WorldWideScience

Sample records for incoherent motion diffusion

  1. Variability of non-Gaussian diffusion MRI and intravoxel incoherent motion (IVIM) measurements in the breast.

    Science.gov (United States)

    Iima, Mami; Kataoka, Masako; Kanao, Shotaro; Kawai, Makiko; Onishi, Natsuko; Koyasu, Sho; Murata, Katsutoshi; Ohashi, Akane; Sakaguchi, Rena; Togashi, Kaori

    2018-01-01

    We prospectively examined the variability of non-Gaussian diffusion magnetic resonance imaging (MRI) and intravoxel incoherent motion (IVIM) measurements with different numbers of b-values and excitations in normal breast tissue and breast lesions. Thirteen volunteers and fourteen patients with breast lesions (seven malignant, eight benign; one patient had bilateral lesions) were recruited in this prospective study (approved by the Internal Review Board). Diffusion-weighted MRI was performed with 16 b-values (0-2500 s/mm2 with one number of excitations [NEX]) and five b-values (0-2500 s/mm2, 3 NEX), using a 3T breast MRI. Intravoxel incoherent motion (flowing blood volume fraction [fIVIM] and pseudodiffusion coefficient [D*]) and non-Gaussian diffusion (theoretical apparent diffusion coefficient [ADC] at b value of 0 sec/mm2 [ADC0] and kurtosis [K]) parameters were estimated from IVIM and Kurtosis models using 16 b-values, and synthetic apparent diffusion coefficient (sADC) values were obtained from two key b-values. The variabilities between and within subjects and between different diffusion acquisition methods were estimated. There were no statistical differences in ADC0, K, or sADC values between the different b-values or NEX. A good agreement of diffusion parameters was observed between 16 b-values (one NEX), five b-values (one NEX), and five b-values (three NEX) in normal breast tissue or breast lesions. Insufficient agreement was observed for IVIM parameters. There were no statistical differences in the non-Gaussian diffusion MRI estimated values obtained from a different number of b-values or excitations in normal breast tissue or breast lesions. These data suggest that a limited MRI protocol using a few b-values might be relevant in a clinical setting for the estimation of non-Gaussian diffusion MRI parameters in normal breast tissue and breast lesions.

  2. Chronic kidney disease: Pathological and functional evaluation with intravoxel incoherent motion diffusion-weighted imaging.

    Science.gov (United States)

    Mao, Wei; Zhou, Jianjun; Zeng, Mengsu; Ding, Yuqin; Qu, Lijie; Chen, Caizhong; Ding, Xiaoqiang; Wang, Yaqiong; Fu, Caixia

    2018-05-01

    Because chronic kidney disease (CKD) is a worldwide problem, accurate pathological and functional evaluation is required for planning treatment and follow-up. Intravoxel incoherent motion diffusion-weighted imaging (IVIM-DWI) can assess both capillary perfusion and tissue diffusion and may be helpful in evaluating renal function and pathology. To evaluate functional and pathological alterations in CKD by applying IVIM-DWI. Prospective study. In all, 72 CKD patients who required renal biopsy and 20 healthy volunteers. 1.5T. All subjects underwent IVIM-DWI of the kidneys, and image analysis was performed by two radiologists. The mean values of true diffusion coefficient (D), pseudo diffusion coefficient (D*), and perfusion fraction (f) were acquired from renal parenchyma. Correlation between IVIM-DWI parameters and estimated glomerular filtration rate (eGFR), as well as pathological damage, were assessed. One-way analysis of variance (ANOVA), paired sample t-test and Spearman correlation analysis. The paired sample t-test revealed that IVIM-DWI parameters were significantly lower in medulla than cortex for both patients and controls (P Imaging 2018;47:1251-1259. © 2017 International Society for Magnetic Resonance in Medicine.

  3. Intravoxel Incoherent Motion Diffusion-weighted Imaging: Evaluation of the Differentiation of Solid Hepatic Lesions

    Directory of Open Access Journals (Sweden)

    Ma Luo

    2017-10-01

    Full Text Available PURPOSE: To evaluate whether intravoxel incoherent motion (IVIM–related parameters could be used to differentiate malignant from benign focal liver lesions (FLLs and to improve diagnostic efficiency. METHODS: Seventy-four patients with 75 lesions, including 51 malignant FLLs and 24 benign FLLs, underwent liver 3.0-T magnetic resonance imaging for routine examination sequences. IVIM diffusion-weighted imaging (DWI with 11 b values (0-800 s/mm2 was also acquired concurrently. Apparent diffusion coefficient (ADCtotal and IVIM-derived parameters, such as the pure diffusion coefficient (D, the pseudodiffusion coefficient (D⁎, and the perfusion fraction (f, were calculated and compared between the two groups. A receiver operating characteristic curve analysis was performed to assess their diagnostic value. RESULTS: ADCtotal, D, and f were significantly lower in the malignant group than in the benign group, whereas D⁎ did not show a statistical difference. D had a larger area under the curve value (0.968 and higher sensitivity (92.30% for differentiation. CONCLUSION: IVIM is a useful method to differentiate malignant and benign FLLs. The D value showed higher efficacy to detect hepatic solid lesions.

  4. Intravoxel incoherent motion diffusion-weighted imaging in stroke patients: initial clinical experience

    International Nuclear Information System (INIS)

    Yao, Y.; Zhang, S.; Tang, X.; Zhang, S.; Shi, J.; Zhu, W.; Zhu, W.

    2016-01-01

    Aim: To evaluate the feasibility of using intravoxel incoherent motion (IVIM) to measure diffusion and perfusion parameter variations in stroke. Materials and methods: Thirty-eight stroke patients were enrolled in the study. IVIM imaging was performed using 15 b-values from 0 to 1000 s/mm"2. Arterial spin labelling (ASL) magnetic resonance perfusion was also undertaken. Relations between the IVIM parameters (including apparent diffusion coefficient [ADC], diffusion coefficient D_s_l_o_w [D], pseudo-diffusion coefficient D_f_a_s_t [D*], fractional perfusion-related volume [f]) and fD* (the multiplication of the first two parameters) and the ASL-derived parameter, cerebral blood flow (CBF), were analysed using paired t-tests. Comparisons of all the parameters between lesions and contralateral normal regions, as well as between acute and subacute groups were analysed using Student's t-test. Results: There were positive correlations between f and CBF as well as fD* and CBF (r=0.472 and 0.653). Quantitative analysis showed a significant decrease in ADC, D, D*, f, fD*, and CBF of the lesions compared with the contralateral side, in which the decrease of fD* (68.6%) was highest. The values of ADC, f, and fD* increased in the subacute period group compared with the acute period group. Conclusions: IVIM analysis allowed separation of perfusion contribution from true diffusion and thus provided an evaluation of the perfusion and diffusion variations during stroke, which might further elucidate the mechanisms of ischaemic stroke. - Highlights: • There exist positive correlations between fractional perfusion-related volume (f) and cerebral blood flow (CBF) as well as fD"∗ and CBF. • A significant decrease in ADC, diffusion coefficient D_s_l_o_w (D), pseudo-diffusion coefficient D_f_a_s_t (D"∗), f, fD"∗ and CBF of the lesions compared with the contralateral normal regions. • The values of ADC, f and fD"∗ increase significantly in the subacute period compared with

  5. Intravoxel Incoherent Motion in Normal Pituitary Gland: Initial Study with Turbo Spin-Echo Diffusion-Weighted Imaging.

    Science.gov (United States)

    Kamimura, K; Nakajo, M; Fukukura, Y; Iwanaga, T; Saito, T; Sasaki, M; Fujisaki, T; Takemura, A; Okuaki, T; Yoshiura, T

    2016-12-01

    DWI with conventional single-shot EPI of the pituitary gland is hampered by strong susceptibility artifacts. Our purpose was to evaluate the feasibility of intravoxel incoherent motion assessment by using DWI based on TSE of the normal anterior pituitary lobe. The intravoxel incoherent motion parameters, including the true diffusion coefficient (D), the perfusion fraction (f), and the pseudo-diffusion coefficient (D*), were obtained with TSE-DWI in 5 brain regions (the pons, the WM and GM of the vermis, and the genu and splenium of the corpus callosum) in 8 healthy volunteers, and their agreement with those obtained with EPI-DWI was evaluated by using the intraclass correlation coefficient. The 3 intravoxel incoherent motion parameters in the anterior pituitary lobe were compared with those in the brain regions by using the Dunnett test. The agreement between TSE-DWI and EPI-DWI was moderate (intraclass correlation coefficient = 0.571) for D, substantial (0.699) for f', but fair (0.405) for D*. D in the anterior pituitary lobe was significantly higher than in the 5 brain regions (P anterior pituitary lobe was significantly higher than in the 5 brain regions (P pituitary D* was not significantly different from that in the 5 brain regions. Our results demonstrated the feasibility of intravoxel incoherent motion assessment of the normal anterior pituitary lobe by using TSE-DWI. High D and f values in the anterior pituitary lobe were thought to reflect its microstructural and perfusion characteristics. © 2016 by American Journal of Neuroradiology.

  6. Use of intravoxel incoherent motion diffusion-weighted imaging to detect early changes in diabetic kidneys.

    Science.gov (United States)

    Deng, Yi; Yang, Biran; Peng, Yan; Liu, Zhiqiang; Luo, Jinwen; Du, Guoxin

    2018-03-14

    The purpose of the study was to examine differences in kidney intravoxel incoherent motion diffusion-weighted imaging (IVIM-DWI) parameters in early-stage diabetic patients versus healthy controls. Nineteen type 2 diabetic patients (group A) with a urinary albumin-to-creatinine ratio (ACR) diabetic kidney changes was determined by receiver operating characteristic analysis. Three radiologists independently measured the parameters derived from IVIM-DWI in the two groups by free-hand placing regions of interest, and the interclass coefficients (ICCs) were analyzed by SPSS.16.0 software. The f values of the kidneys were significantly higher in diabetic patients than in healthy volunteers. The D value of the kidneys was significantly lower in diabetic patients than in healthy volunteers. No significant differences in the D* values of the kidneys were observed between diabetic patients and healthy volunteers. The D values of the right kidneys were significantly higher than those of the left kidneys in both groups. The results of the receiver operating characteristic analysis were as follows: left kidney-f value AUC = 0.650 (cutoff point ≥ 27.49%) and D value AUC = 0.752 (cutoff point ≤ 1.68 × 10 -3  mm 2 /s); and right kidney-f value AUC = 0.650 (cutoff point ≥ 28.24%) and D value AUC = 0.752 (cutoff point ≤ 1.81 × 10 -3 mm 2 /s). The diagnostic performance of the D* value was very low (AUC  0.05). The ICCs of the f value and D value were between 0.637 and 0.827. The ICC of the D* value was less than 0.3. The results of our study suggest that changes in kidneys detected by IVIM-DWI may serve as indicators of early diabetic kidney disease.

  7. Use of intravoxel incoherent motion diffusion-weighted imaging in identifying the vascular and avascular zones of human meniscus.

    Science.gov (United States)

    Guo, Tan; Chen, Juan; Wu, Bing; Zheng, Dandan; Jiao, Sheng; Song, Yan; Chen, Min

    2017-04-01

    To investigate the hypothesis that the intravoxel incoherent motion (IVIM) diffusion-weighted imaging may depict microcirculation of meniscus and the perfusion changes in meniscal disorder. Fifty patients received diffusion-weighted MRI with multiple b-values ranging from 0 to 400 s/mm 2 . The four horns of the menisci were divided into normal, degenerated, and torn groups. IVIM parameters including perfusion fraction (f), pseudo-diffusion coefficient (D*), true diffusion coefficient (D), and the product of f and D* (f D*) of normal meniscal red zone and white zone were derived and compared for microcirculation changes of normal, degenerated, and torn posterior horn of the medial meniscus (PMM). The parameters between red and white zones among the groups were compared. Significant differences were considered when P meniscus and the perfusion changes in meniscal disorder. 3 J. Magn. Reson. Imaging 2017;45:1090-1096. © 2016 International Society for Magnetic Resonance in Medicine.

  8. Perfusion and diffusion characteristics of cervical cancer based on intravoxel incoherent motion MR imaging-a pilot study

    International Nuclear Information System (INIS)

    Lee, Elaine Yuen Phin; Yu, Xue; Khong, Pek-Lan; Chu, Mandy Man Yee; Ngan, Hextan Yuen Sheung; Siu, Steven Wai Kwan; Soong, Inda Sung; Chan, Queenie

    2014-01-01

    To investigate the tissue characteristics of cervical cancer based on the intravoxel incoherent motion (IVIM) model and to assess the IVIM parameters in tissue differentiation in the female pelvis. Sixteen treatment-naive cervical cancer and 17 age-matched healthy subjects were prospectively recruited for diffusion-weighted (b = 0-1,000 s/mm 2 ) and standard pelvic MRI. Bi-exponential analysis was performed to derive the perfusion parameters f (perfusion fraction) and D* (pseudodiffusion coefficient) as well as the diffusion parameter D (true molecular diffusion coefficient) in cervical cancer (n = 16), normal cervix (n = 17), myometrium (n = 33) and leiomyoma (n = 14). Apparent diffusion coefficient (ADC) was calculated. Kruskal-Wallis test and receiver operating characteristics (ROC) curves were used. Cervical cancer had the lowest f (14.9 ± 2.6 %) and was significantly different from normal cervix and leiomyoma (p -3 mm2/s) was lowest in cervical cancer and was significantly different from normal cervix and myometrium (p -3 mm 2 /s and ADC -3 mm 2 /s could differentiate cervical cancer from non-malignant tissues (AUC 0.773-0.908). Cervical cancer has low perfusion and diffusion IVIM characteristics with promising potential for tissue differentiation. (orig.)

  9. Nasopharyngeal carcinoma: comparison of diffusion and perfusion characteristics between different tumour stages using intravoxel incoherent motion MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Lai, Vincent; Li, Xiao; Huang, Bingsheng; Khong, Pek Lan [University of Hong Kong, Queen Mary Hospital, Department of Diagnostic Radiology, Li Ka Shing Faculty of Medicine, Hong Kong (China); Lee, Victor Ho Fun; Lam, Ka On [University of Hong Kong, Queen Mary Hospital, Department of Clinical Oncology, Li Ka Shing Faculty of Medicine, Hong Kong (China); Fong, Daniel Yee Tak [University of Hong Kong, School of Nursing, Li Ka Shing Faculty of Medicine, Hong Kong (China); Chan, Queenie [Philips Healthcare, Hong Kong, New Territories (China)

    2014-01-15

    To explore intravoxel incoherent motion (IVIM) characteristics of nasopharyngeal carcinoma (NPC) and relationships with different tumour stages. We prospectively recruited 80 patients with newly diagnosed undifferentiated NPC. Diffusion-weighted MR imaging was performed and IVIM parameters (D, pure diffusion; f, perfusion fraction; D*, pseudodiffusion coefficient) were calculated. Patients were stratified into low and high tumour stage groups based on American Joint Committee on Cancer (AJCC) and TNM staging for determination of the predictive powers of IVIM parameters using t test, multiple logistic regression and ROC curve analyses. D, f and D* were all statistically significantly lower in high-stage groups in AJCC, T and N staging. D, f and D* were all independent predictors of AJCC staging, f and D* were independent predictors of T staging, and D was an independent predictor of N staging. D was most powerful for AJCC and N staging, whereas f was most powerful for T staging. Optimal cut-off values (area under the curve, sensitivity, specificity, positive likelihood ratio, negative likelihood ratio) were as follows: AJCC stage, D = 0.782 x 10{sup -3} mm{sup 2}/s (0.915, 93.3 %, 76.2 %, 3.92, 0.09); T staging, f = 0.133 (0.905, 80.5 %, 92.5 %, 10.73, 0.21); N staging, D = 0.761 x 10{sup -3} mm{sup 2}/s (0.848, 87.5 %, 66.7 %, 2.62, 0.19). Multivariate analysis showed no diagnostic improvement. Nasopharyngeal carcinoma has distinctive intravoxel incoherent motion characteristics parameters in different tumour staging, potentially helping pretreatment staging. (orig.)

  10. Intravoxel Incoherent Motion MR Imaging in the Differentiation of Benign and Malignant Sinonasal Lesions: Comparison with Conventional Diffusion-Weighted MR Imaging.

    Science.gov (United States)

    Xiao, Z; Tang, Z; Qiang, J; Wang, S; Qian, W; Zhong, Y; Wang, R; Wang, J; Wu, L; Tang, W; Zhang, Z

    2018-01-25

    Intravoxel incoherent motion is a promising method for the differentiation of sinonasal lesions. This study aimed to evaluate the value of intravoxel incoherent motion in the differentiation of benign and malignant sinonasal lesions and to compare the diagnostic performance of intravoxel incoherent motion with that of conventional DWI. One hundred thirty-one patients with histologically proved solid sinonasal lesions (56 benign and 75 malignant) who underwent conventional DWI and intravoxel incoherent motion were recruited in this study. The diffusion coefficient ( D ), pseudodiffusion coefficient ( D *), and perfusion fraction ( f ) values derived from intravoxel incoherent motion and ADC values derived from conventional DWI were measured and compared between the 2 groups using the Student t test. Receiver operating characteristic curve analysis, logistic regression analysis, and 10-fold cross-validation were performed to evaluate the diagnostic performance of single-parametric and multiparametric models. The mean ADC and D values were significantly lower in malignant sinonasal lesions than in benign sinonasal lesions (both P benign and malignant sinonasal lesions. © 2018 by American Journal of Neuroradiology.

  11. Perfusion and diffusion characteristics of cervical cancer based on intravoxel incoherent motion MR imaging-a pilot study

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Elaine Yuen Phin; Yu, Xue; Khong, Pek-Lan [The University of Hong Kong, Department of Diagnostic Radiology, Queen Mary Hospital, Hong Kong (China); Chu, Mandy Man Yee; Ngan, Hextan Yuen Sheung [The University of Hong Kong, Department of Obstetrics and Gynaecology, Queen Mary Hospital, Hong Kong (China); Siu, Steven Wai Kwan [Queen Mary Hospital, Department of Clinical Oncology, Hong Kong (China); Soong, Inda Sung [Pamela Youde Nethersole Eastern Hospital, Department of Clinical Oncology, Hong Kong (China); Chan, Queenie [Philips Healthcare, Hong Kong (China)

    2014-07-15

    To investigate the tissue characteristics of cervical cancer based on the intravoxel incoherent motion (IVIM) model and to assess the IVIM parameters in tissue differentiation in the female pelvis. Sixteen treatment-naive cervical cancer and 17 age-matched healthy subjects were prospectively recruited for diffusion-weighted (b = 0-1,000 s/mm{sup 2}) and standard pelvic MRI. Bi-exponential analysis was performed to derive the perfusion parameters f (perfusion fraction) and D* (pseudodiffusion coefficient) as well as the diffusion parameter D (true molecular diffusion coefficient) in cervical cancer (n = 16), normal cervix (n = 17), myometrium (n = 33) and leiomyoma (n = 14). Apparent diffusion coefficient (ADC) was calculated. Kruskal-Wallis test and receiver operating characteristics (ROC) curves were used. Cervical cancer had the lowest f (14.9 ± 2.6 %) and was significantly different from normal cervix and leiomyoma (p < 0.05). The D (0.86 ± 0.16 x 10{sup -3} mm2/s) was lowest in cervical cancer and was significantly different from normal cervix and myometrium (p < 0.05) but not leiomyoma. No difference was observed in D*. D was consistently lower than ADC in all tissues. ROC curves indicated that f < 16.38 %, D < 1.04 x 10{sup -3} mm{sup 2}/s and ADC < 1.13 x 10{sup -3} mm{sup 2}/s could differentiate cervical cancer from non-malignant tissues (AUC 0.773-0.908). Cervical cancer has low perfusion and diffusion IVIM characteristics with promising potential for tissue differentiation. (orig.)

  12. The histogram analysis of diffusion-weighted intravoxel incoherent motion (IVIM) imaging for differentiating the gleason grade of prostate cancer.

    Science.gov (United States)

    Zhang, Yu-Dong; Wang, Qing; Wu, Chen-Jiang; Wang, Xiao-Ning; Zhang, Jing; Liu, Hui; Liu, Xi-Sheng; Shi, Hai-Bin

    2015-04-01

    To evaluate histogram analysis of intravoxel incoherent motion (IVIM) for discriminating the Gleason grade of prostate cancer (PCa). A total of 48 patients pathologically confirmed as having clinically significant PCa (size > 0.5 cm) underwent preoperative DW-MRI (b of 0-900 s/mm(2)). Data was post-processed by monoexponential and IVIM model for quantitation of apparent diffusion coefficients (ADCs), perfusion fraction f, diffusivity D and pseudo-diffusivity D*. Histogram analysis was performed by outlining entire-tumour regions of interest (ROIs) from histological-radiological correlation. The ability of imaging indices to differentiate low-grade (LG, Gleason score (GS) ≤6) from intermediate/high-grade (HG, GS > 6) PCa was analysed by ROC regression. Eleven patients had LG tumours (18 foci) and 37 patients had HG tumours (42 foci) on pathology examination. HG tumours had significantly lower ADCs and D in terms of mean, median, 10th and 75th percentiles, combined with higher histogram kurtosis and skewness for ADCs, D and f, than LG PCa (p Histogram D showed relatively higher correlations (ñ = 0.641-0.668 vs. ADCs: 0.544-0.574) with ordinal GS of PCa; and its mean, median and 10th percentile performed better than ADCs did in distinguishing LG from HG PCa. It is feasible to stratify the pathological grade of PCa by IVIM with histogram metrics. D performed better in distinguishing LG from HG tumour than conventional ADCs. • GS had relatively higher correlation with tumour D than ADCs. • Difference of histogram D among two-grade tumours was statistically significant. • D yielded better individual features in demonstrating tumour grade than ADC. • D* and f failed to determine tumour grade of PCa.

  13. Intravoxel incoherent motion diffusion imaging of the liver: Optimal b-value subsampling and impact on parameter precision and reproducibility

    International Nuclear Information System (INIS)

    Dyvorne, Hadrien; Jajamovich, Guido; Kakite, Suguru; Kuehn, Bernd; Taouli, Bachir

    2014-01-01

    Highlights: • We assess the precision and reproducibility of liver IVIM diffusion parameters. • Liver IVIM DWI can be performed with 4 b-values with good parameter precision. • Liver IVIM DWI can be performed with 4 b-values with good parameter reproducibility. - Abstract: Purpose: To increase diffusion sampling efficiency in intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) of the liver by reducing the number of diffusion weightings (b-values). Materials and methods: In this IRB approved HIPAA compliant prospective study, 53 subjects (M/F 38/15, mean age 52 ± 13 y) underwent IVIM DWI at 1.5 T using 16 b-values (0–800 s/mm 2 ), with 14 subjects having repeat exams to assess IVIM parameter reproducibility. A biexponential diffusion model was used to quantify IVIM hepatic parameters (PF: perfusion fraction, D: true diffusion and D*: pseudo diffusion). All possible subsets of the 16 b-values were probed, with number of b values ranging from 4 to 15, and corresponding parameters were quantified for each subset. For each b-value subset, global parameter estimation error was computed against the parameters obtained with all 16 b-values and the subsets providing the lowest error were selected. Interscan estimation error was also evaluated between repeat exams to assess reproducibility of the IVIM technique in the liver. The optimal b-values distribution was selected such that the number of b-values was minimal while keeping parameter estimation error below interscan reproducibility error. Results: As the number of b-values decreased, the estimation error increased for all parameters, reflecting decreased precision of IVIM metrics. Using an optimal set of 4 b-values (0, 15, 150 and 800 s/mm 2 ), the errors were 6.5, 22.8 and 66.1% for D, PF and D* respectively. These values lie within the range of test–retest reproducibility for the corresponding parameters, with errors of 12.0, 32.3 and 193.8% for D, PF and D* respectively. Conclusion: A set

  14. Repeatability of apparent diffusion coefficient and intravoxel incoherent motion parameters at 3.0 Tesla in orbital lesions

    Energy Technology Data Exchange (ETDEWEB)

    Lecler, Augustin [Fondation Ophtalmologique Adolphe de Rothschild, Department of Radiology, Paris (France); Cardiovascular Research Centre - PARCC, Universite Paris Descartes Sorbonne Paris Cite, INSERM UMR-S970, Paris (France); Savatovsky, Julien; Sadik, Jean-Claude; Charbonneau, Frederique; Berges, Olivier [Fondation Ophtalmologique Adolphe de Rothschild, Department of Radiology, Paris (France); Balvay, Daniel [Cardiovascular Research Centre - PARCC, Universite Paris Descartes Sorbonne Paris Cite, INSERM UMR-S970, Paris (France); Zmuda, Mathieu; Galatoire, Olivier [Fondation Ophtalmologique Adolphe de Rothschild, Department of Orbitopalpebral Surgery, Paris (France); Picard, Herve [Fondation Ophtalmologique Adolphe de Rothschild, Clinical Research Unit, Paris (France); Fournier, Laure [Cardiovascular Research Centre - PARCC, Universite Paris Descartes Sorbonne Paris Cite, INSERM UMR-S970, Paris (France); Universite Paris Descartes Sorbonne Paris Cite, Assistance Publique-Hopitaux de Paris, Hopital Europeen Georges Pompidou, Radiology Department, Paris (France)

    2017-12-15

    To evaluate repeatability of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) parameters in the orbit. From December 2015 to March 2016, 22 patients were scanned twice using an IVIM sequence with 15b values (0-2,000 s/mm{sup 2}) at 3.0T. Two readers independently delineated regions of interest in an orbital mass and in different intra-orbital and extra-orbital structures. Short-term test-retest repeatability and inter-observer agreement were assessed using the intra-class correlation coefficient (ICC), the coefficient of variation (CV) and Bland-Altman limits of agreements (BA-LA). Test-retest repeatability of IVIM parameters in the orbital mass was satisfactory for ADC and D (mean CV 12% and 14%, ICC 95% and 93%), poor for f and D*(means CV 43% and 110%, ICC 90% and 65%). Inter-observer repeatability agreement was almost perfect in the orbital mass for all the IVIM parameters (ICC = 95%, 93%, 94% and 90% for ADC, D, f and D*, respectively). IVIM appeared to be a robust tool to measure D in orbital lesions with good repeatability, but this approach showed a poor repeatability of f and D*. (orig.)

  15. Repeatability of apparent diffusion coefficient and intravoxel incoherent motion parameters at 3.0 Tesla in orbital lesions

    International Nuclear Information System (INIS)

    Lecler, Augustin; Savatovsky, Julien; Sadik, Jean-Claude; Charbonneau, Frederique; Berges, Olivier; Balvay, Daniel; Zmuda, Mathieu; Galatoire, Olivier; Picard, Herve; Fournier, Laure

    2017-01-01

    To evaluate repeatability of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) parameters in the orbit. From December 2015 to March 2016, 22 patients were scanned twice using an IVIM sequence with 15b values (0-2,000 s/mm 2 ) at 3.0T. Two readers independently delineated regions of interest in an orbital mass and in different intra-orbital and extra-orbital structures. Short-term test-retest repeatability and inter-observer agreement were assessed using the intra-class correlation coefficient (ICC), the coefficient of variation (CV) and Bland-Altman limits of agreements (BA-LA). Test-retest repeatability of IVIM parameters in the orbital mass was satisfactory for ADC and D (mean CV 12% and 14%, ICC 95% and 93%), poor for f and D*(means CV 43% and 110%, ICC 90% and 65%). Inter-observer repeatability agreement was almost perfect in the orbital mass for all the IVIM parameters (ICC = 95%, 93%, 94% and 90% for ADC, D, f and D*, respectively). IVIM appeared to be a robust tool to measure D in orbital lesions with good repeatability, but this approach showed a poor repeatability of f and D*. (orig.)

  16. Compensation for incoherent ground motion

    International Nuclear Information System (INIS)

    Shigeru, Takeda; Hiroshi, Matsumoto; Masakazu, Yoshioka; Yasunori, Takeuchi; Kikuo, Kudo; Tsuneya, Tsubokawa; Mitsuaki, Nozaki; Kiyotomo, Kawagoe

    1999-01-01

    The power spectrum density and coherence function for ground motions are studied for the construction of the next generation electron-positron linear collider. It should provide a center of mass energy between 500 GeV-1 TeV with luminosity as high as 10 33 to 10 34 cm -2 sec -1 . Since the linear collider has a relatively slow repetition rate, large number of particles and small sizes of the beam should be generated and preserved in the machine to obtain the required high luminosity. One of the most critical parameters is the extremely small vertical beam size at the interaction point, thus a proper alignment system for the focusing and accelerating elements of the machine is necessary to achieve the luminosity. We describe recent observed incoherent ground motions and an alignment system to compensate the distortion by the ground motions. (authors)

  17. Histological Grading of Hepatocellular Carcinomas with Intravoxel Incoherent Motion Diffusion-weighted Imaging: Inconsistent Results Depending on the Fitting Method.

    Science.gov (United States)

    Ichikawa, Shintaro; Motosugi, Utaroh; Hernando, Diego; Morisaka, Hiroyuki; Enomoto, Nobuyuki; Matsuda, Masanori; Onishi, Hiroshi

    2018-04-10

    To compare the abilities of three intravoxel incoherent motion (IVIM) imaging approximation methods to discriminate the histological grade of hepatocellular carcinomas (HCCs). Fifty-eight patients (60 HCCs) underwent IVIM imaging with 11 b-values (0-1000 s/mm 2 ). Slow (D) and fast diffusion coefficients (D * ) and the perfusion fraction (f) were calculated for the HCCs using the mean signal intensities in regions of interest drawn by two radiologists. Three approximation methods were used. First, all three parameters were obtained simultaneously using non-linear fitting (method A). Second, D was obtained using linear fitting (b = 500 and 1000), followed by non-linear fitting for D * and f (method B). Third, D was obtained by linear fitting, f was obtained using the regression line intersection and signals at b = 0, and non-linear fitting was used for D * (method C). A receiver operating characteristic analysis was performed to reveal the abilities of these methods to distinguish poorly-differentiated from well-to-moderately-differentiated HCCs. Inter-reader agreements were assessed using intraclass correlation coefficients (ICCs). The measurements of D, D * , and f in methods B and C (Az-value, 0.658-0.881) had better discrimination abilities than did those in method A (Az-value, 0.527-0.607). The ICCs of D and f were good to excellent (0.639-0.835) with all methods. The ICCs of D * were moderate with methods B (0.580) and C (0.463) and good with method A (0.705). The IVIM parameters may vary depending on the fitting methods, and therefore, further technical refinement may be needed.

  18. Determination of malignancy and characterization of hepatic tumor type with diffusion-weighted magnetic resonance imaging: comparison of apparent diffusion coefficient and intravoxel incoherent motion-derived measurements.

    Science.gov (United States)

    Doblas, Sabrina; Wagner, Mathilde; Leitao, Helena S; Daire, Jean-Luc; Sinkus, Ralph; Vilgrain, Valérie; Van Beers, Bernard E

    2013-10-01

    The objective of this study was to compare the value of the apparent diffusion coefficient (ADC) determined with 3 b values and the intravoxel incoherent motion (IVIM)-derived parameters in the determination of malignancy and characterization of hepatic tumor type. Seventy-six patients with 86 solid hepatic lesions, including 8 hemangiomas, 20 lesions of focal nodular hyperplasia, 9 adenomas, 30 hepatocellular carcinomas, 13 metastases, and 6 cholangiocarcinomas, were assessed in this prospective study. Diffusion-weighted images were acquired with 11 b values to measure the ADCs (with b = 0, 150, and 500 s/mm) and the IVIM-derived parameters, namely, the pure diffusion coefficient and the perfusion-related diffusion fraction and coefficient. The diffusion parameters were compared between benign and malignant tumors and between tumor types, and their diagnostic value in identifying tumor malignancy was assessed. The apparent and pure diffusion coefficients were significantly higher in benign than in malignant tumors (benign: 2.32 [0.87] × 10 mm/s and 1.42 [0.37] × 10 mm/s vs malignant: 1.64 [0.51] × 10 mm/s and 1.14 [0.28] × 10 mm/s, respectively; P coefficients provided similar accuracy in assessing tumor malignancy (areas under the receiver operating characteristic curve of 0.770 and 0.723, respectively). In the multigroup analysis, the ADC was found to be significantly higher in hemangiomas than in hepatocellular carcinomas, metastases, and cholangiocarcinomas. In the same manner, it was higher in lesions of focal nodular hyperplasia than in metastases and cholangiocarcinomas. However, the pure diffusion coefficient was significantly higher only in hemangiomas versus hepatocellular and cholangiocellular carcinomas. Compared with the ADC, the diffusion parameters derived from the IVIM model did not improve the determination of malignancy and characterization of hepatic tumor type.

  19. Comparison of Turbo Spin Echo and Echo Planar Imaging for intravoxel incoherent motion and diffusion tensor imaging of the kidney at 3 Tesla

    Energy Technology Data Exchange (ETDEWEB)

    Hilbert, Fabian; Wech, Tobias; Neubauer, Henning; Veldhoen, Simon; Bley, Thorsten Alexander; Koestler, Herbert [Wuerzburg Univ. (Germany). Inst. fuer Diagnostische und Interventionelle Radiologie

    2017-10-01

    Echo Planar Imaging (EPI) is most commonly applied to acquire diffusion-weighted MR-images. EPI is able to capture an entire image in very short time, but is prone to distortions and artifacts. In diffusion-weighted EPI of the kidney severe distortions may occur due to intestinal gas. Turbo Spin Echo (TSE) is robust against distortions and artifacts, but needs more time to acquire an entire image compared to EPI. Therefore, TSE is more sensitive to motion during the readout. In this study we compare diffusion-weighted TSE and EPI of the human kidney with regard to intravoxel incoherent motion (IVIM) and diffusion tensor imaging (DTI). Images were acquired with b-values between 0 and 750 s/mm{sup 2} with TSE and EPI. Distortions were observed with the EPI readout in all volunteers, while the TSE images were virtually distortion-free. Fractional anisotropy of the diffusion tensor was significantly lower for TSE than for EPI. All other parameters of DTI and IVIM were comparable for TSE and EPI. Especially the main diffusion directions yielded by TSE and EPI were similar. The results demonstrate that TSE is a worthwhile distortion-free alternative to EPI for diffusion-weighted imaging of the kidney at 3 Tesla.

  20. Intravoxel Incoherent Motion MR Imaging in the Head and Neck: Correlation with Dynamic Contrast-Enhanced MR Imaging and Diffusion-Weighted Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xiao Quan [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Department of Radiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Choi, Young Jun; Sung, Yu Sub [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Yoon, Ra Gyoung [Department of Radiology, Catholic Kwandong University International St. Mary' s Hospital, Catholic Kwandong University College of Medicine, Incheon 22711 (Korea, Republic of); Jang, Seung Won; Park, Ji Eun [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Heo, Young Jin [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of); Department of Radiology, Busan Paik Hospital, Inje University College of Medicine, Busan 47392 (Korea, Republic of); Baek, Jung Hwan; Lee, Jeong Hyun [Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505 (Korea, Republic of)

    2016-11-01

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D{sup *}), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D{sup *} and model-free parameters from the DCE-MRI (wash-in, T{sub max}, E{sub max}, initial AUC{sub 60}, whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D{sup *} and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p < 0.001, r = 0.980) and muscles (p = 0.013, r = 0.542), despite its significantly higher value than D. The difference between ADC and D showed significant correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D{sup *} (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck.

  1. Intravoxel Incoherent Motion MR Imaging in the Head and Neck: Correlation with Dynamic Contrast-Enhanced MR Imaging and Diffusion-Weighted Imaging.

    Science.gov (United States)

    Xu, Xiao Quan; Choi, Young Jun; Sung, Yu Sub; Yoon, Ra Gyoung; Jang, Seung Won; Park, Ji Eun; Heo, Young Jin; Baek, Jung Hwan; Lee, Jeong Hyun

    2016-01-01

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D(*)), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D(*) and model-free parameters from the DCE-MRI (wash-in, Tmax, Emax, initial AUC60, whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D(*) and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D(*) (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck.

  2. [Value of intravoxel incoherent motion diffusion-weighted imaging in differential diagnosis of benign and malignant hepatic lesions and blood perfusion evaluation].

    Science.gov (United States)

    Ying, M L; Xiao, W W; Xu, S L; Shu, J E; Pan, J F; Fu, J F; Lu, J H; Pan, Y H; Jiang, Y

    2016-11-20

    Objective: To investigate the value of intravoxel incoherent motion diffusion-weighted imaging (IVIM-DWI) in the differential diagnosis and blood perfusion evaluation of benign and malignant hepatic lesions. Methods: A retrospective analysis was performed for 86 patients (96 lesions) with pathologically or clinically confirmed hepatic lesions or hepatic lesions diagnosed based on follow-up results, among whom 48 had malignant lesions (53 lesions) and 38 had benign lesions (43 lesions). The patients underwent conventional magnetic resonance (MR) plain scan, contrast-enhanced scan, and diffusion-weighted imaging (DWI) with different b values (b = 0, 50, 100, 150, 200, 400, 600, 800, 1 000, and 1 200 s/mm 2 ) to determine the parameters of the double exponential model for intravoxel incoherent motion (IVIM): fast diffusion coefficient Dfast, slow diffusion coefficient Dslow, and percentage of fast-diffusion constituent F value. The patients were divided into groups according to the blood supply to lesions on conventional MR plain scan and contrast-enhanced scan, and there were 47 lesions in abundant blood supply group and 49 in poor blood supply group. The data for analysis were Dfast, Dslow, and F values of benign/malignant lesion groups and abundant/poor blood supply groups. The independent samples t-test was used for statistical analysis; the independent samples non-parametric test Mann-Whitney U test was used for the comparison of F value; the receiver operating characteristic (ROC) curve was used to evaluate the value of above parameters in the differentiation of benign and malignant lesions and blood supply evaluation. Results: Compared with the malignant lesion group, the benign lesion group had significantly higher Dslow, and F values ( P benign and malignant hepatic lesions, and F value can show blood perfusion in benign and malignant hepatic lesions without the need for contrast-enhanced scan, which provides a reference for the qualitative diagnosis of liver

  3. MRI assessment of the thigh musculature in dermatomyositis and healthy subjects using diffusion tensor imaging, intravoxel incoherent motion and dynamic DTI.

    Science.gov (United States)

    Sigmund, E E; Baete, S H; Luo, T; Patel, K; Wang, D; Rossi, I; Duarte, A; Bruno, M; Mossa, D; Femia, A; Ramachandran, S; Stoffel, D; Babb, J S; Franks, A; Bencardino, J

    2018-06-04

    Dermatomyositis (DM) is an idiopathic inflammatory myopathy involving severe debilitation in need of diagnostics. We evaluated the proximal lower extremity musculature with diffusion tensor imaging (DTI), intravoxel incoherent motion (IVIM) and dynamic DTI in DM patients and controls and compared with standard clinical workup.  METHODS: In this IRB-approved, HIPAA-compliant study with written informed consent, anatomical, Dixon fat/water and diffusion imaging were collected in bilateral thigh MRI of 22 controls and 27 DM patients in a 3T scanner. Compartments were scored on T1/T2 scales. Single voxel dynamic DTI metrics in quadriceps before and after 3-min leg exercise were measured. Spearman rank correlation and mixed model analysis of variance/covariance (ANOVA/ANCOVA) were used to correlate with T1 and T2 scores and to compare patients with controls. DM patients showed significantly lower pseudo-diffusion and volume in quadriceps than controls. All subjects showed significant correlation between T1 score and signal-weighted fat fraction; tissue diffusion and pseudo-diffusion varied significantly with T1 and T2 score in patients. Radial and mean diffusion exercise response in patients was significantly higher than controls. Static and dynamic diffusion imaging metrics show correlation with conventional imaging scores, reveal spatial heterogeneity, and provide means to differentiate dermatomyositis patients from controls. • Diffusion imaging shows regional differences between thigh muscles of dermatomyositis patients and controls. • Signal-weighted fat fraction and diffusion metrics correlate with T1/T2 scores of disease severity. • Dermatomyositis patients show significantly higher radial diffusion exercise response than controls.

  4. Use of intravoxel incoherent motion diffusion-weighted MR imaging for assessment of treatment response to invasive fungal infection in the lung

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Chenggong; Xiong, Wei; Wu, Yuankui; Li, Caixia; Xu, Yikai [Southern Medical University, Department of Medical Imaging Center, Nanfang Hospital, Guangzhou (China); Xu, Jun; Wei, Qi; Feng, Ru; Liu, Qifa [Southern Medical University, Department of Hematology, Nanfang Hospital, Guangzhou (China); Chan, Queenie [Philips Healthcare, New Territories, Hon Kong (China)

    2017-01-15

    The purpose of this study was to determine whether intravoxel incoherent motion (IVIM) -derived parameters and apparent diffusion coefficient (ADC) could act as imaging biomarkers for predicting antifungal treatment response. Forty-six consecutive patients (mean age, 33.9 ± 13.0 y) with newly diagnosed invasive fungal infection (IFI) in the lung according to EORTC/MSG criteria were prospectively enrolled. All patients underwent diffusion-weighted magnetic resonance (MR) imaging at 3.0 T using 11 b values (0-1000 sec/mm{sup 2}). ADC, pseudodiffusion coefficient D*, perfusion fraction f, and the diffusion coefficient D were compared between patients with favourable (n=32) and unfavourable response (n=14). f values were significantly lower in the unfavourable response group (12.6%±4.4%) than in the favourable response group (30.2%±8.6%) (Z=4.989, P<0.001). However, the ADC, D, and D* were not significantly different between the two groups (P>0.05). Receiver operating characteristic curve analyses showed f to be a significant predictor for differentiation, with a sensitivity of 93.8% and a specificity of 92.9%. IVIM-MRI is potentially useful in the prediction of antifungal treatment response to patients with IFI in the lung. Our results indicate that a low perfusion fraction f may be a noninvasive imaging biomarker for unfavourable response. (orig.)

  5. Intravoxel incoherent motion diffusion-weighted imaging in the liver: comparison of mono-, bi- and tri-exponential modelling at 3.0-T

    International Nuclear Information System (INIS)

    Cercueil, Jean-Pierre; Petit, Jean-Michel; Nougaret, Stephanie; Pierredon-Foulongne, Marie-Ange; Schembri, Valentina; Delhom, Elisabeth; Guiu, Boris; Soyer, Philippe; Fohlen, Audrey; Schmidt, Sabine; Denys, Alban; Aho, Serge

    2015-01-01

    To determine whether a mono-, bi- or tri-exponential model best fits the intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) signal of normal livers. The pilot and validation studies were conducted in 38 and 36 patients with normal livers, respectively. The DWI sequence was performed using single-shot echoplanar imaging with 11 (pilot study) and 16 (validation study) b values. In each study, data from all patients were used to model the IVIM signal of normal liver. Diffusion coefficients (D i ± standard deviations) and their fractions (f i ± standard deviations) were determined from each model. The models were compared using the extra sum-of-squares test and information criteria. The tri-exponential model provided a better fit than both the bi- and mono-exponential models. The tri-exponential IVIM model determined three diffusion compartments: a slow (D 1 = 1.35 ± 0.03 x 10 -3 mm 2 /s; f 1 = 72.7 ± 0.9 %), a fast (D 2 = 26.50 ± 2.49 x 10 -3 mm 2 /s; f 2 = 13.7 ± 0.6 %) and a very fast (D 3 = 404.00 ± 43.7 x 10 -3 mm 2 /s; f 3 = 13.5 ± 0.8 %) diffusion compartment [results from the validation study]. The very fast compartment contributed to the IVIM signal only for b values ≤15 s/mm 2 The tri-exponential model provided the best fit for IVIM signal decay in the liver over the 0-800 s/mm 2 range. In IVIM analysis of normal liver, a third very fast (pseudo)diffusion component might be relevant. (orig.)

  6. Comparison of intravoxel incoherent motion diffusion-weighted imaging between turbo spin-echo and echo-planar imaging of the head and neck

    Energy Technology Data Exchange (ETDEWEB)

    Mikayama, Ryoji; Yabuuchi, Hidetake; Nagatomo, Kazuya; Kimura, Mitsuhiro; Kumazawa, Seiji [Kyushu University, Department of Health Sciences, Graduate School of Medical Sciences, Fukuoka (Japan); Sonoda, Shinjiro; Kobayashi, Koji [Kyushu University Hospital, Division of Radiology, Department of Medical Technology, Fukuoka (Japan); Kawanami, Satoshi; Kamitani, Takeshi; Honda, Hiroshi [Kyushu University, Department of Clinical Radiology, Graduate School of Medical Sciences, Fukuoka (Japan)

    2018-01-15

    To compare image quality, apparent diffusion coefficient (ADC), and intravoxel incoherent motion (IVIM)-derived parameters between turbo spin-echo (TSE)-diffusion-weighted imaging (DWI) and echo-planar imaging (EPI)-DWI of the head and neck. Fourteen volunteers underwent head and neck imaging using TSE-DWI and EPI-DWI. Distortion ratio (DR), signal-to-noise ratio (SNR), contrast-to-noise ratio (CNR), ADC and IVIM-derived parameters were compared between the two techniques. Bland-Altman analysis was performed to analyse reproducibility between the quantitative parameters of TSE-DWI and EPI-DWI. DR of TSE-DWI was significantly smaller than that of EPI-DWI. SNR and CNR of TSE-DWI were significantly higher than those of EPI-DWI. ADC and IVIM-derived parameters of TSE-DWI showed higher values than those of EPI-DWI, although the difference was not significant. Bland-Altman analysis showed wide limits of agreement between the two sequences. TSE-DWI can produce better image quality than EPI-DWI, while TSE-DWI possibly exhibits different values of quantitative parameters. Therefore, TSE-DWI could be a good alternative to EPI-DWI for patients sensitive to distortion. However, it is not recommended to use both TSE-DWI and EPI-DWI on follow-up. (orig.)

  7. Diffusion parameter mapping with the combined intravoxel incoherent motion and kurtosis model using artificial neural networks at 3 T.

    Science.gov (United States)

    Bertleff, Marco; Domsch, Sebastian; Weingärtner, Sebastian; Zapp, Jascha; O'Brien, Kieran; Barth, Markus; Schad, Lothar R

    2017-12-01

    Artificial neural networks (ANNs) were used for voxel-wise parameter estimation with the combined intravoxel incoherent motion (IVIM) and kurtosis model facilitating robust diffusion parameter mapping in the human brain. The proposed ANN approach was compared with conventional least-squares regression (LSR) and state-of-the-art multi-step fitting (LSR-MS) in Monte-Carlo simulations and in vivo in terms of estimation accuracy and precision, number of outliers and sensitivity in the distinction between grey (GM) and white (WM) matter. Both the proposed ANN approach and LSR-MS yielded visually increased parameter map quality. Estimations of all parameters (perfusion fraction f, diffusion coefficient D, pseudo-diffusion coefficient D*, kurtosis K) were in good agreement with the literature using ANN, whereas LSR-MS resulted in D* overestimation and LSR yielded increased values for f and D*, as well as decreased values for K. Using ANN, outliers were reduced for the parameters f (ANN, 1%; LSR-MS, 19%; LSR, 8%), D* (ANN, 21%; LSR-MS, 25%; LSR, 23%) and K (ANN, 0%; LSR-MS, 0%; LSR, 15%). Moreover, ANN enabled significant distinction between GM and WM based on all parameters, whereas LSR facilitated this distinction only based on D and LSR-MS on f, D and K. Overall, the proposed ANN approach was found to be superior to conventional LSR, posing a powerful alternative to the state-of-the-art method LSR-MS with several advantages in the estimation of IVIM-kurtosis parameters, which might facilitate increased applicability of enhanced diffusion models at clinical scan times. Copyright © 2017 John Wiley & Sons, Ltd.

  8. Whole-body intravoxel incoherent motion imaging

    Energy Technology Data Exchange (ETDEWEB)

    Filli, Lukas; Wurnig, Moritz C.; Eberhardt, Christian; Guggenberger, Roman; Boss, Andreas [University Hospital Zurich, Department of Radiology, Zurich (Switzerland); Luechinger, Roger [University and ETH Zurich, Institute of Biomedical Technology, Zurich (Switzerland)

    2015-07-15

    To investigate the technical feasibility of whole-body intravoxel incoherent motion (IVIM) imaging. Whole-body MR images of eight healthy volunteers were acquired at 3T using a spin-echo echo-planar imaging sequence with eight b-values. Coronal parametrical whole-body maps of diffusion (D), pseudodiffusion (D*), and the perfusion fraction (F{sub p}) were calculated. Image quality was rated qualitatively by two independent radiologists, and inter-reader reliability was tested with intra-class correlation coefficients (ICCs). Region of interest (ROI) analysis was performed in the brain, liver, kidney, and erector spinae muscle. Depiction of anatomic structures was rated as good on D maps and good to fair on D* and F{sub p} maps. Exemplary mean D (10{sup -3} mm{sup 2}/s), D* (10{sup -3} mm{sup 2}/s) and F{sub p} (%) values (± standard deviation) of the renal cortex were as follows: 1.7 ± 0.2; 15.6 ± 6.5; 20.9 ± 4.4. Inter-observer agreement was ''substantial'' to ''almost perfect'' (ICC = 0.80 - 0.92). The coefficient of variation of D* was significantly lower with the proposed algorithm compared to the conventional algorithm (p < 0.001), indicating higher stability. The proposed IVIM protocol allows computation of parametrical maps with good to fair image quality. Potential future clinical applications may include characterization of widespread disease such as metastatic tumours or inflammatory myopathies. (orig.)

  9. Correction of Gradient Nonlinearity Bias in Quantitative Diffusion Parameters of Renal Tissue with Intra Voxel Incoherent Motion.

    Science.gov (United States)

    Malyarenko, Dariya I; Pang, Yuxi; Senegas, Julien; Ivancevic, Marko K; Ross, Brian D; Chenevert, Thomas L

    2015-12-01

    Spatially non-uniform diffusion weighting bias due to gradient nonlinearity (GNL) causes substantial errors in apparent diffusion coefficient (ADC) maps for anatomical regions imaged distant from magnet isocenter. Our previously-described approach allowed effective removal of spatial ADC bias from three orthogonal DWI measurements for mono-exponential media of arbitrary anisotropy. The present work evaluates correction feasibility and performance for quantitative diffusion parameters of the two-component IVIM model for well-perfused and nearly isotropic renal tissue. Sagittal kidney DWI scans of a volunteer were performed on a clinical 3T MRI scanner near isocenter and offset superiorly. Spatially non-uniform diffusion weighting due to GNL resulted both in shift and broadening of perfusion-suppressed ADC histograms for off-center DWI relative to unbiased measurements close to isocenter. Direction-average DW-bias correctors were computed based on the known gradient design provided by vendor. The computed bias maps were empirically confirmed by coronal DWI measurements for an isotropic gel-flood phantom. Both phantom and renal tissue ADC bias for off-center measurements was effectively removed by applying pre-computed 3D correction maps. Comparable ADC accuracy was achieved for corrections of both b -maps and DWI intensities in presence of IVIM perfusion. No significant bias impact was observed for IVIM perfusion fraction.

  10. Intravoxel Incoherent Motion and Quantitative Non-Gaussian Diffusion MR Imaging: Evaluation of the Diagnostic and Prognostic Value of Several Markers of Malignant and Benign Breast Lesions.

    Science.gov (United States)

    Iima, Mami; Kataoka, Masako; Kanao, Shotaro; Onishi, Natsuko; Kawai, Makiko; Ohashi, Akane; Sakaguchi, Rena; Toi, Masakazu; Togashi, Kaori

    2018-05-01

    Purpose To investigate the performance of integrated approaches that combined intravoxel incoherent motion (IVIM) and non-Gaussian diffusion parameters compared with the Breast Imaging and Reporting Data System (BI-RADS) to establish multiparameter thresholds scores or probabilities by using Bayesian analysis to distinguish malignant from benign breast lesions and their correlation with molecular prognostic factors. Materials and Methods Between May 2013 and March 2015, 411 patients were prospectively enrolled and 199 patients (allocated to training [n = 99] and validation [n = 100] sets) were included in this study. IVIM parameters (flowing blood volume fraction [fIVIM] and pseudodiffusion coefficient [D*]) and non-Gaussian diffusion parameters (theoretical apparent diffusion coefficient [ADC] at b value of 0 sec/mm 2 [ADC 0 ] and kurtosis [K]) by using IVIM and kurtosis models were estimated from diffusion-weighted image series (16 b values up to 2500 sec/mm 2 ), as well as a synthetic ADC (sADC) calculated by using b values of 200 and 1500 (sADC 200-1500 ) and a standard ADC calculated by using b values of 0 and 800 sec/mm 2 (ADC 0-800 ). The performance of two diagnostic approaches (combined parameter thresholds and Bayesian analysis) combining IVIM and diffusion parameters was evaluated and compared with BI-RADS performance. The Mann-Whitney U test and a nonparametric multiple comparison test were used to compare their performance to determine benignity or malignancy and as molecular prognostic biomarkers and subtypes of breast cancer. Results Significant differences were found between malignant and benign breast lesions for IVIM and non-Gaussian diffusion parameters (ADC 0 , K, fIVIM, fIVIM · D*, sADC 200-1500, and ADC 0-800 ; P < .05). Sensitivity and specificity for the validation set by radiologists A and B were as follows: sensitivity, 94.7% and 89.5%, and specificity, 75.0% and 79.2% for sADC 200-1500 , respectively; sensitivity, 94.7% and 96.1%, and

  11. Intravoxel incoherent motion diffusion-weighted magnetic resonance imaging of focal vertebral bone marrow lesions: initial experience of the differentiation of nodular hyperplastic hematopoietic bone marrow from malignant lesions

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sunghoon; Kwack, Kyu-Sung; Kim, Jae Ho [Ajou University School of Medicine, Division of Musculoskeletal Radiology, Department of Radiology, Suwon, Gyeonggi-do (Korea, Republic of); Ajou University Medical Center, Musculoskeletal Imaging Laboratory, Suwon (Korea, Republic of); Chung, Nam-Su [Ajou University School of Medicine, Department of Orthopaedic Surgery, Suwon (Korea, Republic of); Hwang, Jinwoo [Philips Healthcare, Department of Clinical Science, Seoul (Korea, Republic of); Lee, Hyun Young [Ajou University Medical Center, Regional Clinical Trial Center, Suwon (Korea, Republic of); Yonsei University College of Medicine, Department of Biostatistics, Seoul (Korea, Republic of)

    2017-05-15

    To evaluate the ability of intravoxel incoherent motion (IVIM) diffusion-weighted magnetic resonance imaging (MRI) parameters to differentiate nodular hyperplastic hematopoietic bone marrow (HHBM) from malignant vertebral bone marrow lesions (VBMLs). A total of 33 patients with 58 VBMLs, including 9 nodular HHBM lesions, 39 bone metastases, and 10 myelomas, were retrospectively assessed. All diagnoses were confirmed either pathologically or via image assessment. IVIM diffusion-weighted MRI with 11 b values (from 0 to 800 s/mm{sup 2}) were obtained using a 3.0-T MR imager. The apparent diffusion coefficient (ADC), pure diffusion coefficient (D), perfusion fraction (f), and pseudodiffusion coefficient (D*) were calculated. ADC and IVIM parameters were compared using the Mann-Whitney U test. Receiver operating characteristic (ROC) curve analysis was performed to assess the diagnostic performances of ADC, D, f, and D* in terms of VBML characterization. The diagnostic performance of morphological MR sequences was also assessed for comparison. The ADC and D values of nodular HHBM were significantly lower than those of malignant VBML (both p values < 0.001), whereas the f value was significantly higher (p < 0.001). However, there were no significant differences in D* between the two groups (p = 0.688). On ROC analysis, the area under the curve (AUC) for D was 1.000, which was significantly larger than that for ADC (AUC = 0.902). Intravoxel incoherent motion diffusion-weighted MRI can be used to differentiate between nodular HHBM and malignant VBML. The D value was significantly lower for nodular HHBM, and afforded a better diagnostic performance than the ADC, f, and D* values in terms of such differentiation. (orig.)

  12. TU-F-CAMPUS-I-01: Head and Neck Squamous Cell Carcinoma: Short-Term Repeatability of Apparent Diffusion Coefficient and Intravoxel Incoherent Motion Parameters at 3.0T

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Y; Fuller, C; Mohamed, A; Wang, J; Hazle, J [UT MD Anderson Cancer Center, Houston, TX (United States)

    2015-06-15

    Purpose: Many published studies have recently demonstrated the potential value of intravoxel incoherent motion (IVIM) analysis for disease evaluation. However, few have questioned its measurement repeatability/reproducibility when applied. The purpose of this study was to determine the short-term measurement repeatability of apparent diffusion coefficient ADC, true diffusion coefficient D, pseudodiffusion coefficient D* and perfusion fraction f, in head and neck squamous cell carcinoma (HNSCC) primary tumors and metastatic nodes. Methods: Ten patients with known HNSCC were examined twice using echo-planar DW-MRI with 12 b values (0 to 800 s/mm2) 1hour to 24 hours apart before radiation treatment. All patients were scanned with the customized radiation treatment immobilization devices to reduce motion artifacts and to improve image registration in repeat scans. Regions of interests were drawn in primary tumor and metastases node in each patient (Fig. 1). ADC and IVIM parameters D, D* and f were calculated by least squares data fitting. Short-term test–retest repeatability of ADC and IVIM parameters were assessed by measuring Bland–Altman limits of agreements (BA-LA). Results: Sixteen HNSCC lesions were assessed in 10 patients. Repeatability of perfusion-sensitive parameters, D* and f, in HNSCC lesions was poor (BA-LA: -144% to 88% and −57% to 96% for D* and f, respectively); a lesser extent was observed for the diffusion-sensitive parameters of ADC and D (BA-LA: −34% to 39% and −37% to 40%, for ADC and D, respectively) (Fig. 2). Conclusion: Poor repeatability of D*/f and good repeatability for ADC/D were observed in HNSCC primary tumors and metastatic nodes. Efforts should be made to improve the measurement repeatability of perfusion-sensitive IVIM parameters.

  13. Temporally resolved electrocardiogram-triggered diffusion-weighted imaging of the human kidney: correlation between intravoxel incoherent motion parameters and renal blood flow at different time points of the cardiac cycle.

    Science.gov (United States)

    Wittsack, Hans-Jörg; Lanzman, Rotem S; Quentin, Michael; Kuhlemann, Julia; Klasen, Janina; Pentang, Gael; Riegger, Caroline; Antoch, Gerald; Blondin, Dirk

    2012-04-01

    To evaluate the influence of pulsatile blood flow on apparent diffusion coefficients (ADC) and the fraction of pseudodiffusion (F(P)) in the human kidney. The kidneys of 6 healthy volunteers were examined by a 3-T magnetic resonance scanner. Electrocardiogram (ECG)-gated and respiratory-triggered diffusion-weighted imaging (DWI) and phase-contrast flow measurements were performed. Flow imaging of renal arteries was carried out to quantify the dependence of renal blood flow on the cardiac cycle. ECG-triggered DWI was acquired in the coronal plane with 16 b values in the range of 0 s/mm(2) and 750 s/mm(2) at the time of minimum (MIN) (20 milliseconds after R wave) and maximum renal blood flow (MAX) (197 ± 24 milliseconds after R wave). The diffusion coefficients were calculated using the monoexponential approach as well as the biexponential intravoxel incoherent motion model and correlated to phase-contrast flow measurements. Flow imaging showed pulsatile renal blood flow depending on the cardiac cycle. The mean flow velocity at MIN was 45 cm/s as compared with 61 cm/s at MAX. F(p) at MIN (0.29) was significantly lower than at MAX (0.40) (P = 0.001). Similarly, ADC(mono), derived from the monoexponential model, also showed a significant difference (P renal blood flow and F(p) (r = 0.85) as well as ADC(mono) (r = 0.67) was statistically significant. Temporally resolved ECG-gated DWI enables for the determination of the diffusion coefficients at different time points of the cardiac cycle. ADC(mono) and FP vary significantly among acquisitions at minimum (diastole) and maximum (systole) renal blood flow. Temporally resolved ECG-gated DWI might therefore serve as a novel technique for the assessment of pulsatility in the human kidney.

  14. Simultaneous multi-slice echo planar diffusion weighted imaging of the liver and the pancreas: Optimization of signal-to-noise ratio and acquisition time and application to intravoxel incoherent motion analysis

    Energy Technology Data Exchange (ETDEWEB)

    Boss, Andreas, E-mail: andreas.boss@usz.ch [Institute of Diagnostic and Interventional Radiology, University Hospital Zurich (Switzerland); Barth, Borna; Filli, Lukas; Kenkel, David; Wurnig, Moritz C. [Institute of Diagnostic and Interventional Radiology, University Hospital Zurich (Switzerland); Piccirelli, Marco [Institute of Neuroradiology, University Hospital of Zurich (Switzerland); Reiner, Caecilia S. [Institute of Diagnostic and Interventional Radiology, University Hospital Zurich (Switzerland)

    2016-11-15

    Purpose: To optimize and test a diffusion-weighted imaging (DWI) echo-planar imaging (EPI) sequence with simultaneous multi-slice (SMS) excitation in the liver and pancreas regarding acquisition time (TA), number of slices, signal-to-noise ratio (SNR), image quality (IQ), apparent diffusion coefficient (ADC) quantitation accuracy, and feasibility of intravoxel incoherent motion (IVIM) analysis. Materials and methods: Ten healthy volunteers underwent DWI of the upper abdomen at 3T. A SMS DWI sequence with CAIPIRINHA unaliasing technique (acceleration factors 2/3, denoted AF2/3) was compared to standard DWI-EPI (AF1). Four schemes were evaluated: (i) reducing TA, (ii) keeping TA identical with increasing number of averages, (iii) increasing number of slices with identical TA (iv) increasing number of b-values for IVIM. Acquisition schemes i-iii were evaluated qualitatively (reader score) and quantitatively (ADC values, SNR). Results: In scheme (i) no differences in SNR were observed (p = 0.321 − 0.038) with reduced TA (AF2 increase in SNR/time 75.6%, AF3 increase SNR/time 102.4%). No SNR improvement was obtained in scheme (ii). Increased SNR/time could be invested in acquisition of more and thinner slices or higher number of b-values. Image quality scores were stable for AF2 but decreased for AF3. Only for AF3, liver ADC values were systematically lower. Conclusion: SMS-DWI of the liver and pancreas provides substantially higher SNR/time, which either may be used for shorter scan time, higher slice resolution or IVIM measurements.

  15. Intravoxel Incoherent Motion Diffusion Weighted MR Imaging for Monitoring the Instantly Therapeutic Efficacy of Radiofrequency Ablation in Rabbit VX2 Tumors without Evident Links between Conventional Perfusion Weighted Images.

    Directory of Open Access Journals (Sweden)

    Ziyi Guo

    Full Text Available To investigate the intravoxel incoherent motion diffusion weighted imaging (IVIM-DWI as a potential valuable marker to monitor the therapy responses of VX2 to radiofrequency ablation (RF Ablation.The institutional animal care and use committee approved this study. In 10 VX2 tumor-bearing rabbits, IVIM-DWI examinations were performed with a 3.0T imaging unit by using 16 b values from 0 to 800 sec/mm2. The true diffusion coefficient (D, pseudodiffusion coefficient (D* and perfusion fraction (f of tumors were compared between before and instantly after RF Ablation treatment. The differences of D, D* and f and conventional perfusion parameters (from perfusion CT and dynamic enhanced magnetic resonance imaging, DCE-MRI in the coagulation necrosis area, residual unablated area, untreated area, and normal control had been calculated by compared t-test. The correlation between f or D* with perfusion weighted CT including blood flow, BF (milliliter per 100 mL/min, blood volume, BV (milliliter per 100 mL/min, and capillary permeability-surface area, PMB (as a fraction or from DCE-MRI: transfer constant (Ktrans, extra-vascular extra-cellular volume fraction (Ve and reflux constant (Kep values had been analyzed by region-of-interest (ROI methods to calculate Pearson's correlation coefficients.In the ablated necrosis areas, f and D* significantly decreased and D significantly increased, compared with residual unblazed areas or untreated control groups and normal control groups (P < 0.001. The IVIM-DWI derived f parameters showed significant increases in the residual unablated tumor area. There was no significant correlations between f or D* and conventional perfusion parameters.The IVIM-DW derived f, D and D* parameters have the potential to indicate therapy response immediately after RF Ablation treatment, while no significant correlations with classical tumor perfusion metrics were derived from DCE-MRI and perfusion-CT measurements.

  16. Simultaneous multi-slice echo planar diffusion weighted imaging of the liver and the pancreas: Optimization of signal-to-noise ratio and acquisition time and application to intravoxel incoherent motion analysis

    International Nuclear Information System (INIS)

    Boss, Andreas; Barth, Borna; Filli, Lukas; Kenkel, David; Wurnig, Moritz C.; Piccirelli, Marco; Reiner, Caecilia S.

    2016-01-01

    Purpose: To optimize and test a diffusion-weighted imaging (DWI) echo-planar imaging (EPI) sequence with simultaneous multi-slice (SMS) excitation in the liver and pancreas regarding acquisition time (TA), number of slices, signal-to-noise ratio (SNR), image quality (IQ), apparent diffusion coefficient (ADC) quantitation accuracy, and feasibility of intravoxel incoherent motion (IVIM) analysis. Materials and methods: Ten healthy volunteers underwent DWI of the upper abdomen at 3T. A SMS DWI sequence with CAIPIRINHA unaliasing technique (acceleration factors 2/3, denoted AF2/3) was compared to standard DWI-EPI (AF1). Four schemes were evaluated: (i) reducing TA, (ii) keeping TA identical with increasing number of averages, (iii) increasing number of slices with identical TA (iv) increasing number of b-values for IVIM. Acquisition schemes i-iii were evaluated qualitatively (reader score) and quantitatively (ADC values, SNR). Results: In scheme (i) no differences in SNR were observed (p = 0.321 − 0.038) with reduced TA (AF2 increase in SNR/time 75.6%, AF3 increase SNR/time 102.4%). No SNR improvement was obtained in scheme (ii). Increased SNR/time could be invested in acquisition of more and thinner slices or higher number of b-values. Image quality scores were stable for AF2 but decreased for AF3. Only for AF3, liver ADC values were systematically lower. Conclusion: SMS-DWI of the liver and pancreas provides substantially higher SNR/time, which either may be used for shorter scan time, higher slice resolution or IVIM measurements.

  17. Incoherent neutron scattering functions for random jump diffusion in bounded and infinite media

    International Nuclear Information System (INIS)

    Hall, P.L.; Ross, D.K.

    1981-01-01

    The incoherent neutron scattering function for unbounded jump diffusion is calculated from random walk theory assuming a gaussian distribution of jump lengths. The method is then applied to calculate the scattering function for spatially bounded random jumps in one dimension. The dependence on momentum transfer of the quasi-elastic energy broadenings predicted by this model and a previous model for bounded one-dimensional continuous diffusion are calculated and compared with the predictions of models for diffusion in unbounded media. The one-dimensional solutions can readily be generalized to three dimensions to provide a description of quasi-elastic scattering of neutrons by molecules undergoing localized random motions. (author)

  18. Intravoxel incoherent motion (IVIM histogram biomarkers for prediction of neoadjuvant treatment response in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Gene Y. Cho

    Full Text Available Objective: To examine the prognostic capabilities of intravoxel incoherent motion (IVIM metrics and their ability to predict response to neoadjuvant treatment (NAT. Additionally, to observe changes in IVIM metrics between pre- and post-treatment MRI. Methods: This IRB-approved, HIPAA-compliant retrospective study observed 31 breast cancer patients (32 lesions. Patients underwent standard bilateral breast MRI along with diffusion-weighted imaging before and after NAT. Six patients underwent an additional IVIM-MRI scan 12–14 weeks after initial scan and 2 cycles of treatment. In addition to apparent diffusion coefficients (ADC from monoexponential decay, IVIM mean values (tissue diffusivity Dt, perfusion fraction fp, and pseudodiffusivity Dp and histogram metrics were derived using a biexponential model. An additional filter identified voxels of highly vascular tumor tissue (VTT, excluding necrotic or normal tissue. Clinical data include histology of biopsy and clinical response to treatment through RECIST assessment. Comparisons of treatment response were made using Wilcoxon rank-sum tests. Results: Average, kurtosis, and skewness of pseudodiffusion Dp significantly differentiated RECIST responders from nonresponders. ADC and Dt values generally increased (∼70% and VTT% values generally decreased (∼20% post-treatment. Conclusion: Dp metrics showed prognostic capabilities; slow and heterogeneous pseudodiffusion offer poor prognosis. Baseline ADC/Dt parameters were not significant predictors of response. This work suggests that IVIM mean values and heterogeneity metrics may have prognostic value in the setting of breast cancer NAT. Keywords: Breast cancer, Diffusion weighted MRI, Intravoxel incoherent motion, Neoadjuvant treatment, Response evaluation criteria in solid tumors

  19. Intravoxel incoherent motion magnetic resonance imaging to predict vesicoureteral reflux in children with urinary tract infection

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jeong Woo; Lee, Chang Hee; Park, Yang Shin; Kim, Kyeong Ah; Park, Cheol Min [Korea University College of Medicine, Departments of Radiology, Korea University Guro Hospital, 80 Guro-dong, Guro-gu, Seoul (Korea, Republic of); Yoo, Kee Hwan [Korea University College of Medicine, Departments of Pediatrics, Korea University Guro Hospital, Seoul (Korea, Republic of); Je, Bo-Kyung [Korea University College of Medicine, Department of Radiology, Korea University Ansan Hospital, Seoul (Korea, Republic of); Kiefer, Berthold [Oncology Application Development, Siemens Healthcare, Erlangen (Germany)

    2016-06-15

    To compare the diffusion parameters of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) between the ''reflux'' and the ''non-reflux'' kidneys, and to evaluate the feasibility of using IVIM DWI to predict vesicoureteral reflux (VUR) in children with a urinary tract infection (UTI). Eighty-three kidneys from 57 pediatric patients with a UTI were classified into ''reflux'' and ''non-reflux'' groups according to voiding cystourethrography (VCUG) results. The apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (PF) were measured and compared in the renal pelvis of both groups. Four indices (D*/ADC, PF/ADC, D*/D, and PF/D) were calculated and receiver operating characteristic (ROC) curve analyses were performed. VURs were detected on VCUG in 21 kidneys. PF and D* were significantly higher in the ''reflux'' group than in the ''non-reflux'' group. The indices were all significantly higher. The PF/D index showed the best diagnostic performance in predicting VUR in children with UTI (A{sub z} = 0.864). PF and D* were significantly higher in the ''reflux'' kidney than in the ''non-reflux'' kidney. Our new index (PF/D) could prove useful for predicting VUR. (orig.)

  20. Intravoxel incoherent motion perfusion imaging in acute stroke: initial clinical experience

    International Nuclear Information System (INIS)

    Federau, C.; Becce, F.; Maeder, P.; Meuli, R.; Sumer, S.; Wintermark, M.; O'Brien, K.

    2014-01-01

    Intravoxel incoherent motion (IVIM) imaging is an MRI perfusion technique that uses a diffusion-weighted sequence with multiple b values and a bi-compartmental signal model to measure the so-called pseudo-diffusion of blood caused by its passage through the microvascular network. The goal of the current study was to assess the feasibility of IVIM perfusion fraction imaging in patients with acute stroke. Images were collected in 17 patients with acute stroke. Exclusion criteria were onset of symptoms to imaging >5 days, hemorrhagic transformation, infratentorial lesions, small lesions 2 . Image quality was assessed by two radiologists, and quantitative analysis was performed in regions of interest placed in the stroke area, defined by thresholding the apparent diffusion coefficient maps, as well as in the contralateral region. IVIM perfusion fraction maps showed an area of decreased perfusion fraction f in the region of decreased apparent diffusion coefficient. Quantitative analysis showed a statistically significant decrease in both IVIM perfusion fraction f (0.026 ± 0.019 vs. 0.056 ± 0.025, p = 2.2 . 10 -6 ) and diffusion coefficient D compared with the contralateral side (3.9 ± 0.79 . 10 -4 vs. 7.5 ± 0.86 . 10 -4 mm 2 /s, p = 1.3 . 10 -20 ). IVIM perfusion fraction imaging is feasible in acute stroke. IVIM perfusion fraction is significantly reduced in the visible infarct. Further studies should evaluate the potential for IVIM to predict clinical outcome and treatment response. (orig.)

  1. Intravoxel incoherent motion magnetic resonance imaging to predict vesicoureteral reflux in children with urinary tract infection

    International Nuclear Information System (INIS)

    Kim, Jeong Woo; Lee, Chang Hee; Park, Yang Shin; Kim, Kyeong Ah; Park, Cheol Min; Yoo, Kee Hwan; Je, Bo-Kyung; Kiefer, Berthold

    2016-01-01

    To compare the diffusion parameters of intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) between the ''reflux'' and the ''non-reflux'' kidneys, and to evaluate the feasibility of using IVIM DWI to predict vesicoureteral reflux (VUR) in children with a urinary tract infection (UTI). Eighty-three kidneys from 57 pediatric patients with a UTI were classified into ''reflux'' and ''non-reflux'' groups according to voiding cystourethrography (VCUG) results. The apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (PF) were measured and compared in the renal pelvis of both groups. Four indices (D*/ADC, PF/ADC, D*/D, and PF/D) were calculated and receiver operating characteristic (ROC) curve analyses were performed. VURs were detected on VCUG in 21 kidneys. PF and D* were significantly higher in the ''reflux'' group than in the ''non-reflux'' group. The indices were all significantly higher. The PF/D index showed the best diagnostic performance in predicting VUR in children with UTI (A z = 0.864). PF and D* were significantly higher in the ''reflux'' kidney than in the ''non-reflux'' kidney. Our new index (PF/D) could prove useful for predicting VUR. (orig.)

  2. Subtype differentiation of renal tumors using voxel-based histogram analysis of intravoxel incoherent motion parameters.

    Science.gov (United States)

    Gaing, Byron; Sigmund, Eric E; Huang, William C; Babb, James S; Parikh, Nainesh S; Stoffel, David; Chandarana, Hersh

    2015-03-01

    The aim of this study was to determine if voxel-based histogram analysis of intravoxel incoherent motion imaging (IVIM) parameters can differentiate various subtypes of renal tumors, including benign and malignant lesions. A total of 44 patients with renal tumors who underwent surgery and had histopathology available were included in this Health Insurance Portability and Accountability Act-compliant, institutional review board-approved, single-institution prospective study. In addition to routine renal magnetic resonance imaging examination performed on a 1.5-T system, all patients were imaged with axial diffusion-weighted imaging using 8 b values (range, 0-800 s/mm). A biexponential model was fitted to the diffusion signal data using a segmented algorithm to extract the IVIM parameters perfusion fraction (fp), tissue diffusivity (Dt), and pseudodiffusivity (Dp) for each voxel. Mean and histogram measures of heterogeneity (standard deviation, skewness, and kurtosis) of IVIM parameters were correlated with pathology results of tumor subtype using unequal variance t tests to compare subtypes in terms of each measure. Correction for multiple comparisons was accomplished using the Tukey honestly significant difference procedure. A total of 44 renal tumors including 23 clear cell (ccRCC), 4 papillary (pRCC), 5 chromophobe, and 5 cystic renal cell carcinomas, as well as benign lesions, 4 oncocytomas (Onc) and 3 angiomyolipomas (AMLs), were included in our analysis. Mean IVIM parameters fp and Dt differentiated 8 of 15 pairs of renal tumors. Histogram analysis of IVIM parameters differentiated 9 of 15 subtype pairs. One subtype pair (ccRCC vs pRCC) was differentiated by mean analysis but not by histogram analysis. However, 2 other subtype pairs (AML vs Onc and ccRCC vs Onc) were differentiated by histogram distribution parameters exclusively. The standard deviation of Dt [σ(Dt)] differentiated ccRCC (0.362 ± 0.136 × 10 mm/s) from AML (0.199 ± 0.043 × 10 mm/s) (P = 0

  3. Full counting statistics of multiple Andreev reflections in incoherent diffusive superconducting junctions

    International Nuclear Information System (INIS)

    Samuelsson, P.

    2007-01-01

    We present a theory for the full distribution of current fluctuations in incoherent diffusive superconducting junctions, subjected to a voltage bias. This theory of full counting statistics of incoherent multiple Andreev reflections is valid for an arbitrary applied voltage. We present a detailed discussion of the properties of the first four cumulants as well as the low and high voltage regimes of the full counting statistics. (orig.)

  4. Intravoxel incoherent motion (IVIM) DWI of the liver. Pre-and postprandial comparison

    International Nuclear Information System (INIS)

    Hirose, Junji; Satou, Yuuichi; Amemiya, Ryoji; Yoda, Yoshioki; Motosugi, Utaroh

    2013-01-01

    We evaluated if meal intake changes the diffusivity result calculated using the intravoxel incoherent motion (IVIM) model and the portal flow velocity measured by phase contrast magnetic resonance (MR) imaging. We asked 3 healthy volunteers to eat 794-kcal meals and acquired MR images before and 20 minutes after the meal using a 1.5-tesla clinical MR scanner. We acquired 2-dimensional (2D) phase contrast (PC) gradient echo MR images to measure portal flow and diffusion-weighted images to calculate diffusivity results using the IVIM model and b-values of 0, 10, 20, 30, 40, 50, 70, 100, 200, 400, and 800 s/mm 2 . Portal flow was greater after the meal than (before): Volunteer A, 16.1 cm/s (9.7 cm/s); B, 18.0 cm/s (12.8 cm/s); and C, 18.3 cm/s (11.7 cm/s). The diffusivity results of D * and f were also increased after the meal in all 3 volunteers. D * and f values before and (after) the meal were: Volunteer A, 97.1 and 0.14 (149.6 and 0.20); Volunteer B, 79.4 and 0.20 (183.4 and 0.21); and Volunteer C, 29.4 and 0.19 (132.7 and 0.20). The trend in apparent diffusion coefficient (ADC) and D values were inconsistent among the 3 volunteers. The higher D * and f values in the liver after eating calculated using the IVIM model indicated increased portal flow due to the meal. (author)

  5. Intravoxel incoherent motion magnetic resonance imaging of the knee joint in children with juvenile idiopathic arthritis

    Energy Technology Data Exchange (ETDEWEB)

    Hilbert, Fabian; Sauer, Alexander; Koestler, Herbert [University Hospital Wuerzburg, Department of Diagnostic and Interventional Radiology, Wuerzburg (Germany); Holl-Wieden, Annette [University Hospital Wuerzburg, Department of Paediatrics, Wuerzburg (Germany); Neubauer, Henning [University Hospital Wuerzburg, Department of Diagnostic and Interventional Radiology, Wuerzburg (Germany); University Hospital Ulm, Department of Diagnostic and Interventional Radiology, Ulm (Germany)

    2017-05-15

    MRI of synovitis relies on use of a gadolinium-based contrast agent. Diffusion-weighted MRI (DWI) visualises thickened synovium but is of limited use in the presence of joint effusion. To investigate the feasibility and diagnostic accuracy of diffusion-weighted MRI with intravoxel incoherent motion (IVIM) for diagnosing synovitis in the knee joint of children with juvenile idiopathic arthritis. Twelve consecutive children with confirmed or suspected juvenile idiopathic arthritis (10 girls, median age 11 years) underwent MRI with contrast-enhanced T1-weighted imaging and DWI at 1.5 T. Read-out segmented multi-shot DWI was acquired at b values of 0 s/mm{sup 2}, 200 s/mm{sup 2}, 400 s/mm{sup 2} and 800 s/mm{sup 2}. We calculated the IVIM parameters perfusion fraction (f) and tissue diffusion coefficient (D). Diffusion-weighted images at b=800 s/mm{sup 2}, f parameter maps and post-contrast T1-weighted images were retrospectively assessed by two independent readers for synovitis using the Juvenile Arthritis MRI Scoring system. Seven (58%) children showed synovial hypertrophy on contrast-enhanced imaging. Diagnostic ratings for synovitis on DWI and on f maps were fully consistent with contrast-enhanced imaging, the diagnostic reference. Two children had equivocal low-confidence assessments on DWI. Median f was 6.7±2.0% for synovitis, 2.1±1.2% for effusion, 5.0±1.0% for muscle and 10.6±5.7% for popliteal lymph nodes. Diagnostic confidence was higher based on f maps in three (25%) children and lower in one child (8%), as compared to DWI. DWI with IVIM reliably visualises synovitis of the knee joint. Perfusion fraction maps differentiate thickened synovium from joint effusion and hence increase diagnostic confidence. (orig.)

  6. Feasibility of Intravoxel Incoherent Motion for Differentiating Benign and Malignant Thyroid Nodules.

    Science.gov (United States)

    Tan, Hui; Chen, Jun; Zhao, Yi Ling; Liu, Jin Huan; Zhang, Liang; Liu, Chang Sheng; Huang, Dongjie

    2018-06-13

    This study aimed to preliminarily investigate the feasibility of intravoxel incoherent motion (IVIM) theory in the differential diagnosis of benign and malignant thyroid nodules. Forty-five patients with 56 confirmed thyroid nodules underwent preoperative routine magnetic resonance imaging and IVIM diffusion-weighted imaging. The histopathologic diagnosis was confirmed by surgery. Apparent diffusion coefficient (ADC), perfusion fraction f, diffusivity D, and pseudo-diffusivity D* were quantified. Independent samples t test of IVIM-derived metrics were conducted between benign and malignant nodules. Receiver-operating characteristic analyses were performed to determine the optimal thresholds as well as the sensitivity and specificity for differentiating. Significant intergroup difference was observed in ADC, D, D*, and f (p < 0.001). Malignant tumors featured significantly lower ADC, D and D* values and a higher f value than that of benign nodules. The ADC, D, and D* could distinguish the benign from malignant thyroid nodules, and parameter f differentiate the malignant tumors from benign nodules. The values of the area under the curve for parameter ADC, D, and D* were 0.784 (p = 0.001), 0.795 (p = 0.001), and 0.850 (p < 0.001), separately, of which the area under the curve of f value was the maximum for identifying the malignant from benign nodules, which was 0.841 (p < 0.001). This study suggested that ADC and IVIM-derived metrics, including D, D*, and f, could potentially serve as noninvasive predictors for the preoperative differentiating of thyroid nodules, and f value performed best in identifying the malignant from benign nodules among these parameters. Copyright © 2018 Academic Radiology. Published by Elsevier Inc. All rights reserved.

  7. Assessment of cervical cancer with a parameter-free intravoxel incoherent motion imaging algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Becker, Anton S.; Wurnig, Moritz C.; Boss, Andreas; Ghafoor, Soleen [Institute of Diagnostic and Interventional Radiology, University Hospital of Zurich, Zurich (Switzerland); Perucho, Jose A.; Khong, Pek Lan; Lee, Elaine Y. P. [Dept. of Diagnostic Radiology, The University of Hong Kong, Hong Kong (China)

    2017-06-15

    To evaluate the feasibility of a parameter-free intravoxel incoherent motion (IVIM) approach in cervical cancer, to assess the optimal b-value threshold, and to preliminarily examine differences in the derived perfusion and diffusion parameters for different histological cancer types. After Institutional Review Board approval, 19 female patients (mean age, 54 years; age range, 37–78 years) gave consent and were enrolled in this prospective magnetic resonance imaging study. Clinical staging and biopsy results were obtained. Echo-planar diffusion weighted sequences at 13 b-values were acquired at 3 tesla field strength. Single-sliced region-of-interest IVIM analysis with adaptive b-value thresholds was applied to each tumor, yielding the optimal fit and the optimal parameters for pseudodiffusion (D*), perfusion fraction (Fp) and diffusion coefficient (D). Monoexponential apparent diffusion coefficient (ADC) was calculated for comparison with D. Biopsy revealed squamous cell carcinoma in 10 patients and adenocarcinoma in 9. The b-value threshold (median [interquartile range]) depended on the histological type and was 35 (22.5–50) s/mm{sup 2} in squamous cell carcinoma and 150 (100–150) s/mm{sup 2} in adenocarcinoma (p < 0.05). Comparing squamous cell vs. adenocarcinoma, D* (45.1 [25.1–60.4] × 10{sup −3} mm{sup 2}/s vs. 12.4 [10.5–21.2] × 10{sup −3} mm{sup 2}/s) and Fp (7.5% [7.0–9.0%] vs. 9.9% [9.0–11.4%]) differed significantly between the subtypes (p < 0.02), whereas D did not (0.89 [0.75–0.94] × 10{sup −3} mm{sup 2}/s vs. 0.90 [0.82–0.97] × 10{sup −3} mm{sup 2}/s, p = 0.27). The residuals did not differ (0.74 [0.60–0.92] vs. 0.94 [0.67–1.01], p = 0.32). The ADC systematically underestimated the magnitude of diffusion restriction compared to D (p < 0.001). The parameter-free IVIM approach is feasible in cervical cancer. The b-value threshold and perfusion-related parameters depend on the tumor histology type.

  8. Intravoxel Incoherent Motion Metrics as Potential Biomarkers for Survival in Glioblastoma.

    Directory of Open Access Journals (Sweden)

    Josep Puig

    Full Text Available Intravoxel incoherent motion (IVIM is an MRI technique with potential applications in measuring brain tumor perfusion, but its clinical impact remains to be determined. We assessed the usefulness of IVIM-metrics in predicting survival in newly diagnosed glioblastoma.Fifteen patients with glioblastoma underwent MRI including spin-echo echo-planar DWI using 13 b-values ranging from 0 to 1000 s/mm2. Parametric maps for diffusion coefficient (D, pseudodiffusion coefficient (D*, and perfusion fraction (f were generated for contrast-enhancing regions (CER and non-enhancing regions (NCER. Regions of interest were manually drawn in regions of maximum f and on the corresponding dynamic susceptibility contrast images. Prognostic factors were evaluated by Kaplan-Meier survival and Cox proportional hazards analyses.We found that fCER and D*CER correlated with rCBFCER. The best cutoffs for 6-month survival were fCER>9.86% and D*CER>21.712 x10-3mm2/s (100% sensitivity, 71.4% specificity, 100% and 80% positive predictive values, and 80% and 100% negative predictive values; AUC:0.893 and 0.857, respectively. Treatment yielded the highest hazard ratio (5.484; 95% CI: 1.162-25.88; AUC: 0.723; P = 0.031; fCER combined with treatment predicted survival with 100% accuracy.The IVIM-metrics fCER and D*CER are promising biomarkers of 6-month survival in newly diagnosed glioblastoma.

  9. Assessing hepatic fibrosis: comparing the intravoxel incoherent motion in MRI with acoustic radiation force impulse imaging in US

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Chih-Horng; Liang, Po-Chin; Shih, Tiffany Ting-Fang [National Taiwan University Hospital, Department of Medical Imaging, Taipei (China); National Taiwan University College of Medicine, Department of Radiology, Taipei (China); Ho, Ming-Chih; Hu, Rey-Heng; Lai, Hong-Shiee [National Taiwan University Hospital and College of Medicine, Department of Surgery, Taipei (China); Jeng, Yung-Ming [National Taiwan University Hospital and College of Medicine, Department of Pathology, Taipei (China)

    2015-12-15

    This study compared the diagnostic performance of intravoxel incoherent motion (IVIM) in magnetic resonance imaging (MRI) and acoustic radiation force impulse imaging (ARFI) in ultrasound (US) for liver fibrosis (LF) evaluation. A total of 49 patients scheduled for liver surgery were recruited. LF in the non-tumorous liver parenchyma at the right lobe was estimated using a slow diffusion coefficient, fast diffusion coefficient (D{sub fast}), perfusion fraction (f) of the IVIM parameters, the total apparent diffusion coefficient of conventional diffusion-weighted imaging and the shear wave velocity (Vs) of ARFI. LF was graded using the Metavir scoring system on histological examination. The Spearman rank correlation coefficient for correlation and analysis of variance was used for determining difference. The diagnostic performance was compared using receiver operating characteristic curve analysis. LF exhibited significant correlation with the three parameters D{sub fast}, f, and Vs (r = -0.528, -0.337, and 0.481, respectively, P < 0.05). The D{sub fast} values in the F4 group were significantly lower than those in the F0, F1 and F2 groups. D{sub fast} exhibited a non-inferior performance for diagnosing all fibrosis grades compared with that of Vs. Both IVIM and ARFI provide reliable estimations for the noninvasive assessment of LF. (orig.)

  10. Structure and motion of junctions between coherent and incoherent twin boundaries in copper

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J.A. [Mechanical and Aerospace Engineering, University of California, Los Angeles, CA 90095 (United States); Ghoniem, N.M., E-mail: ghoniem@ucla.edu [Mechanical and Aerospace Engineering, University of California, Los Angeles, CA 90095 (United States)

    2009-09-15

    The atomic mechanisms of twin boundary migration in copper under externally applied mechanical loads and during thermal annealing are investigated utilizing molecular dynamics computer simulations. The migration dynamics of the incoherent {Sigma}=3[110](112) twin boundary (ITB), pinned between two {Sigma}=3[110](111) twin boundaries, is determined. A three-dimensional structural model is described for the junction between intersecting coherent and incoherent twin boundaries, and migration velocities are calculated under thermal annealing conditions. It is shown that the coherent twin boundary (CTB)/ITB junction results in breaking the crystal symmetry by creation of either an edge dislocation or a mixed (edge/screw) at the intersection. These two types of defects can lead to pronounced differences in the observed migration (and hence annealing) rates of ICT/CTB junctions. The annealing rate resulting from the migration of ITBs with a mixed dislocation is found to be more than twice that of the edge dislocation. The mechanism of ITB motion is shown to be governed by successive kink-like motion of neighboring atomic columns, each of which is shifted by 1/4[1 1 0], followed by structural relaxation to accommodate boundary motion.

  11. Structure and motion of junctions between coherent and incoherent twin boundaries in copper

    International Nuclear Information System (INIS)

    Brown, J.A.; Ghoniem, N.M.

    2009-01-01

    The atomic mechanisms of twin boundary migration in copper under externally applied mechanical loads and during thermal annealing are investigated utilizing molecular dynamics computer simulations. The migration dynamics of the incoherent Σ=3[110](112) twin boundary (ITB), pinned between two Σ=3[110](111) twin boundaries, is determined. A three-dimensional structural model is described for the junction between intersecting coherent and incoherent twin boundaries, and migration velocities are calculated under thermal annealing conditions. It is shown that the coherent twin boundary (CTB)/ITB junction results in breaking the crystal symmetry by creation of either an edge dislocation or a mixed (edge/screw) at the intersection. These two types of defects can lead to pronounced differences in the observed migration (and hence annealing) rates of ICT/CTB junctions. The annealing rate resulting from the migration of ITBs with a mixed dislocation is found to be more than twice that of the edge dislocation. The mechanism of ITB motion is shown to be governed by successive kink-like motion of neighboring atomic columns, each of which is shifted by 1/4[1 1 0], followed by structural relaxation to accommodate boundary motion.

  12. Simulation of spatially varying ground motions including incoherence, wave‐passage and differential site‐response effects

    DEFF Research Database (Denmark)

    Konakli, Katerina; Der Kiureghian, Armen

    2012-01-01

    A method is presented for simulating arrays of spatially varying ground motions, incorporating the effects of incoherence, wave passage, and differential site response. Non‐stationarity is accounted for by considering the motions as consisting of stationary segments. Two approaches are developed....

  13. Seismic soil-structure interaction with consideration of spatial incoherence of seismic ground motions: A case study

    Energy Technology Data Exchange (ETDEWEB)

    Tseng, Wen S., E-mail: wen.tseng@rizzoassoc.com [Paul C. Rizzo Associates, Inc., Western Region, 2201 Broadway, Suite 400, Oakland, CA 94612 (United States); Lilhanand, Kiat; Hamasaki, Don; Garcia, Julio A. [Paul C. Rizzo Associates, Inc., Western Region, 2201 Broadway, Suite 400, Oakland, CA 94612 (United States); Srinivasan, Ram [AREVA, NP, Inc., 6399 San Ignacio Avenue, San Jose, CA 95119 (United States)

    2014-04-01

    This paper presents a case study of seismic soil-structure interaction (SSI) analysis with consideration of spatial incoherence of seismic input ground motions. The SSI analyses were performed using the SASSI computer program for the Auxiliary Control Building (ACB) structure of an existing nuclear power plant on a hard rock site located in the Center and Eastern United States (CEUS) region. The incoherent seismic input motions for the hard rock site used for the analyses were generated using the computer program INCOH that works together with SASSI. The objective of the analyses was to generate maximum seismic response parameters for assessment of potential impact of newly developed site-specific (ground motion) response spectra (SSRS) on the seismic design of the ACB and potential benefits that could be gained by considering spatial incoherence of seismic input motions. Maximum seismic response values for selected response parameters of interest were generated with both SSRS-compatible coherent and incoherent seismic input motions. Comparisons were made of the corresponding maximum response parameter values and in-structure (acceleration) response spectra (ISRS) generated for both the coherent and incoherent motion inputs. These comparisons indicate that, by incorporating incoherence of ground motions in the seismic input, the maximum response values reduces and the ISRS peak amplitudes in the high frequency range (>10 Hz) also reduce from the corresponding response values resulting from the coherent motion input. The amount of ISRS-amplitude reduction increases as the spectral frequency increases, as expected. Such reductions can be as much as 20–50%. This case study demonstrates that, for a CEUS hard rock site where relatively high high-frequency in the seismic input response spectra exist, consideration of spatial incoherence of input motions would result in substantial benefits in reducing the high-frequency seismic responses. Such benefits are especially

  14. Probabilistic and deterministic soil structure interaction analysis including ground motion incoherency effects

    International Nuclear Information System (INIS)

    Elkhoraibi, T.; Hashemi, A.; Ostadan, F.

    2014-01-01

    Soil-structure interaction (SSI) is a major step for seismic design of massive and stiff structures typical of the nuclear facilities and civil infrastructures such as tunnels, underground stations, dams and lock head structures. Currently most SSI analyses are performed deterministically, incorporating limited range of variation in soil and structural properties and without consideration of the ground motion incoherency effects. This often leads to overestimation of the seismic response particularly the In-Structure-Response Spectra (ISRS) with significant impositions of design and equipment qualification costs, especially in the case of high-frequency sensitive equipment at stiff soil or rock sites. The reluctance to incorporate a more comprehensive probabilistic approach is mainly due to the fact that the computational cost of performing probabilistic SSI analysis even without incoherency function considerations has been prohibitive. As such, bounding deterministic approaches have been preferred by the industry and accepted by the regulatory agencies. However, given the recently available and growing computing capabilities, the need for a probabilistic-based approach to the SSI analysis is becoming clear with the advances in performance-based engineering and the utilization of fragility analysis in the decision making process whether by the owners or the regulatory agencies. This paper demonstrates the use of both probabilistic and deterministic SSI analysis techniques to identify important engineering demand parameters in the structure. A typical nuclear industry structure is used as an example for this study. The system is analyzed for two different site conditions: rock and deep soil. Both deterministic and probabilistic SSI analysis approaches are performed, using the program SASSI, with and without ground motion incoherency considerations. In both approaches, the analysis begins at the hard rock level using the low frequency and high frequency hard rock

  15. Probabilistic and deterministic soil structure interaction analysis including ground motion incoherency effects

    Energy Technology Data Exchange (ETDEWEB)

    Elkhoraibi, T., E-mail: telkhora@bechtel.com; Hashemi, A.; Ostadan, F.

    2014-04-01

    Soil-structure interaction (SSI) is a major step for seismic design of massive and stiff structures typical of the nuclear facilities and civil infrastructures such as tunnels, underground stations, dams and lock head structures. Currently most SSI analyses are performed deterministically, incorporating limited range of variation in soil and structural properties and without consideration of the ground motion incoherency effects. This often leads to overestimation of the seismic response particularly the In-Structure-Response Spectra (ISRS) with significant impositions of design and equipment qualification costs, especially in the case of high-frequency sensitive equipment at stiff soil or rock sites. The reluctance to incorporate a more comprehensive probabilistic approach is mainly due to the fact that the computational cost of performing probabilistic SSI analysis even without incoherency function considerations has been prohibitive. As such, bounding deterministic approaches have been preferred by the industry and accepted by the regulatory agencies. However, given the recently available and growing computing capabilities, the need for a probabilistic-based approach to the SSI analysis is becoming clear with the advances in performance-based engineering and the utilization of fragility analysis in the decision making process whether by the owners or the regulatory agencies. This paper demonstrates the use of both probabilistic and deterministic SSI analysis techniques to identify important engineering demand parameters in the structure. A typical nuclear industry structure is used as an example for this study. The system is analyzed for two different site conditions: rock and deep soil. Both deterministic and probabilistic SSI analysis approaches are performed, using the program SASSI, with and without ground motion incoherency considerations. In both approaches, the analysis begins at the hard rock level using the low frequency and high frequency hard rock

  16. Angular distribution of diffuse reflectance from incoherent multiple scattering in turbid media.

    Science.gov (United States)

    Gao, M; Huang, X; Yang, P; Kattawar, G W

    2013-08-20

    The angular distribution of diffuse reflection is elucidated with greater understanding by studying a homogeneous turbid medium. We modeled the medium as an infinite slab and studied the reflection dependence on the following three parameters: the incident direction, optical depth, and asymmetry factor. The diffuse reflection is produced by incoherent multiple scattering and is solved through radiative transfer theory. At large optical depths, the angular distribution of the diffuse reflection with small incident angles is similar to that of a Lambertian surface, but, with incident angles larger than 60°, the angular distributions have a prominent reflection peak around the specular reflection angle. These reflection peaks are found originating from the scattering within one transport mean free path in the top layer of the medium. The maximum reflection angles for different incident angles are analyzed and can characterize the structure of angular distributions for different asymmetry factors and optical depths. The properties of the angular distribution can be applied to more complex systems for a better understanding of diffuse reflection.

  17. The effect of, within the sphere confined, particle diffusion on the line shape of incoherent cold neutron scattering spectra

    International Nuclear Information System (INIS)

    Cvikl, B.; Dahlborg, U.; Calvo-Dahlborg, M.

    1999-01-01

    Based upon the model of particles diffusion within the sphere of partially absorbing boundaries, the possibilities of the detection, by the incoherent cold neutron scattering method, of particle precipitation on the boundary walls, has been investigated. The calculated scattering law as a function of the boundary absorption properties exhibits distinct characteristic which might, under favorable conditions, make such an experimental attempt feasible.(author)

  18. Optimization of intra-voxel incoherent motion imaging at 3.0 Tesla for fast liver examination.

    Science.gov (United States)

    Leporq, Benjamin; Saint-Jalmes, Hervé; Rabrait, Cecile; Pilleul, Frank; Guillaud, Olivier; Dumortier, Jérôme; Scoazec, Jean-Yves; Beuf, Olivier

    2015-05-01

    Optimization of multi b-values MR protocol for fast intra-voxel incoherent motion imaging of the liver at 3.0 Tesla. A comparison of four different acquisition protocols were carried out based on estimated IVIM (DSlow , DFast , and f) and ADC-parameters in 25 healthy volunteers. The effects of respiratory gating compared with free breathing acquisition then diffusion gradient scheme (simultaneous or sequential) and finally use of weighted averaging for different b-values were assessed. An optimization study based on Cramer-Rao lower bound theory was then performed to minimize the number of b-values required for a suitable quantification. The duration-optimized protocol was evaluated on 12 patients with chronic liver diseases No significant differences of IVIM parameters were observed between the assessed protocols. Only four b-values (0, 12, 82, and 1310 s.mm(-2) ) were found mandatory to perform a suitable quantification of IVIM parameters. DSlow and DFast significantly decreased between nonadvanced and advanced fibrosis (P < 0.05 and P < 0.01) whereas perfusion fraction and ADC variations were not found to be significant. Results showed that IVIM could be performed in free breathing, with a weighted-averaging procedure, a simultaneous diffusion gradient scheme and only four optimized b-values (0, 10, 80, and 800) reducing scan duration by a factor of nine compared with a nonoptimized protocol. Preliminary results have shown that parameters such as DSlow and DFast based on optimized IVIM protocol can be relevant biomarkers to distinguish between nonadvanced and advanced fibrosis. © 2014 Wiley Periodicals, Inc.

  19. Early evaluation of irradiated parotid glands with intravoxel incoherent motion MR imaging: correlation with dynamic contrast-enhanced MR imaging

    International Nuclear Information System (INIS)

    Zhou, Nan; Chu, Chen; Dou, Xin; Li, Ming; Liu, Song; Zhu, Lijing; Liu, Baorui; Guo, Tingting; Chen, Weibo; He, Jian; Yan, Jing; Zhou, Zhengyang; Yang, Xiaofeng; Liu, Tian

    2016-01-01

    Radiation-induced parotid damage is one of the most common complications in patients with nasopharyngeal carcinoma (NPC) undergoing radiotherapy (RT). Intravoxel incoherent motion (IVIM) magnetic resonance (MR) imaging has been reported for evaluating irradiated parotid damage. However, the changes of IVIM perfusion-related parameters in irradiated parotid glands have not been confirmed by conventional perfusion measurements obtained from dynamic contrast-enhanced (DCE) MR imaging. The purposes of this study were to monitor radiation-induced parotid damage using IVIM and DCE MR imaging and to investigate the correlations between changes of these MR parameters. Eighteen NPC patients underwent bilateral parotid T1-weighted, IVIM and DCE MR imaging pre-RT (2 weeks before RT) and post-RT (4 weeks after RT). Parotid volume; IVIM MR parameters, including apparent diffusion coefficient (ADC), pure diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (f); and DCE MR parameters, including maximum relative enhancement (MRE), time to peak (TTP), Wash in Rate, and the degree of xerostomia were recorded. Correlations of parotid MR parameters with mean radiation dose, atrophy rate and xerostomia degree, as well as the relationships between IVIM and DCE MR parameters, were investigated. From pre-RT to post-RT, all of the IVIM and DCE MR parameters increased significantly (p < 0.001 for ADC, D, f, MRE, Wash in Rate; p = 0.024 for D*; p = 0.037 for TTP). Change rates of ADC, f and MRE were negatively correlated with atrophy rate significantly (all p < 0.05). Significant correlations were observed between the change rates of D* and MRE (r = 0.371, p = 0.026) and between the change rates of D* and TTP (r = 0.396, p = 0.017). The intra- and interobserver reproducibility of IVIM and DCE MR parameters was good to excellent (intraclass correlation coefficient, 0.633–0.983). Early radiation-induced changes of parotid glands could be evaluated by IVIM and

  20. Evaluation of breast cancer using intravoxel incoherent motion (IVIM) histogram analysis: comparison with malignant status, histological subtype, and molecular prognostic factors.

    Science.gov (United States)

    Cho, Gene Young; Moy, Linda; Kim, Sungheon G; Baete, Steven H; Moccaldi, Melanie; Babb, James S; Sodickson, Daniel K; Sigmund, Eric E

    2016-08-01

    To examine heterogeneous breast cancer through intravoxel incoherent motion (IVIM) histogram analysis. This HIPAA-compliant, IRB-approved retrospective study included 62 patients (age 48.44 ± 11.14 years, 50 malignant lesions and 12 benign) who underwent contrast-enhanced 3 T breast MRI and diffusion-weighted imaging. Apparent diffusion coefficient (ADC) and IVIM biomarkers of tissue diffusivity (Dt), perfusion fraction (fp), and pseudo-diffusivity (Dp) were calculated using voxel-based analysis for the whole lesion volume. Histogram analysis was performed to quantify tumour heterogeneity. Comparisons were made using Mann-Whitney tests between benign/malignant status, histological subtype, and molecular prognostic factor status while Spearman's rank correlation was used to characterize the association between imaging biomarkers and prognostic factor expression. The average values of the ADC and IVIM biomarkers, Dt and fp, showed significant differences between benign and malignant lesions. Additional significant differences were found in the histogram parameters among tumour subtypes and molecular prognostic factor status. IVIM histogram metrics, particularly fp and Dp, showed significant correlation with hormonal factor expression. Advanced diffusion imaging biomarkers show relationships with molecular prognostic factors and breast cancer malignancy. This analysis reveals novel diagnostic metrics that may explain some of the observed variability in treatment response among breast cancer patients. • Novel IVIM biomarkers characterize heterogeneous breast cancer. • Histogram analysis enables quantification of tumour heterogeneity. • IVIM biomarkers show relationships with breast cancer malignancy and molecular prognostic factors.

  1. Prediction of the treatment outcome using intravoxel incoherent motion and diffusional kurtosis imaging in nasal or sinonasal squamous cell carcinoma patients

    Energy Technology Data Exchange (ETDEWEB)

    Fujima, Noriyuki; Yoshida, Daisuke; Tsukahara, Akiko; Shimizu, Yukie; Kudo, Kohsuke [Hokkaido University Hospital, Department of Diagnostic and Interventional Radiology, Sapporo, Hokkaido (Japan); Sakashita, Tomohiro; Homma, Akihiro [Hokkaido University Graduate School of Medicine, Department of Otolaryngology-Head and Neck Surgery, Sapporo (Japan); Tha, Khin Khin; Shirato, Hiroki [Hokkaido University Graduate School of Medicine, Department of Radiation Medicine, Sapporo (Japan); Global Institution for Collaborative Research and Education, The Global Station for Quantum Medical Science and Engineering, Sapporo (Japan)

    2017-03-15

    To evaluate the diagnostic value of intravoxel incoherent motion (IVIM) and diffusional kurtosis imaging (DKI) parameters in nasal or sinonasal squamous cell carcinoma (SCC) patients to determine local control/failure. Twenty-eight patients were evaluated. MR acquisition used single-shot spin-echo EPI with 12 b-values. Quantitative parameters (mean value, 25th, 50th and 75th percentiles) of IVIM (perfusion fraction f, pseudo-diffusion coefficient D*, and true-diffusion coefficient D), DKI (kurtosis value K, kurtosis corrected diffusion coefficient D{sub k}) and apparent diffusion coefficient (ADC) were calculated. Parameter values at both the pretreatment and early-treatment period, and the percentage change between these two periods were obtained. Multivariate logistic regression analysis: the percentage changes of D (mean, 25th, 50th, 75th), K (mean, 50th, 75th), Dk (mean, 25th, 50th), and ADC (mean, 25th, 50th) were predictors of local control. ROC curve analysis: the parameter with the highest accuracy = the percentage change of D value with the histogram 25th percentile (0.93 diagnostic accuracy). Multivariate Cox regression analyses: the percentage changes of D (mean, 25th, 50th), K (mean, 50th, 75th), Dk (mean, 25th, 50th) and ADC (mean, 25th, 50th) are predictors. IVIM and DKI parameters, especially the D-value's histogram 25th percentile, are useful for predicting local control. (orig.)

  2. Initial experience of correlating parameters of intravoxel incoherent motion and dynamic contrast-enhanced magnetic resonance imaging at 3.0 T in nasopharyngeal carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Qian-Jun; Zhang, Shui-Xing; Chen, Wen-Bo; Liang, Long; Zhou, Zheng-Gen; Liu, Zai-Yi; Zeng, Qiong-Xin; Liang, Chang-Hong [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, Guangzhou, Guangdong Province (China); Qiu, Qian-Hui [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Otolaryngology, Guangzhou, Guangdong Province (China)

    2014-12-15

    To determine the correlation between intravoxel incoherent motion (IVIM) and dynamic contrast-enhanced (DCE) magnetic resonance imaging (MRI) parameters. Thirty-eight newly diagnosed NPC patients were prospectively enrolled. Diffusion-weighted images (DWI) at 13 b-values were acquired using a 3.0-T MRI system. IVIM parameters including the pure molecular diffusion (D), perfusion-related diffusion (D*), perfusion fraction (f), DCE-MRI parameters including maximum slope of increase (MSI), enhancement amplitude (EA) and enhancement ratio (ER) were calculated by two investigators independently. Intra- and interobserver agreement were evaluated using the intraclass correlation coefficient (ICC) and Bland-Altman analysis. Relationships between IVIM and DCE-MRI parameters were evaluated by calculation of Spearman's correlation coefficient. Intra- and interobserver reproducibility were excellent to relatively good (ICC = 0.887-0.997; narrow width of 95 % limits of agreement). The highest correlation was observed between f and EA (r = 0.633, P < 0.001), with a strong correlation between f and MSI (r = 0.598, P = 0.001). No correlation was observed between f and ER (r = -0.162; P = 0.421) or D* and DCE parameters (r = 0.125-0.307; P > 0.119). This study suggests IVIM perfusion imaging using 3.0-T MRI is feasible in NPC, and f correlates significantly with EA and MSI. (orig.)

  3. Charged-particle incoherent-motion damping in storage rings by means of dissipative elements

    International Nuclear Information System (INIS)

    Derbenev, Ya.S.; Khejfets, S.A.

    1979-01-01

    In consecutive order a possibility of damping of beam incoherent oscillations in a storage ring was studied by means of an external dissipative system in a sufficient common case. It is shown, that a useful effect, as for the case of electron cooling, is one-particle effect of particle oscillations damping due to nonconservatism of its interaction with an external system. Each other mutual influence through the external system becomes significant with increasing beam density and results in the limitation to achievable damping decrements

  4. Liver fibrosis: in vivo evaluation using intravoxel incoherent motion-derived histogram metrics with histopathologic findings at 3.0 T.

    Science.gov (United States)

    Hu, Fubi; Yang, Ru; Huang, Zixing; Wang, Min; Zhang, Hanmei; Yan, Xu; Song, Bin

    2017-12-01

    To retrospectively determine the feasibility of intravoxel incoherent motion (IVIM) imaging based on histogram analysis for the staging of liver fibrosis (LF) using histopathologic findings as the reference standard. 56 consecutive patients (14 men, 42 women; age range, 15-76, years) with chronic liver diseases (CLDs) were studied using IVIM-DWI with 9 b-values (0, 25, 50, 75, 100, 150, 200, 500, 800 s/mm 2 ) at 3.0 T. Fibrosis stage was evaluated using the METAVIR scoring system. Histogram metrics including mean, standard deviation (Std), skewness, kurtosis, minimum (Min), maximum (Max), range, interquartile (Iq) range, and percentiles (10, 25, 50, 75, 90th) were extracted from apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudo-diffusion coefficient (D*), and perfusion fraction (f) maps. All histogram metrics among different fibrosis groups were compared using one-way analysis of variance or nonparametric Kruskal-Wallis test. For significant parameters, receivers operating characteristic curve (ROC) analyses were further performed for the staging of LF. Based on their METAVIR stage, the 56 patients were reclassified into three groups as follows: F0-1 group (n = 25), F2-3 group (n = 21), and F4 group (n = 10). The mean, Iq range, percentiles (50, 75, and 90th) of D* maps between the groups were significant differences (all P histogram metrics of ADC, D, and f maps demonstrated no significant difference among the groups (all P > 0.05). Histogram analysis of D* map derived from IVIM can be used to stage liver fibrosis in patients with CLDs and provide more quantitative information beyond the mean value.

  5. Toward a non-invasive screening tool for differentiation of pancreatic lesions based on intra-voxel incoherent motion derived parameters

    Energy Technology Data Exchange (ETDEWEB)

    Graf, Markus; Simon, Dirk; Mang, Sarah [Deutsches Krebsforschungszentrum (DKFZ), Heidelberg (Germany). Software Development for Integrated Therapy and Diagnostics; Lemke, Andreas [Heidelberg Univ., Mannheim (Germany). Dept. of Computer Assisted Clinical Medicine; Gruenberg, Katharina [Deutsches Krebsforschungszentrum (DKFZ), Heidelberg (Germany). Dept. of Radiology

    2013-03-01

    Early recognition of and differential diagnosis between pancreatic cancer and chronic pancreatitis is an important step in successful therapy. Parameters of the IVIM (intra-voxel incoherent motion) theory can be used to differentiate between those lesions. The objective of this work is to evaluate the effects of rigid image registration on IVIM derived parameters for differentiation of pancreatic lesions such as pancreatic cancer and solid mass forming pancreatitis. The effects of linear image registration methods on reproducibility and accuracy of IVIM derived parameters were quantified on MR images of ten volunteers. For this purpose, they were evaluated statistically by comparison of registered and unregistered parameter data. Further, the perfusion fraction f was used to differentiate pancreatic lesions on eleven previously diagnosed patient data sets. Its diagnostic power with and without rigid registration was evaluated using receiver operating curves (ROC) analysis. The pancreas was segmented manually on MR data sets of healthy volunteers as well as the patients showing solid pancreatic lesions. Diffusion weighted imaging was performed in 10 blocks of breath-hold phases. Linear registration of the weighted image stack leads to a 3.7% decrease in variability of the IVIM derived parameter f due to an improved anatomical overlap of 5%. Consequently, after registration the area under the curve in the ROC-analysis for the differentiation approach increased by 2.7%. In conclusion, rigid registration improves the differentiation process based on f-values. (orig.)

  6. Toward a non-invasive screening tool for differentiation of pancreatic lesions based on intra-voxel incoherent motion derived parameters

    International Nuclear Information System (INIS)

    Graf, Markus; Simon, Dirk; Mang, Sarah; Lemke, Andreas; Gruenberg, Katharina

    2013-01-01

    Early recognition of and differential diagnosis between pancreatic cancer and chronic pancreatitis is an important step in successful therapy. Parameters of the IVIM (intra-voxel incoherent motion) theory can be used to differentiate between those lesions. The objective of this work is to evaluate the effects of rigid image registration on IVIM derived parameters for differentiation of pancreatic lesions such as pancreatic cancer and solid mass forming pancreatitis. The effects of linear image registration methods on reproducibility and accuracy of IVIM derived parameters were quantified on MR images of ten volunteers. For this purpose, they were evaluated statistically by comparison of registered and unregistered parameter data. Further, the perfusion fraction f was used to differentiate pancreatic lesions on eleven previously diagnosed patient data sets. Its diagnostic power with and without rigid registration was evaluated using receiver operating curves (ROC) analysis. The pancreas was segmented manually on MR data sets of healthy volunteers as well as the patients showing solid pancreatic lesions. Diffusion weighted imaging was performed in 10 blocks of breath-hold phases. Linear registration of the weighted image stack leads to a 3.7% decrease in variability of the IVIM derived parameter f due to an improved anatomical overlap of 5%. Consequently, after registration the area under the curve in the ROC-analysis for the differentiation approach increased by 2.7%. In conclusion, rigid registration improves the differentiation process based on f-values. (orig.)

  7. Differentiating between benign and malignant sinonasal lesions using dynamic contrast-enhanced MRI and intravoxel incoherent motion.

    Science.gov (United States)

    Jiang, Jingxuan; Xiao, Zebin; Tang, Zuohua; Zhong, Yufeng; Qiang, Jinwei

    2018-01-01

    To explore the value of dynamic contrast-enhanced MRI (DCE-MRI) and intravoxel incoherent motion (IVIM) for distinguishing between benign and malignant sinonasal lesions and investigate the correlations between the two methods. Patients with sinonasal lesions (42 benign and 31 malignant) who underwent DCE-MRI and IVIM before confirmation by histopathology were enrolled in this prospective study. Parameters derived from DCE-MRI and IVIM were measured, the optimal cut-off values for differential diagnosis were determined, and the correlations between the two methods were evaluated. Statistical analyses were performed using the Wilcoxon rank sum test, receiver operating characteristic (ROC) curve analysis, and Spearman's rank correlation. Significantly higher K trans and K ep values but lower D and f values were found in malignant lesions than in benign lesions (all pbenign and malignant sinonasal lesions. IVIM findings correlate with DCE-MRI results and may represent an alternative to DCE-MRI. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Methyl group rotation and segmental motion in atactic polypropylene. An incoherent quasi elastic neutron scattering investigation

    International Nuclear Information System (INIS)

    Arrighi, V.; Triolo, A.

    1999-01-01

    Complete text of publication follows. Results from the analysis of recent quasielastic neutron scattering (QENS) experiments on atactic polypropylene (aPP), are presented both in the sub-T g and above T g regimes. Experiments were carried out on the IRIS (ISIS, Rutherford Appleton Laboratory, UK) and IN10 (ILL FR) spectrometers in the temperature range from 140 to 400 K. Different instrumental resolutions were used in order to cover a wide energy window. The high resolution data collected on IN10 using the fixed energy scan technique, give clear evidence of two separate dynamic processes that we attribute to methyl group rotational hopping (below T g ) and to segmental motion (above T g ), respectively. Data were fitted using a model involving a distribution of relaxation rates. The IN10 results are used in interpreting and analyzing the QENS data from the IRIS spectrometer. In order to exploit the different energy resolutions of IRIS, Fourier inversion of the experimental data was carried out. This approach to data analysis allows us to widen the energy range available for data analysis. Due to the high activation energy of the methyl group hopping in aPP, this motion overlaps with the segmental relaxation, thus making analysis of high temperature data quite complex. The IN10 results are employed in order to perform data analysis in terms of two distinct processes. (author)

  9. Role of spin diffusion in current-induced domain wall motion for disordered ferromagnets

    KAUST Repository

    Akosa, Collins Ashu; Kim, Won-Seok; Bisig, André ; Klä ui, Mathias; Lee, Kyung-Jin; Manchon, Aurelien

    2015-01-01

    Current-induced spin transfer torque and magnetization dynamics in the presence of spin diffusion in disordered magnetic textures is studied theoretically. We demonstrate using tight-binding calculations that weak, spin-conserving impurity scattering dramatically enhances the nonadiabaticity. To further explore this mechanism, a phenomenological drift-diffusion model for incoherent spin transport is investigated. We show that incoherent spin diffusion indeed produces an additional spatially dependent torque of the form ∼∇2[m×(u⋅∇)m]+ξ∇2[(u⋅∇)m], where m is the local magnetization direction, u is the direction of injected current, and ξ is a parameter characterizing the spin dynamics (precession, dephasing, and spin-flip). This torque, which scales as the inverse square of the domain wall width, only weakly enhances the longitudinal velocity of a transverse domain wall but significantly enhances the transverse velocity of vortex walls. The spatial-dependent spin transfer torque uncovered in this study is expected to have significant impact on the current-driven motion of abrupt two-dimensional textures such as vortices, skyrmions, and merons.

  10. Role of spin diffusion in current-induced domain wall motion for disordered ferromagnets

    KAUST Repository

    Akosa, Collins Ashu

    2015-03-12

    Current-induced spin transfer torque and magnetization dynamics in the presence of spin diffusion in disordered magnetic textures is studied theoretically. We demonstrate using tight-binding calculations that weak, spin-conserving impurity scattering dramatically enhances the nonadiabaticity. To further explore this mechanism, a phenomenological drift-diffusion model for incoherent spin transport is investigated. We show that incoherent spin diffusion indeed produces an additional spatially dependent torque of the form ∼∇2[m×(u⋅∇)m]+ξ∇2[(u⋅∇)m], where m is the local magnetization direction, u is the direction of injected current, and ξ is a parameter characterizing the spin dynamics (precession, dephasing, and spin-flip). This torque, which scales as the inverse square of the domain wall width, only weakly enhances the longitudinal velocity of a transverse domain wall but significantly enhances the transverse velocity of vortex walls. The spatial-dependent spin transfer torque uncovered in this study is expected to have significant impact on the current-driven motion of abrupt two-dimensional textures such as vortices, skyrmions, and merons.

  11. Correlation between intravoxel incoherent motion magnetic resonance imaging derived metrics and serum soluble CD40 ligand level in an embolic canine stroke model

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xiao Quan; Wu, Chen Jiang; Lu, Shan Shan; Gao, Qian Qian; Zu, Qing Quan; Liu, Xing Long; Shi, Hai Bin; Liu, Sheng [Dept. of Radiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing (China)

    2017-09-15

    To determine the relationship between intravoxel incoherent motion (IVIM) imaging derived quantitative metrics and serum soluble CD40 ligand (sCD40L) level in an embolic canine stroke model. A middle cerebral artery occlusion model was established in 24 beagle dogs. Experimental dogs were divided into low- and high-sCD40L group according to serum sCD40L level at 4.5 hours after establishing the model. IVIM imaging was scanned at 4.5 hours after model establishment using 10 b values ranging from 0 to 900 s/mm{sup 2}. Quantitative metrics diffusion coefficient (D), pseudodiffusion coefficient (D{sup *}), and perfusion fraction (f) of ischemic lesions were calculated. Quantitative metrics of ischemic lesions were normalized by contralateral hemisphere using the following formula: normalized D = D{sub stroke} / D{sub contralateral}. Differences in IVIM metrics between the low- and high-sCD40L groups were compared using t test. Pearson's correlation analyses were performed to determine the relationship between IVIM metrics and serum sCD40L level. The high-sCD40L group showed significantly lower f and normalized f values than the low-sCD40L group (f, p < 0.001; normalized f, p < 0.001). There was no significant difference in D{sup *}, normalized D{sup *}, D, or normalized D value between the two groups (All p > 0.05). Both f and normalized f values were negatively correlated with serum sCD40L level (f, r = −0.789, p < 0.001; normalized f, r = −0.823, p < 0.001). However, serum sCD40L level had no significant correlation with D{sup *}, normalized D{sup *}, D, or normalized D (All p > 0.05). The f value derived from IVIM imaging was negatively correlated with serum sCD40L level. f value might serve as a potential imaging biomarker to assess the formation of microvascular thrombosis in hyperacute period of ischemic stroke.

  12. Diffusion in one dimensional random medium and hyperbolic Brownian motion

    International Nuclear Information System (INIS)

    Comtet, A.; Monthus, C.; Paris-6 Univ., 75

    1995-03-01

    Classical diffusion in a random medium involves an exponential functional of Brownian motion. This functional also appears in the study of Brownian diffusion on a Riemann surface of constant negative curvature. This relationship is analyzed in detail and various distributions are studied using stochastic calculus and functional integration. (author) 17 refs

  13. Correlation between intravoxel incoherent motion MR parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome: A pilot study

    International Nuclear Information System (INIS)

    Chu, Chen; Zhou, Nan; Zhang, Huayong; Dou, Xin; Li, Ming; Liu, Song; Zhu, Yun; Chen, Weibo; Chan, Queenie; He, Jian; Sun, Lingyun; Zhou, Zhengyang

    2017-01-01

    Highlights: • Parotid glands at grade 0–3 had significant values from those in healthy glands. • Parotid D and f values were correlated with MR nodule grade significantly. • There were significant differences of D, f, and D * values among glands at grade 0–3. - Abstract: Purpose: To explore the correlation between intravoxel incoherent motion (IVIM) magnetic resonance (MR) parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome (SS). Materials and methods: A total of 31 consecutive patients with SS and 28 gender- and age-matched healthy volunteers underwent bilateral parotid 3.0T MR examination including the IVIM sequence (9 b values, 0–800 s/mm 2 ). The apparent diffusion coefficient (ADC), diffusion coefficient D, pseudo-diffusion coefficient D * , and perfusion fraction f of bilateral parotid glands were obtained, and the nodular grade of each parotid gland was evaluated according to the MR morphological appearance. Results: Sixty-two parotid glands in 31 patients with SS consisted of 32, 14, 8, and 8 parotid glands at MR nodular grades 0, 1, 2, and 3, respectively. In parotid glands of grade 0, 1, 2, 3 and healthy volunteers, the ADC values were (1.13 ± 0.25, 1.11 ± 0.17, 1.05 ± 0.24, 0.89 ± 0.04 and 1.00 ± 0.21) × 10 −3 mm 2 /s, D values were (0.92 ± 0.13, 0.90 ± 0.19, 0.90 ± 0.03, 0.67 ± 0.03, 0.81 ± 0.03) × 10 −3 mm 2 /s, f values were 0.20 ± 0.04, 0.18 ± 0.02, 0.15 ± 0.01, 0.11 ± 0.01, 0.15 ± 0.06, and D * values were (53.89 ± 28.26, 41.78 ± 16.35, 51.24 ± 18.69, 31.83 ± 18.03, 36.83 ± 16.14) × 10 −3 mm 2 /s respectively. The ADC, D, f, and D * values of parotid glands in patients with SS at grade 0 were significantly higher than those in healthy volunteers (all P < 0.05). Significant differences were observed in the D and f values of parotid glands in patients with SS among different grades (P = 0.003, < 0.001, respectively). The IVIM parameters (D, f) of parotid glands at early

  14. Correlation between intravoxel incoherent motion MR parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome: A pilot study

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Chen, E-mail: chuchen19920905@163.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhou, Nan, E-mail: snscorpion@163.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhang, Huayong, E-mail: 13770560567@163.com [Department of Rheumatology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Dou, Xin, E-mail: douxin125@126.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Li, Ming, E-mail: lm069393@163.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Liu, Song, E-mail: liusongnj@126.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhu, Yun, E-mail: qqt111@hotmail.com [Department of Rheumatology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Chen, Weibo, E-mail: Weibo.Chen@philips.com [Philips Healthcare, Shanghai, 200233 (China); Chan, Queenie, E-mail: queenie.chan@philips.com [Philips Healthcare, Hong Kong (China); He, Jian, E-mail: hjxueren@126.com [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Sun, Lingyun, E-mail: lysun_nju@163.com [Department of Rheumatology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China); Zhou, Zhengyang, E-mail: zyzhou@nju.edu.cn [Department of Radiology, Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School, Nanjing, 210008 (China)

    2017-01-15

    Highlights: • Parotid glands at grade 0–3 had significant values from those in healthy glands. • Parotid D and f values were correlated with MR nodule grade significantly. • There were significant differences of D, f, and D{sup *} values among glands at grade 0–3. - Abstract: Purpose: To explore the correlation between intravoxel incoherent motion (IVIM) magnetic resonance (MR) parameters and MR nodular grade of parotid glands in patients with Sjögren’s syndrome (SS). Materials and methods: A total of 31 consecutive patients with SS and 28 gender- and age-matched healthy volunteers underwent bilateral parotid 3.0T MR examination including the IVIM sequence (9 b values, 0–800 s/mm{sup 2}). The apparent diffusion coefficient (ADC), diffusion coefficient D, pseudo-diffusion coefficient D{sup *}, and perfusion fraction f of bilateral parotid glands were obtained, and the nodular grade of each parotid gland was evaluated according to the MR morphological appearance. Results: Sixty-two parotid glands in 31 patients with SS consisted of 32, 14, 8, and 8 parotid glands at MR nodular grades 0, 1, 2, and 3, respectively. In parotid glands of grade 0, 1, 2, 3 and healthy volunteers, the ADC values were (1.13 ± 0.25, 1.11 ± 0.17, 1.05 ± 0.24, 0.89 ± 0.04 and 1.00 ± 0.21) × 10{sup −3} mm{sup 2}/s, D values were (0.92 ± 0.13, 0.90 ± 0.19, 0.90 ± 0.03, 0.67 ± 0.03, 0.81 ± 0.03) × 10{sup −3} mm{sup 2}/s, f values were 0.20 ± 0.04, 0.18 ± 0.02, 0.15 ± 0.01, 0.11 ± 0.01, 0.15 ± 0.06, and D{sup *}values were (53.89 ± 28.26, 41.78 ± 16.35, 51.24 ± 18.69, 31.83 ± 18.03, 36.83 ± 16.14) × 10{sup −3} mm{sup 2}/s respectively. The ADC, D, f, and D{sup *} values of parotid glands in patients with SS at grade 0 were significantly higher than those in healthy volunteers (all P < 0.05). Significant differences were observed in the D and f values of parotid glands in patients with SS among different grades (P = 0.003, < 0.001, respectively). The IVIM

  15. Apparent diffusive motion of centrin foci in living cells: implications for diffusion-based motion in centriole duplication

    Science.gov (United States)

    Rafelski, Susanne M.; Keller, Lani C.; Alberts, Jonathan B.; Marshall, Wallace F.

    2011-04-01

    The degree to which diffusion contributes to positioning cellular structures is an open question. Here we investigate the question of whether diffusive motion of centrin granules would allow them to interact with the mother centriole. The role of centrin granules in centriole duplication remains unclear, but some proposed functions of these granules, for example, in providing pre-assembled centriole subunits, or by acting as unstable 'pre-centrioles' that need to be captured by the mother centriole (La Terra et al 2005 J. Cell Biol. 168 713-22), require the centrin foci to reach the mother. To test whether diffusive motion could permit such interactions in the necessary time scale, we measured the motion of centrin-containing foci in living human U2OS cells. We found that these centrin foci display apparently diffusive undirected motion. Using the apparent diffusion constant obtained from these measurements, we calculated the time scale required for diffusion to capture by the mother centrioles and found that it would greatly exceed the time available in the cell cycle. We conclude that mechanisms invoking centrin foci capture by the mother, whether as a pre-centriole or as a source of components to support later assembly, would require a form of directed motility of centrin foci that has not yet been observed.

  16. Apparent diffusive motion of centrin foci in living cells: implications for diffusion-based motion in centriole duplication

    International Nuclear Information System (INIS)

    Rafelski, Susanne M; Keller, Lani C; Marshall, Wallace F; Alberts, Jonathan B

    2011-01-01

    The degree to which diffusion contributes to positioning cellular structures is an open question. Here we investigate the question of whether diffusive motion of centrin granules would allow them to interact with the mother centriole. The role of centrin granules in centriole duplication remains unclear, but some proposed functions of these granules, for example, in providing pre-assembled centriole subunits, or by acting as unstable 'pre-centrioles' that need to be captured by the mother centriole (La Terra et al 2005 J. Cell Biol. 168 713–22), require the centrin foci to reach the mother. To test whether diffusive motion could permit such interactions in the necessary time scale, we measured the motion of centrin-containing foci in living human U2OS cells. We found that these centrin foci display apparently diffusive undirected motion. Using the apparent diffusion constant obtained from these measurements, we calculated the time scale required for diffusion to capture by the mother centrioles and found that it would greatly exceed the time available in the cell cycle. We conclude that mechanisms invoking centrin foci capture by the mother, whether as a pre-centriole or as a source of components to support later assembly, would require a form of directed motility of centrin foci that has not yet been observed

  17. Characteristics of diffusion flames with accelerated motion

    Directory of Open Access Journals (Sweden)

    Lou Bo

    2016-01-01

    Full Text Available The aim of this work is to present an experiment to study the characteristics of a laminar diffusion flame under acceleration. A Bunsen burner (nozzle diameter 8 mm, using liquefied petroleum gas as its fuel, was ignited under acceleration. The temperature field and the diffusion flame angle of inclination were visualised with the assistance of the visual display technology incorporated in MATLAB™. Results show that the 2-d temperature field under different accelerations matched the variation in average temperatures: they both experience three variations at different time and velocity stages. The greater acceleration has a faster change in average temperature with time, due to the accumulation of combustion heat: the smaller acceleration has a higher average temperature at the same speed. No matter what acceleration was used, in time, the flame angle of inclination increased, but the growth rate decreased until an angle of 90°: this could be explained by analysis of the force distribution within the flame. It is also found that, initially, the growth rate of angle with velocity under the greater acceleration was always smaller than that at lower accelerations; it was also different in flames with uniform velocity fire conditions.

  18. Intravoxel incoherent motion MR imaging for breast lesions: comparison and correlation with pharmacokinetic evaluation from dynamic contrast-enhanced MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Chunling; Liu, Zaiyi; Zhang, Jine; He, Hui; Zhang, Shuixing; Liang, Changhong [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, GuangZhou (China); Wang, Kun [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Breast Cancer, Cancer Center, GuangZhou (China); Chan, Queenie [Philips Healthcare, 6/F, Core Building 1, 1 Science Park East Avenue, Hong Kong Science Park, Shatin, New Territories, Hong Kong (China)

    2016-11-15

    To compare diagnostic performance for breast lesions by quantitative parameters derived from intravoxel incoherent motion (IVIM) and dynamic contrast-enhanced (DCE) magnetic resonance imaging (MRI) and to explore whether correlations exist between these parameters. IVIM and DCE MRI were performed on a 1.5-T MRI scanner in patients with suspicious breast lesions. Thirty-six breast cancers and 23 benign lesions were included in the study. Quantitative parameters from IVIM (D, f and D*) and DCE MRI (K{sup trans}, K{sub ep}, V{sub e} and V{sub p}) were calculated and compared between malignant and benign lesions. Spearman correlation test was used to evaluate correlations between them. D, f, D* from IVIM and K{sup trans}, K{sub ep}, V{sub p} from DCE MRI were statistically different between breast cancers and benign lesions (p < 0.05, respectively) and D demonstrated the largest area under the receiver-operating characteristic curve (AUC = 0.917) and had the highest specificity (83 %). The f value was moderately statistically correlated with V{sub p} (r = 0.692) and had a poor correlation with K{sup trans} (r = 0.456). IVIM MRI is useful in the differentiation of breast lesions. Significant correlations were found between perfusion-related parameters from IVIM and DCE MRI. IVIM may be a useful adjunctive tool to standard MRI in diagnosing breast cancer. (orig.)

  19. Spatiotemporal Diffusive Evolution and Fractal Structure of Ground Motion

    Science.gov (United States)

    Suwada, Tsuyoshi

    2018-02-01

    The spatiotemporal diffusive evolution and fractal structure of ground motion have been investigated at the in-ground tunnel of the KEK B-Factory (KEKB) injector linear accelerator (linac). The slow dynamic fluctuating displacements of the tunnel floor are measured in real time with a new remote-controllable sensing system based on a laser-based alignment system. Based on spatiotemporal analyses with linear-regression models, which were applied in both the time and frequency domains to time-series data recorded over a period of approximately 8 months, both coherent and stochastic components in the displacements of the tunnel floor were clearly observed along the entire length of the linac. In particular, it was clearly observed that the stochastic components exhibited characteristic spatiotemporal diffusive evolution with the fractal structure and fractional dimension. This report describes in detail the experimental techniques and analyses of the spatiotemporal diffusive evolution of ground motion observed at the in-ground tunnel of the injector linac using a real-time remote-controllable sensing system.

  20. A generalized mean-squared displacement from inelastic fixed window scans of incoherent neutron scattering as a model-free indicator of anomalous diffusion confinement

    International Nuclear Information System (INIS)

    Roosen-Runge, F.; Seydel, T.

    2015-01-01

    Elastic fixed window scans of incoherent neutron scattering are an established and frequently employed method to study dynamical changes, usually over a broad temperature range or during a process such as a conformational change in the sample. In particular, the apparent mean-squared displacement can be extracted via a model-free analysis based on a solid physical interpretation as an effective amplitude of molecular motions. Here, we provide a new account of elastic and inelastic fixed window scans, defining a generalized mean-squared displacement for all fixed energy transfers. We show that this generalized mean-squared displacement in principle contains all information on the real mean-square displacement accessible in the instrumental time window. The derived formula provides a clear understanding of the effects of instrumental resolution on the apparent mean-squared displacement. Finally, we show that the generalized mean-square displacement can be used as a model-free indicator on confinement effects within the instrumental time window. (authors)

  1. Intravoxel incoehrent motion MR imaging in the head and neck: Correlation with dynamic contrast-enhanced MR imaging and diffusion-weighted imaging

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Xiao Quan; Choi, Young Jun; Sung, Yu Sub; Jang, Seung Won; Park, Ji Eun; Heo, Young Jin; Beak, Jung Hwan; Lee, Jeong Hyun [Dept. of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of); Yoon, Ra Gyoung [Dept. of Radiology, Catholic Kwandong University International St. Mary' s Hospital, Catholic Kwandong University College of Medicine, Incheon (Korea, Republic of)

    2016-09-15

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D{sup *}), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D{sup *} and model-free parameters from the DCE-MRI (wash-in, T{sub max}, E{sub max}, initial AUC{sub 60}, whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D{sup *} and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p < 0.001, r = 0.980) and muscles (p = 0.013, r = 0.542), despite its significantly higher value than D. The difference between ADC and D showed significant correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D{sup *} (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck.

  2. Intravoxel incoehrent motion MR imaging in the head and neck: Correlation with dynamic contrast-enhanced MR imaging and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Xu, Xiao Quan; Choi, Young Jun; Sung, Yu Sub; Jang, Seung Won; Park, Ji Eun; Heo, Young Jin; Beak, Jung Hwan; Lee, Jeong Hyun; Yoon, Ra Gyoung

    2016-01-01

    To investigate the correlation between perfusion- and diffusion-related parameters from intravoxel incoherent motion (IVIM) and those from dynamic contrast-enhanced MR imaging (DCE-MRI) and diffusion-weighted imaging in tumors and normal muscles of the head and neck. We retrospectively enrolled 20 consecutive patients with head and neck tumors with MR imaging performed using a 3T MR scanner. Tissue diffusivity (D), pseudo-diffusion coefficient (D * ), and perfusion fraction (f) were derived from bi-exponential fitting of IVIM data obtained with 14 different b-values in three orthogonal directions. We investigated the correlation between D, f, and D * and model-free parameters from the DCE-MRI (wash-in, T max , E max , initial AUC 60 , whole AUC) and the apparent diffusion coefficient (ADC) value in the tumor and normal masseter muscle using a whole volume-of-interest approach. Pearson's correlation test was used for statistical analysis. No correlation was found between f or D * and any of the parameters from the DCE-MRI in all patients or in patients with squamous cell carcinoma (p > 0.05). The ADC was significantly correlated with D values in the tumors (p < 0.001, r = 0.980) and muscles (p = 0.013, r = 0.542), despite its significantly higher value than D. The difference between ADC and D showed significant correlation with f values in the tumors (p = 0.017, r = 0.528) and muscles (p = 0.003, r = 0.630), but no correlation with D * (p > 0.05, respectively). Intravoxel incoherent motion shows no significant correlation with model-free perfusion parameters derived from the DCE-MRI but is feasible for the analysis of diffusivity in both tumors and normal muscles of the head and neck

  3. A fractional motion diffusion model for grading pediatric brain tumors.

    Science.gov (United States)

    Karaman, M Muge; Wang, He; Sui, Yi; Engelhard, Herbert H; Li, Yuhua; Zhou, Xiaohong Joe

    2016-01-01

    To demonstrate the feasibility of a novel fractional motion (FM) diffusion model for distinguishing low- versus high-grade pediatric brain tumors; and to investigate its possible advantage over apparent diffusion coefficient (ADC) and/or a previously reported continuous-time random-walk (CTRW) diffusion model. With approval from the institutional review board and written informed consents from the legal guardians of all participating patients, this study involved 70 children with histopathologically-proven brain tumors (30 low-grade and 40 high-grade). Multi- b -value diffusion images were acquired and analyzed using the FM, CTRW, and mono-exponential diffusion models. The FM parameters, D fm , φ , ψ (non-Gaussian diffusion statistical measures), and the CTRW parameters, D m , α , β (non-Gaussian temporal and spatial diffusion heterogeneity measures) were compared between the low- and high-grade tumor groups by using a Mann-Whitney-Wilcoxon U test. The performance of the FM model for differentiating between low- and high-grade tumors was evaluated and compared with that of the CTRW and the mono-exponential models using a receiver operating characteristic (ROC) analysis. The FM parameters were significantly lower ( p  < 0.0001) in the high-grade ( D fm : 0.81 ± 0.26, φ : 1.40 ± 0.10, ψ : 0.42 ± 0.11) than in the low-grade ( D fm : 1.52 ± 0.52, φ : 1.64 ± 0.13, ψ : 0.67 ± 0.13) tumor groups. The ROC analysis showed that the FM parameters offered better specificity (88% versus 73%), sensitivity (90% versus 82%), accuracy (88% versus 78%), and area under the curve (AUC, 93% versus 80%) in discriminating tumor malignancy compared to the conventional ADC. The performance of the FM model was similar to that of the CTRW model. Similar to the CTRW model, the FM model can improve differentiation between low- and high-grade pediatric brain tumors over ADC.

  4. Measurement of the perfusion fraction in brain tumors with intravoxel incoherent motion MR imaging: validation with histopathological vascular density in meningiomas.

    Science.gov (United States)

    Togao, Osamu; Hiwatashi, Akio; Yamashita, Koji; Kikuchi, Kazufumi; Momosaka, Daichi; Yoshimoto, Koji; Kuga, Daisuke; Mizoguchi, Masahiro; Suzuki, Satoshi O; Iwaki, Toru; Van Cauteren, Marc; Iihara, Koji; Honda, Hiroshi

    2018-05-01

    To evaluate the quantification performance of the perfusion fraction (f) measured with intravoxel incoherent motion (IVIM) MR imaging in a comparison with the histological vascular density in meningiomas. 29 consecutive patients with meningioma (59.0 ± 16.8 years old, 8 males and 21 females) who underwent a subsequent surgical resection were examined with both IVIM imaging and a histopathological analysis. IVIM imaging was conducted using a single-shot SE-EPI sequence with 13 b-factors (0, 10, 20, 30, 50, 80, 100, 200, 300, 400, 600, 800, 1000 s mm - 2 ) at 3T. The perfusion fraction (f) was calculated by fitting the IVIM bi-exponential model. The 90-percentile f-value in the tumor region-of-interest (ROI) was defined as the maximum f-value (f-max). Histopathological vascular density (%Vessel) was measured on CD31-immunostainted histopathological specimens. The correlation and agreement between the f-values and %Vessel was assessed. The f-max (15.5 ± 5.5%) showed excellent agreement [intraclass correlation coefficient (ICC) = 0.754] and a significant correlation (r = 0.69, p < 0.0001) with the %Vessel (12.9 ± 9.4%) of the tumors. The Bland-Altman plot analysis showed excellent agreement between the f-max and %Vessel (bias, -2.6%; 95% limits of agreement, from -16.0 to 10.8%). The f-max was not significantly different among the histological subtypes of meningioma. An excellent agreement and a significant correlation were observed between the f-values and %Vessel. The f-value can be used as a noninvasive quantitative imaging measure to directly assess the vascular volume fraction in brain tumors. Advances in knowledge: The f-value measured by IVIM imaging showed a significant correlation and an excellent agreement with the histological vascular density in the meningiomas. The f-value can be used as a noninvasive and quantitative imaging measure to directly assess the volume fraction of capillaries in brain tumors.

  5. The Diffusion Process in Small Particles and Brownian Motion

    Science.gov (United States)

    Khoshnevisan, M.

    Albert Einstein in 1926 published his book entitled ''INVESTIGATIONS ON THE THEORY OF THE BROWNIAN MOVEMENT''. He investigated the process of diffusion in an undissociated dilute solution. The diffusion process is subject to Brownian motion. Furthermore, he elucidated the fact that the heat content of a substance will change the position of the single molecules in an irregular fashion. In this paper, I have shown that in order for the displacement of the single molecules to be proportional to the square root of the time, and for v/2 - v 1 Δ =dv/dx , (where v1 and v2 are the concentrations in two cross sections that are separated by a very small distance), ∫ - ∞ ∞ Φ (Δ) dΔ = I and I/τ ∫ - ∞ ∞Δ2/2 Φ (Δ) dΔ = D conditions to hold, then equation (7a) D =√{ 2 D }√{ τ} must be changed to Δ =√{ 2 D }√{ τ} . I have concluded that D =√{ 2 D }√{ τ} is an unintended error, and it has not been amended for almost 90 years in INVESTIGATIONS ON THE THEORY OF THE BROWNIAN MOVEMENT, 1926 publication.

  6. A diffusion approximation based on renewal processes with applications to strongly biased run–tumble motion

    DEFF Research Database (Denmark)

    Thygesen, Uffe Høgsbro

    2016-01-01

    We consider organisms which use a renewal strategy such as run–tumble when moving in space, for example to perform chemotaxis in chemical gradients. We derive a diffusion approximation for the motion, applying a central limit theorem due to Anscombe for renewal-reward processes; this theorem has ....... The proposed technique for obtaining diffusion approximations is conceptually and computationally simple, and applicable also when statistics of the motion is obtained empirically or through Monte Carlo simulation of the motion....

  7. Brownian Motion of 2D Vacancy Islands by Adatom Terrace Diffusion

    International Nuclear Information System (INIS)

    Morgenstern, Karina; Laegsgaard, Erik; Besenbacher, Flemming

    2001-01-01

    We have studied the Brownian motion of two-dimensional (2D) vacancy islands on Ag(110) at temperatures between 175 and 215K. While the detachment of adatoms from the island and their diffusion on the terrace are permitted in this temperature range, the periphery diffusion of single adatoms is prohibited. The present scanning tunneling microscopy results provide the first direct experimental proof that the Brownian motion of the islands follows a simple scaling law with terrace diffusion being the rate limiting process. The activation energy of the vacancy island motion is determined to 0.41eV

  8. Modeling single-file diffusion with step fractional Brownian motion and a generalized fractional Langevin equation

    International Nuclear Information System (INIS)

    Lim, S C; Teo, L P

    2009-01-01

    Single-file diffusion behaves as normal diffusion at small time and as subdiffusion at large time. These properties can be described in terms of fractional Brownian motion with variable Hurst exponent or multifractional Brownian motion. We introduce a new stochastic process called Riemann–Liouville step fractional Brownian motion which can be regarded as a special case of multifractional Brownian motion with a step function type of Hurst exponent tailored for single-file diffusion. Such a step fractional Brownian motion can be obtained as a solution of the fractional Langevin equation with zero damping. Various kinds of fractional Langevin equations and their generalizations are then considered in order to decide whether their solutions provide the correct description of the long and short time behaviors of single-file diffusion. The cases where the dissipative memory kernel is a Dirac delta function, a power-law function and a combination of these functions are studied in detail. In addition to the case where the short time behavior of single-file diffusion behaves as normal diffusion, we also consider the possibility of a process that begins as ballistic motion

  9. Intermittent Motion, Nonlinear Diffusion Equation and Tsallis Formalism

    Directory of Open Access Journals (Sweden)

    Ervin K. Lenzi

    2017-01-01

    Full Text Available We investigate an intermittent process obtained from the combination of a nonlinear diffusion equation and pauses. We consider the porous media equation with reaction terms related to the rate of switching the particles from the diffusive mode to the resting mode or switching them from the resting to the movement. The results show that in the asymptotic limit of small and long times, the spreading of the system is essentially governed by the diffusive term. The behavior exhibited for intermediate times depends on the rates present in the reaction terms. In this scenario, we show that, in the asymptotic limits, the distributions for this process are given by in terms of power laws which may be related to the q-exponential present in the Tsallis statistics. Furthermore, we also analyze a situation characterized by different diffusive regimes, which emerges when the diffusive term is a mixing of linear and nonlinear terms.

  10. Neutron diffusion: connection with the theory of browniam motion

    International Nuclear Information System (INIS)

    Dellagi, Mohamed

    1977-01-01

    The displacement of the neutron projection on an axis Ox and its density of probability are introduced instead of describing the diffusion theory with neutron density, as is usual. If the point source O is isotropic and neutron monoenergetic, the brownian particle described by Langevin's equation and neutron have the same time correlation of velocity [fr

  11. Incoherent neutron scattering in acetanilide and three deuterated derivatives

    Science.gov (United States)

    Barthes, Mariette; Almairac, Robert; Sauvajol, Jean-Louis; Moret, Jacques; Currat, Roland; Dianoux, José

    1991-03-01

    Incoherent-neutron-scattering measurements of the vibrational density of states of acetanilide and three deuterated derivatives are presented. These data allow one to identify an intense maximum, assigned to the N-H out-of-plane bending mode. The data display the specific behavior of the methyl torsional modes: large isotopic shift and strong low-temperature intensity; confirm our previous inelastic-neutron-scattering studies, indicating no obvious anomalies in the range of frequency of the acoustic phonons. In addition, the data show the existence of thermally activated quasielastic scattering above 100 K, assigned to the random diffusive motion of the methyl protons. These results are discussed in the light of recent theoretical models proposed to explain the anomalous optical properties of this crystal.

  12. Motions in the relativistic fields of a charged dust

    International Nuclear Information System (INIS)

    Fonseca Teixeira, A.F. da.

    1980-04-01

    The general relativistic motion of arbitrarily charged test particles is investigated, in the spherically symmetric fields of a charged, static, incoherent matter with T 0 0 = const. The condition for existence of stable circular orbits is established, inside and outside the diffused source. The null geodesics are also investigated, as a limiting case. (Author) [pt

  13. Theoretical predictions of diffusion from Brownian motion in superstrong polymers

    International Nuclear Information System (INIS)

    Dowell, F.

    1991-01-01

    This paper presents a summary of unique highly nonlinear static and dynamic theories for chain molecules (actually, for almost any kind of organic molecule), including the first superstrong polymers. These theories have been used to predict and explain (1) the physical self-assembly (self-ordering) of specific kinds of molecules into liquid crystalline (LC) phases (i.e., partially ordered phases) and (2) the diffusion of these molecules in various LC phases and the isotropic (I) liquid phase

  14. Localized diffusive motion on two different time scales in solid alkane nanoparticles

    International Nuclear Information System (INIS)

    Wang, S.-K.; Mamontov, Eugene; Bai, M.; Hansen, F.Y.; Taub, H.; Copley, J.R.D.; Garcia Sakai, V.; Gasparovic, Goran; Jenkins, Timothy; Tyagi, M.; Herwig, Kenneth W.; Neumann, D.A.; Montfrooij, W.; Volkmann, U.G.

    2010-01-01

    High-energy-resolution quasielastic neutron scattering on three complementary spectrometers has been used to investigate molecular diffusive motion in solid nano- to bulk-sized particles of the alkane n-C32H66. The crystalline-to-plastic and plastic-to-fluid phase transition temperatures are observed to decrease as the particle size decreases. In all samples, localized molecular diffusive motion in the plastic phase occurs on two different time scales: a 'fast' motion corresponding to uniaxial rotation about the long molecular axis; and a 'slow' motion attributed to conformational changes of the molecule. Contrary to the conventional interpretation in bulk alkanes, the fast uniaxial rotation begins in the low-temperature crystalline phase.

  15. Diffusion-advection within dynamic biological gaps driven by structural motion

    Science.gov (United States)

    Asaro, Robert J.; Zhu, Qiang; Lin, Kuanpo

    2018-04-01

    To study the significance of advection in the transport of solutes, or particles, within thin biological gaps (channels), we examine theoretically the process driven by stochastic fluid flow caused by random thermal structural motion, and we compare it with transport via diffusion. The model geometry chosen resembles the synaptic cleft; this choice is motivated by the cleft's readily modeled structure, which allows for well-defined mechanical and physical features that control the advection process. Our analysis defines a Péclet-like number, AD, that quantifies the ratio of time scales of advection versus diffusion. Another parameter, AM, is also defined by the analysis that quantifies the full potential extent of advection in the absence of diffusion. These parameters provide a clear and compact description of the interplay among the well-defined structural, geometric, and physical properties vis-a ̀-vis the advection versus diffusion process. For example, it is found that AD˜1 /R2 , where R is the cleft diameter and hence diffusion distance. This curious, and perhaps unexpected, result follows from the dependence of structural motion that drives fluid flow on R . AM, on the other hand, is directly related (essentially proportional to) the energetic input into structural motion, and thereby to fluid flow, as well as to the mechanical stiffness of the cleftlike structure. Our model analysis thus provides unambiguous insight into the prospect of competition of advection versus diffusion within biological gaplike structures. The importance of the random, versus a regular, nature of structural motion and of the resulting transient nature of advection under random motion is made clear in our analysis. Further, by quantifying the effects of geometric and physical properties on the competition between advection and diffusion, our results clearly demonstrate the important role that metabolic energy (ATP) plays in this competitive process.

  16. Elements of sub-quantum thermodynamics: quantum motion as ballistic diffusion

    International Nuclear Information System (INIS)

    Groessing, G; Fussy, S; Pascasio, J Mesa; Schwabl, H

    2011-01-01

    By modelling quantum systems as emerging from a (classical) sub-quantum thermodynamics, the quantum mechanical 'decay of the wave packet' is shown to simply result from sub-quantum diffusion with a specific diffusion coefficient varying in time due to a particle's changing thermal environment. It is thereby proven that free quantum motion strictly equals ballistic diffusion. The exact quantum mechanical trajectory distributions and the velocity field of the Gaussian wave packet are thus derived solely from classical physics. Moreover, also quantum motion in a linear (e.g., gravitational) potential is shown to equal said ballistic diffusion. Quantitative statements on the trajectories' characteristic behaviours are obtained which provide a detailed 'micro-causal' explanation in full accordance with momentum conservation.

  17. Apparent diffusion coefficient measurement in a moving phantom simulating linear respiratory motion.

    Science.gov (United States)

    Kwee, Thomas C; Takahara, Taro; Muro, Isao; Van Cauteren, Marc; Imai, Yutaka; Nievelstein, Rutger A J; Mali, Willem P T M; Luijten, Peter R

    2010-10-01

    The aim of this study was to examine the effect of simulated linear respiratory motion on apparent diffusion coefficient (ADC) measurements. Six rectangular test tubes (14 × 92 mm) filled with either water, tomato ketchup, or mayonnaise were positioned in a box containing agarose gel. This box was connected to a double-acting pneumatic cylinder, capable of inducing periodic linear motion in the long-axis direction of the magnetic bore (23-mm stroke). Diffusion-weighted magnetic resonance imaging was performed for both the static and moving phantoms, and ADC measurements were made in the six test tubes in both situations. In the three test tubes whose long axes were parallel to the direction of motion, ADCs agreed well between the moving and static phantom situations. However, in two test tubes that were filled with fluids that had a considerably lower diffusion coefficient than the surrounding agarose gel, and whose long axes were perpendicular to the direction of motion, the ADCs agreed poorly between the moving and static phantom situations. ADC measurements of large homogeneous structures are not affected by linear respiratory motion. However, ADC measurements of inhomogeneous or small structures are affected by linear respiratory motion due to partial volume effects.

  18. Apparent diffusion coefficient measurement in a moving phantom simulating linear respiratory motion

    International Nuclear Information System (INIS)

    Kwee, T.C.; Takahara, Taro; Nievelstein, R.A.J.; Mali, W.P.T.M.; Luijten, P.R.; Muro, Isao; Imai, Yutaka; Cauteren, M. Van

    2010-01-01

    The aim of this study was to examine the effect of simulated linear respiratory motion on apparent diffusion coefficient (ADC) measurements. Six rectangular test tubes (14 x 92 mm) filled with either water, tomato ketchup, or mayonnaise were positioned in a box containing agarose gel. This box was connected to a double-acting pneumatic cylinder, capable of inducing periodic linear motion in the long-axis direction of the magnetic bore (23-mm stroke). Diffusion-weighted magnetic resonance imaging was performed for both the static and moving phantoms, and ADC measurements were made in the six test tubes in both situations. In the three test tubes whose long axes were parallel to the direction of motion, ADCs agreed well between the moving and static phantom situations. However, in two test tubes that were filled with fluids that had a considerably lower diffusion coefficient than the surrounding agarose gel, and whose long axes were perpendicular to the direction of motion, the ADCs agreed poorly between the moving and static phantom situations. ADC measurements of large homogeneous structures are not affected by linear respiratory motion. However, ADC measurements of inhomogeneous or small structures are affected by linear respiratory motion due to partial volume effects. (author)

  19. On the distribution of estimators of diffusion constants for Brownian motion

    International Nuclear Information System (INIS)

    Boyer, Denis; Dean, David S

    2011-01-01

    We discuss the distribution of various estimators for extracting the diffusion constant of single Brownian trajectories obtained by fitting the squared displacement of the trajectory. The analysis of the problem can be framed in terms of quadratic functionals of Brownian motion that correspond to the Euclidean path integral for simple Harmonic oscillators with time dependent frequencies. Explicit analytical results are given for the distribution of the diffusion constant estimator in a number of cases and our results are confirmed by numerical simulations.

  20. A Diffusion Approximation Based on Renewal Processes with Applications to Strongly Biased Run-Tumble Motion.

    Science.gov (United States)

    Thygesen, Uffe Høgsbro

    2016-03-01

    We consider organisms which use a renewal strategy such as run-tumble when moving in space, for example to perform chemotaxis in chemical gradients. We derive a diffusion approximation for the motion, applying a central limit theorem due to Anscombe for renewal-reward processes; this theorem has not previously been applied in this context. Our results extend previous work, which has established the mean drift but not the diffusivity. For a classical model of tumble rates applied to chemotaxis, we find that the resulting chemotactic drift saturates to the swimming velocity of the organism when the chemical gradients grow increasingly steep. The dispersal becomes anisotropic in steep gradients, with larger dispersal across the gradient than along the gradient. In contrast to one-dimensional settings, strong bias increases dispersal. We next include Brownian rotation in the model and find that, in limit of high chemotactic sensitivity, the chemotactic drift is 64% of the swimming velocity, independent of the magnitude of the Brownian rotation. We finally derive characteristic timescales of the motion that can be used to assess whether the diffusion limit is justified in a given situation. The proposed technique for obtaining diffusion approximations is conceptually and computationally simple, and applicable also when statistics of the motion is obtained empirically or through Monte Carlo simulation of the motion.

  1. Localization and Ballistic Diffusion for the Tempered Fractional Brownian-Langevin Motion

    Science.gov (United States)

    Chen, Yao; Wang, Xudong; Deng, Weihua

    2017-10-01

    This paper discusses the tempered fractional Brownian motion (tfBm), its ergodicity, and the derivation of the corresponding Fokker-Planck equation. Then we introduce the generalized Langevin equation with the tempered fractional Gaussian noise for a free particle, called tempered fractional Langevin equation (tfLe). While the tfBm displays localization diffusion for the long time limit and for the short time its mean squared displacement (MSD) has the asymptotic form t^{2H}, we show that the asymptotic form of the MSD of the tfLe transits from t^2 (ballistic diffusion for short time) to t^{2-2H}, and then to t^2 (again ballistic diffusion for long time). On the other hand, the overdamped tfLe has the transition of the diffusion type from t^{2-2H} to t^2 (ballistic diffusion). The tfLe with harmonic potential is also considered.

  2. Using intravoxel incoherent motion MR imaging to study the renal pathophysiological process of contrast-induced acute kidney injury in rats: Comparison with conventional DWI and arterial spin labelling

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Long; Zhang, Bin [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, Guangzhou, Guangdong Province (China); Southern Medical University, Graduate College, Guangzhou (China); Chen, Wen-bo; Liang, Chang-hong; Zhang, Shui-xing [Guangdong General Hospital/Guangdong Academy of Medical Sciences, Department of Radiology, Guangzhou, Guangdong Province (China); Chan, Kannie W.Y.; Li, Yu-guo; Liu, Guan-shu [The Johns Hopkins University School of Medicine, Russell H. Morgan Department of Radiology and Radiological Sciences, Division of MR Research, Baltimore, MD (United States)

    2016-06-15

    To investigate the potential of intravoxel incoherent motion (IVIM) to assess the renal pathophysiological process in contrast-induced acute kidney injury (CIAKI). Twenty-seven rats were induced with CIAKI model, six rats were imaged longitudinally at 24 h prior to and 30 min, 12, 24, 48, 72 and 96 h after administration; three rats were randomly chosen from the rest for serum creatinine and histological studies. D, f, D* and ADC were calculated from IVIM, and renal blood flow (RBF) was obtained from arterial spin labelling (ASL). A progressive reduction in D and ADC was observed in cortex (CO) by 3.07 and 8.62 % at 30 min, and by 25.77 and 28.16 % at 48 h, respectively. A similar change in outer medulla (OM) and inner medulla (IM) was observed at a later time point (12-72 h). D values were strongly correlated with ADC (r = 0.885). As perfusion measurement, a significant decrease was shown for f in 12-48 h and an increase in 72-96 h. A slightly different trend was found for D*, which was decreased by 26.02, 21.78 and 10.19 % in CO, OM and IM, respectively, at 30 min. f and D* were strongly correlated with RBF in the cortex (r = 0.768, r = 0.67), but not in the medulla. IVIM is an effective imaging tool for monitoring progress in renal pathophysiology undergoing CIAKI. (orig.)

  3. New developments in neutron scattering for the study of molecular systems: structure and diffusive motions

    International Nuclear Information System (INIS)

    Volino, F.

    1976-01-01

    After a short review of the main concepts concerning the neutron and its interaction with matter, the authors focus their attention on the study of molecular systems by means of neutron scattering. Instead of reviewing the subject yet again, they limit themselves to the new kind of work which can be done now, with the combined help of high flux reactors and novel instruments. As examples, a few experiments performed at the Institut Laue-Langevin in Grenoble are described: a neutron diffraction study of liquid acetonitrile using a powder diffractometer installed at the hot source; three high-resolution quasi-elastic studies of molecular motions - in an organic solid, (PAA), an organic liquid (C 3 H 6 ) and a liquid crystal (TBBA) - made by combining measurements with high and ultra-high energy resolution spectrometers installed at the cold source. The concept of elastic incoherent structure factor (EISF) is extensively used for the analysis. Finally some prospects on possible future developments are presented. (orig./HK) [de

  4. Diffusion limit of Lévy-Lorentz gas is Brownian motion

    Science.gov (United States)

    Magdziarz, Marcin; Szczotka, Wladyslaw

    2018-07-01

    In this paper we analyze asymptotic behaviour of a stochastic process called Lévy-Lorentz gas. This process is aspecial kind of continuous-time random walk in which walker moves in the fixed environment composed of scattering points. Upon each collision the walker performs a flight to the nearest scattering point. This type of dynamics is observed in Lévy glasses or long quenched polymers. We show that the diffusion limit of Lévy-Lorentz gas with finite mean distance between scattering centers is the standard Brownian motion. Thus, for long times the behaviour of the Lévy-Lorentz gas is close to the diffusive regime.

  5. Anomalous diffusion due to hindering by mobile obstacles undergoing Brownian motion or Orstein-Ulhenbeck processes.

    Science.gov (United States)

    Berry, Hugues; Chaté, Hugues

    2014-02-01

    In vivo measurements of the passive movements of biomolecules or vesicles in cells consistently report "anomalous diffusion," where mean-squared displacements scale as a power law of time with exponent αmovement hindrance by obstacles is often invoked. However, our understanding of how hindered diffusion leads to subdiffusion is based on diffusion amidst randomly located immobile obstacles. Here, we have used Monte Carlo simulations to investigate transient subdiffusion due to mobile obstacles with various modes of mobility. Our simulations confirm that the anomalous regimes rapidly disappear when the obstacles move by Brownian motion. By contrast, mobile obstacles with more confined displacements, e.g., Orstein-Ulhenbeck motion, are shown to preserve subdiffusive regimes. The mean-squared displacement of tracked protein displays convincing power laws with anomalous exponent α that varies with the density of Orstein-Ulhenbeck (OU) obstacles or the relaxation time scale of the OU process. In particular, some of the values we observed are significantly below the universal value predicted for immobile obstacles in two dimensions. Therefore, our results show that subdiffusion due to mobile obstacles with OU type of motion may account for the large variation range exhibited by experimental measurements in living cells and may explain that some experimental estimates are below the universal value predicted for immobile obstacles.

  6. On the response of large dams to incoherent seismic excitation

    International Nuclear Information System (INIS)

    Ramadan, O.; Novak, M.

    1993-01-01

    An intensive parametric study was conducted to investigate the response of concrete gravity dams to horizontal, spatially variable seismic ground motions. Both segmented dams consisting of separate blocks, or monoliths, and continuous monolithic dams are considered. The study includes the effects of various parameters on system natural frequencies, vibration modes, modal displacement ratios, as well as dam displacements and internal stresses due to spatially variable ground motions. The dam analytical model, and dam response to incoherent ground motions are described. The results show that the dam vibrates almost as a rigid body under the fully correlated waves, but bends and twists significantly under the spatially correlated motions. Dam-foundation interaction magnifies the low frequency components of the dam response, more so for a full reservoir, but decreases the high frequency components. For long dams, the effects of spatially incoherent ground motions are qualitatively different and can be much greater than those due to surface travelling waves. 3 refs., 3 figs

  7. A robust post-processing workflow for datasets with motion artifacts in diffusion kurtosis imaging.

    Science.gov (United States)

    Li, Xianjun; Yang, Jian; Gao, Jie; Luo, Xue; Zhou, Zhenyu; Hu, Yajie; Wu, Ed X; Wan, Mingxi

    2014-01-01

    The aim of this study was to develop a robust post-processing workflow for motion-corrupted datasets in diffusion kurtosis imaging (DKI). The proposed workflow consisted of brain extraction, rigid registration, distortion correction, artifacts rejection, spatial smoothing and tensor estimation. Rigid registration was utilized to correct misalignments. Motion artifacts were rejected by using local Pearson correlation coefficient (LPCC). The performance of LPCC in characterizing relative differences between artifacts and artifact-free images was compared with that of the conventional correlation coefficient in 10 randomly selected DKI datasets. The influence of rejected artifacts with information of gradient directions and b values for the parameter estimation was investigated by using mean square error (MSE). The variance of noise was used as the criterion for MSEs. The clinical practicality of the proposed workflow was evaluated by the image quality and measurements in regions of interest on 36 DKI datasets, including 18 artifact-free (18 pediatric subjects) and 18 motion-corrupted datasets (15 pediatric subjects and 3 essential tremor patients). The relative difference between artifacts and artifact-free images calculated by LPCC was larger than that of the conventional correlation coefficient (pworkflow improved the image quality and reduced the measurement biases significantly on motion-corrupted datasets (pworkflow was reliable to improve the image quality and the measurement precision of the derived parameters on motion-corrupted DKI datasets. The workflow provided an effective post-processing method for clinical applications of DKI in subjects with involuntary movements.

  8. Diffuse correlation tomography in the transport regime: A theoretical study of the sensitivity to Brownian motion

    Science.gov (United States)

    Tricoli, Ugo; Macdonald, Callum M.; Durduran, Turgut; Da Silva, Anabela; Markel, Vadim A.

    2018-02-01

    Diffuse correlation tomography (DCT) uses the electric-field temporal autocorrelation function to measure the mean-square displacement of light-scattering particles in a turbid medium over a given exposure time. The movement of blood particles is here estimated through a Brownian-motion-like model in contrast to ordered motion as in blood flow. The sensitivity kernel relating the measurable field correlation function to the mean-square displacement of the particles can be derived by applying a perturbative analysis to the correlation transport equation (CTE). We derive an analytical expression for the CTE sensitivity kernel in terms of the Green's function of the radiative transport equation, which describes the propagation of the intensity. We then evaluate the kernel numerically. The simulations demonstrate that, in the transport regime, the sensitivity kernel provides sharper spatial information about the medium as compared with the correlation diffusion approximation. Also, the use of the CTE allows one to explore some additional degrees of freedom in the data such as the collimation direction of sources and detectors. Our results can be used to improve the spatial resolution of DCT, in particular, with applications to blood flow imaging in regions where the Brownian motion is dominant.

  9. Motion-robust diffusion tensor acquisition at routine 3T magnetic resonance imaging

    International Nuclear Information System (INIS)

    Yasmin, Hasina; Abe, Osamu; Masutani, Yoshitaka; Hayashi, Naoto; Ohtomo, Kuni; Kabasawa, Hiroyuki; Aoki, Shigeki

    2010-01-01

    We compared different acquisition and reconstruction methods in phantom and human studies in the clinical setting to validate our hypothesis that optimizing the k-space acquisition and reconstruction method could decrease motion artifacts. Diffusion tensor images of a water phantom were obtained with three table displacement magnitudes: 1 mm, 2 mm, and 3 mm. Images were reconstructed using homodyne and zero-fill reconstruction. Overscanning in 8- and 16-k y lines was tested. We performed visual assessment of the artifacts using reconstructed coronal images and analyzed them with Wilcoxon signed-ranks test both for phantom and human studies. Also, fractional anisotropy (FA) changes between acquisition methods were compared. Artifacts due to smaller displacement (1 and 2 mm) were significantly reduced in 16-k y overscan with zero filling. The Wilcoxon signed-ranks test showed significant differences (P<0.031 for reconstruction methods and P<0.016 for overscanning methods). FA changes were statistically significant (P<0.037; Student's t-test). The Wilcoxon signed-ranks test showed significant reductions (P<0.005) in the human study. Motion-induced artifacts can be reduced by optimizing acquisition and reconstruction methods. The techniques described in this study offer an effective method for robust estimation of diffusion tensor in the presence of motion-related artifactual data points. (author)

  10. Weak Ergodicity Breaking of Receptor Motion in Living Cells Stemming from Random Diffusivity

    Science.gov (United States)

    Manzo, Carlo; Torreno-Pina, Juan A.; Massignan, Pietro; Lapeyre, Gerald J.; Lewenstein, Maciej; Garcia Parajo, Maria F.

    2015-01-01

    Molecular transport in living systems regulates numerous processes underlying biological function. Although many cellular components exhibit anomalous diffusion, only recently has the subdiffusive motion been associated with nonergodic behavior. These findings have stimulated new questions for their implications in statistical mechanics and cell biology. Is nonergodicity a common strategy shared by living systems? Which physical mechanisms generate it? What are its implications for biological function? Here, we use single-particle tracking to demonstrate that the motion of dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN), a receptor with unique pathogen-recognition capabilities, reveals nonergodic subdiffusion on living-cell membranes In contrast to previous studies, this behavior is incompatible with transient immobilization, and, therefore, it cannot be interpreted according to continuous-time random-walk theory. We show that the receptor undergoes changes of diffusivity, consistent with the current view of the cell membrane as a highly dynamic and diverse environment. Simulations based on a model of an ordinary random walk in complex media quantitatively reproduce all our observations, pointing toward diffusion heterogeneity as the cause of DC-SIGN behavior. By studying different receptor mutants, we further correlate receptor motion to its molecular structure, thus establishing a strong link between nonergodicity and biological function. These results underscore the role of disorder in cell membranes and its connection with function regulation. Because of its generality, our approach offers a framework to interpret anomalous transport in other complex media where dynamic heterogeneity might play a major role, such as those found, e.g., in soft condensed matter, geology, and ecology.

  11. Pattern formation, social forces, and diffusion instability in games with success-driven motion

    Science.gov (United States)

    Helbing, Dirk

    2009-02-01

    A local agglomeration of cooperators can support the survival or spreading of cooperation, even when cooperation is predicted to die out according to the replicator equation, which is often used in evolutionary game theory to study the spreading and disappearance of strategies. In this paper, it is shown that success-driven motion can trigger such local agglomeration and may, therefore, be used to supplement other mechanisms supporting cooperation, like reputation or punishment. Success-driven motion is formulated here as a function of the game-theoretical payoffs. It can change the outcome and dynamics of spatial games dramatically, in particular as it causes attractive or repulsive interaction forces. These forces act when the spatial distributions of strategies are inhomogeneous. However, even when starting with homogeneous initial conditions, small perturbations can trigger large inhomogeneities by a pattern-formation instability, when certain conditions are fulfilled. Here, these instability conditions are studied for the prisoner’s dilemma and the snowdrift game. Furthermore, it is demonstrated that asymmetrical diffusion can drive social, economic, and biological systems into the unstable regime, if these would be stable without diffusion.

  12. Assessment of the link between quantitative biexponential diffusion-weighted imaging and contrast-enhanced MRI in the liver

    NARCIS (Netherlands)

    Dijkstra, Hildebrand; Oudkerk, Matthijs; Kappert, Peter; Sijens, Paul E.

    Purpose: To investigate if intravoxel incoherent motion (IVIM) modeled diffusion-weighted imaging (DWI) can be linked to contrast-enhanced (CE-)MRI in liver parenchyma and liver lesions. Methods: Twenty-five patients underwent IVIM-DWI followed by multiphase CE-MRI using Gd-EOB-DTPA (n = 20) or

  13. Steady motion of skyrmions and domains walls under diffusive spin torques

    KAUST Repository

    Elías, Ricardo Gabriel

    2017-03-09

    We explore the role of the spin diffusion of conducting electrons in two-dimensional magnetic textures (domain walls and skyrmions) with spatial variation of the order of the spin precession length λex. The effect of diffusion reflects in four additional torques that are third order in spatial derivatives of magnetization and bilinear in λex and in the nonadiabatic parameter β′. In order to study the dynamics of the solitons when these diffusive torques are present, we derive the Thiele equation in the limit of steady motion and we compare the results with the nondiffusive limit. When considering a homogenous current these torques increase the longitudinal velocity of transverse domain walls of width Δ by a factor (λex/Δ)2(α/3), α being the magnetic damping constant. In the case of single skyrmions with core radius r0 these new contributions tend to increase the Magnus effect in an amount proportional to (λex/r0)2(1+2αβ′).

  14. Steady motion of skyrmions and domains walls under diffusive spin torques

    KAUST Repository

    Elí as, Ricardo Gabriel; Vidal-Silva, Nicolas; Manchon, Aurelien

    2017-01-01

    We explore the role of the spin diffusion of conducting electrons in two-dimensional magnetic textures (domain walls and skyrmions) with spatial variation of the order of the spin precession length λex. The effect of diffusion reflects in four additional torques that are third order in spatial derivatives of magnetization and bilinear in λex and in the nonadiabatic parameter β′. In order to study the dynamics of the solitons when these diffusive torques are present, we derive the Thiele equation in the limit of steady motion and we compare the results with the nondiffusive limit. When considering a homogenous current these torques increase the longitudinal velocity of transverse domain walls of width Δ by a factor (λex/Δ)2(α/3), α being the magnetic damping constant. In the case of single skyrmions with core radius r0 these new contributions tend to increase the Magnus effect in an amount proportional to (λex/r0)2(1+2αβ′).

  15. Modeling Incoherent Electron Cloud Effects

    International Nuclear Information System (INIS)

    Vay, Jean-Luc; Benedetto, E.; Fischer, W.; Franchetti, G.; Ohmi, K.; Schulte, D.; Sonnad, K.; Tomas, R.; Vay, J.-L.; Zimmermann, F.; Rumolo, G.; Pivi, M.; Raubenheimer, T.

    2007-01-01

    Incoherent electron effects could seriously limit the beam lifetime in proton or ion storage rings, such as LHC, SPS, or RHIC, or blow up the vertical emittance of positron beams, e.g., at the B factories or in linear-collider damping rings. Different approaches to modeling these effects each have their own merits and drawbacks. We describe several simulation codes which simplify the descriptions of the beam-electron interaction and of the accelerator structure in various different ways, and present results for a toy model of the SPS. In addition, we present evidence that for positron beams the interplay of incoherent electron-cloud effects and synchrotron radiation can lead to a significant increase in vertical equilibrium emittance. The magnitude of a few incoherent e+e- scattering processes is also estimated. Options for future code development are reviewed

  16. Synthesis of Cyclic Polymers and Characterization of Their Diffusive Motion in the Melt State at the Single Molecule Level

    KAUST Repository

    Habuchi, Satoshi

    2016-09-26

    We demonstrate a method for the synthesis of cyclic polymers and a protocol for characterizing their diffusive motion in a melt state at the single molecule level. An electrostatic self-assembly and covalent fixation (ESA-CF) process is used for the synthesis of the cyclic poly(tetrahydrofuran) (poly(THF)). The diffusive motion of individual cyclic polymer chains in a melt state is visualized using single molecule fluorescence imaging by incorporating a fluorophore unit in the cyclic chains. The diffusive motion of the chains is quantitatively characterized by means of a combination of mean-squared displacement (MSD) analysis and a cumulative distribution function (CDF) analysis. The cyclic polymer exhibits multiple-mode diffusion which is distinct from its linear counterpart. The results demonstrate that the diffusional heterogeneity of polymers that is often hidden behind ensemble averaging can be revealed by the efficient synthesis of the cyclic polymers using the ESA-CF process and the quantitative analysis of the diffusive motion at the single molecule level using the MSD and CDF analyses.

  17. Strong motion modeling at the Paducah Diffusion Facility for a large New Madrid earthquake

    International Nuclear Information System (INIS)

    Herrmann, R.B.

    1991-01-01

    The Paducah Diffusion Facility is within 80 kilometers of the location of the very large New Madrid earthquakes which occurred during the winter of 1811-1812. Because of their size, seismic moment of 2.0 x 10 27 dyne-cm or moment magnitude M w = 7.5, the possible recurrence of these earthquakes is a major element in the assessment of seismic hazard at the facility. Probabilistic hazard analysis can provide uniform hazard response spectra estimates for structure evaluation, but a deterministic modeling of a such a large earthquake can provide strong constraints on the expected duration of motion. The large earthquake is modeled by specifying the earthquake fault and its orientation with respect to the site, and by specifying the rupture process. Synthetic time histories, based on forward modeling of the wavefield, from each subelement are combined to yield a three component time history at the site. Various simulations are performed to sufficiently exercise possible spatial and temporal distributions of energy release on the fault. Preliminary results demonstrate the sensitivity of the method to various assumptions, and also indicate strongly that the total duration of ground motion at the site is controlled primarily by the length of the rupture process on the fault

  18. Derivatization and diffusive motion of molecular fullerenes: Ab initio and atomistic simulations

    Energy Technology Data Exchange (ETDEWEB)

    Berdiyorov, G., E-mail: gberdiyorov@qf.org.qa; Tabet, N. [Qatar Environment and Energy Research Institute (QEERI), Hamad Ben Khalifa University (HBKU), Qatar Foundation, P.O. Box 5825, Doha (Qatar); Harrabi, K. [Department of Physics, King Fahd University of Petroleum and Minerals, 31261 Dhahran (Saudi Arabia); Mehmood, U.; Hussein, I. A. [Department of Chemical Engineering, King Fahd University of Petroleum and Minerals, 31261 Dharan (Saudi Arabia); Peeters, F. M. [Departement Fysica, Universiteit Antwerpen, Groenenborgerlaan 171, B-2020 Antwerpen (Belgium); Zhang, J. [Department of Materials and London Centre for Nanotechnology, Imperial College London, SW7 2AZ London (United Kingdom); McLachlan, M. A. [Department of Materials and Centre for Plastic Electronics, Imperial College London, SW7 2AZ London (United Kingdom)

    2015-07-14

    Using first principles density functional theory in combination with the nonequilibrium Green's function formalism, we study the effect of derivatization on the electronic and transport properties of C{sub 60} fullerene. As a typical example, we consider [6,6]-phenyl-C{sub 61}-butyric acid methyl ester (PCBM), which forms one of the most efficient organic photovoltaic materials in combination with electron donating polymers. Extra peaks are observed in the density of states (DOS) due to the formation of new electronic states localized at/near the attached molecule. Despite such peculiar behavior in the DOS of an isolated molecule, derivatization does not have a pronounced effect on the electronic transport properties of the fullerene molecular junctions. Both C{sub 60} and PCBM show the same response to finite voltage biasing with new features in the transmission spectrum due to voltage induced delocalization of some electronic states. We also study the diffusive motion of molecular fullerenes in ethanol solvent and inside poly(3-hexylthiophene) lamella using reactive molecular dynamics simulations. We found that the mobility of the fullerene reduces considerably due to derivatization; the diffusion coefficient of C{sub 60} is an order of magnitude larger than the one for PCBM.

  19. Acoustic Holography With Incoherent Sources

    NARCIS (Netherlands)

    Druyvesteyn, W.F.; Raangs, R.

    2005-01-01

    In near field acoustic holography the sound field is scanned near the surface of the vibrating object; from these measurements the vibration of the structure can be calculated. In the case of correlated sources one reference signal is sufficient. When incoherent sources are present the separation of

  20. Use of the temporal median and trimmed mean mitigates effects of respiratory motion in multiple-acquisition abdominal diffusion imaging

    International Nuclear Information System (INIS)

    Jerome, N P; Orton, M R; D’Arcy, J A; Leach, M O; Collins, D J; Feiweier, T; Tunariu, N; Koh, D-M

    2015-01-01

    Respiratory motion commonly confounds abdominal diffusion-weighted magnetic resonance imaging, where averaging of successive samples at different parts of the respiratory cycle, performed in the scanner, manifests the motion as blurring of tissue boundaries and structural features and can introduce bias into calculated diffusion metrics. Storing multiple averages separately allows processing using metrics other than the mean; in this prospective volunteer study, median and trimmed mean values of signal intensity for each voxel over repeated averages and diffusion-weighting directions are shown to give images with sharper tissue boundaries and structural features for moving tissues, while not compromising non-moving structures. Expert visual scoring of derived diffusion maps is significantly higher for the median than for the mean, with modest improvement from the trimmed mean. Diffusion metrics derived from mono- and bi-exponential diffusion models are comparable for non-moving structures, demonstrating a lack of introduced bias from using the median. The use of the median is a simple and computationally inexpensive alternative to complex and expensive registration algorithms, requiring only additional data storage (and no additional scanning time) while returning visually superior images that will facilitate the appropriate placement of regions-of-interest when analysing abdominal diffusion-weighted magnetic resonance images, for assessment of disease characteristics and treatment response. (note)

  1. Synthesis of Cyclic Polymers and Characterization of Their Diffusive Motion in the Melt State at the Single Molecule Level

    KAUST Repository

    Habuchi, Satoshi; Yamamoto, Takuya; Tezuka, Yasuyuki

    2016-01-01

    We demonstrate a method for the synthesis of cyclic polymers and a protocol for characterizing their diffusive motion in a melt state at the single molecule level. An electrostatic self-assembly and covalent fixation (ESA-CF) process is used

  2. Direct comparison of in vivo versus postmortem second-order motion-compensated cardiac diffusion tensor imaging.

    Science.gov (United States)

    Stoeck, Christian T; von Deuster, Constantin; Fleischmann, Thea; Lipiski, Miriam; Cesarovic, Nikola; Kozerke, Sebastian

    2018-04-01

    To directly compare in vivo versus postmortem second-order motion-compensated spin-echo diffusion tensor imaging of the porcine heart. Second-order motion-compensated spin-echo cardiac diffusion tensor imaging was performed during systolic contraction in vivo and repeated upon cardiac arrest by bariumchloride without repositioning of the study animal or replaning of imaging slices. In vivo and postmortem reproducibility was assessed by repeat measurements. Comparison of helix, transverse, and sheet (E2A) angulation as well as mean diffusivity and fractional anisotropy was performed. Intraclass correlation coefficients for repeated measurements (postmortem/in vivo) were 0.95/0.96 for helix, 0.70/0.66 for transverse, and 0.79/0.72 for E2A angulation; 0.83/0.72 for mean diffusivity; and 0.78/0.76 for fractional anisotropy. The corresponding 95% levels of agreement across the left ventricle were: helix 14 to 18°/12 to 15°, transverse 9 to 10°/10 to 11°, E2A 15 to 20°/16 to 18°. The 95% levels of agreement across the left ventricle for the comparison of postmortem versus in vivo were 20 to 22° for helix, 13 to 19° for transverse, and 24 to 31° for E2A angulation. Parameters derived from in vivo second-order motion-compensated spin-echo diffusion tensor imaging agreed well with postmortem imaging, indicating sufficient suppression of motion-induced signal distortions of in vivo cardiac diffusion tensor imaging. Magn Reson Med 79:2265-2276, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  3. The crossover from collective motion to periphery diffusion for two-dimensional adatom-islands on Cu(111)

    International Nuclear Information System (INIS)

    Karim, Altaf; Kara, Abdelkader; Rahman, Talat S; Trushin, Oleg

    2011-01-01

    The diffusion of two-dimensional adatom-islands (up to 100 atoms) on Cu(111) has been studied, using the self-learning kinetic Monte Carlo method (Trushin et al 2005 Phys. Rev. B 72 115401). A variety of multiple- and single-atom processes are revealed in the simulations, and the size dependences of the diffusion coefficients and effective diffusion barriers are calculated for each. From the tabulated frequencies of events found in the simulation, we show a crossover from diffusion due to the collective motion of the island to a regime in which the island diffuses through periphery-dominated mass transport. This crossover occurs for island sizes between 13 and 19 atoms. For islands containing 19-100 atoms the scaling exponent is 1.5, which is in good agreement with previous work. The diffusion of islands containing 2-13 atoms can be explained primarily on the basis of a linear increase of the barrier for the collective motion with the size of the island. (fast track communication)

  4. Intramolecular diffusive motion in alkane monolayers studied by high-resolution quasielastic neutron scattering and molecular dynamics simulations

    DEFF Research Database (Denmark)

    Hansen, Flemming Yssing; Criswell, L.; Fuhrmann, D

    2004-01-01

    Molecular dynamics simulations of a tetracosane (n-C24H50) monolayer adsorbed on a graphite basal-plane surface show that there are diffusive motions associated with the creation and annihilation of gauche defects occurring on a time scale of similar to0.1-4 ns. We present evidence...... that these relatively slow motions are observable by high-energy-resolution quasielastic neutron scattering (QNS) thus demonstrating QNS as a technique, complementary to nuclear magnetic resonance, for studying conformational dynamics on a nanosecond time scale in molecular monolayers....

  5. Molecules in motion: influences of diffusion on metabolic structure and function in skeletal muscle.

    Science.gov (United States)

    Kinsey, Stephen T; Locke, Bruce R; Dillaman, Richard M

    2011-01-15

    Metabolic processes are often represented as a group of metabolites that interact through enzymatic reactions, thus forming a network of linked biochemical pathways. Implicit in this view is that diffusion of metabolites to and from enzymes is very fast compared with reaction rates, and metabolic fluxes are therefore almost exclusively dictated by catalytic properties. However, diffusion may exert greater control over the rates of reactions through: (1) an increase in reaction rates; (2) an increase in diffusion distances; or (3) a decrease in the relevant diffusion coefficients. It is therefore not surprising that skeletal muscle fibers have long been the focus of reaction-diffusion analyses because they have high and variable rates of ATP turnover, long diffusion distances, and hindered metabolite diffusion due to an abundance of intracellular barriers. Examination of the diversity of skeletal muscle fiber designs found in animals provides insights into the role that diffusion plays in governing both rates of metabolic fluxes and cellular organization. Experimental measurements of metabolic fluxes, diffusion distances and diffusion coefficients, coupled with reaction-diffusion mathematical models in a range of muscle types has started to reveal some general principles guiding muscle structure and metabolic function. Foremost among these is that metabolic processes in muscles do, in fact, appear to be largely reaction controlled and are not greatly limited by diffusion. However, the influence of diffusion is apparent in patterns of fiber growth and metabolic organization that appear to result from selective pressure to maintain reaction control of metabolism in muscle.

  6. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  7. On the role of memory effects for dissipation and diffusion in slow collective nuclear motion

    International Nuclear Information System (INIS)

    Cassing, W.; Noerenberg, W.

    1983-01-01

    The energy dissipation in slow collective nuclear motion is viewed as a combined effect of a diabatic production of particle-hole excitations, leading to a conservative storage of collective energy, and a subsequent equilibration due to residual two-body collisions. The effective equation of motion for the collective degree of freedom turns out to be nonlocal in time due to the large mean free path of the nucleons and allows for a simultaneous description of two different attitudes of nuclear matter. The elastic response of heavy nuclei for ''fast'' collective motion switches over to pure friction for very slow collective motion. The time development of the fluctuations in the velocities may show oscillations for times comparable to the local equilibration time and hence, is qualitatively different from the classical limit. A first application of the diabatic dynamical approach is made for the quadrupole motion within a diabatic deformed harmonic oscillator basis. (orig.)

  8. Optimal Exercise Boundary of American Fractional Lookback Option in a Mixed Jump-Diffusion Fractional Brownian Motion Environment

    Directory of Open Access Journals (Sweden)

    Zhaoqiang Yang

    2017-01-01

    Full Text Available A new framework for pricing the American fractional lookback option is developed in the case where the stock price follows a mixed jump-diffusion fraction Brownian motion. By using Itô formula and Wick-Itô-Skorohod integral a new market pricing model is built. The fundamental solutions of stochastic parabolic partial differential equations are estimated under the condition of Merton assumptions. The explicit integral representation of early exercise premium and the critical exercise price are also given. Numerical simulation illustrates some notable features of American fractional lookback options.

  9. Impact of Microwaves on the Electron Cloud and Incoherent Effects

    CERN Document Server

    Decker, Franz Josef; Zimmermann, Frank

    2002-01-01

    We consider the use of microwaves for manipulating the electron cloud, describing an exploratory experiment at PEP-II as well as computer simulations of the electron cloud build-up in the presence of a microwave for an LHC dipole. We then show that the incoherent effects of the electron cloud - energy loss and transverse emittance growth due to scattering of the electrons - are negligible. This suggests that the disturbance of the coherent motion may be another possible application of microwaves, which could prevent beam emittance growth and beam loss.

  10. Modeling persistence of motion in a crowded environment: The diffusive limit of excluding velocity-jump processes

    Science.gov (United States)

    Gavagnin, Enrico; Yates, Christian A.

    2018-03-01

    Persistence of motion is the tendency of an object to maintain motion in a direction for short time scales without necessarily being biased in any direction in the long term. One of the most appropriate mathematical tools to study this behavior is an agent-based velocity-jump process. In the absence of agent-agent interaction, the mean-field continuum limit of the agent-based model (ABM) gives rise to the well known hyperbolic telegraph equation. When agent-agent interaction is included in the ABM, a strictly advective system of partial differential equations (PDEs) can be derived at the population level. However, no diffusive limit of the ABM has been obtained from such a model. Connecting the microscopic behavior of the ABM to a diffusive macroscopic description is desirable, since it allows the exploration of a wider range of scenarios and establishes a direct connection with commonly used statistical tools of movement analysis. In order to connect the ABM at the population level to a diffusive PDE at the population level, we consider a generalization of the agent-based velocity-jump process on a two-dimensional lattice with three forms of agent interaction. This generalization allows us to take a diffusive limit and obtain a faithful population-level description. We investigate the properties of the model at both the individual and population levels and we elucidate some of the models' key characteristic features. In particular, we show an intrinsic anisotropy inherent to the models and we find evidence of a spontaneous form of aggregation at both the micro- and macroscales.

  11. RESIDENCE TIMES OF PARTICLES IN DIFFUSIVE PROTOPLANETARY DISK ENVIRONMENTS. I. VERTICAL MOTIONS

    International Nuclear Information System (INIS)

    Ciesla, F. J.

    2010-01-01

    The chemical and physical evolution of primitive materials in protoplanetary disks are determined by the types of environments they are exposed to and their residence times within each environment. Here, a method for calculating representative paths of materials in diffusive protoplanetary disks is developed and applied to understanding how the vertical trajectories that particles take impact their overall evolution. The methods are general enough to be applied to disks with uniform diffusivity, the so-called constant-α cases, and disks with a spatially varying diffusivity, such as expected in 'layered-disks'. The average long-term dynamical evolution of small particles and gaseous molecules is independent of the specific form of the diffusivity in that they spend comparable fractions of their lifetimes at different heights in the disk. However, the paths that individual particles and molecules take depend strongly on the form of the diffusivity leading to a different range of behavior of particles in terms of deviations from the mean. As temperatures, gas densities, chemical abundances, and photon fluxes will vary with height in protoplanetary disks, the different paths taken by primitive materials will lead to differences in their chemical and physical evolution. Examples of differences in gas phase chemistry and photochemistry are explored here. The methods outlined here provide a powerful tool that can be integrated with chemical models to understand the formation and evolution of primitive materials in protoplanetary disks on timescales of 10 5 -10 6 years.

  12. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Slow Diffusive Motions in a Monolayer of Tetracosane Molecules Adsorbed on Graphite

    DEFF Research Database (Denmark)

    Taub, H.; Hansen, Flemming Yssing; Criswell, L.

    2004-01-01

    to a temperature of similar to230 K, we observe the QNS energy width to be dispersionless, consistent with molecular dynamics simulations showing rotational motion of the molecules about their long axis. At 260 K, the QNS energy width begins to increase with wave vector transfer, suggesting onset of nonuniaxial...

  14. Brownian motion in a field of force and the diffusion theory of chemical reactions. II

    NARCIS (Netherlands)

    Brinkman, H.C.

    1956-01-01

    H. A. Kramers has studied the rate of chemical reactions in view of the Brownian forces caused by a surrounding medium in temperature equilibrium. In a previous paper 3) the author gave a solution of Kramers' diffusion equation in phase space by systematic development. In this paper the general

  15. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  16. Diffusion, confusion and functional MRI

    International Nuclear Information System (INIS)

    Le Bihan, Denis

    2012-01-01

    Diffusion MRI has been introduced in 1985 and has had a very successful life on its own. While it has become a standard for imaging stroke and white matter disorders, the borders between diffusion MRI and the general field of fMRI have always remained fuzzy. First, diffusion MRI has been used to obtain images of brain function, based on the idea that diffusion MRI could also be made sensitive to blood flow, through the intra-voxel incoherent motion (IVIM) concept. Second, the IVIM concept helped better understand the contribution from different vasculature components to the BOLD fMRI signal. Third, it has been shown recently that a genuine fMRI signal can be obtained with diffusion MRI. This 'DfMRI' signal is notably different from the BOLD fMRI signal, especially for its much faster response to brain activation both at onset and offset, which points out to structural changes in the neural tissues, perhaps such as cell swelling, occurring in activated neural tissue. This short article reviews the major steps which have paved the way for this exciting development, underlying how technical progress with MRI equipment has each time been instrumental to expand the horizon of diffusion MRI toward the field of fMRI. (authors)

  17. Air Motion and Thermal Environment in Pig Housing Facilities with Diffuse Inlet

    DEFF Research Database (Denmark)

    Jacobsen, Lis

    A ventilation system with ambient air supply through diffuse ceiling used in pig production facilities is presented. The climatic conditions were examined both experimentally and numerically in an full scale experimental room and the inlet boundary conditions of the diffuse inlet were examined...... in ambient temperature and air exchange rate. The effect of housing equipment on environmental conditions has been examined both experimental and numerically and it was found that impervious housing equipment has a significant effect on the climatic conditions close to the wall in the occupational zone...... in a wind tunnel model. In the full scale experiments the focus has been on the correlation between variations in ambient climatic conditions and changes in environmental condition in the occupational zone. It was found that the environmental conditions in the occupational zone were independent on changes...

  18. Incoherent SSI Analysis of Reactor Building using 2007 Hard-Rock Coherency Model

    International Nuclear Information System (INIS)

    Kang, Joo-Hyung; Lee, Sang-Hoon

    2008-01-01

    Many strong earthquake recordings show the response motions at building foundations to be less intense than the corresponding free-field motions. To account for these phenomena, the concept of spatial variation, or wave incoherence was introduced. Several approaches for its application to practical analysis and design as part of soil-structure interaction (SSI) effect have been developed. However, conventional wave incoherency models didn't reflect the characteristics of earthquake data from hard-rock site, and their application to the practical nuclear structures on the hard-rock sites was not justified sufficiently. This paper is focused on the response impact of hard-rock coherency model proposed in 2007 on the incoherent SSI analysis results of nuclear power plant (NPP) structure. A typical reactor building of pressurized water reactor (PWR) type NPP is modeled classified into surface and embedded foundations. The model is also assumed to be located on medium-hard rock and hard-rock sites. The SSI analysis results are obtained and compared in case of coherent and incoherent input motions. The structural responses considering rocking and torsion effects are also investigated

  19. Basic consideration of diffusion/perfusion imaging

    International Nuclear Information System (INIS)

    Tamagawa, Yoichi; Kimura, Hirohiko; Matsuda, Tsuyoshi; Kawamura, Yasutaka; Nakatsugawa, Shigekazu; Ishii, Yasushi; Sakuma, Hajime; Tsukamoto, Tetsuji.

    1990-01-01

    In magnetic resonance imaging (MRI), microscopic motion of biological system such as molecular diffusion of water and microcirculation of blood in the capillary network (perfusion) has been proposed to cause signal attenuation as an intravoxel incoherent motion (IVIM). Quantitative imaging of the IVIM phenomenon was attempted to generate from a set of spin-echo (SE) sequences with or without sensitization by motion probing gradient (MPG). The IVIM imaging is characterized by a parameter, apparent diffusion coefficient (ADC), which is an integration of both the diffusion and the perfusion factor on voxel-by-voxel basis. Hard ware was adjusted to avoid image artifact mainly produced by eddy current. Feasibility of the method was tested using bottle phantom filled with water at different temperature and acetone, and the calculated ADC values of these media corresponded well with accepted values of diffusion. The method was then applied to biological system to investigate mutual participation of diffusion/perfusion on the ADC value. The result of tumor model born on nude mouse suggested considerable participation of perfusion factor which immediately disappeared after sacrificing the animal. Meanwhile, lower value of sacrificed tissue without microcirculation was suggested to have some restriction of diffusion factor by biological tissue. To substantiate the restriction effect on the diffusion, a series of observation have made on a fiber phantom, stalk of celory with botanical fibers and human brain with nerve fibers, in applying unidirectional MPG along the course of these banch of fiber system. The directional restriction effect of diffusion along the course of fiber (diffusion anisotrophy) was clearly visualized as directional change of ADC value. The present method for tissue characterization by diffusion/perfusion on microscopic level will provide a new insight for evaluation of functional derangement in human brain and other organs. (author)

  20. Long time behaviour of diffusing particles in constrained geometries; application to chromatin motion

    International Nuclear Information System (INIS)

    Rosa, A; Neumann, F R; Gasser, S M; Stasiak, A

    2006-01-01

    Inspired by experiments that use single-particle tracking to measure the regions of confinement of selected chromosomal regions within cell nuclei, we have developed an analytical approach that takes into account various possible positions and shapes of the confinement regions. We show, in particular, that confinement of a particle into a subregion that is entirely enclosed within a spherical volume can lead to a higher limit of the mean radial square displacement value than the one associated with a particle that can explore the entire spherical volume. Finally, we apply the theory to analyse the motion of extrachromosomal chromatin rings within nuclei of living yeast

  1. Asymptotic analysis of reaction-diffusion-advection problems: Fronts with periodic motion and blow-up

    Science.gov (United States)

    Nefedov, Nikolay

    2017-02-01

    This is an extended variant of the paper presented at MURPHYS-HSFS 2016 conference in Barcelona. We discuss further development of the asymptotic method of differential inequalities to investigate existence and stability of sharp internal layers (fronts) for nonlinear singularly perturbed periodic parabolic problems and initial boundary value problems with blow-up of fronts for reaction-diffusion-advection equations. In particular, we consider periodic solutions with internal layer in the case of balanced reaction. For the initial boundary value problems we prove the existence of fronts and give their asymptotic approximation including the new case of blowing-up fronts. This case we illustrate by the generalised Burgers equation.

  2. Reduced equations of motion for quantum systems driven by diffusive Markov processes.

    Science.gov (United States)

    Sarovar, Mohan; Grace, Matthew D

    2012-09-28

    The expansion of a stochastic Liouville equation for the coupled evolution of a quantum system and an Ornstein-Uhlenbeck process into a hierarchy of coupled differential equations is a useful technique that simplifies the simulation of stochastically driven quantum systems. We expand the applicability of this technique by completely characterizing the class of diffusive Markov processes for which a useful hierarchy of equations can be derived. The expansion of this technique enables the examination of quantum systems driven by non-Gaussian stochastic processes with bounded range. We present an application of this extended technique by simulating Stark-tuned Förster resonance transfer in Rydberg atoms with nonperturbative position fluctuations.

  3. Simultaneous Measurement of T2 and Apparent Diffusion Coefficient (T2+ADC) in the Heart With Motion-Compensated Spin Echo Diffusion-Weighted Imaging

    Science.gov (United States)

    Aliotta, Eric; Moulin, Kévin; Zhang, Zhaohuan; Ennis, Daniel B.

    2018-01-01

    Purpose To evaluate a technique for simultaneous quantitative T2 and apparent diffusion coefficient (ADC) mapping in the heart (T2+ADC) using spin echo (SE) diffusion-weighted imaging (DWI). Theory and Methods T2 maps from T2+ADC were compared with single-echo SE in phantoms and with T2-prepared (T2-prep) balanced steady-state free precession (bSSFP) in healthy volunteers. ADC maps from T2+ADC were compared with conventional DWI in phantoms and in vivo. T2+ADC was also demonstrated in a patient with acute myocardial infarction (MI). Results Phantom T2 values from T2+ADC were closer to a single-echo SE reference than T2-prep bSSFP (−2.3 ± 6.0% vs 22.2 ± 16.3%; P T2 values from T2+ADC were significantly shorter than T2-prep bSSFP (35.8 ± 3.1 vs 46.8 ± 3.8 ms; P T2+ADC and conventional motion-compensated DWI (1.39 ± 0.18 vs 1.38 ± 0.18 mm2/ms; P = N.S.). In the patient, T2 and ADC were both significantly elevated in the infarct compared with remote myocardium (T2: 40.4 ± 7.6 vs 56.8 ± 22.0; P T2+ADC generated coregistered, free-breathing T2 and ADC maps in healthy volunteers and a patient with acute MI with no cost in accuracy, precision, or scan time compared with DWI. PMID:28516485

  4. Incoherent and coherent backscattering of light by a layer of densely packed random medium

    Energy Technology Data Exchange (ETDEWEB)

    Tishkovets, Victor P. [Institute of Radio Astronomy of NASU, 4 Chervonopraporna Street, Kharkiv 61002 (Ukraine)], E-mail: tishkovets@ira.kharkov.ua

    2007-12-15

    The problem of light scattering by a layer of densely packed discrete random medium is considered. The theory of light scattering by systems of nonspherical particles is applied to derive equations corresponding to incoherent (diffuse) and interference parts of radiation reflected from the medium. A solution of the system of linear equations describing light scattering by a system of particles is represented by iteration. It is shown that the symmetry properties of the T-matrices and of the translation coefficients for the vector Helmholtz harmonics lead to the reciprocity relation for an arbitrary iteration. This relation is applied to consider the backscattering enhancement phenomenon. Equations expressing the incoherent and interference parts of reflected light from statistically homogeneous and isotropic plane-parallel layer of medium are given. In the exact backscattering direction the relation between incoherent and interference parts is identical to that of sparse media.

  5. Inference on the hurst parameter and the variance of diffusions driven by fractional Brownian motion

    CERN Document Server

    Berzin, Corinne; León, José R

    2014-01-01

    This book is devoted to a number of stochastic models that display scale invariance. It primarily focuses on three issues: probabilistic properties, statistical estimation and simulation of the processes considered. It will be of interest to probability specialists, who will find here an uncomplicated presentation of statistics tools, and to those statisticians who wants to tackle the most recent theories in probability in order to develop Central Limit Theorems in this context; both groups will also benefit from the section on simulation. Algorithms are described in great detail, with a focus on procedures that is not usually found in mathematical treatises. The models studied are fractional Brownian motions and processes that derive from them through stochastic differential equations. Concerning the proofs of the limit theorems, the “Fourth Moment Theorem” is systematically used, as it produces rapid and helpful proofs that can serve as models for the future. Readers will also find elegant and new proof...

  6. Stochastic mechanics and the Kepler problem: Diffusions generated by the quantum motion

    International Nuclear Information System (INIS)

    Garbaczewski, P.

    1986-01-01

    We construct a class of solutions of the Schroedinger equation for the Coulomb-Kepler problem. Their ψ = ρ 1/2 exp(iS/ℎ) structure implies that the quantal dynamics of wave functions is completely determined by the related classical Hamiltonian system. A construction of the associated controlled stochastic processes is then possible, their drift velocity being entirely defined in terms of (explicitly known) probability density ρ(x,y,z,t) and phase S(x,y,z,t). In particular, for the stationary states of the quantum problem, in its four-oscillator reconstruction, we identify the regime in which the related classical Hamiltonian can be effectively replaced by the Hamiltonian of the classical Kepler motion. (orig.)

  7. Fractional Diffusion, Low Exponent Lévy Stable Laws, and 'Slow Motion' Denoising of Helium Ion Microscope Nanoscale Imagery.

    Science.gov (United States)

    Carasso, Alfred S; Vladár, András E

    2012-01-01

    Helium ion microscopes (HIM) are capable of acquiring images with better than 1 nm resolution, and HIM images are particularly rich in morphological surface details. However, such images are generally quite noisy. A major challenge is to denoise these images while preserving delicate surface information. This paper presents a powerful slow motion denoising technique, based on solving linear fractional diffusion equations forward in time. The method is easily implemented computationally, using fast Fourier transform (FFT) algorithms. When applied to actual HIM images, the method is found to reproduce the essential surface morphology of the sample with high fidelity. In contrast, such highly sophisticated methodologies as Curvelet Transform denoising, and Total Variation denoising using split Bregman iterations, are found to eliminate vital fine scale information, along with the noise. Image Lipschitz exponents are a useful image metrology tool for quantifying the fine structure content in an image. In this paper, this tool is applied to rank order the above three distinct denoising approaches, in terms of their texture preserving properties. In several denoising experiments on actual HIM images, it was found that fractional diffusion smoothing performed noticeably better than split Bregman TV, which in turn, performed slightly better than Curvelet denoising.

  8. Quasielastic neutron scattering study of large amplitude motions in molecular systems

    International Nuclear Information System (INIS)

    Bee, M.

    1996-01-01

    This lecture aims at giving some illustrations of the use of Incoherent Quasielastic Neutron Scattering in the investigation of motions of atoms or molecules in phases with dynamical disorder. The general incoherent scattering function is first recalled. Then the Elastic Incoherent Structure Factor is introduced. It is shown how its determination permits to deduce a particular dynamical model. Long-range translational diffusion is illustrated by some experiments carried out with liquids or with different chemical species intercalated in porous media. Examples of rotational motions are provided by solid phases where an orientational disorder of the molecules exists. The jump model is the most commonly used and yields simple scattering laws which can be easily handled. Highly disordered crystals require a description in terms of the isotropic rotational diffusion model. Many of the present studies are concerned with rather complicated systems. Considerable help is obtained either by using selectively deuterated samples or by carrying out measurements with semi-oriented samples. (author) 5 figs., 14 refs

  9. Biological growth in bodies with incoherent interfaces

    Science.gov (United States)

    Swain, Digendranath; Gupta, Anurag

    2018-01-01

    A general theory of thermodynamically consistent biomechanical-biochemical growth in a body, considering mass addition in the bulk and at an incoherent interface, is developed. The incoherency arises due to incompatibility of growth and elastic distortion tensors at the interface. The incoherent interface therefore acts as an additional source of internal stress besides allowing for rich growth kinematics. All the biochemicals in the model are essentially represented in terms of nutrient concentration fields, in the bulk and at the interface. A nutrient balance law is postulated which, combined with mechanical balances and kinetic laws, yields an initial-boundary-value problem coupling the evolution of bulk and interfacial growth, on the one hand, and the evolution of growth and nutrient concentration on the other. The problem is solved, and discussed in detail, for two distinct examples: annual ring formation during tree growth and healing of cutaneous wounds in animals.

  10. From Random Walks to Brownian Motion, from Diffusion to Entropy: Statistical Principles in Introductory Physics

    Science.gov (United States)

    Reeves, Mark

    2014-03-01

    Entropy changes underlie the physics that dominates biological interactions. Indeed, introductory biology courses often begin with an exploration of the qualities of water that are important to living systems. However, one idea that is not explicitly addressed in most introductory physics or biology textbooks is dominant contribution of the entropy in driving important biological processes towards equilibrium. From diffusion to cell-membrane formation, to electrostatic binding in protein folding, to the functioning of nerve cells, entropic effects often act to counterbalance deterministic forces such as electrostatic attraction and in so doing, allow for effective molecular signaling. A small group of biology, biophysics and computer science faculty have worked together for the past five years to develop curricular modules (based on SCALEUP pedagogy) that enable students to create models of stochastic and deterministic processes. Our students are first-year engineering and science students in the calculus-based physics course and they are not expected to know biology beyond the high-school level. In our class, they learn to reduce seemingly complex biological processes and structures to be described by tractable models that include deterministic processes and simple probabilistic inference. The students test these models in simulations and in laboratory experiments that are biologically relevant. The students are challenged to bridge the gap between statistical parameterization of their data (mean and standard deviation) and simple model-building by inference. This allows the students to quantitatively describe realistic cellular processes such as diffusion, ionic transport, and ligand-receptor binding. Moreover, the students confront ``random'' forces and traditional forces in problems, simulations, and in laboratory exploration throughout the year-long course as they move from traditional kinematics through thermodynamics to electrostatic interactions. This talk

  11. Role of string-like collective atomic motion on diffusion and structural relaxation in glass forming Cu-Zr alloys

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Hao [International Center for New-Structured Materials (ICNSM), Zhejiang University and Laboratory of New-Structured Materials, School of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Department of Chemical and Materials Engineering, University of Alberta, Edmonton, Alberta T6G 2V4 (Canada); Zhong, Cheng; Wang, Xiaodong; Cao, Qingping; Jiang, Jian-Zhong, E-mail: jiangjz@zju.edu.cn, E-mail: jack.douglas@nist.gov [International Center for New-Structured Materials (ICNSM), Zhejiang University and Laboratory of New-Structured Materials, School of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou 310027 (China); Douglas, Jack F., E-mail: jiangjz@zju.edu.cn, E-mail: jack.douglas@nist.gov [Materials Science and Engineering Division, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Zhang, Dongxian [State Key Laboratory of Modern Optical Instrumentation, Zhejiang University, Hangzhou 310027 (China)

    2015-04-28

    We investigate Cu-Zr liquid alloys using molecular dynamics simulation and well-accepted embedded atom method potentials over a wide range of chemical composition and temperature as model metallic glass-forming (GF) liquids. As with other types of GF materials, the dynamics of these complex liquids are characterized by “dynamic heterogeneity” in the form of transient polymeric clusters of highly mobile atoms that are composed in turn of atomic clusters exhibiting string-like cooperative motion. In accordance with the string model of relaxation, an extension of the Adam-Gibbs (AG) model, changes in the activation free energy ΔG{sub a} with temperature of both the Cu and Zr diffusion coefficients D, and the alpha structural relaxation time τ{sub α} can be described to a good approximation by changes in the average string length, L. In particular, we confirm that the strings are a concrete realization of the abstract “cooperatively rearranging regions” of AG. We also find coexisting clusters of relatively “immobile” atoms that exhibit predominantly icosahedral local packing rather than the low symmetry packing of “mobile” atoms. These two distinct types of dynamic heterogeneity are then associated with different fluid structural states. Glass-forming liquids are thus analogous to polycrystalline materials where the icosahedrally packed regions correspond to crystal grains, and the strings reside in the relatively disordered grain boundary-like regions exterior to these locally well-ordered regions. A dynamic equilibrium between localized (“immobile”) and wandering (“mobile”) particles exists in the liquid so that the dynamic heterogeneity can be considered to be type of self-assembly process. We also characterize changes in the local atomic free volume in the course of string-like atomic motion to better understand the initiation and propagation of these fluid excitations.

  12. Higher derivative corrections to incoherent metallic transport in holography

    Energy Technology Data Exchange (ETDEWEB)

    Baggioli, Matteo [Institut de Física d’Altes Energies (IFAE), Universitat Autónoma de Barcelona,The Barcelona Institute of Science and Technology,Campus UAB, 08193 Bellaterra (Barcelona) (Spain); Crete Center for Theoretical Physics and I.P.P., Department of Physics, University of Crete,71003 Heraklion (Greece); Goutéraux, Blaise [Nordita, KTH Royal Institute of Technology and Stockholm University,Roslagstullsbacken 23, SE-106 91 Stockholm (Sweden); Stanford Institute for Theoretical Physics, Department of Physics, Stanford University,Varian Laboratory of Physics, 382 Via Pueblo Mall, Stanford, CA 94305-4060 (United States); APC, Université Paris 7, CNRS/IN2P3, CEA/IRFU, Obs. de Paris,Sorbonne Paris Cité (UMR du CNRS 7164),Bâtiment Condorcet, 10, rue Alice Domon et Léonie Duquet, F-75205, Paris Cedex 13 (France); Kiritsis, Elias [APC, Université Paris 7, CNRS/IN2P3, CEA/IRFU, Obs. de Paris,Sorbonne Paris Cité (UMR du CNRS 7164),Bâtiment Condorcet, 10, rue Alice Domon et Léonie Duquet, F-75205, Paris Cedex 13 (France); Crete Center for Theoretical Physics and I.P.P., Department of Physics, University of Crete,71003 Heraklion (Greece); Crete Center for Quantum Complexity and Nanotechnology, University of Crete,71003 Heraklion (Greece); Li, Wei-Jia [Institute of Theoretical Physics, School of Physics and Optoelectronic Technology,Dalian University of Technology, 214 School of Physics,2 Linggong road, Ganjingzi District, Dalian 116024, Liaoning Province (China); Crete Center for Theoretical Physics and I.P.P., Department of Physics, University of Crete,71003 Heraklion (Greece)

    2017-03-31

    Transport in strongly-disordered, metallic systems is governed by diffusive processes. Based on quantum mechanics, it has been conjectured that these diffusivities obey a lower bound D/v{sup 2}≳ℏ/k{sub B}T, the saturation of which provides a mechanism for the T-linear resistivity of bad metals. This bound features a characteristic velocity v, which was later argued to be the butterfly velocity v{sub B}, based on holographic models of transport. This establishes a link between incoherent metallic transport, quantum chaos and Planckian timescales. Here we study higher derivative corrections to an effective holographic action of homogeneous disorder. The higher derivative terms involve only the charge and translation symmetry breaking sector. We show that they have a strong impact on the bound on charge diffusion D{sub c}/v{sub B}{sup 2}≳ℏ/k{sub B}T, by potentially making the coefficient of its right-hand side arbitrarily small. On the other hand, the bound on energy diffusion is not affected.

  13. Incoherent imaging using dynamically scattered coherent electrons

    International Nuclear Information System (INIS)

    Nellist, P.D.; Pennycook, S.J.

    1999-01-01

    We use a Bloch wave approach to show that, even for coherent dynamical scattering from a stationary lattice with no absorption, annular dark-field imaging in a scanning transmission electron microscope gives a direct incoherent structure image of the atomic-column positions of a zone-axis-aligned crystal. Although many Bloch waves may be excited by the probe, the detector provides a filtering effect so that the 1s-type bound states are found to dominate the image contrast for typical experimental conditions. We also find that the column intensity is related to the transverse kinetic energy of the 1s states, which gives atomic number, Z, contrast. The additional effects of phonon scattering are discussed, in particular the reasons why phonon scattering is not a prerequisite for transverse incoherence. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  14. Investigating the effect of poly-l-lactic acid nanoparticles carrying hypericin on the flow-biased diffusive motion of HeLa cell organelles.

    Science.gov (United States)

    Penjweini, Rozhin; Deville, Sarah; Haji Maghsoudi, Omid; Notelaers, Kristof; Ethirajan, Anitha; Ameloot, Marcel

    2017-07-19

    In this study, we investigate in human cervical epithelial HeLa cells the intracellular dynamics and the mutual interaction with the organelles of the poly-l-lactic acid nanoparticles (PLLA NPs) carrying the naturally occurring hydrophobic photosensitizer hypericin. Temporal and spatiotemporal image correlation spectroscopy was used for the assessment of the intracellular diffusion and directed motion of the nanocarriers by tracking the hypericin fluorescence. Using image cross-correlation spectroscopy and specific fluorescent labelling of endosomes, lysosomes and mitochondria, the NPs dynamics in association with the cell organelles was studied. Static colocalization experiments were interpreted according to the Manders' overlap coefficient. Nanoparticles associate with a small fraction of the whole-organelle population. The organelles moving with NPs exhibit higher directed motion compared to those moving without them. The rate of the directed motion drops substantially after the application of nocodazole. The random component of the organelle motions is not influenced by the NPs. Image correlation and cross-correlation spectroscopy are most appropriate to unravel the motion of the PLLA nanocarrier and to demonstrate that the rate of the directed motion of organelles is influenced by their interaction with the nanocarriers. Not all PLLA-hypericin NPs are associated with organelles. © 2017 Royal Pharmaceutical Society.

  15. Quantum diffusion of light interstitials in metals

    International Nuclear Information System (INIS)

    McMullen, T.; Bergersen, B.

    1978-01-01

    A quantum theory of diffusion of self-trapped light interstitials in metals is presented. The theory encompasses both coherent and incoherent tunneling, but the approximation used neglects the dependence of the interstitial transfer matrix element on the vibrational state of the crystal. The coherent tunneling contribution is estimated by fitting the incoherent diffusion rate to experimental data for hydrogen and muon diffusion. It is predicted that coherent diffusion should be dominant below approximately 80 K for H in Nb and below approximately 190 K for μ + in Cu. Experimental verifications of these predictions would require high purity strain free samples and low concentrations of the diffusing species. (author)

  16. Diffusion-Weighted MRI for the Assessment of Liver Fibrosis: Principles and Applications

    Directory of Open Access Journals (Sweden)

    Stefano Palmucci

    2015-01-01

    Full Text Available The importance of an early identification of hepatic fibrosis has been emphasized, in order to start therapy and obtain fibrosis regression. Biopsy is the gold-standard method for the assessment of liver fibrosis in chronic liver diseases, but it is limited by complications, interobserver variability, and sampling errors. Several noninvasive methods have been recently introduced into clinical routine, in order to detect liver fibrosis early. One of the most diffuse approaches is represented by diffusion-weighted liver MRI. In this review, the main technical principles are briefly reported in order to explain the rationale for clinical applications. In addition, roles of apparent diffusion coefficient, intravoxel incoherent motion, and relative apparent diffusion coefficient are also reported, showing their advantages and limits.

  17. Spectral long-range interaction of temporal incoherent solitons.

    Science.gov (United States)

    Xu, Gang; Garnier, Josselin; Picozzi, Antonio

    2014-02-01

    We study the interaction of temporal incoherent solitons sustained by a highly noninstantaneous (Raman-like) nonlinear response. The incoherent solitons exhibit a nonmutual interaction, which can be either attractive or repulsive depending on their relative initial distance. The analysis reveals that incoherent solitons exhibit a long-range interaction in frequency space, which is in contrast with the expected spectral short-range interaction described by the usual approach based on the Raman-like spectral gain curve. Both phenomena of anomalous interaction and spectral long-range behavior of incoherent solitons are described in detail by a long-range Vlasov equation.

  18. Yes, The Precautionary Principle Is Incoherent.

    Science.gov (United States)

    Peterson, Martin

    2017-11-01

    This article is a reply to Thomas Boyer-Kassem's discussion of my criticism of the precautionary principle published in this journal about a decade ago. Boyer-Kassem does not question the logical validity of the theorem proved in my original article, but he brings up important questions about its scope. He also challenges the plausibility of some of the assumptions on which it is based. In this comment, I argue that each objection can be adequately dealt with. As a decision rule, the precautionary principle is (still) incoherent. © 2017 Society for Risk Analysis.

  19. Comparison of non-Gaussian and Gaussian diffusion models of diffusion weighted imaging of rectal cancer at 3.0 T MRI.

    Science.gov (United States)

    Zhang, Guangwen; Wang, Shuangshuang; Wen, Didi; Zhang, Jing; Wei, Xiaocheng; Ma, Wanling; Zhao, Weiwei; Wang, Mian; Wu, Guosheng; Zhang, Jinsong

    2016-12-09

    Water molecular diffusion in vivo tissue is much more complicated. We aimed to compare non-Gaussian diffusion models of diffusion-weighted imaging (DWI) including intra-voxel incoherent motion (IVIM), stretched-exponential model (SEM) and Gaussian diffusion model at 3.0 T MRI in patients with rectal cancer, and to determine the optimal model for investigating the water diffusion properties and characterization of rectal carcinoma. Fifty-nine consecutive patients with pathologically confirmed rectal adenocarcinoma underwent DWI with 16 b-values at a 3.0 T MRI system. DWI signals were fitted to the mono-exponential and non-Gaussian diffusion models (IVIM-mono, IVIM-bi and SEM) on primary tumor and adjacent normal rectal tissue. Parameters of standard apparent diffusion coefficient (ADC), slow- and fast-ADC, fraction of fast ADC (f), α value and distributed diffusion coefficient (DDC) were generated and compared between the tumor and normal tissues. The SEM exhibited the best fitting results of actual DWI signal in rectal cancer and the normal rectal wall (R 2  = 0.998, 0.999 respectively). The DDC achieved relatively high area under the curve (AUC = 0.980) in differentiating tumor from normal rectal wall. Non-Gaussian diffusion models could assess tissue properties more accurately than the ADC derived Gaussian diffusion model. SEM may be used as a potential optimal model for characterization of rectal cancer.

  20. Is the Precautionary Principle Really Incoherent?

    Science.gov (United States)

    Boyer-Kassem, Thomas

    2017-11-01

    The Precautionary Principle has been an increasingly important principle in international treaties since the 1980s. Through varying formulations, it states that when an activity can lead to a catastrophe for human health or the environment, measures should be taken to prevent it even if the cause-and-effect relationship is not fully established scientifically. The Precautionary Principle has been critically discussed from many sides. This article concentrates on a theoretical argument by Peterson (2006) according to which the Precautionary Principle is incoherent with other desiderata of rational decision making, and thus cannot be used as a decision rule that selects an action among several ones. I claim here that Peterson's argument fails to establish the incoherence of the Precautionary Principle, by attacking three of its premises. I argue (i) that Peterson's treatment of uncertainties lacks generality, (ii) that his Archimedian condition is problematic for incommensurability reasons, and (iii) that his explication of the Precautionary Principle is not adequate. This leads me to conjecture that the Precautionary Principle can be envisaged as a coherent decision rule, again. © 2017 Society for Risk Analysis.

  1. Incoherent control of locally controllable quantum systems

    International Nuclear Information System (INIS)

    Dong Daoyi; Zhang Chenbin; Rabitz, Herschel; Pechen, Alexander; Tarn, T.-J.

    2008-01-01

    An incoherent control scheme for state control of locally controllable quantum systems is proposed. This scheme includes three steps: (1) amplitude amplification of the initial state by a suitable unitary transformation, (2) projective measurement of the amplified state, and (3) final optimization by a unitary controlled transformation. The first step increases the amplitudes of some desired eigenstates and the corresponding probability of observing these eigenstates, the second step projects, with high probability, the amplified state into a desired eigenstate, and the last step steers this eigenstate into the target state. Within this scheme, two control algorithms are presented for two classes of quantum systems. As an example, the incoherent control scheme is applied to the control of a hydrogen atom by an external field. The results support the suggestion that projective measurements can serve as an effective control and local controllability information can be used to design control laws for quantum systems. Thus, this scheme establishes a subtle connection between control design and controllability analysis of quantum systems and provides an effective engineering approach in controlling quantum systems with partial controllability information.

  2. Elucidating fluctuating diffusivity in center-of-mass motion of polymer models with time-averaged mean-square-displacement tensor

    Science.gov (United States)

    Miyaguchi, Tomoshige

    2017-10-01

    There have been increasing reports that the diffusion coefficient of macromolecules depends on time and fluctuates randomly. Here a method is developed to elucidate this fluctuating diffusivity from trajectory data. Time-averaged mean-square displacement (MSD), a common tool in single-particle-tracking (SPT) experiments, is generalized to a second-order tensor with which both magnitude and orientation fluctuations of the diffusivity can be clearly detected. This method is used to analyze the center-of-mass motion of four fundamental polymer models: the Rouse model, the Zimm model, a reptation model, and a rigid rodlike polymer. It is found that these models exhibit distinctly different types of magnitude and orientation fluctuations of diffusivity. This is an advantage of the present method over previous ones, such as the ergodicity-breaking parameter and a non-Gaussian parameter, because with either of these parameters it is difficult to distinguish the dynamics of the four polymer models. Also, the present method of a time-averaged MSD tensor could be used to analyze trajectory data obtained in SPT experiments.

  3. Coherent and incoherent processes in resonant photoemission

    Energy Technology Data Exchange (ETDEWEB)

    Magnuson, M.; Karis, O.; Weinelt, M. [Uppsala Univ. (Sweden)] [and others

    1997-04-01

    In this contribution the authors present the distinction between coherent and incoherent processes in resonant photoemission. As a first step they determine whether an autoionization process is photoemission-like or Auger-like. The discussion is based on measurements for a weakly bonded adsorption system, Ar/Pt(111). This type of system is well adapted to investigate these effects since it yields distinctly shifted spectral features depending on the nature of the process. After this, the question of resonance photoemission in metallic systems is addressed. This is done in connection with measurements at the 2p edges for Ni metal. Ni has been one of the prototype systems for resonant photoemission. The resonances have been discussed in connection with the strong correlation and d-band localization effects in this system. Based on the results some general comments about the appearance of resonant effects in metallic systems are made.

  4. Electromagnetically induced absorption via incoherent collisions

    International Nuclear Information System (INIS)

    Yang Xihua; Sheng Jiteng; Xiao Min

    2011-01-01

    We conduct theoretical studies on electromagnetically induced absorption via incoherent collisions in an inhomogeneously broadened ladder-type three-level system with the density-matrix approach. The effects of the collision-induced coherence decay rates as well as the probe laser field intensity on the probe field absorption are examined. It is shown that with the increase of the collisional decay rates in a moderate range, a narrow dip due to electromagnetically induced transparency superimposed on the Doppler-broadened absorption background can be turned into a narrow peak under the conditions that the probe field intensity is not very weak as compared to the pump field, which results from the enhancement of constructive interference and suppression of destructive interference between one-photon and multiphoton transition pathways. The physical origin of the collision-assisted electromagnetically induced absorption is analyzed with a power-series solution of the density-matrix equations.

  5. Fractional Brownian motion run with a multi-scaling clock mimics diffusion of spherical colloids in microstructural fluids.

    Science.gov (United States)

    Park, Moongyu; Cushman, John Howard; O'Malley, Dan

    2014-09-30

    The collective molecular reorientations within a nematic liquid crystal fluid bathing a spherical colloid cause the colloid to diffuse anomalously on a short time scale (i.e., as a non-Brownian particle). The deformations and fluctuations of long-range orientational order in the liquid crystal profoundly influence the transient diffusive regimes. Here we show that an anisotropic fractional Brownian process run with a nonlinear multiscaling clock effectively mimics this collective and transient phenomenon. This novel process has memory, Gaussian increments, and a multiscale mean square displacement that can be chosen independently from the fractal dimension of a particle trajectory. The process is capable of modeling multiscale sub-, super-, or classical diffusion. The finite-size Lyapunov exponents for this multiscaling process are defined for future analysis of related mixing processes.

  6. Diffusion-weighted MR neurography of the tibial nerve and the common peroneal nerve with different motion probing gradients

    International Nuclear Information System (INIS)

    Zhao Lianxin; Wang Guangbin; Liu Yubo; Wu Lebin; Bai Xue; Yang Li; Chen Weibo

    2014-01-01

    Objective: To compare the image quality of diffusion-weighted MR neurography (DW-MRN) of the tibial nerve and the common peroneal nerve prospectively using different motion probing gradients (MPGs). Methods: A total of 21 healthy volunteers underwent DW-MRN at the knee (unilateral imaging) on a 3.0 T magnetic resonance system with unidirectional MPGs. The protocol included anterior-posterior unidirectional, right-left unidirectional, three-directional and six-directional MPGs. The apparent SNR and CNR of tibial nerve and common peroneal nerve were calculated. Three-dimensional MIP images of the nerves were evaluated blindly by two radiologists using a four-point grading scale on basis of entirety depiction and the signal intensity. Significance was determined by using Friedman and paired Wilcoxon tests. Results: The SNR of tibial nerves on DW-MRN with anterior-posterior, right-left, three directional and six directional MPGs were 4.17 (2.70-5.65), 4.35 (0.47-4.69), 3.46 (2.27-4.62) and 3.30 (2.06-4.43), respectively. CNR were 0.61 (0.46-0.70), 0.63 (0.36-0.73), 0.55 (0.39-0.64) and 0.53(0.35-0.63), respectively. The scores of tibial nerve image quality were 4.0 (2.0-4.0), 4.0 (3.0-4.0), 2.5 (2.0-3.5), 2.0 (1.0-2.5), respectively. Interobserver agreement was good and the Kappa value was 0.69 (P<0.05). The SNR of the common peroneal nerves on DW-MRN with anterior-posterior, right-left, three directional and six directional MPGs were 3.05 (2.30-4.20), 3.05 (2.26-4.34), 2.72 (1.84-13.80) and 2.68 (1.87-3.67), respectively. CNR were 0.51 (0.39-0.62), 0.51 (0.39-0.63), 0.46(0.30-0.86) and 0.46 (0.30-0.57), respectively. The scores of the common peroneal nerve image quality were 3.5 (2.0-4.0), 4.0 (2.0-4.0), 2.0 (1.0-3.0) and 2.0 (1.0-2.5), respectively. Interobserver agreement was good and the Kappa value was 0.70 (P<0.05). For SNR, CNR and nerve image quality of the tibial nerves and the common peroneal nerves, there were significant differences among different MPGs (

  7. Incidental experiences of affective coherence and incoherence influence persuasion.

    Science.gov (United States)

    Huntsinger, Jeffrey R

    2013-06-01

    When affective experiences are inconsistent with activated evaluative concepts, people experience what is called affective incoherence; when affective experiences are consistent with activated evaluative concepts, people experience affective coherence. The present research asked whether incidental feelings of affective coherence and incoherence would regulate persuasion. Experiences of affective coherence and incoherence were predicted and found to influence the processing of persuasive messages when evoked prior to receipt of such messages (Experiments 1 and 3), and to influence the confidence with which thoughts generated by persuasive messages were held when evoked after presentation of such messages (Experiments 2 and 3). These results extend research on affective coherence and incoherence by showing that they exert a broader impact on cognitive activity than originally assumed.

  8. Incoherent quasielastic neutron scattering from plastic crystals

    International Nuclear Information System (INIS)

    Bee, M.; Amoureux, J.P.

    1980-01-01

    The aim of this paper is to present some applications of a method indicated by Sears in order to correct for multiple scattering. The calculations were performed in the particular case of slow neutron incoherent quasielastic scattering from organic plastic crystals. First, an exact calculation (up to second scattering) is compared with the results of a Monte Carlo simulation technique. Then, an approximation is developed on the basis of a rotational jump model which allows a further analytical treatment. The multiple scattering is expressed in terms of generalized structure factors (which can be regarded as self convolutions of first order structure factors taking into account the instrumental geometry) and lorentzian functions the widths of which are linear combinations of the jump rates. Three examples are given. Two of them correspond to powder samples while in the third we are concerned with the case of a single crystalline slab. In every case, this approximation is shown to be a good approach to the multiple scattering evaluation, its main advantage being the possibility of applying it without any preliminary knowledge of the correlation times for rotational jumps. (author)

  9. Processing oscillatory signals by incoherent feedforward loops

    Science.gov (United States)

    Zhang, Carolyn; Wu, Feilun; Tsoi, Ryan; Shats, Igor; You, Lingchong

    From the timing of amoeba development to the maintenance of stem cell pluripotency,many biological signaling pathways exhibit the ability to differentiate between pulsatile and sustained signals in the regulation of downstream gene expression.While networks underlying this signal decoding are diverse,many are built around a common motif, the incoherent feedforward loop (IFFL),where an input simultaneously activates an output and an inhibitor of the output.With appropriate parameters,this motif can generate temporal adaptation,where the system is desensitized to a sustained input.This property serves as the foundation for distinguishing signals with varying temporal profiles.Here,we use quantitative modeling to examine another property of IFFLs,the ability to process oscillatory signals.Our results indicate that the system's ability to translate pulsatile dynamics is limited by two constraints.The kinetics of IFFL components dictate the input range for which the network can decode pulsatile dynamics.In addition,a match between the network parameters and signal characteristics is required for optimal ``counting''.We elucidate one potential mechanism by which information processing occurs in natural networks with implications in the design of synthetic gene circuits for this purpose. This work was partially supported by the National Science Foundation Graduate Research Fellowship (CZ).

  10. Incoherences of Brazilian labour laws face to present radioprotection concepts

    International Nuclear Information System (INIS)

    Borges, J.C.

    1996-01-01

    The Brazilian labour legislation establishes, since 1950, some privileges for people working in activities which imply exposure to ionizing radiations. Comparing the present legal framework with technical radioprotection knowledge, one can detect several incoherences covering: classification of such activities; additional payments; reduced labour journey; more vacations; medical surveillance; early retirements; special norms for women. An analysis of these incoherences lead us to propose a new frame of labour rights and radioprotection norms, coupling Brazilian juridical principles and modern radioprotection knowledge. (author)

  11. Preliminary evaluation of the apparent diffusion coefficient of the kidney with a spiral IVIM sequence

    International Nuclear Information System (INIS)

    Tsuda, Kyo; Murakami, Takamichi; Sakurai, Kousuke

    1997-01-01

    We examined the usefulness of the spiral intravoxel incoherent motion (IVIM) sequence in measuring the apparent diffusion coefficient (ADC) of the kidneys. Five volunteers and five patients with chronic renal failure underwent diffusion-sensitive magnetic resonance imaging of the kidneys with the spiral IVIM sequence. The ADC values in patients with chronic renal failure were significantly lower than those in the renal cortex of volunteers. The mean value of ADC in patients with chronic renal failure was lower than that in volunteers, although there was no statistically significant difference. In volunteers, the ADC of the renal cortex was significantly higher than that of the renal medulla. The phantom study indicated that the accuracy of ADC depended on the signal to noise ratio. A spiral IVIM sequence with a high enough signal to noise ratio may be useful in evaluating renal function, especially that of the cortex. (author)

  12. RESIDENCE TIMES OF PARTICLES IN DIFFUSIVE PROTOPLANETARY DISK ENVIRONMENTS. II. RADIAL MOTIONS AND APPLICATIONS TO DUST ANNEALING

    International Nuclear Information System (INIS)

    Ciesla, F. J.

    2011-01-01

    The origin of crystalline grains in comets and the outer regions of protoplanetary disks remains a mystery. It has been suggested that such grains form via annealing of amorphous precursors in the hot, inner region of a protoplanetary disk, where the temperatures needed for such transformations were found, and were then transported outward by some dynamical means. Here we develop a means of tracking the paths that dust grains would have taken through a diffusive protoplanetary disk and examine the types and ranges of environments that particles would have seen over a 10 6 yr time period in the dynamic disk. We then combine this model with three annealing laws to examine how the dynamic evolution of amorphous grains would have led to their physical restructuring and their delivery to various regions of the disk. It is found that 'sibling particles' - those particles that reside at the same location at a given period of time-take a wide range of unique and independent paths through the disk to arrive there. While high temperatures can persist in the disk for very long time periods, we find that those grains that are delivered to the cold outer regions of the disk are largely annealed in the first few x10 5 yr of disk history. This suggests that the crystallinity of grains in the outer disk would be determined early and remain unchanged for much of disk history, in agreement with recent astronomical observations.

  13. CINCH (confocal incoherent correlation holography) super resolution fluorescence microscopy based upon FINCH (Fresnel incoherent correlation holography).

    Science.gov (United States)

    Siegel, Nisan; Storrie, Brian; Bruce, Marc; Brooker, Gary

    2015-02-07

    FINCH holographic fluorescence microscopy creates high resolution super-resolved images with enhanced depth of focus. The simple addition of a real-time Nipkow disk confocal image scanner in a conjugate plane of this incoherent holographic system is shown to reduce the depth of focus, and the combination of both techniques provides a simple way to enhance the axial resolution of FINCH in a combined method called "CINCH". An important feature of the combined system allows for the simultaneous real-time image capture of widefield and holographic images or confocal and confocal holographic images for ready comparison of each method on the exact same field of view. Additional GPU based complex deconvolution processing of the images further enhances resolution.

  14. Towards sub-{Angstrom} resolution through incoherent imaging

    Energy Technology Data Exchange (ETDEWEB)

    Pennycook, S.J.; Chisholm, M.F. [Oak Ridge National Lab., TN (United States); Nellist, P.D. [Cavendish Lab., Cambridge, (United Kingdom)

    1997-04-01

    As first pointed out by Lord Rayleigh a century ago, incoherent imaging offers a substantial resolution enhancement compared to coherent imaging, together with freedom from phase contrast interference effects and contrast oscillations. In the STEM configuration, with a high angle annular detector to provide the transverse incoherence, the image also shows strong Z-contrast, sufficient in the case of a 300 kV STEM to image single Pt and Rh atoms on a {gamma}-alumina support. The annular detector provides complementarity to a bright field detector of the same size. For weakly scattering specimens, it shows greater contrast than the incoherent bright field image, and also facilitates EELS analysis at atomic resolution, using the Z-contrast image to locate the probe with sub-{angstrom} precision. The inner radius of the annular detector can be chosen to reduce the transverse coherence length to well below the spacings needed to resolve the object, a significant advantage compared to light microscopy.

  15. Coherent and incoherent (μ-, e-) conversion in nuclei

    International Nuclear Information System (INIS)

    Chiang, H.C.; Oset, E.; Kosmas, T.S.; Faessler, A.; Vergados, J.D.

    1993-01-01

    Coherent and incoherent (μ - , e - ) conversion in nuclei is studied within the framework of several theories which violate flavour lepton number. A useful approach is followed which allows a factorization of the conversion widths into nuclear factors and other factors which depend only on the elementary process. The nuclear factors are evaluated in a wide range of nuclei allowing simple calculations of the conversion rates throughout the periodic table for a given theory with a minimum of work in the elementary sector. The coherent conversion is found to dominate the process. The results obtained modify appreciable previous results in the literature, particularly in the incoherent process. (orig.)

  16. Incoherent transport for phases that spontaneously break translations

    Science.gov (United States)

    Donos, Aristomenis; Gauntlett, Jerome P.; Griffin, Tom; Ziogas, Vaios

    2018-04-01

    We consider phases of matter at finite charge density which spontaneously break spatial translations. Without taking a hydrodynamic limit we identify a boost invariant incoherent current operator. We also derive expressions for the small frequency behaviour of the thermoelectric conductivities generalising those that have been derived in a translationally invariant context. Within holographic constructions we show that the DC conductivity for the incoherent current can be obtained from a solution to a Stokes flow for an auxiliary fluid on the black hole horizon combined with specific thermodynamic quantities associated with the equilibrium black hole solutions.

  17. Unmasking the mechanism of diffuse left ventricular wall motion abnormality in ischemic cardiomyopathy by resting-redistribution thallium-201 single photon computed tomography

    International Nuclear Information System (INIS)

    Namura, Hiroyuki; Yamabe, Hiroshi; Kakimoto, Tetsuya; Hashimoto, Yasunori; Yasaka, Yoshinori; Yoshida, Hiroaki; Itoh, Kazushi; Yokoyama, Mitsuhiro; Maeda, Kazumi.

    1992-01-01

    The study population comprised patients with ischemic cardiomyopathy (ICM) who had left ventricular wall motion (LVWM) abnormality in 5 or more segments (n=9), those with extensive myocardial infarction (EMI) having LVWM abnormality in 4 or less segments (n=12), and those with dilated left ventricle (DLV) having LVWM abnormality in all 7 segments (n=9). Defect scores (DS), obtained by initial and delayed Tl-201 myocardial single photon emission computed tomography at rest, were visually assessed to compare perfusion patterns in the three patient groups. The group of ICM patients had greater defect segments (DSeg) and % redistribution (Rd) index than the other two groups, although there was no difference in the number of angiographically proven infarct-related coronary vessels between EMI and ICM. In the group of ICM patients, there was inverse correlation not only between left ventricular ejection fraction and the sum of DS but also between left ventricular enddiastolic volume index and both the sum of DSeg and % Rd index. The group of DLV patients had small sum of DSeg and redistribution, compared with the other two groups. Although diffuse LVWM abnormality, as observed in the group of ICM patients, was considered attributable to potential decrease of coronary perfusion shown as defect on SPECT images, it did not always coincide with findings of coronary angiography. Both DSeg and redistribution phenomenon on SPECT images seemed to have the ability to evaluate the severity of ICM, as well as to differentiate ICM, EMI, and DLV. (N.K.)

  18. Interfacial Energy and Fine Defect Structures for Incoherent Films

    OpenAIRE

    Cermelli, Paolo; Gurtin, Morton E.; Leoni, Giovanni

    1999-01-01

    This note summarizes recent results in which modern techniques of the calculus of variations are used to obtain qualitative features of film-substrate interfaces for a broad class of interfacial energies. In particular, we show that the existence of a critical thickness for incoherency and the formation of interfacial dislocations depend strongly on the convexity and smoothness of the interfacial energy function.

  19. Coherence Inherent in an Incoherent Synchrotron Radio Source ...

    Indian Academy of Sciences (India)

    It is well known that synchrotron radiation mechanism does not allow MASER type coherent emission (Pacholczyk 1970). Here we show that coherence can naturally occur in a synchrotron ... cally thick region (Fig. 1), then divides the synchrotron spectrum into an incoherent. 1A thin flat circular unleavened Indian bread.

  20. Optically transparent multiple access networks employing incoherent spectral codes

    NARCIS (Netherlands)

    Huiszoon, B.

    2008-01-01

    This Ph.D. thesis is divided into 7 chapters to provide the reader an overview of the main results achieved in di®erent sub-topics of the study towards optically transparent multiple access networks employing incoherent spectral codes taking into account wireless transmission aspects. The work

  1. Critical exponents of the transition from incoherence to partial oscillation death in the Winfree model

    International Nuclear Information System (INIS)

    Basnarkov, Lasko; Urumov, Viktor

    2009-01-01

    We consider an analytically solvable version of the Winfree model of synchronization of phase oscillators (proposed by Ariaratnam and Strogatz 2001 Phys. Rev. Lett. 86 4278). It is obtained that the transition from incoherence to a partial death state is characterized by third-order or higher phase transitions according to the Ehrenfest classification. The order of the transition depends on the shape of the distribution function for natural frequencies of oscillators in the vicinity of their lowest frequency. The corresponding critical exponents are found analytically and verified with numerical simulations of equations of motion. We also consider the generalized Winfree model with the interaction strength proportional to a power of the Kuramoto order parameter and find the domain where the critical exponent remains unchanged by this modification

  2. Interplay between total thickness and period thickness in the phonon thermal conductivity of superlattices from the nanoscale to the microscale: Coherent versus incoherent phonon transport

    Science.gov (United States)

    Cheaito, Ramez; Polanco, Carlos A.; Addamane, Sadhvikas; Zhang, Jingjie; Ghosh, Avik W.; Balakrishnan, Ganesh; Hopkins, Patrick E.

    2018-02-01

    We report on the room temperature thermal conductivity of AlAs-GaAs superlattices (SLs), in which we systematically vary the period thickness and total thickness between 2 -24 nm and 20.1 -2 ,160 nm , respectively. The thermal conductivity increases with the SL thickness and plateaus at a thickness around 200 nm, showing a clear transition from a quasiballistic to a diffusive phonon transport regime. These results demonstrate the existence of classical size effects in SLs, even at the highest interface density samples. We use harmonic atomistic Green's function calculations to capture incoherence in phonon transport by averaging the calculated transmission over several purely coherent simulations of independent SL with different random mixing at the AlAs-GaAs interfaces. These simulations demonstrate the significant contribution of incoherent phonon transport through the decrease in the transmission and conductance in the SLs as the number of interfaces increases. In spite of this conductance decrease, our simulations show a quasilinear increase in thermal conductivity with the superlattice thickness. This suggests that the observation of a quasilinear increase in thermal conductivity can have important contributions from incoherent phonon transport. Furthermore, this seemingly linear slope in thermal conductivity versus SL thickness data may actually be nonlinear when extended to a larger number of periods, which is a signature of incoherent effects. Indeed, this trend for superlattices with interatomic mixing at the interfaces could easily be interpreted as linear when the number of periods is small. Our results reveal that the change in thermal conductivity with period thickness is dominated by incoherent (particlelike) phonons, whose properties are not dictated by changes in the AlAs or GaAs phonon dispersion relations. This work demonstrates the importance of studying both period and sample thickness dependencies of thermal conductivity to understand the

  3. Annealing characteristics of SiO2-Si structures after incoherent light pulse processing

    International Nuclear Information System (INIS)

    Sieber, N.; Klabes, R.; Voelskow, M.; Fenske, F.

    1982-01-01

    The behaviour of oxide charges and interface charges in boron implanted and non-implanted SiO 2 -Si structures as well as the electrical activation of the dopants by the action of incoherent light pulses was studied. Depth profiles of electrically active boron ions are presented for different annealing conditions as measured by the pulsed C-V method. It can be concluded that exposure of MOS structures to intense radiation of flash lamps does not increase the fixed charge and the fast state density at the SiO 2 -Si interface if optimal annealing conditions (energy densities) are employed. Low dose boron implanted silicon can be electrically activated without diffusion or segregation of dopants

  4. Acetylene diffusion in Na-Y zeolite

    Indian Academy of Sciences (India)

    ideal guest molecule to start with. Here we ... In that case the incoherent scattering law, Sinc(Q, ω), alone describes the dynamics. Q(=k−k0) is the .... The results of QENS measurements to study the diffusion of acetylene gas in zeolite. Na-Y at ...

  5. Incoherently combining logarithmic aspheric lenses for extended depth of field.

    Science.gov (United States)

    Chu, Kaiqin; George, Nicholas; Chi, Wanli

    2009-10-01

    We describe a method for combining concentric logarithmic aspheric lenses in order to obtain an extended depth of field. Substantial improvement in extending the depth of field is obtained by carefully controlling the optical path difference among the concentric lenses so that their outputs combine incoherently. The system is analyzed through diffraction theory and the point spread function is shown to be highly invariant over a long range of object distances. After testing the image performance on a three-dimensional scene, we found that the incoherently combined logarithmic aspheres can provide a high-quality image over an axial distance corresponding to a defocus of +/- 14(lambda/4). Studies of the images of two-point objects are presented to illustrate the resolution of these lenses.

  6. Coherent and Incoherent Neutral Current Scattering for Supernova Detection

    Directory of Open Access Journals (Sweden)

    P. C. Divari

    2012-01-01

    Full Text Available The total cross sections as well as the neutrino event rates are calculated in the neutral current neutrino scattering off 40Ar and 132Xe isotopes at neutrino energies (Ev<100 MeV. The individual contribution coming from coherent and incoherent channels is taking into account. An enhancement of the neutral current component is achieved via the coherent (0gs+→0gs+ channel which is dominant with respect to incoherent (0gs+→Jf one. The response of the above isotopes as a supernova neutrino detection has been considered, assuming a two parameter Fermi-Dirac distribution for the supernova neutrino energy spectra. The calculated total cross sections are tested on a gaseous spherical TPC detector dedicated for supernova neutrino detection.

  7. Phase diagram of incoherently driven strongly correlated photonic lattices

    Science.gov (United States)

    Biella, Alberto; Storme, Florent; Lebreuilly, José; Rossini, Davide; Fazio, Rosario; Carusotto, Iacopo; Ciuti, Cristiano

    2017-08-01

    We explore theoretically the nonequilibrium photonic phases of an array of coupled cavities in presence of incoherent driving and dissipation. In particular, we consider a Hubbard model system where each site is a Kerr nonlinear resonator coupled to a two-level emitter, which is pumped incoherently. Within a Gutzwiller mean-field approach, we determine the steady-state phase diagram of such a system. We find that, at a critical value of the intercavity photon hopping rate, a second-order nonequilibrium phase transition associated with the spontaneous breaking of the U(1 ) symmetry occurs. The transition from an incompressible Mott-like photon fluid to a coherent delocalized phase is driven by commensurability effects and not by the competition between photon hopping and optical nonlinearity. The essence of the mean-field predictions is corroborated by finite-size simulations obtained with matrix product operators and corner-space renormalization methods.

  8. Neutron scattering in disordered alloys: coherent and incoherent intensities

    International Nuclear Information System (INIS)

    Mookerjee, A.; Yussouff, M.

    1985-02-01

    A priori it is not clear how to split the total intensity of thermal neutron scattering from disordered alloys into a coherent and an incoherent part. We present here a formalism to do this. The formalism is based on the augmented space technique introduced earlier by one of the authors. It includes disorder in mass, force constants and scattering lengths. A self-consistent CCPA which is tractable for realistic calculations is presented for the coherent and incoherent intensities. This is expected to prove useful in theoretically analysis data for alloys (e.g. Nisub(x)Ptsub(1-x), Nisub(x)Pdsub(1-x), Nisub(x)Crsub(1-x)) for which it is necessary to go beyond the usual single site CPAs for reliable accuracy. (author)

  9. Evidence of strong proton shape fluctuations from incoherent diffraction

    International Nuclear Information System (INIS)

    Mantysaari, H.; Schenke, B.

    2016-01-01

    We show within the saturation framework that measurements of exclusive vector meson production at high energy provide evidence for strong geometric fluctuations of the proton. In comparison, the effect of saturation scale and color charge fluctuations is weak. This knowledge will allow detailed future measurements of the incoherent cross section to tightly constrain the fluctuating geometry of the proton as a function of the parton momentum fraction x.

  10. Absolute Bunch Length Measurements by Incoherent Radiation Fluctuation Analysis

    International Nuclear Information System (INIS)

    Sannibale, F.; Stupakov, G.V.; Zolotorev, M.S.; Filippetto, D.; Jagerhofer, L.

    2009-01-01

    By analyzing the pulse to pulse intensity fluctuations of the radiation emitted by a charge particle in the incoherent part of the spectrum, it is possible to extract information about the spatial distribution of the beam. At the Advanced Light Source (ALS) of the Lawrence Berkeley National Laboratory, we have developed and successfully tested a simple scheme based on this principle that allows for the absolute measurement of the rms bunch length. A description of the method and the experimental results are presented.

  11. Incoherent scatter studies of upper atmosphere dynamics and coding technique

    International Nuclear Information System (INIS)

    Haeggstroem, Ingemar.

    1990-09-01

    Observations by the EISCAT incoherent scatter radar are used to study the dynamics of the auroral upper atmosphere. The study describes some effects of the strong plasma convection occurring at these latitudes and a new coding technique for incoherent scatter radars. A technique to determine the thermospheric neutral wind from incoherent scatter measurements is described. Simultaneous Fabry-Perot interferometer measurements of the wind are compared with those derived from the radar data. F-region electron density depletions in the afternoon/evening sector of the auroral zone, identified as the main ionospheric trough, are investigated. In a statistical study, based on wide latitude scanning experiment made at solar minimum, the trough appearance at a given latitude is compared to the geomagnetic index K p , and an empirical model predicting the latitude of the trough is proposed. Detailed studies, using different experiment modes, show that the equatorward edge of the auroral oval is co-located of up to 1 degree poleward of the trough minimum, which in turn is co-located with the peak convective electric field, with its boundary 1 degree - 2 degree equatorward of the trough minimum. It is shown that the F-region ion composition changes from pure 0 + to molecular ion dominated (NO + /O 2 + ) as the trough moves into the region probed by the radar. In a special case, where a geomagnetic sudden impulse caused an expansion of the plasma convection pattern, the equatorward trough progression is studied together with ionosonde measurements. A new coding technique for incoherent scatter radar measurement is introduced and described. The method, called alternating codes, provides significantly more accurate estimates of the plasma parameters than can be obtained by frequency commutated multipulse measurements. Simple explanations of the method are given as well as a precise definition. Two examples of application of the alternating codes are presented, showing the high

  12. Are Ascriptions of Intentionality to the Brain Incoherent?

    DEFF Research Database (Denmark)

    Presskorn-Thygesen, Thomas

    The ascriptions of ‘agency’ or ‘intentionality’ to the brain has long been regarded with suspicion from social scientists and philosophers. In the talk, I will argue that this suspicion is perfectly legitimate and that the standard response from the defenders of cognitive neuroscience is illegiti...... to the brain are conceptually incoherent because it commits a mereological fallacy (Bennett&Hacker 2001, 2007)....

  13. Holographic fluorescence microscopy with incoherent digital holographic adaptive optics.

    Science.gov (United States)

    Jang, Changwon; Kim, Jonghyun; Clark, David C; Lee, Seungjae; Lee, Byoungho; Kim, Myung K

    2015-01-01

    Introduction of adaptive optics technology into astronomy and ophthalmology has made great contributions in these fields, allowing one to recover images blurred by atmospheric turbulence or aberrations of the eye. Similar adaptive optics improvement in microscopic imaging is also of interest to researchers using various techniques. Current technology of adaptive optics typically contains three key elements: a wavefront sensor, wavefront corrector, and controller. These hardware elements tend to be bulky, expensive, and limited in resolution, involving, for example, lenslet arrays for sensing or multiactuator deformable mirrors for correcting. We have previously introduced an alternate approach based on unique capabilities of digital holography, namely direct access to the phase profile of an optical field and the ability to numerically manipulate the phase profile. We have also demonstrated that direct access and compensation of the phase profile are possible not only with conventional coherent digital holography, but also with a new type of digital holography using incoherent light: selfinterference incoherent digital holography (SIDH). The SIDH generates a complex—i.e., amplitude plus phase—hologram from one or several interferograms acquired with incoherent light, such as LEDs, lamps, sunlight, or fluorescence. The complex point spread function can be measured using guide star illumination and it allows deterministic deconvolution of the full-field image. We present experimental demonstration of aberration compensation in holographic fluorescence microscopy using SIDH. Adaptive optics by SIDH provides new tools for improved cellular fluorescence microscopy through intact tissue layers or other types of aberrant media.

  14. Electromagnetically induced two-dimensional grating assisted by incoherent pump

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yu-Yuan; Liu, Zhuan-Zhuan; Wan, Ren-Gang, E-mail: wrg@snnu.edu.cn

    2017-04-25

    We propose a scheme for realizing electromagnetically induced two-dimensional grating in a double-Λ system driven simultaneously by a coherent field and an incoherent pump field. In such an atomic configuration, the absorption is suppressed owing to the incoherent pumping process and the probe can be even amplified, while the refractivity is mainly attributed to the dynamically induced coherence. With the help of a standing-wave pattern coherent field, we obtain periodically modulated refractive index without or with gain, and therefore phase grating or gain-phase grating which diffracts a probe light into high-order direction efficiently can be formed in the medium via appropriate manipulation of the system parameters. The diffraction efficiency attainable by the present gratings can be controlled by tuning the coherent field intensity or the interaction length. Hence, the two-dimensional grating can be utilized as all-optical splitter or router in optical networking and communication. - Highlights: • Two-dimensional grating is coherently induced in four-level atoms. • Phase and gain-phase gratings are obtained assisted by incoherent pump. • The diffraction power is improved due to the enhanced refraction modulation. • The gratings can be utilized as multi-channel all-optical splitter and router.

  15. Coherent imaging with incoherent light in digital holographic microscopy

    Science.gov (United States)

    Chmelik, Radim

    2012-01-01

    Digital holographic microscope (DHM) allows for imaging with a quantitative phase contrast. In this way it becomes an important instrument, a completely non-invasive tool for a contrast intravital observation of living cells and a cell drymass density distribution measurement. A serious drawback of current DHMs is highly coherent illumination which makes the lateral resolution worse and impairs the image quality by a coherence noise and a parasitic interference. An uncompromising solution to this problem can be found in the Leith concept of incoherent holography. An off-axis hologram can be formed with arbitrary degree of light coherence in systems equipped with an achromatic interferometer and thus the resolution and the image quality typical for an incoherent-light wide-field microscopy can be achieved. In addition, advanced imaging modes based on limited coherence can be utilized. The typical example is a coherence-gating effect which provides a finite axial resolution and makes DHM image similar to that of a confocal microscope. These possibilities were described theoretically using the formalism of three-dimensional coherent transfer functions and proved experimentally by the coherence-controlled holographic microscope which is DHM based on the Leith achromatic interferometer. Quantitative-phase-contrast imaging is demonstrated with incoherent light by the living cancer cells observation and their motility evaluation. The coherence-gating effect was proved by imaging of model samples through a scattering layer and living cells inside an opalescent medium.

  16. Molecular rotations and diffusion in solids, in particular hydrogen in metals

    International Nuclear Information System (INIS)

    Springer, T.

    1977-01-01

    The chapter deals mainly with problems related to physical chemistry. The author treats diffusion in solids, in particular of hydrogen in metals, and studies of molecular rotations, in particular studies of tunneling transitions which is a relatively new and rapidly developing field of high resolution neutron spectroscopy. Typical neutron spectra to be discussed appear in energy ranges of a few 10 -6 to a few 10 -3 eV, or 10 -5 to 10 -2 cm -1 . The discussion is restricted to scattering from the protons which is predominantly incoherent. This means that only the motions, or excitations, of individual protons or protonic groups are discussed, ignoring collective excitations and interference. (HPOE) [de

  17. GPS Versus Seismological Observations in two Seismogenic Zones in the Adria-Alps- Pannon System; Block Motion vs. Diffuse Deformation, Increased Earthquake Potential vs. Aseismic Slip

    Science.gov (United States)

    Grenerczy, G.; Bus, Z.; Toth, L.; Monus, P.

    2008-12-01

    The tectonic activity, seismicity and the associated seismic hazard is highly variable in the Adria-Alps-Pannon region. The engine of the system is the Adria microplate that compresses a puzzle of crustal blocks towards the European Platform. Based on seismicity and data of continuous and campaign style GPS measurements between 1991 and 2007 we investigated the existence of different blocks and their present kinematics. At the resolution and signal level we have, deformation seems to be more diffuse and block motion is no longer recognizable over the Pannonian basin towards the Carpathains. Although towards the basin seismicity decreases to moderate, the vulnerability is still high, as three capital cities are located near to the two most active seismic zones in this subregion. Each cities and their suburbs produce about 30- 40 % of the GDP of the respective countries. In the second par of our analysis these two seismically active areas, the Mur-Murz and Central Pannonian zones, are investigated. Uniform strain rates and relative displacements were calculated for these regions. The GPS data confirm the mostly left lateral strike slip character of the Mur-Murz fault zone and suggest a contraction between the eastward moving Alpine-North Pannonian unit and the Carpathians. The computation of the seismic strain rate was based on the Kostrov summation. The averaged unit norm seismic moment tensor, which describes the characteristic style of deformation, has been obtained by using the available focal mechanism solutions, whereas the annual seismic moment release showing the rate of the deformation was estimated using the catalogs of historical and recent earthquakes. Our analysis reveals that in both zones the geodetic strain rate is significantly larger than the seismic deformation. Based on the weakness of the lithosphere, the stress magnitudes and the regional features of seismicity, we suggest that the low value of the seismic/geodetic strain rate ratio in the

  18. Value of magnetic resonance imaging in diffuse liver diseases; Stellenwert der MRT bei diffusen Lebererkrankungen

    Energy Technology Data Exchange (ETDEWEB)

    Schramm, N.; D' Anastasi, M.; Reiser, M.F.; Zech, C.J. [Klinikum der Ludwig-Maximilians-Universitaet Muenchen, Campus Grosshadern, Institut fuer Klinische Radiologie, Muenchen (Germany)

    2012-08-15

    Diffuse liver diseases show an increasing prevalence. The diagnostic gold standard of liver biopsy has several disadvantages. There is a clinical demand for non-invasive imaging-based techniques to qualitatively and quantitatively evaluate the entire liver. Ultrasound, computed tomography (CT) and magnetic resonance imaging (MRI) are routinely used. Steatosis: chemical shift and frequency selective imaging, MR spectroscopy (MRS). Hemochromatosis: MR-based iron quantification. Fibrosis: MR elastography, diffusion, intravoxel incoherent motion (IVIM) and MR perfusion. T1-weighted in and opposed phase imaging is the clinically most frequently used MR technique to noninvasively detect and quantify steatosis. New methods for quantification that are not influenced by confounders like iron overload are under investigation. The most sensitive method to measure the fat content of the liver is MRS. As data acquisition and analysis remain complex and there is no whole organ coverage, MRS of the liver is not a routine method. With an optimized protocol incorporating T2* sequences, MRI is the modality of choice to quantify iron overload in hemochromatosis. Standard MR sequences cannot depict early stages of liver fibrosis. Advanced MR techniques (e.g. elastography, diffusion, IVIM and perfusion) for noninvasive assessment of liver fibrosis appear promising but their role has to be further investigated. (orig.) [German] Die Praevalenz diffuser Lebererkrankungen nimmt zu. Der klinische Goldstandard, die Leberbiopsie, hat zahlreiche Nachteile. Es besteht ein Bedarf an bildgebenden Verfahren zur nichtinvasiven qualitativen und quantitativen Beurteilung der gesamten Leber bei diesen Erkrankungen. Hier sind Ultraschall, CT und MRT zu nennen. Steatosis: Chemical-shift- und frequenzselektive Bildgebung, MR-Spektroskopie (MRS) zur Fettquantifizierung. Haemochromatose: MR-basierte Eisenquantifizierung. Fibrose: MR-Elastographie, Diffusion, ''intravoxel incoherent motion

  19. Diffusing diffusivity: Rotational diffusion in two and three dimensions

    Science.gov (United States)

    Jain, Rohit; Sebastian, K. L.

    2017-06-01

    We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

  20. Simultaneous assessment of cerebral blood volume and diffusion heterogeneity using hybrid IVIM and DK MR imaging: initial experience with brain tumors

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Wen-Chau [National Taiwan University, Graduate Institute of Oncology, Taipei (China); National Taiwan University, Graduate Institute of Clinical Medicine, Taipei (China); National Taiwan University, Graduate Institute of Biomedical Electronics and Bioinformatics, Taipei (China); National Taiwan University Hospital, Department of Medical Imaging, Taipei (China); Yang, Shun-Chung; Chen, Ya-Fang; My, Pei-Chi [National Taiwan University Hospital, Department of Medical Imaging, Taipei (China); Tseng, Han-Min [National Taiwan University Hospital, Department of Neurology, Taipei (China)

    2017-01-15

    To investigate the feasibility of simultaneously assessing cerebral blood volume and diffusion heterogeneity using hybrid diffusion-kurtosis (DK) and intravoxel-incoherent-motion (IVIM) MR imaging. Fifteen healthy volunteers and 30 patients with histologically proven brain tumours (25 WHO grade II-IV gliomas and five metastases) were recruited. On a 3-T system, diffusion-weighted imaging was performed with six b-values ranging from 0 to 1,700 s/mm{sup 2}. Nonlinear least-squares fitting was employed to extract diffusion coefficient (D), diffusion kurtosis coefficient (K, a measure of the degree of non-Gaussian and heterogeneous diffusion) and intravascular volume fraction (f, a measure proportional to cerebral blood volume). Repeated-measures multivariate analysis of variance and receiver operating characteristic analysis were performed to assess the ability of D/K/f in differentiating contrast-enhanced tumour from peritumoral oedema and normal-appearing white matter. Based on our imaging setting (baseline signal-to-noise ratio = 32-128), coefficient of variation was 14-20 % for K, ∝6 % for D and 26-44 % for f. The indexes were able to differentiate contrast-enhanced tumour (Wilks' λ = 0.026, p < 10{sup -3}), and performance was greatest with K, followed by f and D. Hybrid DK IVIM imaging is capable of simultaneously measuring cerebral perfusion and diffusion indexes that together may improve brain tumour diagnosis. (orig.)

  1. Incoherent quasielastic neutron scattering from water in supercooled regime

    International Nuclear Information System (INIS)

    Chen, S.; Teixeira, J.; Nicklow, R.

    1982-01-01

    Measurements of the quasielastic spectra have been made with a three-axis neutron spectrometer at constant-Q mode in a temperature range from 38 0 C down to -20 0 C. Two energy resolutions both high (δE = 100 μ eV) and low (δE = 800 μ eV) were used to identify and separate a sharp component from a broad one. As temperature is decreased below zero the spectrum shows an increasing sharp component standing out on top of the broad one. The broad component is attributed to rotational motions of water molecules. A preliminary analysis of the linewidths gives a Q-independent relaxation time which has the same magnitude as the rotational relaxation time measured by nuclear magnetic resonance. The Q dependence of the sharp line is analyzed by a Q-dependent diffusion coefficient. A temperature-independent characteristic length l 0 = 0.5 A is obtained. We then attempt to relate this length to local geometry of protons associated with hydrogen bonding

  2. Experimental tests of induced spatial incoherence using short laser wavelength

    International Nuclear Information System (INIS)

    Obenschain, S.P.; Grun, J.; Herbst, M.J.

    1986-01-01

    The authors have developed a laser beam smoothing technique called induced spatial incoherence (ISI), which can produce the highly uniform focal profiles required for direct-drive laser fusion. Uniform well-controlled focal profiles are required to obtain the highly symmetric pellet implosions needed for high-energy gain. In recent experiments, the authors' tested the effects of ISI on high-power laser-target interaction. With short laser wavelength, the coupling physics dramatically improved over that obtained with an ordinary laser beam

  3. Diffusion tensor magnetic resonance imaging of the pancreas.

    Directory of Open Access Journals (Sweden)

    Noam Nissan

    Full Text Available To develop a diffusion-tensor-imaging (DTI protocol that is sensitive to the complex diffusion and perfusion properties of the healthy and malignant pancreas tissues.Twenty-eight healthy volunteers and nine patients with pancreatic-ductal-adenocacinoma (PDAC, were scanned at 3T with T2-weighted and DTI sequences. Healthy volunteers were also scanned with multi-b diffusion-weighted-imaging (DWI, whereas a standard clinical protocol complemented the PDAC patients' scans. Image processing at pixel resolution yielded parametric maps of three directional diffusion coefficients λ1, λ2, λ3, apparent diffusion coefficient (ADC, and fractional anisotropy (FA, as well as a λ1-vector map, and a main diffusion-direction map.DTI measurements of healthy pancreatic tissue at b-values 0,500 s/mm² yielded: λ1 = (2.65±0.35×10⁻³, λ2 = (1.87±0.22×10⁻³, λ3 = (1.20±0.18×10⁻³, ADC = (1.91±0.22×10⁻³ (all in mm²/s units and FA = 0.38±0.06. Using b-values of 100,500 s/mm² led to a significant reduction in λ1, λ2, λ3 and ADC (p<.0001 and a significant increase (p<0.0001 in FA. The reduction in the diffusion coefficients suggested a contribution of a fast intra-voxel-incoherent-motion (IVIM component at b≤100 s/mm², which was confirmed by the multi-b DWI results. In PDACs, λ1, λ2, λ3 and ADC in both 0,500 s/mm² and 100,500 s/mm² b-values sets, as well as the reduction in these diffusion coefficients between the two sets, were significantly lower in comparison to the distal normal pancreatic tissue, suggesting higher cellularity and diminution of the fast-IVIM component in the cancer tissue.DTI using two reference b-values 0 and 100 s/mm² enabled characterization of the water diffusion and anisotropy of the healthy pancreas, taking into account a contribution of IVIM. The reduction in the diffusion coefficients of PDAC, as compared to normal pancreatic tissue, and the smaller change in these coefficients in PDAC

  4. Hepatocellular carcinoma: IVIM diffusion quantification for prediction of tumor necrosis compared to enhancement ratios

    International Nuclear Information System (INIS)

    Kakite, Suguru; Dyvorne, Hadrien A.; Lee, Karen M.; Jajamovich, Guido H.; Knight-Greenfield, Ashley; Taouli, Bachir

    2015-01-01

    To correlate intra voxel incoherent motion (IVIM) diffusion parameters of liver parenchyma and hepatocellular carcinoma (HCC) with degree of liver/tumor enhancement and necrosis; and to assess the diagnostic performance of diffusion parameters vs. enhancement ratios (ER) for prediction of complete tumor necrosis. In this IRB approved HIPAA compliant study, we included 46 patients with HCC who underwent IVIM diffusion-weighted (DW) MRI in addition to routine sequences at 3.0 T. True diffusion coefficient (D), pseudo-diffusion coefficient (D*), perfusion fraction (PF) and apparent diffusion coefficient (ADC) were quantified in tumors and liver parenchyma. Tumor ER were calculated using contrast-enhanced imaging, and degree of tumor necrosis was assessed using post-contrast image subtraction. IVIM parameters and ER were compared between HCC and background liver and between necrotic and viable tumor components. ROC analysis for prediction of complete tumor necrosis was performed. 79 HCCs were assessed (mean size 2.5 cm). D, PF and ADC were significantly higher in HCC vs. liver (p < 0.0001). There were weak significant negative/positive correlations between D/PF and ER, and significant correlations between D/PF/ADC and tumor necrosis (for D, r 0.452, p < 0.001). Among diffusion parameters, D had the highest area under the curve (AUC 0.811) for predicting complete tumor necrosis. ER outperformed diffusion parameters for prediction of complete tumor necrosis (AUC > 0.95, p < 0.002). D has a reasonable diagnostic performance for predicting complete tumor necrosis, however lower than that of contrast-enhanced imaging

  5. Charge diffusion and the butterfly effect in striped holographic matter

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, Andrew [Department of Physics, Harvard University,Cambridge, MA 02138 (United States); Department of Physics, Stanford University,Stanford, CA 94305 (United States); Steinberg, Julia [Department of Physics, Harvard University,Cambridge, MA 02138 (United States)

    2016-10-26

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

  6. Charge diffusion and the butterfly effect in striped holographic matter

    International Nuclear Information System (INIS)

    Lucas, Andrew; Steinberg, Julia

    2016-01-01

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

  7. Differentiation of prostate cancer lesions with high and with low Gleason score by diffusion-weighted MRI

    Energy Technology Data Exchange (ETDEWEB)

    Barbieri, Sebastiano; Broennimann, Michael; Vermathen, Peter; Thoeny, Harriet C. [Inselspital University Hospital, Institute of Diagnostic, Pediatric, and Interventional Radiology, Bern (Switzerland); Boxler, Silvan [Inselspital, Inselspital University Hospital, Department of Urology, Bern (Switzerland)

    2017-04-15

    To differentiate prostate cancer lesions with high and with low Gleason score by diffusion-weighted-MRI (DW-MRI). This prospective study was approved by the responsible ethics committee. DW-MRI of 84 consenting prostate and/or bladder cancer patients scheduled for radical prostatectomy were acquired and used to compute apparent diffusion coefficient (ADC), intravoxel incoherent motion (IVIM: the pure diffusion coefficient D{sub t}, the pseudo-diffusion fraction F{sub p} and the pseudo-diffusion coefficient D{sub p}), and high b value (as acquired and Hessian filtered) parameters within the index lesion. These parameters (separately and combined in a logistic regression model) were used to differentiate lesions depending on whether whole-prostate histopathological analysis after prostatectomy determined a high (≥7) or low (6) Gleason score. Mean ADC and D{sub t} differed significantly (p of independent two-sample t test < 0.01) between high- and low-grade lesions. The highest classification accuracy was achieved by the mean ADC (AUC 0.74) and D{sub t} (AUC 0.70). A logistic regression model based on mean ADC, mean F{sub p} and mean high b value image led to an AUC of 0.74 following leave-one-out cross-validation. Classification by IVIM parameters was not superior to classification by ADC. DW-MRI parameters correlated with Gleason score but did not provide sufficient information to classify individual patients. (orig.)

  8. Coherence and incoherence collective behavior in financial market

    Science.gov (United States)

    Zhao, Shangmei; Xie, Qiuchao; Lu, Qing; Jiang, Xin; Chen, Wei

    2015-10-01

    Financial markets have been extensively studied as highly complex evolving systems. In this paper, we quantify financial price fluctuations through a coupled dynamical system composed of phase oscillators. We find that a Financial Coherence and Incoherence (FCI) coexistence collective behavior emerges as the system evolves into the stable state, in which the stocks split into two groups: one is represented by coherent, phase-locked oscillators, the other is composed of incoherent, drifting oscillators. It is demonstrated that the size of the coherent stock groups fluctuates during the economic periods according to real-world financial instabilities or shocks. Further, we introduce the coherent characteristic matrix to characterize the involvement dynamics of stocks in the coherent groups. Clustering results on the matrix provides a novel manifestation of the correlations among stocks in the economic periods. Our analysis for components of the groups is consistent with the Global Industry Classification Standard (GICS) classification and can also figure out features for newly developed industries. These results can provide potentially implications on characterizing the inner dynamical structure of financial markets and making optimal investment into tragedies.

  9. Intersubassembly incoherencies and grouping techniques in LMFBR hypothetical overpower accident

    International Nuclear Information System (INIS)

    Wilburn, N.P.

    1977-10-01

    A detailed analysis was made of the FTR core using the 100-channel MELT-IIIA code. Results were studied for the transient overpower accident (where 0.5$/sec and 1$/sec ramps) and in which the Damage Parameter and the Failure Potential criteria were used. Using the information obtained from these series of runs, a new method of grouping the subassemblies into channels has been developed. Also, it was demonstrated that a 7-channel representation of the FTR core using this method does an adequate job of representing the behavior during a hypothetical disruptive transient overpower core accident. It has been shown that this new 7-channel grouping method does a better job than an earlier 20-channel grouping. It has also been demonstrated that the incoherency effects between subassemblies as shown during the 76-channel representation of the reactor can be adequately modeled by 7-channels, provided the 7-channels are selected according to the criteria stated in the report. The overall results of power and net reactivity were shown to be only slightly different in the two cases of the 7-channel and the 76-channel runs. Therefore, it can be concluded that any intersubassembly incoherencies can be modeled adequately by a small number of channels, provided the subassemblies making up these channels are selected according to the criteria stated

  10. QR code optical encryption using spatially incoherent illumination

    Science.gov (United States)

    Cheremkhin, P. A.; Krasnov, V. V.; Rodin, V. G.; Starikov, R. S.

    2017-02-01

    Optical encryption is an actively developing field of science. The majority of encryption techniques use coherent illumination and suffer from speckle noise, which severely limits their applicability. The spatially incoherent encryption technique does not have this drawback, but its effectiveness is dependent on the Fourier spectrum properties of the image to be encrypted. The application of a quick response (QR) code in the capacity of a data container solves this problem, and the embedded error correction code also enables errorless decryption. The optical encryption of digital information in the form of QR codes using spatially incoherent illumination was implemented experimentally. The encryption is based on the optical convolution of the image to be encrypted with the kinoform point spread function, which serves as an encryption key. Two liquid crystal spatial light modulators were used in the experimental setup for the QR code and the kinoform imaging, respectively. The quality of the encryption and decryption was analyzed in relation to the QR code size. Decryption was conducted digitally. The successful decryption of encrypted QR codes of up to 129  ×  129 pixels was demonstrated. A comparison with the coherent QR code encryption technique showed that the proposed technique has a signal-to-noise ratio that is at least two times higher.

  11. The Precautionary Principle Has Not Been Shown to Be Incoherent: A Reply to Peterson : Response

    NARCIS (Netherlands)

    Boyer-Kassem, Thomas

    2017-01-01

    In this journal, I have objected to Peterson's 2006 claim that the precautionary principle is an incoherent decision rule. I defend my objections to Peterson's recent replies, and I still claim that the precautionary principle has not been shown to be incoherent.

  12. The Precautionary Principle Has Not Been Shown to Be Incoherent: A Reply to Peterson.

    Science.gov (United States)

    Boyer-Kassem, Thomas

    2017-11-01

    In this journal, I have objected to Peterson's 2006 claim that the precautionary principle is an incoherent decision rule. I defend my objections to Peterson's recent replies, and I still claim that the precautionary principle has not been shown to be incoherent. © 2017 Society for Risk Analysis.

  13. Resolution of coherent and incoherent imaging systems reconsidered : Classical criteria and a statistical alternative

    NARCIS (Netherlands)

    Van Aert, S.; Van Dyck, D.; Den Dekker, A.J.

    2006-01-01

    The resolution of coherent and incoherent imaging systems is usually evaluated in terms of classical resolution criteria, such as Rayleigh’s. Based on these criteria, incoherent imaging is generally concluded to be ‘better’ than coherent imaging. However, this paper reveals some misconceptions in

  14. Intra-voxel incoherent motion perfusion MR Imaging: a wake-up call

    Energy Technology Data Exchange (ETDEWEB)

    Le Bihan, D. [CEA Saclay, DSV, I2BM, F-91191 Gif Sur Yvette (France)

    2008-07-01

    This work gives the results of several studies made by different authors on IVIM MR Imaging. It appears that there are genuine potential applications for IVIM MR imaging. Perfusion is a very important surrogate marker of many physiologic or pathologic processes. MR imaging perfusion parameters can be obtained by using gadolinium-based contrast agents, either injected as a bolus (to determine blood flow, transit times, etc) or in a steady-state mode (to address blood volume, vessel permeability, etc). With the rising concern of nephrogenic systemic fibrosis, some patients cannot be examined with such an approach. IVIM MR imaging may then appear as an interesting alternative to provide crucial clues on perfusion in tissues, such as the kidneys, the liver, or even the placenta during pregnancy. (O.M.)

  15. Intra-voxel incoherent motion perfusion MR Imaging: a wake-up call

    International Nuclear Information System (INIS)

    Le Bihan, D.

    2008-01-01

    This work gives the results of several studies made by different authors on IVIM MR Imaging. It appears that there are genuine potential applications for IVIM MR imaging. Perfusion is a very important surrogate marker of many physiologic or pathologic processes. MR imaging perfusion parameters can be obtained by using gadolinium-based contrast agents, either injected as a bolus (to determine blood flow, transit times, etc) or in a steady-state mode (to address blood volume, vessel permeability, etc). With the rising concern of nephrogenic systemic fibrosis, some patients cannot be examined with such an approach. IVIM MR imaging may then appear as an interesting alternative to provide crucial clues on perfusion in tissues, such as the kidneys, the liver, or even the placenta during pregnancy. (O.M.)

  16. Delineating incoherent non-Markovian dynamics using quantum coherence

    Energy Technology Data Exchange (ETDEWEB)

    Chanda, Titas, E-mail: titaschanda@hri.res.in; Bhattacharya, Samyadeb, E-mail: samyadebbhattacharya@hri.res.in

    2016-03-15

    We introduce a method of characterization of non-Markovianity using coherence of a system interacting with the environment. We show that under the allowed incoherent operations, monotonicity of a valid coherence measure is affected due to non-Markovian features of the system–environment evolution. We also define a measure to quantify non-Markovianity of the underlying dynamics based on the non-monotonic behavior of the coherence measure. We investigate our proposed non-Markovianity marker in the behavior of dephasing and dissipative dynamics for one and two qubit cases. We also show that our proposed measure captures the back-flow of information from the environment to the system and compatible with well known distinguishability criteria of non-Markovianity.

  17. Plasma density fluctuation measurements from coherent and incoherent microwave reflection

    International Nuclear Information System (INIS)

    Conway, G.D.; Schott, L.; Hirose, A.

    1996-01-01

    Using the spatial coherency present in a reflected microwave signal (Conway et al 1994 Rev. Sci. Instrum. 65 2920) it is possible to measure a coherent, Γ c , and an incoherent, Γ i , reflection coefficient (proportional to the radar cross section) from a turbulent plasma cutoff layer. Results acquired with a 17 GHz reflectometer from a STOR-M tokamak edge region (r/a ∼ 0.8) give significant Γ c and Γ i , which suggests two-dimensional structure in the reflection layer. Using a 'distorted-mirror' model for the plasma fluctuations, estimates of an effective radial width, σ, and poloidal correlation length, L p , can be derived from the reflection coefficients. STOR-M results typically give a σ of a few millimetres and an L p of a couple of centimetres. (author)

  18. Color transparency in incoherent electroproduction of ρ mesons off nuclei

    International Nuclear Information System (INIS)

    Nemchik, J.; Kopeliovich, B. Z.; Potashnikova, I. K.

    2013-01-01

    Color transparency (CT) phenomena in elastic electroproduction of vector mesons off nuclei are usually infected by the onset of coherence length (CL) effects. However, at low energies corresponding to the CLAS experiment at Jefferson Lab (JLab), one can study practically the net CT effects, since CL is much shorter than the nuclear radius. We investigate various manifestations of CT effects using rigorous quantum mechanical approach based on the path integral technique. We include also the effects of ρ meson decay inside the nucleus leading to a rise of the nuclear suppression towards small values of Q 2 . Motivated by the last CLAS data we predict the A, Q 2 and l c dependence of nuclear transparency for ρ 0 mesons produced incoherently off nuclei. We also perform predictions for expected signal of CT corresponding to the planned JLab upgrade to 12 GeV electron beam.

  19. Incoherent beam combining based on the momentum SPGD algorithm

    Science.gov (United States)

    Yang, Guoqing; Liu, Lisheng; Jiang, Zhenhua; Guo, Jin; Wang, Tingfeng

    2018-05-01

    Incoherent beam combining (ICBC) technology is one of the most promising ways to achieve high-energy, near-diffraction laser output. In this paper, the momentum method is proposed as a modification of the stochastic parallel gradient descent (SPGD) algorithm. The momentum method can improve the speed of convergence of the combining system efficiently. The analytical method is employed to interpret the principle of the momentum method. Furthermore, the proposed algorithm is testified through simulations as well as experiments. The results of the simulations and the experiments show that the proposed algorithm not only accelerates the speed of the iteration, but also keeps the stability of the combining process. Therefore the feasibility of the proposed algorithm in the beam combining system is testified.

  20. Incoherent Optical Frequency Domain Reflectometry for Distributed Thermal Sensing

    DEFF Research Database (Denmark)

    Karamehmedovic, Emir

    2006-01-01

    comprising a pump laser, optical filters, optical fibre and photo-detectors are presented. Limitations, trade-offs and optimisation processes are described for setups having different specifications with respect to range, resolution and accuracy. The analysis is conducted using computer simulation programs...... developed and implemented in Matlab. The computer model is calibrated and tested, and describes the entire system with high precision. Noise analysis and digital processing of the detected signal are discussed as well. An equation describing the standard deviation of the measured temperature is derived......This thesis reports the main results from an investigation of a fibre-optic distributed temperature sensor based on spontaneous Raman scattering. The technique used for spatial resolving is the incoherent optical frequency domain reflectometry, where a pump laser is sine modulated with a stepwise...

  1. Color transparency in incoherent electroproduction of {rho} mesons off nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Nemchik, J. [Institute of Experimental Physics SAS, Watsonova 47, 04001 Kosice, Slovakia and Czech Technical University, FNSPE, Brehova 7, 11519 Praque (Czech Republic); Kopeliovich, B. Z.; Potashnikova, I. K. [Departamento de Fisica y Centro de Estudios Subatomicos, Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile)

    2013-04-15

    Color transparency (CT) phenomena in elastic electroproduction of vector mesons off nuclei are usually infected by the onset of coherence length (CL) effects. However, at low energies corresponding to the CLAS experiment at Jefferson Lab (JLab), one can study practically the net CT effects, since CL is much shorter than the nuclear radius. We investigate various manifestations of CT effects using rigorous quantum mechanical approach based on the path integral technique. We include also the effects of {rho} meson decay inside the nucleus leading to a rise of the nuclear suppression towards small values of Q{sup 2}. Motivated by the last CLAS data we predict the A, Q{sup 2} and l{sub c} dependence of nuclear transparency for {rho}{sup 0} mesons produced incoherently off nuclei. We also perform predictions for expected signal of CT corresponding to the planned JLab upgrade to 12 GeV electron beam.

  2. All-optical evaluation of spin-orbit interaction based on diffusive spin motion in a two-dimensional electron gas

    Energy Technology Data Exchange (ETDEWEB)

    Kohda, M. [IBM Research–Zürich, Säumerstrasse 4, CH-8803 Rüschlikon (Switzerland); Department of Materials Science, Tohoku University, 980-8579 Sendai (Japan); Altmann, P.; Salis, G. [IBM Research–Zürich, Säumerstrasse 4, CH-8803 Rüschlikon (Switzerland); Schuh, D.; Ganichev, S. D. [Institute of Experimental and Applied Physics, University of Regensburg, D-93040 Regensburg (Germany); Wegscheider, W. [Solid State Physics Laboratory, ETH Zürich, CH-8093 Zürich (Switzerland)

    2015-10-26

    A method is presented that enables the measurement of spin-orbit coefficients in a diffusive two-dimensional electron gas without the need for processing the sample structure, applying electrical currents or resolving the spatial pattern of the spin mode. It is based on the dependence of the average electron velocity on the spatial distance between local excitation and detection of spin polarization, resulting in a variation of spin precession frequency that in an external magnetic field is linear in the spatial separation. By scanning the relative positions of the exciting and probing spots in a time-resolved Kerr rotation microscope, frequency gradients along the [100] and [010] crystal axes of GaAs/AlGaAs QWs are measured to obtain the Rashba and Dresselhaus spin-orbit coefficients, α and β. This simple method can be applied in a variety of materials with electron diffusion for evaluating spin-orbit coefficients.

  3. Nuclear spin relaxation due to motion on inequivalent sites: H diffusion on O and T sites in the face-centred cubic structure

    International Nuclear Information System (INIS)

    Luo Xinjun; Sholl, C A

    2003-01-01

    Magnetization recoveries for nuclear spin relaxation of like spins due to magnetic dipolar coupling and diffusion on inequivalent sites involve a sum of exponentials. The theory is applied to diffusion on octahedral and tetrahedral interstitial sites in the face-centred cubic structure. Monte Carlo simulations have been used to generate relaxation data for parameters typical for H in metals. It is found that only a single exponential would be observable in the high- and low-temperature limits, but that two-exponential recoveries could be observable in the vicinity of the maximum in the relaxation rate as a function of temperature. The Monte Carlo relaxation data has been fitted using a Bloembergen-Pound-Purcell (BPP) model to assess the accuracy of the BPP model

  4. Continuum Regime Motion of a Growing Droplet in Opposing Thermo-Diffusiophoretic and Gravitational Fields of a Thermal Diffusion Cloud Chamber

    Czech Academy of Sciences Publication Activity Database

    Bakanov, S. P.; Smolík, Jiří; Zaripov, S. K.; Ždímal, Vladimír

    2001-01-01

    Roč. 32, č. 3 (2001), s. 341-350 ISSN 0021-8502 R&D Projects: GA ČR GA104/97/1198 Grant - others:RFBR(RU) 99-01-00-169 Institutional research plan: CEZ:AV0Z4072921 Keywords : thermal diffusion cloud chamber * droplet growth * continuum regime Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.605, year: 2001

  5. Discrimination of malignant versus benign mediastinal lymph nodes using diffusion MRI with an IVIM model

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Li-Ping [Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Peking University Cancer Hospital and Institute, Department of Radiology, Beijing (China); University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); Yan, Wan-Pu; Chen, Ke-Neng [Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Peking University Cancer Hospital and Institute, Department of Thoracic Oncosurgery, Beijing (China); Zhong, Zheng [University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Bioengineering, Chicago, IL (United States); Li, Xiao-Ting; Sun, Ying-Shi [Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Peking University Cancer Hospital and Institute, Department of Radiology, Beijing (China); Cai, Kejia [University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Bioengineering, Chicago, IL (United States); University of Illinois, Department of Radiology, Chicago, IL (United States); Zhou, Xiaohong Joe [University of Illinois at Chicago, Center for MR Research, and Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Bioengineering, Chicago, IL (United States); University of Illinois, Department of Radiology, Chicago, IL (United States); University of Illinois, Department of Neurosurgery, Chicago, IL (United States)

    2018-03-15

    To investigate the value of an intravoxel incoherent motion (IVIM) diffusion model for discriminating malignant versus benign mediastinal lymph nodes (MLN). Thirty-five subjects with enlarged MLN were scanned at 1.5 Tesla. Diffusion-weighted imaging was performed with eight b-values. IVIM parameters D, D*, and f, as well as apparent diffusion coefficient (ADC) from a mono-exponential model were obtained. 91 nodes (49 malignant and 42 benign) were analysed with pathologic (n=90) or radiologic (n=1) confirmations. Receiver operating characteristic (ROC) analysis was used to evaluate the diagnostic performance. The mean values of D, ADC, and f for the malignant group were significantly lower than those for the benign group (p<0.001), while D* showed no significant difference (p=0.281). In the ROC analysis, the combination of D and f produced the largest area under the curve (0.953) compared to ADC or other individual IVIM parameters, leading to the best specificity (92.9%) and diagnostic accuracy (90.1%). This study demonstrates that the combination of IVIM parameters can improve differentiation between malignant and benign MLN as compared to using ADC alone. (orig.)

  6. Single-shot self-interference incoherent digital holography using off-axis configuration.

    Science.gov (United States)

    Hong, Jisoo; Kim, Myung K

    2013-12-01

    We propose a single-shot incoherent holographic imaging technique that adopts self-interference incoherent digital holography (SIDH) with slight tilt of the plane mirror in the optical configuration. The limited temporal coherence length of the illumination leads the guide-star hologram of the proposed system to have a Gaussian envelope of elliptical ring shape. The observation shows that the reconstruction by cross correlation with the guide-star hologram achieves better quality than the usual propagation methods. Experimentally, we verify that the hologram and 3D reconstruction can be implemented incoherently with the proposed single-shot off-axis SIDH.

  7. Seeded Supercontinuum Generation - Modulation Instability Gain, Coherent and Incoherent Rogue Waves

    DEFF Research Database (Denmark)

    Sørensen, Simon Toft; Larsen, Casper; Møller, Uffe Visbech

    2012-01-01

    Deterministic supercontinuum can be generated by seeding the modulation instability-induced pulse break-up. We investigate the influence of the modulation instability gain on seeding and demonstrate the generation of coherent and incoherent rogue waves....

  8. Optical bistability via quantum interference from incoherent pumping and spontaneous emission

    International Nuclear Information System (INIS)

    Sahrai, M.; Asadpour, S.H.; Sadighi-Bonabi, R.

    2011-01-01

    We theoretically investigate the optical bistability (OB) in a V-type three-level atomic system confined in a unidirectional ring cavity via incoherent pumping field. It is shown that the threshold of optical bistability can be controlled by the rate of an incoherent pumping field and by interference mechanism arising from the spontaneous emission and incoherent pumping field. We demonstrate that the optical bistability converts to optical multi-stability (OM) by the quantum interference mechanism. - Highlights: → We modulate the optical bistability (OB) in a four-level N-type atomic system. → The threshold of optical bistability can be controlled by the quantum interferences. → OB converts to optical multi-stability (OM) by the quantum interferences. → We discuss the effect of an incoherent pumping field on reduction of OB threshold.

  9. Sub-Angstrom microscopy through incoherent imaging and image reconstruction

    International Nuclear Information System (INIS)

    Pennycook, S.J.; Jesson, D.E.; Chisholm, M.F.; Ferridge, A.G.; Seddon, M.J.

    1992-03-01

    Z-contrast scanning transmission electron microscopy (STEM) with a high-angle annular detector breaks the coherence of the imaging process, and provides an incoherent image of a crystal projection. Even in the presence of strong dynamical diffraction, the image can be accurately described as a convolution between an object function, sharply peaked at the projected atomic sites, and the probe intensity profile. Such an image can be inverted intuitively without the need for model structures, and therefore provides the important capability to reveal unanticipated interfacial arrangements. It represents a direct image of the crystal projection, revealing the location of the atomic columns and their relative high-angle scattering power. Since no phase is associated with a peak in the object function or the contrast transfer function, extension to higher resolution is also straightforward. Image restoration techniques such as maximum entropy, in conjunction with the 1.3 Angstrom probe anticipated for a 300 kV STEM, appear to provide a simple and robust route to the achievement of sub-Angstrom resolution electron microscopy

  10. An incoherent feedforward loop facilitates adaptive tuning of gene expression.

    Science.gov (United States)

    Hong, Jungeui; Brandt, Nathan; Abdul-Rahman, Farah; Yang, Ally; Hughes, Tim; Gresham, David

    2018-04-05

    We studied adaptive evolution of gene expression using long-term experimental evolution of Saccharomyces cerevisiae in ammonium-limited chemostats. We found repeated selection for non-synonymous variation in the DNA binding domain of the transcriptional activator, GAT1, which functions with the repressor, DAL80 in an incoherent type-1 feedforward loop (I1-FFL) to control expression of the high affinity ammonium transporter gene, MEP2. Missense mutations in the DNA binding domain of GAT1 reduce its binding to the GATAA consensus sequence. However, we show experimentally, and using mathematical modeling, that decreases in GAT1 binding result in increased expression of MEP2 as a consequence of properties of I1-FFLs. Our results show that I1-FFLs, one of the most commonly occurring network motifs in transcriptional networks, can facilitate adaptive tuning of gene expression through modulation of transcription factor binding affinities. Our findings highlight the importance of gene regulatory architectures in the evolution of gene expression. © 2018, Hong et al.

  11. Interference in the resonance fluorescence of two incoherently coupled transitions

    International Nuclear Information System (INIS)

    Kiffner, Martin; Evers, Joerg; Keitel, Christoph H.

    2006-01-01

    The fluorescence light emitted by a four-level system in J=1/2 to J=1/2 configuration driven by a monochromatic laser field and in an external magnetic field is studied. We show that the spectrum of resonance fluorescence emitted on the π transitions shows a signature of spontaneously generated interference effects. The degree of interference in the fluorescence spectrum can be controlled by means of the external magnetic field, provided that the Lande g factors of the excited and the ground state doublet are different. For a suitably chosen magnetic field strength, the relative weight of the Rayleigh line can be completely suppressed, even for low intensities of the coherent driving field. The incoherent fluorescence spectrum emitted on the π transitions exhibits a very narrow peak whose width and weight depend on the magnetic field strength. We demonstrate that the spectrum of resonance fluorescence emitted on the σ transitions shows an indirect signature of interference. A measurement of the relative peak heights in the spectrum from the σ transitions allows us to determine the branching ratio of the spontaneous decay of each excited state into the σ channel

  12. Eikonal theory of the transition to phase incoherence

    International Nuclear Information System (INIS)

    Kaufman, A.N.; Rosengaus, E.

    1983-02-01

    When a monochromatic electromagnetic wave propagates through a nonuniform plasma (of n dimensions), its refraction may be studied in terms of its family of rays in 2n-dimensional phase space (k,x). These rays generate and n-dimensional surface. Imbedded in the phase space. The wave amplitude and phase are defined on this surface. As the rays twist and separate (from the dynamics of the ray Hamiltonian), the surface develops pleats and becomes convoluted. Projection of the surface onto x-space then yields a multivalued k(x). The local spectral density, as a function of k for given x, exhibits sharp spikes at these k(x), in the ray-optics limit. The next correction yields a finite width to these spikes. As the surface becomes more and more pppleated, these spectral peaks overlap; the spectrum changes qualitatively from a line spectrum to a continuous spectrum. Correspondingly, the two-point spatial correlation function loses its long-range order, as the correlation volume contracts. This phenomenon is what we call the transition to incoherence

  13. Diffusion-weighted imaging of the pancreas; Diffusionsbildgebung des Pankreas

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, K. [Deutsches Krebsforschungszentrum (DKFZ) Heidelberg, Abteilung Radiologie, E010, Heidelberg (Germany); Grenacher, L.; Klauss, M. [Universitaetsklinikum Heidelberg, Abt. Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)

    2011-03-15

    Diffusion-weighted imaging (DWI) has increasingly gained in importance over the last 10 years especially in cancer imaging for differentiation of malignant and benign lesions. Through development of fast magnetic resonance imaging (MRI) sequences DWI is not only applicable in neuroradiology but also in abdominal imaging. As a diagnostic tool of the pancreas DWI enables a differentiation between normal tissue, cancer and chronic pancreatitis. The ADC values (apparent diffusion coefficient, the so-called effective diffusion coefficient) reported in the literature for healthy pancreatic tissue are in the range from 1.49 to 1.9 x 10{sup -3} mm{sup 2}/s, for pancreatic cancer in the range from 1.24 to 1.46 x 10{sup -3} mm{sup 2}/s and for autoimmune pancreatitis an average ADC value of 1.012 x 10{sup -3} mm{sup 2}/s. There are controversial data in the literature concerning the differentiation between chronic pancreatitis and pancreatic cancer. Using DWI-derived IVIM (intravoxel incoherent motion) the parameter f (perfusion fraction) seems to be advantageous but it is important to use several b values. In the literature the mean f value in chronic pancreatitis is around 16%, in pancreatic cancer 8% and in healthy pancreatic tissue around 25%. So far, DWI has not been helpful for differentiating cystic lesions of the pancreas. There are many references with other tumor entities and in animal models which indicate that there is a possible benefit of DWI in monitoring therapy of pancreatic cancer but so far no original work has been published. (orig.) [German] Die Diffusionsbildgebung (''diffusion-weighted imaging'', DWI) gewann in den letzten 10 Jahren insbesondere in der Tumorbildgebung zur Unterscheidung zwischen malignen und benignen Laesionen zunehmend an Bedeutung. Durch Entwicklung schnellerer MR-Sequenzen ist sie nicht nur in der Neuroradiologie, sondern auch in der Abdomenbildgebung einsetzbar. In der Pankreasdiagnostik ermoeglicht sie

  14. Coherent vs Incoherent Emission from Semiconductor Structures after Resonant Femtosecond Excitation

    Science.gov (United States)

    Gurioli, Massimo; Bogani, Franco; Ceccherini, Simone; Colocci, Marcello

    1997-04-01

    We show that an interferometric correlation measurement with fs time resolution provides an unambiguous discrimination between coherent and incoherent emission after resonant femtosecond excitation. The experiment directly probes the most important difference between the two emissions, that is, the phase correlation with the excitation pulse. The comparison with cw frequency resolved measurements demonstrates that the relationship between coherent and incoherent emission is similar under femtosecond and steady-state excitation.

  15. Nonlinear dispersion-based incoherent photonic processing for microwave pulse generation with full reconfigurability.

    Science.gov (United States)

    Bolea, Mario; Mora, José; Ortega, Beatriz; Capmany, José

    2012-03-12

    A novel all-optical technique based on the incoherent processing of optical signals using high-order dispersive elements is analyzed for microwave arbitrary pulse generation. We show an approach which allows a full reconfigurability of a pulse in terms of chirp, envelope and central frequency by the proper control of the second-order dispersion and the incoherent optical source power distribution, achieving large values of time-bandwidth product.

  16. Experimental photonic generation of chirped pulses using nonlinear dispersion-based incoherent processing.

    Science.gov (United States)

    Rius, Manuel; Bolea, Mario; Mora, José; Ortega, Beatriz; Capmany, José

    2015-05-18

    We experimentally demonstrate, for the first time, a chirped microwave pulses generator based on the processing of an incoherent optical signal by means of a nonlinear dispersive element. Different capabilities have been demonstrated such as the control of the time-bandwidth product and the frequency tuning increasing the flexibility of the generated waveform compared to coherent techniques. Moreover, the use of differential detection improves considerably the limitation over the signal-to-noise ratio related to incoherent processing.

  17. Optical image encryption method based on incoherent imaging and polarized light encoding

    Science.gov (United States)

    Wang, Q.; Xiong, D.; Alfalou, A.; Brosseau, C.

    2018-05-01

    We propose an incoherent encoding system for image encryption based on a polarized encoding method combined with an incoherent imaging. Incoherent imaging is the core component of this proposal, in which the incoherent point-spread function (PSF) of the imaging system serves as the main key to encode the input intensity distribution thanks to a convolution operation. An array of retarders and polarizers is placed on the input plane of the imaging structure to encrypt the polarized state of light based on Mueller polarization calculus. The proposal makes full use of randomness of polarization parameters and incoherent PSF so that a multidimensional key space is generated to deal with illegal attacks. Mueller polarization calculus and incoherent illumination of imaging structure ensure that only intensity information is manipulated. Another key advantage is that complicated processing and recording related to a complex-valued signal are avoided. The encoded information is just an intensity distribution, which is advantageous for data storage and transition because information expansion accompanying conventional encryption methods is also avoided. The decryption procedure can be performed digitally or using optoelectronic devices. Numerical simulation tests demonstrate the validity of the proposed scheme.

  18. Novel type of chimera spiral waves arising from decoupling of a diffusible component

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Xiaodong; Yang, Tao; Liu, Yang; Zhao, Yuemin; Gao, Qingyu, E-mail: epstein@brandeis.edu, E-mail: gaoqy@cumt.edu.cn [College of Chemical Engineering, China University of Mining and Technology, Xuzhou 221008 (China); Epstein, Irving R., E-mail: epstein@brandeis.edu, E-mail: gaoqy@cumt.edu.cn [Department of Chemistry and Volen Center for Complex Systems, MS 015, Brandeis University, Waltham, Massachusetts 02454-9110 (United States)

    2014-07-14

    Spiral waves composed of coherent traveling waves surrounding a core containing stochastically distributed stationary areas are found in numerical simulations of a three-variable reaction-diffusion system with one diffusible species. In the spiral core, diffusion of this component (w) mediates transitions between dynamic states of the subsystem formed by the other two components, whose dynamics is more rapid than that of w. Diffusive coupling between adjacent sites can be “on” or “off” depending on the subsystem state. The incoherent structures in the spiral core are produced by this decoupling of the slow diffusive component from the fast non-diffusing subsystem. The phase diagram reveals that the region of incoherent behavior in chimera spirals grows drastically, leading to modulation and breakup of the spirals, in the transition zones between 1{sup n-1} and 1{sup n} local mixed-mode oscillations.

  19. Rupture dynamics and ground motions from earthquakes in 2-D heterogeneous media

    KAUST Repository

    Bydlon, Samuel A.; Dunham, Eric M.

    2015-01-01

    become appreciable beyond ∼3km from the fault. Near-fault scattering extends the duration of incoherent, high-frequency ground motions and, at least in our 2-D simulations, elevates root-mean-square accelerations (i.e., Arias intensity) with negligible

  20. Analysis of Ion Composition Estimation Accuracy for Incoherent Scatter Radars

    Science.gov (United States)

    Martínez Ledesma, M.; Diaz, M. A.

    2017-12-01

    The Incoherent Scatter Radar (ISR) is one of the most powerful sounding methods developed to estimate the Ionosphere. This radar system determines the plasma parameters by sending powerful electromagnetic pulses to the Ionosphere and analyzing the received backscatter. This analysis provides information about parameters such as electron and ion temperatures, electron densities, ion composition, and ion drift velocities. Nevertheless in some cases the ISR analysis has ambiguities in the determination of the plasma characteristics. It is of particular relevance the ion composition and temperature ambiguity obtained between the F1 and the lower F2 layers. In this case very similar signals are obtained with different mixtures of molecular ions (NO2+ and O2+) and atomic oxygen ions (O+), and consequently it is not possible to completely discriminate between them. The most common solution to solve this problem is the use of empirical or theoretical models of the ionosphere in the fitting of ambiguous data. More recent works take use of parameters estimated from the Plasma Line band of the radar to reduce the number of parameters to determine. In this work we propose to determine the error estimation of the ion composition ambiguity when using Plasma Line electron density measurements. The sensibility of the ion composition estimation has been also calculated depending on the accuracy of the ionospheric model, showing that the correct estimation is highly dependent on the capacity of the model to approximate the real values. Monte Carlo simulations of data fitting at different signal to noise (SNR) ratios have been done to obtain valid and invalid estimation probability curves. This analysis provides a method to determine the probability of erroneous estimation for different signal fluctuations. Also it can be used as an empirical method to compare the efficiency of the different algorithms and methods on when solving the ion composition ambiguity.

  1. Coherent quantum dynamics launched by incoherent relaxation in a quantum circuit simulator of a light-harvesting complex

    Science.gov (United States)

    Chin, A. W.; Mangaud, E.; Atabek, O.; Desouter-Lecomte, M.

    2018-06-01

    Engineering and harnessing coherent excitonic transport in organic nanostructures has recently been suggested as a promising way towards improving manmade light-harvesting materials. However, realizing and testing the dissipative system-environment models underlying these proposals is presently very challenging in supramolecular materials. A promising alternative is to use simpler and highly tunable "quantum simulators" built from programmable qubits, as recently achieved in a superconducting circuit by Potočnik et al. [A. Potočnik et al., Nat. Commun. 9, 904 (2018), 10.1038/s41467-018-03312-x]. We simulate the real-time dynamics of an exciton coupled to a quantum bath as it moves through a network based on the quantum circuit of Potočnik et al. Using the numerically exact hierarchical equations of motion to capture the open quantum system dynamics, we find that an ultrafast but completely incoherent relaxation from a high-lying "bright" exciton into a doublet of closely spaced "dark" excitons can spontaneously generate electronic coherences and oscillatory real-space motion across the network (quantum beats). Importantly, we show that this behavior also survives when the environmental noise is classically stochastic (effectively high temperature), as in present experiments. These predictions highlight the possibilities of designing matched electronic and spectral noise structures for robust coherence generation that do not require coherent excitation or cold environments.

  2. From coherent to incoherent mismatched interfaces: A generalized continuum formulation of surface stresses

    Science.gov (United States)

    Dingreville, Rémi; Hallil, Abdelmalek; Berbenni, Stéphane

    2014-12-01

    The equilibrium of coherent and incoherent mismatched interfaces is reformulated in the context of continuum mechanics based on the Gibbs dividing surface concept. Two surface stresses are introduced: a coherent surface stress and an incoherent surface stress, as well as a transverse excess strain. The coherent surface stress and the transverse excess strain represent the thermodynamic driving forces of stretching the interface while the incoherent surface stress represents the driving force of stretching one crystal while holding the other fixed and thereby altering the structure of the interface. These three quantities fully characterize the elastic behavior of coherent and incoherent interfaces as a function of the in-plane strain, the transverse stress and the mismatch strain. The isotropic case is developed in detail and particular attention is paid to the case of interfacial thermo-elasticity. This exercise provides an insight on the physical significance of the interfacial elastic constants introduced in the formulation and illustrates the obvious coupling between the interface structure and its associated thermodynamics quantities. Finally, an example based on atomistic simulations of Cu/Cu2O interfaces is given to demonstrate the relevance of the generalized interfacial formulation and to emphasize the dependence of the interfacial thermodynamic quantities on the incoherency strain with an actual material system.

  3. Diffusion in Coulomb crystals.

    Science.gov (United States)

    Hughto, J; Schneider, A S; Horowitz, C J; Berry, D K

    2011-07-01

    Diffusion in Coulomb crystals can be important for the structure of neutron star crusts. We determine diffusion constants D from molecular dynamics simulations. We find that D for Coulomb crystals with relatively soft-core 1/r interactions may be larger than D for Lennard-Jones or other solids with harder-core interactions. Diffusion, for simulations of nearly perfect body-centered-cubic lattices, involves the exchange of ions in ringlike configurations. Here ions "hop" in unison without the formation of long lived vacancies. Diffusion, for imperfect crystals, involves the motion of defects. Finally, we find that diffusion, for an amorphous system rapidly quenched from Coulomb parameter Γ=175 to Coulomb parameters up to Γ=1750, is fast enough that the system starts to crystalize during long simulation runs. These results strongly suggest that Coulomb solids in cold white dwarf stars, and the crust of neutron stars, will be crystalline and not amorphous.

  4. Effect of spatial variability of ground motion on non-linear dynamic behavior of cable stayed bridges

    Directory of Open Access Journals (Sweden)

    Ouanani Mouloud

    2018-01-01

    Full Text Available This present paper summarizes the main results of incoherence of Spatial Variability of Ground Motion (SVGM component on the non-linear dynamic behavior of a Mila cable stayed bridge. The Hindy and Novack coherence model is developed for the present study in order to examine the SVGM on bridge responses, Nonlinear bridge responses are investigated in terms of transverse displacements and bending moments along the superstructure and substructure of the study bridge, as well as temporal variations of rotational ductility demands at the bridge piers ends under the incoherence SVGM component. The results are systematically compared with those obtained assuming uniform ground motion. As a general trend, it may be concluded that incoherence component of SVGM should be considered for the earthquake response assessments of cable-stayed bridges.

  5. Simultaneous assessment of cerebral blood volume and diffusion heterogeneity using hybrid IVIM and DK MR imaging: initial experience with brain tumors.

    Science.gov (United States)

    Wu, Wen-Chau; Yang, Shun-Chung; Chen, Ya-Fang; Tseng, Han-Min; My, Pei-Chi

    2017-01-01

    To investigate the feasibility of simultaneously assessing cerebral blood volume and diffusion heterogeneity using hybrid diffusion-kurtosis (DK) and intravoxel-incoherent-motion (IVIM) MR imaging. Fifteen healthy volunteers and 30 patients with histologically proven brain tumours (25 WHO grade II-IV gliomas and five metastases) were recruited. On a 3-T system, diffusion-weighted imaging was performed with six b-values ranging from 0 to 1,700 s/mm 2 . Nonlinear least-squares fitting was employed to extract diffusion coefficient (D), diffusion kurtosis coefficient (K, a measure of the degree of non-Gaussian and heterogeneous diffusion) and intravascular volume fraction (f, a measure proportional to cerebral blood volume). Repeated-measures multivariate analysis of variance and receiver operating characteristic analysis were performed to assess the ability of D/K/f in differentiating contrast-enhanced tumour from peritumoral oedema and normal-appearing white matter. Based on our imaging setting (baseline signal-to-noise ratio = 32-128), coefficient of variation was 14-20 % for K, ~6 % for D and 26-44 % for f. The indexes were able to differentiate contrast-enhanced tumour (Wilks' λ = 0.026, p DK IVIM imaging is capable of simultaneously measuring cerebral perfusion and diffusion indexes that together may improve brain tumour diagnosis. • Hybrid DK-IVIM imaging allows simultaneous measurement of K, D and f. • Combined K/D/f better demarcates contrast-enhanced tumour than they do separately. • f correlates better with contrast-leakage-corrected CBV DSC than with uncorrected CBV DSC.

  6. Investigations of homologous disaccharides by elastic incoherent neutron scattering and wavelet multiresolution analysis

    Energy Technology Data Exchange (ETDEWEB)

    Magazù, S.; Migliardo, F. [Dipartimento di Fisica e di Scienze della Terra dell’, Università degli Studi di Messina, Viale F. S. D’Alcontres 31, 98166 Messina (Italy); Vertessy, B.G. [Institute of Enzymology, Hungarian Academy of Science, Budapest (Hungary); Caccamo, M.T., E-mail: maccamo@unime.it [Dipartimento di Fisica e di Scienze della Terra dell’, Università degli Studi di Messina, Viale F. S. D’Alcontres 31, 98166 Messina (Italy)

    2013-10-16

    Highlights: • Innovative multiresolution wavelet analysis of elastic incoherent neutron scattering. • Elastic Incoherent Neutron Scattering measurements on homologues disaccharides. • EINS wavevector analysis. • EINS temperature analysis. - Abstract: In the present paper the results of a wavevector and thermal analysis of Elastic Incoherent Neutron Scattering (EINS) data collected on water mixtures of three homologous disaccharides through a wavelet approach are reported. The wavelet analysis allows to compare both the spatial properties of the three systems in the wavevector range of Q = 0.27 Å{sup −1} ÷ 4.27 Å{sup −1}. It emerges that, differently from previous analyses, for trehalose the scalograms are constantly lower and sharper in respect to maltose and sucrose, giving rise to a global spectral density along the wavevector range markedly less extended. As far as the thermal analysis is concerned, the global scattered intensity profiles suggest a higher thermal restrain of trehalose in respect to the other two homologous disaccharides.

  7. Todd Berliner. Hollywood Incoherent. Narration in Seventies Cinema.

    Directory of Open Access Journals (Sweden)

    Pascal Lefèvre

    2010-12-01

    Full Text Available

    Todd Berliner. Hollywood Incoherent. Narration in Seventies Cinema.

    Austin: University of Texas Press, 2010.

    ISBN-10: 0292722796

    ISBN-13: 978-0292722798

     

     

  8. Controlling the light propagation in one-dimensional photonic crystal via incoherent pump and interdot tunneling

    Science.gov (United States)

    Abbasabadi, Majid; Sahrai, Mostafa

    2018-01-01

    We investigated the propagation of an electromagnetic pulse through a one-dimensional photonic crystal doped with quantum-dot (QD) molecules in a defect layer. The QD molecules behave as a three-level quantum system and are driven by a coherent probe laser field and an incoherent pump field. No coherent coupling laser fields were introduced, and the coherence was created by the interdot tunnel effect. Further studied was the effect of tunneling and incoherent pumping on the group velocity of the transmitted and reflected probe pulse.

  9. Ultrafast Dephasing and Incoherent Light Photon Echoes in Organic Amorphous Systems

    Science.gov (United States)

    Yano, Ryuzi; Matsumoto, Yoshinori; Tani, Toshiro; Nakatsuka, Hiroki

    1989-10-01

    Incoherent light photon echoes were observed in organic amorphous systems (cresyl violet in polyvinyl alcohol and 1,4-dihydroxyanthraquinone in polymethacrylic acid) by using temporally-incoherent nanosecond laser pulses. It was found that an echo decay curve of an organic amorphous system is composed of a sharp peak which decays very rapidly and a slowly decaying wing at the tail. We show that the persistent hole burning (PHB) spectra were reproduced by the Fourier-cosine transforms of the echo decay curves. We claim that in general, we must take into account the multi-level feature of the system in order to explain ultrafast dephasing at very low temperatures.

  10. Incoherently Coupled Grey-Grey Spatial Soliton Pairs in Biased Two-Photon Photovoltaic Photorefractive Crystals

    International Nuclear Information System (INIS)

    Su Yanli; Jiang Qichang; Ji Xuanmang

    2010-01-01

    The incoherently coupled grey-grey screening-photovoltaic spatial soliton pairs are predicted in biased two-photon photovoltaic photorefractive crystals under steady-state conditions. These grey-grey screening-photovoltaic soliton pairs can be established provided that the incident beams have the same polarization, wavelength, and are mutually incoherent. The grey-grey screening-photovoltaic soliton pairs can be considered as the united form of grey-grey screening soliton pairs and open or closed-circuit grey-grey photovoltaic soliton pairs. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

  11. Theoretical study of incoherent φ photoproduction on a deuteron target

    International Nuclear Information System (INIS)

    Sekihara, T.; Martinez Torres, A.; Jido, D.; Oset, E.

    2012-01-01

    We study the photoproduction of φ mesons in deuteron, paying attention to the modification of the cross-section from bound protons to the free ones. For this purpose we take into account Fermi motion in single scattering and rescattering of φ to account for φ absorption on a second nucleon as well as the rescattering of the proton on the neutron. We find that the contribution of the double scattering for φ is much smaller than the typical cross-section of γp→φp in free space, which implies a very small screening of the φ production in deuteron. The contribution from the proton rescattering, on the other hand, is found to be not negligible compared to the cross-section of γp→φp in free space, and leads to a moderate reduction of the φ photoproduction cross-section on a deuteron at forward angles if the LEPS set-up is taken into account. The Fermi motion allows contribution of the single scattering in regions forbidden by phase-space in the free case. In particular, we find that for momentum transfer squared close to the maximum value, the Fermi motion changes drastically the shape of dσ/dt, to the point that the ratio of this cross-section to the free one becomes very sensitive to the precise value of t chosen, or the size of the bin used in an experimental analysis. Hence, this particular region of t does not seem to be the most indicated to find effects of a possible φ absorption in the deuteron. This reaction is studied theoretically as a function of t and the results are contrasted with recent experiments at LEPS and Jefferson Lab. The effect of the experimental angular cuts at LEPS is also discussed, providing guidelines for future experimental analyses of the reaction. (orig.)

  12. Correlated diffusion imaging

    International Nuclear Information System (INIS)

    Wong, Alexander; Glaister, Jeffrey; Cameron, Andrew; Haider, Masoom

    2013-01-01

    Prostate cancer is one of the leading causes of cancer death in the male population. Fortunately, the prognosis is excellent if detected at an early stage. Hence, the detection and localization of prostate cancer is crucial for diagnosis, as well as treatment via targeted focal therapy. New imaging techniques can potentially be invaluable tools for improving prostate cancer detection and localization. In this study, we introduce a new form of diffusion magnetic resonance imaging called correlated diffusion imaging, where the tissue being imaged is characterized by the joint correlation of diffusion signal attenuation across multiple gradient pulse strengths and timings. By taking into account signal attenuation at different water diffusion motion sensitivities, correlated diffusion imaging can provide improved delineation between cancerous tissue and healthy tissue when compared to existing diffusion imaging modalities. Quantitative evaluation using receiver operating characteristic (ROC) curve analysis, tissue class separability analysis, and visual assessment by an expert radiologist were performed to study correlated diffusion imaging for the task of prostate cancer diagnosis. These results are compared with that obtained using T2-weighted imaging and standard diffusion imaging (via the apparent diffusion coefficient (ADC)). Experimental results suggest that correlated diffusion imaging provide improved delineation between healthy and cancerous tissue and may have potential as a diagnostic tool for cancer detection and localization in the prostate gland. A new form of diffusion magnetic resonance imaging called correlated diffusion imaging (CDI) was developed for the purpose of aiding radiologists in cancer detection and localization in the prostate gland. Preliminary results show CDI shows considerable promise as a diagnostic aid for radiologists in the detection and localization of prostate cancer

  13. Incoherent-scatter computed tomography with monochromatic synchrotron x ray: feasibility of multi-CT imaging system for simultaneous measurement-of fluorescent and incoherent scatter x rays

    Science.gov (United States)

    Yuasa, T.; Akiba, M.; Takeda, T.; Kazama, M.; Hoshino, A.; Watanabe, Y.; Hyodo, K.; Dilmanian, F. A.; Akatsuka, T.; Itai, Y.

    1997-10-01

    We describe a new system of incoherent scatter computed tomography (ISCT) using monochromatic synchrotron X rays, and we discuss its potential to be used in in vivo imaging for medical use. The system operates on the basis of computed tomography (CT) of the first generation. The reconstruction method for ISCT uses the least squares method with singular value decomposition. The research was carried out at the BLNE-5A bending magnet beam line of the Tristan Accumulation Ring in KEK, Japan. An acrylic cylindrical phantom of 20-mm diameter containing a cross-shaped channel was imaged. The channel was filled with a diluted iodine solution with a concentration of 200 /spl mu/gI/ml. Spectra obtained with the system's high purity germanium (HPGe) detector separated the incoherent X-ray line from the other notable peaks, i.e., the iK/sub /spl alpha// and K/sub /spl beta/1/ X-ray fluorescent lines and the coherent scattering peak. CT images were reconstructed from projections generated by integrating the counts In the energy window centering around the incoherent scattering peak and whose width was approximately 2 keV. The reconstruction routine employed an X-ray attenuation correction algorithm. The resulting image showed more homogeneity than one without the attenuation correction.

  14. On the application of the theory of the translational Brownian movement to the calculation of the differential cross-sections for the incoherent scattering of slow neutrons

    International Nuclear Information System (INIS)

    Coffey, W.T.

    1978-01-01

    It is shown how three models (based on the theory of the Brownian movement) for the translational motion of an atom in a fluid may be used to calculate explicitly the intermediate scattering functions and differential cross-sections for the incoherent scattering of slow neutrons. In the first model the translational motion of the atom is represented by the motion of a particle in space subjected to no forces other than those arising from the thermal motion of its surroundings. The differential scattering cross-section for this model is then obtained as a continued fraction similar to that given by Sack (Proc. Phys. Soc.; B70:402 and 414 (1957)) for the electric polarisability in his investigation of the role of inertial effects in dielectric relaxation. The second model is a corrected version of the itinerant oscillator model of Sears (Proc. Phys. Soc.; 86:953 (1965)). Here the differential cross-section is obtained in the form of a series and a closed-form expression is found for the intermediate scattering function. The last model to be considered is the harmonically bound particle where again a closed form expression is obtained for the intermediate scattering function. In each case the intermediate scattering function has a mathematical form which is similar to the after-effect function describing the decay of electric polarisation for the rotational versions of the models. (author)

  15. Polymer and Water Dynamics in Poly(vinyl alcohol/Poly(methacrylate Networks. A Molecular Dynamics Simulation and Incoherent Neutron Scattering Investigation

    Directory of Open Access Journals (Sweden)

    Ester Chiessi

    2011-10-01

    Full Text Available Chemically cross-linked polymer networks of poly(vinyl alcohol/poly(methacrylate form monolitic hydrogels and microgels suitable for biomedical applications, such as in situ tissue replacement and drug delivery. In this work, molecular dynamics (MD simulation and incoherent neutron scattering methods are used to study the local polymer dynamics and the polymer induced modification of water properties in poly(vinyl alcohol/poly(methacrylate hydrogels. This information is particularly relevant when the diffusion of metabolites and drugs is a requirement for the polymer microgel functionality. MD simulations of an atomic detailed model of the junction domain at the experimental hydration degree were carried out at 283, 293 and 313 K. The polymer-water interaction, the polymer connectivity and the water dynamics were investigated as a function of temperature. Simulation results are compared with findings of elastic and quasi-elastic incoherent neutron scattering measurements, experimental approaches which sample the same space-time window of MD simulations. This combined analysis shows a supercooled water component and an increase of hydrophilicity and mobility with temperature of these amphiphilic polymer networks.

  16. Comparison of bi-exponential and mono-exponential models of diffusion-weighted imaging for detecting active sacroiliitis in ankylosing spondylitis.

    Science.gov (United States)

    Sun, Haitao; Liu, Kai; Liu, Hao; Ji, Zongfei; Yan, Yan; Jiang, Lindi; Zhou, Jianjun

    2018-04-01

    Background There has been a growing need for a sensitive and effective imaging method for the differentiation of the activity of ankylosing spondylitis (AS). Purpose To compare the performances of intravoxel incoherent motion (IVIM)-derived parameters and the apparent diffusion coefficient (ADC) for distinguishing AS-activity. Material and Methods One hundred patients with AS were divided into active (n = 51) and non-active groups (n = 49) and 21 healthy volunteers were included as control. The ADC, diffusion coefficient ( D), pseudodiffusion coefficient ( D*), and perfusion fraction ( f) were calculated for all groups. Kruskal-Wallis tests and receiver operator characteristic (ROC) curve analysis were performed for all parameters. Results There was good reproducibility of ADC /D and relatively poor reproducibility of D*/f. ADC, D, and f were significantly higher in the active group than in the non-active and control groups (all P  0.050). In the ROC analysis, ADC had the largest AUC for distinguishing between the active group and the non-active group (0.988) and between the active and control groups (0.990). Multivariate logistic regression analysis models showed no diagnostic improvement. Conclusion ADC provided better diagnostic performance than IVIM-derived parameters in differentiating AS activity. Therefore, a straightforward and effective mono-exponential model of diffusion-weighted imaging may be sufficient for differentiating AS activity in the clinic.

  17. Incoherent scattering of gamma rays by K-shell electrons. [Differential cross sections, 145 to 662 KeV

    Energy Technology Data Exchange (ETDEWEB)

    Spitale, G.C.; Bloom, S.D.

    1976-05-12

    Differential cross sections for incoherent scattering by K-shell electrons were measured, using coincidence techniques, for incident photons having energies of 662 keV, 320 keV, and 145 keV. The spectral distributions of the scattered photons emerging at scattering angles from 20/sup 0/ to about 140/sup 0/ are reported. Target materials were iron, tin, holmium, and gold at 320 keV; tin and gold at 662 keV; and iron and tin at 145 keV. A typical energy spectrum consists of a scattered peak that is much narrower than would be expected from the bound state electron motion. The peak also, typically, reaches a broad maximum width for scattering angles between 45/sup 0/ and 60/sup 0/. Rather than monotonically increasing with atomic number the peak width reaches a broad maximum, generally, between Z = 50 and Z = 67, and then decreases with increasing atomic number. No Compton defect appears in any of the peaks to within +- 20 keV. A discussion of the expected magnitude of the Compton defect is included. The peak is superimposed on a continuum that diverges at the low end of the scattered photon spectrum for the following cases: gold, holmium, and tin targets for 320-keV incident photons; gold and possibly tin targets for 662-keV photons incident. This infrared divergence is expected on theoretical grounds and has been predicted. It is very nearly isotropic.

  18. Motion of channeling particles in a bent crystal

    International Nuclear Information System (INIS)

    Avakian, A.R.; Harutyunian, A.S.; Hovanessian, A.G.; Shahinian, S.M.; Yang, C.

    1990-01-01

    The motion of high-energy charged particles in a bent crystal is investigated in the approximation of the model of continuous potential of crystallographic planes and with account of incoherent scattering on the atoms of media. Angular distribution of charged particle beams is investigated at the exit of the bent region of the crystal in dependence with the maximum deflection angle and energy of particles. The dependence of the fraction of channeling particles on crystal thickness, crystal curvature and particle energy is found in a simple model approximation. The influence of crystal curvature on incoherent scattering of particles in the crystal is analyzed. The concept of an optimal thickness for the maximum number of particles deflected at a given angle is considered. 8 refs.; 8 figs

  19. Time-stretch microscopy based on time-wavelength sequence reconstruction from wideband incoherent source

    International Nuclear Information System (INIS)

    Zhang, Chi; Xu, Yiqing; Wei, Xiaoming; Tsia, Kevin K.; Wong, Kenneth K. Y.

    2014-01-01

    Time-stretch microscopy has emerged as an ultrafast optical imaging concept offering the unprecedented combination of the imaging speed and sensitivity. However, dedicated wideband and coherence optical pulse source with high shot-to-shot stability has been mandated for time-wavelength mapping—the enabling process for ultrahigh speed wavelength-encoded image retrieval. From the practical point of view, exploiting methods to relax the stringent requirements (e.g., temporal stability and coherence) for the source of time-stretch microscopy is thus of great value. In this paper, we demonstrated time-stretch microscopy by reconstructing the time-wavelength mapping sequence from a wideband incoherent source. Utilizing the time-lens focusing mechanism mediated by a narrow-band pulse source, this approach allows generation of a wideband incoherent source, with the spectral efficiency enhanced by a factor of 18. As a proof-of-principle demonstration, time-stretch imaging with the scan rate as high as MHz and diffraction-limited resolution is achieved based on the wideband incoherent source. We note that the concept of time-wavelength sequence reconstruction from wideband incoherent source can also be generalized to any high-speed optical real-time measurements, where wavelength is acted as the information carrier

  20. New neutron-based isotopic analytical methods; An explorative study of resonance capture and incoherent scattering

    NARCIS (Netherlands)

    Perego, R.C.

    2004-01-01

    Two novel neutron-based analytical techniques have been treated in this thesis, Neutron Resonance Capture Analysis (NRCA), employing a pulsed neutron source, and Neutron Incoherent Scattering (NIS), making use of a cold neutron source. With the NRCA method isotopes are identified by the

  1. Incoherent neutron-scattering determination of hydrogen content : Theory and modeling

    NARCIS (Netherlands)

    Perego, R.C.; Blaauw, M.

    2005-01-01

    Hydrogen concentrations of 0 up to 350?mg/kg in a titanium alloy have been determined at National Institute of Standards and Technology (NIST) with neutron incoherent scattering (NIS) and with cold neutron prompt gamma activation analysis. The latter is a well-established technique, while the former

  2. Coherent laser phase retrieval in the presence of measurement imperfections and incoherent light

    DEFF Research Database (Denmark)

    Hansen, Anders Kragh

    2017-01-01

    -plane Gerchberg–Saxton algorithm and demonstrate that it is highly successful at extracting the intensity profile and wavefront of the spatially coherent part of the light from various lasers, including tapered laser diodes, at a very high fidelity despite the presence of incoherent light and noise....

  3. Optical sectioning using a digital Fresnel incoherent-holography-based confocal imaging system

    Science.gov (United States)

    Kelner, Roy; Katz, Barak; Rosen, Joseph

    2015-01-01

    We propose a new type of confocal microscope using Fresnel incoherent correlation holography (FINCH). Presented here is a confocal configuration of FINCH using a phase pinhole and point illumination that is able to suppress out-of-focus information from the recorded hologram and hence combine the super-resolution capabilities of FINCH with the sectioning capabilities of confocal microscopy. PMID:26413560

  4. Optical sectioning using a digital Fresnel incoherent-holography-based confocal imaging system

    OpenAIRE

    Kelner, Roy; Katz, Barak; Rosen, Joseph

    2014-01-01

    We propose a new type of confocal microscope using Fresnel incoherent correlation holography (FINCH). Presented here is a confocal configuration of FINCH using a phase pinhole and point illumination that is able to suppress out-of-focus information from the recorded hologram and hence combine the super-resolution capabilities of FINCH with the sectioning capabilities of confocal microscopy.

  5. Measurements of integral cross-sections of incoherent interactions of photons with L-shell electrons

    Energy Technology Data Exchange (ETDEWEB)

    Verma, S L; Allawadhi, K L; Sood, B S [Punjabi Univ., Patiala (India). Nuclear Science Labs.

    1983-05-21

    Integral cross-sections of incoherent interactions of 662 and 1250 keV gamma-rays with L-shell electrons of different elements with 74<=Z<=92 have been measured. The experimental results, when interpreted in terms of photoelectric and Compton interaction cross-sections, are found to agree with theory.

  6. Measurement of integral cross-sections of incoherent interactions of photons with K-shell electrons

    Energy Technology Data Exchange (ETDEWEB)

    Verma, S L; Allawadhi, K L; Sood, B S [Punjabi Univ., Patiala (India). Dept. of Physics. Nuclear Science Labs.

    1981-06-01

    Integral cross-sections of incoherent interactions of 145, 279, 662 and 1250 keV gamma-rays with K-shell electrons of thirty-one different elements with 26 <= Z <= 92 have been measured. The results are interpreted in terms of the photoelectric and Compton interactions and are found to agree with theory.

  7. Velocity-Autocorrelation Function in Liquids, Deduced from Neutron Incoherent Scattering Results

    DEFF Research Database (Denmark)

    Carneiro, Kim

    1976-01-01

    The Fourier transform p(ω) of the velocity-autocorrelation function is derived from neutron incoherent scattering results, obtained from the two liquids Ar and H2. The quality and significance of the results are discussed with special emphasis on the long-time t-3/2 tail, found in computer simula...

  8. Determination of the thermospheric neutral wind from incoherent scatter radar measurements

    International Nuclear Information System (INIS)

    Haeggstroem, I.; Murdin, J.; Rees, D.

    1984-11-01

    Measurements made by the EISCAT UHF incoherent scatter radar are used to derive thermospheric winds. The derived wind is compared to Fabry-Perot interferometer measurements of the neutral wind made simultaneously. The uncertainties in the radar derived wind are discussed. (author)

  9. Ion layers, tides, gravity waves, and electric fields in the upper atmosphere, inferred from Arecibo incoherent scatter radar measurements

    International Nuclear Information System (INIS)

    Morton, Y.T.

    1991-01-01

    This thesis uses data accumulated during 1980-1989 by the Arecibo incoherent scatter radar to study the behavior and physics of ionization irregularities. Low latitude ionization irregularities, known as sporadic-E and intermediate layers, undergo a regular daily descent, convergence, and dumping of ion layers controlled by the neutral tidal wind. A useful way of studying ion layers and their motion is by ion layer trajectory maps which consist of points representing the altitude and time of ionization layers. Two types of maps were used which assigned either a uniform layer intensity or a gray level/pseudo-color to indicate different layer intensities. Important aspects of layer formation are revealed by map analysis. During January, intermediate layers consistently appeared four times per day instead of the normal twice per day pattern. Simulation of ion trajectories based on the ion momentum equation, which includes both Lorentzian and collisional forces, shows that a combination of diurnal, semidiurnal, and six-hour tides is necessary for such a feature to exist, whereas only diurnal and semidiurnal tides are needed to create the normal pattern. The six-hour period tide has not been previously reported. Extra or irregular layers appear frequently in layer trajectory maps, which can be simulated by the addition of gravity waves to the regular tidal wind system. Electric field effects are normally not a factor in low latitude ion layer formation because they are relatively weak and not commonly observed. Layer configurations during a geomagnetic storm, however, indicate that the electric field played an important role in controlling ion motion

  10. Understanding quantum tunneling using diffusion Monte Carlo simulations

    Science.gov (United States)

    Inack, E. M.; Giudici, G.; Parolini, T.; Santoro, G.; Pilati, S.

    2018-03-01

    In simple ferromagnetic quantum Ising models characterized by an effective double-well energy landscape the characteristic tunneling time of path-integral Monte Carlo (PIMC) simulations has been shown to scale as the incoherent quantum-tunneling time, i.e., as 1 /Δ2 , where Δ is the tunneling gap. Since incoherent quantum tunneling is employed by quantum annealers (QAs) to solve optimization problems, this result suggests that there is no quantum advantage in using QAs with respect to quantum Monte Carlo (QMC) simulations. A counterexample is the recently introduced shamrock model (Andriyash and Amin, arXiv:1703.09277), where topological obstructions cause an exponential slowdown of the PIMC tunneling dynamics with respect to incoherent quantum tunneling, leaving open the possibility for potential quantum speedup, even for stoquastic models. In this work we investigate the tunneling time of projective QMC simulations based on the diffusion Monte Carlo (DMC) algorithm without guiding functions, showing that it scales as 1 /Δ , i.e., even more favorably than the incoherent quantum-tunneling time, both in a simple ferromagnetic system and in the more challenging shamrock model. However, a careful comparison between the DMC ground-state energies and the exact solution available for the transverse-field Ising chain indicates an exponential scaling of the computational cost required to keep a fixed relative error as the system size increases.

  11. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.

    2017-06-06

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  12. Conserved linear dynamics of single-molecule Brownian motion

    Science.gov (United States)

    Serag, Maged F.; Habuchi, Satoshi

    2017-06-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  13. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.; Habuchi, Satoshi

    2017-01-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  14. Diffusion of chlorine in single-crystal (Sr,Y)Cl2.03

    International Nuclear Information System (INIS)

    Goff, J.P.; Hayes, W.; Ward, R.C.C; Hull, S.; Hutchings, M.T.

    1992-01-01

    Quasielastic energy broadening of the incoherent neutron scattering from single-crystal (Sr,Y)Cl 2.03 has been studied at elevated temperatures using the time-of-flight spectrometer IRIS at the Rutherford-Appleton Laboratory. Incoherent spectra measured at temperatures of 923 and 973 K have been fitted by a Chudley-Elliott model, in which individual anions occupy sites for a mean residence time τ before hopping to adjacent regular lattice sites. These results obtained from an anion-excess system are compared with a previous investigation of chlorine diffusion in pure SrCl 2 . (orig.)

  15. Molecular motion in restricted geometries

    Indian Academy of Sciences (India)

    Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time ...

  16. Diffusion effects in undulator radiation

    Directory of Open Access Journals (Sweden)

    Ilya Agapov

    2014-11-01

    Full Text Available Quantum diffusion effects in undulator radiation in semiclassical approximation are considered. Short-term effects on the electron beam motion are discussed and it is shown that approaches based on diffusion approximation with drift-diffusion coefficients derived from undulator or bending magnet radiation spectrum, and on Poisson statistics with radiation spectrum defined by the local beding field, all lead to similar results in terms of electron energy spread for cases of practical interest. An analytical estimate of the influence of quantum diffusion on the undulator radiation spectrum is derived.

  17. Selected clinically established and scientific techniques of diffusion-weighted MRI. In the context of imaging in oncology; Ausgewaehlte klinisch etablierte und wissenschaftliche Techniken der diffusionsgewichteten MRT. Im Kontext der onkologischen Bildgebung

    Energy Technology Data Exchange (ETDEWEB)

    Freitag, M.T.; Bickelhaupt, S.; Ziener, C.; Mosebach, J.; Schlemmer, H.P. [Deutsches Krebsforschungszentrum, Abteilung fuer Radiologie, Heidelberg (Germany); Meier-Hein, K. [Deutsches Krebsforschungszentrum, Abteilung fuer medizinische Informatik, Heidelberg (Germany); Radtke, J.P. [Deutsches Krebsforschungszentrum, Abteilung fuer Radiologie, Heidelberg (Germany); Universitaetsklinik Heidelberg, Abteilung fuer Urologie, Heidelberg (Germany); Kuder, T.A.; Laun, F.B. [Deutsches Krebsforschungszentrum, Abteilung fuer Medizinische Physik in der Radiologie, Heidelberg (Germany)

    2016-02-15

    Diffusion-weighted imaging (DWI) is a magnetic resonance imaging (MRI) technique that was established in the clinical routine primarily for the detection of brain ischemia. In the past 15 years its clinical use has been extended to oncological radiology, as tumor and metastases can be depicted in DWI due to their hypercellular nature. The basis of DWI is the Stejskal-Tanner experiment. The diffusion properties of tissue can be visualized after acquisition of at least two diffusion-weighted series using echo planar imaging and a specific sequence of gradient pulses. The use of DWI in prostate MRI was reported to be one of the first established applications that found its way into internationally recognized clinical guidelines of the European Society of Urological Radiology (ESUR) and the prostate imaging reporting and data system (PI-RADS) scale. Due to recently reported high specificity and negative predictive values of 94 % and 92 %, respectively, its regular use for breast MRI is expected in the near future. Furthermore, DWI can also reliably be used for whole-body imaging in patients with multiple myeloma or for measuring the extent of bone metastases. New techniques in DWI, such as intravoxel incoherent motion imaging, diffusion kurtosis imaging and histogram-based analyses represent promising approaches to achieve a more quantitative evaluation for tumor detection and therapy response. (orig.) [German] Die diffusionsgewichtete Bildgebung (''diffusion-weighted imaging'', DWI), ein Verfahren aus der Magnetresonanztomographie (MRT), wurde in der klinischen Routine primaer fuer die Detektion von Schlaganfaellen etabliert. Der Einsatz dieser Methode hat in den letzten 15 Jahren auch fuer die onkologische Diagnostik stark zugenommen, da Tumoren und Metastasen aufgrund ihrer hochzellulaeren Zusammensetzung in der DWI sehr gut sichtbar gemacht werden koennen. Basis der diffusionsgewichteten Bildgebung ist das Experiment nach Stejskal-Tanner. Hier

  18. The effect of the precipitation of coherent and incoherent precipitates on the ductility and toughness of high-strength steel

    International Nuclear Information System (INIS)

    Hamano, R.

    1993-01-01

    The effect of the coexistence of coherent and incoherent precipitates, such as M 2 C and NiAl, on the ductility and plane strain fracture toughness of 5 wt pct Ni-2 wt pct Al-based high-strength steels was studied. In order to disperse coherent and incoherent precipitates, the heat treatments were carried out as follows: (a) austenitizing at 1373 K, (b) tempering at 1023 or 923 K for dispersing the incoherent precipitates of M 2 C and NiAl, and then (c) aging at 843 K for 2.4 ks to disperse the coherent precipitate of NiAl into the matrix, which contains incoherent precipitates, such as M 2 C and NiAl. The results were obtained as follows: (a) when the strengthening precipitates consist of coherent ones, such as M 2 C and/or NiAl, the ductility and toughness are extremely low, and (b) when the strengthening precipitates consist of coherent and incoherent precipitates, such as M 2 C and NiAl, the ductility and fracture toughness significantly increase with no loss in strength. It is shown that the coexistence of coherent and incoherent precipitates increases homogeneous deformation, thus preventing local strain concentration and early cleavage cracking. Accordingly, the actions of coherent precipitates in strengthening the matrix and of incoherent precipitates in promoting, homogeneous deformation can be expected to increase both the strength and toughness of the material

  19. Motion discrimination under uncertainty and ambiguity.

    NARCIS (Netherlands)

    Kalisvaart, J.P.; Klaver, I.; Goossens, J.

    2011-01-01

    Speed and accuracy of visual motion discrimination depend systematically on motion strength. This behavior is traditionally explained by diffusion models that assume accumulation of sensory evidence over time to a decision bound. However, how does the brain decide when sensory evidence is ambiguous,

  20. Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures

    Science.gov (United States)

    Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.

    2018-05-01

    Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.

  1. Selection for biopsy of kidney transplant patients by diffusion-weighted MRI

    Energy Technology Data Exchange (ETDEWEB)

    Steiger, Philipp; Barbieri, Sebastiano; Ith, Michael; Thoeny, Harriet C. [Inselspital, Bern University Hospital, University of Bern, Inselspital, Department of Radiology, Neuroradiology, and Nuclear Medicine, Institute of Diagnostic, Pediatric, and Interventional Radiology, Bern (Switzerland); Kruse, Anja [Inselspital, Bern University Hospital, University of Bern, Inselspital, Department of Nephrology and Hypertension, Bern (Switzerland)

    2017-10-15

    To assess retrospectively whether diffusion-weighted magnetic resonance imaging (DW-MRI) allows physicians to determine the severity of histopathologic findings in biopsies of renal allograft patients with deteriorating renal function. Forty consecutive kidney transplant patients underwent DW-MRI and biopsy. Patients were assigned to one group with severe and to another group with normal or mild histopathologic findings. These two groups were compared based on a qualitative DW-MRI assessment (homo-/heterogeneity) and the combination of qualitative and quantitative DW-MRI parameters (ADC, and intravoxel incoherent motion, IVIM, parameters: D, f, D*). Sensitivity, specificity, and accuracy were determined for each parameter. Biopsy findings were severe in 25 patients and normal or mild in 15 patients. Qualitative DW-MRI led to a sensitivity of 44.0% and a specificity of 93.3%. Combined qualitative and quantitative DW-MRI led to an accuracy of 80% for both the minimal ADC (ADCmin) and the minimal perfusion fraction (fmin) with a sensitivity of 84.0% and 92.0% and a specificity of 73.3% and 60.0%, respectively. Combined qualitative and quantitative DW-MRI might allow physicians to determine the severity of histopathologic findings in biopsies of a high number of kidney transplant patients. (orig.)

  2. Nonlinear propagation of a spatially incoherent laser beam: self-induced smoothing and reduction of scattering instabilities

    International Nuclear Information System (INIS)

    Maximov, A.V.; Ourdev, I.G.; Rozmus, W.; Capjack, C.E.; Mounaix, Ph.; Huller, S.; Pesme, D.; Tikhonchuk, V.T.; Divol, L.

    2000-01-01

    It is shown that plasma-induced angular spreading and spectral broadening of a spatially incoherent laser beam correspond to increased spatial and temporal incoherence of the laser light. The spatial incoherence is characterized by an effective beam f-number, decreasing in space along the direction of light propagation. Plasma-induced beam smoothing can influence laser-plasma interaction physics. In particular, decreasing the correlation time of the propagating laser light may dramatically reduce the levels of backward stimulated Brillouin and Raman scattering inside the plasma. Also, the decrease of the laser beam effective f-number reduces the reflectivity of backward stimulated Brillouin scattering. (authors)

  3. New diffusion imaging method with a single acquisition sequence

    International Nuclear Information System (INIS)

    Melki, Ph.S.; Bittoun, J.; Lefevre, J.E.

    1987-01-01

    The apparent diffusion coefficient (ADC) is related to the molecular diffusion coefficient and to physiologic information: microcirculation in the capillary network, incoherent slow flow, and restricted diffusion. The authors present a new MR imaging sequence that yields computed ADC images in only one acquisition of 9-minutes with a 1.5-T imager (GE Signa). Compared to the previous method, this sequence is at least two times faster and thus can be used as a routine examination to supplement T1-, T2-, and density-weighted images. The method was assessed by measurement of the molecular diffusion in liquids, and the first clinical images obtained in neurologic diseases demonstrate its efficiency for clinical investigation. The possibility of separately imaging diffusion and perfusion is supported by an algorithm

  4. Depth-resolved incoherent and coherent wide-field high-content imaging (Conference Presentation)

    Science.gov (United States)

    So, Peter T.

    2016-03-01

    Recent advances in depth-resolved wide-field imaging technique has enabled many high throughput applications in biology and medicine. Depth resolved imaging of incoherent signals can be readily accomplished with structured light illumination or nonlinear temporal focusing. The integration of these high throughput systems with novel spectroscopic resolving elements further enable high-content information extraction. We will introduce a novel near common-path interferometer and demonstrate its uses in toxicology and cancer biology applications. The extension of incoherent depth-resolved wide-field imaging to coherent modality is non-trivial. Here, we will cover recent advances in wide-field 3D resolved mapping of refractive index, absorbance, and vibronic components in biological specimens.

  5. Production of flat KrF laser focal profiles with echelon free-induced spatial incoherence

    International Nuclear Information System (INIS)

    Deniz, A.V.; Obenschain, S.P.; Pronko, M.; Lehmberg, R.H.

    1990-01-01

    High gain direct-drive laser fusion requires a uniform spherical pellet implosion. This in turn requires that the focal profile of each driving beam be sufficiently uniform and controlled. Several methods for producing uniform beams have been proposed. One promising technique, echelon free-induced spatial incoherence (ISI), consists of propagating a broadband spatially incoherent beam through an entire laser system. This technique will be used in the Nike laser, which is a twenty-four- to forty-eight-beam multikilojoule KrF system currently under construction at the Naval Research Laboratory (NRL). This paper presents measurements of focal profiles of laser light smoothed by echelon free ISI from a KrF oscillator and amplifier. The initial implementation is shown

  6. SFERXS, Photoabsorption, Coherent, Incoherent Scattering Cross-Sections Function for Shielding

    International Nuclear Information System (INIS)

    Legarda, F.; Mtz de la Fuente, O.; Herranz, M.

    2002-01-01

    Description of program or function: The use of electromagnetic radiation cross-sections in radiation shielding calculations and more generally in transport theory applications actually requires an interpolation between values which are tabulated for certain values of the energy. In order to facilitate this process and to reduce the computer memory requirements, we have developed, by a least squares method, a set of functions which represents the cross-sections for the photoelectric absorption, the coherent (Rayleigh) and the incoherent (Compton) scattering (1). For this purpose we have accepted as true values the ones tabulated by Storm and Israel (2) for the photoeffect, by Hubbell et Al. (3) for the incoherent scattering and by Hubbell and Overbo (4) for the coherent scattering

  7. Compressive sensing sectional imaging for single-shot in-line self-interference incoherent holography

    Science.gov (United States)

    Weng, Jiawen; Clark, David C.; Kim, Myung K.

    2016-05-01

    A numerical reconstruction method based on compressive sensing (CS) for self-interference incoherent digital holography (SIDH) is proposed to achieve sectional imaging by single-shot in-line self-interference incoherent hologram. The sensing operator is built up based on the physical mechanism of SIDH according to CS theory, and a recovery algorithm is employed for image restoration. Numerical simulation and experimental studies employing LEDs as discrete point-sources and resolution targets as extended sources are performed to demonstrate the feasibility and validity of the method. The intensity distribution and the axial resolution along the propagation direction of SIDH by angular spectrum method (ASM) and by CS are discussed. The analysis result shows that compared to ASM the reconstruction by CS can improve the axial resolution of SIDH, and achieve sectional imaging. The proposed method may be useful to 3D analysis of dynamic systems.

  8. Transformation of EIA to EIT by incoherent pumping of the 85Rb D1 line

    Science.gov (United States)

    Yu, Hoon; Kim, Jung Dong; Jung, Tae Young; Kim, Jung Bog

    2012-10-01

    We have observed a transformation from electromagnetically-induced absorption (EIA) to electromagnetically induced transparency (EIT) in open systems of the 85Rb D1 line by adding an incoherent optical pumping laser. This result raises a new question about recent theoretical work which does not address the degree of open. The pump beam only plays a role in transferring atoms by a spontaneous transition into the interacting system for EIT observation, which is an incoherent process. The dependence of the absorption spectra on the intensity and the polarization of each laser beam were observed. We have found the same tendencies in all transitions except the F = 2 ↔ F' = 3 transition of the 85Rb D1 line, which is the system that almost satisfies conventional EIA conditions.

  9. Incoherent scattering of gamma photons for non-destructive tomographic inspection of pipeline

    International Nuclear Information System (INIS)

    Sharma, Amandeep; Sandhu, B.S.; Singh, Bhajan

    2010-01-01

    A scanner system, operating in a non-destructive and non-invasive way, is presented for pipeline to determine its location in land soil, wall thickness, type of liquid flowing and crack/blockage position. The present experiment simulates a real case where pipe corrosion (wall thinning) under insulation can be known from the study of incoherent scattering of 662 keV gamma photons. The incoherent scattered intensity, obtained by unfolding (deconvolution) the experimental pulse-height distribution of NaI(Tl) scintillation detector with the help of inverse response matrix, provides the desired information. The method is quite sensitive for small change (∼1 mm) in the thickness of pipe wall, locating a defect of 1 mm width under insulation and a small change (∼0.1 gm cm -3 ) in the density of liquid flowing through pipe.

  10. Vibronic dephasing model for coherent-to-incoherent crossover in DNA

    Science.gov (United States)

    Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas

    2018-05-01

    In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.

  11. Formation of 2D bright spatial solitons in lithium niobate with photovoltaic response and incoherent background

    Science.gov (United States)

    Pustozerov, A.; Shandarov, V.

    2017-12-01

    The influence of incoherent background illumination produced by light-emitting diodes (LED's) of different average wavelengths and laser diode emitting in blue region of visible on diffraction characteristics of narrow coherent light beams of He-Ne laser due to refractive index changes of Fe-doped lithium niobate sample are studied. It has been experimentally demonstrated that nonlinear diffraction of red beams with wavelength 633 nm and diameters on full width of half maximum (FWHM) near to 15 μm may be totally compensated using background light with average wavelengths 450 - 465 nm. To provide the necessary intensity of incoherent background, the combinations of spherical and cylindrical concave lenses with blue LED and laser diode module without focusing its beam have been used.

  12. The Trouble with Diffusion

    Directory of Open Access Journals (Sweden)

    R.T. DeHoff

    2002-09-01

    Full Text Available The phenomenological formalism, which yields Fick's Laws for diffusion in single phase multicomponent systems, is widely accepted as the basis for the mathematical description of diffusion. This paper focuses on problems associated with this formalism. This mode of description of the process is cumbersome, defining as it does matrices of interdiffusion coefficients (the central material properties that require a large experimental investment for their evaluation in three component systems, and, indeed cannot be evaluated for systems with more than three components. It is also argued that the physical meaning of the numerical values of these properties with respect to the atom motions in the system remains unknown. The attempt to understand the physical content of the diffusion coefficients in the phenomenological formalism has been the central fundamental problem in the theory of diffusion in crystalline alloys. The observation by Kirkendall that the crystal lattice moves during diffusion led Darken to develop the concept of intrinsic diffusion, i.e., atom motion relative to the crystal lattice. Darken and his successors sought to relate the diffusion coefficients computed for intrinsic fluxes to those obtained from the motion of radioactive tracers in chemically homogeneous samples which directly report the jump frequencies of the atoms as a function of composition and temperature. This theoretical connection between tracer, intrinsic and interdiffusion behavior would provide the basis for understanding the physical content of interdiffusion coefficients. Definitive tests of the resulting theoretical connection have been carried out for a number of binary systems for which all three kinds of observations are available. In a number of systems predictions of intrinsic coefficients from tracer data do not agree with measured values although predictions of interdiffusion coefficients appear to give reasonable agreement. Thus, the complete

  13. Support vector machine for breast cancer classification using diffusion-weighted MRI histogram features: Preliminary study.

    Science.gov (United States)

    Vidić, Igor; Egnell, Liv; Jerome, Neil P; Teruel, Jose R; Sjøbakk, Torill E; Østlie, Agnes; Fjøsne, Hans E; Bathen, Tone F; Goa, Pål Erik

    2018-05-01

    Diffusion-weighted MRI (DWI) is currently one of the fastest developing MRI-based techniques in oncology. Histogram properties from model fitting of DWI are useful features for differentiation of lesions, and classification can potentially be improved by machine learning. To evaluate classification of malignant and benign tumors and breast cancer subtypes using support vector machine (SVM). Prospective. Fifty-one patients with benign (n = 23) and malignant (n = 28) breast tumors (26 ER+, whereof six were HER2+). Patients were imaged with DW-MRI (3T) using twice refocused spin-echo echo-planar imaging with echo time / repetition time (TR/TE) = 9000/86 msec, 90 × 90 matrix size, 2 × 2 mm in-plane resolution, 2.5 mm slice thickness, and 13 b-values. Apparent diffusion coefficient (ADC), relative enhanced diffusivity (RED), and the intravoxel incoherent motion (IVIM) parameters diffusivity (D), pseudo-diffusivity (D*), and perfusion fraction (f) were calculated. The histogram properties (median, mean, standard deviation, skewness, kurtosis) were used as features in SVM (10-fold cross-validation) for differentiation of lesions and subtyping. Accuracies of the SVM classifications were calculated to find the combination of features with highest prediction accuracy. Mann-Whitney tests were performed for univariate comparisons. For benign versus malignant tumors, univariate analysis found 11 histogram properties to be significant differentiators. Using SVM, the highest accuracy (0.96) was achieved from a single feature (mean of RED), or from three feature combinations of IVIM or ADC. Combining features from all models gave perfect classification. No single feature predicted HER2 status of ER + tumors (univariate or SVM), although high accuracy (0.90) was achieved with SVM combining several features. Importantly, these features had to include higher-order statistics (kurtosis and skewness), indicating the importance to account for heterogeneity. Our

  14. Bound coherent and incoherent thermal neutron scattering cross sections of the elements

    International Nuclear Information System (INIS)

    Sears, V.F.

    1982-12-01

    An up-to-date table of bound coherent and incoherent thermal neutron scattering cross sections of the elements is presented. Values from two different data sources are calculated and compared. These sources are: (1) the free-atom cross sections listed in the Σbarn bookΣ and (2) the Julich scattering length tables. We also call attention to, and clarify, the confusion that exists in the literature concerning the sign of the imaginary part of the complex scattering length

  15. Coherent versus incoherent resonant emission: an experimental method for easy discrimination and measurement

    Science.gov (United States)

    Ceccherini, S.; Colocci, M.; Gurioli, M.; Bogani, F.

    1998-11-01

    The distinction between the coherent and the incoherent component of the radiation emitted from resonantly excited material systems is difficult experimentally, particularly when ultra-short optical pulses are used for excitation. We propose an experimental procedure allowing an easy measurement of the two components. The method is completely general and applicable to any kind of physical system; its feasibility is demonstrated on the resonant emission from excitons in a semiconductor quantum well.

  16. Dose and dose rate effects on coherent-to-incoherent transition of precipitates upon irradiation

    Institute of Scientific and Technical Information of China (English)

    LI Zhengchao

    2006-01-01

    A typical precipitation hardened alloy, Cu-Co dilute alloy was selected to study the precipitation behavior and irradiation effect on precipitates. It is found that the principal effect of ion irradiation on the coherent precipitates is loss of coherency, and TEM cross-section observations show that the fraction of the incoherent precipitates is dependent on dose but not on dose rate during heavy ion irradiation.

  17. Incoherent Manipulation of the Photoactive Yellow Protein Photocycle with Dispersed Pump-Dump-Probe Spectroscopy

    OpenAIRE

    Larsen, Delmar S.; van Stokkum, Ivo H. M.; Vengris, Mikas; van der Horst, Michael A.; de Weerd, Frank L.; Hellingwerf, Klaas J.; van Grondelle, Rienk

    2004-01-01

    Photoactive yellow protein is the protein responsible for initiating the ``blue-light vision¿¿ of Halorhodospira halophila. The dynamical processes responsible for triggering the photoactive yellow protein photocycle have been disentangled with the use of a novel application of dispersed ultrafast pump-dump-probe spectroscopy, where the photocycle can be started and interrupted with appropriately tuned and timed laser pulses. This ``incoherent¿¿ manipulation of the photocycle allows for the d...

  18. Spatial Mapping of Translational Diffusion Coefficients Using Diffusion Tensor Imaging: A Mathematical Description.

    Science.gov (United States)

    Shetty, Anil N; Chiang, Sharon; Maletic-Savatic, Mirjana; Kasprian, Gregor; Vannucci, Marina; Lee, Wesley

    2014-01-01

    In this article, we discuss the theoretical background for diffusion weighted imaging and diffusion tensor imaging. Molecular diffusion is a random process involving thermal Brownian motion. In biological tissues, the underlying microstructures restrict the diffusion of water molecules, making diffusion directionally dependent. Water diffusion in tissue is mathematically characterized by the diffusion tensor, the elements of which contain information about the magnitude and direction of diffusion and is a function of the coordinate system. Thus, it is possible to generate contrast in tissue based primarily on diffusion effects. Expressing diffusion in terms of the measured diffusion coefficient (eigenvalue) in any one direction can lead to errors. Nowhere is this more evident than in white matter, due to the preferential orientation of myelin fibers. The directional dependency is removed by diagonalization of the diffusion tensor, which then yields a set of three eigenvalues and eigenvectors, representing the magnitude and direction of the three orthogonal axes of the diffusion ellipsoid, respectively. For example, the eigenvalue corresponding to the eigenvector along the long axis of the fiber corresponds qualitatively to diffusion with least restriction. Determination of the principal values of the diffusion tensor and various anisotropic indices provides structural information. We review the use of diffusion measurements using the modified Stejskal-Tanner diffusion equation. The anisotropy is analyzed by decomposing the diffusion tensor based on symmetrical properties describing the geometry of diffusion tensor. We further describe diffusion tensor properties in visualizing fiber tract organization of the human brain.

  19. Coherent and incoherent J /ψ photonuclear production in an energy-dependent hot-spot model

    Science.gov (United States)

    Cepila, J.; Contreras, J. G.; Krelina, M.

    2018-02-01

    In a previous publication, we have presented a model for the photoproduction of J /ψ vector mesons off protons, where the proton structure in the impact-parameter plane is described by an energy-dependent hot-spot profile. Here we extend this model to study the photonuclear production of J /ψ vector mesons in coherent and incoherent interactions of heavy nuclei. We study two methods to extend the model to the nuclear case: using the standard Glauber-Gribov formalism and using geometric scaling to obtain the nuclear saturation scale. We find that the incoherent cross section changes sizably with the inclusion of subnucleonic hot spots and that this change is energy dependent. We propose to search for this behavior by measuring the ratio of the incoherent to coherent cross sections at different energies. We compare the results of our model to results from the Relativistic Heavy-Ion Collider (RHIC) and from run 1 at the Large Hadron Collider (LHC), finding satisfactory agreement. We also present predictions for the LHC at the new energies reached in run 2. The predictions include J /ψ production in ultraperipheral collisions, as well as the recently observed photonuclear production in peripheral collisions.

  20. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  1. Molecular diffusion in monolayer and submonolayer nitrogen

    DEFF Research Database (Denmark)

    Hansen, Flemming Yssing; Bruch, Ludwig Walter

    2001-01-01

    The orientational and translational motions in a monolayer fluid of physisorbed molecular nitrogen are treated using molecular dynamics simulations. Dynamical response functions and several approximations to the coefficient of translational diffusion are determined for adsorption on the basal plane...

  2. Flux motion and dissipation in high-temperature superconductors

    International Nuclear Information System (INIS)

    Gray, K.E.; Kim, D.H.

    1991-08-01

    The effects on flux motion and dissipation of interlayer coupling of the Cu-O planes along the c-axis are considered for the high- temperature superconductors (HTS). It is argued that for the highly-anisotropic HTS, the weak interlayer coupling plays a dominant role that can be described by incoherent Josephson tunneling between superconducting Cu-O bi- or tri-layers. In YBa 2 Cu 3 O 7 , the layers are strongly coupled, presumably because the conducting Cu-O chains short circuit the Josephson tunneling, so that these effects are weak or missing

  3. Continuous diffusion signal, EAP and ODF estimation via Compressive Sensing in diffusion MRI.

    Science.gov (United States)

    Merlet, Sylvain L; Deriche, Rachid

    2013-07-01

    In this paper, we exploit the ability of Compressed Sensing (CS) to recover the whole 3D Diffusion MRI (dMRI) signal from a limited number of samples while efficiently recovering important diffusion features such as the Ensemble Average Propagator (EAP) and the Orientation Distribution Function (ODF). Some attempts to use CS in estimating diffusion signals have been done recently. However, this was mainly an experimental insight of CS capabilities in dMRI and the CS theory has not been fully exploited. In this work, we also propose to study the impact of the sparsity, the incoherence and the RIP property on the reconstruction of diffusion signals. We show that an efficient use of the CS theory enables to drastically reduce the number of measurements commonly used in dMRI acquisitions. Only 20-30 measurements, optimally spread on several b-value shells, are shown to be necessary, which is less than previous attempts to recover the diffusion signal using CS. This opens an attractive perspective to measure the diffusion signals in white matter within a reduced acquisition time and shows that CS holds great promise and opens new and exciting perspectives in diffusion MRI (dMRI). Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Thermal diffuse scattering in transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Forbes, B.D.; D' Alfonso, A.J. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Findlay, S.D. [School of Physics, Monash University, Victoria 3800 (Australia); Van Dyck, D. [EMAT, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); LeBeau, J.M. [North Carolina State University, Raleigh, NC 27695-7907 (United States); Stemmer, S. [Materials Department, University of California, Santa Barbara, CA 93106-5050 (United States); Allen, L.J., E-mail: lja@unimelb.edu.au [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia)

    2011-12-15

    In conventional transmission electron microscopy, thermal scattering significantly affects the image contrast. It has been suggested that not accounting for this correctly is the main cause of the Stobbs factor, the ubiquitous, large contrast mismatch found between theory and experiment. In the case where a hard aperture is applied, we show that previous conclusions drawn from work using bright field scanning transmission electron microscopy and invoking the principle of reciprocity are reliable in the presence of thermal scattering. In the aperture-free case it has been suggested that even the most sophisticated mathematical models for thermal diffuse scattering lack in their numerical implementation, specifically that there may be issues in sampling, including that of the contrast transfer function of the objective lens. We show that these concerns can be satisfactorily overcome with modest computing resources; thermal scattering can be modelled accurately enough for the purpose of making quantitative comparison between simulation and experiment. Spatial incoherence of the source is also investigated. Neglect or inadequate handling of thermal scattering in simulation can have an appreciable effect on the predicted contrast and can be a significant contribution to the Stobbs factor problem. -- Highlights: Black-Right-Pointing-Pointer We determine the numerical requirements for accurate simulation of TDS in CTEM. Black-Right-Pointing-Pointer TDS can be simulated to high precision using the Born-Oppenheimer model. Black-Right-Pointing-Pointer Such calculations establish the contribution of TDS to the Stobbs factor problem. Black-Right-Pointing-Pointer Treating spatial incoherence using envelope functions increases image contrast. Black-Right-Pointing-Pointer Rigorous treatment of spatial incoherence significantly reduces image contrast.

  5. Depolarization of diffusing spins by paramagnetic impurities

    International Nuclear Information System (INIS)

    Schillaci, M.E.; Hutson, R.L.; Heffner, R.H.; Leon, M.; Dodds, S.A.; Estle, T.L.

    1981-01-01

    We study the depolarization of diffusing spins (muons) interacting with dilute paramagnetic impurities in a solid using a simple computational model which properly treats the muon motion and preserves correct muon-impurity distances. Long-range (dipolar) and nearest-neighbor (contact) interactions are treated together. Diffusion parameters are deduced and model comparisons made for AuGd (300 ppm). (orig.)

  6. Diffusion, quantum theory, and radically elementary mathematics (MN-47)

    CERN Document Server

    Faris, William G

    2014-01-01

    Diffusive motion--displacement due to the cumulative effect of irregular fluctuations--has been a fundamental concept in mathematics and physics since Einstein''s work on Brownian motion. It is also relevant to understanding various aspects of quantum theory. This book explains diffusive motion and its relation to both nonrelativistic quantum theory and quantum field theory. It shows how diffusive motion concepts lead to a radical reexamination of the structure of mathematical analysis. The book''s inspiration is Princeton University mathematics professor Edward Nelson''s influential work in

  7. Lower thermospheric neutral densities determined from Soendre Stroemfjord incoherent scatter radar during LTCS 1

    International Nuclear Information System (INIS)

    Reese, K.W.; Johnson, R.M.; Killeen, T.L.

    1991-01-01

    Ion-neutral collision frequencies determined from measurements obtained by the incoherent scatter radar located at Soendre Stroemfjord, Greenland, have been used to derive lower thermospheric neutral densities during the first Lower Thermosphere Coupling Study (LTCS 1), September 21-26, 1987. Periods of Joule and particle heating which might disturb the E region thermal equilibrium were systematically eliminated. The mean profile of neutral density for the period is in good agreement with the mass spectrometer incoherent scatter 1986 (MSIS-86) model between 92 and 104 km. A tendency to overestimate collision frequencies above 105 km may arise from range-smearing effects. The results of a tidal analysis performed on the neutral density between 92 and 109 km show that the amplitudes of the diurnal and semidiurnal components of the tides are approximately equivalent. The observations are generally in better agreement with the MSIS-86 predictions than with the thermosphere-ionosphere general circulation model (TIGCM) simulation of the LTCS 1 interval. The observed phase of the diurnal component is approximately constant with height above 98 km and is in close agreement with the MSIS-86 model phases; however, the TIGCM diurnal phases are shifted by 6-8 hours to later local times. The phase of the semidiurnal tide is in good agreement with predictions of the MSIS-86 model and the TIGCM simulation of this interval, except near 98 km. The observed semidiurnal phase is also consistent with previous high-latitude results (Kirkwood, 1986). The relative amplitude of the observed semidiurnal oscillation is up to 15% larger than that previously observed at the European Incoherent Scatter facility but is consistent with the amplitudes presented in an earlier study of Millstone Hill measurements (Salah, 1974)

  8. A simulation experiment and analysis on the effects of in-coherence in fuel coolant interaction

    International Nuclear Information System (INIS)

    Kondo, S.; Togo, Y.; Iwamura, T.

    1976-01-01

    Experimental and analytical studies were conducted to investigate effects of incoherence (space time behavior of molten fuel) on molten fuel coolant interaction. In experiments, a 2 mm diameter molten tin jet was injected upward into the water in a slender tank. The results were analyzed based on the pressure records and high speed photographs. The pressure records indicated that there were two types of interaction between molten jet and water, intermittent explosion mode and continuous one. The explosion mode appeared when the temperature of molten tin was above 350 0 C or so and that of water was below 70 0 C or so. The high speed photograph indicated that an establishment of a stable jet column was necessary for an explosive interaction and that a bubble like region grew and collapsed at the root of the jet in accordance with the generation of pressure pulse. It was found that the mass of metal which contributed to the vapor explosion was only a small part of the injected metal in the case of jet injection type contact mode and this was the reason why the gross thermal to mechanical energy conversion ratio was around 0.03% in this type of contact mode, though this ratio was around 2% if only the part of record around the pressure pulse was taken into consideration. In the analysis part, a multi-channel FCI model was developed to evaluate the spatial incoherence effect on pressure at subassembly exit. The calculated pressure trace indicated that the spatial incoherence has considerable effects for an evaluation of structure response under FCI pressure loading. (auth.)

  9. Spatially continuous approach to the description of incoherencies in fast reactor accident analysis

    International Nuclear Information System (INIS)

    Luck, L.B.

    1976-12-01

    A generalized cell-type approach is developed in which individual subassemblies are represented as a unit. By appropriate characterization of the results of separate detailed investigations, spatial variations within a cell are represented as a superposition. The advantage of this approach is that costly detailed cell-type information is generated only once or a very few times. Spatial information obtained by the cell treatment is properly condensed in order to drastically reduce the transient computation time. Approximate treatments of transient phenomena are developed based on the use of distributions of volume and reactivity worth with temperature and other reactor parameters. Incoherencies during transient are physically dependent on the detailed variations in the initial state. Therefore, stationary volumetric distributions which contain in condensed form the detailed initial incoherency information provides a proper basis for the transient treatment. Approximate transient volumetric distributions are generated by a suitable transformation of the stationary distribution to reflect the changes in the transient temperature field. Evaluation of transient changes is based on results of conventional uniform channel calculations and a superposition of lateral variations as they are derived from prior cell investigations. Specific formulations are developed for the treatment of reactivity feedback. Doppler and sodium expansion reactivity feedback is related to condensed temperature-worth distributions. Transient evaluation of the worth distribution is based on the relation between stationary and transient volumetric distributions, which contains the condensed temperature field information. Coolant voiding is similarly treated with proper distribution information. Results show that the treatments developed for the transient phase up to and including sodium boiling constitute a fast and effective simulation of inter- and intra-subassembly incoherence effects

  10. Atomic form factors, incoherent scattering functions, and photon scattering cross sections

    International Nuclear Information System (INIS)

    Hubbell, J.H.; Veigele, W.J.; Briggs, E.A.; Brown, R.T.; Cromer, D.T.; Howerton, R.J.

    1975-01-01

    Tabulations are presented of the atomic form factor, F (α,Z), and the incoherent scattering function, S (x,Z), for values of x (=sin theta/2)/lambda) from 0.005 A -1 to 10 9 A -1 , for all elements A=1 to 100. These tables are constructed from available state-of-the-art theoretical data, including the Pirenne formulas for Z=1, configuration-into action results by Brown using Brown-Fontana and Weiss correlated wavefunctions for Z=2 to 6 non-relativistic Hartree-Fock results by Cromer for Z=7 to 100 and a relativistic K-shell analytic expression for F (x,Z) by Bethe Levinger for x>10 A -1 for all elements Z=2 to 100. These tabulated values are graphically compared with available photon scattering angular distribution measurements. Tables of coherent (Rayleigh) and incoherent (Compton) total scattering cross sections obtained by nummerical integration over combinations of F 2 (x,Z) with the Thomson formula and S (x,Z) with the Klum-Nishina Formual, respectively, are presented for all elements Z=1 to 100, for photon energies 100 eV (lambda=124 A) to 100 MeV (0.000124 A). The incoherent scattering cross sections also include the radiative and double-Compton corrections as given by Mork. Similar tables are presented for the special cases of terminally-bonded hydrogen and for the H 2 molecule, interpolated and extrapolated from values calculated by Stewart et al., and by Bentley and Stewart using Kolos-Roothaan wavefunctions

  11. Parametric instabilities of parallel propagating incoherent Alfven waves in a finite ion beta plasma

    International Nuclear Information System (INIS)

    Nariyuki, Y.; Hada, T.; Tsubouchi, K.

    2007-01-01

    Large amplitude, low-frequency Alfven waves constitute one of the most essential elements of magnetohydrodynamic (MHD) turbulence in the fast solar wind. Due to small collisionless dissipation rates, the waves can propagate long distances and efficiently convey such macroscopic quantities as momentum, energy, and helicity. Since loading of such quantities is completed when the waves damp away, it is important to examine how the waves can dissipate in the solar wind. Among various possible dissipation processes of the Alfven waves, parametric instabilities have been believed to be important. In this paper, we numerically discuss the parametric instabilities of coherent/incoherent Alfven waves in a finite ion beta plasma using a one-dimensional hybrid (superparticle ions plus an electron massless fluid) simulation, in order to explain local production of sunward propagating Alfven waves, as suggested by Helios/Ulysses observation results. Parameter studies clarify the dependence of parametric instabilities of coherent/incoherent Alfven waves on the ion and electron beta ratio. Parametric instabilities of coherent Alfven waves in a finite ion beta plasma are vastly different from those in the cold ions (i.e., MHD and/or Hall-MHD systems), even if the collisionless damping of the Alfven waves are neglected. Further, ''nonlinearly driven'' modulational instability is important for the dissipation of incoherent Alfven waves in a finite ion beta plasma regardless of their polarization, since the ion kinetic effects let both the right-hand and left-hand polarized waves become unstable to the modulational instability. The present results suggest that, although the antisunward propagating dispersive Alfven waves are efficiently dissipated through the parametric instabilities in a finite ion beta plasma, these instabilities hardly produce the sunward propagating waves

  12. Conservative diffusions

    International Nuclear Information System (INIS)

    Carlen, E.A.

    1984-01-01

    In Nelson's stochastic mechanics, quantum phenomena are described in terms of diffusions instead of wave functions. These diffusions are formally given by stochastic differential equations with extremely singular coefficients. Using PDE methods, we prove the existence of solutions. This reult provides a rigorous basis for stochastic mechanics. (orig.)

  13. Anomalous diffusion of fermions in superlattices

    International Nuclear Information System (INIS)

    Drozdz, S.; Okolowicz, J.; Srokowski, T.; Ploszajczak, M.

    1996-03-01

    Diffusion of fermions in the periodic two-dimensional lattice of fermions is studied. It is shown that effects connected with antisymmetrization of the wave function increase chaoticness of motion. Various types of anomalous diffusion, characterized by a power spectral analysis are found. The nonlocality of the Pauli potential destroys cantori in the phase space. Consequently, the diffusion process is dominated by long free paths and the power spectrum is logarithmic at small frequency limit. (author)

  14. Misplaced Idealism and Incoherent Realism in the Philosophy of the Refugee Crisis

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2016-01-01

    Many contributions to the philosophical debate about conceptual and normative issues raised by the refugee crisis fail to take properly account of the difference between ideal and nonideal theory. This makes several otherwise interesting and apparently plausible contributions to the philosophy...... of arguments about how we should understand or respond to the refugee crisis, which appear to offer coherent principles for the moral guidance of political actors but which are actually incoherent as principles of practical reasoning for the context they aim to address....

  15. From Coherently Excited Highly Correlated States to Incoherent Relaxation Processes in Semiconductors

    International Nuclear Information System (INIS)

    Scha''fer, W.; Lo''venich, R.; Fromer, N. A.; Chemla, D. S.

    2001-01-01

    Recent theories of highly excited semiconductors are based on two formalisms, referring to complementary experimental conditions, the real-time nonequilibrium Green's function techniques and the coherently controlled truncation of the many-particle problem. We present a novel many-particle theory containing both of these methods as limiting cases. As a first example of its application, we investigate four-particle correlations in a strong magnetic field including dephasing resulting from the growth of incoherent one-particle distribution functions. Our results are the first rigorous solution concerning formation and decay of four-particle correlations in semiconductors. They are in excellent agreement with experimental data

  16. Anomalous vibrational modes in acetanilide: A F.D.S. incoherent inelastic neutron scattering study

    International Nuclear Information System (INIS)

    Barthes, M.; Moret, J.; Eckert, J.; Johnson, S.W.; Swanson, B.I.; Unkefer, C.J.

    1991-01-01

    The origin of the anomalous infra-red and Raman modes in acetanilide (C 6 H 5 NHCOCH 3 , or ACN), remains a subject of considerable controversy. One family of theoretical models involves Davydov-like solitons nonlinear vibrational coupling, or ''polaronic'' localized modes. An alternative interpretation of the extra-bands in terms of a Fermi resonance was proposed and recently the existence of slightly non-degenerate hydrogen atom configurations in the H-bond was suggested as an explanation for the anomalies. In this paper we report some new results on the anomalous vibrational modes in ACN that were obtained by inelastic incoherent neutron scattering (INS)

  17. Coexistence of synchrony and incoherence in oscillatory media under nonlinear global coupling

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Lennart; García-Morales, Vladimir [Physik-Department, Nonequilibrium Chemical Physics, Technische Universität München, James-Franck-Str. 1, D-85748 Garching (Germany); Institute for Advanced Study, Technische Universität München, Lichtenbergstr. 2a, D-85748 Garching (Germany); Schönleber, Konrad; Krischer, Katharina, E-mail: krischer@tum.de [Physik-Department, Nonequilibrium Chemical Physics, Technische Universität München, James-Franck-Str. 1, D-85748 Garching (Germany)

    2014-03-15

    We report a novel mechanism for the formation of chimera states, a peculiar spatiotemporal pattern with coexisting synchronized and incoherent domains found in ensembles of identical oscillators. Considering Stuart-Landau oscillators, we demonstrate that a nonlinear global coupling can induce this symmetry breaking. We find chimera states also in a spatially extended system, a modified complex Ginzburg-Landau equation. This theoretical prediction is validated with an oscillatory electrochemical system, the electro-oxidation of silicon, where the spontaneous formation of chimeras is observed without any external feedback control.

  18. Microscopic theory of coherent and incoherent optical properties of semiconductor heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, Martin

    2008-09-02

    An important question is whether there is a regime in which lasing from indirect semiconductors is possible. Thus, we discuss this question in this thesis. It is shown that under incoherent emission conditions it is possible to create an exciton condensate in multiple-quantum-well (MQW) systems. The influence of a MQW structure on the exciton lifetime is investigated. For the description of the light-matter interaction of a QW in the coherent excitation regime, the semiconductor Bloch equation (SBE) are used. The incoherent regime is described by the semiconductor luminescence equations (SLE). In principle it is even possible to couple SBE and SLE. The resulting theory is able to describe interactions between coherent and incoherent processes we investigate both, the coherent and the incoherent light-emission regime. Thus we define the investigated system and introduce the many-body Hamiltonian that describes consistently the light-matter interaction in the classical and the quantum limit. We introduce the SBE that allow to compute the light-matter interaction in the coherent scenario. The extended scattering model is used to investigate the absorption of a Ge QW for different time delays after the excitations. In this context, we analyze whether there is a regime in which optical gain can be realized. Then we apply a transfer-matrix method to include into our calculations the influence of the dielectric environment on the optical response. Thereafter the SLE for a MQW system are introduced. We derive a scheme that allows for decoupling environmental effects from the pure PL-emission properties of the QW. The PL of the actual QW system is obtained by multiplying this filter function and the free-space PL that describes the quantum emission into a medium with spatially constant background-refractive index. It is studied how the MQW-Bragg structure influences the PL-emission properties compared to the emission of a single QW device. As a last feature, it is shown

  19. All-fiber 7x1 signal combiner for incoherent laser beam combining

    DEFF Research Database (Denmark)

    Noordegraaf, Danny; Maack, Martin D.; Skovgaard, Peter M. W.

    2011-01-01

    We demonstrate an all-fiber 7x1 signal combiner for incoherent laser beam combining. This is a potential key component for reaching several kW of stabile laser output power. The combiner couples the output from 7 single-mode (SM) fiber lasers into a single multi-mode (MM) fiber. The input signal ...... in device temperature is observed. At an intermediate power level of 600 W a beam parameter product (BPP) of 2.22 mm x mrad is measured, corresponding to an M2 value of 6.5. These values are approaching the theoretical limit dictated by brightness conservation....

  20. Physical model for the incoherent writing/erasure of cavity solitons in semiconductor optical amplifiers.

    Science.gov (United States)

    Barbay, S; Kuszelewicz, R

    2007-09-17

    We present a physical mechanism that explains the recent observations of incoherent writing and erasure of Cavity Solitons in a semiconductor optical amplifier [S. Barbay et al, Opt. Lett. 31, 1504-1506 (2006)]. This mechanism allows to understand the main observations of the experiment. In particular it perfectly explains why writing and erasure are possible as a result of a local perturbation in the carrier density, and why a delay is observed along with the writing process. Numerical simulations in 1D are performed and show very good qualitative agreement with the experimental observations.

  1. Separation of coherent and incoherent scattering in liquid para-H{sub 2} by polarisation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Hernandez, M; Mompean, F J [Madrid Univ. (Spain); Schaerpf, O; Andersen, K H [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); Fak, B [CEA Centre d` Etudes de Grenoble, 38 (France)

    1997-04-01

    In the 1960 IAEA Symposium on Neutron Scattering, Sarma presented his theoretical study on the scattering of cold neutrons by liquid hydrogen and demonstrated how the intimate coupling between nuclear and rotational degrees of freedom finally results in the possibility of observing collective modes from this material, which to many neutron scatterers is synonymous with `incoherent`. This problem is investigated with polarised neutrons to gain access to a limited region of the (Q,E) space where the collective response from this liquid is found. (author).

  2. Q2 Dependence of Nuclear Transparency for Incoherent ρ0 Electroproduction

    International Nuclear Information System (INIS)

    John Arrington; Frank Dohrmann; Ahmed El Alaoui; Don Geesaman; Kawtar Hafidi; Roy Holt; Harold Jackson; David Potterveld; Brahim Mustapha; Paul Reimer; Elaine Schulte; Krishni Wijesooriya; Maurik Holtrop; Jacques Ball; Michel Garcon; Jean Laget; Franck Sabatie; Michel Guidal; Latifa Elouadrhiri; Borissov, A.; Wolfgang Lorenzon; Stepan Stepanyan; Lawrence Weinstein

    2002-01-01

    Measurements of exclusive incoherent electroproduction of ρ 0 (770) meson from 2 D, 12 C, and 63 Cu targets up to Q 2 = 4 GeV 2 are proposed using the CLAS detector. The objective of these measurements is to determine the Q 2 dependence of the nuclear transparency ratio for the two nuclear targets: 12 C and 63 Cu at fixed coherence length of quark-antiquark fluctuations of the virtual photon. A sizeable rise of the nuclear transparency is predicted and can be measured in this experiment. A relatively large increase of the nuclear transparency can be considered as a signature of the onset of color transparency

  3. Analysis of the Spectral Efficiency of Frequency-Encoded OCDMA Systems With Incoherent Sources

    Science.gov (United States)

    Rochette, Martin; Ayotte, Simon; Rusch, Leslie A.

    2005-04-01

    This paper presents the spectral efficiency of frequency-encoded (FE) optical code-division multiple-access (OCDMA) systems with incoherent sources. The spectral efficiency of five code families compatible with FE-OCDMA is calculated as a function of the number of users. Analytical equations valid in the limiting case of Gaussian noise are also developed for the bit-error rate and the spectral efficiency. Among the code families considered, the modified quadratic congruence code leads to the maximum achievable spectral efficiency.

  4. Dynamics and Structural Details of Amorphous Phases of Ice Determined by Incoherent Inelastic Neutron Scattering

    International Nuclear Information System (INIS)

    Klug, D.D.; Tulk, C.A.; Svensson, E.C.; Loong, C.

    1999-01-01

    Incoherent-inelastic neutron scattering data are obtained over the energy range of lattice and internal vibrations of water molecules in phases of ice prepared by pressure-induced amorphization (high-density amorphous ice, hda), by thermal annealing of hda (low-density amorphous ice, lda), and by rapidly cooling water, as well as in ice Ih and Ic . Hydrogen bonding interactions in lda differ significantly from those in the glass obtained by rapid quenching, which has hydrogen-bond interactions characteristic of highly supercooled water. Hydrogen-bond interactions in hda are weaker than in the low-density phases. copyright 1999 The American Physical Society

  5. High-order UWB pulses scheme to generate multilevel modulation formats based on incoherent optical sources.

    Science.gov (United States)

    Bolea, Mario; Mora, José; Ortega, Beatriz; Capmany, José

    2013-11-18

    We present a high-order UWB pulses generator based on a microwave photonic filter which provides a set of positive and negative samples by using the slicing of an incoherent optical source and the phase inversion in a Mach-Zehnder modulator. The simple scalability and high reconfigurability of the system permit a better accomplishment of the FCC requirements. Moreover, the proposed scheme permits an easy adaptation to pulse amplitude modulation, bi phase modulation, pulse shape modulation and pulse position modulation. The flexibility of the scheme for being adaptable to multilevel modulation formats permits to increase the transmission bit rate by using hybrid modulation formats.

  6. Coherent versus incoherent dynamics in InAs quantum-dot active wave guides

    DEFF Research Database (Denmark)

    Borri, Paola; Langbein, W.; Hvam, Jørn Märcher

    2001-01-01

    Coherent dynamics measured by time-resolved four-wave mixing is compared to incoherent population dynamics measured by differential transmission spectroscopy on the ground-state transition at room temperature of two types of InAs-based quantum dots with different confinement energies. The measure....... The measurements are performed with heterodyne detection on quantum-dot active wave guides to enhance the light-matter interaction length. An elastic nature of the measured dephasing is revealed which is independent of the dot energy level scheme....

  7. Observation of Coherent and Incoherent Dissociation Mechanisms in the Angular Distribution of Atomic Photofragment Alignment

    International Nuclear Information System (INIS)

    Bracker, A.S.; Lee, Y.T.; Bracker, A.S.; Wouters, E.R.; Suits, A.G.; Lee, Y.T.; Lee, Y.T.; Vasyutinskii, O.S.

    1998-01-01

    We have analyzed the recoil angle dependence of chlorine atom angular momentum alignment for the dissociation of chlorine molecules at 355nm. This angular distribution was isolated from ion image measurements, which map a three-dimensional velocity vector distribution of state-selectively-ionized photofragments into a two-dimensional spatial distribution. Using a general quantum mechanical method to simulate the alignment angular distribution, we show that there are clear contributions to alignment from both incoherent and coherent components of a perpendicular optical transition in the molecule. copyright 1998 The American Physical Society

  8. Three-Dimensional Imaging by Self-Reference Single-Channel Digital Incoherent Holography

    Science.gov (United States)

    Rosen, Joseph; Kelner, Roy

    2016-01-01

    Digital holography offers a reliable and fast method to image a three-dimensional scene from a single perspective. This article reviews recent developments of self-reference single-channel incoherent hologram recorders. Hologram recorders in which both interfering beams, commonly referred to as the signal and the reference beams, originate from the same observed objects are considered as self-reference systems. Moreover, the hologram recorders reviewed herein are configured in a setup of a single channel interferometer. This unique configuration is achieved through the use of one or more spatial light modulators. PMID:28757811

  9. Three-dimensional mapping of fluorescent nanoparticles using incoherent digital holography.

    Science.gov (United States)

    Yanagawa, Takumi; Abe, Ryosuke; Hayasaki, Yoshio

    2015-07-15

    Three-dimensional mapping of fluorescent nanoparticles was performed by using incoherent digital holography. The positions of the nanoparticles were quantitatively determined by using Gaussian fitting of the axial- and lateral-diffraction distributions through position calibration from the observation space to the sample space. It was found that the axial magnification was constant whereas the lateral magnification linearly depended on the axial position of the fluorescent nanoparticles. The mapping of multiple fluorescent nanoparticles fixed in gelatin and a single fluorescent nanoparticle manipulated with optical tweezers in water were demonstrated.

  10. Brownian Motion of Boomerang Colloidal Particles

    Science.gov (United States)

    Wei, Qi-Huo; Konya, Andrew; Wang, Feng; Selinger, Jonathan V.; Sun, Kai; Chakrabarty, Ayan

    2014-03-01

    We present experimental and theoretical studies on the Brownian motion of boomerang colloidal particles confined between two glass plates. Our experimental observations show that the mean displacements are biased towards the center of hydrodynamic stress (CoH), and that the mean-square displacements exhibit a crossover from short-time faster to long-time slower diffusion with the short-time diffusion coefficients dependent on the points used for tracking. A model based on Langevin theory elucidates that these behaviors are ascribed to the superposition of two diffusive modes: the ellipsoidal motion of the CoH and the rotational motion of the tracking point with respect to the CoH.

  11. Diffusion in ceramics

    CERN Document Server

    Pelleg, Joshua

    2016-01-01

    This textbook provides an introduction to changes that occur in solids such as ceramics, mainly at high temperatures, which are diffusion controlled, as well as presenting research data. Such changes are related to the kinetics of various reactions such as precipitation, oxidation and phase transformations, but are also related to some mechanical changes, such as creep. The book is composed of two parts, beginning with a look at the basics of diffusion according to Fick's Laws. Solutions of Fick’s second law for constant D, diffusion in grain boundaries and dislocations are presented along with a look at the atomistic approach for the random motion of atoms. In the second part, the author discusses diffusion in several technologically important ceramics. The ceramics selected are monolithic single phase ones, including: A12O3, SiC, MgO, ZrO2 and Si3N4. Of these, three refer to oxide ceramics (alumina, magnesia and zirconia). Carbide based ceramics are represented by the technologically very important Si-ca...

  12. Quasi-elastic neutron scattering studies of the diffusion of hydrogen in metals

    Energy Technology Data Exchange (ETDEWEB)

    Ross, D K [Birmingham Univ. (UK). School of Physics and Space Research

    1989-01-01

    Quasi-elastic neutron scattering provides a uniquely detailed way of investigating microscopic models for diffusion in lattice gases. In the present paper we discuss extensions of the original Chudley-Elliott model to cover systems containing high concentrations of interacting particles for both the incoherent and coherent cases. In the former case, the peak width is changed by site blocking and by interactions and its shape is altered by correlation effects between successive jumps. In the coherent case, although interactions introduce different correlation effects, the most important changes are due to the short-range order caused by the interactions. A simple Mean Field theory is described which predicts peak narrowing where the diffuse scattering is at a maximum. Experimental tests of both coherent and incoherent theories are described for the case of {alpha}'NbD{sub x}. (orig.).

  13. Quasi-elastic neutron scattering studies of the diffusion of hydrogen in metals

    International Nuclear Information System (INIS)

    Ross, D.K.

    1989-01-01

    Quasi-elastic neutron scattering provides a uniquely detailed way of investigating microscopic models for diffusion in lattice gases. In the present paper we discuss extensions of the original Chudley-Elliott model to cover systems containing high concentrations of interacting particles for both the incoherent and coherent cases. In the former case, the peak width is changed by site blocking and by interactions and its shape is altered by correlation effects between successive jumps. In the coherent case, although interactions introduce different correlation effects, the most important changes are due to the short-range order caused by the interactions. A simple Mean Field theory is described which predicts peak narrowing where the diffuse scattering is at a maximum. Experimental tests of both coherent and incoherent theories are described for the case of α'NbD x . (orig.)

  14. Ion motion and conductivity in rubidium and cesium hexafluorotitanates

    International Nuclear Information System (INIS)

    Moskvich, Yu.N.; Cherkasov, B.I.; Sukhovskij, A.A.; Davidovich, R.L.; AN SSSR, Vladivostok. Inst. Khimii)

    1988-01-01

    Relaxation times for 19 F nuclei and electric conductivity in Rb 2 TiF 6 and Cs 2 TiF 6 polycrystals are measured. The parameters of reoriented anion motion and diffusion cation motion are determined according to the NMR data. The effect of phase transition to the cubic phase on the parameters of these motions are studied. High conductivity reaching values σ∼10 -2 -10 -3 Ohm -1 xm -1 is detected at high temperatures. The electric conductivity observed is shown to be caused by the diffusion motion of Rb + and Cs + cations

  15. A variational treatment of material configurations with application to interface motion and microstructural evolution

    Science.gov (United States)

    Teichert, Gregory H.; Rudraraju, Shiva; Garikipati, Krishna

    2017-02-01

    We present a unified variational treatment of evolving configurations in crystalline solids with microstructure. The crux of our treatment lies in the introduction of a vector configurational field. This field lies in the material, or configurational, manifold, in contrast with the traditional displacement field, which we regard as lying in the spatial manifold. We identify two distinct cases which describe (a) problems in which the configurational field's evolution is localized to a mathematically sharp interface, and (b) those in which the configurational field's evolution can extend throughout the volume. The first case is suitable for describing incoherent phase interfaces in polycrystalline solids, and the latter is useful for describing smooth changes in crystal structure and naturally incorporates coherent (diffuse) phase interfaces. These descriptions also lead to parameterizations of the free energies for the two cases, from which variational treatments can be developed and equilibrium conditions obtained. For sharp interfaces that are out-of-equilibrium, the second law of thermodynamics furnishes restrictions on the kinetic law for the interface velocity. The class of problems in which the material undergoes configurational changes between distinct, stable crystal structures are characterized by free energy density functions that are non-convex with respect to configurational strain. For physically meaningful solutions and mathematical well-posedness, it becomes necessary to incorporate interfacial energy. This we have done by introducing a configurational strain gradient dependence in the free energy density function following ideas laid out by Toupin (1962, Elastic materials with couple-stresses. Arch. Ration. Mech. Anal., 11, 385-414). The variational treatment leads to a system of partial differential equations governing the configuration that is coupled with the traditional equations of nonlinear elasticity. The coupled system of equations governs

  16. Continuum random-phase approximation study of the incoherent μ--e- conversion rate and its spurious 1- admixture

    International Nuclear Information System (INIS)

    Papakonstantinou, P.; Wambach, J.; Kosmas, T.S.; Faessler, A.

    2006-01-01

    The incoherent transition strength of the exotic μ - -e - conversion in the 208 Pb nucleus is investigated by utilizing the continuum random-phase-approximation method, appropriate for the evaluation of the rate that goes to the continuum of the nuclear spectrum. We find that the contribution of resonances lying high in the continuum is not negligible. Special attention is paid to the detailed study of the pronounced 1 - contribution that according to previous calculations, dominates the overall incoherent rate in about all the nuclear targets. The spurious center-of-mass admixture to the partial rate originating from the 1 - excitations is explored, and its elimination is performed by correcting properly the dipole operators. The results found this way show that the greatest portion of the total 1 - contribution to the incoherent rate is spurious

  17. Quantum imaging with incoherently scattered light from a free-electron laser

    Science.gov (United States)

    Schneider, Raimund; Mehringer, Thomas; Mercurio, Giuseppe; Wenthaus, Lukas; Classen, Anton; Brenner, Günter; Gorobtsov, Oleg; Benz, Adrian; Bhatti, Daniel; Bocklage, Lars; Fischer, Birgit; Lazarev, Sergey; Obukhov, Yuri; Schlage, Kai; Skopintsev, Petr; Wagner, Jochen; Waldmann, Felix; Willing, Svenja; Zaluzhnyy, Ivan; Wurth, Wilfried; Vartanyants, Ivan A.; Röhlsberger, Ralf; von Zanthier, Joachim

    2018-02-01

    The advent of accelerator-driven free-electron lasers (FEL) has opened new avenues for high-resolution structure determination via diffraction methods that go far beyond conventional X-ray crystallography methods. These techniques rely on coherent scattering processes that require the maintenance of first-order coherence of the radiation field throughout the imaging procedure. Here we show that higher-order degrees of coherence, displayed in the intensity correlations of incoherently scattered X-rays from an FEL, can be used to image two-dimensional objects with a spatial resolution close to or even below the Abbe limit. This constitutes a new approach towards structure determination based on incoherent processes, including fluorescence emission or wavefront distortions, generally considered detrimental for imaging applications. Our method is an extension of the landmark intensity correlation measurements of Hanbury Brown and Twiss to higher than second order, paving the way towards determination of structure and dynamics of matter in regimes where coherent imaging methods have intrinsic limitations.

  18. ARTIFICIAL INCOHERENT SPECKLES ENABLE PRECISION ASTROMETRY AND PHOTOMETRY IN HIGH-CONTRAST IMAGING

    Energy Technology Data Exchange (ETDEWEB)

    Jovanovic, N.; Guyon, O.; Pathak, P.; Kudo, T. [National Astronomical Observatory of Japan, Subaru Telescope, 650 North A’Ohoku Place, Hilo, HI, 96720 (United States); Martinache, F. [Observatoire de la Cote d’Azur, Boulevard de l’Observatoire, F-06304 Nice (France); Hagelberg, J., E-mail: jovanovic.nem@gmail.com [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)

    2015-11-10

    State-of-the-art coronagraphs employed on extreme adaptive optics enabled instruments are constantly improving the contrast detection limit for companions at ever-closer separations from the host star. In order to constrain their properties and, ultimately, compositions, it is important to precisely determine orbital parameters and contrasts with respect to the stars they orbit. This can be difficult in the post-coronagraphic image plane, as by definition the central star has been occulted by the coronagraph. We demonstrate the flexibility of utilizing the deformable mirror in the adaptive optics system of the Subaru Coronagraphic Extreme Adaptive Optics system to generate a field of speckles for the purposes of calibration. Speckles can be placed up to 22.5 λ/D from the star, with any position angle, brightness, and abundance required. Most importantly, we show that a fast modulation of the added speckle phase, between 0 and π, during a long science integration renders these speckles effectively incoherent with the underlying halo. We quantitatively show for the first time that this incoherence, in turn, increases the robustness and stability of the adaptive speckles, which will improve the precision of astrometric and photometric calibration procedures. This technique will be valuable for high-contrast imaging observations with imagers and integral field spectrographs alike.

  19. Ground clutter cancellation in incoherent radars: solutions for EISCAT Svalbard radar

    Directory of Open Access Journals (Sweden)

    T. Turunen

    2000-09-01

    Full Text Available Incoherent scatter radars measure ionosphere parameters using modified Thomson scatter from free electrons in the target (see e.g. Hagfors, 1997. The integrated cross section of the ionospheric scatterers is extremely small and the measurements can easily be disturbed by signals returned by unwanted targets. Ground clutter signals, entering via the antenna side lobes, can render measurements at the nearest target ranges totally impossible. The EISCAT Svalbard Radar (ESR, which started measurements in 1996, suffers from severe ground clutter and the ionosphere cannot be measured in any simple manner at ranges less than about 120–150 km, depending on the modulation employed. If the target and clutter signals have different, and clearly identifiable, properties then, in principle, there are always ways to eliminate the clutter. In incoherent scatter measurements, differences in the coherence times of the wanted and unwanted signals can be used for clutter cancellation. The clutter cancellation must be applied to all modulations, usually alternating codes in modern experiments, used for shorter ranges. Excellent results have been obtained at the ESR using a simple pulse-to-pulse clutter subtraction method, but there are also other possibilities.Key words: Radio science (ionospheric physics; signal processing; instruments and techniques

  20. Direct, coherent and incoherent intermediate state tunneling and scanning tunnel microscopy (STM)

    International Nuclear Information System (INIS)

    Halbritter, J.

    1997-01-01

    Theory and experiment in tunneling are still qualitative in nature, which hold true also for the latest developments in direct-, resonant-, coherent- and incoherent-tunneling. Those tunnel processes have recently branched out of the field of ''solid state tunnel junctions'' into the fields of scanning tunnel microscopy (STM), single electron tunneling (SET) and semiconducting resonant tunnel structures (RTS). All these fields have promoted the understanding of tunneling in different ways reaching from the effect of coherence, of incoherence and of charging in tunneling, to spin flip or inelastic effects. STM allows not only the accurate measurements of the tunnel current and its voltage dependence but, more importantly, the easy quantification via the (quantum) tunnel channel conductance and the distance dependence. This new degree of freedom entering exponentially the tunnel current allows an unique identification of individual tunnel channels and their quantification. In STM measurements large tunnel currents are observed for large distances d > 1 nm explainable by intermediate state tunneling. Direct tunneling with its reduced tunnel time and reduced off-site Coulomb charging bridges distances below 1 nm, only. The effective charge transfer process with its larger off-site and on-site charging at intermediate states dominates tunnel transfer in STM, biology and chemistry over distances in the nm-range. Intermediates state tunneling becomes variable range hopping conduction for distances larger than d > 2 nm, for larger densities of intermediate states n 1 (ε) and for larger temperatures T or voltages U, still allowing high resolution imaging

  1. First E- and D-region incoherent scatter spectra observed over Jicamarca

    Directory of Open Access Journals (Sweden)

    J. L. Chau

    2006-07-01

    Full Text Available We present here the first Jicamarca observations of incoherent scatter radar (ISR spectra detected from E- and D-region altitudes. In the past such observations have not been possible at Jicamarca due a combined effect of strong equatorial electrojet (EEJ clutter and hardware limitations in the receiving system. The observations presented here were made during weak EEJ conditions (i.e., almost zero zonal electric field using an improved digital receiving system with a wide dynamic range and a high data throughput. The observed ISR spectra from E- and D-region altitudes are, as expected, narrow and get even narrower with decreasing altitude due to increasing ion-neutral collision frequencies. Therefore, it was possible to obtain accurate spectral measurements using a pulse-to-pulse data analysis. At lower altitudes in the D-region where signal correlation times are relatively long we used coherent integration to improve the signal-to-noise ratio of the collected data samples. The spectral estimates were fitted using a standard incoherent scatter (IS spectral model between 87 and 120 km, and a Lorentzian function below 110 km. Our preliminary estimates of temperature and ion-neutral collisions frequencies above 87 km are in good agreement with the MSISE-90 model. Below 87 km, the measured spectral widths are larger than expected, causing an overestimation of the temperatures, most likely due to spectral distortions caused by atmospheric turbulence.

  2. Loss of incoherence and determination of coupling constants in quantum gravity

    International Nuclear Information System (INIS)

    Giddings, S.B.; Strominger, A.

    1988-01-01

    The wave function of an interacting 'family' of one large 'parent' and many Planck-sized 'baby' universes is computed in a semiclassical approximation using an adaptation of Hartle-Hawking initial conditions. A recently discovered gravitational instanton which exists for general relativity coupled to axions is employed. The outcome of a single experiment in the parent universe is in general described by a mixed state, even if the initial state is pure. However, a sequence of measurements rapidly collapses the wave function of the family of universes into one of an infinite number of 'coherent' states for which quantum incoherence is not observed in the parent universe. This provides a concrete illustration of an unexpected phenomena whose existence has been argued for on quite general grounds by Coleman: Quantum incoherence due to information loss to baby universes is not experimentally observable. We further argue that all coupling constants governing dynamics in the parent universe depend on the parameters describing the particular coherent state into which the family wave function collapses. In particular, generically terms that violate any global symmetries will be induced in the effective action for the parent universe. These last results have much broader applicability than our specific model. (orig.)

  3. Tunable and broadband microwave frequency combs based on a semiconductor laser with incoherent optical feedback

    International Nuclear Information System (INIS)

    Zhao Mao-Rong; Wu Zheng-Mao; Deng Tao; Zhou Zhen-Li; Xia Guang-Qiong

    2015-01-01

    Based on a semiconductor laser (SL) with incoherent optical feedback, a novel all-optical scheme for generating tunable and broadband microwave frequency combs (MFCs) is proposed and investigated numerically. The results show that, under suitable operation parameters, the SL with incoherent optical feedback can be driven to operate at a regular pulsing state, and the generated MFCs have bandwidths broader than 40 GHz within a 10 dB amplitude variation. For a fixed bias current, the line spacing (or repetition frequency) of the MFCs can be easily tuned by varying the feedback delay time and the feedback strength, and the tuning range of the line spacing increases with the increase in the bias current. The linewidth of the MFCs is sensitive to the variation of the feedback delay time and the feedback strength, and a linewidth of tens of KHz can be achieved through finely adjusting the feedback delay time and the feedback strength. In addition, mappings of amplitude variation, repetition frequency, and linewidth of MFCs in the parameter space of the feedback delay time and the feedback strength are presented. (paper)

  4. Auditory Motion Elicits a Visual Motion Aftereffect

    Directory of Open Access Journals (Sweden)

    Christopher C. Berger

    2016-12-01

    Full Text Available The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect—an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

  5. Auditory Motion Elicits a Visual Motion Aftereffect.

    Science.gov (United States)

    Berger, Christopher C; Ehrsson, H Henrik

    2016-01-01

    The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect-an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

  6. Auditory motion capturing ambiguous visual motion

    Directory of Open Access Journals (Sweden)

    Arjen eAlink

    2012-01-01

    Full Text Available In this study, it is demonstrated that moving sounds have an effect on the direction in which one sees visual stimuli move. During the main experiment sounds were presented consecutively at four speaker locations inducing left- or rightwards auditory apparent motion. On the path of auditory apparent motion, visual apparent motion stimuli were presented with a high degree of directional ambiguity. The main outcome of this experiment is that our participants perceived visual apparent motion stimuli that were ambiguous (equally likely to be perceived as moving left- or rightwards more often as moving in the same direction than in the opposite direction of auditory apparent motion. During the control experiment we replicated this finding and found no effect of sound motion direction on eye movements. This indicates that auditory motion can capture our visual motion percept when visual motion direction is insufficiently determinate without affecting eye movements.

  7. Time-averaged MSD of Brownian motion

    OpenAIRE

    Andreanov, Alexei; Grebenkov, Denis

    2012-01-01

    We study the statistical properties of the time-averaged mean-square displacements (TAMSD). This is a standard non-local quadratic functional for inferring the diffusion coefficient from an individual random trajectory of a diffusing tracer in single-particle tracking experiments. For Brownian motion, we derive an exact formula for the Laplace transform of the probability density of the TAMSD by mapping the original problem onto chains of coupled harmonic oscillators. From this formula, we de...

  8. Translational and rotational motions of proteins in a protein crowded environment

    NARCIS (Netherlands)

    Zorilla, S.; Hink, M.A.; Visser, A.J.W.G.; Lillo, M.P.

    2007-01-01

    Fluorescence correlation spectroscopy (FCS) was used to measure the translational diffusion of labeled apomyoglobin (tracer) in concentrated solutions of ribonuclease A and human serum albumin (crowders), as a quantitative model system of protein diffusive motions in crowded physiological

  9. Interaction between a dark spot and a two-dimensional nonlinear photonic lattice with fully incoherent white light

    International Nuclear Information System (INIS)

    Liu, Zhaohong; Liu, Simin; Guo, Ru; Song, Tao; Zhu, Nan

    2007-01-01

    We study experimentally the interaction of a dark spot with a nonlinear photonic lattice with fully incoherent white light emitted from an incandescent bulb in the self-defocussing photovoltaic media when the dark spot is aimed at different positions of lattices with different lattice spacing. In this case a host of novel phenomena is demonstrated, including dark spot induced lattice dislocation-deformation, the annihilation of the dark spot and so on. Results demonstrate that the interaction between incoherent dark spot and photonic lattice is always attraction and the large-spacing photonic lattice is analogous to the continuous medium

  10. All-fiber incoherent frequency-to-time mapping method for microwave signal generation with baseband transmission and multicasting support

    DEFF Research Database (Denmark)

    Company Torres, Victor; Tafur Monroy, Idelfonso; Lancis, Jesus

    2008-01-01

    We present a proof-of-principle experiment for achieving simultaneous distribution of baseband radio-frequency data and up-conversion with broadcasting support over a passive optical network. The technique is based on an incoherent frequency-to-time mapping method for pulse shaping. Specifically...... resembles the shape of the incoherent source. The photodetected signal contains both the baseband data and an up-frequency converted copy with central wavelength for the microwave carrier into the ultra-wideband range and tuning capability by selection of the fiber length. (c) 2008 Elsevier B.V. All rights...

  11. Measurement of differential incoherent scattering cross-sections of 145 keV photons from K-shell electrons

    Energy Technology Data Exchange (ETDEWEB)

    Acharya, V B; Ghumman, B S [Punjabi Univ., Patiala (India). Dept. of Physics

    1980-06-01

    Differential cross-sections for incoherent scattering of 145 keV photons from K-shell electrons of tin, silver and molybdenum have been measured at 110deg to investigate the effect of electron binding on differential cross-sections in the low energy region. The incoherent scattered photons are selected in coincidence with X-rays which follow the vacancies caused by the ejection of the electrons. NaI(Tl) scintillators are used for the detection of scattered photons and emitted X-rays. The experimental results are compared with the available theoretical data.

  12. Influence of Fano interference and incoherent processes on optical bistability in a four-level quantum dot nanostructure

    International Nuclear Information System (INIS)

    Hossein Asadpour, Seyyed; Solookinejad, G; Panahi, M; Ahmadi Sangachin, E

    2016-01-01

    Role of Fano interference and incoherent pumping field on optical bistability in a four-level designed InGaN/GaN quantum dot nanostructure embedded in a unidirectional ring cavity are analyzed. It is found that intensity threshold of optical bistability can be manipulated by Fano interference. It is shown that incoherent pumping fields make the threshold of optical bistability behave differently by Fano interference. Moreover, in the presence of Fano interference the medium becomes phase-dependent. Therefore, the relative phase of applied fields can affect the behaviors of optical bistability and intensity threshold can be controlled easily. (paper)

  13. Diffusion formation and psychiatric diseases

    International Nuclear Information System (INIS)

    Reith, W.; Kulikovski, J.

    2015-01-01

    The basic principle behind diffusion is Brownian motion. The diffusion parameters obtained in a clinical association provide information on the spatial distribution of water molecule mobility and, therefore, evidence of the morphological integrity of the white and grey matters of the brain. In recent years functional magnetic resonance imaging (fMRI) could contribute to obtaining a detailed understanding of the cortical and subcortical cerebral networks. Diffusion tensor imaging (DTI) investigations can demonstrate the extent of anisotropy and the fiber pathways in so-called parametric images. For example, in Alzheimer's disease DTI reveals a reduced structural connectivity between the posterior cingulum and the hippocampus. This article shows examples of the application of diffusion-weighted imaging (DWI) in psychiatric disorders. (orig.) [de

  14. Motion control report

    CERN Document Server

    2013-01-01

    Please note this is a short discount publication. In today's manufacturing environment, Motion Control plays a major role in virtually every project.The Motion Control Report provides a comprehensive overview of the technology of Motion Control:* Design Considerations* Technologies* Methods to Control Motion* Examples of Motion Control in Systems* A Detailed Vendors List

  15. Basic principles of diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Bammer, Roland.

    2003-01-01

    In diffusion-weighted MRI (DWI), image contrast is determined by the random microscopic motion of water protons. During the last years, DWI has become an important modality in the diagnostic work-up of acute ischemia in the CNS. There are also a few promising reports about the application of DWI to other regions in the human body, such as the vertebral column or the abdomen. This manuscript provides an introduction into the basics of DWI and Diffusion Tensor imaging. The potential of various MR sequences in concert with diffusion preparation are discussed with respect to acquisition speed, spatial resolution, and sensitivity to bulk physiologic motion. More advanced diffusion measurement techniques, such as high angular resolution diffusion imaging, are also addressed

  16. Application of a Simplified Method for Estimating Perfusion Derived from Diffusion-Weighted MR Imaging in Glioma Grading.

    Science.gov (United States)

    Cao, Mengqiu; Suo, Shiteng; Han, Xu; Jin, Ke; Sun, Yawen; Wang, Yao; Ding, Weina; Qu, Jianxun; Zhang, Xiaohua; Zhou, Yan

    2017-01-01

    Purpose : To evaluate the feasibility of a simplified method based on diffusion-weighted imaging (DWI) acquired with three b -values to measure tissue perfusion linked to microcirculation, to validate it against from perfusion-related parameters derived from intravoxel incoherent motion (IVIM) and dynamic contrast-enhanced (DCE) magnetic resonance (MR) imaging, and to investigate its utility to differentiate low- from high-grade gliomas. Materials and Methods : The prospective study was approved by the local institutional review board and written informed consent was obtained from all patients. From May 2016 and May 2017, 50 patients confirmed with glioma were assessed with multi- b -value DWI and DCE MR imaging at 3.0 T. Besides conventional apparent diffusion coefficient (ADC 0,1000 ) map, perfusion-related parametric maps for IVIM-derived perfusion fraction ( f ) and pseudodiffusion coefficient (D*), DCE MR imaging-derived pharmacokinetic metrics, including K trans , v e and v p , as well as a metric named simplified perfusion fraction (SPF), were generated. Correlation between perfusion-related parameters was analyzed by using the Spearman rank correlation. All imaging parameters were compared between the low-grade ( n = 19) and high-grade ( n = 31) groups by using the Mann-Whitney U test. The diagnostic performance for tumor grading was evaluated with receiver operating characteristic (ROC) analysis. Results : SPF showed strong correlation with IVIM-derived f and D* ( ρ = 0.732 and 0.716, respectively; both P simplified method to measure tissue perfusion based on DWI by using three b -values may be helpful to differentiate low- from high-grade gliomas. SPF may serve as a valuable alternative to measure tumor perfusion in gliomas in a noninvasive, convenient and efficient way.

  17. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  18. A Simplified Approach to Measure the Effect of the Microvasculature in Diffusion-weighted MR Imaging Applied to Breast Tumors: Preliminary Results.

    Science.gov (United States)

    Teruel, Jose R; Goa, Pål E; Sjøbakk, Torill E; Østlie, Agnes; Fjøsne, Hans E; Bathen, Tone F

    2016-11-01

    Purpose To evaluate the relative change of the apparent diffusion coefficient (ADC) at low- and medium-b-value regimens as a surrogate marker of microcirculation, to study its correlation with dynamic contrast agent-enhanced (DCE) magnetic resonance (MR) imaging-derived parameters, and to assess its potential for differentiation between malignant and benign breast tumors. Materials and Methods Ethics approval and informed consent were obtained. From May 2013 to June 2015, 61 patients diagnosed with either malignant or benign breast tumors were prospectively recruited. All patients were scanned with a 3-T MR imager, including diffusion-weighted imaging (DWI) and DCE MR imaging. Parametric analysis of DWI and DCE MR imaging was performed, including a proposed marker, relative enhanced diffusivity (RED). Spearman correlation was calculated between DCE MR imaging and DWI parameters, and the potential of the different DWI-derived parameters for differentiation between malignant and benign breast tumors was analyzed by dividing the sample into equally sized training and test sets. Optimal cut-off values were determined with receiver operating characteristic curve analysis in the training set, which were then used to evaluate the independent test set. Results RED had a Spearman rank correlation of 0.61 with the initial area under the curve calculated from DCE MR imaging. Furthermore, RED differentiated cancers from benign tumors with an overall accuracy of 90% (27 of 30) on the test set with 88.2% (15 of 17) sensitivity and 92.3% (12 of 13) specificity. Conclusion This study presents promising results introducing a simplified approach to assess results from a DWI protocol sensitive to the intravoxel incoherent motion effect by using only three b values. This approach could potentially aid in the differentiation, characterization, and monitoring of breast pathologies. © RSNA, 2016 Online supplemental material is available for this article.

  19. Some Aspects of Diffusion Theory

    CERN Document Server

    Pignedoli, A

    2011-01-01

    This title includes: V.C.A. Ferraro: Diffusion of ions in a plasma with applications to the ionosphere; P.C. Kendall: On the diffusion in the atmosphere and ionosphere; F. Henin: Kinetic equations and Brownian motion; T. Kahan: Theorie des reacteurs nucleaires: methodes de resolution perturbationnelles, interactives et variationnelles; C. Cattaneo: Sulla conduzione del calore; C. Agostinelli: Formule di Green per la diffusione del campo magnetico in un fluido elettricamente conduttore; A. Pignedoli: Transformational methods applied to some one-dimensional problems concerning the equations of t

  20. A new look at Op art: towards a simple explanation of illusory motion

    Science.gov (United States)

    Zanker, Johannes M.; Walker, Robin

    Vivid motion illusions created by some Op art paintings are at the centre of a lively scientific debate about possible mechanisms that might underlie these phenomena. Here we review emerging evidence from a new approach that combines perceptual judgements of the illusion and observations of eye movements with simulations of the induced optic flow. This work suggests that the small involuntary saccades which participants make when viewing such Op art patterns would generate an incoherent distribution of motion signals that resemble the perceptual effects experienced by the observers. The combined experimental and computational evidence supports the view that the illusion is indeed caused by involuntary image displacements picked up by low-level motion detectors, and further suggests that coherent motion signals are crucial to perceive a stable world.

  1. Diffusion tensor optical coherence tomography

    Science.gov (United States)

    Marks, Daniel L.; Blackmon, Richard L.; Oldenburg, Amy L.

    2018-01-01

    In situ measurements of diffusive particle transport provide insight into tissue architecture, drug delivery, and cellular function. Analogous to diffusion-tensor magnetic resonance imaging (DT-MRI), where the anisotropic diffusion of water molecules is mapped on the millimeter scale to elucidate the fibrous structure of tissue, here we propose diffusion-tensor optical coherence tomography (DT-OCT) for measuring directional diffusivity and flow of optically scattering particles within tissue. Because DT-OCT is sensitive to the sub-resolution motion of Brownian particles as they are constrained by tissue macromolecules, it has the potential to quantify nanoporous anisotropic tissue structure at micrometer resolution as relevant to extracellular matrices, neurons, and capillaries. Here we derive the principles of DT-OCT, relating the detected optical signal from a minimum of six probe beams with the six unique diffusion tensor and three flow vector components. The optimal geometry of the probe beams is determined given a finite numerical aperture, and a high-speed hardware implementation is proposed. Finally, Monte Carlo simulations are employed to assess the ability of the proposed DT-OCT system to quantify anisotropic diffusion of nanoparticles in a collagen matrix, an extracellular constituent that is known to become highly aligned during tumor development.

  2. Daytime and Nighttime Neutral Wind and Temperature Measurements from Incoherent Scatter Radar at 300 KM over Arecibo.

    Science.gov (United States)

    1985-12-01

    Incoherent *scatter observations and their interpretation, 3. Atmos. Tarr. Phys., 34, 351-364, 1972. Bohnk&,R., and Harper,R., Vector measurements of F...equatorial F-region, 3. Atmos. Terr. Phys., 39, 1159-1168, 1977. Rishbeth, H., Ganguly,S., Walker,3.C., Feild -aligned and field-perpendicular velocities

  3. Excitation decay due to incoherent energy transfer : A comparative study by means of an exact density expansion

    NARCIS (Netherlands)

    Knoester, J.; Himbergen, J.E. Van

    1984-01-01

    In this paper we consider a system of identical, randomly distributed donors, between which incoherent energy transfer takes place, described by coupled rate equations. It is proved, that the well-known diagrammatic series expansion of Gochanour, Andersen, and Fayer for the self-energy, while not an

  4. Electron and ion temperatures: a comparison of ground-based incoherent scatter and AE-C satellite measurements

    International Nuclear Information System (INIS)

    Benson, R.F.; Bauer, P.; Brace, L.H.; Carlson, H.C.; Hagen, J.; Hanson, W.B.; Hoegy, W.R.; Torr, M.R.; Wickwar, V.B.

    1977-01-01

    The Atmosphere Exploere-C satellite (AE-C) is uniquely suited for correlative studies with ground-based stations because its on-board propulsion system enables a desired ground station overflight condition to be maintained for a period of several weeks. It also provides the first low-altitude (below 260 km) comparison of satellite and incoherent scatter electron and ion temperatures. More than 40 comparisons of remote and in situ measurements were made by using data from AE-C and four incoherent scatter stations (Arecibo, Chatanika, Millstone Hill, and St. Santin). The results indicate very good agreement between satellite and ground measurements of the ion temperature, the average satellite retarding potential analyzer temperatures differing from the average incoherent scatter temperatures by -2% at St. Santin, +3% at Millstone Hill, and +2% at Arecibo. The electron temperatures also agree well, the average satellite temperatures exceeding the average incoherent scatter temperatures by 3% at St. Santin, 2% at Arecibo, and 11% at Millstone Hill. Several temperature comparisons were made between AE-C and Chatanika. In spite of the highly variable ionosphere often encountered at this high-latitude location, good agreement was obtained between the in situ and remote measurements of electron and ion temperatures. Longitudinal variations are found to be very important in the comparisons of electron temperature in some locations. The agreement between the electron temperatures is considerably better than that found in some earlier comparisons involving satellities at higher altitudes

  5. Errors due to random noise in velocity measurement using incoherent-scatter radar

    Directory of Open Access Journals (Sweden)

    P. J. S. Williams

    1996-12-01

    Full Text Available The random-noise errors involved in measuring the Doppler shift of an 'incoherent-scatter' spectrum are predicted theoretically for all values of Te/Ti from 1.0 to 3.0. After correction has been made for the effects of convolution during transmission and reception and the additional errors introduced by subtracting the average of the background gates, the rms errors can be expressed by a simple semi-empirical formula. The observed errors are determined from a comparison of simultaneous EISCAT measurements using an identical pulse code on several adjacent frequencies. The plot of observed versus predicted error has a slope of 0.991 and a correlation coefficient of 99.3%. The prediction also agrees well with the mean of the error distribution reported by the standard EISCAT analysis programme.

  6. A compact new incoherent Thomson scattering diagnostic for low-temperature plasma studies

    Science.gov (United States)

    Vincent, Benjamin; Tsikata, Sedina; Mazouffre, Stéphane; Minea, Tiberiu; Fils, Jérôme

    2018-05-01

    Incoherent Thomson scattering (ITS) has a long history of application for the determination of electron density and temperature in dense fusion plasmas, and in recent years, has been increasingly extended to studies in low-temperature plasma environments. In this work, the design and preliminary implementation of a new, sensitive and uniquely compact ITS platform known as Thomson scattering experiments for low temperature ion sources are described. Measurements have been performed on a hollow cathode plasma source, providing access to electron densities as low as 1016 m‑3 and electron temperatures of a few eV and below. This achievement has been made possible by the implementation of a narrow volume Bragg grating notch filter for the attenuation of stray light, a feature which guarantees compactness and reduced transmission losses in comparison to standard ITS platforms.

  7. Ray-optics cloaking devices for large objects in incoherent natural light

    Science.gov (United States)

    Chen, Hongsheng; Zheng, Bin; Shen, Lian; Wang, Huaping; Zhang, Xianmin; Zheludev, Nikolay I.; Zhang, Baile

    2013-10-01

    A cloak that can hide living creatures from sight is a common feature of mythology but still remains unrealized as a practical device. To preserve the wave phase, the previous cloaking solution proposed by Pendry and colleagues required transformation of the electromagnetic space around the hidden object in such a way that the rays bending around the object inside the cloak region have to travel faster than those passing it by. This difficult phase preservation requirement is the main obstacle for building a broadband polarization-insensitive cloak for large objects. Here we propose a simplified version of Pendry’s cloak by abolishing the requirement for phase preservation, as it is irrelevant for observation using incoherent natural light with human eyes, which are phase and polarization insensitive. This allows for a cloak design on large scales using commonly available materials. We successfully demonstrate the cloaking of living creatures, a cat and a fish, from the eye.

  8. Collective dynamics of populations of weakly correlated filaments of incoherent white light

    International Nuclear Information System (INIS)

    Guo, Jinxin; Sheridan, John T; Saravanamuttu, Kalaichelvi

    2013-01-01

    We examined the dynamics of two populations of self-trapped filaments of spatially and temporally incoherent white light. The populations consisted of (i) independent filaments generated through self-trapping of incandescent speckles, and (ii) co-dependent filaments created through modulation instability of a broad incandescent beam. Both filament populations were positionally stable in conditions where individual pairs of self-trapped beams interact strongly. Both also acquired significantly broad intensity distributions, which were independent of their parent optical fields; a small but persistent number of high-intensity filaments was identified in both cases. These studies provide accessible routes to weakly correlated ensembles, insight into their collective behaviour such as self-stabilization and self-selected intensity distributions, and reveal intriguing similarities between the dynamics of two populations of different origins. (paper)

  9. Incoherent dictionary learning for reducing crosstalk noise in least-squares reverse time migration

    Science.gov (United States)

    Wu, Juan; Bai, Min

    2018-05-01

    We propose to apply a novel incoherent dictionary learning (IDL) algorithm for regularizing the least-squares inversion in seismic imaging. The IDL is proposed to overcome the drawback of traditional dictionary learning algorithm in losing partial texture information. Firstly, the noisy image is divided into overlapped image patches, and some random patches are extracted for dictionary learning. Then, we apply the IDL technology to minimize the coherency between atoms during dictionary learning. Finally, the sparse representation problem is solved by a sparse coding algorithm, and image is restored by those sparse coefficients. By reducing the correlation among atoms, it is possible to preserve most of the small-scale features in the image while removing much of the long-wavelength noise. The application of the IDL method to regularization of seismic images from least-squares reverse time migration shows successful performance.

  10. Incoherent feedforward control governs adaptation of activated ras in a eukaryotic chemotaxis pathway.

    Science.gov (United States)

    Takeda, Kosuke; Shao, Danying; Adler, Micha; Charest, Pascale G; Loomis, William F; Levine, Herbert; Groisman, Alex; Rappel, Wouter-Jan; Firtel, Richard A

    2012-01-03

    Adaptation in signaling systems, during which the output returns to a fixed baseline after a change in the input, often involves negative feedback loops and plays a crucial role in eukaryotic chemotaxis. We determined the dynamical response to a uniform change in chemoattractant concentration of a eukaryotic chemotaxis pathway immediately downstream from G protein-coupled receptors. The response of an activated Ras showed near-perfect adaptation, leading us to attempt to fit the results using mathematical models for the two possible simple network topologies that can provide perfect adaptation. Only the incoherent feedforward network accurately described the experimental results. This analysis revealed that adaptation in this Ras pathway is achieved through the proportional activation of upstream components and not through negative feedback loops. Furthermore, these results are consistent with a local excitation, global inhibition mechanism for gradient sensing, possibly with a Ras guanosine triphosphatase-activating protein acting as a global inhibitor.

  11. Enhancement of the incoherent scattering plasma lines due to precipitating protons and secondary electrons

    International Nuclear Information System (INIS)

    Bjoernaa, N.; Havnes, O.; Jensen, J.O.; Trulsen, J.

    1982-01-01

    Precipitating protons in the energy range 1-100 keV are regularly present in the auroral ionosphere. These protons will produce enhancements in the intensity of the upshifted plasma line of the incoherently scattered spectrum. Similarly, secondary electrons produced by the precipitating protons give rise to enhanced plasma line intensities. For a quantitative discussion of these effects an experimentally measured proton flux is adapted and the corresponding secondary electron flux calculated. These particle fluxes are then applied in connection with the EISCAT radar facility. Both fluxes give rise to enhancements of the order of 20. It is possible to separate between proton and electron contributions to the enhanced plasma lines for scattering heights above the source region of secondary electrons. (Auth.)

  12. Incoherent-scatter radar measurements of electric field and plasma in the auroral ionosphere

    International Nuclear Information System (INIS)

    Vondrak, R.

    1983-01-01

    This chapter summarizes Chatanika radar measurements of electric fields and currents, and their relation to E-region ionization and conductivity. Electric-field coupling between the ionosphere and magnetosphere and the relationship between field-aligned currents and meridional ionospheric currents are examined. Topics considered include the diurnal pattern of the ionization and electric field; electrical coupling between the ionosphere and magnetosphere; and the relationship between meridional currents and field-aligned currents. It is concluded that the incoherent-scatter radar technique has been developed into a powerful method for remotely measuring the electrical and thermal properties of the auroral ionospheric plasma, and that the usefulness of the radar measurements is greatly enhanced when combined with simultaneous satellite measurements

  13. A mixed incoherent feed-forward loop contributes to the regulation of bacterial photosynthesis genes.

    Science.gov (United States)

    Mank, Nils N; Berghoff, Bork A; Klug, Gabriele

    2013-03-01

    Living cells use a variety of regulatory network motifs for accurate gene expression in response to changes in their environment or during differentiation processes. In Rhodobacter sphaeroides, a complex regulatory network controls expression of photosynthesis genes to guarantee optimal energy supply on one hand and to avoid photooxidative stress on the other hand. Recently, we identified a mixed incoherent feed-forward loop comprising the transcription factor PrrA, the sRNA PcrZ and photosynthesis target genes as part of this regulatory network. This point-of-view provides a comparison to other described feed-forward loops and discusses the physiological relevance of PcrZ in more detail.

  14. Formation of incoherent deformation twin boundaries in a coarse-grained Al-7Mg alloy

    Science.gov (United States)

    Jin, S. B.; Zhang, K.; Bjørge, R.; Tao, N. R.; Marthinsen, K.; Lu, K.; Li, Y. J.

    2015-08-01

    Deformation twinning has rarely been observed in coarse grained Al and its alloys except under some extreme conditions such as ultrahigh deformation strain or strain rates. Here, we report that a significant amount of Σ3 deformation twins could be generated in a coarse-grained Al-7 Mg alloy by dynamic plastic deformation (DPD). A systematic investigation of the Σ3 boundaries shows that they are Σ3{112} type incoherent twin boundaries (ITBs). These ITBs have formed by gradual evolution from copious low-angle deformation bands through -twist Σ boundaries by lattice rotation. These findings provide an approach to generate deformation twin boundaries in high stacking fault energy metallic alloys. It is suggested that high solution content of Mg in the alloy and the special deformation mode of DPD played an important role in formation of the Σ and ITBs.

  15. Design, demonstration and analysis of a modified wavelength-correlating receiver for incoherent OCDMA system.

    Science.gov (United States)

    Zhou, Heng; Qiu, Kun; Wang, Leyang

    2011-03-28

    A novel wavelength-correlating receiver for incoherent Optical Code Division Multiple Access (OCDMA) system is proposed and demonstrated in this paper. Enabled by the wavelength conversion based scheme, the proposed receiver can support various code types including one-dimensional optical codes and time-spreading/wavelength-hopping two dimensional codes. Also, a synchronous detection scheme with time-to- wavelength based code acquisition is proposed, by which code acquisition time can be substantially reduced. Moreover, a novel data-validation methodology based on all-optical pulse-width monitoring is introduced for the wavelength-correlating receiver. Experimental demonstration of the new proposed receiver is presented and low bit error rate data-receiving is achieved without optical hard limiting and electronic power thresholding. For the first time, a detailed theoretical performance analysis specialized for the wavelength-correlating receiver is presented. Numerical results show that the overall performance of the proposed receiver prevails over conventional OCDMA receivers.

  16. Optical information encryption based on incoherent superposition with the help of the QR code

    Science.gov (United States)

    Qin, Yi; Gong, Qiong

    2014-01-01

    In this paper, a novel optical information encryption approach is proposed with the help of QR code. This method is based on the concept of incoherent superposition which we introduce for the first time. The information to be encrypted is first transformed into the corresponding QR code, and thereafter the QR code is further encrypted into two phase only masks analytically by use of the intensity superposition of two diffraction wave fields. The proposed method has several advantages over the previous interference-based method, such as a higher security level, a better robustness against noise attack, a more relaxed work condition, and so on. Numerical simulation results and actual smartphone collected results are shown to validate our proposal.

  17. Unidirectional reflection and invisibility in nonlinear media with an incoherent nonlinearity

    Science.gov (United States)

    Mostafazadeh, Ali; Oflaz, Neslihan

    2017-11-01

    We give explicit criteria for the reflectionlessness, transparency, and invisibility of a finite-range potential in the presence of an incoherent (intensity-dependent) nonlinearity that is confined to the range of the potential. This allows us to conduct a systematic study of the effects of such a nonlinearity on a locally periodic class of finite-range potentials that display perturbative unidirectional invisibility. We use our general results to examine the effects of a weak Kerr nonlinearity on the behavior of these potentials and show that the presence of nonlinearity destroys the unidirectional invisibility of these potentials. If the strength of the Kerr nonlinearity is so weak that the first-order perturbation theory is reliable, the presence of nonlinearity does not affect the unidirectional reflectionlessness and transmission reciprocity of the potential. We show that the expected violation of the latter is a second order perturbative effect.

  18. Diffusion in cladding materials

    International Nuclear Information System (INIS)

    Anand, M.S.; Pande, B.M.; Agarwala, R.P.

    1992-01-01

    Aluminium has been used as a cladding material in most research reactors because its low neutron absorption cross section and ease of fabrication. However, it is not suitable for cladding in power reactors and as such zircaloy-2 is normally used as a clad because it can withstand high temperature. It has low neutron absorption cross section, good oxidation, corrosion, creep properties and possesses good mechanical strength. With the passage of time, further development in this branch of science took place and designers started looking for better neutron economy and less hydrogen pickup in PHW reactors. The motion of fission products in the cladding material could pose a problem after long operation. In order to understand their behaviour under reactor environment, it is essential to study first the diffusion under normal conditions. These studies will throw light on the interaction of defects with impurities which would in turn help in understanding the mechanism of diffusion. In this article, it is intended to discuss the diffusion behaviour of impurities in cladding materials.(i.e. aluminium, zircaloy-2, zirconium-niobium alloy etc.). (author). 94 refs., 4 figs., 3 tabs

  19. Nonadiabatic particle motion in magnetic mirror traps

    International Nuclear Information System (INIS)

    Irie, H.; Otsuka, S.; Varma, R.K.; Watanabe, T.; Nishikawa, Kyoji.

    1982-01-01

    By numerical integration of the equation of single particle motion, the basic features of the actual nonadiabatic escape of particles are studied. The results are compared with the predictions of two existing theoretical models: ''diffusion'' model derived by B. V. Chirikov and ''tunneling'' model introduced by R. K. Varma. (author)

  20. Review of diffusion tensor imaging and its application in children

    Energy Technology Data Exchange (ETDEWEB)

    Vorona, Gregory A. [Children' s Hospital of Richmond at Virginia Commonwealth University, Department of Radiology, Richmond, VA (United States); Berman, Jeffrey I. [Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States)

    2015-09-15

    Diffusion MRI is an imaging technique that uses the random motion of water to probe tissue microstructure. Diffusion tensor imaging (DTI) can quantitatively depict the organization and connectivity of white matter. Given the non-invasiveness of the technique, DTI has become a widely used tool for researchers and clinicians to examine the white matter of children. This review covers the basics of diffusion-weighted imaging and diffusion tensor imaging and discusses examples of their clinical application in children. (orig.)

  1. Stochastic motion of particles in tandem mirror devices

    International Nuclear Information System (INIS)

    Ichikawa, Y.H.; Kamimura, T.

    1982-01-01

    Stochastic motion of particles in tandem mirror devices is examined on basis of a nonlinear mapping of particle positions on the equatorial plane. Local stability analysis provides detailed informations on particle trajectories. The rate of stochastic plasma diffusion is estimated from numerical observations of motions of particles over a large number of time steps. (author)

  2. Measuring nanoparticle diffusion in an ABELtrap

    Science.gov (United States)

    Dienerowitz, M.; Dienerowitz, F.; Börsch, M.

    2018-03-01

    Monitoring the Brownian motion of individual nanoscopic objects is key to investigate their transport properties and interactions with their close environment. Most techniques rely on transient diffusion through a detection volume or immobilisation, which restrict observation times or motility. We measure the diffusion coefficient and surface charge of individual nanoparticles and DNA molecules in an anti-Brownian electrokinetic trap (ABELtrap). This instrument is an active feedback trap confining the Brownian motion of a nanoparticle to the detection site by applying an electric field based on the particle’s current position. We simulate the Brownian motion of nanospheres in our sample geometry, including wall effects, due to partial confinement in the third dimension. The theoretically predicted values are in excellent agreement with our diffusion measurements in the ABELtrap. We also demonstrate the ABELtrap’s ability to measure varying sizes of DNA origami structures during denaturation.

  3. Anisotropic diffusion within human white matter

    International Nuclear Information System (INIS)

    Chenevert, T.L.; Brunberg, J.A.; Pipe, J.G.

    1990-01-01

    This paper reports on measurements performed to assess the impact of fiber orientation on the apparent diffusion coefficient of human white matter in vivo. Orthogonal section selection pulses and strong motion sensitization gradient pulses were used for localized diffusion measurement along an anteroposteriorly oriented 1 x 1 cm tissue column in the left cerebral hemisphere. This region was selected since white matter fiber orientations are reasonably well defined. Independent acquisitions with motion sensitivity along anteroposterior and right-left directions allowed study of diffusion anisotropy. Motion artifacts were minimized by magnitude summation after one-dimensional Fourier transform of frequency-encoded echoes; consequently, cardiac gating was not required. Five normal volunteers were studied on a 1.5-T clinical MR system

  4. The relationship between ventilatory lung motion and pulmonary perfusion shown by ventilatory lung motion imaging

    International Nuclear Information System (INIS)

    Fujii, Tadashige; Tanaka, Masao; Nakatsuka, Tatsuya; Yoshimura, Kazuhiko; Hirose, Yoshiki; Hirayama, Jiro; Kobayashi, Toshio; Handa, Kenjiro

    1991-01-01

    Using ventilatory lung motion imaging, which was obtained from two perfusion lung scintigrams with 99m Tc-macroaggregated albumin taken in maximal inspiration and maximal expiration, the lung motion (E-I/I) of the each unilateral lung was studied in various cardiopulmonary diseases. The sum of (E-I)/I(+) of the unilateral lung was decreased in the diseased lung for localized pleuropulmonary diseases, including primary lung cancer and pleural thickening, and in both lungs for heart diseases, and diffuse pulmonary diseases including diffuse interstitial pneumonia and diffuse panbronchiolitis. The sum of (E-I)/I(+) of the both lungs, which correlated with vital capacity and PaO 2 , was decreased in diffuse interstitial pneumonia, pulmonary emphysema, diffuse panbronchiolitis, primary lung cancer, pleural diseases and so on. (E-I)/I(+), correlated with pulmonary perfusion (n=49, r=0.51, p 81m Kr or 133 Xe (n=49, r=0.61, p<0.001) than pulmonary perfusion. The ventilatory lung motion imaging, which demonstrates the motion of the intra-pulmonary areas and lung edges, appears useful for estimating pulmonary ventilation of the perfused area as well as pulmonary perfusion. (author)

  5. Turbulent diffusion of small particles

    International Nuclear Information System (INIS)

    Margolin, L.G.

    1977-11-01

    The diffusion of small, spherical, rigid particles suspended in an incompressible turbulent fluid, but not interacting with each other, was studied. As a stochastic process, the turbulent fluid velocity field is assumed to be homogeneous, isotropic and stationary. Assuming the Stokes regime, a particle of equation of motion is used which includes only the effects of Stokes drag and a virtual mass force and an exact solution is found for the particle velocity correlation function, for all times and initial conditions, in terms of a fluid velocity correlation function measured along the motion of the particle. This shows that for times larger than a certain time scale, the particle velocity correlation becomes stationary. The effect of small shears in the fluid velocity was considered, under the additional restrictions of a certain high frequency regime for the turbulence. The shears convected past the particle much faster than the growth of the boundary layer. New force terms due to the presence of such shears are calculated and incorporated into the equation of motion. A perturbation solution to this equation is constructed, and the resultant particle velocity correlation function and diffusion coefficient are calculated. To lowest order, the particle diffusivity is found to be unaltered by the presence of small mean flow shears. The last model treated is one in which particles traverse a turbulent fluid with a large mean velocity. Among other restrictions, linearized form drag is assumed. The diffusion coefficient for such particles was calculated, and found to be much smaller than the passive scalar diffusion coefficient. This agrees within 5 percent with the experimental results of Snyder and Lumley

  6. Motion in radiotherapy

    DEFF Research Database (Denmark)

    Korreman, Stine Sofia

    2012-01-01

    This review considers the management of motion in photon radiation therapy. An overview is given of magnitudes and variability of motion of various structures and organs, and how the motion affects images by producing artifacts and blurring. Imaging of motion is described, including 4DCT and 4DPE...

  7. Edgeworth expansion for functionals of continuous diffusion processes

    DEFF Research Database (Denmark)

    Podolskij, Mark; Yoshida, Nakahiro

    This paper presents new results on the Edgeworth expansion for high frequency functionals of continuous diffusion processes. We derive asymptotic expansions for weighted functionals of the Brownian motion and apply them to provide the Edgeworth expansion for power variation of diffusion processes....... Our methodology relies on martingale embedding, Malliavin calculus and stable central limit theorems for semimartingales. Finally, we demonstrate the density expansion for studentized statistics of power variations.......This paper presents new results on the Edgeworth expansion for high frequency functionals of continuous diffusion processes. We derive asymptotic expansions for weighted functionals of the Brownian motion and apply them to provide the Edgeworth expansion for power variation of diffusion processes...

  8. Effects of atmospheric oscillations on the field-aligned ion motions in the polar F-region

    Directory of Open Access Journals (Sweden)

    S. Oyama

    Full Text Available The field-aligned neutral oscillations in the F-region (altitudes between 165 and 275 km were compared using data obtained simultaneously with two independent instruments: the European Incoherent Scatter (EISCAT UHF radar and a scanning Fabry-Perot interferometer (FPI. During the night of February 8, 1997, simultaneous observations with these instruments were conducted at Tromsø, Norway. Theoretically, the field-aligned neutral wind velocity can be obtained from the field-aligned ion velocity and by diffusion and ambipolar diffusion velocities. We thus derived field-aligned neutral wind velocities from the plasma velocities in EISCAT radar data. They were compared with those observed with the FPI (λ=630.0 nm, which are assumed to be weighted height averages of the actual neutral wind. The weighting function is the normalized height dependent emission rate. We used two model weighting functions to derive the neutral wind from EISCAT data. One was that the neutral wind velocity observed with the FPI is velocity integrated over the entire emission layer and multiplied by the theoretical normalized emission rate. The other was that the neutral wind velocity observed with the FPI corresponds to the velocity only around an altitude where the emission rate has a peak. Differences between the two methods were identified, but not completely clarified. However, the neutral wind velocities from both instruments had peak-to-peak correspondences at oscillation periods of about 10–40 min, shorter than that for the momentum transfer from ions to neutrals, but longer than from neutrals to ions. The synchronizing motions in the neutral wind velocities suggest that the momentum transfer from neutrals to ions was thought to be dominant for the observed field-aligned oscillations rather than the transfer from ions to neutrals. It is concluded that during the observation, the plasma oscillations observed with the EISCAT radar at different altitudes

  9. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  10. Multipassage diffuser

    International Nuclear Information System (INIS)

    Lalis, A.; Rouviere, R.; Simon, G.

    1976-01-01

    A multipassage diffuser having 2p passages comprises a leak-tight cylindrical enclosure closed by a top cover and a bottom end-wall, parallel porous tubes which are rigidly assembled in sectors between tube plates and through which the gas mixture flows, the tube sectors being disposed at uniform intervals on the periphery of the enclosure. The top tube plates are rigidly fixed to an annular header having the shape of a half-torus and adapted to communicate with the tubes of the corresponding sector. Each passage is constituted by a plurality of juxtaposed sectors in which the mixture circulates in the same direction, the header being divided into p portions limited by radial partition-walls and each constituting two adjacent passages. The diffuser is provided beneath the bottom end-wall with p-1 leak-tight chambers each adapted to open into two different portions of the header, and with two collector-chambers each fitted with a nozzle for introducing the gas mixture and discharging the fraction of the undiffused mixture. By means of a central orifice formed in the bottom end-wall the enclosure communicates with a shaft for discharging the diffused fraction of the gas mixture

  11. Coherent Forward Stimulated-Brillouin Scattering of a Spatially Incoherent Laser Beam in a Plasma and Its Effect on Beam Spray

    International Nuclear Information System (INIS)

    Grech, M.; Riazuelo, G.; Pesme, D.; Weber, S.; Tikhonchuk, V. T.

    2009-01-01

    A statistical model for forward stimulated-Brillouin scattering is developed for a spatially incoherent, monochromatic, laser beam propagating in a plasma. The threshold above which the laser beam spatial incoherence cannot prevent the coherent growth of forward stimulated-Brillouin scattering is computed. It is found to be well below the threshold for self-focusing. Three-dimensional simulations confirm its existence and reveal the onset of beam spray above it. From these results, we propose a new figure of merit for the control of propagation through a plasma of a spatially incoherent laser beam

  12. Motion Transplantation Techniques: A Survey

    NARCIS (Netherlands)

    van Basten, Ben; Egges, Arjan

    2012-01-01

    During the past decade, researchers have developed several techniques for transplanting motions. These techniques transplant a partial auxiliary motion, possibly defined for a small set of degrees of freedom, on a base motion. Motion transplantation improves motion databases' expressiveness and

  13. The Applicability of Incoherent Array Processing to IMS Seismic Array Stations

    Science.gov (United States)

    Gibbons, S. J.

    2012-04-01

    The seismic arrays of the International Monitoring System for the CTBT differ greatly in size and geometry, with apertures ranging from below 1 km to over 60 km. Large and medium aperture arrays with large inter-site spacings complicate the detection and estimation of high frequency phases since signals are often incoherent between sensors. Many such phases, typically from events at regional distances, remain undetected since pipeline algorithms often consider only frequencies low enough to allow coherent array processing. High frequency phases that are detected are frequently attributed qualitatively incorrect backazimuth and slowness estimates and are consequently not associated with the correct event hypotheses. This can lead to missed events both due to a lack of contributing phase detections and by corruption of event hypotheses by spurious detections. Continuous spectral estimation can be used for phase detection and parameter estimation on the largest aperture arrays, with phase arrivals identified as local maxima on beams of transformed spectrograms. The estimation procedure in effect measures group velocity rather than phase velocity and the ability to estimate backazimuth and slowness requires that the spatial extent of the array is large enough to resolve time-delays between envelopes with a period of approximately 4 or 5 seconds. The NOA, AKASG, YKA, WRA, and KURK arrays have apertures in excess of 20 km and spectrogram beamforming on these stations provides high quality slowness estimates for regional phases without additional post-processing. Seven arrays with aperture between 10 and 20 km (MJAR, ESDC, ILAR, KSRS, CMAR, ASAR, and EKA) can provide robust parameter estimates subject to a smoothing of the resulting slowness grids, most effectively achieved by convolving the measured slowness grids with the array response function for a 4 or 5 second period signal. The MJAR array in Japan recorded high SNR Pn signals for both the 2006 and 2009 North Korea

  14. Small-polaron model of light atom diffusion

    International Nuclear Information System (INIS)

    Emin, D.

    1977-01-01

    A number of researchers have treated the diffusion of light interstitials in metals in strict analogy with the theory for the hopping diffusion of electrons in low-mobility insulators. In other words, these authors view the diffusion of light atoms as simply being an example of small-polaron hopping motion. In this paper the motion of a small polaron is introduced, and the mechanism of its motion is described. The experimental results are then succinctly presented. Next the physical assumptions implicit in the theory are compared with the situation which is believed to characterize the existence and motion of light interstitial atoms in metals. Concomitantly, the modifications of the small-polaron theory required in applying it to light atom diffusion are ennumerated

  15. Theory of collective diffusion in two-dimensional colloidal suspensions

    Czech Academy of Sciences Publication Activity Database

    Chvoj, Zdeněk; Lahtinen, J. M.; Ala-Nissila, T.

    -, - (2004), s. 1-8 ISSN 1742-5468 R&D Projects: GA AV ČR IAA1010207 Institutional research plan: CEZ:AV0Z1010914 Keywords : surface diffusion * Brownian motion * fluctuations Subject RIV: BE - Theoretical Physics

  16. Brownian motion of tethered nanowires.

    Science.gov (United States)

    Ota, Sadao; Li, Tongcang; Li, Yimin; Ye, Ziliang; Labno, Anna; Yin, Xiaobo; Alam, Mohammad-Reza; Zhang, Xiang

    2014-05-01

    Brownian motion of slender particles near a boundary is ubiquitous in biological systems and in nanomaterial assembly, but the complex hydrodynamic interaction in those systems is still poorly understood. Here, we report experimental and computational studies of the Brownian motion of silicon nanowires tethered on a substrate. An optical interference method enabled direct observation of microscopic rotations of the slender bodies in three dimensions with high angular and temporal resolutions. This quantitative observation revealed anisotropic and angle-dependent hydrodynamic wall effects: rotational diffusivity in inclined and azimuth directions follows different power laws as a function of the length, ∼ L(-2.5) and ∼ L(-3), respectively, and is more hindered for smaller inclined angles. In parallel, we developed an implicit simulation technique that takes the complex wire-wall hydrodynamic interactions into account efficiently, the result of which agreed well with the experimentally observed angle-dependent diffusion. The demonstrated techniques provide a platform for studying the microrheology of soft condensed matters, such as colloidal and biological systems near interfaces, and exploring the optimal self-assembly conditions of nanostructures.

  17. Anomalous diffusion spreads its wings

    Energy Technology Data Exchange (ETDEWEB)

    Klafter, J. [School of Chemistry, Tel Aviv University, Tel-Aviv (Israel)]. E-mail: klafter@post.tau.ac.il; Sokolov, I.M. [Institute of Physics, Humboldt University, Berlin (Germany)]. E-mail: igor.sokolov@physik.hu-berlin.de

    2005-08-01

    An increasing number of natural phenomena do not fit into the relatively simple description of diffusion developed by Einstein a century ago. As all of us are no doubt aware, this year has been declared 'world year of physics' to celebrate the three remarkable breakthroughs made by Albert Einstein in 1905. However, it is not so well known that Einstein's work on Brownian motion - the random motion of tiny particles first observed and investigated by the botanist Robert Brown in 1827 - has been cited more times in the scientific literature than his more famous papers on special relativity and the quantum nature of light. In a series of publications that included his doctoral thesis, Einstein derived an equation for Brownian motion from microscopic principles - a feat that ultimately enabled Jean Perrin and others to prove the existence of atoms (see 'Einstein's random walk' Physics World January pp19-22). Einstein was not the only person thinking about this type of problem. The 27 July 1905 issue of Nature contained a letter with the title 'The problem of the random walk' by the British statistician Karl Pearson, who was interested in the way that mosquitoes spread malaria, which he showed was described by the well-known diffusion equation. As such, the displacement of a mosquito from its initial position is proportional to the square root of time, and the distribution of the positions of many such 'random walkers' starting from the same origin is Gaussian in form. The random walk has since turned out to be intimately linked to Einstein's work on Brownian motion, and has become a major tool for understanding diffusive processes in nature. (U.K.)

  18. Quantum diffusion

    International Nuclear Information System (INIS)

    Habib, S.

    1994-01-01

    We consider a simple quantum system subjected to a classical random force. Under certain conditions it is shown that the noise-averaged Wigner function of the system follows an integro-differential stochastic Liouville equation. In the simple case of polynomial noise-couplings this equation reduces to a generalized Fokker-Planck form. With nonlinear noise injection new ''quantum diffusion'' terms rise that have no counterpart in the classical case. Two special examples that are not of a Fokker-Planck form are discussed: the first with a localized noise source and the other with a spatially modulated noise source

  19. A design of a wavelength-hopping time-spreading incoherent optical code division multiple access system

    International Nuclear Information System (INIS)

    Glesk, I.; Baby, V.

    2005-01-01

    We present the architecture and code design for a highly scalable, 2.5 Gb/s per user optical code division multiple access (OCDMA) system. The system is scalable to 100 potential and more than 10 simultaneous users, each with a bit error rate (BER) of less than 10 -9 . The system architecture uses a fast wavelength-hopping, time-spreading codes. Unlike frequency and phase sensitive coherent OCDMA systems, this architecture utilizes standard on off keyed optical pulses allocated in the time and wavelength dimensions. This incoherent OCDMA approach is compatible with existing WDM optical networks and utilizes off the shelf components. We discuss the novel optical subsystem design for encoders and decoders that enable the realization of a highly scalable incoherent OCDMA system with rapid reconfigurability. A detailed analysis of the scalability of the two dimensional code is presented and select network deployment architectures for OCDMA are discussed (Authors)

  20. Hereditary Diffuse Gastric Cancer

    Science.gov (United States)

    ... Hereditary Diffuse Gastric Cancer Request Permissions Hereditary Diffuse Gastric Cancer Approved by the Cancer.Net Editorial Board , 10/2017 What is hereditary diffuse gastric cancer? Hereditary diffuse gastric cancer (HDGC) is a rare ...

  1. Current-induced magnetization changes in a spin valve due to incoherent emission of non-equilibrium magnons

    OpenAIRE

    Kozub, V. I.; Caro, J.

    2004-01-01

    We describe spin transfer in a ferromagnet/normal metal/ferromagnet spin-valve point contact. Spin is transferred from the spin-polarized device current to the magnetization of the free layer by the mechanism of incoherent magnon emission by electrons. Our approach is based on the rate equation for the magnon occupation, using Fermi's golden rule for magnon emission and absorption and the non-equilibrium electron distribution for a biased spin valve. The magnon emission reduces the magnetizat...

  2. Electron temperature measurements by the plasma line technique at the French incoherent scatter radar facilities

    International Nuclear Information System (INIS)

    Kofman, W.; Lejeune, G.; Hagfors, T.; Bauer, P.

    1981-01-01

    The results of experiments aimed at the determination of the electron temperature by a plasma line technique are presented. Using the multistatic capabilities of the French incoherent scatter radar, the plasma line frequencies were simultaneously measured at two receiving stations (Mende and Nancay) at the altitude corresponding to the maximum of the F layer. Different plasma line frequencies are measued because of different effective k vectors that appear in the thermal term of the plasma dispersion relation. We derive and apply two data analysis procedures that enable us to determine this frequency difference. Comparison of this measured frequency difference to that calculated using the ion component electron temperature demonstrates that the plasma lines could indeed be used to determine the electron temperature. A strong dependence of the power in the plasma line as a function of the angle between k vector and magnetic field is observed in agreement with the theory. The future developments of this technique with the EISCAT radar facilities are discussed

  3. An efficient central DOA tracking algorithm for multiple incoherently distributed sources

    Science.gov (United States)

    Hassen, Sonia Ben; Samet, Abdelaziz

    2015-12-01

    In this paper, we develop a new tracking method for the direction of arrival (DOA) parameters assuming multiple incoherently distributed (ID) sources. The new approach is based on a simple covariance fitting optimization technique exploiting the central and noncentral moments of the source angular power densities to estimate the central DOAs. The current estimates are treated as measurements provided to the Kalman filter that model the dynamic property of directional changes for the moving sources. Then, the covariance-fitting-based algorithm and the Kalman filtering theory are combined to formulate an adaptive tracking algorithm. Our algorithm is compared to the fast approximated power iteration-total least square-estimation of signal parameters via rotational invariance technique (FAPI-TLS-ESPRIT) algorithm using the TLS-ESPRIT method and the subspace updating via FAPI-algorithm. It will be shown that the proposed algorithm offers an excellent DOA tracking performance and outperforms the FAPI-TLS-ESPRIT method especially at low signal-to-noise ratio (SNR) values. Moreover, the performances of the two methods increase as the SNR values increase. This increase is more prominent with the FAPI-TLS-ESPRIT method. However, their performances degrade when the number of sources increases. It will be also proved that our method depends on the form of the angular distribution function when tracking the central DOAs. Finally, it will be shown that the more the sources are spaced, the more the proposed method can exactly track the DOAs.

  4. Semidiurnal tide in the E region from incoherent scatter measurements at Arecibo

    International Nuclear Information System (INIS)

    Wand, R.H.

    1976-01-01

    A five-pulse technique was implemented for the 430 MHz incoherent scatter radar at Arecibo Observatory (18.3 0 N) to explore the detailed thermal structure of the E region from 105 to 130 km with an altitude resolution of 3 km. Five days of measurements in Sept-Oct 1970 showed long-period temperature fluctuations having a downward phase progression. The temperature oscillations are interpreted as manifestations of a semidiurnal tide which is quite stable over a 12-day period, together with a superimposed spectrum of shorter-period gravity waves which are randomly phased from day to day. The semidiurnal tide increased to a maximum amplitude of 17 percent of the mean temperature near 115 km and decreased above this altitude as dissipative effects became important. The vertical wavelength, deduced from the altitude variation of semidiurnal tidal phase, showed a smooth increase from about 20 km at an altitude of 109 km to about 50 km at an altitude of 127 km. No ready interpretation of the observed tidal characteristics was possible in terms of present theories for the semidiurnal tide. Altitude profiles of mean daytime temperature and ion-neutral collision frequency were also obtained from the measurements. The mean temperature gradient between 115 and 130 km was 15 K/km, which is somewhat larger than that given by current atmospheric models

  5. Combined distributed Raman and Bragg fiber temperature sensing using incoherent optical frequency domain reflectometry

    Directory of Open Access Journals (Sweden)

    M. Koeppel

    2018-02-01

    Full Text Available Optical temperature sensors offer unique features which make them indispensable for key industries such as the energy sector. However, commercially available systems are usually designed to perform either distributed or distinct hot spot temperature measurements since they are restricted to one measurement principle. We have combined two concepts, fiber Bragg grating (FBG temperature sensors and Raman-based distributed temperature sensing (DTS, to overcome these limitations. Using a technique called incoherent optical frequency domain reflectometry (IOFDR, it is possible to cascade several FBGs with the same Bragg wavelength in one fiber and simultaneously perform truly distributed Raman temperature measurements. In our lab we have achieved a standard deviation of 2.5 K or better at a spatial resolution in the order of 1 m with the Raman DTS. We have also carried out a field test in a high-voltage environment with strong magnetic fields where we performed simultaneous Raman and FBG temperature measurements using a single sensor fiber only.

  6. All-fiber 7x1 signal combiner for incoherent laser beam combining

    Science.gov (United States)

    Noordegraaf, D.; Maack, M. D.; Skovgaard, P. M. W.; Johansen, J.; Becker, F.; Belke, S.; Blomqvist, M.; Laegsgaard, J.

    2011-02-01

    We demonstrate an all-fiber 7x1 signal combiner for incoherent laser beam combining. This is a potential key component for reaching several kW of stabile laser output power. The combiner couples the output from 7 single-mode (SM) fiber lasers into a single multi-mode (MM) fiber. The input signal fibers have a core diameter of 17 μm and the output MM fiber has a core diameter of 100 μm. In a tapered section light gradually leaks out of the SM fibers and is captured by a surrounding fluorine-doped cladding. The combiner is tested up to 2.5 kW of combined output power and only a minor increase in device temperature is observed. At an intermediate power level of 600 W a beam parameter product (BPP) of 2.22 mm x mrad is measured, corresponding to an M2 value of 6.5. These values are approaching the theoretical limit dictated by brightness conservation.

  7. Comparison of the UAF Ionosphere Model with Incoherent-Scatter Radar Data

    Science.gov (United States)

    McAllister, J.; Maurits, S.; Kulchitsky, A.; Watkins, B.

    2004-12-01

    The UAF Eulerian Parallel Polar Ionosphere Model (UAF EPPIM) is a first-principles three-dimensional time-dependent representation of the northern polar ionosphere (>50 degrees north latitude). The model routinely generates short-term (~2 hours) ionospheric forecasts in real-time. It may also be run in post-processing/batch mode for specific time periods, including long-term (multi-year) simulations. The model code has been extensively validated (~100k comparisons/model year) against ionosonde foF2 data during quiet and moderate solar activity in 2002-2004 with reasonable fidelity (typical relative RMS 10-20% for summer daytime, 30-50% winter nighttime). However, ionosonde data is frequently not available during geomagnetic disturbances. The objective of the work reported here is to compare model outputs with available incoherent-scatter radar data during the storm period of October-November 2003. Model accuracy is examined for this period and compared to model performance during geomagnetically quiet and moderate circumstances. Possible improvements are suggested which are likely to boost model fidelity during storm conditions.

  8. Sparse synthetic aperture with Fresnel elements (S-SAFE) using digital incoherent holograms

    Science.gov (United States)

    Kashter, Yuval; Rivenson, Yair; Stern, Adrian; Rosen, Joseph

    2015-01-01

    Creating a large-scale synthetic aperture makes it possible to break the resolution boundaries dictated by the wave nature of light of common optical systems. However, their implementation is challenging, since the generation of a large size continuous mosaic synthetic aperture composed of many patterns is complicated in terms of both phase matching and time-multiplexing duration. In this study we present an advanced configuration for an incoherent holographic imaging system with super resolution qualities that creates a partial synthetic aperture. The new system, termed sparse synthetic aperture with Fresnel elements (S-SAFE), enables significantly decreasing the number of the recorded elements, and it is free from positional constrains on their location. Additionally, in order to obtain the best image quality we propose an optimal mosaicking structure derived on the basis of physical and numerical considerations, and introduce three reconstruction approaches which are compared and discussed. The super-resolution capabilities of the proposed scheme and its limitations are analyzed, numerically simulated and experimentally demonstrated. PMID:26367947

  9. Incoherent digital holograms acquired by interferenceless coded aperture correlation holography system without refractive lenses.

    Science.gov (United States)

    Kumar, Manoj; Vijayakumar, A; Rosen, Joseph

    2017-09-14

    We present a lensless, interferenceless incoherent digital holography technique based on the principle of coded aperture correlation holography. The acquired digital hologram by this technique contains a three-dimensional image of some observed scene. Light diffracted by a point object (pinhole) is modulated using a random-like coded phase mask (CPM) and the intensity pattern is recorded and composed as a point spread hologram (PSH). A library of PSHs is created using the same CPM by moving the pinhole to all possible axial locations. Intensity diffracted through the same CPM from an object placed within the axial limits of the PSH library is recorded by a digital camera. The recorded intensity this time is composed as the object hologram. The image of the object at any axial plane is reconstructed by cross-correlating the object hologram with the corresponding component of the PSH library. The reconstruction noise attached to the image is suppressed by various methods. The reconstruction results of multiplane and thick objects by this technique are compared with regular lens-based imaging.

  10. Global measures of ionospheric electrodynamic activity inferred from combined incoherent scatter radar and ground magnetometer observations

    International Nuclear Information System (INIS)

    Richmond, A.D.; Kamide, Y.; Akasofu, S.I.; Alcayde, D.; Blanc, M.; De LaBeaujardiere, O.; Evans, D.S.; Foster, J.C.; Holt, J.M.; Friis-Christensen, E.; Pellinen, R.J.; Senior, C.; Zaitzev, A.N.

    1990-01-01

    An analysis of several global measures of high-latitude ionospheric electrodynamic activity is undertakn on the basis of results obtained from the Assimilative Mapping of Ionospheric Electrodynamics (AMIE) procedure applied to incoherent scatter radar and ground magnetometer observatons for January 18-19, 1984. Different global measures of electric potentials, currents, resistances, and energy transfer from the magnetosphere show temporal variations that are generally well correlated. The authors present parameterizations of thees quantities in terms of the AE index and the hemispheric power index of precipitating auroral particles. It is shown how error estimates of the mapped electric fields can be used to correct the estimation of Joule heating. Global measures of potential drop, field-aligned current, and Joule heating as obtained by the AMIE procedure are compared with similar measures presented in previous studies. Agreement is found to within the uncertainties inherent in each study. The mean potential drop through which field-aligned currents flow in closing through the ionosphere is approximately 28% of the total polar cap potential drop under all conditions during these 2 days. They note that order-of-magnitude differences can appear when comparing different global measures of total electric current flow and of effective resistances of the global circuit, so that care must be exercised in choosing characteristic values of these parameters for circuit-analogy studies of ionosphere-magnetosphere electrodynamic coupling

  11. Incoherent manipulation of the photoactive yellow protein photocycle with dispersed pump-dump-probe spectroscopy.

    Science.gov (United States)

    Larsen, Delmar S; van Stokkum, Ivo H M; Vengris, Mikas; van Der Horst, Michael A; de Weerd, Frank L; Hellingwerf, Klaas J; van Grondelle, Rienk

    2004-09-01

    Photoactive yellow protein is the protein responsible for initiating the "blue-light vision" of Halorhodospira halophila. The dynamical processes responsible for triggering the photoactive yellow protein photocycle have been disentangled with the use of a novel application of dispersed ultrafast pump-dump-probe spectroscopy, where the photocycle can be started and interrupted with appropriately tuned and timed laser pulses. This "incoherent" manipulation of the photocycle allows for the detailed spectroscopic investigation of the underlying photocycle dynamics and the construction of a fully self-consistent dynamical model. This model requires three kinetically distinct excited-state intermediates, two (ground-state) photocycle intermediates, I(0) and pR, and a ground-state intermediate through which the protein, after unsuccessful attempts at initiating the photocycle, returns to the equilibrium ground state. Also observed is a previously unknown two-photon ionization channel that generates a radical and an ejected electron into the protein environment. This second excitation pathway evolves simultaneously with the pathway containing the one-photon photocycle intermediates.

  12. Noise processing by microRNA-mediated circuits: The Incoherent Feed-Forward Loop, revisited

    Directory of Open Access Journals (Sweden)

    Silvia Grigolon

    2016-04-01

    Full Text Available The intrinsic stochasticity of gene expression is usually mitigated in higher eukaryotes by post-transcriptional regulation channels that stabilise the output layer, most notably protein levels. The discovery of small non-coding RNAs (miRNAs in specific motifs of the genetic regulatory network has led to identifying noise buffering as the possible key function they exert in regulation. Recent in vitro and in silico studies have corroborated this hypothesis. It is however also known that miRNA-mediated noise reduction is hampered by transcriptional bursting in simple topologies. Here, using stochastic simulations validated by analytical calculations based on van Kampen's expansion, we revisit the noise-buffering capacity of the miRNA-mediated Incoherent Feed Forward Loop (IFFL, a small module that is widespread in the gene regulatory networks of higher eukaryotes, in order to account for the effects of intermittency in the transcriptional activity of the modulator gene. We show that bursting considerably alters the circuit's ability to control static protein noise. By comparing with other regulatory architectures, we find that direct transcriptional regulation significantly outperforms the IFFL in a broad range of kinetic parameters. This suggests that, under pulsatile inputs, static noise reduction may be less important than dynamical aspects of noise and information processing in characterising the performance of regulatory elements.

  13. A new method for incoherent combining of far-field laser beams based on multiple faculae recognition

    Science.gov (United States)

    Ye, Demao; Li, Sichao; Yan, Zhihui; Zhang, Zenan; Liu, Yuan

    2018-03-01

    Compared to coherent beam combining, incoherent beam combining can complete the output of high power laser beam with high efficiency, simple structure, low cost and high thermal damage resistance, and it is easy to realize in engineering. Higher target power is achieved by incoherent beam combination which using technology of multi-channel optical path correction. However, each channel forms a spot in the far field respectively, which cannot form higher laser power density with low overlap ratio of faculae. In order to improve the combat effectiveness of the system, it is necessary to overlap different faculae that improve the target energy density. Hence, a novel method for incoherent combining of far-field laser beams is present. The method compromises piezoelectric ceramic technology and evaluation algorithm of faculae coincidence degree which based on high precision multi-channel optical path correction. The results show that the faculae recognition algorithm is low-latency(less than 10ms), which can meet the needs of practical engineering. Furthermore, the real time focusing ability of far field faculae is improved which was beneficial to the engineering of high-energy laser weapon or other laser jamming systems.

  14. Aspect sensitive E- and F-region SPEAR-enhanced incoherent backscatter observed by the EISCAT Svalbard radar

    Directory of Open Access Journals (Sweden)

    R. S. Dhillon

    2009-01-01

    Full Text Available Previous studies of the aspect sensitivity of heater-enhanced incoherent radar backscatter in the high-latitude ionosphere have demonstrated the directional dependence of incoherent scatter signatures corresponding to artificially excited electrostatic waves, together with consistent field-aligned signatures that may be related to the presence of artificial field-aligned irregularities. These earlier high-latitude results have provided motivation for repeating the investigation in the different geophysical conditions that obtain in the polar cap ionosphere. The Space Plasma Exploration by Active Radar (SPEAR facility is located within the polar cap and has provided observations of RF-enhanced ion and plasma line spectra recorded by the EISCAT Svalbard UHF incoherent scatter radar system (ESR, which is collocated with SPEAR. In this paper, we present observations of aspect sensitive E- and F-region SPEAR-induced ion and plasma line enhancements that indicate excitation of both the purely growing mode and the parametric decay instability, together with sporadic E-layer results that may indicate the presence of cavitons. We note consistent enhancements from field-aligned, vertical and also from 5° south of field-aligned. We attribute the prevalence of vertical scatter to the importance of the Spitze region, and of that from field-aligned to possible wave/irregularity coupling.

  15. Improved BER based on intensity noise alleviation using developed detection technique for incoherent SAC-OCDMA systems

    Science.gov (United States)

    Al-Khafaji, Hamza M. R.; Aljunid, S. A.; Fadhil, Hilal A.

    2012-06-01

    The major drawback of incoherent spectral-amplitude coding optical code-division multiple-access (SAC-OCDMA) systems is their inherent intensity noise originating due to the incoherency of the broadband light sources. In this paper, we propose a developed detection technique named the modified-AND subtraction detection for incoherent SAC-OCDMA systems. This detection technique is based upon decreasing the received signal strength during the decoding process by dividing the spectrum of the utilized code sequence. The proposed technique is capable of mitigating the intensity noise effect, as well as suppressing the multiple-access interference impact. Based on modified quadratic congruence (MQC) code, the analytical results reveal that the modified-AND detection offer best bit-error rate (BER) performance and enables MQC code to support higher transmission rate up to 1.25 Gb/s compared to conventional AND detection. Furthermore, we ascertained that the proposed technique enhances the system performance using a simulation experiment.

  16. Comparison of biexponential and monoexponential model of diffusion-weighted imaging for distinguishing between common renal cell carcinoma and fat poor angiomyolipoma

    International Nuclear Information System (INIS)

    Ding, Yuqin; Zeng, Mengsu; Rao, Shengxiang; Chen, Caizhong; Fu, Caixia

    2016-01-01

    To compare the diagnostic accuracy of intravoxel incoherent motion (IVIM)-derived parameters and apparent diffusion coefficient (ADC) in distinguishing between renal cell carcinoma (RCC) and fat poor angiomyolipoma (AML). Eighty-three patients with pathologically confirmed renal tumors were included in the study. All patients underwent renal 1.5T MRI, including IVIM protocol with 8 b values (0-800 s/mm"2). The ADC, diffusion coefficient (D), pseudodiffusion coefficient (D*), and perfusion fraction (f) were calculated. One-way ANOVA was used for comparing ADC and IVIM-derived parameters among clear cell RCC (ccRCC), non-ccRCC and fat poor AML. The diagnostic performance of these parameters was evaluated by using receiver operating characteristic (ROC) analysis. The ADC were significantly greater in ccRCCs than that of non-ccRCCs and fat poor AMLs (each p 0.97 × 10"-"3 mm"2/s, D* < 28.03 × 10"-"3 mm"2/s, and f < 13.61% maximized the diagnostic sensitivity for distinguishing non-ccRCCs from fat poor AMLs. The final estimates of AUC (95% confidence interval), sensitivity, specificity, positive predictive value, negative predictive value and accuracy for the entire cohort were 0.875 (0.719-0.962), 100% (23/23), 75% (9/12), 88.5% (23/26), 100% (9/9), and 91.4% (32/35), respectively. The ADC and D showed similar diagnostic accuracy in distinguishing between ccRCCs and fat poor AMLs. The IVIM-derived parameters were better than ADC in discriminating non-ccRCCs from fat poor AMLs

  17. Theoretical and experimental studies of the influence of the number of crosstalk signals on the penalty caused by incoherent optical crosstalk

    DEFF Research Database (Denmark)

    Rasmussen, Christian Jørgen; Liu, Fenghai; Pedersen, Rune Johan Skullerud

    1999-01-01

    Calculations based on the exact probability density function of the received power show that for a fixed total crosstalk power, the incoherent crosstalk penalty increases with the number of crosstalk signals. Performed experiments verify this.......Calculations based on the exact probability density function of the received power show that for a fixed total crosstalk power, the incoherent crosstalk penalty increases with the number of crosstalk signals. Performed experiments verify this....

  18. Attention and apparent motion.

    Science.gov (United States)

    Horowitz, T; Treisman, A

    1994-01-01

    Two dissociations between short- and long-range motion in visual search are reported. Previous research has shown parallel processing for short-range motion and apparently serial processing for long-range motion. This finding has been replicated and it has also been found that search for short-range targets can be impaired both by using bicontrast stimuli, and by prior adaptation to the target direction of motion. Neither factor impaired search in long-range motion displays. Adaptation actually facilitated search with long-range displays, which is attributed to response-level effects. A feature-integration account of apparent motion is proposed. In this theory, short-range motion depends on specialized motion feature detectors operating in parallel across the display, but subject to selective adaptation, whereas attention is needed to link successive elements when they appear at greater separations, or across opposite contrasts.

  19. Mechanism and kinetics of hydrated electron diffusion

    International Nuclear Information System (INIS)

    Tay, Kafui A.; Coudert, Francois-Xavier; Boutin, Anne

    2008-01-01

    Molecular dynamics simulations are used to study the mechanism and kinetics of hydrated electron diffusion. The electron center of mass is found to exhibit Brownian-type behavior with a diffusion coefficient considerably greater than that of the solvent. As previously postulated by both experimental and theoretical works, the instantaneous response of the electron to the librational motions of surrounding water molecules constitutes the principal mode of motion. The diffusive mechanism can be understood within the traditional framework of transfer diffusion processes, where the diffusive step is akin to the exchange of an extramolecular electron between neighboring water molecules. This is a second-order process with a computed rate constant of 5.0 ps -1 at 298 K. In agreement with experiment the electron diffusion exhibits Arrhenius behavior over the temperature range of 298-400 K. We compute an activation energy of 8.9 kJ mol -1 . Through analysis of Arrhenius plots and the application of a simple random walk model it is demonstrated that the computed rate constant for exchange of an excess electron is indeed the phenomenological rate constant associated with the diffusive process

  20. Objects in Motion

    Science.gov (United States)

    Damonte, Kathleen

    2004-01-01

    One thing scientists study is how objects move. A famous scientist named Sir Isaac Newton (1642-1727) spent a lot of time observing objects in motion and came up with three laws that describe how things move. This explanation only deals with the first of his three laws of motion. Newton's First Law of Motion says that moving objects will continue…

  1. Motion compensated digital tomosynthesis

    NARCIS (Netherlands)

    van der Reijden, Anneke; van Herk, Marcel; Sonke, Jan-Jakob

    2013-01-01

    Digital tomosynthesis (DTS) is a limited angle image reconstruction method for cone beam projections that offers patient surveillance capabilities during VMAT based SBRT delivery. Motion compensation (MC) has the potential to mitigate motion artifacts caused by respiratory motion, such as blur. The

  2. Parameter estimation in fractional diffusion models

    CERN Document Server

    Kubilius, Kęstutis; Ralchenko, Kostiantyn

    2017-01-01

    This book is devoted to parameter estimation in diffusion models involving fractional Brownian motion and related processes. For many years now, standard Brownian motion has been (and still remains) a popular model of randomness used to investigate processes in the natural sciences, financial markets, and the economy. The substantial limitation in the use of stochastic diffusion models with Brownian motion is due to the fact that the motion has independent increments, and, therefore, the random noise it generates is “white,” i.e., uncorrelated. However, many processes in the natural sciences, computer networks and financial markets have long-term or short-term dependences, i.e., the correlations of random noise in these processes are non-zero, and slowly or rapidly decrease with time. In particular, models of financial markets demonstrate various kinds of memory and usually this memory is modeled by fractional Brownian diffusion. Therefore, the book constructs diffusion models with memory and provides s...

  3. Time-averaged MSD of Brownian motion

    International Nuclear Information System (INIS)

    Andreanov, Alexei; Grebenkov, Denis S

    2012-01-01

    We study the statistical properties of the time-averaged mean-square displacements (TAMSD). This is a standard non-local quadratic functional for inferring the diffusion coefficient from an individual random trajectory of a diffusing tracer in single-particle tracking experiments. For Brownian motion, we derive an exact formula for the Laplace transform of the probability density of the TAMSD by mapping the original problem onto chains of coupled harmonic oscillators. From this formula, we deduce the first four cumulant moments of the TAMSD, the asymptotic behavior of the probability density and its accurate approximation by a generalized Gamma distribution

  4. Time-averaged MSD of Brownian motion

    Science.gov (United States)

    Andreanov, Alexei; Grebenkov, Denis S.

    2012-07-01

    We study the statistical properties of the time-averaged mean-square displacements (TAMSD). This is a standard non-local quadratic functional for inferring the diffusion coefficient from an individual random trajectory of a diffusing tracer in single-particle tracking experiments. For Brownian motion, we derive an exact formula for the Laplace transform of the probability density of the TAMSD by mapping the original problem onto chains of coupled harmonic oscillators. From this formula, we deduce the first four cumulant moments of the TAMSD, the asymptotic behavior of the probability density and its accurate approximation by a generalized Gamma distribution.

  5. Analysis of clad motion during a loss of flow (LOF) accident in a fast sodium cooled reactor

    International Nuclear Information System (INIS)

    Henkel, P.

    1985-10-01

    A new model describing clad motion during a Loss of Flow (LOF) accident in a Liquid Metal Cooled Fast (Breeder) Reactor (LMFBR) is presented. Its special features are Clad motion is treated within a fuel pin bundle. The bundle geometry is represented by an equivalent annular geometry which serves as the descriptional basis for the clad motion analysis; Several flow regimes are considered. These include a wave or film flow along the fuel pin surfaces as well as a drop flow within the coolant channels. A new entrainment criterion is successfully applied to describe the entrainment of molten cladding and the coolant flow is modelled as a two-dimensional, monstationary flow. Therefore, radial cross flows in a pin bundle can be calculated. Especially, thermal incoherency effects can be treated consistently. The analysis of clad motion in the two experiments STAR1 and STAR2 using the subsequently presented SANDCMOT model gives good agreement with the experimental data. (orig.) [de

  6. Active Teaching of Diffusion through History of Science, Computer Animation and Role Playing

    Science.gov (United States)

    Krajsek, Simona Strgulc; Vilhar, Barbara

    2010-01-01

    We developed and tested a lesson plan for active teaching of diffusion in secondary schools (grades 10-13), which stimulates understanding of the thermal (Brownian) motion of particles as the principle underlying diffusion. During the lesson, students actively explore the Brownian motion through microscope observations of irregularly moving small…

  7. Estimates for diffusion barriers and atomic potentials in MGO

    International Nuclear Information System (INIS)

    Skala, L.; Kenkre, V.M.

    1991-01-01

    In this paper, as part of a program of investigation of microwave sintering, self-consistent CNDO/2 calculations are presented for diffusion barriers and potentials for the motion of interstitial atoms and vacancies in MgO. Clusters of 30 atoms are used in the calculations. Activation energies, diffusion barriers, shape of the potentials and electron densities are obtained

  8. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  9. Simple Brownian diffusion an introduction to the standard theoretical models

    CERN Document Server

    Gillespie, Daniel T

    2013-01-01

    Brownian diffusion, the motion of large molecules in a sea of very many much smaller molecules, is topical because it is one of the ways in which biologically important molecules move about inside living cells. This book presents the mathematical physics that underlies the four simplest models of Brownian diffusion.

  10. Optimizing experimental parameters for tracking of diffusing particles

    DEFF Research Database (Denmark)

    Vestergaard, Christian L.

    2016-01-01

    We describe how a single-particle tracking experiment should be designed in order for its recorded trajectories to contain the most information about a tracked particle's diffusion coefficient. The precision of estimators for the diffusion coefficient is affected by motion blur, limited photon st...

  11. O'Connell's process as a vicious Brownian motion

    International Nuclear Information System (INIS)

    Katori, Makoto

    2011-01-01

    Vicious Brownian motion is a diffusion scaling limit of Fisher's vicious walk model, which is a system of Brownian particles in one dimension such that if two motions meet they kill each other. We consider the vicious Brownian motions conditioned never to collide with each other and call it noncolliding Brownian motion. This conditional diffusion process is equivalent to the eigenvalue process of the Hermitian-matrix-valued Brownian motion studied by Dyson [J. Math. Phys. 3, 1191 (1962)]. Recently, O'Connell [Ann. Probab. (to be published)] introduced a generalization of the noncolliding Brownian motion by using the eigenfunctions (the Whittaker functions) of the quantum Toda lattice in order to analyze a directed polymer model in 1 + 1 dimensions. We consider a system of one-dimensional Brownian motions with a long-ranged killing term as a generalization of the vicious Brownian motion and construct the O'Connell process as a conditional process of the killing Brownian motions to survive forever.

  12. Simulating intrafraction prostate motion with a random walk model.

    Science.gov (United States)

    Pommer, Tobias; Oh, Jung Hun; Munck Af Rosenschöld, Per; Deasy, Joseph O

    2017-01-01

    Prostate motion during radiation therapy (ie, intrafraction motion) can cause unwanted loss of radiation dose to the prostate and increased dose to the surrounding organs at risk. A compact but general statistical description of this motion could be useful for simulation of radiation therapy delivery or margin calculations. We investigated whether prostate motion could be modeled with a random walk model. Prostate motion recorded during 548 radiation therapy fractions in 17 patients was analyzed and used for input in a random walk prostate motion model. The recorded motion was categorized on the basis of whether any transient excursions (ie, rapid prostate motion in the anterior and superior direction followed by a return) occurred in the trace and transient motion. This was separately modeled as a large step in the anterior/superior direction followed by a returning large step. Random walk simulations were conducted with and without added artificial transient motion using either motion data from all observed traces or only traces without transient excursions as model input, respectively. A general estimate of motion was derived with reasonable agreement between simulated and observed traces, especially during the first 5 minutes of the excursion-free simulations. Simulated and observed diffusion coefficients agreed within 0.03, 0.2 and 0.3 mm 2 /min in the left/right, superior/inferior, and anterior/posterior directions, respectively. A rapid increase in variance at the start of observed traces was difficult to reproduce and seemed to represent the patient's need to adjust before treatment. This could be estimated somewhat using artificial transient motion. Random walk modeling is feasible and recreated the characteristics of the observed prostate motion. Introducing artificial transient motion did not improve the overall agreement, although the first 30 seconds of the traces were better reproduced. The model provides a simple estimate of prostate motion during

  13. Rolling Shutter Motion Deblurring

    KAUST Repository

    Su, Shuochen

    2015-06-07

    Although motion blur and rolling shutter deformations are closely coupled artifacts in images taken with CMOS image sensors, the two phenomena have so far mostly been treated separately, with deblurring algorithms being unable to handle rolling shutter wobble, and rolling shutter algorithms being incapable of dealing with motion blur. We propose an approach that delivers sharp and undis torted output given a single rolling shutter motion blurred image. The key to achieving this is a global modeling of the camera motion trajectory, which enables each scanline of the image to be deblurred with the corresponding motion segment. We show the results of the proposed framework through experiments on synthetic and real data.

  14. Smoothing Motion Estimates for Radar Motion Compensation.

    Energy Technology Data Exchange (ETDEWEB)

    Doerry, Armin W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-07-01

    Simple motion models for complex motion environments are often not adequate for keeping radar data coherent. Eve n perfect motion samples appli ed to imperfect models may lead to interim calculations e xhibiting errors that lead to degraded processing results. Herein we discuss a specific i ssue involving calculating motion for groups of pulses, with measurements only available at pulse-group boundaries. - 4 - Acknowledgements This report was funded by General A tomics Aeronautical Systems, Inc. (GA-ASI) Mission Systems under Cooperative Re search and Development Agre ement (CRADA) SC08/01749 between Sandia National Laboratories and GA-ASI. General Atomics Aeronautical Systems, Inc. (GA-ASI), an affilia te of privately-held General Atomics, is a leading manufacturer of Remotely Piloted Aircraft (RPA) systems, radars, and electro-optic and rel ated mission systems, includin g the Predator(r)/Gray Eagle(r)-series and Lynx(r) Multi-mode Radar.

  15. A new model of anomalous phosphorus diffusion in silicon

    International Nuclear Information System (INIS)

    Budil, M.; Poetzl, H.; Stingeder, G.; Grasserbauer, M.

    1989-01-01

    A model is presented to describe the 'kink and tail' diffusion of phosphorus. The diffusion behaviour of phosphorus is expplained by the motion of phosphorus-interstitial and phosphorus-vacancy pairs in different charge states. The model yields the enhancement of diffusion in the tail region depending on surface concentration. Furthermore it yields the same selfdiffusion coefficient for interstitials as the gold diffusion experiments. A transformation of the diffusion equation was found to reduce the number of simulation equations. (author) 7 refs., 5 figs

  16. Diffusion imaging and tractography of congenital brain malformations

    International Nuclear Information System (INIS)

    Wahl, Michael; Barkovich, A.J.; Mukherjee, Pratik

    2010-01-01

    Diffusion imaging is an MRI modality that measures the microscopic molecular motion of water in order to investigate white matter microstructure. The modality has been used extensively in recent years to investigate the neuroanatomical basis of congenital brain malformations. We review the basic principles of diffusion imaging and of specific techniques, including diffusion tensor imaging (DTI) and high angular resolution diffusion imaging (HARDI). We show how DTI and HARDI, and their application to fiber tractography, has elucidated the aberrant connectivity underlying a number of congenital brain malformations. Finally, we discuss potential uses for diffusion imaging of developmental disorders in the clinical and research realms. (orig.)

  17. Diffusion of tritiated water (HTO) in dextran+water mixtures

    International Nuclear Information System (INIS)

    Comper, W.D.; Van Damme, M.P.I.; Preston, B.N.

    1982-01-01

    The diffusion of HTO has been measured in dextran solutions using an open-ended capillary technique and a newly developed Sundeloef diffusion cell. HTO diffusion has been examined as a function of dextran concentration and molecular weight. These results, together with our previous results on the intradiffusion and mutual-diffusion coefficients of dextrans, now provide a complete set of conventional translational diffusion coefficients for both components in this binary system. Various assumptions associated with the theoretical description of polymer translational motion can now be examined. (author)

  18. Curves from Motion, Motion from Curves

    Science.gov (United States)

    2000-01-01

    De linearum curvarum cum lineis rectis comparatione dissertatio geometrica - an appendix to a treatise by de Lalouv~re (this was the only publication... correct solution to the problem of motion in the gravity of a permeable rotating Earth, considered by Torricelli (see §3). If the Earth is a homogeneous...in 1686, which contains the correct solution as part of a remarkably comprehensive theory of orbital motions under centripetal forces. It is a

  19. Diffusion weighted imaging by MR method

    International Nuclear Information System (INIS)

    Horikawa, Yoshiharu; Naruse, Shoji; Ebisu, Toshihiko; Tokumitsu, Takuaki; Ueda, Satoshi; Tanaka, Chuzo; Higuchi, Toshihiro; Umeda, Masahiro.

    1993-01-01

    Diffusion weighted magnetic resonance imaging is a recently developed technique used to examine the micromovement of water molecules in vivo. We have applied this technique to examine various kinds of brain diseases, both experimentally and clinically. The calculated apparent diffusion coefficient (ADC) in vivo showed reliable values. In experimentally induced brain edema in rats, the pathophysiological difference of the type of edema (such as cytotoxic, and vasogenic) could be differentiated on the diffusion weighted MR images. Cytotoxic brain edema showed high intensity (slower diffusion) on the diffusion weighted images. On the other hand, vasogenic brain edema showed a low intensity image (faster diffusion). Diffusion anisotropy was demonstrated according to the direction of myelinated fibers and applied motion proving gradient (MPG). This anisotropy was also demonstrated in human brain tissue along the course of the corpus callosum, pyramidal tract and optic radiation. In brain ischemia cases, lesions were detected as high signal intensity areas, even one hour after the onset of ischemia. Diffusion was faster in brain tumor compared with normal brain. Histological differences were not clearly reflected by the ADC value. In epidermoid tumor cases, the intensity was characteristically high, was demonstrated, and the cerebrospinal fluid border was clearly demonstrated. New clinical information obtainable with this molecular diffusion method will prove to be useful in various clinical studies. (author)

  20. Fractional Brownian motion with a reflecting wall

    Science.gov (United States)

    Wada, Alexander H. O.; Vojta, Thomas

    2018-02-01

    Fractional Brownian motion, a stochastic process with long-time correlations between its increments, is a prototypical model for anomalous diffusion. We analyze fractional Brownian motion in the presence of a reflecting wall by means of Monte Carlo simulations. Whereas the mean-square displacement of the particle shows the expected anomalous diffusion behavior ˜tα , the interplay between the geometric confinement and the long-time memory leads to a highly non-Gaussian probability density function with a power-law singularity at the barrier. In the superdiffusive case α >1 , the particles accumulate at the barrier leading to a divergence of the probability density. For subdiffusion α implications of these findings, in particular, for applications that are dominated by rare events.

  1. Structural motion engineering

    CERN Document Server

    Connor, Jerome

    2014-01-01

    This innovative volume provides a systematic treatment of the basic concepts and computational procedures for structural motion design and engineering for civil installations. The authors illustrate the application of motion control to a wide spectrum of buildings through many examples. Topics covered include optimal stiffness distributions for building-type structures, the role of damping in controlling motion, tuned mass dampers, base isolation systems, linear control, and nonlinear control. The book's primary objective is the satisfaction of motion-related design requirements, such as restrictions on displacement and acceleration. The book is ideal for practicing engineers and graduate students. This book also: ·         Broadens practitioners' understanding of structural motion control, the enabling technology for motion-based design ·         Provides readers the tools to satisfy requirements of modern, ultra-high strength materials that lack corresponding stiffness, where the motion re...

  2. The role of incoherent microRNA-mediated feedforward loops in noise buffering.

    Directory of Open Access Journals (Sweden)

    Matteo Osella

    2011-03-01

    Full Text Available MicroRNAs are endogenous non-coding RNAs which negatively regulate the expression of protein-coding genes in plants and animals. They are known to play an important role in several biological processes and, together with transcription factors, form a complex and highly interconnected regulatory network. Looking at the structure of this network, it is possible to recognize a few overrepresented motifs which are expected to perform important elementary regulatory functions. Among them, a special role is played by the microRNA-mediated feedforward loop in which a master transcription factor regulates a microRNA and, together with it, a set of target genes. In this paper we show analytically and through simulations that the incoherent version of this motif can couple the fine-tuning of a target protein level with an efficient noise control, thus conferring precision and stability to the overall gene expression program, especially in the presence of fluctuations in upstream regulators. Among the other results, a nontrivial prediction of our model is that the optimal attenuation of fluctuations coincides with a modest repression of the target expression. This feature is coherent with the expected fine-tuning function and in agreement with experimental observations of the actual impact of a wide class of microRNAs on the protein output of their targets. Finally, we describe the impact on noise-buffering efficiency of the cross-talk between microRNA targets that can naturally arise if the microRNA-mediated circuit is not considered as isolated, but embedded in a larger network of regulations.

  3. Comparison of the performance of different radar pulse compression techniques in an incoherent scatter radar measurement

    Directory of Open Access Journals (Sweden)

    B. Damtie

    2009-02-01

    Full Text Available Improving an estimate of an incoherent scatter radar signal is vital to provide reliable and unbiased information about the Earth's ionosphere. Thus optimizing the measurement spatial and temporal resolutions has attracted considerable attention. The optimization usually relies on employing different kinds of pulse compression filters in the analysis and a matched filter is perhaps the most widely used one. A mismatched filter has also been used in order to suppress the undesirable sidelobes that appear in the case of matched filtering. Moreover, recently an adaptive pulse compression method, which can be derived based on the minimum mean-square error estimate, has been proposed. In this paper we have investigated the performance of matched, mismatched and adaptive pulse compression methods in terms of the output signal-to-noise ratio (SNR and the variance and bias of the estimator. This is done by using different types of optimal radar waveforms. It is shown that for the case of low SNR the signal degradation associated to an adaptive filtering is less than that of the mismatched filtering. The SNR loss of both matched and adaptive pulse compression techniques was found to be nearly the same for most of the investigated codes for the case of high SNR. We have shown that the adaptive filtering technique is a compromise between matched and mismatched filtering method when one evaluates its performance in terms of the variance and the bias of the estimator. All the three analysis methods were found to have the same performance when a sidelobe-free matched filter code is employed.

  4. Comparison of the performance of different radar pulse compression techniques in an incoherent scatter radar measurement

    Directory of Open Access Journals (Sweden)

    B. Damtie

    2009-02-01

    Full Text Available Improving an estimate of an incoherent scatter radar signal is vital to provide reliable and unbiased information about the Earth's ionosphere. Thus optimizing the measurement spatial and temporal resolutions has attracted considerable attention. The optimization usually relies on employing different kinds of pulse compression filters in the analysis and a matched filter is perhaps the most widely used one. A mismatched filter has also been used in order to suppress the undesirable sidelobes that appear in the case of matched filtering. Moreover, recently an adaptive pulse compression method, which can be derived based on the minimum mean-square error estimate, has been proposed. In this paper we have investigated the performance of matched, mismatched and adaptive pulse compression methods in terms of the output signal-to-noise ratio (SNR and the variance and bias of the estimator. This is done by using different types of optimal radar waveforms. It is shown that for the case of low SNR the signal degradation associated to an adaptive filtering is less than that of the mismatched filtering. The SNR loss of both matched and adaptive pulse compression techniques was found to be nearly the same for most of the investigated codes for the case of high SNR. We have shown that the adaptive filtering technique is a compromise between matched and mismatched filtering method when one evaluates its performance in terms of the variance and the bias of the estimator. All the three analysis methods were found to have the same performance when a sidelobe-free matched filter code is employed.

  5. Dissipation and decoherence in Brownian motion

    Energy Technology Data Exchange (ETDEWEB)

    Bellomo, Bruno [Dipartimento di Scienze Fisiche ed Astronomiche dell' Universita di Palermo, Via Archirafi, 36, 90123 Palermo (Italy); Barnett, Stephen M [Department of Physics, University of Strathclyde, Glasgow G4 0NG (United Kingdom); Jeffers, John [Department of Physics, University of Strathclyde, Glasgow G4 0NG (United Kingdom)

    2007-05-15

    We consider the evolution of a Brownian particle described by a measurement-based master equation. We derive the solution to this equation for general initial conditions and apply it to a Gaussian initial state. We analyse the effects of the diffusive terms, present in the master equation, and describe how these modify uncertainties and coherence length. This allows us to model dissipation and decoherence in quantum Brownian motion.

  6. Diffusion archeology for diffusion progression history reconstruction.

    Science.gov (United States)

    Sefer, Emre; Kingsford, Carl

    2016-11-01

    Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring - perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial diffusion data. Here, we tackle the problem of reconstructing a diffusion history from one or more snapshots of the diffusion state. This ability can be invaluable to learn when certain computer nodes are infected or which people are the initial disease spreaders to control future diffusions. We formulate this problem over discrete-time SEIRS-type diffusion models in terms of maximum likelihood. We design methods that are based on submodularity and a novel prize-collecting dominating-set vertex cover (PCDSVC) relaxation that can identify likely diffusion steps with some provable performance guarantees. Our methods are the first to be able to reconstruct complete diffusion histories accurately in real and simulated situations. As a special case, they can also identify the initial spreaders better than the existing methods for that problem. Our results for both meme and contaminant diffusion show that the partial diffusion data problem can be overcome with proper modeling and methods, and that hidden temporal characteristics of diffusion can be predicted from limited data.

  7. Brownian Motion of Asymmetric Boomerang Colloidal Particles

    Science.gov (United States)

    Chakrabarty, Ayan; Konya, Andrew; Wang, Feng; Selinger, Jonathan; Sun, Kai; Wei, Qi-Huo

    2014-03-01

    We used video microscopy and single particle tracking to study the diffusion and local behaviors of asymmetric boomerang particles in a quasi-two dimensional geometry. The motion is biased towards the center of hydrodynamic stress (CoH) and the mean square displacements of the particles are linear at short and long times with different diffusion coefficients and in the crossover regime it is sub-diffusive. Our model based on Langevin theory shows that these behaviors arise from the non-coincidence of the CoH with the center of the body. Since asymmetric boomerangs represent a class of rigid bodies of more generals shape, therefore our findings are generic and true for any non-skewed particle in two dimensions. Both experimental and theoretical results will be discussed.

  8. Motion and relativity

    CERN Document Server

    Infeld, Leopold

    1960-01-01

    Motion and Relativity focuses on the methodologies, solutions, and approaches involved in the study of motion and relativity, including the general relativity theory, gravitation, and approximation.The publication first offers information on notation and gravitational interaction and the general theory of motion. Discussions focus on the notation of the general relativity theory, field values on the world-lines, general statement of the physical problem, Newton's theory of gravitation, and forms for the equation of motion of the second kind. The text then takes a look at the approximation meth

  9. Brain Image Motion Correction

    DEFF Research Database (Denmark)

    Jensen, Rasmus Ramsbøl; Benjaminsen, Claus; Larsen, Rasmus

    2015-01-01

    The application of motion tracking is wide, including: industrial production lines, motion interaction in gaming, computer-aided surgery and motion correction in medical brain imaging. Several devices for motion tracking exist using a variety of different methodologies. In order to use such devices...... offset and tracking noise in medical brain imaging. The data are generated from a phantom mounted on a rotary stage and have been collected using a Siemens High Resolution Research Tomograph for positron emission tomography. During acquisition the phantom was tracked with our latest tracking prototype...

  10. Incoherent scattering functions of 145 keV gamma rays by K-shell electrons in Y, Ag and Au

    International Nuclear Information System (INIS)

    Raghava Rao, A.; Ramana Reddy, S.V.S.; Premchand, K.; Narasimham, K.L.; Parthasaradhi, K.; Lakshminarayana, V.

    1982-01-01

    The values of incoherent scattering functions are determined experimentally for 145 keV gamma rays in elements Au, Ag and Y at scattering angles 40 0 , 70 0 and 100 0 , using a x-ray gamma coincidence technique. The corresponding theoretical values are obtained from the tabulations of Hubbell et al, and computed from the models of Jauch and Rohrlich and Shimizu et al. A comparison between the theoretical and experimental results showed that the non-relativistic approach adopted in the theory of Shimizu et al is inapplicable to the present cases. A gross agreement is noticed between the present experimental results and the other theoretical values. (author)

  11. Neutrino-nucleus cross-sections: a unified theoretical approach for nucleon knock-out, coherent and incoherent pion production

    CERN Document Server

    Martini, M; G. Chanfray; Marteau, J

    2010-01-01

    Neutrino-nucleus cross-sections are needed to interpret neutrino oscillation data, as neutrino detectors involve complex nuclei. We present a theory of neutrino interactions with nuclei aimed at a unified description of the partial cross-sections, namely quasi-elastic and multi-nucleon emission, coherent and incoherent single pion production. We compare our approach to the available neutrino experimental data on carbon. We also discuss the evolution of the neutrino cross-sections with the mass number in view of future precision ex- periments which will use a liquid argon chamber.

  12. Generation and spectroscopic signatures of a fractional quantum Hall liquid of photons in an incoherently pumped optical cavity

    Science.gov (United States)

    Umucalılar, R. O.; Carusotto, I.

    2017-11-01

    We investigate theoretically a driven dissipative model of strongly interacting photons in a nonlinear optical cavity in the presence of a synthetic magnetic field. We show the possibility of using a frequency-dependent incoherent pump to create a strongly correlated ν =1 /2 bosonic Laughlin state of light: Due to the incompressibility of the Laughlin state, fluctuations in the total particle number and excitation of edge modes can be tamed by imposing a suitable external potential profile for photons. We further propose angular-momentum-selective spectroscopy of the emitted light as a tool to obtain unambiguous signatures of the microscopic physics of the quantum Hall liquid of light.

  13. Using the Flipchem Photochemistry Model When Fitting Incoherent Scatter Radar Data

    Science.gov (United States)

    Reimer, A. S.; Varney, R. H.

    2017-12-01

    The North face Resolute Bay Incoherent Scatter Radar (RISR-N) routinely images the dynamics of the polar ionosphere, providing measurements of the plasma density, electron temperature, ion temperature, and line of sight velocity with seconds to minutes time resolution. RISR-N does not directly measure ionospheric parameters, but backscattered signals, recording them as voltage samples. Using signal processing techniques, radar autocorrelation functions (ACF) are estimated from the voltage samples. A model of the signal ACF is then fitted to the ACF using non-linear least-squares techniques to obtain the best-fit ionospheric parameters. The signal model, and therefore the fitted parameters, depend on the ionospheric ion composition that is used [e.g. Zettergren et. al. (2010), Zou et. al. (2017)].The software used to process RISR-N ACF data includes the "flipchem" model, which is an ion photochemistry model developed by Richards [2011] that was adapted from the Field LineInterhemispheric Plasma (FLIP) model. Flipchem requires neutral densities, neutral temperatures, electron density, ion temperature, electron temperature, solar zenith angle, and F10.7 as inputs to compute ion densities, which are input to the signal model. A description of how the flipchem model is used in RISR-N fitting software will be presented. Additionally, a statistical comparison of the fitted electron density, ion temperature, electron temperature, and velocity obtained using a flipchem ionosphere, a pure O+ ionosphere, and a Chapman O+ ionosphere will be presented. The comparison covers nearly two years of RISR-N data (April 2015 - December 2016). Richards, P. G. (2011), Reexamination of ionospheric photochemistry, J. Geophys. Res., 116, A08307, doi:10.1029/2011JA016613.Zettergren, M., Semeter, J., Burnett, B., Oliver, W., Heinselman, C., Blelly, P.-L., and Diaz, M.: Dynamic variability in F-region ionospheric composition at auroral arc boundaries, Ann. Geophys., 28, 651-664, https

  14. Occurrence rate of ion upflow and downflow observed by the Poker Flat Incoherent Scatter Radar (PFISR)

    Science.gov (United States)

    Zou, S.; Lu, J.; Varney, R. H.

    2017-12-01

    This study aims to investigate the occurrence rate of ion upflow and downflow events in the auroral ionosphere, using a full 3-year (2011-2013) dataset collected by the Poker Flat Incoherent Scatter Radar (PFISR) at 65.5° magnetic latitude. Ion upflow and downflow events are defined if there are three consecutive data points larger/smaller than 100/-100 m/s in the ion field-aligned velocity altitude profile. Their occurrence rates have been evaluated as a function of magnetic local time (MLT), season, geomagnetic activity, solar wind and interplanetary magnetic field (IMF). We found that the ion upflows are twice more likely to occur on the nightside than the dayside, and have slightly higher occurrence rate near Fall equinox. In contrast, the ion downflow events are more likely to occur in the afternoon sector but also during Fall equinox. In addition, the occurrence rate of ion upflows on the nightside increases when the aurora electrojet index (AE) and planetary K index (Kp) increase, while the downflows measured on the dayside clearly increase as the AE and Kp increase. In general, the occurrence rate of ion upflows increases with enhanced solar wind and IMF drivers. This correlation is particularly strong between the upflows on the nightside and the solar wind dynamic pressure and IMF Bz. The lack of correlation of upflows on the dayside with these parameters is due to the location of PFISR, which is usually equatorward of the dayside auroral zone and within the nightside auroral zone under disturbed conditions. The occurrence rate of downflow at all MLTs does not show strong dependence on the solar wind and IMF conditions. However, it occurs much more frequently on the dayside when the IMF By is strongly positive, i.e., >10 nT and the IMF Bz is strongly negative, i.e., < -10 nT. We suggest that the increased occurrence rate of downflows on the dayside is associated with dayside storm-enhanced density and the plume.

  15. Excess Entropy and Diffusivity

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Excess Entropy and Diffusivity. Excess entropy scaling of diffusivity (Rosenfeld,1977). Analogous relationships also exist for viscosity and thermal conductivity.

  16. Time rescaling and Gaussian properties of the fractional Brownian motions

    International Nuclear Information System (INIS)

    Maccone, C.

    1981-01-01

    The fractional Brownian motions are proved to be a class of Gaussian (normal) stochastic processes suitably rescaled in time. Some consequences affecting their eigenfunction expansion (Karhunen-Loeve expansion) are inferred. A known formula of Cameron and Martin is generalized. The first-passage time probability density is found. The partial differential equation of the fractional Brownian diffusion is obtained. And finally the increments of the fractional Brownian motions are proved to be independent for nonoverlapping time intervals. (author)

  17. Random motion and Brownian rotation

    International Nuclear Information System (INIS)

    Wyllie, G.

    1980-01-01

    The course is centred on the Brownian motion - the random movement of molecules arising from thermal fluctuations of the surrounding medium - and starts with the classical theory of A. Einstein, M.v. Smoluchowski and P. Langevin. The first part of this article is quite elementary, and several of the questions raised in it have been instructively treated in a much more sophisticated way in recent reviews by Pomeau and Resibois and by Fox. This simple material may nevertheless be helpful to some readers whose main interest lies in approaching the work on Brownian rotation reviewed in the latter part of the present article. The simplest, and most brutally idealised, problem in our field of interest is that of the random walk in one dimension of space. Its solution leads on, through the diffusivity-mobility relation of Einstein, to Langevin's treatment of the Brownian motion. The application of these ideas to the movement of a molecule in a medium of similar molecules is clearly unrealistic, and much energy has been devoted to finding a suitable generalisation. We shall discuss in particular ideas due to Green, Zwanzig and Mori. (orig./WL)

  18. Brownian motion of solitons in a Bose-Einstein condensate.

    Science.gov (United States)

    Aycock, Lauren M; Hurst, Hilary M; Efimkin, Dmitry K; Genkina, Dina; Lu, Hsin-I; Galitski, Victor M; Spielman, I B

    2017-03-07

    We observed and controlled the Brownian motion of solitons. We launched solitonic excitations in highly elongated [Formula: see text] Bose-Einstein condensates (BECs) and showed that a dilute background of impurity atoms in a different internal state dramatically affects the soliton. With no impurities and in one dimension (1D), these solitons would have an infinite lifetime, a consequence of integrability. In our experiment, the added impurities scatter off the much larger soliton, contributing to its Brownian motion and decreasing its lifetime. We describe the soliton's diffusive behavior using a quasi-1D scattering theory of impurity atoms interacting with a soliton, giving diffusion coefficients consistent with experiment.

  19. Homogeneity based segmentation and enhancement of Diffusion Tensor Images : a white matter processing framework

    NARCIS (Netherlands)

    Rodrigues, P.R.

    2011-01-01

    In diffusion magnetic resonance imaging (DMRI) the Brownian motion of the water molecules, within biological tissue, is measured through a series of images. In diffusion tensor imaging (DTI) this diffusion is represented using tensors. DTI describes, in a non-invasive way, the local anisotropy

  20. Vibrations and reorientations of H2O molecules in [Sr(H2O)6]Cl2 studied by Raman light scattering, incoherent inelastic neutron scattering and proton magnetic resonance.

    Science.gov (United States)

    Hetmańczyk, Joanna; Hetmańczyk, Lukasz; Migdał-Mikuli, Anna; Mikuli, Edward; Florek-Wojciechowska, Małgorzata; Harańczyk, Hubert

    2014-04-24

    Vibrational-reorientational dynamics of H2O ligands in the high- and low-temperature phases of [Sr(H2O)6]Cl2 was investigated by Raman Spectroscopy (RS), proton magnetic resonance ((1)H NMR), quasielastic and inelastic incoherent Neutron Scattering (QENS and IINS) methods. Neutron powder diffraction (NPD) measurements, performed simultaneously with QENS, did not indicated a change of the crystal structure at the phase transition (detected earlier by differential scanning calorimetry (DSC) at TC(h)=252.9 K (on heating) and at TC(c)=226.5K (on cooling)). Temperature dependence of the full-width at half-maximum (FWHM) of νs(OH) band at ca. 3248 cm(-1) in the RS spectra indicated small discontinuity in the vicinity of phase transition temperature, what suggests that the observed phase transition may be associated with a change of the H2O reorientational dynamics. However, an activation energy value (Ea) for the reorientational motions of H2O ligands in both phases is nearly the same and equals to ca. 8 kJ mol(-1). The QENS peaks, registered for low temperature phase do not show any broadening. However, in the high temperature phase a small QENS broadening is clearly visible, what implies that the reorientational dynamics of H2O ligands undergoes a change at the phase transition. (1)H NMR line is a superposition of two powder Pake doublets, differentiated by a dipolar broadening, suggesting that there are two types of the water molecules in the crystal lattice of [Sr(H2O)6]Cl2 which are structurally not equivalent average distances between the interacting protons are: 1.39 and 1.18 Å. However, their reorientational dynamics is very similar (τc=3.3⋅10(-10) s). Activation energies for the reorientational motion of these both kinds of H2O ligands have nearly the same values in an experimental error limit: and equal to ca. 40 kJ mole(-1). The phase transition is not seen in the (1)H NMR spectra temperature dependencies. Infrared (IR), Raman (RS) and inelastic

  1. Hydration-coupled protein boson peak measured by incoherent neutron scattering

    International Nuclear Information System (INIS)

    Nakagawa, Hiroshi; Kataoka, Mikio; Joti, Yasumasa; Kitao, Akio; Shibata, Kaoru; Tokuhisa, Atsushi; Tsukushi, Itaru; Go, Nobuhiro

    2006-01-01

    The boson peak of a protein was examined in relation to hydration using staphylococcal nuclease. Although the boson peak is commonly observed in synthetic polymers, glassy materials and amorphous materials, the origin of the boson peak is not fully understood. The motions that contribute to the peak are harmonic vibrations. Upon hydration the peak frequency shifts to a higher frequency and the effective force constant of the vibration increases at low temperatures, suggesting that the protein energy surface is modified. Hydration of the protein leads to a more rugged surface and the vibrational motions are trapped within the local minimum at cryogenic temperatures. The origin of the protein boson peak may be related to this rugged energy surface

  2. Mechanisms underlying anomalous diffusion in the plasma membrane.

    Science.gov (United States)

    Krapf, Diego

    2015-01-01

    The plasma membrane is a complex fluid where lipids and proteins undergo diffusive motion critical to biochemical reactions. Through quantitative imaging analyses such as single-particle tracking, it is observed that diffusion in the cell membrane is usually anomalous in the sense that the mean squared displacement is not linear with time. This chapter describes the different models that are employed to describe anomalous diffusion, paying special attention to the experimental evidence that supports these models in the plasma membrane. We review models based on anticorrelated displacements, such as fractional Brownian motion and obstructed diffusion, and nonstationary models such as continuous time random walks. We also emphasize evidence for the formation of distinct compartments that transiently form on the cell surface. Finally, we overview heterogeneous diffusion processes in the plasma membrane, which have recently attracted considerable interest. Copyright © 2015. Published by Elsevier Inc.

  3. Wavevector and energy resolution of the polarized diffuse scattering spectrometer D7

    Energy Technology Data Exchange (ETDEWEB)

    Fennell, T., E-mail: tom.fennell@psi.ch [Laboratory for Neutron Scattering and Imaging, Paul Scherrer Institut, 5232 Villigen PSI (Switzerland); Mangin-Thro, L., E-mail: mangin-throl@ill.fr [Institut Laue-Langevin, 71 avenue des Martyrs, CS 20156 - 38042 Grenoble Cedex 9 (France); Mutka, H., E-mail: mutka@ill.fr [Institut Laue-Langevin, 71 avenue des Martyrs, CS 20156 - 38042 Grenoble Cedex 9 (France); Nilsen, G.J., E-mail: goran.nilsen@stfc.ac.uk [ISIS Neutron and Muon Source, Rutherford Appleton Laboratory, Didcot OX11 0QX (United Kingdom); Wildes, A.R., E-mail: wildes@ill.fr [Institut Laue-Langevin, 71 avenue des Martyrs, CS 20156 - 38042 Grenoble Cedex 9 (France)

    2017-06-11

    The instrumental divergence parameters and resolution for the D7 neutron diffuse scattering spectrometer at the Institut Laue-Langevin, France, are presented. The resolution parameters are calibrated against measurements of powders, single crystals, and the incoherent scattering from vanadium. We find that the powder diffraction resolution is well described by the Cagliotti function, the single crystal resolution function can be parameterized using the Cooper-Nathans formalism, and that in time-of-flight mode the energy resolution is consistent with monochromatic focussing.

  4. Molecular Dynamics Simulation of Salt Diffusion in Polyelectrolyte Assemblies.

    Science.gov (United States)

    Zhang, Ran; Duan, Xiaozheng; Ding, Mingming; Shi, Tongfei

    2018-06-05

    The diffusion of salt ions and charged probe molecules in polyelectrolyte assemblies is often assumed to follow a theoretical hopping model, in which the diffusing ion is hopping between charged sites of chains based on electroneutrality. However, experimental verification of diffusing pathway at such microscales is difficult, and the corresponding molecular mechanisms remain elusive. In this study, we perform all-atom molecular dynamics (MD) simulations of salt diffusion in polyelectrolyte (PE) assembly of poly (sodium 4-styrenesulfonate) (PSS) and poly (diallyldimethylammonium chloride) (PDAC). Besides the ion hopping mode, the diffusing trajectories are found presenting common features of a jump process, i.e., subjecting to PE relaxation, water pockets in the structure open and close, thus the ion can move from one pocket to another. Anomalous subdiffusion of ions and water is observed due to the trapping scenarios in these water pockets. The jump events are much rarer compared with ion hopping but significantly increases salt diffusion with increasing temperature. Our result strongly indicates that salt diffusion in hydrated PDAC/PSS is a combined process of ion hopping and jump motion. This provides new molecular explanation for the coupling of salt motion with chain motion and the nonlinear increase of salt diffusion at glass transition temperature.

  5. Projectile Motion Hoop Challenge

    Science.gov (United States)

    Jordan, Connor; Dunn, Amy; Armstrong, Zachary; Adams, Wendy K.

    2018-01-01

    Projectile motion is a common phenomenon that is used in introductory physics courses to help students understand motion in two dimensions. Authors have shared a range of ideas for teaching this concept and the associated kinematics in "The Physics Teacher" ("TPT"); however, the "Hoop Challenge" is a new setup not…

  6. Temporal logic motion planning

    CSIR Research Space (South Africa)

    Seotsanyana, M

    2010-01-01

    Full Text Available In this paper, a critical review on temporal logic motion planning is presented. The review paper aims to address the following problems: (a) In a realistic situation, the motion planning problem is carried out in real-time, in a dynamic, uncertain...

  7. Aristotle, Motion, and Rhetoric.

    Science.gov (United States)

    Sutton, Jane

    Aristotle rejects a world vision of changing reality as neither useful nor beneficial to human life, and instead he reaffirms both change and eternal reality, fuses motion and rest, and ends up with "well-behaved" changes. This concept of motion is foundational to his world view, and from it emerges his theory of knowledge, philosophy of…

  8. Stochastic ground motion simulation

    Science.gov (United States)

    Rezaeian, Sanaz; Xiaodan, Sun; Beer, Michael; Kougioumtzoglou, Ioannis A.; Patelli, Edoardo; Siu-Kui Au, Ivan

    2014-01-01

    Strong earthquake ground motion records are fundamental in engineering applications. Ground motion time series are used in response-history dynamic analysis of structural or geotechnical systems. In such analysis, the validity of predicted responses depends on the validity of the input excitations. Ground motion records are also used to develop ground motion prediction equations(GMPEs) for intensity measures such as spectral accelerations that are used in response-spectrum dynamic analysis. Despite the thousands of available strong ground motion records, there remains a shortage of records for large-magnitude earthquakes at short distances or in specific regions, as well as records that sample specific combinations of source, path, and site characteristics.

  9. Grasping the mechanisms of narratives' incoherence in schizophrenia: an analysis of the temporal structure of patients' life story.

    Science.gov (United States)

    Allé, M C; Gandolphe, M-C; Doba, K; Köber, C; Potheegadoo, J; Coutelle, R; Habermas, T; Nandrino, J-L; Danion, J-M; Berna, F

    2016-08-01

    Life narratives of patients with schizophrenia are characterized by impaired coherence so that the listener has often difficulties to grasp the life trajectory of the patients. In order to better understand what causes this reduced temporal coherence, we investigated the temporal structure of patients' life narratives through different temporal narrative elements (elaboration of beginnings and endings, local temporal indicators and temporal deviations from a linear order), across two complementary studies. Life narratives were collected by means of two different methods; a free recall in study 1 and a more structured protocol, aiming at reducing the cognitive task demands in study 2. All narratives from the two studies were analyzed using the same validated method. Both studies showed that global temporal coherence is significantly reduced in patients with schizophrenia (ps.02). This is mainly due to their stronger tendency to temporally deviate from a linear temporal order without marking the deviation as such. We also observed significant correlations in the patient groups between global temporal coherence and executive dysfunction (p=.008) or their higher tendency to temporally deviate from a linear temporal order in their life narratives (p<.001). These results shed light on narrative correlates of temporal narrative incoherence in schizophrenia and highlight the central role of executive dysfunction in this incoherence. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Photonic generation of FCC-compliant UWB pulses based on modified Gaussian quadruplet and incoherent wavelength-to-time conversion

    Science.gov (United States)

    Mu, Hongqian; Wang, Muguang; Tang, Yu; Zhang, Jing; Jian, Shuisheng

    2018-03-01

    A novel scheme for the generation of FCC-compliant UWB pulse is proposed based on modified Gaussian quadruplet and incoherent wavelength-to-time conversion. The modified Gaussian quadruplet is synthesized based on linear sum of a broad Gaussian pulse and two narrow Gaussian pulses with the same pulse-width and amplitude peak. Within specific parameter range, FCC-compliant UWB with spectral power efficiency of higher than 39.9% can be achieved. In order to realize the designed waveform, a UWB generator based on spectral shaping and incoherent wavelength-to-time mapping is proposed. The spectral shaper is composed of a Gaussian filter and a programmable filter. Single-mode fiber functions as both dispersion device and transmission medium. Balanced photodetection is employed to combine linearly the broad Gaussian pulse and two narrow Gaussian pulses, and at same time to suppress pulse pedestals that result in low-frequency components. The proposed UWB generator can be reconfigured for UWB doublet by operating the programmable filter as a single-band Gaussian filter. The feasibility of proposed UWB generator is demonstrated experimentally. Measured UWB pulses match well with simulation results. FCC-compliant quadruplet with 10-dB bandwidth of 6.88-GHz, fractional bandwidth of 106.8% and power efficiency of 51% is achieved.

  11. Measurements of incoherent light and background structure at exo-Earth detection levels in the High Contrast Imaging Testbed

    Science.gov (United States)

    Cady, Eric; Shaklan, Stuart

    2014-08-01

    A major component of the estimation and correction of starlight at very high contrasts is the creation of a dark hole: a region in the vicinity of the core of the stellar point spread function (PSF) where speckles in the PSF wings have been greatly attenuated, up to a factor of 1010 for the imaging of terrestrial exoplanets. At these very high contrasts, removing these speckles requires distinguishing between light from the stellar PSF scattered by instrument imperfections, which may be partially corrected across a broad band using deformable mirrors in the system, from light from other sources which generally may not. These other sources may be external or internal to the instrument (e.g. planets, exozodiacal light), but in either case, their distinguishing characteristic is their inability to interfere coherently with the PSF. In the following we discuss the estimation, structure, and expected origin of this incoherent" signal, primarily in the context of a series of experiments made with a linear band-limited mask in Jan-Mar 2013. We find that the incoherent" signal at moderate contrasts is largely estimation error of the coherent signal, while at very high contrasts it represents a true floor which is stable over week-timescales.

  12. An Improved InSAR Image Co-Registration Method for Pairs with Relatively Big Distortions or Large Incoherent Areas

    Directory of Open Access Journals (Sweden)

    Zhenwei Chen

    2016-09-01

    Full Text Available Co-registration is one of the most important steps in interferometric synthetic aperture radar (InSAR data processing. The standard offset-measurement method based on cross-correlating uniformly distributed patches takes no account of specific geometric transformation between images or characteristics of ground scatterers. Hence, it is inefficient and difficult to obtain satisfying co-registration results for image pairs with relatively big distortion or large incoherent areas. Given this, an improved co-registration strategy is proposed in this paper which takes both the geometric features and image content into consideration. Firstly, some geometric transformations including scale, flip, rotation, and shear between images were eliminated based on the geometrical information, and the initial co-registration polynomial was obtained. Then the registration points were automatically detected by integrating the signal-to-clutter-ratio (SCR thresholds and the amplitude information, and a further co-registration process was performed to refine the polynomial. Several comparison experiments were carried out using 2 TerraSAR-X data from the Hong Kong airport and 21 PALSAR data from the Donghai Bridge. Experiment results demonstrate that the proposed method brings accuracy and efficiency improvements for co-registration and processing abilities in the cases of big distortion between images or large incoherent areas in the images. For most co-registrations, the proposed method can enhance the reliability and applicability of co-registration and thus promote the automation to a higher level.

  13. An Improved InSAR Image Co-Registration Method for Pairs with Relatively Big Distortions or Large Incoherent Areas.

    Science.gov (United States)

    Chen, Zhenwei; Zhang, Lei; Zhang, Guo

    2016-09-17

    Co-registration is one of the most important steps in interferometric synthetic aperture radar (InSAR) data processing. The standard offset-measurement method based on cross-correlating uniformly distributed patches takes no account of specific geometric transformation between images or characteristics of ground scatterers. Hence, it is inefficient and difficult to obtain satisfying co-registration results for image pairs with relatively big distortion or large incoherent areas. Given this, an improved co-registration strategy is proposed in this paper which takes both the geometric features and image content into consideration. Firstly, some geometric transformations including scale, flip, rotation, and shear between images were eliminated based on the geometrical information, and the initial co-registration polynomial was obtained. Then the registration points were automatically detected by integrating the signal-to-clutter-ratio (SCR) thresholds and the amplitude information, and a further co-registration process was performed to refine the polynomial. Several comparison experiments were carried out using 2 TerraSAR-X data from the Hong Kong airport and 21 PALSAR data from the Donghai Bridge. Experiment results demonstrate that the proposed method brings accuracy and efficiency improvements for co-registration and processing abilities in the cases of big distortion between images or large incoherent areas in the images. For most co-registrations, the proposed method can enhance the reliability and applicability of co-registration and thus promote the automation to a higher level.

  14. Self-diffusion in dense granular shear flows.

    Science.gov (United States)

    Utter, Brian; Behringer, R P

    2004-03-01

    Diffusivity is a key quantity in describing velocity fluctuations in granular materials. These fluctuations are the basis of many thermodynamic and hydrodynamic models which aim to provide a statistical description of granular systems. We present experimental results on diffusivity in dense, granular shear flows in a two-dimensional Couette geometry. We find that self-diffusivities D are proportional to the local shear rate gamma; with diffusivities along the direction of the mean flow approximately twice as large as those in the perpendicular direction. The magnitude of the diffusivity is D approximately gamma;a(2), where a is the particle radius. However, the gradient in shear rate, coupling to the mean flow, and strong drag at the moving boundary lead to particle displacements that can appear subdiffusive or superdiffusive. In particular, diffusion appears to be superdiffusive along the mean flow direction due to Taylor dispersion effects and subdiffusive along the perpendicular direction due to the gradient in shear rate. The anisotropic force network leads to an additional anisotropy in the diffusivity that is a property of dense systems and has no obvious analog in rapid flows. Specifically, the diffusivity is suppressed along the direction of the strong force network. A simple random walk simulation reproduces the key features of the data, such as the apparent superdiffusive and subdiffusive behavior arising from the mean velocity field, confirming the underlying diffusive motion. The additional anisotropy is not observed in the simulation since the strong force network is not included. Examples of correlated motion, such as transient vortices, and Lévy flights are also observed. Although correlated motion creates velocity fields which are qualitatively different from collisional Brownian motion and can introduce nondiffusive effects, on average the system appears simply diffusive.

  15. Enhanced separation of diffusing particles by chaotic advection

    International Nuclear Information System (INIS)

    Aref, H.; Jones, S.W.

    1989-01-01

    Combining the reversibility of advection by a Stokes flow with the irreversibility of diffusion leads to a separation strategy for diffusing substances. This basic idea goes back to Taylor and Heller. It is shown here that the sensitivity of the method can be greatly enhanced by making the advection chaotic. The separation is particularly efficient when the thinnest structures resulting from advection are made comparable in size to a diffusion length. Simple heuristic estimates based on an understanding of chaotic motion and diffusion lead to a certain scaling that is seen in numerical experiments on this separation method

  16. On the enhancement of Er{sup 3+} diffusion in LiNbO{sub 3} crystals by Er{sup 3+}/Ti{sup 4+} co-diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, José Manuel Marques Martins de, E-mail: jmmma@utad.pt [INESC-TEC, Rua do Campo Alegre, 687, Porto 4169-007 (Portugal); Department of Physics, School of Science and Technology, University of Trás-os-Montes e Alto Douro, PO. Box 1013, 5001-801 Vila Real (Portugal); Sada, Cinzia [Dipartimento di Fisica e Astronomia G. Galilei, Università di Padova, Via Marzolo 8, 35131 Padova (Italy)

    2016-02-15

    Highlights: • Enhancement of the diffusion of erbium ions (Er{sup 3+}) in lithium niobate crystals. • Incoherence on published results lead to need for systematic revision of literature. • Further insight into the topic of co-diffusion of Er{sup 3+}/Ti{sup 4+} ions into LiNbO{sub 3}. - Abstract: After carrying out a revision of the literature on the enhancement of Er{sup 3+} diffusion in LiNbO{sub 3} crystals by Er{sup 3+}/Ti{sup 4+} co-diffusion and analyzing our own experimental results, we conclude that no reproducible results were reported, meaning that further research on this subject is necessary.

  17. Diffusion in solids

    International Nuclear Information System (INIS)

    Tiwari, G.P.; Kale, G.B.; Patil, R.V.

    1999-01-01

    The article presents a brief survey of process of diffusion in solids. It is emphasised that the essence of diffusion is the mass transfer through the atomic jumps. To begin with formal equations for diffusion coefficient are presented. This is followed by discussions on mechanisms of diffusion. Except for solutes which form interstitial solid solution, diffusion in majority of cases is mediated through exchange of sites between an atom and its neighbouring vacancy. Various vacancy parameters such as activation volume, correlation factor, mass effect etc are discussed and their role in establishing the mode of diffusion is delineated. The contribution of dislocations and grain boundaries in diffusion process is brought out. The experimental determination of different types of diffusion coefficients are described. Finally, the pervasive nature of diffusion process in number of commercial processes is outlined to show the importance of diffusion studies in materials science and technology. (author)

  18. Contact line motion in confined liquid–gas systems: Slip versus phase transition

    KAUST Repository

    Xu, Xinpeng; Qian, Tiezheng

    2010-01-01

    -slip boundary condition, as the latter leads to a nonintegrable stress singularity. Recently, various diffuse-interface models have been proposed to explain the contact line motion using mechanisms missing from the sharp-interface treatments in fluid mechanics

  19. Resolving Fast, Confined Diffusion in Bacteria with Image Correlation Spectroscopy.

    Science.gov (United States)

    Rowland, David J; Tuson, Hannah H; Biteen, Julie S

    2016-05-24

    By following single fluorescent molecules in a microscope, single-particle tracking (SPT) can measure diffusion and binding on the nanometer and millisecond scales. Still, although SPT can at its limits characterize the fastest biomolecules as they interact with subcellular environments, this measurement may require advanced illumination techniques such as stroboscopic illumination. Here, we address the challenge of measuring fast subcellular motion by instead analyzing single-molecule data with spatiotemporal image correlation spectroscopy (STICS) with a focus on measurements of confined motion. Our SPT and STICS analysis of simulations of the fast diffusion of confined molecules shows that image blur affects both STICS and SPT, and we find biased diffusion rate measurements for STICS analysis in the limits of fast diffusion and tight confinement due to fitting STICS correlation functions to a Gaussian approximation. However, we determine that with STICS, it is possible to correctly interpret the motion that blurs single-molecule images without advanced illumination techniques or fast cameras. In particular, we present a method to overcome the bias due to image blur by properly estimating the width of the correlation function by directly calculating the correlation function variance instead of using the typical Gaussian fitting procedure. Our simulation results are validated by applying the STICS method to experimental measurements of fast, confined motion: we measure the diffusion of cytosolic mMaple3 in living Escherichia coli cells at 25 frames/s under continuous illumination to illustrate the utility of STICS in an experimental parameter regime for which in-frame motion prevents SPT and tight confinement of fast diffusion precludes stroboscopic illumination. Overall, our application of STICS to freely diffusing cytosolic protein in small cells extends the utility of single-molecule experiments to the regime of fast confined diffusion without requiring advanced

  20. Collective motion in quantum many-body systems

    Energy Technology Data Exchange (ETDEWEB)

    Haemmerling, Jens

    2011-06-07

    We study the emergence of collective dynamics in the integrable Hamiltonian system of two finite ensembles of coupled harmonic oscillators. After identification of a collective degree of freedom, the Hamiltonian is mapped onto a model of Caldeira-Leggett type, where the collective coordinate is coupled to an internal bath of phonons. In contrast to the usual Caldeira-Leggett model, the bath in the present case is part of the system. We derive an equation of motion for the collective coordinate which takes the form of a damped harmonic oscillator. We show that the distribution of quantum transition strengths induced by the collective mode is determined by its classical dynamics. This allows us to derive the spreading for the collective coordinate from first principles. After that we study the interplay between collective and incoherent single-particle motion in a model of two chains of particles whose interaction comprises a non-integrable part. In the perturbative regime, but for a general form of the interaction, we calculate the Fourier transform of the time correlation for the collective coordinate. We obtain the remarkable result that it always has a unique semi-classical interpretation. We show this by a proper renormalization procedure which also allows us to map the non-integrable system to the integrable model of Caldeira-Leggett-type considered previously in which the bath is part of the system.

  1. Diffusion archeology for diffusion progression history reconstruction

    OpenAIRE

    Sefer, Emre; Kingsford, Carl

    2015-01-01

    Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring — perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial d...

  2. Structured illumination to spatially map chromatin motions.

    Science.gov (United States)

    Bonin, Keith; Smelser, Amanda; Moreno, Naike Salvador; Holzwarth, George; Wang, Kevin; Levy, Preston; Vidi, Pierre-Alexandre

    2018-05-01

    We describe a simple optical method that creates structured illumination of a photoactivatable probe and apply this method to characterize chromatin motions in nuclei of live cells. A laser beam coupled to a diffractive optical element at the back focal plane of an excitation objective generates an array of near diffraction-limited beamlets with FWHM of 340  ±  30  nm, which simultaneously photoactivate a 7  ×  7 matrix pattern of GFP-labeled histones, with spots 1.70  μm apart. From the movements of the photoactivated spots, we map chromatin diffusion coefficients at multiple microdomains of the cell nucleus. The results show correlated motions of nearest chromatin microdomain neighbors, whereas chromatin movements are uncorrelated at the global scale of the nucleus. The method also reveals a DNA damage-dependent decrease in chromatin diffusion. The diffractive optical element instrumentation can be easily and cheaply implemented on commercial inverted fluorescence microscopes to analyze adherent cell culture models. A protocol to measure chromatin motions in nonadherent human hematopoietic stem and progenitor cells is also described. We anticipate that the method will contribute to the identification of the mechanisms regulating chromatin mobility, which influences most genomic processes and may underlie the biogenesis of genomic translocations associated with hematologic malignancies. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

  3. Application of a Simplified Method for Estimating Perfusion Derived from Diffusion-Weighted MR Imaging in Glioma Grading

    Directory of Open Access Journals (Sweden)

    Mengqiu Cao

    2018-01-01

    Full Text Available Purpose: To evaluate the feasibility of a simplified method based on diffusion-weighted imaging (DWI acquired with three b-values to measure tissue perfusion linked to microcirculation, to validate it against from perfusion-related parameters derived from intravoxel incoherent motion (IVIM and dynamic contrast-enhanced (DCE magnetic resonance (MR imaging, and to investigate its utility to differentiate low- from high-grade gliomas.Materials and Methods: The prospective study was approved by the local institutional review board and written informed consent was obtained from all patients. From May 2016 and May 2017, 50 patients confirmed with glioma were assessed with multi-b-value DWI and DCE MR imaging at 3.0 T. Besides conventional apparent diffusion coefficient (ADC0,1000 map, perfusion-related parametric maps for IVIM-derived perfusion fraction (f and pseudodiffusion coefficient (D*, DCE MR imaging-derived pharmacokinetic metrics, including Ktrans, ve and vp, as well as a metric named simplified perfusion fraction (SPF, were generated. Correlation between perfusion-related parameters was analyzed by using the Spearman rank correlation. All imaging parameters were compared between the low-grade (n = 19 and high-grade (n = 31 groups by using the Mann-Whitney U test. The diagnostic performance for tumor grading was evaluated with receiver operating characteristic (ROC analysis.Results: SPF showed strong correlation with IVIM-derived f and D* (ρ = 0.732 and 0.716, respectively; both P < 0.001. Compared with f, SPF was more correlated with DCE MR imaging-derived Ktrans (ρ = 0.607; P < 0.001 and vp (ρ = 0.397; P = 0.004. Among all parameters, SPF achieved the highest accuracy for differentiating low- from high-grade gliomas, with an area under the ROC curve value of 0.942, which was significantly higher than that of ADC0,1000 (P = 0.004. By using SPF as a discriminative index, the diagnostic sensitivity and specificity were 87.1% and 94

  4. Drift motions of small-scale irregularities in the high-latitude F region: An experimental comparison with plasma drift motions

    International Nuclear Information System (INIS)

    Ruohoniemi, J.M.; Greenwald, R.A.; Baker, K.B.; Villain, J.P.; McCready, M.A.

    1987-01-01

    On the evening of January 6, 1986, coordinated observations were carried out with the Johns Hopkins University Applied Physics Laboratory HF coherent scatter radar at Goose Bay, Labrador, and the SRI International incoherent scatter radar at Sondre Stromfjord, Greenland. The common field of view comprised a section of high-latitude F region ionosphere centered on the great circle plane between the radar sites. Over a 40-min period, the HF radar observed strong backscatter from small-scale (13.9 m) field-aligned irregularities. The bulk line-of-sight drift velocity of the irregularities is deduced from the backscatter data. The returns collected simultaneously with the incoherent scatter radar are processed for estimates of the mean line-of-sight ion velocity. Approximately 100 distinct comparisons are possible between the two sets of velocity estimates. Reversals exceeding 1,000 m/s are present in both. In this paper, the authors demonstrate a correspondence between the measured irregularity and ion drifts that is consistent with the supposition that the motion of the irregularities is dominated by convective drift of the ambient plasma. This indicates that the small-scale irregularities detected by HF radars in the high-latitude F region can serve as tracers of ionospheric convective drift

  5. Intrinsic and extrinsic measurement for Brownian motion

    International Nuclear Information System (INIS)

    Castro-Villarreal, Pavel

    2014-01-01

    Based upon the Smoluchowski equation on curved manifolds, three physical observables are considered for Brownian displacement, namely geodesic displacement s, Euclidean displacement δR, and projected displacement δR ⊥ . The Weingarten–Gauss equations are used to calculate the mean-square Euclidean displacements in the short-time regime. Our findings show that from an extrinsic point of view the geometry of the space affects the Brownian motion in such a way that the particle’s diffusion is decelerated, contrasting with the intrinsic point of view where dynamics is controlled by the sign of the Gaussian curvature (Castro-Villarreal, 2010 J. Stat. Mech. P08006). Furthermore, it is possible to give exact formulas for 〈δR〉 and 〈δR 2 〉 on spheres and minimal surfaces, which are valid for all values of time. In the latter case, surprisingly, Brownian motion corresponds to the usual diffusion in flat geometries, albeit minimal surfaces have non-zero Gaussian curvature. Finally, the two-dimensional case is emphasized due to its close relation to surface self-diffusion in fluid membranes. (paper)

  6. Respiratory lung motion analysis using a nonlinear motion correction technique for respiratory-gated lung perfusion SPECT images

    International Nuclear Information System (INIS)

    Ue, Hidenori; Haneishi, Hideaki; Iwanaga, Hideyuki; Suga, Kazuyoshi

    2007-01-01

    This study evaluated the respiratory motion of lungs using a nonlinear motion correction technique for respiratory-gated single photon emission computed tomography (SPECT) images. The motion correction technique corrects the respiratory motion of the lungs nonlinearly between two-phase images obtained by respiratory-gated SPECT. The displacement vectors resulting from respiration can be computed at every location of the lungs. Respiratory lung motion analysis is carried out by calculating the mean value of the body axis component of the displacement vector in each of the 12 small regions into which the lungs were divided. In order to enable inter-patient comparison, the 12 mean values were normalized by the length of the lung region along the direction of the body axis. This method was applied to 25 Technetium (Tc)-99m-macroaggregated albumin (MAA) perfusion SPECT images, and motion analysis results were compared with the diagnostic results. It was confirmed that the respiratory lung motion reflects the ventilation function. A statistically significant difference in the amount of the respiratory lung motion was observed between the obstructive pulmonary diseases and other conditions, based on an unpaired Student's t test (P<0.0001). A difference in the motion between normal lungs and lungs with a ventilation obstruction was detected by the proposed method. This method is effective for evaluating obstructive pulmonary diseases such as pulmonary emphysema and diffuse panbronchiolitis. (author)

  7. Toying with Motion.

    Science.gov (United States)

    Galus, Pamela J.

    2002-01-01

    Presents a variety of activities that support the development of an understanding of Newton's laws of motion. Activities use toy cars, mobile roads, and a seat-of-nails. Includes a scoring rubric. (DDR)

  8. Projectile Motion Hoop Challenge

    Science.gov (United States)

    Jordan, Connor; Dunn, Amy; Armstrong, Zachary; Adams, Wendy K.

    2018-04-01

    Projectile motion is a common phenomenon that is used in introductory physics courses to help students understand motion in two dimensions. Authors have shared a range of ideas for teaching this concept and the associated kinematics in The Physics Teacher; however, the "Hoop Challenge" is a new setup not before described in TPT. In this article an experiment is illustrated to explore projectile motion in a fun and challenging manner that has been used with both high school and university students. With a few simple materials, students have a vested interest in being able to calculate the height of the projectile at a given distance from its launch site. They also have an exciting visual demonstration of projectile motion when the lab is over.

  9. Travelers' Health: Motion Sickness

    Science.gov (United States)

    ... sickness, especially when pregnant, menstruating, or on hormones. Race/ethnicity—Asians may be more susceptible to motion ... it, sitting in the front seat of a car or bus, sitting over the wing of an ...

  10. Dizziness and Motion Sickness

    Science.gov (United States)

    ... that extends into the inner ear can completely destroy both the hearing and equilibrium function of that ... motion sickness: •Do not read while traveling •Avoid sitting in the rear seat •Do not sit in ...

  11. Motion Sickness: First Aid

    Science.gov (United States)

    ... com. Accessed July 29, 2017. Priesol AJ. Motion sickness. https://www.uptodate.com/content/search. Accessed July 29, 2017. Brunette GW, et al. CDC Health Information for International Travel 2018. New York, N. ...

  12. Visual Motion Perception

    Science.gov (United States)

    1991-08-15

    displace- ment limit for motion in random dots," Vision Res., 24, 293-300. Pantie , A. & K. Turano (1986) "Direct comparisons of apparent motions...Hicks & AJ, Pantie (1978) "Apparent movement of successively generated subjec. uve figures," Perception, 7, 371-383. Ramachandran. V.S. & S.M. Anstis...thanks think deaf girl until world uncle flag home talk finish short thee our screwdiver sonry flower wrCstlir~g plan week wait accident guilty tree

  13. Coupled transverse motion

    International Nuclear Information System (INIS)

    Teng, L.C.

    1989-01-01

    The magnetic field in an accelerator or a storage ring is usually so designed that the horizontal (x) and the vertical (y) motions of an ion are uncoupled. However, because of imperfections in construction and alignment, some small coupling is unavoidable. In this lecture, we discuss in a general way what is known about the behaviors of coupled motions in two degrees-of-freedom. 11 refs., 6 figs

  14. Phase correction of MR perfusion/diffusion images

    International Nuclear Information System (INIS)

    Chenevert, T.L.; Pipe, J.G.; Brunberg, J.A.; Yeung, H.N.

    1989-01-01

    Apparent diffusion coefficient (ADC) and perfusion MR sequences are exceptionally sensitive to minute motion and, therefore, are prone to bulk motions that hamper ADC/perfusion quantification. The authors have developed a phase correction algorithm to substantially reduce this error. The algorithm uses a diffusion-insensitive data set to correct data that are diffusion sensitive but phase corrupt. An assumption of the algorithm is that bulk motion phase shifts are uniform in one dimension, although they may be arbitrarily large and variable from acquisition to acquisition. This is facilitated by orthogonal section selection. The correction is applied after one Fourier transform of a two-dimensional Fourier transform reconstruction. Imaging experiments on rat and human brain demonstrate significant artifact reduction in ADC and perfusion measurements

  15. Spin-diffusions and diffusive molecular dynamics

    Science.gov (United States)

    Farmer, Brittan; Luskin, Mitchell; Plecháč, Petr; Simpson, Gideon

    2017-12-01

    Metastable configurations in condensed matter typically fluctuate about local energy minima at the femtosecond time scale before transitioning between local minima after nanoseconds or microseconds. This vast scale separation limits the applicability of classical molecular dynamics (MD) methods and has spurned the development of a host of approximate algorithms. One recently proposed method is diffusive MD which aims at integrating a system of ordinary differential equations describing the likelihood of occupancy by one of two species, in the case of a binary alloy, while quasistatically evolving the locations of the atoms. While diffusive MD has shown itself to be efficient and provide agreement with observations, it is fundamentally a model, with unclear connections to classical MD. In this work, we formulate a spin-diffusion stochastic process and show how it can be connected to diffusive MD. The spin-diffusion model couples a classical overdamped Langevin equation to a kinetic Monte Carlo model for exchange amongst the species of a binary alloy. Under suitable assumptions and approximations, spin-diffusion can be shown to lead to diffusive MD type models. The key assumptions and approximations include a well-defined time scale separation, a choice of spin-exchange rates, a low temperature approximation, and a mean field type approximation. We derive several models from different assumptions and show their relationship to diffusive MD. Differences and similarities amongst the models are explored in a simple test problem.

  16. Nonstationary random acoustic and electromagnetic fields as wave diffusion processes

    International Nuclear Information System (INIS)

    Arnaut, L R

    2007-01-01

    We investigate the effects of relatively rapid variations of the boundaries of an overmoded cavity on the stochastic properties of its interior acoustic or electromagnetic field. For quasi-static variations, this field can be represented as an ideal incoherent and statistically homogeneous isotropic random scalar or vector field, respectively. A physical model is constructed showing that the field dynamics can be characterized as a generalized diffusion process. The Langevin-It o-hat and Fokker-Planck equations are derived and their associated statistics and distributions for the complex analytic field, its magnitude and energy density are computed. The energy diffusion parameter is found to be proportional to the square of the ratio of the standard deviation of the source field to the characteristic time constant of the dynamic process, but is independent of the initial energy density, to first order. The energy drift vanishes in the asymptotic limit. The time-energy probability distribution is in general not separable, as a result of nonstationarity. A general solution of the Fokker-Planck equation is obtained in integral form, together with explicit closed-form solutions for several asymptotic cases. The findings extend known results on statistics and distributions of quasi-stationary ideal random fields (pure diffusions), which are retrieved as special cases

  17. Thermophoretic Motion of Water Nanodroplets confined inside Carbon Nanotubes

    DEFF Research Database (Denmark)

    Zambrano, Harvey A; Walther, Jens Honore; Koumoutsakos, Petros

    2009-01-01

    We study the thermophoretic motion of water nanodroplets confined inside carbon nanotubes using molecular dynamics simulations. We find that the nanodroplets move in the direction opposite the imposed thermal gradient with a terminal velocity that is linearly proportional to the gradient....... The translational motion is associated with a solid body rotation of the water nanodroplet coinciding with the helical symmetry of the carbon nanotube. The thermal diffusion displays a weak dependence on the wetting of the water-carbon nanotube interface. We introduce the use of the Moment Scaling Spectrum (MSS......) in order to determine the characteristics of the motion of the nanoparticles inside the carbon nanotube. The MSS indicates that affinity of the nanodroplet with the walls of the carbon nanotubes is important for the isothermal diffusion, and hence for the Soret coefficient of the system....

  18. A multiscale guide to Brownian motion

    International Nuclear Information System (INIS)

    Grebenkov, Denis S; Belyaev, Dmitry; Jones, Peter W

    2016-01-01

    We revise the Lévy construction of Brownian motion as a simple though rigorous approach to operate with various Gaussian processes. A Brownian path is explicitly constructed as a linear combination of wavelet-based ‘geometrical features’ at multiple length scales with random weights. Such a wavelet representation gives a closed formula mapping of the unit interval onto the functional space of Brownian paths. This formula elucidates many classical results about Brownian motion (e.g., non-differentiability of its path), providing an intuitive feeling for non-mathematicians. The illustrative character of the wavelet representation, along with the simple structure of the underlying probability space, is different from the usual presentation of most classical textbooks. Similar concepts are discussed for the Brownian bridge, fractional Brownian motion, the Ornstein-Uhlenbeck process, Gaussian free fields, and fractional Gaussian fields. Wavelet representations and dyadic decompositions form the basis of many highly efficient numerical methods to simulate Gaussian processes and fields, including Brownian motion and other diffusive processes in confining domains. (topical review)

  19. Multi-stage En/decoders integrated in low loss Si3N4-SiO2 for incoherent spectral amplitude OCDMA on PON

    NARCIS (Netherlands)

    Huiszoon, B.; Leinse, Arne; Geuzebroek, D.H.; Augustin, L.M.; Klein, E.J.; de Waardt, H.; Khoe, G.D.; Koonen, A.M.J.; Emplit, Ph.; Delqué, M.; Gorza, S.-P.; Kockaert, P.; Leijtens, X

    2007-01-01

    In this paper, we show and analyze, for the first time, the static performance of integrated multi-stage cascade and tree spectral amplitude OCDMA en/decoders (E/Ds) which are fabricated in the low loss Si3N4–SiO2 material system. Combined with incoherent broad spectral sources these E/Ds enable

  20. Plasma wakefields driven by an incoherent combination of laser pulses: a path towards high-average power laser-plasma accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Benedetti, C.; Schroeder, C.B.; Esarey, E.; Leemans, W.P.

    2014-05-01

    he wakefield generated in a plasma by incoherently combining a large number of low energy laser pulses (i.e.,without constraining the pulse phases) is studied analytically and by means of fully-self-consistent particle-in-cell simulations. The structure of the wakefield has been characterized and its amplitude compared with the amplitude of the wake generated by a single (coherent) laser pulse. We show that, in spite of the incoherent nature of the wakefield within the volume occupied by the laser pulses, behind this region the structure of the wakefield can be regular with an amplitude comparable or equal to that obtained from a single pulse with the same energy. Wake generation requires that the incoherent structure in the laser energy density produced by the combined pulses exists on a time scale short compared to the plasma period. Incoherent combination of multiple laser pulses may enable a technologically simpler path to high-repetition rate, high-average power laser-plasma accelerators and associated applications.