic results. © 2012 American Institute of Physics.

  16. Diffusion-weighted MR imaging of the abdomen with pulse triggering

    International Nuclear Information System (INIS)

    Muertz, P.; Pauleit, D.; Traeber, F.; Kreft, B.P.; Schild, H.H.

    2000-01-01

    Purpose: The aim of this work was to reduce the influence of motion on diffusion-weighted MR images of the abdomen by pulse triggering of single-shot sequences. Methods: Five healthy volunteers were examined both without and with finger pulse-triggering of a diffusion-weighted single-shot echo planar MR imaging sequence at 1.5 T. Series of diffusion-weighted images were acquired at different phases of the cardiac cycle by varying the time delay between finger pulse and sequence acquisition. The measurements were repeated three times. The diffusion weighted images were analysed by measuring the signal intensities and by determining the ADC values within the spleen, kidney and liver. Results: The magnitude of motion artifacts on diffusion weighted images shows a strong dependence on the trigger delay. The optimum trigger delay is found to be between 500 and 600 ms. For these values the abdominal organs appear homogeneous on all diffusion weighted images and the strongest signal intensities are detected. At optimum triggering the accuracy of the apparent diffusion coefficients is up to 10 times better than without triggering. Moreover, the standard deviation of the repeated measurements is smaller than 12% for all volunteers and for all organs. Without triggering the standard deviation is larger by a factor of 4 on average. Conclusion: Pulse triggering of single-shot sequences leads to significant reduction of motion related artifacts on diffusion weighted images of the abdomen and provides more accurate and reproducible ADC values. (orig.) [de

  17. Active Teaching of Diffusion through History of Science, Computer Animation and Role Playing

    Science.gov (United States)

    Krajsek, Simona Strgulc; Vilhar, Barbara

    2010-01-01

    We developed and tested a lesson plan for active teaching of diffusion in secondary schools (grades 10-13), which stimulates understanding of the thermal (Brownian) motion of particles as the principle underlying diffusion. During the lesson, students actively explore the Brownian motion through microscope observations of irregularly moving small…

  18. Neutron scattering studies of the dynamics of biological systems as a function of hydration, temperature and pressure

    International Nuclear Information System (INIS)

    Trapp, Marcus

    2010-01-01

    Incoherent elastic and quasi-elastic neutron scattering were used to measure membrane and protein dynamics in the nano- to picosecond time and Angstrom length scale. The hydration dependent dynamics of DMPC model membranes was studied using elastic and quasi-elastic neutron scattering. The elastic experiments showed a clear shift of the temperature of the main phase transition to higher temperatures with decreasing hydration level. The performed quasi-elastic measurements demonstrated nicely the influence, hydration has on the diffusive motions of the head lipid groups. Different models are necessary to fit the Q-dependence of the elastic incoherent structure factor and show therefore the reduced mobility as a result of reduced water content. In addition to temperature, pressure as a second thermodynamic variable was used to explore dynamics of DMPC membranes. The ordering introduced by applying pressure has similar effect to decreased hydration, therefore both approaches are complementary. Covering three orders of magnitude in observation time, the dynamics of native AChE and its complexed counterpart in presence of Huperzin A was investigated in the range from 1 ns to 100 ps. The mean square displacements obtained from the elastic data allowed the determination of activation energies and gave evidence that a hierarchy of motions contributes to the enzymatic activity. Diffusion constants and residence times were extracted from the quasi-elastic broadening. (author) [fr

  19. Absolute Bunch Length Measurements by Incoherent Radiation Fluctuation Analysis

    International Nuclear Information System (INIS)

    Sannibale, F.; Stupakov, G.V.; Zolotorev, M.S.; Filippetto, D.; Jagerhofer, L.

    2009-01-01

    By analyzing the pulse to pulse intensity fluctuations of the radiation emitted by a charge particle in the incoherent part of the spectrum, it is possible to extract information about the spatial distribution of the beam. At the Advanced Light Source (ALS) of the Lawrence Berkeley National Laboratory, we have developed and successfully tested a simple scheme based on this principle that allows for the absolute measurement of the rms bunch length. A description of the method and the experimental results are presented.

  20. Characteristics of diffusion flames with accelerated motion

    Directory of Open Access Journals (Sweden)

    Lou Bo

    2016-01-01

    Full Text Available The aim of this work is to present an experiment to study the characteristics of a laminar diffusion flame under acceleration. A Bunsen burner (nozzle diameter 8 mm, using liquefied petroleum gas as its fuel, was ignited under acceleration. The temperature field and the diffusion flame angle of inclination were visualised with the assistance of the visual display technology incorporated in MATLAB™. Results show that the 2-d temperature field under different accelerations matched the variation in average temperatures: they both experience three variations at different time and velocity stages. The greater acceleration has a faster change in average temperature with time, due to the accumulation of combustion heat: the smaller acceleration has a higher average temperature at the same speed. No matter what acceleration was used, in time, the flame angle of inclination increased, but the growth rate decreased until an angle of 90°: this could be explained by analysis of the force distribution within the flame. It is also found that, initially, the growth rate of angle with velocity under the greater acceleration was always smaller than that at lower accelerations; it was also different in flames with uniform velocity fire conditions.

  1. Self-diffusion at the melting point: From H2 and N2 to liquid metals

    International Nuclear Information System (INIS)

    Armstrong, B.H.

    1992-01-01

    A nominal lower bound to the mean free diffusion time at the melting point T m was obtained earlier which provided a factor-two type estimate for self-diffusion coefficients of the alkali halides, alkali metals, eight other metals, and Ar. The argument was based on the classical Uncertainty Principle applied to the solid crystal, whereby maximum-frequency phonons lose validity as collective excitations and degenerate into aperiodic, single-particle diffusive motion at the melting point. Because of the short time scale of this motion, the perfect-gas diffusion equation and true mass can be used to obtain the self-diffusion coefficient in the Debye approximation to the phonon spectrum. This result for the self-diffusion coefficient also yields the scale factor that determines the order of magnitude of liquid self-diffusion coefficients, which has long been an open question. The earlier theory is summarized and clarified, and the results extended to the more complex molecular liquids H 2 and N 2 . It is also demonstrated that combining Lindemann's melting law with the perfect-gas diffusion equation estimate yields a well-known empirical expression for liquid-metal self-diffusion at T m . Validity of the self-diffusion estimate over a melting temperature range from 14 to more than 1,300 K and over a wide variety of crystals provides strong confirmation for the existence of the specialized diffusive motion at the melting point, as well as confirmation of a relation between the phonon spectrum of the solid crystal and diffusive motion in the melt. 21 refs., 2 tabs

  2. Rupture dynamics and ground motions from earthquakes in 2-D heterogeneous media

    KAUST Repository

    Bydlon, Samuel A.

    2015-03-21

    ©2015. American Geophysical Union. All Rights Reserved. We perform 2-D simulations of earthquakes on rough faults in media with random heterogeneities (with von Karman distribution) to study the effects of geometric and material heterogeneity on the rupture process and resulting high-frequency ground motions in the near-fault region (out to ∼20km). Variations in slip and rupture velocity can arise from material heterogeneity alone but are dominantly controlled by fault roughness. Scattering effects become appreciable beyond ∼3km from the fault. Near-fault scattering extends the duration of incoherent, high-frequency ground motions and, at least in our 2-D simulations, elevates root-mean-square accelerations (i.e., Arias intensity) with negligible reduction in peak velocities. We also demonstrate that near-fault scattering typically occurs in the power law tail of the power spectral density function, quantified by the Hurst exponent and another parameter combining standard deviation and correlation length. Key Points Fault roughness, not material heterogeneity, dominates rupture process Introduce parameter that can be used to quantify near-fault scattering Scattering affects the duration and amplitude of high-frequency ground motions

  3. Stochastic motion of particles in tandem mirror devices

    International Nuclear Information System (INIS)

    Ichikawa, Y.H.; Kamimura, T.

    1982-01-01

    Stochastic motion of particles in tandem mirror devices is examined on basis of a nonlinear mapping of particle positions on the equatorial plane. Local stability analysis provides detailed informations on particle trajectories. The rate of stochastic plasma diffusion is estimated from numerical observations of motions of particles over a large number of time steps. (author)

  4. Molecular motion in restricted geometries

    Indian Academy of Sciences (India)

    Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time ...

  5. Predicting X-ray diffuse scattering from translation–libration–screw structural ensembles

    International Nuclear Information System (INIS)

    Van Benschoten, Andrew H.; Afonine, Pavel V.; Terwilliger, Thomas C.; Wall, Michael E.; Jackson, Colin J.; Sauter, Nicholas K.; Adams, Paul D.; Urzhumtsev, Alexandre; Fraser, James S.

    2015-01-01

    A method of simulating X-ray diffuse scattering from multi-model PDB files is presented. Despite similar agreement with Bragg data, different translation–libration–screw refinement strategies produce unique diffuse intensity patterns. Identifying the intramolecular motions of proteins and nucleic acids is a major challenge in macromolecular X-ray crystallography. Because Bragg diffraction describes the average positional distribution of crystalline atoms with imperfect precision, the resulting electron density can be compatible with multiple models of motion. Diffuse X-ray scattering can reduce this degeneracy by reporting on correlated atomic displacements. Although recent technological advances are increasing the potential to accurately measure diffuse scattering, computational modeling and validation tools are still needed to quantify the agreement between experimental data and different parameterizations of crystalline disorder. A new tool, phenix.diffuse, addresses this need by employing Guinier’s equation to calculate diffuse scattering from Protein Data Bank (PDB)-formatted structural ensembles. As an example case, phenix.diffuse is applied to translation–libration–screw (TLS) refinement, which models rigid-body displacement for segments of the macromolecule. To enable the calculation of diffuse scattering from TLS-refined structures, phenix.tls-as-xyz builds multi-model PDB files that sample the underlying T, L and S tensors. In the glycerophosphodiesterase GpdQ, alternative TLS-group partitioning and different motional correlations between groups yield markedly dissimilar diffuse scattering maps with distinct implications for molecular mechanism and allostery. These methods demonstrate how, in principle, X-ray diffuse scattering could extend macromolecular structural refinement, validation and analysis

  6. Predicting X-ray diffuse scattering from translation–libration–screw structural ensembles

    Energy Technology Data Exchange (ETDEWEB)

    Van Benschoten, Andrew H. [University of California San Francisco, San Francisco, CA 94158 (United States); Afonine, Pavel V. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Terwilliger, Thomas C.; Wall, Michael E. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Jackson, Colin J. [Australian National University, Canberra, ACT 2601 (Australia); Sauter, Nicholas K. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Adams, Paul D. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); University of California Berkeley, Berkeley, CA 94720 (United States); Urzhumtsev, Alexandre [Institut de Génétique et de Biologie Moléculaire et Cellulaire, CNRS–INSERM–UdS, 1 Rue Laurent Fries, BP 10142, 67404 Illkirch (France); Université de Lorraine, BP 239, 54506 Vandoeuvre-les-Nancy (France); Fraser, James S., E-mail: james.fraser@ucsf.edu [University of California San Francisco, San Francisco, CA 94158 (United States)

    2015-07-28

    A method of simulating X-ray diffuse scattering from multi-model PDB files is presented. Despite similar agreement with Bragg data, different translation–libration–screw refinement strategies produce unique diffuse intensity patterns. Identifying the intramolecular motions of proteins and nucleic acids is a major challenge in macromolecular X-ray crystallography. Because Bragg diffraction describes the average positional distribution of crystalline atoms with imperfect precision, the resulting electron density can be compatible with multiple models of motion. Diffuse X-ray scattering can reduce this degeneracy by reporting on correlated atomic displacements. Although recent technological advances are increasing the potential to accurately measure diffuse scattering, computational modeling and validation tools are still needed to quantify the agreement between experimental data and different parameterizations of crystalline disorder. A new tool, phenix.diffuse, addresses this need by employing Guinier’s equation to calculate diffuse scattering from Protein Data Bank (PDB)-formatted structural ensembles. As an example case, phenix.diffuse is applied to translation–libration–screw (TLS) refinement, which models rigid-body displacement for segments of the macromolecule. To enable the calculation of diffuse scattering from TLS-refined structures, phenix.tls-as-xyz builds multi-model PDB files that sample the underlying T, L and S tensors. In the glycerophosphodiesterase GpdQ, alternative TLS-group partitioning and different motional correlations between groups yield markedly dissimilar diffuse scattering maps with distinct implications for molecular mechanism and allostery. These methods demonstrate how, in principle, X-ray diffuse scattering could extend macromolecular structural refinement, validation and analysis.

  7. A new method for incoherent combining of far-field laser beams based on multiple faculae recognition

    Science.gov (United States)

    Ye, Demao; Li, Sichao; Yan, Zhihui; Zhang, Zenan; Liu, Yuan

    2018-03-01

    Compared to coherent beam combining, incoherent beam combining can complete the output of high power laser beam with high efficiency, simple structure, low cost and high thermal damage resistance, and it is easy to realize in engineering. Higher target power is achieved by incoherent beam combination which using technology of multi-channel optical path correction. However, each channel forms a spot in the far field respectively, which cannot form higher laser power density with low overlap ratio of faculae. In order to improve the combat effectiveness of the system, it is necessary to overlap different faculae that improve the target energy density. Hence, a novel method for incoherent combining of far-field laser beams is present. The method compromises piezoelectric ceramic technology and evaluation algorithm of faculae coincidence degree which based on high precision multi-channel optical path correction. The results show that the faculae recognition algorithm is low-latency(less than 10ms), which can meet the needs of practical engineering. Furthermore, the real time focusing ability of far field faculae is improved which was beneficial to the engineering of high-energy laser weapon or other laser jamming systems.

  8. Optimizing experimental parameters for tracking of diffusing particles

    DEFF Research Database (Denmark)

    Vestergaard, Christian L.

    2016-01-01

    We describe how a single-particle tracking experiment should be designed in order for its recorded trajectories to contain the most information about a tracked particle's diffusion coefficient. The precision of estimators for the diffusion coefficient is affected by motion blur, limited photon st...

  9. Measurement of Rapid Protein Diffusion in the Cytoplasm by Photo-Converted Intensity Profile Expansion

    Directory of Open Access Journals (Sweden)

    Rotem Gura Sadovsky

    2017-03-01

    Full Text Available The fluorescence microscopy methods presently used to characterize protein motion in cells infer protein motion from indirect observables, rather than measuring protein motion directly. Operationalizing these methods requires expertise that can constitute a barrier to their broad utilization. Here, we have developed PIPE (photo-converted intensity profile expansion to directly measure the motion of tagged proteins and quantify it using an effective diffusion coefficient. PIPE works by pulsing photo-convertible fluorescent proteins, generating a peaked fluorescence signal at the pulsed region, and analyzing the spatial expansion of the signal. We demonstrate PIPE’s success in measuring accurate diffusion coefficients in silico and in vitro and compare effective diffusion coefficients of native cellular proteins and free fluorophores in vivo. We apply PIPE to measure diffusion anomality in the cell and use it to distinguish free fluorophores from native cellular proteins. PIPE’s direct measurement and ease of use make it appealing for cell biologists.

  10. Compressive sensing sectional imaging for single-shot in-line self-interference incoherent holography

    Science.gov (United States)

    Weng, Jiawen; Clark, David C.; Kim, Myung K.

    2016-05-01

    A numerical reconstruction method based on compressive sensing (CS) for self-interference incoherent digital holography (SIDH) is proposed to achieve sectional imaging by single-shot in-line self-interference incoherent hologram. The sensing operator is built up based on the physical mechanism of SIDH according to CS theory, and a recovery algorithm is employed for image restoration. Numerical simulation and experimental studies employing LEDs as discrete point-sources and resolution targets as extended sources are performed to demonstrate the feasibility and validity of the method. The intensity distribution and the axial resolution along the propagation direction of SIDH by angular spectrum method (ASM) and by CS are discussed. The analysis result shows that compared to ASM the reconstruction by CS can improve the axial resolution of SIDH, and achieve sectional imaging. The proposed method may be useful to 3D analysis of dynamic systems.

  11. Effects of atmospheric oscillations on the field-aligned ion motions in the polar F-region

    Directory of Open Access Journals (Sweden)

    S. Oyama

    Full Text Available The field-aligned neutral oscillations in the F-region (altitudes between 165 and 275 km were compared using data obtained simultaneously with two independent instruments: the European Incoherent Scatter (EISCAT UHF radar and a scanning Fabry-Perot interferometer (FPI. During the night of February 8, 1997, simultaneous observations with these instruments were conducted at Tromsø, Norway. Theoretically, the field-aligned neutral wind velocity can be obtained from the field-aligned ion velocity and by diffusion and ambipolar diffusion velocities. We thus derived field-aligned neutral wind velocities from the plasma velocities in EISCAT radar data. They were compared with those observed with the FPI (λ=630.0 nm, which are assumed to be weighted height averages of the actual neutral wind. The weighting function is the normalized height dependent emission rate. We used two model weighting functions to derive the neutral wind from EISCAT data. One was that the neutral wind velocity observed with the FPI is velocity integrated over the entire emission layer and multiplied by the theoretical normalized emission rate. The other was that the neutral wind velocity observed with the FPI corresponds to the velocity only around an altitude where the emission rate has a peak. Differences between the two methods were identified, but not completely clarified. However, the neutral wind velocities from both instruments had peak-to-peak correspondences at oscillation periods of about 10–40 min, shorter than that for the momentum transfer from ions to neutrals, but longer than from neutrals to ions. The synchronizing motions in the neutral wind velocities suggest that the momentum transfer from neutrals to ions was thought to be dominant for the observed field-aligned oscillations rather than the transfer from ions to neutrals. It is concluded that during the observation, the plasma oscillations observed with the EISCAT radar at different altitudes

  12. Direct measurement of the ballistic motion of a freely floating colloid in Newtonian and viscoelastic fluids.

    Science.gov (United States)

    Hammond, Andrew P; Corwin, Eric I

    2017-10-01

    A thermal colloid suspended in a liquid will transition from a short-time ballistic motion to a long-time diffusive motion. However, the transition between ballistic and diffusive motion is highly dependent on the properties and structure of the particular liquid. We directly observe a free floating tracer particle's ballistic motion and its transition to the long-time regime in both a Newtonian fluid and a viscoelastic Maxwell fluid. We examine the motion of the free particle in a Newtonian fluid and demonstrate a high degree of agreement with the accepted Clercx-Schram model for motion in a dense fluid. Measurements of the functional form of the ballistic-to-diffusive transition provide direct measurements of the temperature, viscosity, and tracer radius. We likewise measure the motion in a viscoelastic Maxwell fluid and find a significant disagreement between the theoretical asymptotic behavior and our measured values of the microscopic properties of the fluid. We observe a greatly increased effective mass for a freely moving particle and a decreased plateau modulus.

  13. Spatial Mapping of Translational Diffusion Coefficients Using Diffusion Tensor Imaging: A Mathematical Description.

    Science.gov (United States)

    Shetty, Anil N; Chiang, Sharon; Maletic-Savatic, Mirjana; Kasprian, Gregor; Vannucci, Marina; Lee, Wesley

    2014-01-01

    In this article, we discuss the theoretical background for diffusion weighted imaging and diffusion tensor imaging. Molecular diffusion is a random process involving thermal Brownian motion. In biological tissues, the underlying microstructures restrict the diffusion of water molecules, making diffusion directionally dependent. Water diffusion in tissue is mathematically characterized by the diffusion tensor, the elements of which contain information about the magnitude and direction of diffusion and is a function of the coordinate system. Thus, it is possible to generate contrast in tissue based primarily on diffusion effects. Expressing diffusion in terms of the measured diffusion coefficient (eigenvalue) in any one direction can lead to errors. Nowhere is this more evident than in white matter, due to the preferential orientation of myelin fibers. The directional dependency is removed by diagonalization of the diffusion tensor, which then yields a set of three eigenvalues and eigenvectors, representing the magnitude and direction of the three orthogonal axes of the diffusion ellipsoid, respectively. For example, the eigenvalue corresponding to the eigenvector along the long axis of the fiber corresponds qualitatively to diffusion with least restriction. Determination of the principal values of the diffusion tensor and various anisotropic indices provides structural information. We review the use of diffusion measurements using the modified Stejskal-Tanner diffusion equation. The anisotropy is analyzed by decomposing the diffusion tensor based on symmetrical properties describing the geometry of diffusion tensor. We further describe diffusion tensor properties in visualizing fiber tract organization of the human brain.

  14. Time-averaged MSD of Brownian motion

    OpenAIRE

    Andreanov, Alexei; Grebenkov, Denis

    2012-01-01

    We study the statistical properties of the time-averaged mean-square displacements (TAMSD). This is a standard non-local quadratic functional for inferring the diffusion coefficient from an individual random trajectory of a diffusing tracer in single-particle tracking experiments. For Brownian motion, we derive an exact formula for the Laplace transform of the probability density of the TAMSD by mapping the original problem onto chains of coupled harmonic oscillators. From this formula, we de...

  15. Diffusion in the presence of a local attracting factor: Theory and interdisciplinary applications

    Science.gov (United States)

    Veermäe, Hardi; Patriarca, Marco

    2017-06-01

    In many complex diffusion processes the drift of random walkers is not caused by an external force, as in the case of Brownian motion, but by local variations of fitness perceived by the random walkers. In this paper, a simple but general framework is presented that describes such a type of random motion and may be of relevance in different problems, such as opinion dynamics, cultural spreading, and animal movement. To this aim, we study the problem of a random walker in d dimensions moving in the presence of a local heterogeneous attracting factor expressed in terms of an assigned position-dependent "attractiveness function." At variance with standard Brownian motion, the attractiveness function introduced here regulates both the advection and diffusion of the random walker, thus providing testable predictions for a specific form of fluctuation-relations. We discuss the relation between the drift-diffusion equation based on the attractiveness function and that describing standard Brownian motion, and we provide some explicit examples illustrating its relevance in different fields, such as animal movement, chemotactic diffusion, and social dynamics.

  16. Simultaneous Measurement of T2 and Apparent Diffusion Coefficient (T2+ADC) in the Heart With Motion-Compensated Spin Echo Diffusion-Weighted Imaging

    Science.gov (United States)

    Aliotta, Eric; Moulin, Kévin; Zhang, Zhaohuan; Ennis, Daniel B.

    2018-01-01

    Purpose To evaluate a technique for simultaneous quantitative T2 and apparent diffusion coefficient (ADC) mapping in the heart (T2+ADC) using spin echo (SE) diffusion-weighted imaging (DWI). Theory and Methods T2 maps from T2+ADC were compared with single-echo SE in phantoms and with T2-prepared (T2-prep) balanced steady-state free precession (bSSFP) in healthy volunteers. ADC maps from T2+ADC were compared with conventional DWI in phantoms and in vivo. T2+ADC was also demonstrated in a patient with acute myocardial infarction (MI). Results Phantom T2 values from T2+ADC were closer to a single-echo SE reference than T2-prep bSSFP (−2.3 ± 6.0% vs 22.2 ± 16.3%; P T2 values from T2+ADC were significantly shorter than T2-prep bSSFP (35.8 ± 3.1 vs 46.8 ± 3.8 ms; P T2+ADC and conventional motion-compensated DWI (1.39 ± 0.18 vs 1.38 ± 0.18 mm2/ms; P = N.S.). In the patient, T2 and ADC were both significantly elevated in the infarct compared with remote myocardium (T2: 40.4 ± 7.6 vs 56.8 ± 22.0; P T2+ADC generated coregistered, free-breathing T2 and ADC maps in healthy volunteers and a patient with acute MI with no cost in accuracy, precision, or scan time compared with DWI. PMID:28516485

  17. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  18. Diffusion in Coulomb crystals.

    Science.gov (United States)

    Hughto, J; Schneider, A S; Horowitz, C J; Berry, D K

    2011-07-01

    Diffusion in Coulomb crystals can be important for the structure of neutron star crusts. We determine diffusion constants D from molecular dynamics simulations. We find that D for Coulomb crystals with relatively soft-core 1/r interactions may be larger than D for Lennard-Jones or other solids with harder-core interactions. Diffusion, for simulations of nearly perfect body-centered-cubic lattices, involves the exchange of ions in ringlike configurations. Here ions "hop" in unison without the formation of long lived vacancies. Diffusion, for imperfect crystals, involves the motion of defects. Finally, we find that diffusion, for an amorphous system rapidly quenched from Coulomb parameter Γ=175 to Coulomb parameters up to Γ=1750, is fast enough that the system starts to crystalize during long simulation runs. These results strongly suggest that Coulomb solids in cold white dwarf stars, and the crust of neutron stars, will be crystalline and not amorphous.

  19. Fractional Brownian motion with a reflecting wall

    Science.gov (United States)

    Wada, Alexander H. O.; Vojta, Thomas

    2018-02-01

    Fractional Brownian motion, a stochastic process with long-time correlations between its increments, is a prototypical model for anomalous diffusion. We analyze fractional Brownian motion in the presence of a reflecting wall by means of Monte Carlo simulations. Whereas the mean-square displacement of the particle shows the expected anomalous diffusion behavior ˜tα , the interplay between the geometric confinement and the long-time memory leads to a highly non-Gaussian probability density function with a power-law singularity at the barrier. In the superdiffusive case α >1 , the particles accumulate at the barrier leading to a divergence of the probability density. For subdiffusion α implications of these findings, in particular, for applications that are dominated by rare events.

  20. Modes of correlated angular motion in live cells across three distinct time scales

    International Nuclear Information System (INIS)

    Harrison, Andrew W; Kenwright, David A; Woodman, Philip G; Allan, Victoria J; Waigh, Thomas A

    2013-01-01

    Particle tracking experiments with high speed digital microscopy yield the positions and trajectories of lipid droplets inside living cells. Angular correlation analysis shows that the lipid droplets have uncorrelated motion at short time scales (τ 10 ms, becomes persistent, indicating directed movement. The motion at all time scales is associated with the lipid droplets being tethered to and driven along the microtubule network. The point at which the angular correlation changes from anti-persistent to persistent motion corresponds to the cross over between sub-diffusive and super diffusive motion, as observed by mean square displacement analysis. Correct analysis of the angular correlations of the detector noise is found to be crucial in modelling the observed phenomena. (paper)

  1. Interaction between a dark spot and a two-dimensional nonlinear photonic lattice with fully incoherent white light

    International Nuclear Information System (INIS)

    Liu, Zhaohong; Liu, Simin; Guo, Ru; Song, Tao; Zhu, Nan

    2007-01-01

    We study experimentally the interaction of a dark spot with a nonlinear photonic lattice with fully incoherent white light emitted from an incandescent bulb in the self-defocussing photovoltaic media when the dark spot is aimed at different positions of lattices with different lattice spacing. In this case a host of novel phenomena is demonstrated, including dark spot induced lattice dislocation-deformation, the annihilation of the dark spot and so on. Results demonstrate that the interaction between incoherent dark spot and photonic lattice is always attraction and the large-spacing photonic lattice is analogous to the continuous medium

  2. Influence of Fano interference and incoherent processes on optical bistability in a four-level quantum dot nanostructure

    International Nuclear Information System (INIS)

    Hossein Asadpour, Seyyed; Solookinejad, G; Panahi, M; Ahmadi Sangachin, E

    2016-01-01

    Role of Fano interference and incoherent pumping field on optical bistability in a four-level designed InGaN/GaN quantum dot nanostructure embedded in a unidirectional ring cavity are analyzed. It is found that intensity threshold of optical bistability can be manipulated by Fano interference. It is shown that incoherent pumping fields make the threshold of optical bistability behave differently by Fano interference. Moreover, in the presence of Fano interference the medium becomes phase-dependent. Therefore, the relative phase of applied fields can affect the behaviors of optical bistability and intensity threshold can be controlled easily. (paper)

  3. A study of the diffusion mechanisms in amorphous metallic alloys: diffusion and diffusion under high pressure in an amorphous NiZr alloy

    International Nuclear Information System (INIS)

    Grandjean, A.

    1996-01-01

    The aim of this work is a better understanding of the diffusion mechanism in amorphous metallic alloys. Then interdiffusion and hafnium diffusion in amorphous NiZr alloy have been studied. Samples used are made by sputtering co-deposition under vacuum and are well relaxed before the diffusion measurements. The time evolution of resistivity during annealing due to the decay of a composition modulated film has been measured and from this change in resistivity interdiffusion coefficients have been determined. Dependence of Hf diffusion on temperature and pressure has been studied using (SIMS). In this two cases, the diffusion process obeys an Arrhenius law and gives an activation energy of 1.33 eV for interdiffusion, and 0.76 eV for Hf diffusion. An effect of pressure on Hf diffusion has been found leading to an activation volume of 8.5 angstrom 3 . Thanks to these results, two approaches of the diffusion mechanisms in these systems have been proposed. The first comes from a comparison with the diffusion mechanisms in crystalline metals, that is to say by point defects. The second is an hypothesis of collective motions in these non crystalline alloys. (author)

  4. Study on diffusion anisotropy of cerebral ischemia using diffusion weighted echo-planar MRI

    International Nuclear Information System (INIS)

    Kajima, Toshio

    1997-01-01

    Focal cerebral ischemia was produced by occlusion of the intracranial main cerebral artery with a silicone cylinder in Wistar rats. Diffusion-weighted echo-planar images (DW-EPls) using the motion-probing gradient (MPG) method were acquired at 1-3 hours and 24-48 hours after occlusion. Apparent diffusion coefficients (ADCs) were calculated from these images in ischemic lesions and in normal unoccluded regions. Results were as follows. Ischemic lesions could be detected on the DW-EPIs at 1 hour after occlusion. The ADC of water in the brain tissue was smaller than that of free water as a result of restricted diffusion. Anisotropic diffusion that probably can be attributed to the myelin sheath was observed in the normal white matter. In the ischemic lesions, the ADC decreased rapidly within 1-3 hours after occlusion and then decreased gradually after 24-48 hours. In the ischemic white matter, diffusion anisotropy disappeared at 24-48 hours after occlusion. Diffusion-weighted imaging may have applications in the examination of pathophysiological mechanisms in cerebral ischemia by means of evaluation of ADC and diffusion anisotropy. (author)

  5. Coherent laser phase retrieval in the presence of measurement imperfections and incoherent light

    DEFF Research Database (Denmark)

    Hansen, Anders Kragh

    2017-01-01

    -plane Gerchberg–Saxton algorithm and demonstrate that it is highly successful at extracting the intensity profile and wavefront of the spatially coherent part of the light from various lasers, including tapered laser diodes, at a very high fidelity despite the presence of incoherent light and noise....

  6. All-fiber incoherent frequency-to-time mapping method for microwave signal generation with baseband transmission and multicasting support

    DEFF Research Database (Denmark)

    Company Torres, Victor; Tafur Monroy, Idelfonso; Lancis, Jesus

    2008-01-01

    We present a proof-of-principle experiment for achieving simultaneous distribution of baseband radio-frequency data and up-conversion with broadcasting support over a passive optical network. The technique is based on an incoherent frequency-to-time mapping method for pulse shaping. Specifically...... resembles the shape of the incoherent source. The photodetected signal contains both the baseband data and an up-frequency converted copy with central wavelength for the microwave carrier into the ultra-wideband range and tuning capability by selection of the fiber length. (c) 2008 Elsevier B.V. All rights...

  7. A new model of anomalous phosphorus diffusion in silicon

    International Nuclear Information System (INIS)

    Budil, M.; Poetzl, H.; Stingeder, G.; Grasserbauer, M.

    1989-01-01

    A model is presented to describe the 'kink and tail' diffusion of phosphorus. The diffusion behaviour of phosphorus is expplained by the motion of phosphorus-interstitial and phosphorus-vacancy pairs in different charge states. The model yields the enhancement of diffusion in the tail region depending on surface concentration. Furthermore it yields the same selfdiffusion coefficient for interstitials as the gold diffusion experiments. A transformation of the diffusion equation was found to reduce the number of simulation equations. (author) 7 refs., 5 figs

  8. Isotropic resolution diffusion tensor imaging of lumbosacral and sciatic nerves using a phase-corrected diffusion-prepared 3D turbo spin echo.

    Science.gov (United States)

    Cervantes, Barbara; Van, Anh T; Weidlich, Dominik; Kooijman, Hendrick; Hock, Andreas; Rummeny, Ernst J; Gersing, Alexandra; Kirschke, Jan S; Karampinos, Dimitrios C

    2018-08-01

    To perform in vivo isotropic-resolution diffusion tensor imaging (DTI) of lumbosacral and sciatic nerves with a phase-navigated diffusion-prepared (DP) 3D turbo spin echo (TSE) acquisition and modified reconstruction incorporating intershot phase-error correction and to investigate the improvement on image quality and diffusion quantification with the proposed phase correction. Phase-navigated DP 3D TSE included magnitude stabilizers to minimize motion and eddy-current effects on the signal magnitude. Phase navigation of motion-induced phase errors was introduced before readout in 3D TSE. DTI of lower back nerves was performed in vivo using 3D TSE and single-shot echo planar imaging (ss-EPI) in 13 subjects. Diffusion data were phase-corrected per k z plane with respect to T 2 -weighted data. The effects of motion-induced phase errors on DTI quantification was assessed for 3D TSE and compared with ss-EPI. Non-phase-corrected 3D TSE resulted in artifacts in diffusion-weighted images and overestimated DTI parameters in the sciatic nerve (mean diffusivity [MD] = 2.06 ± 0.45). Phase correction of 3D TSE DTI data resulted in reductions in all DTI parameters (MD = 1.73 ± 0.26) of statistical significance (P ≤ 0.001) and in closer agreement with ss-EPI DTI parameters (MD = 1.62 ± 0.21). DP 3D TSE with phase correction allows distortion-free isotropic diffusion imaging of lower back nerves with robustness to motion-induced artifacts and DTI quantification errors. Magn Reson Med 80:609-618, 2018. © 2018 The Authors Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. © 2018 The Authors Magnetic Resonance

  9. Depolarization of diffusing spins by paramagnetic impurities

    International Nuclear Information System (INIS)

    Schillaci, M.E.; Hutson, R.L.; Heffner, R.H.; Leon, M.; Dodds, S.A.; Estle, T.L.

    1981-01-01

    We study the depolarization of diffusing spins (muons) interacting with dilute paramagnetic impurities in a solid using a simple computational model which properly treats the muon motion and preserves correct muon-impurity distances. Long-range (dipolar) and nearest-neighbor (contact) interactions are treated together. Diffusion parameters are deduced and model comparisons made for AuGd (300 ppm). (orig.)

  10. Thermophoretic Motion of Water Nanodroplets confined inside Carbon Nanotubes

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Koumoutsakos, Petros

    2009-01-01

    We study the thermophoretic motion of water nanodroplets confined inside carbon nanotubes using molecular dynamics simulations. We find that the nanodroplets move in the direction opposite the imposed thermal gradient with a terminal velocity that is linearly proportional to the gradient....... The translational motion is associated with a solid body rotation of the water nanodroplet coinciding with the helical symmetry of the carbon nanotube. The thermal diffusion displays a weak dependence on the wetting of the water-carbon nanotube interface. We introduce the use of the Moment Scaling Spectrum (MSS......) in order to determine the characteristics of the motion of the nanoparticles inside the carbon nanotube. The MSS indicates that affinity of the nanodroplet with the walls of the carbon nanotubes is important for the isothermal diffusion, and hence for the Soret coefficient of the system....

  11. Optical sectioning using a digital Fresnel incoherent-holography-based confocal imaging system

    OpenAIRE

    Kelner, Roy; Katz, Barak; Rosen, Joseph

    2014-01-01

    We propose a new type of confocal microscope using Fresnel incoherent correlation holography (FINCH). Presented here is a confocal configuration of FINCH using a phase pinhole and point illumination that is able to suppress out-of-focus information from the recorded hologram and hence combine the super-resolution capabilities of FINCH with the sectioning capabilities of confocal microscopy.

  12. Translational and rotational motions of proteins in a protein crowded environment

    NARCIS (Netherlands)

    Zorilla, S.; Hink, M.A.; Visser, A.J.W.G.; Lillo, M.P.

    2007-01-01

    Fluorescence correlation spectroscopy (FCS) was used to measure the translational diffusion of labeled apomyoglobin (tracer) in concentrated solutions of ribonuclease A and human serum albumin (crowders), as a quantitative model system of protein diffusive motions in crowded physiological

  13. Coordinated observations of electron energy spectra and electrostatic cyclotron waves during diffuse auroras

    International Nuclear Information System (INIS)

    Fontaine, D.; Perraut, S.; Cornilleau-Wehrlin, N.; Aparicio, B.; Bosqued, J.M.; Rodgers, D.

    1986-01-01

    An auroral precipitation event lasting several hours in the dusk sector on June 2, 1982 is studied in conjunction with three instruments: the EISCAT European Incoherent Scatter radar based in Scandinavia, the GEOS-2 European geostationary spacecraft, and the ARCAD-3 French-Soviet polar spacecraft. Electron energy spectra between about 1 and 10 keV, computed from EISCAT measurements, were in agreement, during a diffuse aurora period, with direct observations onboard ARCAD-3, and also with the plasma sheet component (3-10 keV) measured onboard GEOS-2 and available at large pitch-angles. This last comparison suggested the quasi-isotropy of equatorial electron fluxes. The electrostatic electron cyclotron harmonic waves, also observed onboard GEOS-2, were not found to be intense enough to cause by themselves the strong pitch-angle diffusion of electrons of a few keV

  14. Anomalous diffusion spreads its wings

    Energy Technology Data Exchange (ETDEWEB)

    Klafter, J. [School of Chemistry, Tel Aviv University, Tel-Aviv (Israel)]. E-mail: klafter@post.tau.ac.il; Sokolov, I.M. [Institute of Physics, Humboldt University, Berlin (Germany)]. E-mail: igor.sokolov@physik.hu-berlin.de

    2005-08-01

    An increasing number of natural phenomena do not fit into the relatively simple description of diffusion developed by Einstein a century ago. As all of us are no doubt aware, this year has been declared 'world year of physics' to celebrate the three remarkable breakthroughs made by Albert Einstein in 1905. However, it is not so well known that Einstein's work on Brownian motion - the random motion of tiny particles first observed and investigated by the botanist Robert Brown in 1827 - has been cited more times in the scientific literature than his more famous papers on special relativity and the quantum nature of light. In a series of publications that included his doctoral thesis, Einstein derived an equation for Brownian motion from microscopic principles - a feat that ultimately enabled Jean Perrin and others to prove the existence of atoms (see 'Einstein's random walk' Physics World January pp19-22). Einstein was not the only person thinking about this type of problem. The 27 July 1905 issue of Nature contained a letter with the title 'The problem of the random walk' by the British statistician Karl Pearson, who was interested in the way that mosquitoes spread malaria, which he showed was described by the well-known diffusion equation. As such, the displacement of a mosquito from its initial position is proportional to the square root of time, and the distribution of the positions of many such 'random walkers' starting from the same origin is Gaussian in form. The random walk has since turned out to be intimately linked to Einstein's work on Brownian motion, and has become a major tool for understanding diffusive processes in nature. (U.K.)

  15. Electromagnetically induced absorption via incoherent collisions

    International Nuclear Information System (INIS)

    Yang Xihua; Sheng Jiteng; Xiao Min

    2011-01-01

    We conduct theoretical studies on electromagnetically induced absorption via incoherent collisions in an inhomogeneously broadened ladder-type three-level system with the density-matrix approach. The effects of the collision-induced coherence decay rates as well as the probe laser field intensity on the probe field absorption are examined. It is shown that with the increase of the collisional decay rates in a moderate range, a narrow dip due to electromagnetically induced transparency superimposed on the Doppler-broadened absorption background can be turned into a narrow peak under the conditions that the probe field intensity is not very weak as compared to the pump field, which results from the enhancement of constructive interference and suppression of destructive interference between one-photon and multiphoton transition pathways. The physical origin of the collision-assisted electromagnetically induced absorption is analyzed with a power-series solution of the density-matrix equations.

  16. Intersubassembly incoherencies and grouping techniques in LMFBR hypothetical overpower accident

    International Nuclear Information System (INIS)

    Wilburn, N.P.

    1977-10-01

    A detailed analysis was made of the FTR core using the 100-channel MELT-IIIA code. Results were studied for the transient overpower accident (where 0.5$/sec and 1$/sec ramps) and in which the Damage Parameter and the Failure Potential criteria were used. Using the information obtained from these series of runs, a new method of grouping the subassemblies into channels has been developed. Also, it was demonstrated that a 7-channel representation of the FTR core using this method does an adequate job of representing the behavior during a hypothetical disruptive transient overpower core accident. It has been shown that this new 7-channel grouping method does a better job than an earlier 20-channel grouping. It has also been demonstrated that the incoherency effects between subassemblies as shown during the 76-channel representation of the reactor can be adequately modeled by 7-channels, provided the 7-channels are selected according to the criteria stated in the report. The overall results of power and net reactivity were shown to be only slightly different in the two cases of the 7-channel and the 76-channel runs. Therefore, it can be concluded that any intersubassembly incoherencies can be modeled adequately by a small number of channels, provided the subassemblies making up these channels are selected according to the criteria stated

  17. Aspect sensitive E- and F-region SPEAR-enhanced incoherent backscatter observed by the EISCAT Svalbard radar

    Directory of Open Access Journals (Sweden)

    R. S. Dhillon

    2009-01-01

    Full Text Available Previous studies of the aspect sensitivity of heater-enhanced incoherent radar backscatter in the high-latitude ionosphere have demonstrated the directional dependence of incoherent scatter signatures corresponding to artificially excited electrostatic waves, together with consistent field-aligned signatures that may be related to the presence of artificial field-aligned irregularities. These earlier high-latitude results have provided motivation for repeating the investigation in the different geophysical conditions that obtain in the polar cap ionosphere. The Space Plasma Exploration by Active Radar (SPEAR facility is located within the polar cap and has provided observations of RF-enhanced ion and plasma line spectra recorded by the EISCAT Svalbard UHF incoherent scatter radar system (ESR, which is collocated with SPEAR. In this paper, we present observations of aspect sensitive E- and F-region SPEAR-induced ion and plasma line enhancements that indicate excitation of both the purely growing mode and the parametric decay instability, together with sporadic E-layer results that may indicate the presence of cavitons. We note consistent enhancements from field-aligned, vertical and also from 5° south of field-aligned. We attribute the prevalence of vertical scatter to the importance of the Spitze region, and of that from field-aligned to possible wave/irregularity coupling.

  18. Spatially continuous approach to the description of incoherencies in fast reactor accident analysis

    International Nuclear Information System (INIS)

    Luck, L.B.

    1976-12-01

    A generalized cell-type approach is developed in which individual subassemblies are represented as a unit. By appropriate characterization of the results of separate detailed investigations, spatial variations within a cell are represented as a superposition. The advantage of this approach is that costly detailed cell-type information is generated only once or a very few times. Spatial information obtained by the cell treatment is properly condensed in order to drastically reduce the transient computation time. Approximate treatments of transient phenomena are developed based on the use of distributions of volume and reactivity worth with temperature and other reactor parameters. Incoherencies during transient are physically dependent on the detailed variations in the initial state. Therefore, stationary volumetric distributions which contain in condensed form the detailed initial incoherency information provides a proper basis for the transient treatment. Approximate transient volumetric distributions are generated by a suitable transformation of the stationary distribution to reflect the changes in the transient temperature field. Evaluation of transient changes is based on results of conventional uniform channel calculations and a superposition of lateral variations as they are derived from prior cell investigations. Specific formulations are developed for the treatment of reactivity feedback. Doppler and sodium expansion reactivity feedback is related to condensed temperature-worth distributions. Transient evaluation of the worth distribution is based on the relation between stationary and transient volumetric distributions, which contains the condensed temperature field information. Coolant voiding is similarly treated with proper distribution information. Results show that the treatments developed for the transient phase up to and including sodium boiling constitute a fast and effective simulation of inter- and intra-subassembly incoherence effects

  19. Fractional Diffusion, Low Exponent Lévy Stable Laws, and 'Slow Motion' Denoising of Helium Ion Microscope Nanoscale Imagery.

    Science.gov (United States)

    Carasso, Alfred S; Vladár, András E

    2012-01-01

    Helium ion microscopes (HIM) are capable of acquiring images with better than 1 nm resolution, and HIM images are particularly rich in morphological surface details. However, such images are generally quite noisy. A major challenge is to denoise these images while preserving delicate surface information. This paper presents a powerful slow motion denoising technique, based on solving linear fractional diffusion equations forward in time. The method is easily implemented computationally, using fast Fourier transform (FFT) algorithms. When applied to actual HIM images, the method is found to reproduce the essential surface morphology of the sample with high fidelity. In contrast, such highly sophisticated methodologies as Curvelet Transform denoising, and Total Variation denoising using split Bregman iterations, are found to eliminate vital fine scale information, along with the noise. Image Lipschitz exponents are a useful image metrology tool for quantifying the fine structure content in an image. In this paper, this tool is applied to rank order the above three distinct denoising approaches, in terms of their texture preserving properties. In several denoising experiments on actual HIM images, it was found that fractional diffusion smoothing performed noticeably better than split Bregman TV, which in turn, performed slightly better than Curvelet denoising.

  20. Brownian motion of solitons in a Bose-Einstein condensate.

    Science.gov (United States)

    Aycock, Lauren M; Hurst, Hilary M; Efimkin, Dmitry K; Genkina, Dina; Lu, Hsin-I; Galitski, Victor M; Spielman, I B

    2017-03-07

    We observed and controlled the Brownian motion of solitons. We launched solitonic excitations in highly elongated [Formula: see text] Bose-Einstein condensates (BECs) and showed that a dilute background of impurity atoms in a different internal state dramatically affects the soliton. With no impurities and in one dimension (1D), these solitons would have an infinite lifetime, a consequence of integrability. In our experiment, the added impurities scatter off the much larger soliton, contributing to its Brownian motion and decreasing its lifetime. We describe the soliton's diffusive behavior using a quasi-1D scattering theory of impurity atoms interacting with a soliton, giving diffusion coefficients consistent with experiment.

  1. Diffusion formation and psychiatric diseases

    International Nuclear Information System (INIS)

    Reith, W.; Kulikovski, J.

    2015-01-01

    The basic principle behind diffusion is Brownian motion. The diffusion parameters obtained in a clinical association provide information on the spatial distribution of water molecule mobility and, therefore, evidence of the morphological integrity of the white and grey matters of the brain. In recent years functional magnetic resonance imaging (fMRI) could contribute to obtaining a detailed understanding of the cortical and subcortical cerebral networks. Diffusion tensor imaging (DTI) investigations can demonstrate the extent of anisotropy and the fiber pathways in so-called parametric images. For example, in Alzheimer's disease DTI reveals a reduced structural connectivity between the posterior cingulum and the hippocampus. This article shows examples of the application of diffusion-weighted imaging (DWI) in psychiatric disorders. (orig.) [de

  2. Diffusion of tritiated water (HTO) in dextran+water mixtures

    International Nuclear Information System (INIS)

    Comper, W.D.; Van Damme, M.P.I.; Preston, B.N.

    1982-01-01

    The diffusion of HTO has been measured in dextran solutions using an open-ended capillary technique and a newly developed Sundeloef diffusion cell. HTO diffusion has been examined as a function of dextran concentration and molecular weight. These results, together with our previous results on the intradiffusion and mutual-diffusion coefficients of dextrans, now provide a complete set of conventional translational diffusion coefficients for both components in this binary system. Various assumptions associated with the theoretical description of polymer translational motion can now be examined. (author)

  3. Transformation of EIA to EIT by incoherent pumping of the 85Rb D1 line

    Science.gov (United States)

    Yu, Hoon; Kim, Jung Dong; Jung, Tae Young; Kim, Jung Bog

    2012-10-01

    We have observed a transformation from electromagnetically-induced absorption (EIA) to electromagnetically induced transparency (EIT) in open systems of the 85Rb D1 line by adding an incoherent optical pumping laser. This result raises a new question about recent theoretical work which does not address the degree of open. The pump beam only plays a role in transferring atoms by a spontaneous transition into the interacting system for EIT observation, which is an incoherent process. The dependence of the absorption spectra on the intensity and the polarization of each laser beam were observed. We have found the same tendencies in all transitions except the F = 2 ↔ F' = 3 transition of the 85Rb D1 line, which is the system that almost satisfies conventional EIA conditions.

  4. Methyl group rotation and segmental motion in atactic polypropylene. An incoherent quasi elastic neutron scattering investigation

    International Nuclear Information System (INIS)

    Arrighi, V.; Triolo, A.

    1999-01-01

    Complete text of publication follows. Results from the analysis of recent quasielastic neutron scattering (QENS) experiments on atactic polypropylene (aPP), are presented both in the sub-T g and above T g regimes. Experiments were carried out on the IRIS (ISIS, Rutherford Appleton Laboratory, UK) and IN10 (ILL FR) spectrometers in the temperature range from 140 to 400 K. Different instrumental resolutions were used in order to cover a wide energy window. The high resolution data collected on IN10 using the fixed energy scan technique, give clear evidence of two separate dynamic processes that we attribute to methyl group rotational hopping (below T g ) and to segmental motion (above T g ), respectively. Data were fitted using a model involving a distribution of relaxation rates. The IN10 results are used in interpreting and analyzing the QENS data from the IRIS spectrometer. In order to exploit the different energy resolutions of IRIS, Fourier inversion of the experimental data was carried out. This approach to data analysis allows us to widen the energy range available for data analysis. Due to the high activation energy of the methyl group hopping in aPP, this motion overlaps with the segmental relaxation, thus making analysis of high temperature data quite complex. The IN10 results are employed in order to perform data analysis in terms of two distinct processes. (author)

  5. Experimental tests of induced spatial incoherence using short laser wavelength

    International Nuclear Information System (INIS)

    Obenschain, S.P.; Grun, J.; Herbst, M.J.

    1986-01-01

    The authors have developed a laser beam smoothing technique called induced spatial incoherence (ISI), which can produce the highly uniform focal profiles required for direct-drive laser fusion. Uniform well-controlled focal profiles are required to obtain the highly symmetric pellet implosions needed for high-energy gain. In recent experiments, the authors' tested the effects of ISI on high-power laser-target interaction. With short laser wavelength, the coupling physics dramatically improved over that obtained with an ordinary laser beam

  6. IUTAM symposium on hydrodynamic diffusion of suspended particles

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.H. [ed.

    1995-12-31

    Hydrodynamic diffusion refers to the fluctuating motion of nonBrownian particles (or droplets or bubbles) which occurs in a dispersion due to multiparticle interactions. For example, in a concentrated sheared suspension, particles do not move along streamlines but instead exhibit fluctuating motions as they tumble around each other. This leads to a net migration of particles down gradients in particle concentration and in shear rate, due to the higher frequency of encounters of a test particle with other particles on the side of the test particle which has higher concentration or shear rate. As another example, suspended particles subject to sedimentation, centrifugation, or fluidization, do not generally move relative to the fluid with a constant velocity, but instead experience diffusion-like fluctuations in velocity due to interactions with neighboring particles and the resulting variation in the microstructure or configuration of the suspended particles. In flowing granular materials, the particles interact through direct collisions or contacts (rather than through the surrounding fluid); these collisions also cause the particles to undergo fluctuating motions characteristic of diffusion processes. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

  7. Intrinsic and extrinsic measurement for Brownian motion

    International Nuclear Information System (INIS)

    Castro-Villarreal, Pavel

    2014-01-01

    Based upon the Smoluchowski equation on curved manifolds, three physical observables are considered for Brownian displacement, namely geodesic displacement s, Euclidean displacement δR, and projected displacement δR ⊥ . The Weingarten–Gauss equations are used to calculate the mean-square Euclidean displacements in the short-time regime. Our findings show that from an extrinsic point of view the geometry of the space affects the Brownian motion in such a way that the particle’s diffusion is decelerated, contrasting with the intrinsic point of view where dynamics is controlled by the sign of the Gaussian curvature (Castro-Villarreal, 2010 J. Stat. Mech. P08006). Furthermore, it is possible to give exact formulas for 〈δR〉 and 〈δR 2 〉 on spheres and minimal surfaces, which are valid for all values of time. In the latter case, surprisingly, Brownian motion corresponds to the usual diffusion in flat geometries, albeit minimal surfaces have non-zero Gaussian curvature. Finally, the two-dimensional case is emphasized due to its close relation to surface self-diffusion in fluid membranes. (paper)

  8. Theoretical and experimental studies of the influence of the number of crosstalk signals on the penalty caused by incoherent optical crosstalk

    DEFF Research Database (Denmark)

    Rasmussen, Christian Jørgen; Liu, Fenghai; Pedersen, Rune Johan Skullerud

    1999-01-01

    Calculations based on the exact probability density function of the received power show that for a fixed total crosstalk power, the incoherent crosstalk penalty increases with the number of crosstalk signals. Performed experiments verify this.......Calculations based on the exact probability density function of the received power show that for a fixed total crosstalk power, the incoherent crosstalk penalty increases with the number of crosstalk signals. Performed experiments verify this....

  9. Optical sectioning using a digital Fresnel incoherent-holography-based confocal imaging system

    Science.gov (United States)

    Kelner, Roy; Katz, Barak; Rosen, Joseph

    2015-01-01

    We propose a new type of confocal microscope using Fresnel incoherent correlation holography (FINCH). Presented here is a confocal configuration of FINCH using a phase pinhole and point illumination that is able to suppress out-of-focus information from the recorded hologram and hence combine the super-resolution capabilities of FINCH with the sectioning capabilities of confocal microscopy. PMID:26413560

  10. Ground clutter cancellation in incoherent radars: solutions for EISCAT Svalbard radar

    Directory of Open Access Journals (Sweden)

    T. Turunen

    2000-09-01

    Full Text Available Incoherent scatter radars measure ionosphere parameters using modified Thomson scatter from free electrons in the target (see e.g. Hagfors, 1997. The integrated cross section of the ionospheric scatterers is extremely small and the measurements can easily be disturbed by signals returned by unwanted targets. Ground clutter signals, entering via the antenna side lobes, can render measurements at the nearest target ranges totally impossible. The EISCAT Svalbard Radar (ESR, which started measurements in 1996, suffers from severe ground clutter and the ionosphere cannot be measured in any simple manner at ranges less than about 120–150 km, depending on the modulation employed. If the target and clutter signals have different, and clearly identifiable, properties then, in principle, there are always ways to eliminate the clutter. In incoherent scatter measurements, differences in the coherence times of the wanted and unwanted signals can be used for clutter cancellation. The clutter cancellation must be applied to all modulations, usually alternating codes in modern experiments, used for shorter ranges. Excellent results have been obtained at the ESR using a simple pulse-to-pulse clutter subtraction method, but there are also other possibilities.Key words: Radio science (ionospheric physics; signal processing; instruments and techniques

  11. Loss of incoherence and determination of coupling constants in quantum gravity

    International Nuclear Information System (INIS)

    Giddings, S.B.; Strominger, A.

    1988-01-01

    The wave function of an interacting 'family' of one large 'parent' and many Planck-sized 'baby' universes is computed in a semiclassical approximation using an adaptation of Hartle-Hawking initial conditions. A recently discovered gravitational instanton which exists for general relativity coupled to axions is employed. The outcome of a single experiment in the parent universe is in general described by a mixed state, even if the initial state is pure. However, a sequence of measurements rapidly collapses the wave function of the family of universes into one of an infinite number of 'coherent' states for which quantum incoherence is not observed in the parent universe. This provides a concrete illustration of an unexpected phenomena whose existence has been argued for on quite general grounds by Coleman: Quantum incoherence due to information loss to baby universes is not experimentally observable. We further argue that all coupling constants governing dynamics in the parent universe depend on the parameters describing the particular coherent state into which the family wave function collapses. In particular, generically terms that violate any global symmetries will be induced in the effective action for the parent universe. These last results have much broader applicability than our specific model. (orig.)

  12. Application of a Simplified Method for Estimating Perfusion Derived from Diffusion-Weighted MR Imaging in Glioma Grading.

    Science.gov (United States)

    Cao, Mengqiu; Suo, Shiteng; Han, Xu; Jin, Ke; Sun, Yawen; Wang, Yao; Ding, Weina; Qu, Jianxun; Zhang, Xiaohua; Zhou, Yan

    2017-01-01

    Purpose : To evaluate the feasibility of a simplified method based on diffusion-weighted imaging (DWI) acquired with three b -values to measure tissue perfusion linked to microcirculation, to validate it against from perfusion-related parameters derived from intravoxel incoherent motion (IVIM) and dynamic contrast-enhanced (DCE) magnetic resonance (MR) imaging, and to investigate its utility to differentiate low- from high-grade gliomas. Materials and Methods : The prospective study was approved by the local institutional review board and written informed consent was obtained from all patients. From May 2016 and May 2017, 50 patients confirmed with glioma were assessed with multi- b -value DWI and DCE MR imaging at 3.0 T. Besides conventional apparent diffusion coefficient (ADC 0,1000 ) map, perfusion-related parametric maps for IVIM-derived perfusion fraction ( f ) and pseudodiffusion coefficient (D*), DCE MR imaging-derived pharmacokinetic metrics, including K trans , v e and v p , as well as a metric named simplified perfusion fraction (SPF), were generated. Correlation between perfusion-related parameters was analyzed by using the Spearman rank correlation. All imaging parameters were compared between the low-grade ( n = 19) and high-grade ( n = 31) groups by using the Mann-Whitney U test. The diagnostic performance for tumor grading was evaluated with receiver operating characteristic (ROC) analysis. Results : SPF showed strong correlation with IVIM-derived f and D* ( ρ = 0.732 and 0.716, respectively; both P simplified method to measure tissue perfusion based on DWI by using three b -values may be helpful to differentiate low- from high-grade gliomas. SPF may serve as a valuable alternative to measure tumor perfusion in gliomas in a noninvasive, convenient and efficient way.

  13. Formation of 2D bright spatial solitons in lithium niobate with photovoltaic response and incoherent background

    Science.gov (United States)

    Pustozerov, A.; Shandarov, V.

    2017-12-01

    The influence of incoherent background illumination produced by light-emitting diodes (LED's) of different average wavelengths and laser diode emitting in blue region of visible on diffraction characteristics of narrow coherent light beams of He-Ne laser due to refractive index changes of Fe-doped lithium niobate sample are studied. It has been experimentally demonstrated that nonlinear diffraction of red beams with wavelength 633 nm and diameters on full width of half maximum (FWHM) near to 15 μm may be totally compensated using background light with average wavelengths 450 - 465 nm. To provide the necessary intensity of incoherent background, the combinations of spherical and cylindrical concave lenses with blue LED and laser diode module without focusing its beam have been used.

  14. Delineating incoherent non-Markovian dynamics using quantum coherence

    Energy Technology Data Exchange (ETDEWEB)

    Chanda, Titas, E-mail: titaschanda@hri.res.in; Bhattacharya, Samyadeb, E-mail: samyadebbhattacharya@hri.res.in

    2016-03-15

    We introduce a method of characterization of non-Markovianity using coherence of a system interacting with the environment. We show that under the allowed incoherent operations, monotonicity of a valid coherence measure is affected due to non-Markovian features of the system–environment evolution. We also define a measure to quantify non-Markovianity of the underlying dynamics based on the non-monotonic behavior of the coherence measure. We investigate our proposed non-Markovianity marker in the behavior of dephasing and dissipative dynamics for one and two qubit cases. We also show that our proposed measure captures the back-flow of information from the environment to the system and compatible with well known distinguishability criteria of non-Markovianity.

  15. Correlated diffusion imaging

    International Nuclear Information System (INIS)

    Wong, Alexander; Glaister, Jeffrey; Cameron, Andrew; Haider, Masoom

    2013-01-01

    Prostate cancer is one of the leading causes of cancer death in the male population. Fortunately, the prognosis is excellent if detected at an early stage. Hence, the detection and localization of prostate cancer is crucial for diagnosis, as well as treatment via targeted focal therapy. New imaging techniques can potentially be invaluable tools for improving prostate cancer detection and localization. In this study, we introduce a new form of diffusion magnetic resonance imaging called correlated diffusion imaging, where the tissue being imaged is characterized by the joint correlation of diffusion signal attenuation across multiple gradient pulse strengths and timings. By taking into account signal attenuation at different water diffusion motion sensitivities, correlated diffusion imaging can provide improved delineation between cancerous tissue and healthy tissue when compared to existing diffusion imaging modalities. Quantitative evaluation using receiver operating characteristic (ROC) curve analysis, tissue class separability analysis, and visual assessment by an expert radiologist were performed to study correlated diffusion imaging for the task of prostate cancer diagnosis. These results are compared with that obtained using T2-weighted imaging and standard diffusion imaging (via the apparent diffusion coefficient (ADC)). Experimental results suggest that correlated diffusion imaging provide improved delineation between healthy and cancerous tissue and may have potential as a diagnostic tool for cancer detection and localization in the prostate gland. A new form of diffusion magnetic resonance imaging called correlated diffusion imaging (CDI) was developed for the purpose of aiding radiologists in cancer detection and localization in the prostate gland. Preliminary results show CDI shows considerable promise as a diagnostic aid for radiologists in the detection and localization of prostate cancer

  16. A Simplified Approach to Measure the Effect of the Microvasculature in Diffusion-weighted MR Imaging Applied to Breast Tumors: Preliminary Results.

    Science.gov (United States)

    Teruel, Jose R; Goa, Pål E; Sjøbakk, Torill E; Østlie, Agnes; Fjøsne, Hans E; Bathen, Tone F

    2016-11-01

    Purpose To evaluate the relative change of the apparent diffusion coefficient (ADC) at low- and medium-b-value regimens as a surrogate marker of microcirculation, to study its correlation with dynamic contrast agent-enhanced (DCE) magnetic resonance (MR) imaging-derived parameters, and to assess its potential for differentiation between malignant and benign breast tumors. Materials and Methods Ethics approval and informed consent were obtained. From May 2013 to June 2015, 61 patients diagnosed with either malignant or benign breast tumors were prospectively recruited. All patients were scanned with a 3-T MR imager, including diffusion-weighted imaging (DWI) and DCE MR imaging. Parametric analysis of DWI and DCE MR imaging was performed, including a proposed marker, relative enhanced diffusivity (RED). Spearman correlation was calculated between DCE MR imaging and DWI parameters, and the potential of the different DWI-derived parameters for differentiation between malignant and benign breast tumors was analyzed by dividing the sample into equally sized training and test sets. Optimal cut-off values were determined with receiver operating characteristic curve analysis in the training set, which were then used to evaluate the independent test set. Results RED had a Spearman rank correlation of 0.61 with the initial area under the curve calculated from DCE MR imaging. Furthermore, RED differentiated cancers from benign tumors with an overall accuracy of 90% (27 of 30) on the test set with 88.2% (15 of 17) sensitivity and 92.3% (12 of 13) specificity. Conclusion This study presents promising results introducing a simplified approach to assess results from a DWI protocol sensitive to the intravoxel incoherent motion effect by using only three b values. This approach could potentially aid in the differentiation, characterization, and monitoring of breast pathologies. © RSNA, 2016 Online supplemental material is available for this article.

  17. A study of the diffusion mechanisms in amorphous metallic alloys: diffusion and diffusion under high pressure in an amorphous NiZr alloy; Contribution a l`etude des mecanismes de transport dans les materiaux metalliques amorphes: diffusion et diffusion sous pression dans NiZr amorphe

    Energy Technology Data Exchange (ETDEWEB)

    Grandjean, A.

    1996-03-01

    The aim of this work is a better understanding of the diffusion mechanism in amorphous metallic alloys. Then interdiffusion and hafnium diffusion in amorphous NiZr alloy have been studied. Samples used are made by sputtering co-deposition under vacuum and are well relaxed before the diffusion measurements. The time evolution of resistivity during annealing due to the decay of a composition modulated film has been measured and from this change in resistivity interdiffusion coefficients have been determined. Dependence of Hf diffusion on temperature and pressure has been studied using (SIMS). In this two cases, the diffusion process obeys an Arrhenius law and gives an activation energy of 1.33 eV for interdiffusion, and 0.76 eV for Hf diffusion. An effect of pressure on Hf diffusion has been found leading to an activation volume of 8.5 angstrom{sup 3}. Thanks to these results, two approaches of the diffusion mechanisms in these systems have been proposed. The first comes from a comparison with the diffusion mechanisms in crystalline metals, that is to say by point defects. The second is an hypothesis of collective motions in these non crystalline alloys. (author).

  18. Comparison of biexponential and monoexponential model of diffusion-weighted imaging for distinguishing between common renal cell carcinoma and fat poor angiomyolipoma

    International Nuclear Information System (INIS)

    Ding, Yuqin; Zeng, Mengsu; Rao, Shengxiang; Chen, Caizhong; Fu, Caixia

    2016-01-01

    To compare the diagnostic accuracy of intravoxel incoherent motion (IVIM)-derived parameters and apparent diffusion coefficient (ADC) in distinguishing between renal cell carcinoma (RCC) and fat poor angiomyolipoma (AML). Eighty-three patients with pathologically confirmed renal tumors were included in the study. All patients underwent renal 1.5T MRI, including IVIM protocol with 8 b values (0-800 s/mm"2). The ADC, diffusion coefficient (D), pseudodiffusion coefficient (D*), and perfusion fraction (f) were calculated. One-way ANOVA was used for comparing ADC and IVIM-derived parameters among clear cell RCC (ccRCC), non-ccRCC and fat poor AML. The diagnostic performance of these parameters was evaluated by using receiver operating characteristic (ROC) analysis. The ADC were significantly greater in ccRCCs than that of non-ccRCCs and fat poor AMLs (each p 0.97 × 10"-"3 mm"2/s, D* < 28.03 × 10"-"3 mm"2/s, and f < 13.61% maximized the diagnostic sensitivity for distinguishing non-ccRCCs from fat poor AMLs. The final estimates of AUC (95% confidence interval), sensitivity, specificity, positive predictive value, negative predictive value and accuracy for the entire cohort were 0.875 (0.719-0.962), 100% (23/23), 75% (9/12), 88.5% (23/26), 100% (9/9), and 91.4% (32/35), respectively. The ADC and D showed similar diagnostic accuracy in distinguishing between ccRCCs and fat poor AMLs. The IVIM-derived parameters were better than ADC in discriminating non-ccRCCs from fat poor AMLs

  19. Collective motion in quantum many-body systems

    Energy Technology Data Exchange (ETDEWEB)

    Haemmerling, Jens

    2011-06-07

    We study the emergence of collective dynamics in the integrable Hamiltonian system of two finite ensembles of coupled harmonic oscillators. After identification of a collective degree of freedom, the Hamiltonian is mapped onto a model of Caldeira-Leggett type, where the collective coordinate is coupled to an internal bath of phonons. In contrast to the usual Caldeira-Leggett model, the bath in the present case is part of the system. We derive an equation of motion for the collective coordinate which takes the form of a damped harmonic oscillator. We show that the distribution of quantum transition strengths induced by the collective mode is determined by its classical dynamics. This allows us to derive the spreading for the collective coordinate from first principles. After that we study the interplay between collective and incoherent single-particle motion in a model of two chains of particles whose interaction comprises a non-integrable part. In the perturbative regime, but for a general form of the interaction, we calculate the Fourier transform of the time correlation for the collective coordinate. We obtain the remarkable result that it always has a unique semi-classical interpretation. We show this by a proper renormalization procedure which also allows us to map the non-integrable system to the integrable model of Caldeira-Leggett-type considered previously in which the bath is part of the system.

  20. Some Aspects of Diffusion Theory

    CERN Document Server

    Pignedoli, A

    2011-01-01

    This title includes: V.C.A. Ferraro: Diffusion of ions in a plasma with applications to the ionosphere; P.C. Kendall: On the diffusion in the atmosphere and ionosphere; F. Henin: Kinetic equations and Brownian motion; T. Kahan: Theorie des reacteurs nucleaires: methodes de resolution perturbationnelles, interactives et variationnelles; C. Cattaneo: Sulla conduzione del calore; C. Agostinelli: Formule di Green per la diffusione del campo magnetico in un fluido elettricamente conduttore; A. Pignedoli: Transformational methods applied to some one-dimensional problems concerning the equations of t

  1. Diffusion imaging and tractography of congenital brain malformations

    International Nuclear Information System (INIS)

    Wahl, Michael; Barkovich, A.J.; Mukherjee, Pratik

    2010-01-01

    Diffusion imaging is an MRI modality that measures the microscopic molecular motion of water in order to investigate white matter microstructure. The modality has been used extensively in recent years to investigate the neuroanatomical basis of congenital brain malformations. We review the basic principles of diffusion imaging and of specific techniques, including diffusion tensor imaging (DTI) and high angular resolution diffusion imaging (HARDI). We show how DTI and HARDI, and their application to fiber tractography, has elucidated the aberrant connectivity underlying a number of congenital brain malformations. Finally, we discuss potential uses for diffusion imaging of developmental disorders in the clinical and research realms. (orig.)

  2. Brownian motion of tethered nanowires.

    Science.gov (United States)

    Ota, Sadao; Li, Tongcang; Li, Yimin; Ye, Ziliang; Labno, Anna; Yin, Xiaobo; Alam, Mohammad-Reza; Zhang, Xiang

    2014-05-01

    Brownian motion of slender particles near a boundary is ubiquitous in biological systems and in nanomaterial assembly, but the complex hydrodynamic interaction in those systems is still poorly understood. Here, we report experimental and computational studies of the Brownian motion of silicon nanowires tethered on a substrate. An optical interference method enabled direct observation of microscopic rotations of the slender bodies in three dimensions with high angular and temporal resolutions. This quantitative observation revealed anisotropic and angle-dependent hydrodynamic wall effects: rotational diffusivity in inclined and azimuth directions follows different power laws as a function of the length, ∼ L(-2.5) and ∼ L(-3), respectively, and is more hindered for smaller inclined angles. In parallel, we developed an implicit simulation technique that takes the complex wire-wall hydrodynamic interactions into account efficiently, the result of which agreed well with the experimentally observed angle-dependent diffusion. The demonstrated techniques provide a platform for studying the microrheology of soft condensed matters, such as colloidal and biological systems near interfaces, and exploring the optimal self-assembly conditions of nanostructures.

  3. Diffusion in ceramics

    CERN Document Server

    Pelleg, Joshua

    2016-01-01

    This textbook provides an introduction to changes that occur in solids such as ceramics, mainly at high temperatures, which are diffusion controlled, as well as presenting research data. Such changes are related to the kinetics of various reactions such as precipitation, oxidation and phase transformations, but are also related to some mechanical changes, such as creep. The book is composed of two parts, beginning with a look at the basics of diffusion according to Fick's Laws. Solutions of Fick’s second law for constant D, diffusion in grain boundaries and dislocations are presented along with a look at the atomistic approach for the random motion of atoms. In the second part, the author discusses diffusion in several technologically important ceramics. The ceramics selected are monolithic single phase ones, including: A12O3, SiC, MgO, ZrO2 and Si3N4. Of these, three refer to oxide ceramics (alumina, magnesia and zirconia). Carbide based ceramics are represented by the technologically very important Si-ca...

  4. Molecules in motion: influences of diffusion on metabolic structure and function in skeletal muscle.

    Science.gov (United States)

    Kinsey, Stephen T; Locke, Bruce R; Dillaman, Richard M

    2011-01-15

    Metabolic processes are often represented as a group of metabolites that interact through enzymatic reactions, thus forming a network of linked biochemical pathways. Implicit in this view is that diffusion of metabolites to and from enzymes is very fast compared with reaction rates, and metabolic fluxes are therefore almost exclusively dictated by catalytic properties. However, diffusion may exert greater control over the rates of reactions through: (1) an increase in reaction rates; (2) an increase in diffusion distances; or (3) a decrease in the relevant diffusion coefficients. It is therefore not surprising that skeletal muscle fibers have long been the focus of reaction-diffusion analyses because they have high and variable rates of ATP turnover, long diffusion distances, and hindered metabolite diffusion due to an abundance of intracellular barriers. Examination of the diversity of skeletal muscle fiber designs found in animals provides insights into the role that diffusion plays in governing both rates of metabolic fluxes and cellular organization. Experimental measurements of metabolic fluxes, diffusion distances and diffusion coefficients, coupled with reaction-diffusion mathematical models in a range of muscle types has started to reveal some general principles guiding muscle structure and metabolic function. Foremost among these is that metabolic processes in muscles do, in fact, appear to be largely reaction controlled and are not greatly limited by diffusion. However, the influence of diffusion is apparent in patterns of fiber growth and metabolic organization that appear to result from selective pressure to maintain reaction control of metabolism in muscle.

  5. Measurements of integral cross-sections of incoherent interactions of photons with L-shell electrons

    Energy Technology Data Exchange (ETDEWEB)

    Verma, S L; Allawadhi, K L; Sood, B S [Punjabi Univ., Patiala (India). Nuclear Science Labs.

    1983-05-21

    Integral cross-sections of incoherent interactions of 662 and 1250 keV gamma-rays with L-shell electrons of different elements with 74<=Z<=92 have been measured. The experimental results, when interpreted in terms of photoelectric and Compton interaction cross-sections, are found to agree with theory.

  6. Three-dimensional mapping of fluorescent nanoparticles using incoherent digital holography.

    Science.gov (United States)

    Yanagawa, Takumi; Abe, Ryosuke; Hayasaki, Yoshio

    2015-07-15

    Three-dimensional mapping of fluorescent nanoparticles was performed by using incoherent digital holography. The positions of the nanoparticles were quantitatively determined by using Gaussian fitting of the axial- and lateral-diffraction distributions through position calibration from the observation space to the sample space. It was found that the axial magnification was constant whereas the lateral magnification linearly depended on the axial position of the fluorescent nanoparticles. The mapping of multiple fluorescent nanoparticles fixed in gelatin and a single fluorescent nanoparticle manipulated with optical tweezers in water were demonstrated.

  7. Parametric instabilities of parallel propagating incoherent Alfven waves in a finite ion beta plasma

    International Nuclear Information System (INIS)

    Nariyuki, Y.; Hada, T.; Tsubouchi, K.

    2007-01-01

    Large amplitude, low-frequency Alfven waves constitute one of the most essential elements of magnetohydrodynamic (MHD) turbulence in the fast solar wind. Due to small collisionless dissipation rates, the waves can propagate long distances and efficiently convey such macroscopic quantities as momentum, energy, and helicity. Since loading of such quantities is completed when the waves damp away, it is important to examine how the waves can dissipate in the solar wind. Among various possible dissipation processes of the Alfven waves, parametric instabilities have been believed to be important. In this paper, we numerically discuss the parametric instabilities of coherent/incoherent Alfven waves in a finite ion beta plasma using a one-dimensional hybrid (superparticle ions plus an electron massless fluid) simulation, in order to explain local production of sunward propagating Alfven waves, as suggested by Helios/Ulysses observation results. Parameter studies clarify the dependence of parametric instabilities of coherent/incoherent Alfven waves on the ion and electron beta ratio. Parametric instabilities of coherent Alfven waves in a finite ion beta plasma are vastly different from those in the cold ions (i.e., MHD and/or Hall-MHD systems), even if the collisionless damping of the Alfven waves are neglected. Further, ''nonlinearly driven'' modulational instability is important for the dissipation of incoherent Alfven waves in a finite ion beta plasma regardless of their polarization, since the ion kinetic effects let both the right-hand and left-hand polarized waves become unstable to the modulational instability. The present results suggest that, although the antisunward propagating dispersive Alfven waves are efficiently dissipated through the parametric instabilities in a finite ion beta plasma, these instabilities hardly produce the sunward propagating waves

  8. Review of diffusion tensor imaging and its application in children

    Energy Technology Data Exchange (ETDEWEB)

    Vorona, Gregory A. [Children' s Hospital of Richmond at Virginia Commonwealth University, Department of Radiology, Richmond, VA (United States); Berman, Jeffrey I. [Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States)

    2015-09-15

    Diffusion MRI is an imaging technique that uses the random motion of water to probe tissue microstructure. Diffusion tensor imaging (DTI) can quantitatively depict the organization and connectivity of white matter. Given the non-invasiveness of the technique, DTI has become a widely used tool for researchers and clinicians to examine the white matter of children. This review covers the basics of diffusion-weighted imaging and diffusion tensor imaging and discusses examples of their clinical application in children. (orig.)

  9. Nonstationary random acoustic and electromagnetic fields as wave diffusion processes

    International Nuclear Information System (INIS)

    Arnaut, L R

    2007-01-01

    We investigate the effects of relatively rapid variations of the boundaries of an overmoded cavity on the stochastic properties of its interior acoustic or electromagnetic field. For quasi-static variations, this field can be represented as an ideal incoherent and statistically homogeneous isotropic random scalar or vector field, respectively. A physical model is constructed showing that the field dynamics can be characterized as a generalized diffusion process. The Langevin-It o-hat and Fokker-Planck equations are derived and their associated statistics and distributions for the complex analytic field, its magnitude and energy density are computed. The energy diffusion parameter is found to be proportional to the square of the ratio of the standard deviation of the source field to the characteristic time constant of the dynamic process, but is independent of the initial energy density, to first order. The energy drift vanishes in the asymptotic limit. The time-energy probability distribution is in general not separable, as a result of nonstationarity. A general solution of the Fokker-Planck equation is obtained in integral form, together with explicit closed-form solutions for several asymptotic cases. The findings extend known results on statistics and distributions of quasi-stationary ideal random fields (pure diffusions), which are retrieved as special cases

  10. Seismic behavior of NPP structures subjected to realistic 3D, inclined seismic motions, in variable layered soil/rock, on surface or embedded foundations

    International Nuclear Information System (INIS)

    Jeremić, B.; Tafazzoli, N.; Ancheta, T.; Orbović, N.; Blahoianu, A.

    2013-01-01

    Highlights: • Full 3D, inclined, incoherent seismic motions used for modeling SSI of an NPP. • Analyzed effects of variable and uniform soil/rock layering profiles on SSI. • Surface and embedded foundations were modeled and differences analyzed. - Abstract: Presented here is an investigation of the seismic response of a massive NPP structures due to full 3D, inclined, un-correlated input motions for different soil and rock profiles. Of particular interest are the effects of soil and rock layering on the response and the changes of input motions (frequency characteristics) due to such layering. In addition to rock/soil layering effects, investigated are also effects of foundation embedment on dynamic response. Significant differences were observed in dynamic response of containment and internal structure founded on surface and on embedded foundations. These differences were observed for both rock and soil profiles. Select results are used to present most interesting findings

  11. Incoherent quasielastic neutron scattering from water in supercooled regime

    International Nuclear Information System (INIS)

    Chen, S.; Teixeira, J.; Nicklow, R.

    1982-01-01

    Measurements of the quasielastic spectra have been made with a three-axis neutron spectrometer at constant-Q mode in a temperature range from 38 0 C down to -20 0 C. Two energy resolutions both high (δE = 100 μ eV) and low (δE = 800 μ eV) were used to identify and separate a sharp component from a broad one. As temperature is decreased below zero the spectrum shows an increasing sharp component standing out on top of the broad one. The broad component is attributed to rotational motions of water molecules. A preliminary analysis of the linewidths gives a Q-independent relaxation time which has the same magnitude as the rotational relaxation time measured by nuclear magnetic resonance. The Q dependence of the sharp line is analyzed by a Q-dependent diffusion coefficient. A temperature-independent characteristic length l 0 = 0.5 A is obtained. We then attempt to relate this length to local geometry of protons associated with hydrogen bonding

  12. Needlelike motion of prolate ellipsoids in the sea of spheres

    Science.gov (United States)

    Vasanthi, R.; Ravichandran, S.; Bagchi, Biman

    2001-05-01

    Molecular dynamics simulations of translational motion of isolated prolate ellipsoids in the sea of spheres have been carried out for several different values of the aspect ratio (κ), obtained by changing either the length or the diameter of the ellipsoids, at several different solvent densities. The interaction among the spheres is given by the Lennard-Jones pair potential while that between spheres and ellipsoids is given by a modified Gay-Berne potential. Both the mean-square displacements of the center of mass of the ellipsoids and their orientational time correlation function have been calculated. It is found that at short to intermediate times, the motion of ellipsoids is anisotropic and primarily needlelike—the molecules prefer to move parallel to their long axis. The ratio of these two diffusion constants (D∥ and D⊥) approaches κ, suggesting a decoupling of D∥ from the length of the ellipsoid. The diffusion becomes isotropic in the long time with the total diffusion coefficient given by D∥+2D⊥. The crossover from the anisotropic to the isotropic diffusion is surprisingly sharp and clear in most cases.

  13. Ion layers, tides, gravity waves, and electric fields in the upper atmosphere, inferred from Arecibo incoherent scatter radar measurements

    International Nuclear Information System (INIS)

    Morton, Y.T.

    1991-01-01

    This thesis uses data accumulated during 1980-1989 by the Arecibo incoherent scatter radar to study the behavior and physics of ionization irregularities. Low latitude ionization irregularities, known as sporadic-E and intermediate layers, undergo a regular daily descent, convergence, and dumping of ion layers controlled by the neutral tidal wind. A useful way of studying ion layers and their motion is by ion layer trajectory maps which consist of points representing the altitude and time of ionization layers. Two types of maps were used which assigned either a uniform layer intensity or a gray level/pseudo-color to indicate different layer intensities. Important aspects of layer formation are revealed by map analysis. During January, intermediate layers consistently appeared four times per day instead of the normal twice per day pattern. Simulation of ion trajectories based on the ion momentum equation, which includes both Lorentzian and collisional forces, shows that a combination of diurnal, semidiurnal, and six-hour tides is necessary for such a feature to exist, whereas only diurnal and semidiurnal tides are needed to create the normal pattern. The six-hour period tide has not been previously reported. Extra or irregular layers appear frequently in layer trajectory maps, which can be simulated by the addition of gravity waves to the regular tidal wind system. Electric field effects are normally not a factor in low latitude ion layer formation because they are relatively weak and not commonly observed. Layer configurations during a geomagnetic storm, however, indicate that the electric field played an important role in controlling ion motion

  14. Enhanced separation of diffusing particles by chaotic advection

    International Nuclear Information System (INIS)

    Aref, H.; Jones, S.W.

    1989-01-01

    Combining the reversibility of advection by a Stokes flow with the irreversibility of diffusion leads to a separation strategy for diffusing substances. This basic idea goes back to Taylor and Heller. It is shown here that the sensitivity of the method can be greatly enhanced by making the advection chaotic. The separation is particularly efficient when the thinnest structures resulting from advection are made comparable in size to a diffusion length. Simple heuristic estimates based on an understanding of chaotic motion and diffusion lead to a certain scaling that is seen in numerical experiments on this separation method

  15. New neutron-based isotopic analytical methods; An explorative study of resonance capture and incoherent scattering

    NARCIS (Netherlands)

    Perego, R.C.

    2004-01-01

    Two novel neutron-based analytical techniques have been treated in this thesis, Neutron Resonance Capture Analysis (NRCA), employing a pulsed neutron source, and Neutron Incoherent Scattering (NIS), making use of a cold neutron source. With the NRCA method isotopes are identified by the

  16. A design of a wavelength-hopping time-spreading incoherent optical code division multiple access system

    International Nuclear Information System (INIS)

    Glesk, I.; Baby, V.

    2005-01-01

    We present the architecture and code design for a highly scalable, 2.5 Gb/s per user optical code division multiple access (OCDMA) system. The system is scalable to 100 potential and more than 10 simultaneous users, each with a bit error rate (BER) of less than 10 -9 . The system architecture uses a fast wavelength-hopping, time-spreading codes. Unlike frequency and phase sensitive coherent OCDMA systems, this architecture utilizes standard on off keyed optical pulses allocated in the time and wavelength dimensions. This incoherent OCDMA approach is compatible with existing WDM optical networks and utilizes off the shelf components. We discuss the novel optical subsystem design for encoders and decoders that enable the realization of a highly scalable incoherent OCDMA system with rapid reconfigurability. A detailed analysis of the scalability of the two dimensional code is presented and select network deployment architectures for OCDMA are discussed (Authors)

  17. Measurement of integral cross-sections of incoherent interactions of photons with K-shell electrons

    Energy Technology Data Exchange (ETDEWEB)

    Verma, S L; Allawadhi, K L; Sood, B S [Punjabi Univ., Patiala (India). Dept. of Physics. Nuclear Science Labs.

    1981-06-01

    Integral cross-sections of incoherent interactions of 145, 279, 662 and 1250 keV gamma-rays with K-shell electrons of thirty-one different elements with 26 <= Z <= 92 have been measured. The results are interpreted in terms of the photoelectric and Compton interactions and are found to agree with theory.

  18. On time-dependent diffusion coefficients arising from stochastic processes with memory

    Science.gov (United States)

    Carpio-Bernido, M. Victoria; Barredo, Wilson I.; Bernido, Christopher C.

    2017-08-01

    Time-dependent diffusion coefficients arise from anomalous diffusion encountered in many physical systems such as protein transport in cells. We compare these coefficients with those arising from analysis of stochastic processes with memory that go beyond fractional Brownian motion. Facilitated by the Hida white noise functional integral approach, diffusion propagators or probability density functions (pdf) are obtained and shown to be solutions of modified diffusion equations with time-dependent diffusion coefficients. This should be useful in the study of complex transport processes.

  19. Respiratory lung motion analysis using a nonlinear motion correction technique for respiratory-gated lung perfusion SPECT images

    International Nuclear Information System (INIS)

    Ue, Hidenori; Haneishi, Hideaki; Iwanaga, Hideyuki; Suga, Kazuyoshi

    2007-01-01

    This study evaluated the respiratory motion of lungs using a nonlinear motion correction technique for respiratory-gated single photon emission computed tomography (SPECT) images. The motion correction technique corrects the respiratory motion of the lungs nonlinearly between two-phase images obtained by respiratory-gated SPECT. The displacement vectors resulting from respiration can be computed at every location of the lungs. Respiratory lung motion analysis is carried out by calculating the mean value of the body axis component of the displacement vector in each of the 12 small regions into which the lungs were divided. In order to enable inter-patient comparison, the 12 mean values were normalized by the length of the lung region along the direction of the body axis. This method was applied to 25 Technetium (Tc)-99m-macroaggregated albumin (MAA) perfusion SPECT images, and motion analysis results were compared with the diagnostic results. It was confirmed that the respiratory lung motion reflects the ventilation function. A statistically significant difference in the amount of the respiratory lung motion was observed between the obstructive pulmonary diseases and other conditions, based on an unpaired Student's t test (P<0.0001). A difference in the motion between normal lungs and lungs with a ventilation obstruction was detected by the proposed method. This method is effective for evaluating obstructive pulmonary diseases such as pulmonary emphysema and diffuse panbronchiolitis. (author)

  20. Diffusion-Weighted Magnetic Resonance Imaging of Cerebrospinal Fluid in Patients with and without Communicating Hydrocephalus

    International Nuclear Information System (INIS)

    Nasel, C.; Gentzsch, S.; Heimberger, K.

    2007-01-01

    Background: Recent concepts about cerebrospinal fluid (CSF) circulation in communicating hydrocephalus (CoHy), which is also termed 'restricted arterial pulsation hydrocephalus,' suggest reduced arterial pulsations of subarachnoid vessels with a smaller amount of CSF shifted in subarachnoid spaces during the early systole. The postulated restriction of subarachnoid arterial pulsations in CoHy should induce a smaller motion artifact and reduced local stream effects in CSF in magnetic resonance (MR) diffusion-weighted imaging (DWI). Purpose: To investigate the maximum diffusivity in CSF in patients with and without CoHy using DWI. Material and Methods: 12 patients without CSF circulation disturbances and six cases with proven CoHy were assessed. Diffusion was measured in six non collinear directions without triggering the arterial pulse wave (scan time 6:45 min, voxel size 2x2x2 mm). Due to expected artifacts, the calculated maximum diffusivity was called apparent diffusivity. Regional high and low apparent diffusivity was assessed in CSF spaces on newly created 3D CSF motion maps. Results: Patients with regular CSF circulation exhibited high apparent diffusivity in CSF in basal subarachnoid spaces, whereas apparent diffusivity was low there in patients with CoHy. Conclusion: DWI opens a feasible approach to study CSF motion in the neurocranium. Restricted arterial pulsations seem to be involved in CoHy

  1. Diffusion-Weighted Magnetic Resonance Imaging of Cerebrospinal Fluid in Patients with and without Communicating Hydrocephalus

    Energy Technology Data Exchange (ETDEWEB)

    Nasel, C.; Gentzsch, S.; Heimberger, K. [Cerebrovascular Imaging Workgroup of the Div. of Neuroradiology, Dept. of Radiology, Medical Univ. Vienna, Vienna (Austria)

    2007-09-15

    Background: Recent concepts about cerebrospinal fluid (CSF) circulation in communicating hydrocephalus (CoHy), which is also termed 'restricted arterial pulsation hydrocephalus,' suggest reduced arterial pulsations of subarachnoid vessels with a smaller amount of CSF shifted in subarachnoid spaces during the early systole. The postulated restriction of subarachnoid arterial pulsations in CoHy should induce a smaller motion artifact and reduced local stream effects in CSF in magnetic resonance (MR) diffusion-weighted imaging (DWI). Purpose: To investigate the maximum diffusivity in CSF in patients with and without CoHy using DWI. Material and Methods: 12 patients without CSF circulation disturbances and six cases with proven CoHy were assessed. Diffusion was measured in six non collinear directions without triggering the arterial pulse wave (scan time 6:45 min, voxel size 2x2x2 mm). Due to expected artifacts, the calculated maximum diffusivity was called apparent diffusivity. Regional high and low apparent diffusivity was assessed in CSF spaces on newly created 3D CSF motion maps. Results: Patients with regular CSF circulation exhibited high apparent diffusivity in CSF in basal subarachnoid spaces, whereas apparent diffusivity was low there in patients with CoHy. Conclusion: DWI opens a feasible approach to study CSF motion in the neurocranium. Restricted arterial pulsations seem to be involved in CoHy.

  2. Diffusion with Varying Drag; the Runaway Problem.

    Science.gov (United States)

    Rollins, David Kenneth

    We study the motion of electrons in an ionized plasma of electrons and ions in an external electric field. A probability distribution function describes the electron motion and is a solution of a Fokker-Planck equation. In zero field, the solution approaches an equilibrium Maxwellian. For arbitrarily small field, electrons overcome the diffusive effects and are freely accelerated by the field. This is the electron runaway phenomenon. We treat the electric field as a small perturbation. We consider various diffusion coefficients for the one dimensional problem and determine the runaway current as a function of the field strength. Diffusion coefficients, non-zero on a finite interval are examined. Some non-trivial cases of these can be solved exactly in terms of known special functions. The more realistic case where the diffusion coefficient decays with velocity are then considered. To determine the runaway current, the equivalent Schrodinger eigenvalue problem is analysed. The smallest eigenvalue is shown to be equal to the runaway current. Using asymptotic matching a solution can be constructed which is then used to evaluate the runaway current. The runaway current is exponentially small as a function of field strength. This method is used to extract results from the three dimensional problem.

  3. Diffusion with varying drag; the runaway problem

    International Nuclear Information System (INIS)

    Rollins, D.K.

    1986-01-01

    The motion of electrons in an ionized plasma of electrons and ions in an external electric field is studied. A probability distribution function describes the electron motion and is a solution of a Fokker-Planck equation. In zero field, the solution approaches an equilibrium Maxwellian. For arbitrarily small field, electrons overcome the diffusive effects and are freely accelerated by the field. This is the electron-runaway phenomenon. The electric field is treated as a small perturbation. Various diffusion coefficients are considered for the one dimensional problem, and the runaway current is determined as a function of the field strength. Diffusion coefficients, non-zero on a finite interval are examined. Some non-trivial cases of these can be solved exactly in terms of known special functions. The more realistic case where the diffusion coeffient decays with velocity are then considered. To determine the runaway current, the equivalent Schroedinger eigenvalue problem is analyzed. The smallest eigenvalue is shown to be equal to the runaway current. Using asymptotic matching, a solution can be constructed which is then used to evaluate the runaway current. The runaway current is exponentially small as a function of field strength. This method is used to extract results from the three dimensional problem

  4. Numerical vs. turbulent diffusion in geophysical flow modelling

    International Nuclear Information System (INIS)

    D'Isidoro, M.; Maurizi, A.; Tampieri, F.

    2008-01-01

    Numerical advection schemes induce the spreading of passive tracers from localized sources. The effects of changing resolution and Courant number are investigated using the WAF advection scheme, which leads to a sub-diffusive process. The spreading rate from an instantaneous source is compared with the physical diffusion necessary to simulate unresolved turbulent motions. The time at which the physical diffusion process overpowers the numerical spreading is estimated, and is shown to reduce as the resolution increases, and to increase as the wind velocity increases.

  5. ARTIFICIAL INCOHERENT SPECKLES ENABLE PRECISION ASTROMETRY AND PHOTOMETRY IN HIGH-CONTRAST IMAGING

    Energy Technology Data Exchange (ETDEWEB)

    Jovanovic, N.; Guyon, O.; Pathak, P.; Kudo, T. [National Astronomical Observatory of Japan, Subaru Telescope, 650 North A’Ohoku Place, Hilo, HI, 96720 (United States); Martinache, F. [Observatoire de la Cote d’Azur, Boulevard de l’Observatoire, F-06304 Nice (France); Hagelberg, J., E-mail: jovanovic.nem@gmail.com [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)

    2015-11-10

    State-of-the-art coronagraphs employed on extreme adaptive optics enabled instruments are constantly improving the contrast detection limit for companions at ever-closer separations from the host star. In order to constrain their properties and, ultimately, compositions, it is important to precisely determine orbital parameters and contrasts with respect to the stars they orbit. This can be difficult in the post-coronagraphic image plane, as by definition the central star has been occulted by the coronagraph. We demonstrate the flexibility of utilizing the deformable mirror in the adaptive optics system of the Subaru Coronagraphic Extreme Adaptive Optics system to generate a field of speckles for the purposes of calibration. Speckles can be placed up to 22.5 λ/D from the star, with any position angle, brightness, and abundance required. Most importantly, we show that a fast modulation of the added speckle phase, between 0 and π, during a long science integration renders these speckles effectively incoherent with the underlying halo. We quantitatively show for the first time that this incoherence, in turn, increases the robustness and stability of the adaptive speckles, which will improve the precision of astrometric and photometric calibration procedures. This technique will be valuable for high-contrast imaging observations with imagers and integral field spectrographs alike.

  6. Coherent and incoherent processes in resonant photoemission

    Energy Technology Data Exchange (ETDEWEB)

    Magnuson, M.; Karis, O.; Weinelt, M. [Uppsala Univ. (Sweden)] [and others

    1997-04-01

    In this contribution the authors present the distinction between coherent and incoherent processes in resonant photoemission. As a first step they determine whether an autoionization process is photoemission-like or Auger-like. The discussion is based on measurements for a weakly bonded adsorption system, Ar/Pt(111). This type of system is well adapted to investigate these effects since it yields distinctly shifted spectral features depending on the nature of the process. After this, the question of resonance photoemission in metallic systems is addressed. This is done in connection with measurements at the 2p edges for Ni metal. Ni has been one of the prototype systems for resonant photoemission. The resonances have been discussed in connection with the strong correlation and d-band localization effects in this system. Based on the results some general comments about the appearance of resonant effects in metallic systems are made.

  7. Estimates for diffusion barriers and atomic potentials in MGO

    International Nuclear Information System (INIS)

    Skala, L.; Kenkre, V.M.

    1991-01-01

    In this paper, as part of a program of investigation of microwave sintering, self-consistent CNDO/2 calculations are presented for diffusion barriers and potentials for the motion of interstitial atoms and vacancies in MgO. Clusters of 30 atoms are used in the calculations. Activation energies, diffusion barriers, shape of the potentials and electron densities are obtained

  8. Relative distance between tracers as a measure of diffusivity within moving aggregates

    Science.gov (United States)

    Pönisch, Wolfram; Zaburdaev, Vasily

    2018-02-01

    Tracking of particles, be it a passive tracer or an actively moving bacterium in the growing bacterial colony, is a powerful technique to probe the physical properties of the environment of the particles. One of the most common measures of particle motion driven by fluctuations and random forces is its diffusivity, which is routinely obtained by measuring the mean squared displacement of the particles. However, often the tracer particles may be moving in a domain or an aggregate which itself experiences some regular or random motion and thus masks the diffusivity of tracers. Here we provide a method for assessing the diffusivity of tracer particles within mobile aggregates by measuring the so-called mean squared relative distance (MSRD) between two tracers. We provide analytical expressions for both the ensemble and time averaged MSRD allowing for direct identification of diffusivities from experimental data.

  9. Analysis of current diffusive ballooning mode in tokamaks

    International Nuclear Information System (INIS)

    Uchida, M.; Fukuyama, A.; Itoh, S.-I.; Yagi, M.

    1999-12-01

    The effect of finite gyroradius on the current diffusive ballooning mode is examined. Starting from the reduced MHD equations including turbulent transports, coupling with drift motion and finite gyroradius effect of ions, we derive a ballooning mode equation with complex transport coefficients. The eigenfrequency, saturation level and thermal diffusivity are evaluated numerically from the marginal stability condition. Preliminary results of their parameter dependence is presented. (author)

  10. Simple Brownian diffusion an introduction to the standard theoretical models

    CERN Document Server

    Gillespie, Daniel T

    2013-01-01

    Brownian diffusion, the motion of large molecules in a sea of very many much smaller molecules, is topical because it is one of the ways in which biologically important molecules move about inside living cells. This book presents the mathematical physics that underlies the four simplest models of Brownian diffusion.

  11. Lower thermospheric neutral densities determined from Soendre Stroemfjord incoherent scatter radar during LTCS 1

    International Nuclear Information System (INIS)

    Reese, K.W.; Johnson, R.M.; Killeen, T.L.

    1991-01-01

    Ion-neutral collision frequencies determined from measurements obtained by the incoherent scatter radar located at Soendre Stroemfjord, Greenland, have been used to derive lower thermospheric neutral densities during the first Lower Thermosphere Coupling Study (LTCS 1), September 21-26, 1987. Periods of Joule and particle heating which might disturb the E region thermal equilibrium were systematically eliminated. The mean profile of neutral density for the period is in good agreement with the mass spectrometer incoherent scatter 1986 (MSIS-86) model between 92 and 104 km. A tendency to overestimate collision frequencies above 105 km may arise from range-smearing effects. The results of a tidal analysis performed on the neutral density between 92 and 109 km show that the amplitudes of the diurnal and semidiurnal components of the tides are approximately equivalent. The observations are generally in better agreement with the MSIS-86 predictions than with the thermosphere-ionosphere general circulation model (TIGCM) simulation of the LTCS 1 interval. The observed phase of the diurnal component is approximately constant with height above 98 km and is in close agreement with the MSIS-86 model phases; however, the TIGCM diurnal phases are shifted by 6-8 hours to later local times. The phase of the semidiurnal tide is in good agreement with predictions of the MSIS-86 model and the TIGCM simulation of this interval, except near 98 km. The observed semidiurnal phase is also consistent with previous high-latitude results (Kirkwood, 1986). The relative amplitude of the observed semidiurnal oscillation is up to 15% larger than that previously observed at the European Incoherent Scatter facility but is consistent with the amplitudes presented in an earlier study of Millstone Hill measurements (Salah, 1974)

  12. Influence of incoherent twin boundaries on the electrical properties of β-Ga2O3 layers homoepitaxially grown by metal-organic vapor phase epitaxy

    Science.gov (United States)

    Fiedler, A.; Schewski, R.; Baldini, M.; Galazka, Z.; Wagner, G.; Albrecht, M.; Irmscher, K.

    2017-10-01

    We present a quantitative model that addresses the influence of incoherent twin boundaries on the electrical properties in β-Ga2O3. This model can explain the mobility collapse below a threshold electron concentration of 1 × 1018 cm-3 as well as partly the low doping efficiency in β-Ga2O3 layers grown homoepitaxially by metal-organic vapor phase epitaxy on (100) substrates of only slight off-orientation. A structural analysis by transmission electron microscopy (TEM) reveals a high density of twin lamellae in these layers. In contrast to the coherent twin boundaries parallel to the (100) plane, the lateral incoherent twin boundaries exhibit one dangling bond per unit cell that acts as an acceptor-like electron trap. Since the twin lamellae are thin, we consider the incoherent twin boundaries to be line defects with a density of 1011-1012 cm-2 as determined by TEM. We estimate the influence of the incoherent twin boundaries on the electrical transport properties by adapting Read's model of charged dislocations. Our calculations quantitatively confirm that the mobility reduction and collapse as well as partly the compensation are due to the presence of twin lamellae.

  13. Rotation driven translational diffusion of polyatomic ions in water: A novel mechanism for breakdown of Stokes-Einstein relation

    Science.gov (United States)

    Banerjee, Puja; Yashonath, Subramanian; Bagchi, Biman

    2017-04-01

    While most of the existing theoretical and simulation studies have focused on simple, spherical, halide and alkali ions, many chemically, biologically, and industrially relevant electrolytes involve complex non-spherical polyatomic ions like nitrate, chlorate, and sulfate to name only a few. Interestingly, some polyatomic ions in spite of being larger in size show anomalously high diffusivity and therefore cause a breakdown of the venerable Stokes-Einstein (S-E) relation between the size and diffusivity. Here we report a detailed analysis of the dynamics of anions in aqueous potassium nitrate (KNO3) and aqueous potassium acetate (CH3COOK) solutions. The two ions, nitrate (-NO3) and acetate (CH3-CO2 ), with their similar size show a large difference in diffusivity values. We present evidence that the translational motion of these polyatomic ions is coupled to the rotational motion of the ion. We show that unlike the acetate ion, nitrate ion with a symmetric charge distribution among all periphery oxygen atoms shows a faster rotational motion with large amplitude rotational jumps which enhances its translational motion due to translational-rotational coupling. By creating a family of modified-charge model systems, we have analysed the rotational motion of asymmetric polyatomic ions and the contribution of it to the translational motion. These model systems help clarifying and establishing the relative contribution of rotational motion in enhancing the diffusivity of the nitrate ion over the value predicted by the S-E relation and also over the other polyatomic ions having asymmetric charge distribution like the acetate ion. In the latter case, reduced rotational motion results in lower diffusivity values than those with symmetric charge distribution. We propose translational-rotational coupling as a general mechanism of the breakdown of the S-E relation in the case of polyatomic ions.

  14. Homogeneity based segmentation and enhancement of Diffusion Tensor Images : a white matter processing framework

    NARCIS (Netherlands)

    Rodrigues, P.R.

    2011-01-01

    In diffusion magnetic resonance imaging (DMRI) the Brownian motion of the water molecules, within biological tissue, is measured through a series of images. In diffusion tensor imaging (DTI) this diffusion is represented using tensors. DTI describes, in a non-invasive way, the local anisotropy

  15. Neutronographic measurements of the motion of hydrogen and hydrogeneous substances in liquids and solids

    International Nuclear Information System (INIS)

    Zeilinger, A.; Pochman, W.A.; Rauch, H.; Suleiman, M.

    1976-01-01

    Earlier measurements of hydrogen motion in liquids by neutron radiography have been extended to obtain additional parameters of governing the mixing behavior of light and heavy water. Furthermore motion of water in concrete was measured leading to a determination of (1) the vapor diffusion coefficient of water in concrete, (2) the porosity of the concrete, and (3) the mass transfer coefficient of vapor from the concrete to the environment. Recently the ability of neutron radiography to measure the hydrogen motion in metals was demonstrated and the diffusion coefficients of hydrogen in V, Ta, Nb and beta-Ti was determined. In addition, some work on resolution measurements of neutron radiography will be reported. (author)

  16. Time-averaged MSD of Brownian motion

    International Nuclear Information System (INIS)

    Andreanov, Alexei; Grebenkov, Denis S

    2012-01-01

    We study the statistical properties of the time-averaged mean-square displacements (TAMSD). This is a standard non-local quadratic functional for inferring the diffusion coefficient from an individual random trajectory of a diffusing tracer in single-particle tracking experiments. For Brownian motion, we derive an exact formula for the Laplace transform of the probability density of the TAMSD by mapping the original problem onto chains of coupled harmonic oscillators. From this formula, we deduce the first four cumulant moments of the TAMSD, the asymptotic behavior of the probability density and its accurate approximation by a generalized Gamma distribution

  17. Time-averaged MSD of Brownian motion

    Science.gov (United States)

    Andreanov, Alexei; Grebenkov, Denis S.

    2012-07-01

    We study the statistical properties of the time-averaged mean-square displacements (TAMSD). This is a standard non-local quadratic functional for inferring the diffusion coefficient from an individual random trajectory of a diffusing tracer in single-particle tracking experiments. For Brownian motion, we derive an exact formula for the Laplace transform of the probability density of the TAMSD by mapping the original problem onto chains of coupled harmonic oscillators. From this formula, we deduce the first four cumulant moments of the TAMSD, the asymptotic behavior of the probability density and its accurate approximation by a generalized Gamma distribution.

  18. Lagrangian Description of Nonadiabatic Particle Motion in Spherical Tori

    Energy Technology Data Exchange (ETDEWEB)

    R.B. White; Yu.V. Yakovenko; Ya.I. Kolesnichenko

    2002-06-21

    The ability of a device to provide adiabatic motion of charged particles is crucial for magnetic confinement. As the magnetic field in the present-day spherical tori, e.g., MAST and NSTX, is much lower than in the conventional tokamaks, effects of the finite Larmor radius (FLR) on the motion of fast ions are of importance in these devices, affecting the stochasticity threshold for the interaction of the ions with electromagnetic perturbations. In addition, FLR by itself may result in non-conservation (jumps) of the magnetic moment of particles [4]. In this work we propose a Lagrangian approach to description of the resonant collisionless motion of charged particles under a perturbation, allowing for FLR. The work generalizes results of Ref. [1], where only time-independent perturbations were considered. The approach is used to find the stochasticity thresholds for the Goldston-White-Boozer (GWB) diffusion [2] and the cyclotron-resonance-induced (CRI) diffusion (for the case of the firs t cyclotron resonance, the latter was discovered in Ref. [3]). In addition, a new expression for the magnetic moment variation caused by FLR is found.

  19. Lagrangian Description of Nonadiabatic Particle Motion in Spherical Tori

    International Nuclear Information System (INIS)

    White, R.B.; Yakovenko, Yu.V.; Kolesnichenko, Ya.I.

    2002-01-01

    The ability of a device to provide adiabatic motion of charged particles is crucial for magnetic confinement. As the magnetic field in the present-day spherical tori, e.g., MAST and NSTX, is much lower than in the conventional tokamaks, effects of the finite Larmor radius (FLR) on the motion of fast ions are of importance in these devices, affecting the stochasticity threshold for the interaction of the ions with electromagnetic perturbations. In addition, FLR by itself may result in non-conservation (jumps) of the magnetic moment of particles [4]. In this work we propose a Lagrangian approach to description of the resonant collisionless motion of charged particles under a perturbation, allowing for FLR. The work generalizes results of Ref. [1], where only time-independent perturbations were considered. The approach is used to find the stochasticity thresholds for the Goldston-White-Boozer (GWB) diffusion [2] and the cyclotron-resonance-induced (CRI) diffusion (for the case of the first cyclotron resonance, the latter was discovered in Ref. [3]). In addition, a new expression for the magnetic moment variation caused by FLR is found

  20. A simulation experiment and analysis on the effects of in-coherence in fuel coolant interaction

    International Nuclear Information System (INIS)

    Kondo, S.; Togo, Y.; Iwamura, T.

    1976-01-01

    Experimental and analytical studies were conducted to investigate effects of incoherence (space time behavior of molten fuel) on molten fuel coolant interaction. In experiments, a 2 mm diameter molten tin jet was injected upward into the water in a slender tank. The results were analyzed based on the pressure records and high speed photographs. The pressure records indicated that there were two types of interaction between molten jet and water, intermittent explosion mode and continuous one. The explosion mode appeared when the temperature of molten tin was above 350 0 C or so and that of water was below 70 0 C or so. The high speed photograph indicated that an establishment of a stable jet column was necessary for an explosive interaction and that a bubble like region grew and collapsed at the root of the jet in accordance with the generation of pressure pulse. It was found that the mass of metal which contributed to the vapor explosion was only a small part of the injected metal in the case of jet injection type contact mode and this was the reason why the gross thermal to mechanical energy conversion ratio was around 0.03% in this type of contact mode, though this ratio was around 2% if only the part of record around the pressure pulse was taken into consideration. In the analysis part, a multi-channel FCI model was developed to evaluate the spatial incoherence effect on pressure at subassembly exit. The calculated pressure trace indicated that the spatial incoherence has considerable effects for an evaluation of structure response under FCI pressure loading. (auth.)

  1. Molecular diffusion in monolayer and submonolayer nitrogen

    DEFF Research Database (Denmark)

    Hansen, Flemming Yssing; Bruch, Ludwig Walter

    2001-01-01

    The orientational and translational motions in a monolayer fluid of physisorbed molecular nitrogen are treated using molecular dynamics simulations. Dynamical response functions and several approximations to the coefficient of translational diffusion are determined for adsorption on the basal plane...

  2. First E- and D-region incoherent scatter spectra observed over Jicamarca

    Directory of Open Access Journals (Sweden)

    J. L. Chau

    2006-07-01

    Full Text Available We present here the first Jicamarca observations of incoherent scatter radar (ISR spectra detected from E- and D-region altitudes. In the past such observations have not been possible at Jicamarca due a combined effect of strong equatorial electrojet (EEJ clutter and hardware limitations in the receiving system. The observations presented here were made during weak EEJ conditions (i.e., almost zero zonal electric field using an improved digital receiving system with a wide dynamic range and a high data throughput. The observed ISR spectra from E- and D-region altitudes are, as expected, narrow and get even narrower with decreasing altitude due to increasing ion-neutral collision frequencies. Therefore, it was possible to obtain accurate spectral measurements using a pulse-to-pulse data analysis. At lower altitudes in the D-region where signal correlation times are relatively long we used coherent integration to improve the signal-to-noise ratio of the collected data samples. The spectral estimates were fitted using a standard incoherent scatter (IS spectral model between 87 and 120 km, and a Lorentzian function below 110 km. Our preliminary estimates of temperature and ion-neutral collisions frequencies above 87 km are in good agreement with the MSISE-90 model. Below 87 km, the measured spectral widths are larger than expected, causing an overestimation of the temperatures, most likely due to spectral distortions caused by atmospheric turbulence.

  3. Field theory of propagating reaction-diffusion fronts

    International Nuclear Information System (INIS)

    Escudero, C.

    2004-01-01

    The problem of velocity selection of reaction-diffusion fronts has been widely investigated. While the mean-field limit results are well known theoretically, there is a lack of analytic progress in those cases in which fluctuations are to be taken into account. Here, we construct an analytic theory connecting the first principles of the reaction-diffusion process to an effective equation of motion via field-theoretic arguments, and we arrive at results already confirmed by numerical simulations

  4. Large diffusion anisotropy and orientation sorting of phosphorene nanoflakes under a temperature gradient.

    Science.gov (United States)

    Cheng, Yuan; Zhang, Gang; Zhang, Yingyan; Chang, Tienchong; Pei, Qing-Xiang; Cai, Yongqing; Zhang, Yong-Wei

    2018-01-25

    We perform molecular dynamics simulations to investigate the motion of phosphorene nanoflakes on a large graphene substrate under a thermal gradient. It is found that the atomic interaction between the graphene substrate and the phosphorene nanoflake generates distinct rates of motion for phosphorene nanoflakes with different orientations. Remarkably, for square phosphorene nanoflakes, the motion of zigzag-oriented nanoflakes is 2-fold faster than those of armchair-oriented and randomly-oriented nanoflakes. This large diffusion anisotropy suggests that sorting of phosphorene nanoflakes into specific orientations can be realized by a temperature gradient. The findings here provide interesting insights into strong molecular diffusion anisotropy and offer a novel route for manipulating two-dimensional materials.

  5. Bound coherent and incoherent thermal neutron scattering cross sections of the elements

    International Nuclear Information System (INIS)

    Sears, V.F.

    1982-12-01

    An up-to-date table of bound coherent and incoherent thermal neutron scattering cross sections of the elements is presented. Values from two different data sources are calculated and compared. These sources are: (1) the free-atom cross sections listed in the Σbarn bookΣ and (2) the Julich scattering length tables. We also call attention to, and clarify, the confusion that exists in the literature concerning the sign of the imaginary part of the complex scattering length

  6. Scale-free animal movement patterns: Levy walks outperform fractional Brownian motions and fractional Levy motions in random search scenarios

    International Nuclear Information System (INIS)

    Reynolds, A M

    2009-01-01

    The movement patterns of a diverse range of animals have scale-free characteristics. These characteristics provide necessary but not sufficient conditions for the presence of movement patterns that can be approximated by Levy walks. Nevertheless, it has been widely assumed that the occurrence of scale-free animal movements can indeed be attributed to the presence of Levy walks. This is, in part, because it is known that the super-diffusive properties of Levy walks can be advantageous in random search scenarios when searchers have little or no prior knowledge of target locations. However, fractional Brownian motions (fBms) and fractional Levy motions (fLms) are both scale-free and super-diffusive, and so it is possible that these motions rather than Levy walks underlie some or all occurrences of scale-free animal movement patterns. Here this possibility is examined in numerical simulations through a determination of the searching efficiencies of fBm and fLm searches. It is shown that these searches are less efficient than Levy walk searches. This finding does not rule out the possibility that some animals with scale-free movement patterns are executing fBm and fLm searches, but it does make Levy walk searches the more likely possibility.

  7. Three-Dimensional Imaging by Self-Reference Single-Channel Digital Incoherent Holography

    Science.gov (United States)

    Rosen, Joseph; Kelner, Roy

    2016-01-01

    Digital holography offers a reliable and fast method to image a three-dimensional scene from a single perspective. This article reviews recent developments of self-reference single-channel incoherent hologram recorders. Hologram recorders in which both interfering beams, commonly referred to as the signal and the reference beams, originate from the same observed objects are considered as self-reference systems. Moreover, the hologram recorders reviewed herein are configured in a setup of a single channel interferometer. This unique configuration is achieved through the use of one or more spatial light modulators. PMID:28757811

  8. PAC study of ionic motion in silver compound superionic conductors

    International Nuclear Information System (INIS)

    Mekata, M.; Seguchi, Y.

    1983-01-01

    Ionic motion in superionic conductors, Ag 2 S, Ag 2 Se and Ag 3 SI was investigated by γ-γ PAC on 111 Cd. Diffusion constant measurements showed that probe ions migrate almost as fast as Ag + ions above 500 K in Ag 2 S and Ag 2 Se and above 700 K in Ag 3 SI. Multivalent impurities were found to be unstable in AgI and Ag 2 Te. The correlation time of ionic motion was deduced from the observed relaxation rate together with the diffusion constants. The correlation time and its activation energy increase in order of Ag 2 S, Ag 2 Se and Ag 3 SI. The flight distance of Ag + ions remains almost constant in the measured temperature range. (Auth.)

  9. Neutron diffusion: connection with the theory of browniam motion

    International Nuclear Information System (INIS)

    Dellagi, Mohamed

    1977-01-01

    The displacement of the neutron projection on an axis Ox and its density of probability are introduced instead of describing the diffusion theory with neutron density, as is usual. If the point source O is isotropic and neutron monoenergetic, the brownian particle described by Langevin's equation and neutron have the same time correlation of velocity [fr

  10. RESIDENCE TIMES OF PARTICLES IN DIFFUSIVE PROTOPLANETARY DISK ENVIRONMENTS. I. VERTICAL MOTIONS

    International Nuclear Information System (INIS)

    Ciesla, F. J.

    2010-01-01

    The chemical and physical evolution of primitive materials in protoplanetary disks are determined by the types of environments they are exposed to and their residence times within each environment. Here, a method for calculating representative paths of materials in diffusive protoplanetary disks is developed and applied to understanding how the vertical trajectories that particles take impact their overall evolution. The methods are general enough to be applied to disks with uniform diffusivity, the so-called constant-α cases, and disks with a spatially varying diffusivity, such as expected in 'layered-disks'. The average long-term dynamical evolution of small particles and gaseous molecules is independent of the specific form of the diffusivity in that they spend comparable fractions of their lifetimes at different heights in the disk. However, the paths that individual particles and molecules take depend strongly on the form of the diffusivity leading to a different range of behavior of particles in terms of deviations from the mean. As temperatures, gas densities, chemical abundances, and photon fluxes will vary with height in protoplanetary disks, the different paths taken by primitive materials will lead to differences in their chemical and physical evolution. Examples of differences in gas phase chemistry and photochemistry are explored here. The methods outlined here provide a powerful tool that can be integrated with chemical models to understand the formation and evolution of primitive materials in protoplanetary disks on timescales of 10 5 -10 6 years.

  11. Diffusion tensor optical coherence tomography

    Science.gov (United States)

    Marks, Daniel L.; Blackmon, Richard L.; Oldenburg, Amy L.

    2018-01-01

    In situ measurements of diffusive particle transport provide insight into tissue architecture, drug delivery, and cellular function. Analogous to diffusion-tensor magnetic resonance imaging (DT-MRI), where the anisotropic diffusion of water molecules is mapped on the millimeter scale to elucidate the fibrous structure of tissue, here we propose diffusion-tensor optical coherence tomography (DT-OCT) for measuring directional diffusivity and flow of optically scattering particles within tissue. Because DT-OCT is sensitive to the sub-resolution motion of Brownian particles as they are constrained by tissue macromolecules, it has the potential to quantify nanoporous anisotropic tissue structure at micrometer resolution as relevant to extracellular matrices, neurons, and capillaries. Here we derive the principles of DT-OCT, relating the detected optical signal from a minimum of six probe beams with the six unique diffusion tensor and three flow vector components. The optimal geometry of the probe beams is determined given a finite numerical aperture, and a high-speed hardware implementation is proposed. Finally, Monte Carlo simulations are employed to assess the ability of the proposed DT-OCT system to quantify anisotropic diffusion of nanoparticles in a collagen matrix, an extracellular constituent that is known to become highly aligned during tumor development.

  12. Neutron quasi-elastic scattering study of translational motions in the smectic H, C and A phases of TBBA

    International Nuclear Information System (INIS)

    Dianoux, A.J.; Volino, F.; Heidemann, A.; Hervet, H.

    1975-01-01

    Neutron quasi-elastic scattering experiments in the smectic H, C and A phases of TBBA are presented, using the high resolution backscattering technique. The data are analyzed in terms of translational motion and are characterized by an apparent self diffusion coefficient Dsub(ap). The physical meaning of Dsub(ap) is discussed in terms of the true bulk self diffusion tensor and other kinds of translational motions [fr

  13. Nonadiabatic particle motion in magnetic mirror traps

    International Nuclear Information System (INIS)

    Irie, H.; Otsuka, S.; Varma, R.K.; Watanabe, T.; Nishikawa, Kyoji.

    1982-01-01

    By numerical integration of the equation of single particle motion, the basic features of the actual nonadiabatic escape of particles are studied. The results are compared with the predictions of two existing theoretical models: ''diffusion'' model derived by B. V. Chirikov and ''tunneling'' model introduced by R. K. Varma. (author)

  14. Brownian Motion of Asymmetric Boomerang Colloidal Particles

    Science.gov (United States)

    Chakrabarty, Ayan; Konya, Andrew; Wang, Feng; Selinger, Jonathan; Sun, Kai; Wei, Qi-Huo

    2014-03-01

    We used video microscopy and single particle tracking to study the diffusion and local behaviors of asymmetric boomerang particles in a quasi-two dimensional geometry. The motion is biased towards the center of hydrodynamic stress (CoH) and the mean square displacements of the particles are linear at short and long times with different diffusion coefficients and in the crossover regime it is sub-diffusive. Our model based on Langevin theory shows that these behaviors arise from the non-coincidence of the CoH with the center of the body. Since asymmetric boomerangs represent a class of rigid bodies of more generals shape, therefore our findings are generic and true for any non-skewed particle in two dimensions. Both experimental and theoretical results will be discussed.

  15. Coherent versus incoherent dynamics in InAs quantum-dot active wave guides

    DEFF Research Database (Denmark)

    Borri, Paola; Langbein, W.; Hvam, Jørn Märcher

    2001-01-01

    Coherent dynamics measured by time-resolved four-wave mixing is compared to incoherent population dynamics measured by differential transmission spectroscopy on the ground-state transition at room temperature of two types of InAs-based quantum dots with different confinement energies. The measure....... The measurements are performed with heterodyne detection on quantum-dot active wave guides to enhance the light-matter interaction length. An elastic nature of the measured dephasing is revealed which is independent of the dot energy level scheme....

  16. Analysis of diffuse scattering in neutron powder diagrams. Application to glassy carbon

    International Nuclear Information System (INIS)

    Boysen, H.

    1985-01-01

    From the quantitative analysis of the diffuse scattered intensity in powder diagrams valuable information about the disorder in crystals may be obtained. According to the dimensionality of this disorder (0D, 1D, 2D or 3D corresponding to diffuse peaks, streaks, planes or volume in reciprocal space) a characteristic modulation of the background is observed, which is described by specific functions. These are derived by averaging the appropriate cross sections over all crystallite orientations in the powder and folding with the resolution function of the instrument. If proper account is taken of all proportionality factors different components of the background can be put on one relative scale. The results are applied to two samples of glassy carbon differing in their degree of disorder. The neutron powder patterns contain contributions from 0D (00l peaks due to the stacking of graphitic layers), 1D (hkzeta streaks caused by the random orientation of these layers) and 3D (incoherent scattering, averaged thermal diffuse scattering, multiple scattering). From the fit to the observed data various parameters of the disorder like domain sizes, strains, interlayer distances, amount of incorporated hydrogen, pore sizes etc. are determined. It is shown that the omission of resolution corrections leads to false parameters. (orig.)

  17. Incoherent beam combining based on the momentum SPGD algorithm

    Science.gov (United States)

    Yang, Guoqing; Liu, Lisheng; Jiang, Zhenhua; Guo, Jin; Wang, Tingfeng

    2018-05-01

    Incoherent beam combining (ICBC) technology is one of the most promising ways to achieve high-energy, near-diffraction laser output. In this paper, the momentum method is proposed as a modification of the stochastic parallel gradient descent (SPGD) algorithm. The momentum method can improve the speed of convergence of the combining system efficiently. The analytical method is employed to interpret the principle of the momentum method. Furthermore, the proposed algorithm is testified through simulations as well as experiments. The results of the simulations and the experiments show that the proposed algorithm not only accelerates the speed of the iteration, but also keeps the stability of the combining process. Therefore the feasibility of the proposed algorithm in the beam combining system is testified.

  18. Assessment of identity development and identity diffusion in adolescence - Theoretical basis and psychometric properties of the self-report questionnaire AIDA.

    Science.gov (United States)

    Goth, Kirstin; Foelsch, Pamela; Schlüter-Müller, Susanne; Birkhölzer, Marc; Jung, Emanuel; Pick, Oliver; Schmeck, Klaus

    2012-07-19

    In the continuing revision of Diagnostic and Statistical Manual (DSM-V) "identity" is integrated as a central diagnostic criterion for personality disorders (self-related personality functioning). According to Kernberg, identity diffusion is one of the core elements of borderline personality organization. As there is no elaborated self-rating inventory to assess identity development in healthy and disturbed adolescents, we developed the AIDA (Assessment of Identity Development in Adolescence) questionnaire to assess this complex dimension, varying from "Identity Integration" to "Identity Diffusion", in a broad and substructured way and evaluated its psychometric properties in a mixed school and clinical sample. Test construction was deductive, referring to psychodynamic as well as social-cognitive theories, and led to a special item pool, with consideration for clarity and ease of comprehension. Participants were 305 students aged 12-18 attending a public school and 52 adolescent psychiatric inpatients and outpatients with diagnoses of personality disorders (N = 20) or other mental disorders (N = 32). Convergent validity was evaluated by covariations with personality development (JTCI 12-18 R scales), criterion validity by differences in identity development (AIDA scales) between patients and controls. AIDA showed excellent total score (Diffusion: α = .94), scale (Discontinuity: α = .86; Incoherence: α = .92) and subscale (α = .73-.86) reliabilities. High levels of Discontinuity and Incoherence were associated with low levels in Self Directedness, an indicator of maladaptive personality functioning. Both AIDA scales were significantly different between PD-patients and controls with remarkable effect sizes (d) of 2.17 and 1.94 standard deviations. AIDA is a reliable and valid instrument to assess normal and disturbed identity in adolescents. Studies for further validation and for obtaining population norms are in progress and may provide

  19. A human motion model based on maps for navigation systems

    Directory of Open Access Journals (Sweden)

    Kaiser Susanna

    2011-01-01

    Full Text Available Abstract Foot-mounted indoor positioning systems work remarkably well when using additionally the knowledge of floor-plans in the localization algorithm. Walls and other structures naturally restrict the motion of pedestrians. No pedestrian can walk through walls or jump from one floor to another when considering a building with different floor-levels. By incorporating known floor-plans in sequential Bayesian estimation processes such as particle filters (PFs, long-term error stability can be achieved as long as the map is sufficiently accurate and the environment sufficiently constraints pedestrians' motion. In this article, a new motion model based on maps and floor-plans is introduced that is capable of weighting the possible headings of the pedestrian as a function of the local environment. The motion model is derived from a diffusion algorithm that makes use of the principle of a source effusing gas and is used in the weighting step of a PF implementation. The diffusion algorithm is capable of including floor-plans as well as maps with areas of different degrees of accessibility. The motion model more effectively represents the probability density function of possible headings that are restricted by maps and floor-plans than a simple binary weighting of particles (i.e., eliminating those that crossed walls and keeping the rest. We will show that the motion model will help for obtaining better performance in critical navigation scenarios where two or more modes may be competing for some of the time (multi-modal scenarios.

  20. Connection between encounter volume and diffusivity in geophysical flows

    Science.gov (United States)

    Rypina, Irina I.; Smith, Stefan G. Llewellyn; Pratt, Larry J.

    2018-04-01

    Trajectory encounter volume - the volume of fluid that passes close to a reference fluid parcel over some time interval - has been recently introduced as a measure of mixing potential of a flow. Diffusivity is the most commonly used characteristic of turbulent diffusion. We derive the analytical relationship between the encounter volume and diffusivity under the assumption of an isotropic random walk, i.e., diffusive motion, in one and two dimensions. We apply the derived formulas to produce maps of encounter volume and the corresponding diffusivity in the Gulf Stream region of the North Atlantic based on satellite altimetry, and discuss the mixing properties of Gulf Stream rings. Advantages offered by the derived formula for estimating diffusivity from oceanographic data are discussed, as well as applications to other disciplines.

  1. Time-delayed feedback control of diffusion in random walkers

    Science.gov (United States)

    Ando, Hiroyasu; Takehara, Kohta; Kobayashi, Miki U.

    2017-07-01

    Time delay in general leads to instability in some systems, while specific feedback with delay can control fluctuated motion in nonlinear deterministic systems to a stable state. In this paper, we consider a stochastic process, i.e., a random walk, and observe its diffusion phenomenon with time-delayed feedback. As a result, the diffusion coefficient decreases with increasing delay time. We analytically illustrate this suppression of diffusion by using stochastic delay differential equations and justify the feasibility of this suppression by applying time-delayed feedback to a molecular dynamics model.

  2. Tunable and broadband microwave frequency combs based on a semiconductor laser with incoherent optical feedback

    International Nuclear Information System (INIS)

    Zhao Mao-Rong; Wu Zheng-Mao; Deng Tao; Zhou Zhen-Li; Xia Guang-Qiong

    2015-01-01

    Based on a semiconductor laser (SL) with incoherent optical feedback, a novel all-optical scheme for generating tunable and broadband microwave frequency combs (MFCs) is proposed and investigated numerically. The results show that, under suitable operation parameters, the SL with incoherent optical feedback can be driven to operate at a regular pulsing state, and the generated MFCs have bandwidths broader than 40 GHz within a 10 dB amplitude variation. For a fixed bias current, the line spacing (or repetition frequency) of the MFCs can be easily tuned by varying the feedback delay time and the feedback strength, and the tuning range of the line spacing increases with the increase in the bias current. The linewidth of the MFCs is sensitive to the variation of the feedback delay time and the feedback strength, and a linewidth of tens of KHz can be achieved through finely adjusting the feedback delay time and the feedback strength. In addition, mappings of amplitude variation, repetition frequency, and linewidth of MFCs in the parameter space of the feedback delay time and the feedback strength are presented. (paper)

  3. Multiple Scale Reaction-Diffusion-Advection Problems with Moving Fronts

    Science.gov (United States)

    Nefedov, Nikolay

    2016-06-01

    In this work we discuss the further development of the general scheme of the asymptotic method of differential inequalities to investigate stability and motion of sharp internal layers (fronts) for nonlinear singularly perturbed parabolic equations, which are called in applications reaction-diffusion-advection equations. Our approach is illustrated for some new important cases of initial boundary value problems. We present results on stability and on the motion of the fronts.

  4. A multiscale guide to Brownian motion

    International Nuclear Information System (INIS)

    Grebenkov, Denis S; Belyaev, Dmitry; Jones, Peter W

    2016-01-01

    We revise the Lévy construction of Brownian motion as a simple though rigorous approach to operate with various Gaussian processes. A Brownian path is explicitly constructed as a linear combination of wavelet-based ‘geometrical features’ at multiple length scales with random weights. Such a wavelet representation gives a closed formula mapping of the unit interval onto the functional space of Brownian paths. This formula elucidates many classical results about Brownian motion (e.g., non-differentiability of its path), providing an intuitive feeling for non-mathematicians. The illustrative character of the wavelet representation, along with the simple structure of the underlying probability space, is different from the usual presentation of most classical textbooks. Similar concepts are discussed for the Brownian bridge, fractional Brownian motion, the Ornstein-Uhlenbeck process, Gaussian free fields, and fractional Gaussian fields. Wavelet representations and dyadic decompositions form the basis of many highly efficient numerical methods to simulate Gaussian processes and fields, including Brownian motion and other diffusive processes in confining domains. (topical review)

  5. Coherent versus incoherent resonant emission: an experimental method for easy discrimination and measurement

    Science.gov (United States)

    Ceccherini, S.; Colocci, M.; Gurioli, M.; Bogani, F.

    1998-11-01

    The distinction between the coherent and the incoherent component of the radiation emitted from resonantly excited material systems is difficult experimentally, particularly when ultra-short optical pulses are used for excitation. We propose an experimental procedure allowing an easy measurement of the two components. The method is completely general and applicable to any kind of physical system; its feasibility is demonstrated on the resonant emission from excitons in a semiconductor quantum well.

  6. Diffusion and spectroscopy of water and lipids in fully hydrated dimyristoylphosphatidylcholine bilayer membranes

    International Nuclear Information System (INIS)

    Yang, J.; Martí, J.; Calero, C.

    2014-01-01

    Microscopic structure and dynamics of water and lipids in a fully hydrated dimyristoylphosphatidylcholine phospholipid lipid bilayer membrane in the liquid-crystalline phase have been analyzed with all-atom molecular dynamics simulations based on the recently parameterized CHARMM36 force field. The diffusive dynamics of the membrane lipids and of its hydration water, their reorientational motions as well as their corresponding spectral densities, related to the absorption of radiation, have been considered for the first time using the present force field. In addition, structural properties such as density and pressure profiles, a deuterium-order parameter, surface tension, and the extent of water penetration in the membrane have been analyzed. Molecular self-diffusion, reorientational motions, and spectral densities of atomic species reveal a variety of time scales playing a role in membrane dynamics. The mechanisms of lipid motion strongly depend on the time scale considered, from fast ballistic translation at the scale of picoseconds (effective diffusion coefficients of the order of 10 −5 cm 2 /s) to diffusive flow of a few lipids forming nanodomains at the scale of hundreds of nanoseconds (diffusion coefficients of the order of 10 −8 cm 2 /s). In the intermediate regime of sub-diffusion, collisions with nearest neighbors prevent the lipids to achieve full diffusion. Lipid reorientations along selected directions agree well with reported nuclear magnetic resonance data and indicate two different time scales, one about 1 ns and a second one in the range of 2–8 ns. We associated the two time scales of reorientational motions with angular distributions of selected vectors. Calculated spectral densities corresponding to lipid and water reveal an overall good qualitative agreement with Fourier transform infrared spectroscopy experiments. Our simulations indicate a blue-shift of the low frequency spectral bands of hydration water as a result of its interaction

  7. Diffusion and spectroscopy of water and lipids in fully hydrated dimyristoylphosphatidylcholine bilayer membranes

    Energy Technology Data Exchange (ETDEWEB)

    Yang, J.; Martí, J., E-mail: jordi.marti@upc.edu [Department of Physics and Nuclear Engineering, Technical University of Catalonia-Barcelona Tech, B4-B5 Northern Campus, Jordi Girona 1-3, 08034 Barcelona, Catalonia (Spain); Calero, C. [Department of Physics and Nuclear Engineering, Technical University of Catalonia-Barcelona Tech, B4-B5 Northern Campus, Jordi Girona 1-3, 08034 Barcelona, Catalonia (Spain); Center for Polymer Studies, Department of Physics, Boston University, 590 Commonwealth Avenue, Boston, Massachusetts 02215 (United States)

    2014-03-14

    Microscopic structure and dynamics of water and lipids in a fully hydrated dimyristoylphosphatidylcholine phospholipid lipid bilayer membrane in the liquid-crystalline phase have been analyzed with all-atom molecular dynamics simulations based on the recently parameterized CHARMM36 force field. The diffusive dynamics of the membrane lipids and of its hydration water, their reorientational motions as well as their corresponding spectral densities, related to the absorption of radiation, have been considered for the first time using the present force field. In addition, structural properties such as density and pressure profiles, a deuterium-order parameter, surface tension, and the extent of water penetration in the membrane have been analyzed. Molecular self-diffusion, reorientational motions, and spectral densities of atomic species reveal a variety of time scales playing a role in membrane dynamics. The mechanisms of lipid motion strongly depend on the time scale considered, from fast ballistic translation at the scale of picoseconds (effective diffusion coefficients of the order of 10{sup −5} cm{sup 2}/s) to diffusive flow of a few lipids forming nanodomains at the scale of hundreds of nanoseconds (diffusion coefficients of the order of 10{sup −8} cm{sup 2}/s). In the intermediate regime of sub-diffusion, collisions with nearest neighbors prevent the lipids to achieve full diffusion. Lipid reorientations along selected directions agree well with reported nuclear magnetic resonance data and indicate two different time scales, one about 1 ns and a second one in the range of 2–8 ns. We associated the two time scales of reorientational motions with angular distributions of selected vectors. Calculated spectral densities corresponding to lipid and water reveal an overall good qualitative agreement with Fourier transform infrared spectroscopy experiments. Our simulations indicate a blue-shift of the low frequency spectral bands of hydration water as a result of

  8. Heat transport in the XXZ spin chain: from ballistic to diffusive regimes and dephasing enhancement

    International Nuclear Information System (INIS)

    Mendoza-Arenas, J J; Al-Assam, S; Clark, S R; Jaksch, D

    2013-01-01

    In this work we study the heat transport in an XXZ spin-1/2 Heisenberg chain with homogeneous magnetic field, incoherently driven out of equilibrium by reservoirs at the boundaries. We focus on the effect of bulk dephasing (energy-dissipative) processes in different parameter regimes of the system. The non-equilibrium steady state of the chain is obtained by simulating its evolution under the corresponding Lindblad master equation, using the time evolving block decimation method. In the absence of dephasing, the heat transport is ballistic for weak interactions, while being diffusive in the strongly interacting regime, as evidenced by the heat current scaling with the system size. When bulk dephasing takes place in the system, diffusive transport is induced in the weakly interacting regime, with the heat current monotonically decreasing with the dephasing rate. In contrast, in the strongly interacting regime, the heat current can be significantly enhanced by dephasing for systems of small size. (paper)

  9. Dose and dose rate effects on coherent-to-incoherent transition of precipitates upon irradiation

    Institute of Scientific and Technical Information of China (English)

    LI Zhengchao

    2006-01-01

    A typical precipitation hardened alloy, Cu-Co dilute alloy was selected to study the precipitation behavior and irradiation effect on precipitates. It is found that the principal effect of ion irradiation on the coherent precipitates is loss of coherency, and TEM cross-section observations show that the fraction of the incoherent precipitates is dependent on dose but not on dose rate during heavy ion irradiation.

  10. Disparity, motion, and color information improve gloss constancy performance.

    Science.gov (United States)

    Wendt, Gunnar; Faul, Franz; Ekroll, Vebjørn; Mausfeld, Rainer

    2010-09-01

    S. Nishida and M. Shinya (1998) found that observers have only a limited ability to recover surface-reflectance properties under changes in surface shape. Our aim in the present study was to investigate how the degree of surface-reflectance constancy depends on the availability of information that may help to infer the reflectance and shape properties of surfaces. To this end, we manipulated the availability of (i) motion-induced information (static vs. dynamic presentation), (ii) disparity information (with the levels "monocular," "surface disparity," and "surface + highlight disparity"), and (iii) color information (grayscale stimuli vs. hue differences between diffuse and specular reflections). The task of the subjects was to match the perceived lightness and glossiness between two surfaces with different spatial frequency and amplitude by manipulating the diffuse component and the exponent of the Phong lighting model in one of the surfaces. Our results indicate that all three types of information improve the constancy of glossiness matches--both in isolation and in combination. The lightness matching data only revealed an influence of motion and color information. Our results indicate, somewhat counterintuitively, that motion information has a detrimental effect on lightness constancy.

  11. Functionals of Brownian motion, localization and metric graphs

    International Nuclear Information System (INIS)

    Comtet, Alain; Desbois, Jean; Texier, Christophe

    2005-01-01

    We review several results related to the problem of a quantum particle in a random environment. In an introductory part, we recall how several functionals of Brownian motion arise in the study of electronic transport in weakly disordered metals (weak localization). Two aspects of the physics of the one-dimensional strong localization are reviewed: some properties of the scattering by a random potential (time delay distribution) and a study of the spectrum of a random potential on a bounded domain (the extreme value statistics of the eigenvalues). Then we mention several results concerning the diffusion on graphs, and more generally the spectral properties of the Schroedinger operator on graphs. The interest of spectral determinants as generating functions characterizing the diffusion on graphs is illustrated. Finally, we consider a two-dimensional model of a charged particle coupled to the random magnetic field due to magnetic vortices. We recall the connection between spectral properties of this model and winding functionals of planar Brownian motion. (topical review)

  12. Structured illumination to spatially map chromatin motions.

    Science.gov (United States)

    Bonin, Keith; Smelser, Amanda; Moreno, Naike Salvador; Holzwarth, George; Wang, Kevin; Levy, Preston; Vidi, Pierre-Alexandre

    2018-05-01

    We describe a simple optical method that creates structured illumination of a photoactivatable probe and apply this method to characterize chromatin motions in nuclei of live cells. A laser beam coupled to a diffractive optical element at the back focal plane of an excitation objective generates an array of near diffraction-limited beamlets with FWHM of 340  ±  30  nm, which simultaneously photoactivate a 7  ×  7 matrix pattern of GFP-labeled histones, with spots 1.70  μm apart. From the movements of the photoactivated spots, we map chromatin diffusion coefficients at multiple microdomains of the cell nucleus. The results show correlated motions of nearest chromatin microdomain neighbors, whereas chromatin movements are uncorrelated at the global scale of the nucleus. The method also reveals a DNA damage-dependent decrease in chromatin diffusion. The diffractive optical element instrumentation can be easily and cheaply implemented on commercial inverted fluorescence microscopes to analyze adherent cell culture models. A protocol to measure chromatin motions in nonadherent human hematopoietic stem and progenitor cells is also described. We anticipate that the method will contribute to the identification of the mechanisms regulating chromatin mobility, which influences most genomic processes and may underlie the biogenesis of genomic translocations associated with hematologic malignancies. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

  13. Misplaced Idealism and Incoherent Realism in the Philosophy of the Refugee Crisis

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2016-01-01

    Many contributions to the philosophical debate about conceptual and normative issues raised by the refugee crisis fail to take properly account of the difference between ideal and nonideal theory. This makes several otherwise interesting and apparently plausible contributions to the philosophy...... of arguments about how we should understand or respond to the refugee crisis, which appear to offer coherent principles for the moral guidance of political actors but which are actually incoherent as principles of practical reasoning for the context they aim to address....

  14. Coexistence of synchrony and incoherence in oscillatory media under nonlinear global coupling

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Lennart; García-Morales, Vladimir [Physik-Department, Nonequilibrium Chemical Physics, Technische Universität München, James-Franck-Str. 1, D-85748 Garching (Germany); Institute for Advanced Study, Technische Universität München, Lichtenbergstr. 2a, D-85748 Garching (Germany); Schönleber, Konrad; Krischer, Katharina, E-mail: krischer@tum.de [Physik-Department, Nonequilibrium Chemical Physics, Technische Universität München, James-Franck-Str. 1, D-85748 Garching (Germany)

    2014-03-15

    We report a novel mechanism for the formation of chimera states, a peculiar spatiotemporal pattern with coexisting synchronized and incoherent domains found in ensembles of identical oscillators. Considering Stuart-Landau oscillators, we demonstrate that a nonlinear global coupling can induce this symmetry breaking. We find chimera states also in a spatially extended system, a modified complex Ginzburg-Landau equation. This theoretical prediction is validated with an oscillatory electrochemical system, the electro-oxidation of silicon, where the spontaneous formation of chimeras is observed without any external feedback control.

  15. SU-F-303-13: Initial Evaluation of Four Dimensional Diffusion- Weighted MRI (4D-DWI) and Its Effect On Apparent Diffusion Coefficient (ADC) Measurement

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Y [Duke University Medical Physics Program (United States); Yin, F; Czito, B; Bashir, M; Palta, M; Cai, J [Duke University Medical Center, Durham, NC (United States); Zhong, X; Dale, B [Siemens Healthcare, Durham, NC (United States)

    2015-06-15

    Purpose: Diffusion-weighted imaging(DWI) has been shown to have superior tumor-to-tissue contrast for cancer detection.This study aims at developing and evaluating a four dimensional DWI(4D-DWI) technique using retrospective sorting method for imaging respiratory motion for radiotherapy planning,and evaluate its effect on Apparent Diffusion Coefficient(ADC) measurement. Materials/Methods: Image acquisition was performed by repeatedly imaging a volume of interest using a multi-slice single-shot 2D-DWI sequence in the axial planes and cine MRI(served as reference) using FIESTA sequence.Each 2D-DWI image were acquired in xyz-diffusion-directions with a high b-value(b=500s/mm2).The respiratory motion was simultaneously recorded using bellows.Retrospective sorting was applied in each direction to reconstruct 4D-DWI.The technique was evaluated using a computer simulated 4D-digital human phantom(XCAT),a motion phantom and a healthy volunteer under an IRB-approved study.Motion trajectories of regions-of-interests(ROI) were extracted from 4D-DWI and compared with reference.The mean motion trajectory amplitude differences(D) between the two was calculated.To quantitatively analyze the motion artifacts,XCAT were controlled to simulate regular motion and the motions of 10 liver cancer patients.4D-DWI,free-breathing DWI(FB- DWI) were reconstructed.Tumor volume difference(VD) of each phase of 4D-DWI and FB-DWI from the input static tumor were calculated.Furthermore, ADC was measured for each phase of 4D-DWI and FB-DWI data,and mean tumor ADC values(M-ADC) were calculated.Mean M-ADC over all 4D-DWI phases was compared with M-ADC calculated from FB-DWI. Results: 4D-DWI of XCAT,the motion phantom and the healthy volunteer demonstrated the respiratory motion clearly.ROI D values were 1.9mm,1.7mm and 2.0mm,respectively.For motion artifacts analysis,XCAT 4D-DWI images show much less motion artifacts compare to FB-DWI.Mean VD for 4D-WDI and FB-DWI were 8.5±1.4% and 108±15

  16. Nonrigid Registration of Prostate Diffusion-Weighted MRI

    Directory of Open Access Journals (Sweden)

    Lei Hao

    2017-01-01

    Full Text Available Motion and deformation are common in prostate diffusion-weighted magnetic resonance imaging (DWI during acquisition. These misalignments lead to errors in estimating an apparent diffusion coefficient (ADC map fitted with DWI. To address this problem, we propose an image registration algorithm to align the prostate DWI and improve ADC map. First, we apply affine transformation to DWI to correct intraslice motions. Then, nonrigid registration based on free-form deformation (FFD is used to compensate for intraimage deformations. To evaluate the influence of the proposed algorithm on ADC values, we perform statistical experiments in three schemes: no processing of the DWI, with the affine transform approach, and with FFD. The experimental results show that our proposed algorithm can correct the misalignment of prostate DWI and decrease the artifacts of ROI in the ADC maps. These ADC maps thus obtain sharper contours of lesions, which are helpful for improving the diagnosis and clinical staging of prostate cancer.

  17. Diffusion weighted imaging by MR method

    International Nuclear Information System (INIS)

    Horikawa, Yoshiharu; Naruse, Shoji; Ebisu, Toshihiko; Tokumitsu, Takuaki; Ueda, Satoshi; Tanaka, Chuzo; Higuchi, Toshihiro; Umeda, Masahiro.

    1993-01-01

    Diffusion weighted magnetic resonance imaging is a recently developed technique used to examine the micromovement of water molecules in vivo. We have applied this technique to examine various kinds of brain diseases, both experimentally and clinically. The calculated apparent diffusion coefficient (ADC) in vivo showed reliable values. In experimentally induced brain edema in rats, the pathophysiological difference of the type of edema (such as cytotoxic, and vasogenic) could be differentiated on the diffusion weighted MR images. Cytotoxic brain edema showed high intensity (slower diffusion) on the diffusion weighted images. On the other hand, vasogenic brain edema showed a low intensity image (faster diffusion). Diffusion anisotropy was demonstrated according to the direction of myelinated fibers and applied motion proving gradient (MPG). This anisotropy was also demonstrated in human brain tissue along the course of the corpus callosum, pyramidal tract and optic radiation. In brain ischemia cases, lesions were detected as high signal intensity areas, even one hour after the onset of ischemia. Diffusion was faster in brain tumor compared with normal brain. Histological differences were not clearly reflected by the ADC value. In epidermoid tumor cases, the intensity was characteristically high, was demonstrated, and the cerebrospinal fluid border was clearly demonstrated. New clinical information obtainable with this molecular diffusion method will prove to be useful in various clinical studies. (author)

  18. On the role of memory effects for dissipation and diffusion in slow collective nuclear motion

    International Nuclear Information System (INIS)

    Cassing, W.; Noerenberg, W.

    1983-01-01

    The energy dissipation in slow collective nuclear motion is viewed as a combined effect of a diabatic production of particle-hole excitations, leading to a conservative storage of collective energy, and a subsequent equilibration due to residual two-body collisions. The effective equation of motion for the collective degree of freedom turns out to be nonlocal in time due to the large mean free path of the nucleons and allows for a simultaneous description of two different attitudes of nuclear matter. The elastic response of heavy nuclei for ''fast'' collective motion switches over to pure friction for very slow collective motion. The time development of the fluctuations in the velocities may show oscillations for times comparable to the local equilibration time and hence, is qualitatively different from the classical limit. A first application of the diabatic dynamical approach is made for the quadrupole motion within a diabatic deformed harmonic oscillator basis. (orig.)

  19. Direct, coherent and incoherent intermediate state tunneling and scanning tunnel microscopy (STM)

    International Nuclear Information System (INIS)

    Halbritter, J.

    1997-01-01

    Theory and experiment in tunneling are still qualitative in nature, which hold true also for the latest developments in direct-, resonant-, coherent- and incoherent-tunneling. Those tunnel processes have recently branched out of the field of ''solid state tunnel junctions'' into the fields of scanning tunnel microscopy (STM), single electron tunneling (SET) and semiconducting resonant tunnel structures (RTS). All these fields have promoted the understanding of tunneling in different ways reaching from the effect of coherence, of incoherence and of charging in tunneling, to spin flip or inelastic effects. STM allows not only the accurate measurements of the tunnel current and its voltage dependence but, more importantly, the easy quantification via the (quantum) tunnel channel conductance and the distance dependence. This new degree of freedom entering exponentially the tunnel current allows an unique identification of individual tunnel channels and their quantification. In STM measurements large tunnel currents are observed for large distances d > 1 nm explainable by intermediate state tunneling. Direct tunneling with its reduced tunnel time and reduced off-site Coulomb charging bridges distances below 1 nm, only. The effective charge transfer process with its larger off-site and on-site charging at intermediate states dominates tunnel transfer in STM, biology and chemistry over distances in the nm-range. Intermediates state tunneling becomes variable range hopping conduction for distances larger than d > 2 nm, for larger densities of intermediate states n 1 (ε) and for larger temperatures T or voltages U, still allowing high resolution imaging

  20. Theory of collective diffusion in two-dimensional colloidal suspensions

    Czech Academy of Sciences Publication Activity Database

    Chvoj, Zdeněk; Lahtinen, J. M.; Ala-Nissila, T.

    -, - (2004), s. 1-8 ISSN 1742-5468 R&D Projects: GA AV ČR IAA1010207 Institutional research plan: CEZ:AV0Z1010914 Keywords : surface diffusion * Brownian motion * fluctuations Subject RIV: BE - Theoretical Physics

  1. Incoherent Optical Frequency Domain Reflectometry for Distributed Thermal Sensing

    DEFF Research Database (Denmark)

    Karamehmedovic, Emir

    2006-01-01

    comprising a pump laser, optical filters, optical fibre and photo-detectors are presented. Limitations, trade-offs and optimisation processes are described for setups having different specifications with respect to range, resolution and accuracy. The analysis is conducted using computer simulation programs...... developed and implemented in Matlab. The computer model is calibrated and tested, and describes the entire system with high precision. Noise analysis and digital processing of the detected signal are discussed as well. An equation describing the standard deviation of the measured temperature is derived......This thesis reports the main results from an investigation of a fibre-optic distributed temperature sensor based on spontaneous Raman scattering. The technique used for spatial resolving is the incoherent optical frequency domain reflectometry, where a pump laser is sine modulated with a stepwise...

  2. A diffusive model for halo width growth during vertical displacement events

    International Nuclear Information System (INIS)

    Eidietis, N.W.; Humphreys, D.A.

    2011-01-01

    The electromagnetic loads produced by halo currents during vertical displacement events (VDEs) impose stringent requirements on the strength of ITER in-vessel components. A predictive understanding of halo current evolution is essential for ensuring the robust design of these components. A significant factor determining that evolution is the plasma resistance, which is a function of three quantities: the resistivities of the core and halo regions, and the halo region width. A diffusive model of halo width growth during VDEs has been developed, which provides one part of a physics basis for predictive halo current simulations. The diffusive model was motivated by DIII-D observations that VDEs with cold post-thermal quench plasma and a current decay time much faster than the vertical motion (type I VDE) possess much wider halo region widths than warmer plasma VDEs, where the current decay is much slower than the vertical motion (type II). A 2D finite element code is used to model the diffusion of toroidal halo current during selected type I and type II DIII-D VDEs. The model assumes a core plasma region within the last closed flux surface (LCFS) diffusing current into a halo plasma filling the vessel outside the LCFS. LCFS motion and plasma temperature are prescribed from experimental observations. The halo width evolution produced by this model compares favourably with experimental measurements of type I and type II toroidal halo current width evolution.

  3. Diffusion properties of active particles with directional reversal

    International Nuclear Information System (INIS)

    Großmann, R; Bär, M; Peruani, F

    2016-01-01

    The diffusion properties of self-propelled particles which move at constant speed and, in addition, reverse their direction of motion repeatedly are investigated. The internal dynamics of particles triggering these reversal processes is modeled by a stochastic clock. The velocity correlation function as well as the mean squared displacement is investigated and, furthermore, a general expression for the diffusion coefficient for self-propelled particles with directional reversal is derived. Our analysis reveals the existence of an optimal, finite rotational noise amplitude which maximizes the diffusion coefficient. We comment on the relevance of these results with regard to biological systems and suggest further experiments in this context. (paper)

  4. Enhanced Oxygen Diffusion Within the Internal Oxidation Zone of Alloy 617 in Controlled Impurity Helium Environments from 1023 K to 1123 K (750 °C to 850 °C)

    Science.gov (United States)

    Gulsoy, Gokce; Was, Gary S.

    2015-04-01

    Alloy 617 was exposed to He-CO-CO2 environments with of either 9 or 1320 at temperatures from 1023 K to 1123 K (750 °C to 850 °C) to determine the oxygen diffusion coefficients within the internal oxidation zone of the alloy. The oxygen diffusion coefficients determined based on both intergranular and transgranular oxidation rates were several orders of magnitude greater than those reported in pure nickel and in nickel-based binary alloys, indicating that the rapid internal aluminum oxidation of Alloy 617 was primarily due to enhanced oxygen diffusion along the incoherent Al2O3-alloy interfaces. The range of activation energy values determined for oxygen diffusion associated with the intergranular aluminum oxidation was from 149.6 to 154.7 kJ/mol, and that associated with the transgranular aluminum oxidation was from 244.7 to 283.5 kJ/mol.

  5. Time rescaling and Gaussian properties of the fractional Brownian motions

    International Nuclear Information System (INIS)

    Maccone, C.

    1981-01-01

    The fractional Brownian motions are proved to be a class of Gaussian (normal) stochastic processes suitably rescaled in time. Some consequences affecting their eigenfunction expansion (Karhunen-Loeve expansion) are inferred. A known formula of Cameron and Martin is generalized. The first-passage time probability density is found. The partial differential equation of the fractional Brownian diffusion is obtained. And finally the increments of the fractional Brownian motions are proved to be independent for nonoverlapping time intervals. (author)

  6. Excitation decay due to incoherent energy transfer : A comparative study by means of an exact density expansion

    NARCIS (Netherlands)

    Knoester, J.; Himbergen, J.E. Van

    1984-01-01

    In this paper we consider a system of identical, randomly distributed donors, between which incoherent energy transfer takes place, described by coupled rate equations. It is proved, that the well-known diagrammatic series expansion of Gochanour, Andersen, and Fayer for the self-energy, while not an

  7. Daytime and Nighttime Neutral Wind and Temperature Measurements from Incoherent Scatter Radar at 300 KM over Arecibo.

    Science.gov (United States)

    1985-12-01

    Incoherent *scatter observations and their interpretation, 3. Atmos. Tarr. Phys., 34, 351-364, 1972. Bohnk&,R., and Harper,R., Vector measurements of F...equatorial F-region, 3. Atmos. Terr. Phys., 39, 1159-1168, 1977. Rishbeth, H., Ganguly,S., Walker,3.C., Feild -aligned and field-perpendicular velocities

  8. Whether diffusion in axisymmetric confinement systems is intrinsically ambipolar

    International Nuclear Information System (INIS)

    Kovrizhnykh, L.M.

    1997-01-01

    The problem of diffusion ambipolarity in axisymmetric magnetic systems is analyzed. The question is discussed of whether diffusion is intrinsically ambipolar (and if so, then in which particular cases) or the ambipolarity constraint is an additional independent condition, which does not follow from the equations of motion and, hence, contains new information. It is shown that the second assertion is correct: strictly speaking, diffusion can never be intrinsically ambipolar, and, in the presence of several different mechanisms causing electron and ion losses across the magnetic field, only the total fluxes, but not the partial ones, should satisfy the ambipolarity constraint. (UK)

  9. Analysis of the Spectral Efficiency of Frequency-Encoded OCDMA Systems With Incoherent Sources

    Science.gov (United States)

    Rochette, Martin; Ayotte, Simon; Rusch, Leslie A.

    2005-04-01

    This paper presents the spectral efficiency of frequency-encoded (FE) optical code-division multiple-access (OCDMA) systems with incoherent sources. The spectral efficiency of five code families compatible with FE-OCDMA is calculated as a function of the number of users. Analytical equations valid in the limiting case of Gaussian noise are also developed for the bit-error rate and the spectral efficiency. Among the code families considered, the modified quadratic congruence code leads to the maximum achievable spectral efficiency.

  10. Concerted diffusion of lipids in raft-like membranes

    NARCIS (Netherlands)

    Apajalahti, Touko; Niemela, Perttu; Govindan, Praveen Nedumpully; Miettinen, Markus S.; Salonen, Emppu; Marrink, Siewert-Jan; Vattulainen, Ilpo

    2010-01-01

    Currently, there is no comprehensive model for the dynamics of cellular membranes. The understanding of even the basic dynamic processes, such as lateral diffusion of lipids, is still quite limited. Recent studies of one-component membrane systems have shown that instead of single-particle motions,

  11. Q2 Dependence of Nuclear Transparency for Incoherent ρ0 Electroproduction

    International Nuclear Information System (INIS)

    John Arrington; Frank Dohrmann; Ahmed El Alaoui; Don Geesaman; Kawtar Hafidi; Roy Holt; Harold Jackson; David Potterveld; Brahim Mustapha; Paul Reimer; Elaine Schulte; Krishni Wijesooriya; Maurik Holtrop; Jacques Ball; Michel Garcon; Jean Laget; Franck Sabatie; Michel Guidal; Latifa Elouadrhiri; Borissov, A.; Wolfgang Lorenzon; Stepan Stepanyan; Lawrence Weinstein

    2002-01-01

    Measurements of exclusive incoherent electroproduction of ρ 0 (770) meson from 2 D, 12 C, and 63 Cu targets up to Q 2 = 4 GeV 2 are proposed using the CLAS detector. The objective of these measurements is to determine the Q 2 dependence of the nuclear transparency ratio for the two nuclear targets: 12 C and 63 Cu at fixed coherence length of quark-antiquark fluctuations of the virtual photon. A sizeable rise of the nuclear transparency is predicted and can be measured in this experiment. A relatively large increase of the nuclear transparency can be considered as a signature of the onset of color transparency

  12. Incoherent Manipulation of the Photoactive Yellow Protein Photocycle with Dispersed Pump-Dump-Probe Spectroscopy

    OpenAIRE

    Larsen, Delmar S.; van Stokkum, Ivo H. M.; Vengris, Mikas; van der Horst, Michael A.; de Weerd, Frank L.; Hellingwerf, Klaas J.; van Grondelle, Rienk

    2004-01-01

    Photoactive yellow protein is the protein responsible for initiating the ``blue-light vision¿¿ of Halorhodospira halophila. The dynamical processes responsible for triggering the photoactive yellow protein photocycle have been disentangled with the use of a novel application of dispersed ultrafast pump-dump-probe spectroscopy, where the photocycle can be started and interrupted with appropriately tuned and timed laser pulses. This ``incoherent¿¿ manipulation of the photocycle allows for the d...

  13. From quantum stochastic differential equations to Gisin-Percival state diffusion

    Science.gov (United States)

    Parthasarathy, K. R.; Usha Devi, A. R.

    2017-08-01

    Starting from the quantum stochastic differential equations of Hudson and Parthasarathy [Commun. Math. Phys. 93, 301 (1984)] and exploiting the Wiener-Itô-Segal isomorphism between the boson Fock reservoir space Γ (L2(R+ ) ⊗(Cn⊕Cn ) ) and the Hilbert space L2(μ ) , where μ is the Wiener probability measure of a complex n-dimensional vector-valued standard Brownian motion {B (t ) ,t ≥0 } , we derive a non-linear stochastic Schrödinger equation describing a classical diffusion of states of a quantum system, driven by the Brownian motion B. Changing this Brownian motion by an appropriate Girsanov transformation, we arrive at the Gisin-Percival state diffusion equation [N. Gisin and J. Percival, J. Phys. A 167, 315 (1992)]. This approach also yields an explicit solution of the Gisin-Percival equation, in terms of the Hudson-Parthasarathy unitary process and a randomized Weyl displacement process. Irreversible dynamics of system density operators described by the well-known Gorini-Kossakowski-Sudarshan-Lindblad master equation is unraveled by coarse-graining over the Gisin-Percival quantum state trajectories.

  14. Dissipation and decoherence in Brownian motion

    Energy Technology Data Exchange (ETDEWEB)

    Bellomo, Bruno [Dipartimento di Scienze Fisiche ed Astronomiche dell' Universita di Palermo, Via Archirafi, 36, 90123 Palermo (Italy); Barnett, Stephen M [Department of Physics, University of Strathclyde, Glasgow G4 0NG (United Kingdom); Jeffers, John [Department of Physics, University of Strathclyde, Glasgow G4 0NG (United Kingdom)

    2007-05-15

    We consider the evolution of a Brownian particle described by a measurement-based master equation. We derive the solution to this equation for general initial conditions and apply it to a Gaussian initial state. We analyse the effects of the diffusive terms, present in the master equation, and describe how these modify uncertainties and coherence length. This allows us to model dissipation and decoherence in quantum Brownian motion.

  15. Fluorescence Correlation Spectroscopy to Study Diffusion of Polymer Chains within Layered Hydrogen-Bonded Polymer Films

    Science.gov (United States)

    Pristinski, Denis; Kharlampieva, Evguenia; Sukhishvili, Svetlana

    2002-03-01

    Fluorescence Correlation Spectroscopy (FCS) has been used to probe molecular motions within polymer multilayers formed by hydrogen-bonding sequential self-assembly. Polyethylene glycol (PEG) molecules were end-labeled with the fluorescent tags, and self-assembled with polymethacrylic acid (PMAA) using layer-by-layer deposition. We have found that molecules included in the top adsorbed layer have significant mobility at the millisecond time scale, probably due to translational diffusion. However, their dynamics deviate from classical Brownian motion with a single diffusion time. Possible reasons for the deviation are discussed. We found that motions were significantly slowed with increasing depth within the PEG/PMAA multilayer. This phenomena occured in a narrow pH range around 4.0 in which intermolecular interactions were relatively weak.

  16. Risk and resilience factors in coping with daily stress in adulthood: the role of age, self-concept incoherence, and personal control.

    Science.gov (United States)

    Diehl, Manfred; Hay, Elizabeth L

    2010-09-01

    This study observed young, middle-aged, and older adults (N = 239; Mage = 49.6 years; range = 18-89 years) for 30 consecutive days to examine the association between daily stress and negative affect, taking into account potential risk (i.e., self-concept incoherence) and resilience (i.e., age, perceived personal control) factors. Results indicated that younger individuals and individuals with a more incoherent self-concept showed higher average negative affect across the study. As well, individuals reported higher negative affect on days that they experienced more stress than usual and on days that they reported less control than usual. These main effects were qualified by significant interactions. In particular, the association between daily stress and negative affect was stronger on days on which adults reported low control compared with days on which they reported high control (i.e., perceptions of control buffered stress). Reactivity to daily stress did not differ for individuals of different ages or for individuals with different levels of self-concept incoherence. Although all individuals reported higher negative affect on days on which they reported less control than usual, this association was more pronounced among younger adults. The current study helps to elucidate the role of risk and resilience factors when adults are faced with daily stress.

  17. Shear-induced diffusion of red blood cells measured with dynamic light scattering-optical coherence tomography.

    Science.gov (United States)

    Tang, Jianbo; Erdener, Sefik Evren; Li, Baoqiang; Fu, Buyin; Sakadzic, Sava; Carp, Stefan A; Lee, Jonghwan; Boas, David A

    2018-02-01

    Quantitative measurements of intravascular microscopic dynamics, such as absolute blood flow velocity, shear stress and the diffusion coefficient of red blood cells (RBCs), are fundamental in understanding the blood flow behavior within the microcirculation, and for understanding why diffuse correlation spectroscopy (DCS) measurements of blood flow are dominantly sensitive to the diffusive motion of RBCs. Dynamic light scattering-optical coherence tomography (DLS-OCT) takes the advantages of using DLS to measure particle flow and diffusion within an OCT resolution-constrained three-dimensional volume, enabling the simultaneous measurements of absolute RBC velocity and diffusion coefficient with high spatial resolution. In this work, we applied DLS-OCT to measure both RBC velocity and the shear-induced diffusion coefficient within penetrating venules of the somatosensory cortex of anesthetized mice. Blood flow laminar profile measurements indicate a blunted laminar flow profile and the degree of blunting decreases with increasing vessel diameter. The measured shear-induced diffusion coefficient was proportional to the flow shear rate with a magnitude of ~0.1 to 0.5 × 10 -6  mm 2 . These results provide important experimental support for the recent theoretical explanation for why DCS is dominantly sensitive to RBC diffusive motion. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Posture-based processing in visual short-term memory for actions.

    Science.gov (United States)

    Vicary, Staci A; Stevens, Catherine J

    2014-01-01

    Visual perception of human action involves both form and motion processing, which may rely on partially dissociable neural networks. If form and motion are dissociable during visual perception, then they may also be dissociable during their retention in visual short-term memory (VSTM). To elicit form-plus-motion and form-only processing of dance-like actions, individual action frames can be presented in the correct or incorrect order. The former appears coherent and should elicit action perception, engaging both form and motion pathways, whereas the latter appears incoherent and should elicit posture perception, engaging form pathways alone. It was hypothesized that, if form and motion are dissociable in VSTM, then recognition of static body posture should be better after viewing incoherent than after viewing coherent actions. However, as VSTM is capacity limited, posture-based encoding of actions may be ineffective with increased number of items or frames. Using a behavioural change detection task, recognition of a single test posture was significantly more likely after studying incoherent than after studying coherent stimuli. However, this effect only occurred for spans of two (but not three) items and for stimuli with five (but not nine) frames. As in perception, posture and motion are dissociable in VSTM.

  19. Calculating effective diffusivities in the limit of vanishing molecular diffusion

    International Nuclear Information System (INIS)

    Pavliotis, G.A.; Stuart, A.M.; Zygalakis, K.C.

    2009-01-01

    In this paper we study the problem of the numerical calculation (by Monte Carlo methods) of the effective diffusivity for a particle moving in a periodic divergent-free velocity field, in the limit of vanishing molecular diffusion. In this limit traditional numerical methods typically fail, since they do not represent accurately the geometry of the underlying deterministic dynamics. We propose a stochastic splitting method that takes into account the volume-preserving property of the equations of motion in the absence of noise, and when inertial effects can be neglected. An extension of the method is then proposed for the cases where the noise has a non-trivial time-correlation structure and when inertial effects cannot be neglected. The method of modified equations is used to explain failings of Euler-based methods. The new stochastic geometric integrators are shown to outperform standard Euler-based integrators. Various asymptotic limits of physical interest are investigated by means of numerical experiments, using the new integrators

  20. Pivotal role of hMT+ in long-range disambiguation of interhemispheric bistable surface motion.

    Science.gov (United States)

    Duarte, João Valente; Costa, Gabriel Nascimento; Martins, Ricardo; Castelo-Branco, Miguel

    2017-10-01

    It remains an open question whether long-range disambiguation of ambiguous surface motion can be achieved in early visual cortex or instead in higher level regions, which concerns object/surface segmentation/integration mechanisms. We used a bistable moving stimulus that can be perceived as a pattern comprehending both visual hemi-fields moving coherently downward or as two widely segregated nonoverlapping component objects (in each visual hemi-field) moving separately inward. This paradigm requires long-range integration across the vertical meridian leading to interhemispheric binding. Our fMRI study (n = 30) revealed a close relation between activity in hMT+ and perceptual switches involving interhemispheric segregation/integration of motion signals, crucially under nonlocal conditions where components do not overlap and belong to distinct hemispheres. Higher signal changes were found in hMT+ in response to spatially segregated component (incoherent) percepts than to pattern (coherent) percepts. This did not occur in early visual cortex, unlike apparent motion, which does not entail surface segmentation. We also identified a role for top-down mechanisms in state transitions. Deconvolution analysis of switch-related changes revealed prefrontal, insula, and cingulate areas, with the right superior parietal lobule (SPL) being particularly involved. We observed that directed influences could emerge either from left or right hMT+ during bistable motion integration/segregation. SPL also exhibited significant directed functional connectivity with hMT+, during perceptual state maintenance (Granger causality analysis). Our results suggest that long-range interhemispheric binding of ambiguous motion representations mainly reflect bottom-up processes from hMT+ during perceptual state maintenance. In contrast, state transitions maybe influenced by high-level regions such as the SPL. Hum Brain Mapp 38:4882-4897, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley

  1. The Applicability of Incoherent Array Processing to IMS Seismic Array Stations

    Science.gov (United States)

    Gibbons, S. J.

    2012-04-01

    The seismic arrays of the International Monitoring System for the CTBT differ greatly in size and geometry, with apertures ranging from below 1 km to over 60 km. Large and medium aperture arrays with large inter-site spacings complicate the detection and estimation of high frequency phases since signals are often incoherent between sensors. Many such phases, typically from events at regional distances, remain undetected since pipeline algorithms often consider only frequencies low enough to allow coherent array processing. High frequency phases that are detected are frequently attributed qualitatively incorrect backazimuth and slowness estimates and are consequently not associated with the correct event hypotheses. This can lead to missed events both due to a lack of contributing phase detections and by corruption of event hypotheses by spurious detections. Continuous spectral estimation can be used for phase detection and parameter estimation on the largest aperture arrays, with phase arrivals identified as local maxima on beams of transformed spectrograms. The estimation procedure in effect measures group velocity rather than phase velocity and the ability to estimate backazimuth and slowness requires that the spatial extent of the array is large enough to resolve time-delays between envelopes with a period of approximately 4 or 5 seconds. The NOA, AKASG, YKA, WRA, and KURK arrays have apertures in excess of 20 km and spectrogram beamforming on these stations provides high quality slowness estimates for regional phases without additional post-processing. Seven arrays with aperture between 10 and 20 km (MJAR, ESDC, ILAR, KSRS, CMAR, ASAR, and EKA) can provide robust parameter estimates subject to a smoothing of the resulting slowness grids, most effectively achieved by convolving the measured slowness grids with the array response function for a 4 or 5 second period signal. The MJAR array in Japan recorded high SNR Pn signals for both the 2006 and 2009 North Korea

  2. Study of water diffusion on single-supported bilayer lipid membranes by quasielastic neutron scattering

    DEFF Research Database (Denmark)

    Bai, M.; Miskowiec, A.; Hansen, F. Y.

    2012-01-01

    High-energy-resolution quasielastic neutron scattering has been used to elucidate the diffusion of water molecules in proximity to single bilayer lipid membranes supported on a silicon substrate. By varying sample temperature, level of hydration, and deuteration, we identify three different types...... of diffusive water motion: bulk-like, confined, and bound. The motion of bulk-like and confined water molecules is fast compared to those bound to the lipid head groups (7-10 H2O molecules per lipid), which move on the same nanosecond time scale as H atoms within the lipid molecules. Copyright (C) EPLA, 2012...

  3. An Invariance Principle to Ferrari-Spohn Diffusions

    Science.gov (United States)

    Ioffe, Dmitry; Shlosman, Senya; Velenik, Yvan

    2015-06-01

    We prove an invariance principle for a class of tilted 1 + 1-dimensional SOS models or, equivalently, for a class of tilted random walk bridges in . The limiting objects are stationary reversible ergodic diffusions with drifts given by the logarithmic derivatives of the ground states of associated singular Sturm-Liouville operators. In the case of a linear area tilt, we recover the Ferrari-Spohn diffusion with log-Airy drift, which was derived in Ferrari and Spohn (Ann Probab 33(4):1302—1325, 2005) in the context of Brownian motions conditioned to stay above circular and parabolic barriers.

  4. All-fiber 7x1 signal combiner for incoherent laser beam combining

    DEFF Research Database (Denmark)

    Noordegraaf, Danny; Maack, Martin D.; Skovgaard, Peter M. W.

    2011-01-01

    We demonstrate an all-fiber 7x1 signal combiner for incoherent laser beam combining. This is a potential key component for reaching several kW of stabile laser output power. The combiner couples the output from 7 single-mode (SM) fiber lasers into a single multi-mode (MM) fiber. The input signal ...... in device temperature is observed. At an intermediate power level of 600 W a beam parameter product (BPP) of 2.22 mm x mrad is measured, corresponding to an M2 value of 6.5. These values are approaching the theoretical limit dictated by brightness conservation....

  5. From Coherently Excited Highly Correlated States to Incoherent Relaxation Processes in Semiconductors

    International Nuclear Information System (INIS)

    Scha''fer, W.; Lo''venich, R.; Fromer, N. A.; Chemla, D. S.

    2001-01-01

    Recent theories of highly excited semiconductors are based on two formalisms, referring to complementary experimental conditions, the real-time nonequilibrium Green's function techniques and the coherently controlled truncation of the many-particle problem. We present a novel many-particle theory containing both of these methods as limiting cases. As a first example of its application, we investigate four-particle correlations in a strong magnetic field including dephasing resulting from the growth of incoherent one-particle distribution functions. Our results are the first rigorous solution concerning formation and decay of four-particle correlations in semiconductors. They are in excellent agreement with experimental data

  6. Explicit studies of the quantum theory of light interstitial diffusion

    International Nuclear Information System (INIS)

    Emin, D.; Baskes, M.I.; Wilson, W.D.

    1978-01-01

    The formalism associated with small-polaron diffusion in the high temperature semiclassical regime is generalized so as to transcend simplifications employed in developing the nonadiabatic theory. The diffusion constant is then calculated for simple models in which the metal atoms interact with each other and with the interstitial atom with two-body forces. Studies of these models not only confirm the necessity of generalizing the formalism but also yield diffusion constants whose magnitudes and temperature dependenes ar consistent with the general features of the existing data for the diffusion of hydrogen and its isotopes in bcc metals. The motion of a positive muon between interstitial positions of a metal is also investigated

  7. Rotational and translational diffusions of fluorescent probes during gelation process

    Science.gov (United States)

    Hattori, Yusuke; Panizza, Pascal; Letamendia, Louis; Ushiki, Hideharu

    2006-04-01

    Gelation process has been investigated by using light scattering techniques in recent years. We measured both of rotational and translational motions of fluorescent probes during gelation process. The measurements were performed after the temperature quenched at 30 °C. As the results, rotational diffusion coefficient of fluorescein was decreased after 6.0 × 10 4 s and energy transfer rate was reduced after 2.0 × 10 4 s. We sorted the gelation process into the following three parts, (I) pre-gelation, (II) reduction of translational diffusion (aging), and (III) reduction of rotational diffusion with saturating translational diffusion (post-gelation). The time scale of the process was completely different from the results of other methods.

  8. Ergodicity breaking, ageing, and confinement in generalized diffusion processes with position and time dependent diffusivity

    International Nuclear Information System (INIS)

    Cherstvy, Andrey G; Metzler, Ralf

    2015-01-01

    We study generalized anomalous diffusion processes whose diffusion coefficient D(x, t) ∼ D 0 |x| α t β depends on both the position x of the test particle and the process time t. This process thus combines the features of scaled Brownian motion and heterogeneous diffusion parent processes. We compute the ensemble and time averaged mean squared displacements of this generalized diffusion process. The scaling exponent of the ensemble averaged mean squared displacement is shown to be the product of the critical exponents of the parent processes, and describes both subdiffusive and superdiffusive systems. We quantify the amplitude fluctuations of the time averaged mean squared displacement as function of the length of the time series and the lag time. In particular, we observe a weak ergodicity breaking of this generalized diffusion process: even in the long time limit the ensemble and time averaged mean squared displacements are strictly disparate. When we start to observe this process some time after its initiation we observe distinct features of ageing. We derive a universal ageing factor for the time averaged mean squared displacement containing all information on the ageing time and the measurement time. External confinement is shown to alter the magnitudes and statistics of the ensemble and time averaged mean squared displacements. (paper)

  9. The Pricing of Vulnerable Options in a Fractional Brownian Motion Environment

    Directory of Open Access Journals (Sweden)

    Chao Wang

    2015-01-01

    Full Text Available Under the assumption of the stock price, interest rate, and default intensity obeying the stochastic differential equation driven by fractional Brownian motion, the jump-diffusion model is established for the financial market in fractional Brownian motion setting. With the changes of measures, the traditional pricing method is simplified and the general pricing formula is obtained for the European vulnerable option with stochastic interest rate. At the same time, the explicit expression for it comes into being.

  10. Wave Augmented Diffusers for Centrifugal Compressors

    Science.gov (United States)

    Paxson, Daniel E.; Skoch, Gary J.

    1998-01-01

    A conceptual device is introduced which would utilize unsteady wave motion to slow and turn flows in the diffuser section of a centrifugal compressor. The envisioned device would substantially reduce the size of conventional centrifugal diffusers by eliminating the relatively large ninety degree bend needed to turn the flow from the radial/tangential to the axial direction. The bend would be replaced by a wall and the flow would instead exit through a series of rotating ports located on a disk, adjacent to the diffuser hub, and fixed to the impeller shaft. The ports would generate both expansion and compression waves which would rapidly transition from the hub/shroud (axial) direction to the radial/tangential direction. The waves would in turn induce radial/tangential and axial flow. This paper presents a detailed description of the device. Simplified cycle analysis and performance results are presented which were obtained using a time accurate, quasi-one-dimensional CFD code with models for turning, port flow conditions, and losses due to wall shear stress. The results indicate that a periodic wave system can be established which yields diffuser performance comparable to a conventional diffuser. Discussion concerning feasibility, accuracy, and integration follow.

  11. Role of string-like collective atomic motion on diffusion and structural relaxation in glass forming Cu-Zr alloys

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Hao [International Center for New-Structured Materials (ICNSM), Zhejiang University and Laboratory of New-Structured Materials, School of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Department of Chemical and Materials Engineering, University of Alberta, Edmonton, Alberta T6G 2V4 (Canada); Zhong, Cheng; Wang, Xiaodong; Cao, Qingping; Jiang, Jian-Zhong, E-mail: jiangjz@zju.edu.cn, E-mail: jack.douglas@nist.gov [International Center for New-Structured Materials (ICNSM), Zhejiang University and Laboratory of New-Structured Materials, School of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou 310027 (China); Douglas, Jack F., E-mail: jiangjz@zju.edu.cn, E-mail: jack.douglas@nist.gov [Materials Science and Engineering Division, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Zhang, Dongxian [State Key Laboratory of Modern Optical Instrumentation, Zhejiang University, Hangzhou 310027 (China)

    2015-04-28

    We investigate Cu-Zr liquid alloys using molecular dynamics simulation and well-accepted embedded atom method potentials over a wide range of chemical composition and temperature as model metallic glass-forming (GF) liquids. As with other types of GF materials, the dynamics of these complex liquids are characterized by “dynamic heterogeneity” in the form of transient polymeric clusters of highly mobile atoms that are composed in turn of atomic clusters exhibiting string-like cooperative motion. In accordance with the string model of relaxation, an extension of the Adam-Gibbs (AG) model, changes in the activation free energy ΔG{sub a} with temperature of both the Cu and Zr diffusion coefficients D, and the alpha structural relaxation time τ{sub α} can be described to a good approximation by changes in the average string length, L. In particular, we confirm that the strings are a concrete realization of the abstract “cooperatively rearranging regions” of AG. We also find coexisting clusters of relatively “immobile” atoms that exhibit predominantly icosahedral local packing rather than the low symmetry packing of “mobile” atoms. These two distinct types of dynamic heterogeneity are then associated with different fluid structural states. Glass-forming liquids are thus analogous to polycrystalline materials where the icosahedrally packed regions correspond to crystal grains, and the strings reside in the relatively disordered grain boundary-like regions exterior to these locally well-ordered regions. A dynamic equilibrium between localized (“immobile”) and wandering (“mobile”) particles exists in the liquid so that the dynamic heterogeneity can be considered to be type of self-assembly process. We also characterize changes in the local atomic free volume in the course of string-like atomic motion to better understand the initiation and propagation of these fluid excitations.

  12. Stochastic response of rigid foundations

    International Nuclear Information System (INIS)

    Pais, A.L.; Kausel, E.

    1986-01-01

    While the study of Kinematic Interaction effects calls, in general, for advanced analytical and numerical techniques, an excellent approximation was proposed recently by Iguchi. This approximation was used by the authors to analyze embedded foundations subjected to spatially random SH-wave fields, i.e., motions that exhibit some degree of incoherence. The wave fields considered ranged from perfectly coherent motions (resulting from seismic waves arriving from a single direction) to chaotic motions resulting from waves arriving simultaneously from all directions. Additional parameters considered were the shape of the foundation (cylindrical, rectangular) and the degree of embedment. It was found that kinematic interaction usually reduces the severity of the motions transmitted to the structure, and that incoherent motions do not exhibit the frequency selectivity (i.e., narrow valleys in the foundation response spectra) that coherent motions do

  13. Incoherent quasielastic neutron scattering from plastic crystals

    International Nuclear Information System (INIS)

    Bee, M.; Amoureux, J.P.

    1980-01-01

    The aim of this paper is to present some applications of a method indicated by Sears in order to correct for multiple scattering. The calculations were performed in the particular case of slow neutron incoherent quasielastic scattering from organic plastic crystals. First, an exact calculation (up to second scattering) is compared with the results of a Monte Carlo simulation technique. Then, an approximation is developed on the basis of a rotational jump model which allows a further analytical treatment. The multiple scattering is expressed in terms of generalized structure factors (which can be regarded as self convolutions of first order structure factors taking into account the instrumental geometry) and lorentzian functions the widths of which are linear combinations of the jump rates. Three examples are given. Two of them correspond to powder samples while in the third we are concerned with the case of a single crystalline slab. In every case, this approximation is shown to be a good approach to the multiple scattering evaluation, its main advantage being the possibility of applying it without any preliminary knowledge of the correlation times for rotational jumps. (author)

  14. In-utero three dimension high resolution fetal brain diffusion tensor imaging.

    Science.gov (United States)

    Jiang, Shuzhou; Xue, Hui; Counsell, Serena; Anjari, Mustafa; Allsop, Joanna; Rutherford, Mary; Rueckert, Daniel; Hajnal, Joseph V

    2007-01-01

    We present a methodology to achieve 3D high resolution in-utero fetal brain DTI that shows excellent ADC as well as promising FA maps. After continuous DTI scanning to acquire a repeated series of parallel slices with 15 diffusion directions, image registration is used to realign the images to correct for fetal motion. Once aligned, the diffusion images are treated as irregularly sampled data where each voxel is associated with an appropriately rotated diffusion direction, and used to estimate the diffusion tensor on a regular grid. The method has been tested successful on eight fetuses and has been validated on adults imaged at 1.5T.

  15. Incoherent scattering of gamma rays by K-shell electrons. [Differential cross sections, 145 to 662 KeV

    Energy Technology Data Exchange (ETDEWEB)

    Spitale, G.C.; Bloom, S.D.

    1976-05-12

    Differential cross sections for incoherent scattering by K-shell electrons were measured, using coincidence techniques, for incident photons having energies of 662 keV, 320 keV, and 145 keV. The spectral distributions of the scattered photons emerging at scattering angles from 20/sup 0/ to about 140/sup 0/ are reported. Target materials were iron, tin, holmium, and gold at 320 keV; tin and gold at 662 keV; and iron and tin at 145 keV. A typical energy spectrum consists of a scattered peak that is much narrower than would be expected from the bound state electron motion. The peak also, typically, reaches a broad maximum width for scattering angles between 45/sup 0/ and 60/sup 0/. Rather than monotonically increasing with atomic number the peak width reaches a broad maximum, generally, between Z = 50 and Z = 67, and then decreases with increasing atomic number. No Compton defect appears in any of the peaks to within +- 20 keV. A discussion of the expected magnitude of the Compton defect is included. The peak is superimposed on a continuum that diverges at the low end of the scattered photon spectrum for the following cases: gold, holmium, and tin targets for 320-keV incident photons; gold and possibly tin targets for 662-keV photons incident. This infrared divergence is expected on theoretical grounds and has been predicted. It is very nearly isotropic.

  16. Homogenization of a thermo-diffusion system with Smoluchowski interactions

    NARCIS (Netherlands)

    Krehel, O.; Aiki, T.; Muntean, A.

    2014-01-01

    We study the solvability and homogenization of a thermal-diffusion reaction problem posed in a periodically perforated domain. The system describes the motion of populations of hot colloidal particles interacting together via Smoluchowski production terms. The upscaled system, obtained via two-scale

  17. Increased brain water self-diffusion in patients with idiopathic intracranial hypertension

    DEFF Research Database (Denmark)

    Gideon, P; Sørensen, P S; Thomsen, C

    1995-01-01

    PURPOSE: To investigate changes in brain water diffusion in patients with idiopathic intracranial hypertension. METHODS: A motion-compensated MR pulse sequence was used to create diffusion maps of the apparent diffusion coefficient (ADC) in 12 patients fulfilling conventional diagnostic criteria...... for idiopathic intracranial hypertension and in 12 healthy volunteers. RESULTS: A significantly larger ADC was found within subcortical white matter in the patient group (mean, 1.16 x 10(-9) m2/s) than in the control group (mean, 0.75 x 10(-9) m2/s), whereas no significant differences were found within cortical...

  18. Advances in MRI diagnosis of prostate cancer

    International Nuclear Information System (INIS)

    Zhang Longmin; Liu Ailian

    2014-01-01

    Prostate cancer is the second most common cancer in the world, and the incidence of prostate cancer in China shows an upward trend. MRI has high soft tissue resolution and multi-dimensional imaging advantages, and it can better show the anatomy of the prostate and adjacent tissue structures. With the development of MR technique, it plays a more and more important role in prostate cancer diagnosis. This review starts from the imaging performance of routine MRI sequence of prostate cancer, and a variety of functional MRI applications in the diagnosis and differential diagnosis of prostate cancer are described in detail, such as MR perfusion-weighted imaging, MR spectroscopy, MR diffusion-weighted imaging, MR diffusion tensor imaging, intravoxel incoherent motion diffusion-weighted imaging, MR susceptibility-weighted imaging. Meanwhile this review introduces that functional MRI has more advantages and can provide more image information than routine MRI sequence. According to a series of semi-quantitative and quantitative data, functional MRI can further provide the blood perfusion of prostate cancer, water molecule diffusion and microcirculation state, metabolism and biochemical composition change information. (authors)

  19. Rotation sequence to report humerothoracic kinematics during 3D motion involving large horizontal component: application to the tennis forehand drive.

    Science.gov (United States)

    Creveaux, Thomas; Sevrez, Violaine; Dumas, Raphaël; Chèze, Laurence; Rogowski, Isabelle

    2018-03-01

    The aim of this study was to examine the respective aptitudes of three rotation sequences (Y t X f 'Y h '', Z t X f 'Y h '', and X t Z f 'Y h '') to effectively describe the orientation of the humerus relative to the thorax during a movement involving a large horizontal abduction/adduction component: the tennis forehand drive. An optoelectronic system was used to record the movements of eight elite male players, each performing ten forehand drives. The occurrences of gimbal lock, phase angle discontinuity and incoherency in the time course of the three angles defining humerothoracic rotation were examined for each rotation sequence. Our results demonstrated that no single sequence effectively describes humerothoracic motion without discontinuities throughout the forehand motion. The humerothoracic joint angles can nevertheless be described without singularities when considering the backswing/forward-swing and the follow-through phases separately. Our findings stress that the sequence choice may have implications for the report and interpretation of 3D joint kinematics during large shoulder range of motion. Consequently, the use of Euler/Cardan angles to represent 3D orientation of the humerothoracic joint in sport tasks requires the evaluation of the rotation sequence regarding singularity occurrence before analysing the kinematic data, especially when the task involves a large shoulder range of motion in the horizontal plane.

  20. Simulating intrafraction prostate motion with a random walk model.

    Science.gov (United States)

    Pommer, Tobias; Oh, Jung Hun; Munck Af Rosenschöld, Per; Deasy, Joseph O

    2017-01-01

    Prostate motion during radiation therapy (ie, intrafraction motion) can cause unwanted loss of radiation dose to the prostate and increased dose to the surrounding organs at risk. A compact but general statistical description of this motion could be useful for simulation of radiation therapy delivery or margin calculations. We investigated whether prostate motion could be modeled with a random walk model. Prostate motion recorded during 548 radiation therapy fractions in 17 patients was analyzed and used for input in a random walk prostate motion model. The recorded motion was categorized on the basis of whether any transient excursions (ie, rapid prostate motion in the anterior and superior direction followed by a return) occurred in the trace and transient motion. This was separately modeled as a large step in the anterior/superior direction followed by a returning large step. Random walk simulations were conducted with and without added artificial transient motion using either motion data from all observed traces or only traces without transient excursions as model input, respectively. A general estimate of motion was derived with reasonable agreement between simulated and observed traces, especially during the first 5 minutes of the excursion-free simulations. Simulated and observed diffusion coefficients agreed within 0.03, 0.2 and 0.3 mm 2 /min in the left/right, superior/inferior, and anterior/posterior directions, respectively. A rapid increase in variance at the start of observed traces was difficult to reproduce and seemed to represent the patient's need to adjust before treatment. This could be estimated somewhat using artificial transient motion. Random walk modeling is feasible and recreated the characteristics of the observed prostate motion. Introducing artificial transient motion did not improve the overall agreement, although the first 30 seconds of the traces were better reproduced. The model provides a simple estimate of prostate motion during

  1. Plasma density fluctuation measurements from coherent and incoherent microwave reflection

    International Nuclear Information System (INIS)

    Conway, G.D.; Schott, L.; Hirose, A.

    1996-01-01

    Using the spatial coherency present in a reflected microwave signal (Conway et al 1994 Rev. Sci. Instrum. 65 2920) it is possible to measure a coherent, Γ c , and an incoherent, Γ i , reflection coefficient (proportional to the radar cross section) from a turbulent plasma cutoff layer. Results acquired with a 17 GHz reflectometer from a STOR-M tokamak edge region (r/a ∼ 0.8) give significant Γ c and Γ i , which suggests two-dimensional structure in the reflection layer. Using a 'distorted-mirror' model for the plasma fluctuations, estimates of an effective radial width, σ, and poloidal correlation length, L p , can be derived from the reflection coefficients. STOR-M results typically give a σ of a few millimetres and an L p of a couple of centimetres. (author)

  2. Anisotropic Rotational Diffusion Studied by Nuclear Spin Relaxation and Molecular Dynamics Simulation: An Undergraduate Physical Chemistry Laboratory

    Science.gov (United States)

    Fuson, Michael M.

    2017-01-01

    Laboratories studying the anisotropic rotational diffusion of bromobenzene using nuclear spin relaxation and molecular dynamics simulations are described. For many undergraduates, visualizing molecular motion is challenging. Undergraduates rarely encounter laboratories that directly assess molecular motion, and so the concept remains an…

  3. Diffusion of hydrous species in model basaltic melt

    Science.gov (United States)

    Zhang, Li; Guo, Xuan; Wang, Qinxia; Ding, Jiale; Ni, Huaiwei

    2017-10-01

    Water diffusion in Fe-free model basaltic melt with up to 2 wt% H2O was investigated at 1658-1846 K and 1 GPa in piston-cylinder apparatus using both hydration and diffusion couple techniques. Diffusion profiles measured by FTIR are consistent with a model in which both molecular H2O (H2Om) and hydroxyl (OH) contribute to water diffusion. OH diffusivity is roughly 13% of H2Om diffusivity, showing little dependence on temperature or water concentration. Water diffusion is dominated by the motion of OH until total H2O (H2Ot) concentration reaches 1 wt%. The dependence of apparent H2Ot diffusivity on H2Ot concentration appears to be overestimated by a previous study on MORB melt, but H2Ot diffusivity at 1 wt% H2Ot in basaltic melt is still greater than those in rhyolitic to andesitic melts. The appreciable contribution of OH to water diffusion in basaltic melt can be explained by enhanced mobility of OH, probably associated with the development of free hydroxyl bonded with network-modifying cations, as well as higher OH concentration. Calculation based on the Nernst-Einstein equation demonstrates that OH may serve as an effective charge carrier in hydrous basaltic melt, which could partly account for the previously observed strong influence of water on electrical conductivity of basaltic melt.

  4. Eikonal theory of the transition to phase incoherence

    International Nuclear Information System (INIS)

    Kaufman, A.N.; Rosengaus, E.

    1983-02-01

    When a monochromatic electromagnetic wave propagates through a nonuniform plasma (of n dimensions), its refraction may be studied in terms of its family of rays in 2n-dimensional phase space (k,x). These rays generate and n-dimensional surface. Imbedded in the phase space. The wave amplitude and phase are defined on this surface. As the rays twist and separate (from the dynamics of the ray Hamiltonian), the surface develops pleats and becomes convoluted. Projection of the surface onto x-space then yields a multivalued k(x). The local spectral density, as a function of k for given x, exhibits sharp spikes at these k(x), in the ray-optics limit. The next correction yields a finite width to these spikes. As the surface becomes more and more pppleated, these spectral peaks overlap; the spectrum changes qualitatively from a line spectrum to a continuous spectrum. Correspondingly, the two-point spatial correlation function loses its long-range order, as the correlation volume contracts. This phenomenon is what we call the transition to incoherence

  5. Time scale of diffusion in molecular and cellular biology

    International Nuclear Information System (INIS)

    Holcman, D; Schuss, Z

    2014-01-01

    Diffusion is the driver of critical biological processes in cellular and molecular biology. The diverse temporal scales of cellular function are determined by vastly diverse spatial scales in most biophysical processes. The latter are due, among others, to small binding sites inside or on the cell membrane or to narrow passages between large cellular compartments. The great disparity in scales is at the root of the difficulty in quantifying cell function from molecular dynamics and from simulations. The coarse-grained time scale of cellular function is determined from molecular diffusion by the mean first passage time of molecular Brownian motion to a small targets or through narrow passages. The narrow escape theory (NET) concerns this issue. The NET is ubiquitous in molecular and cellular biology and is manifested, among others, in chemical reactions, in the calculation of the effective diffusion coefficient of receptors diffusing on a neuronal cell membrane strewn with obstacles, in the quantification of the early steps of viral trafficking, in the regulation of diffusion between the mother and daughter cells during cell division, and many other cases. Brownian trajectories can represent the motion of a molecule, a protein, an ion in solution, a receptor in a cell or on its membrane, and many other biochemical processes. The small target can represent a binding site or an ionic channel, a hidden active site embedded in a complex protein structure, a receptor for a neurotransmitter on the membrane of a neuron, and so on. The mean time to attach to a receptor or activator determines diffusion fluxes that are key regulators of cell function. This review describes physical models of various subcellular microdomains, in which the NET coarse-grains the molecular scale to a higher cellular-level, thus clarifying the role of cell geometry in determining subcellular function. (topical review)

  6. Time scale of diffusion in molecular and cellular biology

    Science.gov (United States)

    Holcman, D.; Schuss, Z.

    2014-05-01

    Diffusion is the driver of critical biological processes in cellular and molecular biology. The diverse temporal scales of cellular function are determined by vastly diverse spatial scales in most biophysical processes. The latter are due, among others, to small binding sites inside or on the cell membrane or to narrow passages between large cellular compartments. The great disparity in scales is at the root of the difficulty in quantifying cell function from molecular dynamics and from simulations. The coarse-grained time scale of cellular function is determined from molecular diffusion by the mean first passage time of molecular Brownian motion to a small targets or through narrow passages. The narrow escape theory (NET) concerns this issue. The NET is ubiquitous in molecular and cellular biology and is manifested, among others, in chemical reactions, in the calculation of the effective diffusion coefficient of receptors diffusing on a neuronal cell membrane strewn with obstacles, in the quantification of the early steps of viral trafficking, in the regulation of diffusion between the mother and daughter cells during cell division, and many other cases. Brownian trajectories can represent the motion of a molecule, a protein, an ion in solution, a receptor in a cell or on its membrane, and many other biochemical processes. The small target can represent a binding site or an ionic channel, a hidden active site embedded in a complex protein structure, a receptor for a neurotransmitter on the membrane of a neuron, and so on. The mean time to attach to a receptor or activator determines diffusion fluxes that are key regulators of cell function. This review describes physical models of various subcellular microdomains, in which the NET coarse-grains the molecular scale to a higher cellular-level, thus clarifying the role of cell geometry in determining subcellular function.

  7. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  8. Atomic motion in a high-intensity standing wave laser field

    International Nuclear Information System (INIS)

    Saez Ramdohr, L.F.

    1987-01-01

    This work discusses the effect of a high-intensity standing wave laser field on the motion of neutral atoms moving with a relatively high velocity. The analysis involves a detailed calculation of the force acting on the atoms and the calculation of the diffusion tensor associated with the fluctuations of the quantum force operator. The high-intensity laser field limit corresponds to a Rabi frequency much greater than the natural rate of the atom. The general results are valid for any atomic velocity. Results are then specialized to the case of slow and fast atoms where the Doppler shift of the laser frequency due to the atomic motion is either smaller or larger than the natural decay rate of the atom. The results obtained for the force and diffusion tensor are applied to a particular ideal experiment that studies the evolution of a fast atomic beam crossing a high-intensity laser beam. The theories developed previously, for a similar laser configuration, discuss only the low atomic velocities case and not the more realistic case of fast atoms. Here, an approximate solution of the equation for the distribution is obtained. Starting from the approximate distribution function, the deflection angle and dispersion angle for the atomic beam with respect to the free motion are calculated

  9. Homogeneity based segmentation and enhancement of Diffusion Tensor Images : a white matter processing framework

    OpenAIRE

    Rodrigues, P.R.

    2011-01-01

    In diffusion magnetic resonance imaging (DMRI) the Brownian motion of the water molecules, within biological tissue, is measured through a series of images. In diffusion tensor imaging (DTI) this diffusion is represented using tensors. DTI describes, in a non-invasive way, the local anisotropy pattern enabling the reconstruction of the nervous fibers - dubbed tractography. DMRI constitutes a powerful tool to analyse the structure of the white matter within a voxel, but also to investigate the...

  10. Accounting for Fault Roughness in Pseudo-Dynamic Ground-Motion Simulations

    KAUST Repository

    Mai, Paul Martin

    2017-04-03

    Geological faults comprise large-scale segmentation and small-scale roughness. These multi-scale geometrical complexities determine the dynamics of the earthquake rupture process, and therefore affect the radiated seismic wavefield. In this study, we examine how different parameterizations of fault roughness lead to variability in the rupture evolution and the resulting near-fault ground motions. Rupture incoherence naturally induced by fault roughness generates high-frequency radiation that follows an ω−2 decay in displacement amplitude spectra. Because dynamic rupture simulations are computationally expensive, we test several kinematic source approximations designed to emulate the observed dynamic behavior. When simplifying the rough-fault geometry, we find that perturbations in local moment tensor orientation are important, while perturbations in local source location are not. Thus, a planar fault can be assumed if the local strike, dip, and rake are maintained. We observe that dynamic rake angle variations are anti-correlated with the local dip angles. Testing two parameterizations of dynamically consistent Yoffe-type source-time function, we show that the seismic wavefield of the approximated kinematic ruptures well reproduces the radiated seismic waves of the complete dynamic source process. This finding opens a new avenue for an improved pseudo-dynamic source characterization that captures the effects of fault roughness on earthquake rupture evolution. By including also the correlations between kinematic source parameters, we outline a new pseudo-dynamic rupture modeling approach for broadband ground-motion simulation.

  11. Accounting for Fault Roughness in Pseudo-Dynamic Ground-Motion Simulations

    Science.gov (United States)

    Mai, P. Martin; Galis, Martin; Thingbaijam, Kiran K. S.; Vyas, Jagdish C.; Dunham, Eric M.

    2017-09-01

    Geological faults comprise large-scale segmentation and small-scale roughness. These multi-scale geometrical complexities determine the dynamics of the earthquake rupture process, and therefore affect the radiated seismic wavefield. In this study, we examine how different parameterizations of fault roughness lead to variability in the rupture evolution and the resulting near-fault ground motions. Rupture incoherence naturally induced by fault roughness generates high-frequency radiation that follows an ω-2 decay in displacement amplitude spectra. Because dynamic rupture simulations are computationally expensive, we test several kinematic source approximations designed to emulate the observed dynamic behavior. When simplifying the rough-fault geometry, we find that perturbations in local moment tensor orientation are important, while perturbations in local source location are not. Thus, a planar fault can be assumed if the local strike, dip, and rake are maintained. We observe that dynamic rake angle variations are anti-correlated with the local dip angles. Testing two parameterizations of dynamically consistent Yoffe-type source-time function, we show that the seismic wavefield of the approximated kinematic ruptures well reproduces the radiated seismic waves of the complete dynamic source process. This finding opens a new avenue for an improved pseudo-dynamic source characterization that captures the effects of fault roughness on earthquake rupture evolution. By including also the correlations between kinematic source parameters, we outline a new pseudo-dynamic rupture modeling approach for broadband ground-motion simulation.

  12. Accounting for Fault Roughness in Pseudo-Dynamic Ground-Motion Simulations

    KAUST Repository

    Mai, Paul Martin; Galis, Martin; Thingbaijam, Kiran Kumar; Vyas, Jagdish Chandra; Dunham, Eric M.

    2017-01-01

    Geological faults comprise large-scale segmentation and small-scale roughness. These multi-scale geometrical complexities determine the dynamics of the earthquake rupture process, and therefore affect the radiated seismic wavefield. In this study, we examine how different parameterizations of fault roughness lead to variability in the rupture evolution and the resulting near-fault ground motions. Rupture incoherence naturally induced by fault roughness generates high-frequency radiation that follows an ω−2 decay in displacement amplitude spectra. Because dynamic rupture simulations are computationally expensive, we test several kinematic source approximations designed to emulate the observed dynamic behavior. When simplifying the rough-fault geometry, we find that perturbations in local moment tensor orientation are important, while perturbations in local source location are not. Thus, a planar fault can be assumed if the local strike, dip, and rake are maintained. We observe that dynamic rake angle variations are anti-correlated with the local dip angles. Testing two parameterizations of dynamically consistent Yoffe-type source-time function, we show that the seismic wavefield of the approximated kinematic ruptures well reproduces the radiated seismic waves of the complete dynamic source process. This finding opens a new avenue for an improved pseudo-dynamic source characterization that captures the effects of fault roughness on earthquake rupture evolution. By including also the correlations between kinematic source parameters, we outline a new pseudo-dynamic rupture modeling approach for broadband ground-motion simulation.

  13. Can molecular diffusion explain Space Shuttle plume spreading?

    Science.gov (United States)

    Meier, R. R.; Plane, John M. C.; Stevens, Michael H.; Paxton, L. J.; Christensen, A. B.; Crowley, G.

    2010-04-01

    The satellite-borne Global Ultraviolet Imager (GUVI) has produced more than 20 images of NASA Space Shuttle main engine plumes in the lower thermosphere. These reveal atomic hydrogen and, by inference, water vapor transport over hemispherical-scale distances with speeds much faster than expected from models of thermospheric wind motions. Furthermore, the hydrogen plumes expand rapidly. We find rates that exceed the horizontal diffusion speed at nominal plume altitudes of 104-112 km. Kelley et al. (2009) have proposed a 2-D turbulence mechanism to explain the observed spreading rates (and rapid advection) of the plumes. But upon further investigation, we conclude that H atom diffusion can indeed account for the observed expansion rates by recognizing that vertical diffusion quickly conveys atoms to higher altitudes where horizontal diffusion is much more rapid. We also find evidence for H atom production directly during the Shuttle's main engine burn.

  14. Contact line motion in confined liquid–gas systems: Slip versus phase transition

    KAUST Repository

    Xu, Xinpeng; Qian, Tiezheng

    2010-01-01

    -slip boundary condition, as the latter leads to a nonintegrable stress singularity. Recently, various diffuse-interface models have been proposed to explain the contact line motion using mechanisms missing from the sharp-interface treatments in fluid mechanics

  15. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  16. Measuring Advection and Diffusion of Colloids in Shear Flow

    NARCIS (Netherlands)

    Duits, Michael H.G.; Ghosh, Somnath; Mugele, Friedrich Gunther

    2015-01-01

    An analysis of the dynamics of colloids in shear flow can be challenging because of the superposition of diffusion and advection. We present a method that separates the two motions, starting from the time-dependent particle coordinates. The restriction of the tracking to flow lanes and the

  17. Theory of activated penetrant diffusion in viscous fluids and colloidal suspensions

    International Nuclear Information System (INIS)

    Zhang, Rui; Schweizer, Kenneth S.

    2015-01-01

    We heuristically formulate a microscopic, force level, self-consistent nonlinear Langevin equation theory for activated barrier hopping and non-hydrodynamic diffusion of a hard sphere penetrant in very dense hard sphere fluid matrices. Penetrant dynamics is controlled by a rich competition between force relaxation due to penetrant self-motion and collective matrix structural (alpha) relaxation. In the absence of penetrant-matrix attraction, three activated dynamical regimes are predicted as a function of penetrant-matrix size ratio which are physically distinguished by penetrant jump distance and the nature of matrix motion required to facilitate its hopping. The penetrant diffusion constant decreases the fastest with size ratio for relatively small penetrants where the matrix effectively acts as a vibrating amorphous solid. Increasing penetrant-matrix attraction strength reduces penetrant diffusivity due to physical bonding. For size ratios approaching unity, a distinct dynamical regime emerges associated with strong slaving of penetrant hopping to matrix structural relaxation. A crossover regime at intermediate penetrant-matrix size ratio connects the two limiting behaviors for hard penetrants, but essentially disappears if there are strong attractions with the matrix. Activated penetrant diffusivity decreases strongly with matrix volume fraction in a manner that intensifies as the size ratio increases. We propose and implement a quasi-universal approach for activated diffusion of a rigid atomic/molecular penetrant in a supercooled liquid based on a mapping between the hard sphere system and thermal liquids. Calculations for specific systems agree reasonably well with experiments over a wide range of temperature, covering more than 10 orders of magnitude of variation of the penetrant diffusion constant

  18. Effects of temperature gradient induced nanoparticle motion on conduction and convection of fluid

    International Nuclear Information System (INIS)

    Zhou Leping; Peterson, George P.; Yoda, Minani; Wang Buxuan

    2012-01-01

    The role of temperature gradient induced nanoparticle motion on conduction and convection was investigated. Possible mechanisms for variations resulting from variations in the thermophysical properties are theoretically and experimentally discussed. The effect of the nanoparticle motion on conduction is demonstrated through thermal conductivity measurement of deionized water with suspended CuO nanoparticles (50 nm in diameter) and correlated with the contributions of Brownian diffusion, thermophoresis, etc. The tendencies observed is that the magnitude of and the variation in the thermal conductivity increases with increasing volume fraction for a given temperature, which is due primarily to the Brownian diffusion of the nanoparticles. Using dimensional analysis, the thermal conductivity is correlated and both the interfacial thermal resistance and near-field radiation are found to be essentially negligible. A modification term that incorporates the contributions of Brownian motion and thermophoresis is proposed. The effect of nanoscale convection is illustrated through an experimental investigation that utilized fluorescent polystyrene nanoparticle tracers (200 nm in diameter) and multilayer nanoparticle image velocimetry. The results indicate that both the magnitude and the deviation of the fluid motion increased with increasing heat flux in the near-wall region. Meanwhile, the fluid motion tended to decrease with the off-wall distance for a given heating power. A corresponding numerical study of convection of pure deionized water shows that the velocity along the off-wall direction is several orders of magnitude lower than that of deionized water, which indicates that Brownian motion in the near-wall region is crucial for fluid with suspended nanoparticles in convection.

  19. Ionic diffusion in quartz studied by transport measurements, SIMS and atomistic simulations

    International Nuclear Information System (INIS)

    Sartbaeva, Asel; Wells, Stephen A; Redfern, Simon A T; Hinton, Richard W; Reed, Stephen J B

    2005-01-01

    Ionic diffusion in the quartz-β-eucryptite system is studied by DC transport measurements, SIMS and atomistic simulations. Transport data show a large transient increase in ionic current at the α-β phase transition of quartz (the Hedvall effect). The SIMS data indicate two diffusion processes, one involving rapid Li + motion and the other involving penetration of Al and Li atoms into quartz at the phase transition. Atomistic simulations explain why the fine microstructure of twin domain walls in quartz near the transition does not hinder Li + diffusion

  20. Diffusion in cladding materials

    International Nuclear Information System (INIS)

    Anand, M.S.; Pande, B.M.; Agarwala, R.P.

    1992-01-01

    Aluminium has been used as a cladding material in most research reactors because its low neutron absorption cross section and ease of fabrication. However, it is not suitable for cladding in power reactors and as such zircaloy-2 is normally used as a clad because it can withstand high temperature. It has low neutron absorption cross section, good oxidation, corrosion, creep properties and possesses good mechanical strength. With the passage of time, further development in this branch of science took place and designers started looking for better neutron economy and less hydrogen pickup in PHW reactors. The motion of fission products in the cladding material could pose a problem after long operation. In order to understand their behaviour under reactor environment, it is essential to study first the diffusion under normal conditions. These studies will throw light on the interaction of defects with impurities which would in turn help in understanding the mechanism of diffusion. In this article, it is intended to discuss the diffusion behaviour of impurities in cladding materials.(i.e. aluminium, zircaloy-2, zirconium-niobium alloy etc.). (author). 94 refs., 4 figs., 3 tabs

  1. Giant transversal particle diffusion in a longitudinal magnetic ratchet.

    Science.gov (United States)

    Tierno, Pietro; Reimann, Peter; Johansen, Tom H; Sagués, Francesc

    2010-12-03

    We study the transversal motion of paramagnetic particles on a uniaxial garnet film, exhibiting a longitudinal ratchet effect in the presence of an oscillating magnetic field. Without the field, the thermal diffusion coefficient obtained by video microscopy is D(0) ≈ 3 × 10(-4)  μm2/s. With the field, the transversal diffusion exhibits a giant enhancement by almost four decades and a pronounced maximum as a function of the driving frequency. We explain the experimental findings with a theoretical interpretation in terms of random disorder effects within the magnetic film.

  2. Processing oscillatory signals by incoherent feedforward loops

    Science.gov (United States)

    Zhang, Carolyn; Wu, Feilun; Tsoi, Ryan; Shats, Igor; You, Lingchong

    From the timing of amoeba development to the maintenance of stem cell pluripotency,many biological signaling pathways exhibit the ability to differentiate between pulsatile and sustained signals in the regulation of downstream gene expression.While networks underlying this signal decoding are diverse,many are built around a common motif, the incoherent feedforward loop (IFFL),where an input simultaneously activates an output and an inhibitor of the output.With appropriate parameters,this motif can generate temporal adaptation,where the system is desensitized to a sustained input.This property serves as the foundation for distinguishing signals with varying temporal profiles.Here,we use quantitative modeling to examine another property of IFFLs,the ability to process oscillatory signals.Our results indicate that the system's ability to translate pulsatile dynamics is limited by two constraints.The kinetics of IFFL components dictate the input range for which the network can decode pulsatile dynamics.In addition,a match between the network parameters and signal characteristics is required for optimal ``counting''.We elucidate one potential mechanism by which information processing occurs in natural networks with implications in the design of synthetic gene circuits for this purpose. This work was partially supported by the National Science Foundation Graduate Research Fellowship (CZ).

  3. Vibrations and reorientations of H2O molecules in [Sr(H2O)6]Cl2 studied by Raman light scattering, incoherent inelastic neutron scattering and proton magnetic resonance.

    Science.gov (United States)

    Hetmańczyk, Joanna; Hetmańczyk, Lukasz; Migdał-Mikuli, Anna; Mikuli, Edward; Florek-Wojciechowska, Małgorzata; Harańczyk, Hubert

    2014-04-24

    Vibrational-reorientational dynamics of H2O ligands in the high- and low-temperature phases of [Sr(H2O)6]Cl2 was investigated by Raman Spectroscopy (RS), proton magnetic resonance ((1)H NMR), quasielastic and inelastic incoherent Neutron Scattering (QENS and IINS) methods. Neutron powder diffraction (NPD) measurements, performed simultaneously with QENS, did not indicated a change of the crystal structure at the phase transition (detected earlier by differential scanning calorimetry (DSC) at TC(h)=252.9 K (on heating) and at TC(c)=226.5K (on cooling)). Temperature dependence of the full-width at half-maximum (FWHM) of νs(OH) band at ca. 3248 cm(-1) in the RS spectra indicated small discontinuity in the vicinity of phase transition temperature, what suggests that the observed phase transition may be associated with a change of the H2O reorientational dynamics. However, an activation energy value (Ea) for the reorientational motions of H2O ligands in both phases is nearly the same and equals to ca. 8 kJ mol(-1). The QENS peaks, registered for low temperature phase do not show any broadening. However, in the high temperature phase a small QENS broadening is clearly visible, what implies that the reorientational dynamics of H2O ligands undergoes a change at the phase transition. (1)H NMR line is a superposition of two powder Pake doublets, differentiated by a dipolar broadening, suggesting that there are two types of the water molecules in the crystal lattice of [Sr(H2O)6]Cl2 which are structurally not equivalent average distances between the interacting protons are: 1.39 and 1.18 Å. However, their reorientational dynamics is very similar (τc=3.3⋅10(-10) s). Activation energies for the reorientational motion of these both kinds of H2O ligands have nearly the same values in an experimental error limit: and equal to ca. 40 kJ mole(-1). The phase transition is not seen in the (1)H NMR spectra temperature dependencies. Infrared (IR), Raman (RS) and inelastic

  4. Theoretical predictions of diffusion from Brownian motion in superstrong polymers

    International Nuclear Information System (INIS)

    Dowell, F.

    1991-01-01

    This paper presents a summary of unique highly nonlinear static and dynamic theories for chain molecules (actually, for almost any kind of organic molecule), including the first superstrong polymers. These theories have been used to predict and explain (1) the physical self-assembly (self-ordering) of specific kinds of molecules into liquid crystalline (LC) phases (i.e., partially ordered phases) and (2) the diffusion of these molecules in various LC phases and the isotropic (I) liquid phase

  5. Transverse single-file diffusion and enhanced longitudinal diffusion near a subcritical bifurcation

    Science.gov (United States)

    Dessup, Tommy; Coste, Christophe; Saint Jean, Michel

    2018-05-01

    A quasi-one-dimensional system of repelling particles undergoes a configurational phase transition when the transverse confining potential decreases. Below a threshold, it becomes energetically favorable for the system to adopt one of two staggered raw patterns, symmetric with respect to the system axis. This transition is a subcritical pitchfork bifurcation for short range interactions. As a consequence, the homogeneous zigzag pattern is unstable in a finite zigzag amplitude range [hC 1,hC 2] . We exhibit strong qualitative effects of the subcriticality on the thermal motions of the particles. When the zigzag amplitude is close enough to the limits hC 1 and hC 2, a transverse vibrational soft mode occurs which induces a strongly subdiffusive behavior of the transverse fluctuations, similar to single-file diffusion. On the contrary, the longitudinal fluctuations are enhanced, with a diffusion coefficient which is more than doubled. Conversely, a simple measurement of the thermal fluctuations allows a precise determination of the bifurcation thresholds.

  6. A model of ATL ground motion for storage rings

    International Nuclear Information System (INIS)

    Wolski, Andrzej; Walker, Nicholas J.

    2003-01-01

    Low emittance electron storage rings, such as those used in third generation light sources or linear collider damping rings, rely for their performance on highly stable alignment of the lattice components. Even if all vibration and environmental noise sources could be suppressed, diffusive ground motion will lead to orbit drift and emittance growth. Understanding such motion is important for predicting the performance of a planned accelerator and designing a correction system. A description (known as the ATL model) of ground motion over relatively long time scales has been developed and has become the standard for studies of the long straight beamlines in linear colliders. Here, we show how the model may be developed to include beamlines of any geometry. We apply the model to the NLC and TESLA damping rings, to compare their relative stability under different conditions

  7. Self-Organization Observed in Numerical Simulations of a Hard-Core Diffuse Z Pinch

    International Nuclear Information System (INIS)

    Makhin, V; Siemon, R E; Bauer, B S; Esaulov, A; Lindemuth, I R; Ryutov, D D; Sheehey, P T; Sotnikov, V I

    2005-04-01

    The evolution of an unstable plasma profile into a stable profile, which we term self-organization, appears to be a robust process. Although it was not termed self organization, the same effect has been noted in past simulations with the same code. The result has been made easier to discern by the introduction of z-averaged profiles. A recent report of PIC simulations in the hard-core z-pinch configuration also shows self-organization. Figures 3 and 4 in Reference 21 show how pressure profiles in a low-β PIC simulation relax from unstable to stable. The non-linear evolution of the interchange motion has been studied under controlled initial conditions that result in exponential growth of a mode with a prescribed axial wavelength. An interesting feature of such growth is an abrupt transition from coherent to incoherent motion, after which the z-averaged pressure, current, and temperature profiles become quasi stationary. According to our understanding of MAGO experiments, the observed plasma behavior is consistent with the expectation of self-organization, but the diagnostics are not sufficiently detailed thus far to make a definite conclusion. The results of this simulations reported in this paper add motivation to planned experiments on an inverse pinch at UNR

  8. Dissipative particle dynamics of diffusion-NMR requires high Schmidt-numbers

    Energy Technology Data Exchange (ETDEWEB)

    Azhar, Mueed; Greiner, Andreas [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Korvink, Jan G., E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Department of Microstructure Technology, Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, Eggenstein-Leopoldshafen (Germany); Kauzlarić, David, E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Freiburg Institute for Advanced Studies, University of Freiburg, Albertstr. 19, 79104 Freiburg (Germany)

    2016-06-28

    We present an efficient mesoscale model to simulate the diffusion measurement with nuclear magnetic resonance (NMR). On the level of mesoscopic thermal motion of fluid particles, we couple the Bloch equations with dissipative particle dynamics (DPD). Thereby we establish a physically consistent scaling relation between the diffusion constant measured for DPD-particles and the diffusion constant of a real fluid. The latter is based on a splitting into a centre-of-mass contribution represented by DPD, and an internal contribution which is not resolved in the DPD-level of description. As a consequence, simulating the centre-of-mass contribution with DPD requires high Schmidt numbers. After a verification for fundamental pulse sequences, we apply the NMR-DPD method to NMR diffusion measurements of anisotropic fluids, and of fluids restricted by walls of microfluidic channels. For the latter, the free diffusion and the localisation regime are considered.

  9. Chaotic dynamics of large-scale double-diffusive convection in a porous medium

    Science.gov (United States)

    Kondo, Shutaro; Gotoda, Hiroshi; Miyano, Takaya; Tokuda, Isao T.

    2018-02-01

    We have studied chaotic dynamics of large-scale double-diffusive convection of a viscoelastic fluid in a porous medium from the viewpoint of dynamical systems theory. A fifth-order nonlinear dynamical system modeling the double-diffusive convection is theoretically obtained by incorporating the Darcy-Brinkman equation into transport equations through a physical dimensionless parameter representing porosity. We clearly show that the chaotic convective motion becomes much more complicated with increasing porosity. The degree of dynamic instability during chaotic convective motion is quantified by two important measures: the network entropy of the degree distribution in the horizontal visibility graph and the Kaplan-Yorke dimension in terms of Lyapunov exponents. We also present an interesting on-off intermittent phenomenon in the probability distribution of time intervals exhibiting nearly complete synchronization.

  10. Spectral Analysis and Computation of Effective Diffusivities for Steady Random Flows

    Science.gov (United States)

    2016-04-28

    even in the motion of sea ice floes influenced by winds and ocean currents. The long time, large scale behavior of such systems is equivalent to an...flow plays a key role in many important processes in the global climate system [55] and Earth’s ecosys- tems [14]. Advection of geophysical fluids...HOMOGENIZATION OF THE ADVECTION-DIFFUSION EQUATION The dispersion of a cloud of passive scalars with density φ diffusing with molecular dif- fusivity ε and

  11. Physical model for the incoherent writing/erasure of cavity solitons in semiconductor optical amplifiers.

    Science.gov (United States)

    Barbay, S; Kuszelewicz, R

    2007-09-17

    We present a physical mechanism that explains the recent observations of incoherent writing and erasure of Cavity Solitons in a semiconductor optical amplifier [S. Barbay et al, Opt. Lett. 31, 1504-1506 (2006)]. This mechanism allows to understand the main observations of the experiment. In particular it perfectly explains why writing and erasure are possible as a result of a local perturbation in the carrier density, and why a delay is observed along with the writing process. Numerical simulations in 1D are performed and show very good qualitative agreement with the experimental observations.

  12. Measurement and Interpretation of Diffuse Scattering in X-Ray Diffraction for Macromolecular Crystallography

    Energy Technology Data Exchange (ETDEWEB)

    Wall, Michael E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-10-16

    X-ray diffraction from macromolecular crystals includes both sharply peaked Bragg reflections and diffuse intensity between the peaks. The information in Bragg scattering reflects the mean electron density in the unit cells of the crystal. The diffuse scattering arises from correlations in the variations of electron density that may occur from one unit cell to another, and therefore contains information about collective motions in proteins.

  13. Slow Diffusive Motions in a Monolayer of Tetracosane Molecules Adsorbed on Graphite

    DEFF Research Database (Denmark)

    Taub, H.; Hansen, Flemming Yssing; Criswell, L.

    2004-01-01

    to a temperature of similar to230 K, we observe the QNS energy width to be dispersionless, consistent with molecular dynamics simulations showing rotational motion of the molecules about their long axis. At 260 K, the QNS energy width begins to increase with wave vector transfer, suggesting onset of nonuniaxial...

  14. Reflected Brownian motions in the KPZ universality class

    CERN Document Server

    Weiss, Thomas; Spohn, Herbert

    2017-01-01

    This book presents a detailed study of a system of interacting Brownian motions in one dimension. The interaction is point-like such that the n-th Brownian motion is reflected from the Brownian motion with label n-1. This model belongs to the Kardar-Parisi-Zhang (KPZ) universality class. In fact, because of the singular interaction, many universal properties can be established with rigor. They depend on the choice of initial conditions. Discussion addresses packed and periodic initial conditions (Chapter 5), stationary initial conditions (Chapter 6), and mixtures thereof (Chapter 7). The suitably scaled spatial process will be proven to converge to an Airy process in the long time limit. A chapter on determinantal random fields and another one on Airy processes are added to have the notes self-contained. These notes serve as an introduction to the KPZ universality class, illustrating the main concepts by means of a single model only. The notes will be of interest to readers from interacting diffusion processe...

  15. Studies of molecular dynamics with neutron scattering techniques. Part of a coordinated programme on neutron scattering techniques

    International Nuclear Information System (INIS)

    Vinhas, L.A.

    1980-05-01

    Molecular dynamics was studied in samples of tert-butanol, cyclohexanol and methanol, using neutron inelastic and quasi-elastic techniques. The frequency spectra of cyclohexanol in crystalline phase were interpreted by assigning individual energy peaks to hindered rotation of molecules, lattice vibration, hydrogen bond stretching and ring bending modes. Neutron quasi-elastic scattering measurements permitted the testing of models for molecular diffusion as a function of temperature. The interpretation of neutron incoherent inelastic scattering on methanol indicated the different modes of molecular dynamics in this material; individual inelastic peaks in the spectra could be assigned to vibrations of crystalline lattice, stretching of hydrogen bond and vibrational and torsional modes of CH 3 OH molecule. The results of the experimental work on tertbutanol indicate two distinct modes of motion in this material: individual molecular librations are superposed to a cooperative rotation diffusion which occurs both in solid and in liquid state

  16. In vivo Anomalous Diffusion and Weak Ergodicity Breaking of Lipid Granules

    DEFF Research Database (Denmark)

    Jeon, J.-H.; Tejedor, V.; Burov, S.

    2011-01-01

    Combining extensive single particle tracking microscopy data of endogenous lipid granules in living fission yeast cells with analytical results we show evidence for anomalous diffusion and weak ergodicity breaking. Namely we demonstrate that at short times the granules perform subdiffusion...... according to the laws of continuous time random walk theory. The associated violation of ergodicity leads to a characteristic turnover between two scaling regimes of the time averaged mean squared displacement. At longer times the granule motion is consistent with fractional Brownian motion....

  17. Chaotic diffusion across a magnetic island due to a single electrostatic drift wave

    International Nuclear Information System (INIS)

    Misguich, J.H.

    1990-05-01

    It is shown that the guiding center motion around a single chain of magnetic islands in a Tokamak can become chaotic in the presence of a single electrostatic drift wave. This process leads to radial diffusion across the islands without magnetic braiding. The chaotic diffusion appears to be selective in velocity space. Realistic values of the physical parameters are considered to deduce that this process can be effective in usual conditions: with the observed islands, and electrostatic field values corresponding to measured density fluctuations, this diffusion concerns ions with velocities higher than thermal, and almost all of the electron population. The consequences for radial diffusion are discussed

  18. Nonparametric estimates of drift and diffusion profiles via Fokker-Planck algebra.

    Science.gov (United States)

    Lund, Steven P; Hubbard, Joseph B; Halter, Michael

    2014-11-06

    Diffusion processes superimposed upon deterministic motion play a key role in understanding and controlling the transport of matter, energy, momentum, and even information in physics, chemistry, material science, biology, and communications technology. Given functions defining these random and deterministic components, the Fokker-Planck (FP) equation is often used to model these diffusive systems. Many methods exist for estimating the drift and diffusion profiles from one or more identifiable diffusive trajectories; however, when many identical entities diffuse simultaneously, it may not be possible to identify individual trajectories. Here we present a method capable of simultaneously providing nonparametric estimates for both drift and diffusion profiles from evolving density profiles, requiring only the validity of Langevin/FP dynamics. This algebraic FP manipulation provides a flexible and robust framework for estimating stationary drift and diffusion coefficient profiles, is not based on fluctuation theory or solved diffusion equations, and may facilitate predictions for many experimental systems. We illustrate this approach on experimental data obtained from a model lipid bilayer system exhibiting free diffusion and electric field induced drift. The wide range over which this approach provides accurate estimates for drift and diffusion profiles is demonstrated through simulation.

  19. Investigating the Eddy Diffusivity Concept in the Coastal Ocean

    Science.gov (United States)

    Rypina, I.; Kirincich, A.; Lentz, S. J.; Sundermeyer, M. A.

    2016-12-01

    We test the validity, utility, and limitations of the lateral eddy diffusivity concept in a coastal environment through analyzing data from coupled drifter and dye releases within the footprint of a high-resolution (800 m) high-frequency radar south of Martha's Vineyard, Massachusetts. Specifically, we investigate how well a combination of radar-based velocities and drifter-derived diffusivities can reproduce observed dye spreading over an 8-h time interval. A drifter-based estimate of an anisotropic diffusivity tensor is used to parameterize small-scale motions that are unresolved and under-resolved by the radar system. This leads to a significant improvement in the ability of the radar to reproduce the observed dye spreading. Our drifter-derived diffusivity estimates are O(10 m2/s), are consistent with the diffusivity inferred from aerial images of the dye taken using the quadcopter-mounted digital camera during the dye release, and are roughly an order of magnitude larger than diffusivity estimates of Okubo (O(1 m2/s)) for similar spatial scales ( 1 km). Despite the fact that the drifter-based diffusivity approach was successful in improving the ability of the radar to reproduce the observed dye spreading, the dispersion of drifters was, for the most part, not consistent with the diffusive spreading regime.

  20. Diffusion tensor MR microscopy of tissues with low diffusional anisotropy.

    Science.gov (United States)

    Bajd, Franci; Mattea, Carlos; Stapf, Siegfried; Sersa, Igor

    2016-06-01

    Diffusion tensor imaging exploits preferential diffusional motion of water molecules residing within tissue compartments for assessment of tissue structural anisotropy. However, instrumentation and post-processing errors play an important role in determination of diffusion tensor elements. In the study, several experimental factors affecting accuracy of diffusion tensor determination were analyzed. Effects of signal-to-noise ratio and configuration of the applied diffusion-sensitizing gradients on fractional anisotropy bias were analyzed by means of numerical simulations. In addition, diffusion tensor magnetic resonance microscopy experiments were performed on a tap water phantom and bovine articular cartilage-on-bone samples to verify the simulation results. In both, the simulations and the experiments, the multivariate linear regression of the diffusion-tensor analysis yielded overestimated fractional anisotropy with low SNRs and with low numbers of applied diffusion-sensitizing gradients. An increase of the apparent fractional anisotropy due to unfavorable experimental conditions can be overcome by applying a larger number of diffusion sensitizing gradients with small values of the condition number of the transformation matrix. This is in particular relevant in magnetic resonance microscopy, where imaging gradients are high and the signal-to-noise ratio is low.