... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...
Garlepp, M J; Mastaglia, F L
1996-01-01
The idiopathic inflammatory myopathies (IIM) are a heterogenous group of rare disorders that share many similarities. In addition to sporadic inclusion body myositis (IBM), these include dematomyositis (DM), polymyositis (PM), and autoimmune necrotizing myopathy (NM). For discussion of later three disorders, the reader is referred to the IIM review in this issue. IBM is the most common IIM after age 50. It typically presents with chronic insidious proximal leg and/or distal arm asymmetric mus...
Dimachkie, Mazen M; Barohn, Richard J
2014-08-01
The idiopathic inflammatory myopathies (IIMs) are a heterogeneous group of rare disorders that share many similarities. In addition to sporadic inclusion body myositis (IBM), these include dermatomyositis, polymyositis, and autoimmune necrotizing myopathy. IBM is the most common IIM after age 50 years. Muscle histopathology shows endomysial inflammatory exudates surrounding and invading nonnecrotic muscle fibers often accompanied by rimmed vacuoles and protein deposits. It is likely that IBM is has a prominent degenerative component. This article reviews the evolution of knowledge in IBM, with emphasis on recent developments in the field, and discusses ongoing clinical trials. Copyright © 2014 Elsevier Inc. All rights reserved.
Muscle sonography in six patients with hereditary inclusion body myopathy
International Nuclear Information System (INIS)
Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence
2008-01-01
To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)
Amyloid myopathy: a diagnostic challenge
Directory of Open Access Journals (Sweden)
Heli Tuomaala
2009-08-01
Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.
Emerging therapeutic options for sporadic inclusion body myositis
Directory of Open Access Journals (Sweden)
Alfano LN
2015-09-01
Full Text Available Lindsay N Alfano, Linda P Lowes Nationwide Children’s Hospital, Center for Gene Therapy, Columbus, OH, USA Abstract: Sporadic inclusion body myositis is the most common inflammatory muscle disorder preferentially affecting males over the age of 40 years. Progressive muscle weakness of the finger flexors and quadriceps muscles results in loss of independence with activities of daily living and eventual wheelchair dependence. Initial signs of disease are often overlooked and can lead to mis- or delayed diagnosis. The underlying cause of disease is unknown, and disease progression appears refractory to available treatment options. This review discusses the clinical presentation of inclusion body myositis and the current efforts in diagnosis, and focuses on the current state of research for both nonpharmacological and pharmacological treatment options for this patient group. Keywords: myositis, inclusion body myositis, inflammatory myopathy, treatment, function, outcomes
Intravenous immune globulin in hereditary inclusion body myopathy: a pilot study
Directory of Open Access Journals (Sweden)
Dorward Heidi
2007-01-01
Full Text Available Abstract Background Hereditary Inclusion Body Myopathy (HIBM is an autosomal recessive, adult onset, non-inflammatory neuromuscular disorder with no effective treatment. The causative gene, GNE, codes for UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which catalyzes the first two reactions in the synthesis of sialic acid. Reduced sialylation of muscle glycoproteins, such as α-dystroglycan and neural cell adhesion molecule (NCAM, has been reported in HIBM. Methods We treated 4 HIBM patients with intravenous immune globulin (IVIG, in order to provide sialic acid, because IgG contains 8 μmol of sialic acid/g. IVIG was infused as a loading dose of 1 g/kg on two consecutive days followed by 3 doses of 400 mg/kg at weekly intervals. Results For all four patients, mean quadriceps strength improved from 19.0 kg at baseline to 23.2 kg (+22% directly after IVIG loading to 25.6 kg (+35% at the end of the study. Mean shoulder strength improved from 4.1 kg at baseline to 5.9 kg (+44% directly after IVIG loading to 6.0 kg (+46% at the end of the study. The composite improvement for 8 other muscle groups was 5% after the initial loading and 19% by the end of the study. Esophageal motility and lingual strength improved in the patients with abnormal barium swallows. Objective measures of functional improvement gave variable results, but the patients experienced improvements in daily activities that they considered clinically significant. Immunohistochemical staining and immunoblotting of muscle biopsies for α-dystroglycan and NCAM did not provide consistent evidence for increased sialylation after IVIG treatment. Side effects were limited to transient headaches and vomiting. Conclusion The mild benefits in muscle strength experienced by HIBM patients after IVIG treatment may be related to the provision of sialic acid supplied by IVIG. Other sources of sialic acid are being explored as treatment options for HIBM.
Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report
Directory of Open Access Journals (Sweden)
Rosana Hermínia Scola
2005-06-01
Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.
Idiopathic Inflammatory Myopathies: An update
Directory of Open Access Journals (Sweden)
Bulent KURT
2016-06-01
Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45
GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation
Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip
2016-01-01
Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745
Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome
International Nuclear Information System (INIS)
Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves
2014-01-01
Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)
Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome
Energy Technology Data Exchange (ETDEWEB)
Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)
2014-08-15
Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)
Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?
International Nuclear Information System (INIS)
Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta
2015-01-01
To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)
Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?
Energy Technology Data Exchange (ETDEWEB)
Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)
2015-12-15
To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)
Morphologic imaging in muscular dystrophies and inflammatory myopathies
International Nuclear Information System (INIS)
Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya
2010-01-01
To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)
Morphologic imaging in muscular dystrophies and inflammatory myopathies
Energy Technology Data Exchange (ETDEWEB)
Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)
2010-12-15
To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)
[Insight into the training of patients with idiopathic inflammatory myopathy].
Váncsa, Andrea
2016-09-01
Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.
Diagnosis and treatment of the idiopathic inflammatory myopathies
Gazeley, David J.; Cronin, Mary E.
2011-01-01
The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...
Suggs, Jennifer A; Melkani, Girish C; Glasheen, Bernadette M; Detor, Mia M; Melkani, Anju; Marsan, Nathan P; Swank, Douglas M; Bernstein, Sanford I
2017-06-01
Individuals with inclusion body myopathy type 3 (IBM3) display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K) in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in decreased in vitro
Directory of Open Access Journals (Sweden)
Jennifer A. Suggs
2017-06-01
Full Text Available Individuals with inclusion body myopathy type 3 (IBM3 display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in
[Biologic therapy in idiopathic inflammatory myopathy].
Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M
2014-09-15
The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.
Directory of Open Access Journals (Sweden)
Rosana Herminia Scola
1996-06-01
Full Text Available Estudamos 16 casos entre 1400 biópsias musculares que apresentavam vacúolos marginados, cujo aspecto histológico sugeria corpos de inclusão citoplasmáticos. Procuramos correlacionar os dados clínicos, laboratoriais e histopatológicos, a fim de determinar a especificidade dos corpos de inclusão citoplasmáticos para determinadas doenças. A creatinaquinase mostrou-se elevada em 10 casos. A eletromiografia foi anormal em todos os casos. A histoquímica muscular em 5 casos revelou uma miopatia, em 7 padrão misto, em dois desinervação e em 2 casos miopatia inflamatória. A microscopia eletrônica demonstrou a presença de filamentos em 8 casos (nucleares, dispersos no citoplasma ou na região subsarcolemal. Os pacientes foram classificados conforme a história clínica, hereditariedade, dados laboratoriais, eletrofisiológicos, histoquímicos e microscopia eletrônica Encontramos miosite com corpos de inclusão citoplasmática (4 casos, atrofia muscular espinhal juvenil (6 casos, miopatias distais (3 casos, distrofia de cinturas pélvica e escapular (2 casos e polineuropatia periférica (1 caso. Apresentamos revisão sobre a patogenia, formação e possível etiologia dos vacúolos marginados e sua relação com as diversas entidades em que foram detectados, sugerindo que não são específicos para uma única doença.Among 1400 muscle biopsies, we studied 16 cases with rimmed vacuoles, whose histology suggests cytoplasm inclusion bodies. We tried to correlate the clinical, laboratory and histopatological data in order to verify the specificity of cytoplasm inclusion bodies to certain diseases. The creatinekinase was increased in 10 cases. In all cases electromyography was abnormal. Muscle histochemistry revealed myopathy in 5 cases, mixed pattern in 7, denervation in 2 and in 2 cases, inflammatory myopathy. Electron microscopy showed the presence of filaments in 8 cases (nuclear, disseminated in cytoplasm or in the subsarcolemmal region
Directory of Open Access Journals (Sweden)
Yan Lu
2018-05-01
Full Text Available Hereditary inclusion body myopathy (HIBM is a rare autosomal recessive adult onset muscle disease which affects one to three individuals per million worldwide. This disease is autosomal dominant and occurs in adulthood. Our previous study reported a new subtype of HIBM linked to the susceptibility locus at 7q22.1-31.1. The present study is aimed to identify the candidate gene responsible for the phenotype in HIBM pedigree. After multipoint linkage analysis, we performed targeted capture sequencing on 16 members and whole-exome sequencing (WES on 5 members. Bioinformatics filtering was performed to prioritize the candidate pathogenic gene variants, which were further genotyped by Sanger sequencing. Our results showed that the highest peak of LOD score (4.70 was on chromosome 7q22.1-31.1.We identified 2 and 22 candidates using targeted capture sequencing and WES respectively, only one of which as CFTRc.1666A>G mutation was well cosegregated with the HIBM phenotype. Using transcriptome analysis, we did not detect the differences of CFTR's mRNA expression in the proband compared with healthy members. Due to low incidence of HIBM and there is no other pedigree to assess, mutation was detected in three patients with duchenne muscular dystrophyn (DMD and five patients with limb-girdle muscular dystrophy (LGMD. And we found that the frequency of mutation detected in DMD and LGMD patients was higher than that of being expected in normal population. We suggested that the CFTRc.1666A>G may be a candidate marker which has strong genetic linkage with the causative gene in the HIBM family.
Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies
DEFF Research Database (Denmark)
Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.
2016-01-01
Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....
Price, Mark A.; Barghout, Victoria; Benveniste, Olivier; Christopher-Stine, Lisa; Corbett, Alastair; de Visser, Marianne; Hilton-Jones, David; Kissel, John T.; Lloyd, Thomas E.; Lundberg, Ingrid E.; Mastaglia, Francis; Mozaffar, Tahseen; Needham, Merrilee; Schmidt, Jens; Sivakumar, Kumaraswamy; DeMuro, Carla; Tseng, Brian S.
2016-01-01
There is a paucity of data on mortality and causes of death (CoDs) in patients with sporadic inclusion body myositis (sIBM), a rare, progressive, degenerative, inflammatory myopathy that typically affects those aged over 50 years. Based on patient records and expertise of clinical specialists, this
Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy
Directory of Open Access Journals (Sweden)
Saleh Saleh Elessawy
2016-09-01
Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.
Inclusion-Body Myositis: Diagnosis
... for MDA Blog Donate Search MDA.org Close Inclusion-Body Myositis (IBM) Diagnosis As with other muscle diseases, a doctor diagnoses inclusion-body myositis (IBM) by considering the individual’s personal ...
Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.
Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo
2012-01-01
Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.
Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.
Directory of Open Access Journals (Sweden)
Kazunari Momma
Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.
Hereditary myopathies with early respiratory insufficiency in adults.
Naddaf, Elie; Milone, Margherita
2017-11-01
Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.
Zygmunt, Deborah A; Crowe, Kelly E; Flanigan, Kevin M; Martin, Paul T
2017-09-01
Recombinant adeno-associated virus (rAAV) is a commonly used gene therapy vector for the delivery of therapeutic transgenes in a variety of human diseases, but pre-existing serum antibodies to viral capsid proteins can greatly inhibit rAAV transduction of tissues. Serum was assayed from patients with Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), inclusion body myositis (IBM), and GNE myopathy (GNE). These were compared to serum from otherwise normal human subjects to determine the extent of pre-existing serum antibodies to rAAVrh74, rAAV1, rAAV2, rAAV6, rAAV8, and rAAV9. In almost all cases, patients with measurable titers to one rAAV serotype showed titers to all other serotypes tested, with average titers to rAAV2 being highest in all instances. Twenty-six percent of all young normal subjects (18 years old). Fifty percent of all IBM and GNE patients also had antibody titers to all rAAV serotypes, while only 18% of DMD and 0% of BMD patients did. In addition, serum-naïve macaques treated systemically with rAAVrh74 could develop cross-reactive antibodies to all other serotypes tested at 24 weeks post treatment. These data demonstrate that most DMD and BMD patients should be amenable to vascular rAAV-mediated treatment without the concern of treatment blockage by pre-existing serum rAAV antibodies, and that serum antibodies to rAAVrh74 are no more common than those for rAAV6, rAAV8, or rAAV9.
Radiological features of Paget disease of bone associated with VCP myopathy
Energy Technology Data Exchange (ETDEWEB)
Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)
2012-03-15
Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)
Dimachkie, Mazen M.; Barohn, Richard J.
2014-01-01
Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent
... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...
Hypothyroid myopathy. A clinical and pathologaical study.
McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G
1980-09-01
Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature
Renal pathophysiologic role of cortical tubular inclusion bodies.
Radi, Zaher A; Stewart, Zachary S; Grzemski, Felicity A; Bobrowski, Walter F
2013-01-01
Renal tubular inclusion bodies are rarely associated with drug administration. The authors describe the finding of renal cortical tubular intranuclear and intracytoplasmic inclusion bodies associated with the oral administration of a norepinephrine/serotonin reuptake inhibitor (NSRI) test article in Sprague-Dawley (SD) rats. Rats were given an NSRI daily for 4 weeks, and kidney histopathologic, ultrastructural pathology, and immunohistochemical examinations were performed. Round eosinophilic intranuclear inclusion bodies were observed histologically in the tubular epithelial cells of the renal cortex in male and female SD rats given the NSRI compound. No evidence of degeneration or necrosis was noted in the inclusion-containing renal cells. By ultrastructural pathology, inclusion bodies consisted of finely granular, amorphous, and uniformly stained nonmembrane-bound material. By immunohistochemistry, inclusion bodies stained positive for d-amino acid oxidase (DAO) protein. In addition, similar inclusion bodies were noted in the cytoplasmic tubular epithelial compartment by ultrastructural and immunohistochemical examination. This is the first description of these renal inclusion bodies after an NSRI test article administration in SD rats. Such drug-induced renal inclusion bodies are rat-specific, do not represent an expression of nephrotoxicity, represent altered metabolism of d-amino acids, and are not relevant to human safety risk assessment.
Inclusion bodies are a site of ebolavirus replication.
Hoenen, Thomas; Shabman, Reed S; Groseth, Allison; Herwig, Astrid; Weber, Michaela; Schudt, Gordian; Dolnik, Olga; Basler, Christopher F; Becker, Stephan; Feldmann, Heinz
2012-11-01
Inclusion bodies are a characteristic feature of ebolavirus infections in cells. They contain large numbers of preformed nucleocapsids, but their biological significance has been debated, and they have been suggested to be aggregates of viral proteins without any further biological function. However, recent data for other viruses that produce similar structures have suggested that inclusion bodies might be involved in genome replication and transcription. In order to study filovirus inclusion bodies, we fused mCherry to the ebolavirus polymerase L, which is found in inclusion bodies. The resulting L-mCherry fusion protein was functional in minigenome assays and incorporated into virus-like particles. Importantly, L-mCherry fluorescence in transfected cells was readily detectable and distributed in a punctate pattern characteristic for inclusion bodies. A recombinant ebolavirus encoding L-mCherry instead of L was rescued and showed virtually identical growth kinetics and endpoint titers to those for wild-type virus. Using this virus, we showed that the onset of inclusion body formation corresponds to the onset of viral genome replication, but that viral transcription occurs prior to inclusion body formation. Live-cell imaging further showed that inclusion bodies are highly dynamic structures and that they can undergo dramatic reorganization during cell division. Finally, by labeling nascent RNAs using click technology we showed that inclusion bodies are indeed the site of viral RNA synthesis. Based on these data we conclude that, rather than being inert aggregates of nucleocapsids, ebolavirus inclusion bodies are in fact complex and dynamic structures and an important site at which viral RNA replication takes place.
Guy, R J; Kamm, M A; Martin, J E
1997-02-01
We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.
Isolation of cell-free bacterial inclusion bodies.
Rodríguez-Carmona, Escarlata; Cano-Garrido, Olivia; Seras-Franzoso, Joaquin; Villaverde, Antonio; García-Fruitós, Elena
2010-09-17
Bacterial inclusion bodies are submicron protein clusters usually found in recombinant bacteria that have been traditionally considered as undesirable products from protein production processes. However, being fully biocompatible, they have been recently characterized as nanoparticulate inert materials useful as scaffolds for tissue engineering, with potentially wider applicability in biomedicine and material sciences. Current protocols for inclusion body isolation from Escherichia coli usually offer between 95 to 99% of protein recovery, what in practical terms, might imply extensive bacterial cell contamination, not compatible with the use of inclusion bodies in biological interfaces. Using an appropriate combination of chemical and mechanical cell disruption methods we have established a convenient procedure for the recovery of bacterial inclusion bodies with undetectable levels of viable cell contamination, below 10⁻¹ cfu/ml, keeping the particulate organization of these aggregates regarding size and protein folding features. The application of the developed protocol allows obtaining bacterial free inclusion bodies suitable for use in mammalian cell cultures and other biological interfaces.
Tarnopolsky, Mark A
2016-12-01
Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.
Gelpi, Ellen; Lladó, Albert; Clarimón, Jordi; Rey, Maria Jesús; Rivera, Rosa Maria; Ezquerra, Mario; Antonell, Anna; Navarro-Otano, Judith; Ribalta, Teresa; Piñol-Ripoll, Gerard; Pérez, Anna; Valldeoriola, Francesc; Ferrer, Isidre
2012-09-01
Basophilic inclusion body disease and neuronal intermediate filament inclusion disease (NIFID) are rare diseases included among frontotemporal lobar degenerations with FUS-positive inclusions (FTLD-FUS). We report clinical and pathologic features of 2 new patients and reevaluate neuropathologic characteristics of 2 previously described cases, including an early-onset case of basophilic inclusion body disease (aged 38 years) with a 5-year disease course and abundant FUS-positive inclusion bodies and 3 NIFID cases. One NIFID case (aged 37 years) presented with early-onset psychiatric disturbances and rapidly progressive cognitive decline. Two NIFID cases had later onset (aged 64 years and 70 years) and complex neurologic deficits. Postmortem neuropathologic studies in late-onset NIFID cases disclosed α-internexin-positive "hyaline conglomerate"-type inclusions that were positive with 1 commercial anti-FUS antibody directed to residues 200 and 250, but these were negative to amino acids 90 and 220 of human FUS. Early-onset NIFID had similar inclusions that were positive with both commercial anti-FUS antibodies. Genetic testing performed on all cases revealed no FUS gene mutations. These findings indicate that phenotypic variability in NIFID, including clinical manifestations and particular neuropathologic findings, may be related to the age at onset and individual differences in the evolution of lesions.
Towards revealing the structure of bacterial inclusion bodies.
Wang, Lei
2009-01-01
Protein aggregation is a widely observed phenomenon in human diseases, biopharmaceutical production, and biological research. Protein aggregates are generally classified as highly ordered, such as amyloid fibrils, or amorphous, such as bacterial inclusion bodies. Amyloid fibrils are elongated filaments with diameters of 6-12 nm, they are comprised of residue-specific cross-beta structure, and display characteristic properties, such as binding with amyloid-specific dyes. Amyloid fibrils are associated with dozens of human pathological conditions, including Alzheimer disease and prion diseases. Distinguished from amyloid fibrils, bacterial inclusion bodies display apparent amorphous morphology. Inclusion bodies are formed during high-level recombinant protein production, and formation of inclusion bodies is a major concern in biotechnology. Despite of the distinctive morphological difference, bacterial inclusion bodies have been found to have some amyloid-like properties, suggesting that they might contain structures similar to amyloid-like fibrils. Recent structural data further support this hypothesis, and this review summarizes the latest progress towards revealing the structural details of bacterial inclusion bodies.
de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique
2005-03-01
Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.
DEFF Research Database (Denmark)
Witting, Nanna; Andersen, Linda K; Vissing, John
2016-01-01
Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...
Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization
Directory of Open Access Journals (Sweden)
O. A. Antelava
2014-01-01
Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by
Mitochondrial disorders in congenital myopathies
Directory of Open Access Journals (Sweden)
D. A. Kharlamov
2014-01-01
Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.
Yatabe, K; Kawai, M
1997-08-01
Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.
Klingstedt, Therése; Blechschmidt, Cristiane; Nogalska, Anna; Prokop, Stefan; Häggqvist, Bo; Danielsson, Olof; Engel, W King; Askanas, Valerie; Heppner, Frank L; Nilsson, K Peter R
2013-03-18
Small hydrophobic ligands identifying intracellular protein deposits are of great interest, as protein inclusion bodies are the pathological hallmark of several degenerative diseases. Here we report that fluorescent amyloid ligands, termed luminescent conjugated oligothiophenes (LCOs), rapidly and with high sensitivity detect protein inclusion bodies in skeletal muscle tissue from patients with sporadic inclusion body myositis (s-IBM). LCOs having a conjugated backbone of at least five thiophene units emitted strong fluorescence upon binding, and showed co-localization with proteins reported to accumulate in s-IBM protein inclusion bodies. Compared with conventional amyloid ligands, LCOs identified a larger fraction of immunopositive inclusion bodies. When the conjugated thiophene backbone was extended with terminal carboxyl groups, the LCO revealed striking spectral differences between distinct protein inclusion bodies. We conclude that 1) LCOs are sensitive, rapid and powerful tools for identifying protein inclusion bodies and 2) LCOs identify a wider range of protein inclusion bodies than conventional amyloid ligands. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Molecular and Genetic Studies of Congenital Myopathies
2018-03-21
Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy
Endocrine myopathy: Case-based review
Directory of Open Access Journals (Sweden)
Babul Reddy Hanmayyagari
2016-01-01
Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.
Myopathy in acute hypothyroidism
Ma, JTC; Yu, YL; Kung, AWC
1987-01-01
Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...
Myopathy in acute hypothyroidism.
Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.
1987-01-01
Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...
Muscle regeneration in mitochondrial myopathies
DEFF Research Database (Denmark)
Krag, T O; Hauerslev, S; Jeppesen, T D
2013-01-01
Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...
Basile, Filomena; Di Santi, Annalisa; Caldora, Mercedes; Ferretti, Luigi; Bentivegna, Flegra; Pica, Alessandra
2011-08-01
The aim of this study was to clarify the role of the erythrocyte inclusions found during the hematological screening of loggerhead population of the Mediterranean Sea. We studied the erythrocyte inclusions in blood specimens collected from six juvenile and nine adult specimens of the loggerhead turtle, Caretta caretta, from the Adriatic and Tyrrhenian Seas. Our study indicates that the percentage of mature erythrocytes containing inclusions ranged from 3 to 82%. Each erythrocyte contained only one round inclusion body. Inclusion bodies stained with May Grünwald-Giemsa show that their cytochemical and ultrastructure characteristics are identical to those of human Heinz bodies. Because Heinz bodies originate from the precipitation of unstable hemoglobin (Hb) and cause globular osmotic resistance to increase, we analyzed loggerhead Hb using electrophoresis and high-performance liquid chromatography to detect and quantitate Hb fractions. We also tested the resistance of Hb to alkaline pH, heat, isopropanol denaturation, and globular osmosis. Our hemogram results excluded the occurrence of any infection, which could be associated with an inclusion body, in all the specimens. Negative Feulgen staining indicated that the inclusion bodies are not derived from DNA fragmentation. We hypothesize that amino acid substitutions could explain why loggerhead Hb precipitates under normal physiologic conditions, forming Heinz bodies. The identification of inclusion bodies in loggerhead erythrocytes allow us to better understand the haematological characteristics and the physiology of these ancient reptiles, thus aiding efforts to conserve such an endangered species. Copyright © 2011 Wiley-Liss, Inc., A Wiley Company.
Evidence-based treatment of metabolic myopathy
Directory of Open Access Journals (Sweden)
Yan LIN
2014-05-01
Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment. Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature. Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should
Stepwise approach to myopathy in systemic disease.
Chawla, Jasvinder
2011-01-01
Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.
Genetics Home Reference: familial encephalopathy with neuroserpin inclusion bodies
... Home Health Conditions FENIB Familial encephalopathy with neuroserpin inclusion bodies Printable PDF Open All Close All Enable ... expand/collapse boxes. Description Familial encephalopathy with neuroserpin inclusion bodies ( FENIB ) is a disorder that causes progressive ...
STATINS AND MYOPATHY: MOLECULAR MECHANISMS
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2012-01-01
Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered.
Genetics Home Reference: Miyoshi myopathy
... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...
de Freitas, M R; Nascimento, O J
1975-06-01
The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.
Inclusion body myositis. Clinical aspects
Cox, Fieke Maria Elisabeth
2014-01-01
Sporadische inclusion body myositis (IBM) is een van de meest voor voorkomende verworven spierziekte die ontstaat na het 50e levensjaar. In dit proefschrift worden de klinische aspecten van sporadische IBM beschreven. Uit de studie met betrekking tot het natuurlijk beloop blijkt dat de ziekte niet
Creating Inclusive Physical Activity Spaces: The Case of Body-Positive Yoga.
Pickett, Andrew C; Cunningham, George B
2017-09-01
Within the modern cultural climate, those in larger bodies face high levels of weight stigma, particularly in sport and physical activity spaces, which serves as a strong barrier to their participation. However, given the strong link between physical activity and general health and well-being for participants, it is important to explore strategies that encourage participation of these individuals. Thus, the current research examined strategies that physical activity instructors use to develop inclusive exercise spaces for all body sizes. This study employed a series of semistructured qualitative interviews (n = 9) with instructors of body-inclusive yoga classes to explore the ways in which they encourage participation for those in larger bodies. Emergent themes from the current study suggested support for 6 factors for creating body-inclusive physical activity spaces: authentic leadership, a culture of inclusion, a focus on health, inclusive language, leader social activism, and a sense of community. This study revealed that leaders must intentionally cultivate inclusion in their spaces to encourage those in nonconforming bodies to participate. These findings have important health and management implications for the sport and physical activity context and provide a basic outline of practical strategies that practitioners can use to foster inclusion in their spaces.
A diagnostic algorithm for metabolic myopathies.
Berardo, Andres; DiMauro, Salvatore; Hirano, Michio
2010-03-01
Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.
Inclusion bodies of aggregated hemosiderins in liver macrophages.
Hayashi, Hisao; Tatsumi, Yasuaki; Wakusawa, Shinya; Shigemasa, Ryota; Koide, Ryoji; Tsuchida, Ken-Ichi; Morotomi, Natsuko; Yamashita, Tetsuji; Kumagai, Kotaro; Ono, Yukiya; Hayashi, Kazuhiko; Ishigami, Masatoshi; Goto, Hidemi; Kato, Ayako; Kato, Koichi
2017-12-01
Hemosiderin formation is a structural indication of iron overload. We investigated further adaptations of the liver to excess iron. Five patients with livers showing iron-rich inclusions larger than 2 µm were selected from our database. The clinical features of patients and structures of the inclusions were compared with those of 2 controls with mild iron overload. All patients had severe iron overload with more than 5000 ng/mL of serum ferritin. Etiologies were variable, from hemochromatosis to iatrogenic iron overload. Their histological stages were either portal fibrosis or cirrhosis. Inclusion bodies were ultra-structurally visualized as aggregated hemosiderins in the periportal macrophages. X-ray analysis always identified, in addition to a large amount of iron complexes including oxygen and phosphorus, a small amount of copper and sulfur in the mosaic matrixes of inclusions. There were no inclusions in the control livers. Inclusion bodies, when the liver is loaded with excess iron, may appear in the macrophages as isolated organella of aggregated hemosiderins. Trace amounts of copper-sulfur complexes were always identified in the mosaic matrices of the inclusions, suggesting cuproprotein induction against excess iron. In conclusion, inclusion formation in macrophages may be an adaptation of the liver loaded with excess iron.
[Inclusion Bodies are Formed in SFTSV-infected Human Macrophages].
Jin, Cong; Song, Jingdong; Han, Ying; Li, Chuan; Qiu, Peihong; Liang, Mifang
2016-01-01
The severe fever with thrombocytopenia syndrome virus (SFTSV) is a new member in the genus Phlebovirus of the family Bunyaviridae identified in China. The SFTSV is also the causative pathogen of an emerging infectious disease: severe fever with thrombocytopenia syndrome. Using immunofluorescent staining and confocal microscopy, the intracellular distribution of nucleocapsid protein (NP) in SFTSV-infected THP-1 cells was investigated with serial doses of SFTSV at different times after infection. Transmission electron microscopy was used to observe the ultrafine intracellular structure of SFTSV-infected THP-1 cells at different times after infection. SFTSV NP could form intracellular inclusion bodies in infected THP-1 cells. The association between NP-formed inclusion bodies and virus production was analyzed: the size of the inclusion body formed 3 days after infection was correlated with the viral load in supernatants collected 7 days after infection. These findings suggest that the inclusion bodies formed in SFTSV-infected THP-1 cells could be where the SFTSV uses host-cell proteins and intracellular organelles to produce new viral particles.
Dynamic recruitment of active proteasomes into polyglutamine initiated inclusion bodies
Schipper-Krom, Sabine; Juenemann, Katrin; Jansen, Anne H.; Wiemhoefer, Anne; van den Nieuwendijk, Rianne; Smith, Donna L.; Hink, Mark A.; Bates, Gillian P.; Overkleeft, Hermen; Ovaa, Huib; Reits, Eric
2014-01-01
Neurodegenerative disorders such as Huntington's disease are hallmarked by neuronal intracellular inclusion body formation. Whether proteasomes are irreversibly recruited into inclusion bodies in these protein misfolding disorders is a controversial subject. In addition, it has been proposed that
Ultrastructure of inclusion bodies in annulus cells in the degenerating human intervertebral disc.
Gruber, H E; Hanley, E N
2009-06-01
The rough endoplasmic reticulum (rER) of the cell has an architectural editing function that checks whether protein structure and three-dimensional assembly have occurred properly prior to export of newly synthesized material out of the cell. If these have been faulty, the material is retained within the rER as an inclusion body. Inclusion bodies have been identified previously in chondrocytes and osteoblasts in chondrodysplasias and osteogenesis imperfecta. Inclusion bodies in intervertebral disc cells, however, have only recently been recognized. Our objectives were to use transmission electron microscopy to analyze more fully inclusion bodies in the annulus pulposus and to study the extracellular matrix (ECM) surrounding cells containing inclusion bodies. ECM frequently encapsulated cells with inclusion bodies, and commonly contained prominent banded aggregates of Type VI collagen. Inclusion body material had several morphologies, including relatively smooth, homogeneous material, or a rougher, less homogeneous feature. Such findings expand our knowledge of the fine structure of the human disc cell and ECM during disc degeneration, and indicate the potential utility of ultrastructural identification of discs with intracellular inclusion bodies as a screening method for molecular studies directed toward identification of defective gene products in degenerating discs.
International Nuclear Information System (INIS)
Lee, Junho; Yang, Kyu-Hwan; Joe, Cheol O.; Kang, Seok-Seong
2011-01-01
Research highlights: → Distinct inclusion bodies are developed by inhibition of UPP and ALP. → The inclusion bodies differ in morphology, localization and formation process. → The inclusion bodies are distinguishable by the localization of TSC2. → Inhibition of both UPP and ALP simultaneously induces those inclusion bodies. -- Abstract: Accumulation of misfolded proteins is caused by the impairment of protein quality control systems, such as ubiquitin-proteasome pathway (UPP) and autophagy-lysosome pathway (ALP). In this study, the formation of inclusion bodies was examined after the blockade of UPP and/or ALP in A549 cells. UPP inhibition induced a single and large inclusion body localized in microtubule-organizing center. Interestingly, however, ALP inhibition generated dispersed small inclusion bodies in the cytoplasm. Tuberous sclerosis complex 2 was selectively accumulated in the inclusion bodies of UPP-inhibited cells, but not those of ALP-inhibited cells. Blockade of transcription and translation entirely inhibited the formation of inclusion body induced by UPP inhibition, but partially by ALP inhibition. Moreover, the simultaneous inhibition of two protein catabolic pathways independently developed two distinct inclusion bodies within a single cell. These findings clearly demonstrated that dysfunction of each catabolic pathway induced formation and accumulation of unique inclusion bodies on the basis of morphology, localization and formation process in A549 cells.
Localized scleroderma and regional inflammatory myopathy.
Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A
2014-05-01
Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.
Exercise training in metabolic myopathies
DEFF Research Database (Denmark)
Vissing, J
2016-01-01
metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...
DiMauro, Salvatore
2006-11-01
Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.
Protein recovery from inclusion bodies of Escherichia coli using mild solubilization process.
Singh, Anupam; Upadhyay, Vaibhav; Upadhyay, Arun Kumar; Singh, Surinder Mohan; Panda, Amulya Kumar
2015-03-25
Formation of inclusion bodies in bacterial hosts poses a major challenge for large scale recovery of bioactive proteins. The process of obtaining bioactive protein from inclusion bodies is labor intensive and the yields of recombinant protein are often low. Here we review the developments in the field that are targeted at improving the yield, as well as quality of the recombinant protein by optimizing the individual steps of the process, especially solubilization of the inclusion bodies and refolding of the solubilized protein. Mild solubilization methods have been discussed which are based on the understanding of the fact that protein molecules in inclusion body aggregates have native-like structure. These methods solubilize the inclusion body aggregates while preserving the native-like protein structure. Subsequent protein refolding and purification results in high recovery of bioactive protein. Other parameters which influence the overall recovery of bioactive protein from inclusion bodies have also been discussed. A schematic model describing the utility of mild solubilization methods for high throughput recovery of bioactive protein has also been presented.
Inherited myopathies and muscular dystrophies
Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.
The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and
Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy
Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H
2015-01-01
Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...
In vitro folding of inclusion body proteins.
Rudolph, R; Lilie, H
1996-01-01
Insoluble, inactive inclusion bodies are frequently formed upon recombinant protein production in transformed microorganisms. These inclusion bodies, which contain the recombinant protein in an highly enriched form, can be isolated by solid/liquid separation. After solubilization, native proteins can be generated from the inactive material by using in vitro folding techniques. New folding procedures have been developed for efficient in vitro reconstitution of complex hydrophobic, multidomain, oligomeric, or highly disulfide-bonded proteins. These protocols take into account process parameters such as protein concentration, catalysis of disulfide bond formation, temperature, pH, and ionic strength, as well as specific solvent ingredients that reduce unproductive side reactions. Modification of the protein sequence has been exploited to improve in vitro folding.
Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy
Directory of Open Access Journals (Sweden)
Lei Tian
2015-06-01
Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.
[In vitro renaturation of proteins from inclusion bodies].
Porowińska, Dorota; Marszałek, Ewelina; Wardęcka, Paulina; Komoszyński, Michał
2012-06-11
Recombinant proteins and enzymes are commonly used in many areas of our life, such as diagnostics, industry and medicine, due to heterologous synthesis in prokaryotic expression systems. However, a high expression level of foreign protein in bacteria cells results in formation of inactive and insoluble aggregates--inclusion bodies. Reactivation of aggregated proteins is a complex and time-consuming process. Every protein requires experimental optimization of the process conditions. The choice of the refolding method depends on the type of recombinant protein and its physical, chemical and biological properties. Recovery of the activity of proteins accumulated in inclusion bodies can be divided into 4 steps: 1) inclusion bodies isolation, 2) solubilization of aggregates, 3) renaturation, 4) purification of catalytically active molecules. Efficiency of the refolding process depends on many physical factors and chemical and biological agents. The above parameters determine the time of the folding and prevent protein aggregation. They also assist the folding and have an influence on the solubility and stability of native molecules. To date, dilution, dialysis and chromatography are the most often used methods for protein refolding.
Should body image programs be inclusive? A focus group study of college students.
Ciao, Anna C; Ohls, Olivia C; Pringle, Kevin D
2018-01-01
Most evidence-based body image programs for college students (e.g., the Body Project) are designed for female-only audiences, although body dissatisfaction is not limited to female-identified individuals. Furthermore, programs do not explicitly discuss diversity, although individuals with marginalized gender, racial, and sexual identities may be particularly vulnerable to body image disturbances. Making programs more inclusive may increase their disseminability. This qualitative study examined the feasibility of adapting the Body Project for universal and inclusive use with college students. Participants (N = 36; M age = 21.66 years; 73% female-identified; 20% sexual minority; 23% racial minority) attended one of five semi-structured focus groups to explore the inclusivity of appearance-based cultural norms using adapted Body Project activities and discuss the feasibility of universal and inclusive interventions. Inductive qualitative content analysis with three-rater consensus identified focus group themes. There was consensus that inclusive interventions could have a positive impact (broadening perspectives, normalizing body image concerns, increasing awareness) despite potential barriers (poor diversity representation, vulnerability). There was strong consensus regarding advice for facilitating inclusive interventions (e.g., skilled facilitation, education, increasing diversity). Results suggest that inclusive body image programs are desirable and provide a framework for creating the EVERYbody Project, a program for more universal audiences. © 2017 Wiley Periodicals, Inc.
... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...
Adult-onset nemaline myopathy presenting as respiratory failure.
LENUS (Irish Health Repository)
Kelly, Emer
2008-11-01
Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.
Genetics Home Reference: inclusion body myopathy 2
... molecules, sialic acid influences a wide variety of cellular functions including cell movement (migration), attaching cells to one another (adhesion), signaling between cells, and inflammation. The mutations responsible ...
Dynamic recruitment of active proteasomes into polyglutamine initiated inclusion bodies.
Schipper-Krom, Sabine; Juenemann, Katrin; Jansen, Anne H; Wiemhoefer, Anne; van den Nieuwendijk, Rianne; Smith, Donna L; Hink, Mark A; Bates, Gillian P; Overkleeft, Hermen; Ovaa, Huib; Reits, Eric
2014-01-03
Neurodegenerative disorders such as Huntington's disease are hallmarked by neuronal intracellular inclusion body formation. Whether proteasomes are irreversibly recruited into inclusion bodies in these protein misfolding disorders is a controversial subject. In addition, it has been proposed that the proteasomes may become clogged by the aggregated protein fragments, leading to impairment of the ubiquitin-proteasome system. Here, we show by fluorescence pulse-chase experiments in living cells that proteasomes are dynamically and reversibly recruited into inclusion bodies. As these recruited proteasomes remain catalytically active and accessible to substrates, our results challenge the concept of proteasome sequestration and impairment in Huntington's disease, and support the reported absence of proteasome impairment in mouse models of Huntington's disease. Copyright © 2013 Federation of European Biochemical Societies. All rights reserved.
Lee, Junho; Yang, Kyu-Hwan; Joe, Cheol O; Kang, Seok-Seong
2011-01-14
Accumulation of misfolded proteins is caused by the impairment of protein quality control systems, such as ubiquitin-proteasome pathway (UPP) and autophagy-lysosome pathway (ALP). In this study, the formation of inclusion bodies was examined after the blockade of UPP and/or ALP in A549 cells. UPP inhibition induced a single and large inclusion body localized in microtubule-organizing center. Interestingly, however, ALP inhibition generated dispersed small inclusion bodies in the cytoplasm. Tuberous sclerosis complex 2 was selectively accumulated in the inclusion bodies of UPP-inhibited cells, but not those of ALP-inhibited cells. Blockade of transcription and translation entirely inhibited the formation of inclusion body induced by UPP inhibition, but partially by ALP inhibition. Moreover, the simultaneous inhibition of two protein catabolic pathways independently developed two distinct inclusion bodies within a single cell. These findings clearly demonstrated that dysfunction of each catabolic pathway induced formation and accumulation of unique inclusion bodies on the basis of morphology, localization and formation process in A549 cells. Copyright © 2010 Elsevier Inc. All rights reserved.
Lewy and his inclusion bodies: Discovery and rejection
Directory of Open Access Journals (Sweden)
Eliasz Engelhardt
Full Text Available ABSTRACT Fritz Jacob Heinrich Lewy described the pathology of Paralysis agitans [Parkinson disease] and was the first to identify eosinophilic inclusion bodies in neurons of certain brain nuclei, later known as Lewy bodies, the pathological signature of the Lewy body diseases. In 1912, he published his seminal study, followed soon after by an update paper, and 10 years later, in 1923, by his voluminous book, where he exhaustively described the subject. The publication provided extensive information on the pathology of Paralysis agitans, and the entirely novel finding of eosinophilic inclusion bodies, which would become widely recognized and debated in the future. His discovery was acknowledged by important researchers who even named the structure after him. However, after his last publication on the issue, inexplicably, he never mentioned his histopathological discovery again. Despite several hypotheses, the reasons that led him to neglect (reject the structure which he so preeminently described have remained elusive.
Bacterial Inclusion Bodies: Discovering Their Better Half.
Rinas, Ursula; Garcia-Fruitós, Elena; Corchero, José Luis; Vázquez, Esther; Seras-Franzoso, Joaquin; Villaverde, Antonio
2017-09-01
Bacterial inclusion bodies (IBs) are functional, non-toxic amyloids occurring in recombinant bacteria showing analogies with secretory granules of the mammalian endocrine system. The scientific interest in these mesoscale protein aggregates has been historically masked by their status as a hurdle in recombinant protein production. However, progressive understanding of how the cell handles the quality of recombinant polypeptides and the main features of their intriguing molecular organization has stimulated the interest in inclusion bodies and spurred their use in diverse technological fields. The engineering and tailoring of IBs as functional protein particles for materials science and biomedicine is a good example of how formerly undesired bacterial byproducts can be rediscovered as promising functional materials for a broad spectrum of applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tunable geometry of bacterial inclusion bodies as substrate materials for tissue engineering
Energy Technology Data Exchange (ETDEWEB)
GarcIa-Fruitos, Elena; Seras-Franzoso, JoaquIn; Vazquez, Esther; Villaverde, Antonio [CIBER en BioingenierIa, Biomateriales y Nanomedicina, Bellaterra, 08193 Barcelona (Spain); Institut de Biotecnologia i de Biomedicina and Departament de Genetica i de Microbiologia, Universitat Autonoma de Barcelona, 08193 Bellaterra (Cerdanyola del Valles), Barcelona (Spain)
2010-05-21
A spectrum of materials for biomedical applications is produced in bacteria, and some of them, such as metals or polyhydroxyalkanoates, are straightforwardly obtained as particulate entities. We have explored the biofabrication process of bacterial inclusion bodies, particulate proteinaceous materials (ranging from 50 to 500 nm in diameter) recently recognized as suitable for surface topographical modification and tissue engineering. Inclusion bodies have been widely described as spherical or pseudo-spherical particles with only minor morphological variability, mostly restricted to their size. Here we have identified a cellular gene in Escherichia coli (clpP) that controls the in vivo fabrication process of inclusion bodies. In the absence of the encoded protease, the dynamics of protein deposition is perturbed, resulting in unusual tear-shaped particles with enhanced surface-volume ratios. This fact modifies the ability of inclusion bodies to promote mammalian cell attachment and differentiation upon surface decoration. The implications of the genetic control of inclusion body geometry are discussed in the context of their biological fabrication and regarding the biomedical potential of these protein clusters in regenerative medicine.
Tunable geometry of bacterial inclusion bodies as substrate materials for tissue engineering
International Nuclear Information System (INIS)
GarcIa-Fruitos, Elena; Seras-Franzoso, JoaquIn; Vazquez, Esther; Villaverde, Antonio
2010-01-01
A spectrum of materials for biomedical applications is produced in bacteria, and some of them, such as metals or polyhydroxyalkanoates, are straightforwardly obtained as particulate entities. We have explored the biofabrication process of bacterial inclusion bodies, particulate proteinaceous materials (ranging from 50 to 500 nm in diameter) recently recognized as suitable for surface topographical modification and tissue engineering. Inclusion bodies have been widely described as spherical or pseudo-spherical particles with only minor morphological variability, mostly restricted to their size. Here we have identified a cellular gene in Escherichia coli (clpP) that controls the in vivo fabrication process of inclusion bodies. In the absence of the encoded protease, the dynamics of protein deposition is perturbed, resulting in unusual tear-shaped particles with enhanced surface-volume ratios. This fact modifies the ability of inclusion bodies to promote mammalian cell attachment and differentiation upon surface decoration. The implications of the genetic control of inclusion body geometry are discussed in the context of their biological fabrication and regarding the biomedical potential of these protein clusters in regenerative medicine.
Refolding techniques for recovering biologically active recombinant proteins from inclusion bodies.
Yamaguchi, Hiroshi; Miyazaki, Masaya
2014-02-20
Biologically active proteins are useful for studying the biological functions of genes and for the development of therapeutic drugs and biomaterials in a biotechnology industry. Overexpression of recombinant proteins in bacteria, such as Escherichia coli, often results in the formation of inclusion bodies, which are protein aggregates with non-native conformations. As inclusion bodies contain relatively pure and intact proteins, protein refolding is an important process to obtain active recombinant proteins from inclusion bodies. However, conventional refolding methods, such as dialysis and dilution, are time consuming and, often, recovered yields of active proteins are low, and a trial-and-error process is required to achieve success. Recently, several approaches have been reported to refold these aggregated proteins into an active form. The strategies largely aim at reducing protein aggregation during the refolding procedure. This review focuses on protein refolding techniques using chemical additives and laminar flow in microfluidic chips for the efficient recovery of active proteins from inclusion bodies.
Refolding Techniques for Recovering Biologically Active Recombinant Proteins from Inclusion Bodies
Directory of Open Access Journals (Sweden)
Hiroshi Yamaguchi
2014-02-01
Full Text Available Biologically active proteins are useful for studying the biological functions of genes and for the development of therapeutic drugs and biomaterials in a biotechnology industry. Overexpression of recombinant proteins in bacteria, such as Escherichia coli, often results in the formation of inclusion bodies, which are protein aggregates with non-native conformations. As inclusion bodies contain relatively pure and intact proteins, protein refolding is an important process to obtain active recombinant proteins from inclusion bodies. However, conventional refolding methods, such as dialysis and dilution, are time consuming and, often, recovered yields of active proteins are low, and a trial-and-error process is required to achieve success. Recently, several approaches have been reported to refold these aggregated proteins into an active form. The strategies largely aim at reducing protein aggregation during the refolding procedure. This review focuses on protein refolding techniques using chemical additives and laminar flow in microfluidic chips for the efficient recovery of active proteins from inclusion bodies.
[Solubilization Specificities Interferon beta-1b from Inclusion Bodies].
Zhuravko, A S; Kononova, N V; Bobruskin, A I
2015-01-01
A new solubilization method of recombinant interferon beta-1b (IFNβ-1b) from the inclusion bodies was developed. This method allows to extract the target protein selectively in the solutions of different alcohols, such as ethanol, propanol and isopropanol. It was shown that the more effective IFNβ-1b solubilization was achieved in the 55% propanol solution. This method allowed to extract the target protein from inclusion bodies around 85-90%, and significantly reduced Escherichia coli content in the solubilizate, in comparison with standard methods.
Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.
2011-01-01
Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871
Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa
2013-10-01
Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.
Directory of Open Access Journals (Sweden)
Aralikatte Onkarappa Saroja
2013-01-01
Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.
Myopathies of endocrine disorders: A prospective clinical and biochemical study
Directory of Open Access Journals (Sweden)
Vikas Sharma
2014-01-01
Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.
Systemic calciphylaxis presenting as a painful, proximal myopathy.
Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.
1992-01-01
A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.
Directory of Open Access Journals (Sweden)
Arun K Upadhyay
Full Text Available The objective of the research was to understand the structural determinants governing protein aggregation into inclusion bodies during expression of recombinant proteins in Escherichia coli. Recombinant human growth hormone (hGH and asparaginase were expressed as inclusion bodies in E.coli and the kinetics of aggregate formation was analyzed in details. Asparaginase inclusion bodies were of smaller size (200 nm and the size of the aggregates did not increase with induction time. In contrast, the seeding and growth behavior of hGH inclusion bodies were found to be sequential, kinetically stable and the aggregate size increased from 200 to 800 nm with induction time. Human growth hormone inclusion bodies showed higher resistance to denaturants and proteinase K degradation in comparison to those of asparaginase inclusion bodies. Asparaginase inclusion bodies were completely solubilized at 2-3 M urea concentration and could be refolded into active protein, whereas 7 M urea was required for complete solubilization of hGH inclusion bodies. Both hGH and asparaginase inclusion bodies showed binding with amyloid specific dyes. In spite of its low β-sheet content, binding with dyes was more prominent in case of hGH inclusion bodies than that of asparaginase. Arrangements of protein molecules present in the surface as well as in the core of inclusion bodies were similar. Hydrophobic interactions between partially folded amphiphillic and hydrophobic alpha-helices were found to be one of the main determinants of hGH inclusion body formation. Aggregation behavior of the protein molecules decides the nature and properties of inclusion bodies.
Upadhyay, Arun K.; Murmu, Aruna; Singh, Anupam; Panda, Amulya K.
2012-01-01
The objective of the research was to understand the structural determinants governing protein aggregation into inclusion bodies during expression of recombinant proteins in Escherichia coli. Recombinant human growth hormone (hGH) and asparaginase were expressed as inclusion bodies in E.coli and the kinetics of aggregate formation was analyzed in details. Asparaginase inclusion bodies were of smaller size (200 nm) and the size of the aggregates did not increase with induction time. In contrast, the seeding and growth behavior of hGH inclusion bodies were found to be sequential, kinetically stable and the aggregate size increased from 200 to 800 nm with induction time. Human growth hormone inclusion bodies showed higher resistance to denaturants and proteinase K degradation in comparison to those of asparaginase inclusion bodies. Asparaginase inclusion bodies were completely solubilized at 2–3 M urea concentration and could be refolded into active protein, whereas 7 M urea was required for complete solubilization of hGH inclusion bodies. Both hGH and asparaginase inclusion bodies showed binding with amyloid specific dyes. In spite of its low β-sheet content, binding with dyes was more prominent in case of hGH inclusion bodies than that of asparaginase. Arrangements of protein molecules present in the surface as well as in the core of inclusion bodies were similar. Hydrophobic interactions between partially folded amphiphillic and hydrophobic alpha-helices were found to be one of the main determinants of hGH inclusion body formation. Aggregation behavior of the protein molecules decides the nature and properties of inclusion bodies. PMID:22479486
Application of preparative disk gel electrophoresis for antigen purification from inclusion bodies.
Okegawa, Yuki; Koshino, Masanori; Okushima, Teruya; Motohashi, Ken
2016-02-01
Specific antibodies are a reliable tool to examine protein expression patterns and to determine the protein localizations within cells. Generally, recombinant proteins are used as antigens for specific antibody production. However, recombinant proteins from mammals and plants are often overexpressed as insoluble inclusion bodies in Escherichia coli. Solubilization of these inclusion bodies is desirable because soluble antigens are more suitable for injection into animals to be immunized. Furthermore, highly purified proteins are also required for specific antibody production. Plastidic acetyl-CoA carboxylase (ACCase: EC 6.4.1.2) from Arabidopsis thaliana, which catalyzes the formation of malonyl-CoA from acetyl-CoA in chloroplasts, formed inclusion bodies when the recombinant protein was overexpressed in E. coli. To obtain the purified protein to use as an antigen, we applied preparative disk gel electrophoresis for protein purification from inclusion bodies. This method is suitable for antigen preparation from inclusion bodies because the purified protein is recovered as a soluble fraction in electrode running buffer containing 0.1% sodium dodecyl sulfate that can be directly injected into immune animals, and it can be used for large-scale antigen preparation (several tens of milligrams). Copyright © 2015 Elsevier Inc. All rights reserved.
The genetic basis of pectoralis major myopathies in modern broiler chicken lines.
Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago
2015-12-01
This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.
Spectrum of metabolic myopathies.
Angelini, Corrado
2015-04-01
Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.
Analysis of lipid profile in lipid storage myopathy.
Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi
2016-09-01
Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct
Talafová, Klaudia; Hrabárová, Eva; Chorvát, Dušan; Nahálka, Jozef
2013-02-07
Adhesins of pathogens recognise the glycans on the host cell and mediate adherence. They are also crucial for determining the tissue preferences of pathogens. Currently, glyco-nanomaterials provide potential tool for antimicrobial therapy. We demonstrate that properly glyco-tailored inclusion bodies can specifically bind pathogen adhesins and release therapeutic substances. In this paper, we describe the preparation of tailored inclusion bodies via the conjugation of indicator protein aggregated to form inclusion bodies with soluble proteins. Whereas the indicator protein represents a remedy, the soluble proteins play a role in pathogen recognition. For conjugation, glutaraldehyde was used as linker. The treatment of conjugates with polar lysine, which was used to inactivate the residual glutaraldehyde, inhibited unwanted hydrophobic interactions between inclusion bodies. The tailored inclusion bodies specifically interacted with the SabA adhesin from Helicobacter pylori aggregated to form inclusion bodies that were bound to the sialic acids decorating the surface of human erythrocytes. We also tested the release of indicator proteins from the inclusion bodies using sortase A and Ssp DNAB intein self-cleaving modules, respectively. Sortase A released proteins in a relatively short period of time, whereas the intein cleavage took several weeks. The tailored inclusion bodies are promising "nanopills" for biomedical applications. They are able to specifically target the pathogen, while a self-cleaving module releases a soluble remedy. Various self-cleaving modules can be enabled to achieve the diverse pace of remedy release.
Toxic myopathy in a dog associated with the presence of monensin in dry food.
Wilson, J S
1980-01-01
This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.
Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food
Wilson, J. S.
1980-01-01
This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.
Mitochondrial myopathy presenting as fibromyalgia: a case report
Directory of Open Access Journals (Sweden)
Abdullah Mishal
2012-02-01
Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.
Statin-associated immune-mediated myopathy: biology and clinical implications.
Christopher-Stine, Lisa; Basharat, Pari
2017-04-01
In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.
Soni-removal of nucleic acids from inclusion bodies.
Neerathilingam, Muniasamy; Mysore, Sumukh; Gandham, Sai Hari A
2014-05-23
Inclusion bodies (IBs) are commonly formed in Escherichia coli due to over expression of recombinant proteins in non-native state. Isolation, denaturation and refolding of these IBs is generally performed to obtain functional protein. However, during this process IBs tend to form non-specific interactions with sheared nucleic acids from the genome, thus getting carried over into downstream processes. This may hinder the refolding of IBs into their native state. To circumvent this, we demonstrate a methodology termed soni-removal which involves disruption of nucleic acid-inclusion body interaction using sonication; followed by solvent based separation. As opposed to conventional techniques that use enzymes and column-based separations, soni-removal is a cost effective alternative for complete elimination of buried and/or strongly bound short nucleic acid contaminants from IBs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
A bibliography of high energy two-body and inclusive scattering data
International Nuclear Information System (INIS)
Gault, F.D.; Read, B.J.; Roberts, R.G.
1977-09-01
A bibliography is presented of the data on high energy two-body and quasi-two-body final state scattering processes. This updated edition also covers one and two-particle inclusive production. It contains references to those published papers whose main purpose is to provide data on high energy two-body and inclusive hadronic scattering cross-sections rather than just properties of the produced particles. It covers the leading high energy physics journals and the period up to June 1977. The entries are grouped by process in the order indicated in the Table of Contents, and an author index is also provided. (author)
Polymyositis and dermatomyositis: Disease spectrum and classification
Directory of Open Access Journals (Sweden)
Siba P Raychaudhuri
2012-01-01
Full Text Available Muscle inflammation and weakness are the key features of idiopathic inflammatory myopathies (IIMs. In addition IIMs are frequently associated with cutaneous and pulmonary involvement. In clinical practice the three common inflammatory myopathies we come across are polymyositis (PM, dermatomyositis (DM and inclusion body myositis (IBM. The Bohan and Peter criteria combine clinical, laboratory, and pathologic features to define PM and DM. They did not recognize inclusion body myositis (IBM or other inflammatory myopathies, such as granulomatous and eosinophilic myositis. Thus the disease spectrum is wide and IIMs are a heterogeneous group of autoimmune disorders. To address these issues in this article we have discussed the currently developing newer classifications of IIMs.
Richtlijn 'dermatomyositis, polymyositis en sporadische "inclusion body"-myositis'
Hoogendijk, J. E.; Bijlsma, J. W. J.; van Engelen, B. G. M.; Lindeman, E.; van Royen-Kerkhof, A.; de Rie, M. A.; de Visser, M.; Jennekens, F. G. I.
2005-01-01
This guideline presents recommendations for the diagnosis and treatment of dermatomyositis, polymyositis and sporadic inclusion body myositis (sIBM) according to the best available evidence. Characteristic skin abnormalities can be sufficient for the diagnosis of dermatomyositis. In case of doubt, a
Directory of Open Access Journals (Sweden)
Luh Yeni Laksmini
2014-09-01
Full Text Available Inclusion body myositis (IBM merupakan penyakit inflamasi pada otot yang bersifat progresif dengan penyebab yang tidak diketahui dan tidak menunjukkan respon yang baik terhadap berbagai terapi. Gambaran histopatologi IBM ditandai dengan infiltrat sel-sel limfosit diantara ruangan endomisial, di dalam otot dan di sekitar otot dengan fokus-fokus inklusi di dalam miosit (rimmed vacuole serta beberapa serat otot terlihat atrofi dan nekrosis. Dilaporkan wanita, usia 46 tahun dengan IBM. Keluhan utama pasien berupa kelemahan pada kedua tangan, kaki kanan terasa berat jika diangkat sehingga susah berjalan. Pemeriksaan saraf sensorik ekstremitas dekstra dan sinistra dalam batas normal. Pemeriksaan enzim cretinine kinase meningkat secara dramatik. Pemeriksaan histopatologi dari biospi otot gastrocnemius menunjukkan gambaran yang sesuai untuk IBM dan telah dilakukan penanganan dengan pemberian oral methilprednisolon 3x32 mg dan mecobalmin 1x500ìg intravena, namun tidak menunjukkan respon yang baik terhadap terapi dan akhirnya pasien meninggal. [MEDICINA 2013;44:118-123].
Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy
Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn
2014-01-01
Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570
An integrated diagnosis strategy for congenital myopathies.
Directory of Open Access Journals (Sweden)
Johann Böhm
Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.
Expression of nattokinase in Escherichia coli and renaturation of its inclusion body.
Ni, He; Guo, Peng-Cheng; Jiang, Wei-Ling; Fan, Xiao-Min; Luo, Xiang-Yu; Li, Hai-Hang
2016-08-10
Nattokinase is an important fibrinolytic enzyme with therapeutic applications for cardiovascular diseases. The full-length and mature nattokinase genes were cloned from Bacillus subtilis var. natto and expressed in pQE30 vector in Escherichia coli. The full-length gene expressed low nattokinase activity in the intracellular soluble and the medium fractions. The mature gene expressed low soluble nattokinase activity and large amount insoluble protein in inclusion bodies without enzyme activity. Large amount of refolding solutions (RSs) at different pH values were screening and RS-10 and RS-11 at pH 9 were selected to refold nattokinase inclusion bodies. The recombinant cells were lysed with 0.1mg/mL lysozyme and ultrasonic treatment. After centrifugation, the pellete was washed twice with 20mM Tris-HCl buffer (pH 7.5) containing 1% Triton X-100 to purify the inclusion bodies. The inclusion bodies were dissolved in water at pH 12.0 and refolded with RS-10. The refolded proteins showed 42.8IU/mg and 79.3IU/mg fibrinolytic activity by the traditional dilution method (20-fold dilution into RS-10) and the directly mixing the protein solution with equal volume RS-10, respectively, compared to the 52.0IU/mg of total water-soluble proteins from B. subtilis var. natto. This work demonstrated that the inclusion body of recombinant nattokinase expressed in E. coli could be simply refolded to the natural enzyme activity level by directly mixing the protein solution with equal volume refolding solution. Copyright © 2016 Elsevier B.V. All rights reserved.
Acute steroid myopathy: a highly overlooked entity.
Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev
2018-02-15
Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.
Association of inclusion body myositis with T cell large granular lymphocytic leukaemia
DEFF Research Database (Denmark)
Greenberg, Steven A; Pinkus, Jack L; Amato, Anthony A
2016-01-01
SEE HOHLFELD AND SCHULZE-KOOPS DOI101093/BRAIN/AWW053 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE: Inclusion body myositis and T cell large granular lymphocytic leukaemia are rare diseases involving pathogenic cytotoxic CD8+ T cells. After encountering four patients with both disorders, we...... prospectively screened 38 patients with inclusion body myositis for the presence of expanded large granular lymphocyte populations by standard clinical laboratory methods (flow cytometry, examination of blood smears, and T cell receptor gene rearrangements), and performed muscle immunohistochemistry for CD8, CD......57, and TIA1. Most (22/38; 58%) patients with inclusion body myositis had aberrant populations of large granular lymphocytes in their blood meeting standard diagnostic criteria for T cell large granular lymphocytic leukaemia. These T cell populations were clonal in 20/20 patients and stably present...
Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review
Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.
2015-01-01
Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685
Statin Induced Myopathy a Patient with Multiple Systemic Diseases
Directory of Open Access Journals (Sweden)
Özgül Uçar
2011-04-01
Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.
BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.
Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta
2015-12-01
BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.
International Nuclear Information System (INIS)
Edstroem, L.; Wroblewski, R.; Mair, W.G.
1982-01-01
Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation
Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study
Energy Technology Data Exchange (ETDEWEB)
Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno [AP-HP, Centre de Reference de pathologie neuromusculaire Paris-Est, Groupe Hospitalier Pitie-Salpetriere, Assistance Publique-Hopitaux de Paris, Paris, (France); Bassez, Guillaume [AP-HP, Centre de Reference de Pathologie Neuromusculaire Paris-Ouest, CHU Henri Mondor, Creteil, (France); Carlier, Pierre G. [CEA, I2BM, MIRCen, IdM NMR Laboratory, T-75651 Paris, (France); Clement, Karine [AP-HP, Institute of Cardiometabolism and Nutrition, ICAN, Pitie-Salpetriere Hospital, University Pierre et Marie-Curie Paris6, Paris, INSERM, U872 team 7, Paris, (France); Petit, Francois M. [AP-HP, Molecular Genetics and Metabolic Diseases Laboratory, Antoine Beclere Hospital, Clamart, (France); Carlier, Robert-Yves [AP-HP, Departement d' imagerie Medicale et Centre d' innovation Technologique, CHU Raymond-Poincare, Garches, (France)
2013-07-01
Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)
Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study
International Nuclear Information System (INIS)
Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno; Bassez, Guillaume; Carlier, Pierre G.; Clement, Karine; Petit, Francois M.; Carlier, Robert-Yves
2013-01-01
Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)
Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?
Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.
2013-01-01
Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy
Immune-mediated statin myopathy.
Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit
2016-01-01
Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Inclusion bodies of the multi-nuclear... Inclusion bodies of the multi-nuclear polyhedrosis virus of Anagrapha falcifera; exemption from the requirement of a tolerance. The microbial pest control agent inclusion bodies of the multi-nuclear...
Cifuentes-Muñoz, Nicolás; Branttie, Jean; Slaughter, Kerri Beth; Dutch, Rebecca Ellis
2017-12-15
Human metapneumovirus (HMPV) causes significant upper and lower respiratory disease in all age groups worldwide. The virus possesses a negative-sense single-stranded RNA genome of approximately 13.3 kb encapsidated by multiple copies of the nucleoprotein (N), giving rise to helical nucleocapsids. In addition, copies of the phosphoprotein (P) and the large RNA polymerase (L) decorate the viral nucleocapsids. After viral attachment, endocytosis, and fusion mediated by the viral glycoproteins, HMPV nucleocapsids are released into the cell cytoplasm. To visualize the subsequent steps of genome transcription and replication, a fluorescence in situ hybridization (FISH) protocol was established to detect different viral RNA subpopulations in infected cells. The FISH probes were specific for detection of HMPV positive-sense RNA (+RNA) and viral genomic RNA (vRNA). Time course analysis of human bronchial epithelial BEAS-2B cells infected with HMPV revealed the formation of inclusion bodies (IBs) from early times postinfection. HMPV IBs were shown to be cytoplasmic sites of active transcription and replication, with the translation of viral proteins being closely associated. Inclusion body formation was consistent with an actin-dependent coalescence of multiple early replicative sites. Time course quantitative reverse transcription-PCR analysis suggested that the coalescence of inclusion bodies is a strategy to efficiently replicate and transcribe the viral genome. These results provide a better understanding of the steps following HMPV entry and have important clinical implications. IMPORTANCE Human metapneumovirus (HMPV) is a recently discovered pathogen that affects human populations of all ages worldwide. Reinfections are common throughout life, but no vaccines or antiviral treatments are currently available. In this work, a spatiotemporal analysis of HMPV replication and transcription in bronchial epithelial cell-derived immortal cells was performed. HMPV was shown to
Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A
Energy Technology Data Exchange (ETDEWEB)
Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others
1995-08-28
The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.
Association between statin-associated myopathy and skeletal muscle damage.
Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette
2009-07-07
Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.
Meeting the challenges in the diagnosis of inflammatory myopathies ...
African Journals Online (AJOL)
Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...
Amici, David R; Pinal-Fernandez, Iago; Mázala, Davi A G; Lloyd, Thomas E; Corse, Andrea M; Christopher-Stine, Lisa; Mammen, Andrew L; Chin, Eva R
2017-03-22
Sporadic inclusion body myositis (IBM) is the most common primary myopathy in the elderly, but its pathoetiology is still unclear. Perturbed myocellular calcium (Ca 2+ ) homeostasis can exacerbate many of the factors proposed to mediate muscle degeneration in IBM, such as mitochondrial dysfunction, protein aggregation, and endoplasmic reticulum stress. Ca 2+ dysregulation may plausibly be initiated in IBM by immune-mediated membrane damage and/or abnormally accumulating proteins, but no studies to date have investigated Ca 2+ regulation in IBM patients. We first investigated protein expression via immunoblot in muscle biopsies from IBM, dermatomyositis, and non-myositis control patients, identifying several differentially expressed Ca 2+ -regulatory proteins in IBM. Next, we investigated the Ca 2+ -signaling transcriptome by RNA-seq, finding 54 of 183 (29.5%) genes from an unbiased list differentially expressed in IBM vs. controls. Using an established statistical approach to relate genes with causal transcription networks, Ca 2+ abundance was considered a significant upstream regulator of observed whole-transcriptome changes. Post-hoc analyses of Ca 2+ -regulatory mRNA and protein data indicated a lower protein to transcript ratio in IBM vs. controls, which we hypothesized may relate to increased Ca 2+ -dependent proteolysis and decreased protein translation. Supporting this hypothesis, we observed robust (4-fold) elevation in the autolytic activation of a Ca 2+ -activated protease, calpain-1, as well as increased signaling for translational attenuation (eIF2a phosphorylation) downstream of the unfolded protein response. Finally, in IBM samples we observed mRNA and protein under-expression of calpain-3, the skeletal muscle-specific calpain, which broadly supports proper Ca 2+ homeostasis. Together, these data provide novel insight into mechanisms by which intracellular Ca 2+ regulation is perturbed in IBM and offer evidence of pathological downstream effects.
Atypical presentation of GNE myopathy with asymmetric hand weakness
de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria
2014-01-01
GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749
Lilleker, J B; Rietveld, A; Pye, S R; Mariampillai, K; Benveniste, O; Peeters, M T J; Miller, J A L; Hanna, M G; Machado, P M; Parton, M J; Gheorghe, K R; Badrising, U A; Lundberg, I E; Sacconi, S; Herbert, M K; McHugh, N J; Lecky, B R F; Brierley, C; Hilton-Jones, D; Lamb, J A; Roberts, M E; Cooper, R G; Saris, C G J; Pruijn, G J M; Chinoy, H; van Engelen, B G M
2017-05-01
Autoantibodies directed against cytosolic 5'-nucleotidase 1A have been identified in many patients with inclusion body myositis. This retrospective study investigated the association between anticytosolic 5'-nucleotidase 1A antibody status and clinical, serological and histopathological features to explore the utility of this antibody to identify inclusion body myositis subgroups and to predict prognosis. Data from various European inclusion body myositis registries were pooled. Anticytosolic 5'-nucleotidase 1A status was determined by an established ELISA technique. Cases were stratified according to antibody status and comparisons made. Survival and mobility aid requirement analyses were performed using Kaplan-Meier curves and Cox proportional hazards regression. Data from 311 patients were available for analysis; 102 (33%) had anticytosolic 5'-nucleotidase 1A antibodies. Antibody-positive patients had a higher adjusted mortality risk (HR 1.89, 95% CI 1.11 to 3.21, p=0.019), lower frequency of proximal upper limb weakness at disease onset (8% vs 23%, adjusted OR 0.29, 95% CI 0.12 to 0.68, p=0.005) and an increased prevalence of excess of cytochrome oxidase deficient fibres on muscle biopsy analysis (87% vs 72%, adjusted OR 2.80, 95% CI 1.17 to 6.66, p=0.020), compared with antibody-negative patients. Differences were observed in clinical and histopathological features between anticytosolic 5'-nucleotidase 1A antibody positive and negative patients with inclusion body myositis, and antibody-positive patients had a higher adjusted mortality risk. Stratification of inclusion body myositis by anticytosolic 5'-nucleotidase 1A antibody status may be useful, potentially highlighting a distinct inclusion body myositis subtype with a more severe phenotype. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Challa, Sundaram; Jakati, Saumya; Uppin, Megha S; Kannan, Meena A; Liza, Rajasekhar; Murthy Jagarlapudi, M K
2018-01-01
Bohan and Peter criteria are widely used for the diagnosis of idiopathic inflammatory myopathies (IIMs). Recently, European Neuromuscular Center (ENMC) formulated criteria to identify subgroups of IIMs. To compare the two diagnostic criteria in adult IIMs. This was a retrospective review of case records of histologically confirmed IIMs in adults between January 2014 and May 2015. Both the Bohan and Peter, and ENMC 2004 criteria were applied in the same group of patients to subgroup the IIMs. Muscle biopsy was evaluated in all the four domains: muscle fiber, inflammatory, connective tissue, and vascular, with the basic panel of histological stains. Sporadic inclusion body myositis (s-IBM) was diagnosed using ENMC IBM diagnostic research criteria 2011. During the study period, 69 patients fulfilled the ENMC criteria for IIMs including 16 patients with s-IBM. The subgrouping as per the ENMC criteria (53) was: dermatomyositis (DM) in 30; polymyositis (PM) in 2; immune-mediated necrotizing myopathy (IMNM) in 9; and nonspecific myositis (NM) in 12 patients, whereas subgrouping by the Bohan and Peter criteria was DM in 9 and PM with and without connective tissue disease (CTD) in 26 patients only. There was underdiagnosis of DM, as perifascicular atrophy is not recognized as a diagnostic histological feature, and overdiagnosis of PM with and without CTD due to poor characterization of histological features in PM by the Bohan and Peter criteria. Systematic evaluation of muscle biopsy according to the ENMC criteria with basic panel of histochemical stains improved the diagnostic yield of IIM significantly when compared to the Bohan and Peter criteria.
Blood-flow restricted resistance training in patients with sporadic inclusion body myositis
DEFF Research Database (Denmark)
Jørgensen, A.; Aagaard, P.; Frandsen, U.
2018-01-01
Objectives: To investigate the effect of 12 weeks of low-load blood-flow restricted resistance (BFR) training on self-reported and objective physical function, and maximal muscle strength in patients with sporadic inclusion body myositis (sIBM). Method: Twenty-two patients with sIBM were randomized......), which was used to measure self-reported physical function. All patients performed physical function tests (2-Minute Walk Test, Timed Up and Go, and 30-Second Chair Stand), completed the Inclusion Body Myositis Functional Rating Scale (IBMFRS), and were tested for isolated knee extensor muscle strength...
Congenital myopathy is caused by mutation of HACD1.
Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti
2013-12-20
Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.
Vernengo, Luis; Chourbagi, Oussama; Panuncio, Ana; Lilienbaum, Alain; Batonnet-Pichon, Sabrina; Bruston, Francine; Rodrigues-Lima, Fernando; Mesa, Rosario; Pizzarossa, Carlos; Demay, Laurence; Richard, Pascale; Vicart, Patrick; Rodriguez, Maria-Mirta
2010-03-01
Desmin myopathy is a heterogeneous neuromuscular disorder characterized by skeletal myopathy and cardiomyopathy, inherited mostly in an autosomal dominant pattern. We report a five generation Uruguayan family with severe cardiomyopathy and skeletal myopathy. Its most striking features are: atrial dilation, arrhythmia, conduction block and sudden death due to conduction impairment. Affected skeletal muscle shows alteration of mitochondria with paracrystallin inclusions and granulofilamentous material scattered in the muscle fibres. This family carries an unusual deletion p.E114del within the 1A rod domain of desmin. Transfected cells expressing the mutated desmin show punctuated and speckled cytoplasmic aggregates. The mutation causes a local conformational change in heptads a/d residues and charge positions. These findings lead to the hypothesis that coiled-coil interactions may be impaired, resulting in severe alterations in the desmin network. This is the first time that a mutation affecting this domain in the desmin molecule is described in a desminopathy. Copyright 2010. Published by Elsevier B.V.
Autosomal dominant distal myopathy: Linkage to chromosome 14
Energy Technology Data Exchange (ETDEWEB)
Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.
1995-02-01
We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.
Membrane and inclusion body targeting of lyssavirus matrix proteins.
Pollin, Reiko; Granzow, Harald; Köllner, Bernd; Conzelmann, Karl-Klaus; Finke, Stefan
2013-02-01
Lyssavirus matrix proteins (M) support virus budding and have accessory functions that may contribute to host cell manipulation and adaptation to specific hosts. Here, we show that rabies virus (RABV) and European Bat Lyssavirus Type 1 (EBLV-1) M proteins differ in targeting and accumulation at cellular membranes. In contrast to RABV M, EBLV-1 M expressed from authentic EBLV-1 or chimeric RABV accumulated at the Golgi apparatus. Chimeric M proteins revealed that Golgi association depends on the integrity of the entire EBLV-1 M protein. Since RABV and EBLV-1 M differ in the use of cellular membranes for particle formation, differential membrane targeting and transport of M might determine the site of virus production. Moreover, both RABV and EBLV-1 M were for the first time detected within the nucleus and in Negri body-like inclusions bodies. Whereas nuclear M may imply hitherto unknown functions of lyssavirus M in host cell manipulation, the presence of M in inclusion bodies may correlate with regulatory functions of M in virus RNA synthesis. The data strongly support a model in which targeting of lyssavirus M proteins to distinctintracellular sites is a key determinant of diverse features in lyssavirus replication, host adaptation and pathogenesis. © 2012 Blackwell Publishing Ltd.
The expanding phenotype of mitochondrial myopathy.
DiMauro, Salvatore; Gurgel-Giannetti, Juliana
2005-10-01
Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.
[The practice guideline 'Dermatomyositis, polymyositis and sporadic inclusion body myositis'
Hoogendijk, J.E.; Bijlsma, J.W.J.; Engelen, B.G.M. van; Lindeman, E.J.M.; Royen-Kerkhof, A. van; Rie, M.A. de; Visser, M. de; Jennekens, F.G.I.
2005-01-01
This guideline presents recommendations for the diagnosis and treatment of dermatomyositis, polymyositis and sporadic inclusion body myositis (sIBM) according to the best available evidence. Characteristic skin abnormalities can be sufficient for the diagnosis of dermatomyositis. In case of doubt, a
Rietveld, A; Pye, S R; Mariampillai, K; Benveniste, O; Peeters, M T J; Miller, J A L; Hanna, M G; Machado, P M; Parton, M J; Gheorghe, K R; Badrising, U A; Lundberg, I E; Sacconi, S; Herbert, M K; McHugh, N J; Lecky, B R F; Brierley, C; Hilton-Jones, D; Lamb, J A; Roberts, M E; Cooper, R G; Saris, C G J; Pruijn, G J M; Chinoy, H; van Engelen, B G M
2017-01-01
Objectives Autoantibodies directed against cytosolic 5′-nucleotidase 1A have been identified in many patients with inclusion body myositis. This retrospective study investigated the association between anticytosolic 5′-nucleotidase 1A antibody status and clinical, serological and histopathological features to explore the utility of this antibody to identify inclusion body myositis subgroups and to predict prognosis. Materials and methods Data from various European inclusion body myositis registries were pooled. Anticytosolic 5′-nucleotidase 1A status was determined by an established ELISA technique. Cases were stratified according to antibody status and comparisons made. Survival and mobility aid requirement analyses were performed using Kaplan-Meier curves and Cox proportional hazards regression. Results Data from 311 patients were available for analysis; 102 (33%) had anticytosolic 5′-nucleotidase 1A antibodies. Antibody-positive patients had a higher adjusted mortality risk (HR 1.89, 95% CI 1.11 to 3.21, p=0.019), lower frequency of proximal upper limb weakness at disease onset (8% vs 23%, adjusted OR 0.29, 95% CI 0.12 to 0.68, p=0.005) and an increased prevalence of excess of cytochrome oxidase deficient fibres on muscle biopsy analysis (87% vs 72%, adjusted OR 2.80, 95% CI 1.17 to 6.66, p=0.020), compared with antibody-negative patients. Interpretation Differences were observed in clinical and histopathological features between anticytosolic 5′-nucleotidase 1A antibody positive and negative patients with inclusion body myositis, and antibody-positive patients had a higher adjusted mortality risk. Stratification of inclusion body myositis by anticytosolic 5′-nucleotidase 1A antibody status may be useful, potentially highlighting a distinct inclusion body myositis subtype with a more severe phenotype. PMID:28122761
Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.
Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin
2015-08-01
Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.
A Case Report of Inflammatory Myopathy and Sideroblastic Anemia
Directory of Open Access Journals (Sweden)
F Binesh
2007-01-01
Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.
Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.
Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok
GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.
Cerebrovascular Accidents In Myopathies
Directory of Open Access Journals (Sweden)
Farzad Fatehi
2017-02-01
Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.
Genetics Home Reference: nemaline myopathy
... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...
Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features
Directory of Open Access Journals (Sweden)
Zhiyv Niu
2018-03-01
Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy
Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.
Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita
2018-01-01
The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the
Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.
Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony
2017-04-01
Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies
White striping and woody breast myopathies in the modern poultry industry: a review.
Kuttappan, V A; Hargis, B M; Owens, C M
2016-11-01
Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.
Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.
Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew
2016-06-01
Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.
Yamaguchi, Hiroshi; Miyazaki, Masaya
2015-01-01
Active recombinant proteins are used for studying the biological functions of genes and for the development of therapeutic drugs. Overexpression of recombinant proteins in bacteria often results in the formation of inclusion bodies, which are protein aggregates with non-native conformations. Protein refolding is an important process for obtaining active recombinant proteins from inclusion bodies. However, the conventional refolding method of dialysis or dilution is time-consuming and recovered active protein yields are often low, and a cumbersome trial-and-error process is required to achieve success. To circumvent these difficulties, we used controllable diffusion through laminar flow in microchannels to regulate the denaturant concentration. This method largely aims at reducing protein aggregation during the refolding procedure. This Commentary introduces the principles of the protein refolding method using microfluidic chips and the advantage of our results as a tool for rapid and efficient recovery of active recombinant proteins from inclusion bodies.
REV-ERB and ROR: therapeutic targets for treating myopathies
Welch, Ryan D.; Flaveny, Colin A.
2017-08-01
Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.
Papazian, Óscar; Rivas-Chacón, Rafael
2013-09-06
To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.
Myofibrillar myopathies: State of the art, present and future challenges.
Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B
2015-10-01
Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Oestreicher, Z.; Lower, B.; Lower, S.; Bazylinski, D. A.
2011-12-01
Biomineralization occurs throughout the living world; a few common examples include iron oxide in chiton teeth, calcium carbonate in mollusk shells, calcium phosphate in animal bones and teeth, silica in diatom shells, and magnetite crystals inside the cells of magnetotactic bacteria. Biologically controlled mineralization is characterized by biominerals that have species-specific properties such as: preferential crystallographic orientation, consistent particle size, highly ordered spatial locations, and well-defined composition and structure. It is well known that magnetotactic bacteria synthesize crystals of magnetite inside of their cells, but how they mineralize the magnetite is poorly understood. Magnetosomes have a species-specific morphology that is due to specific proteins involved in the mineralization process. In addition to magnetite crystals, magnetotactic bacteria also produce inclusion bodies or granules that contain different elements, such as phosphorus, calcium, and sulfur. In this study we used the transmission electron microscope to analyze the structure of magnetite crystals and inclusion bodies from different species of magnetotactic bacteria in order to determine the composition of the inclusion bodies and to ascertain whether or not the magnetite crystals contain elements other than iron and oxygen. Using energy dispersive spectroscopy we found that different bacteria from different environments possess inclusion bodies that contain different elements such as phosphorus, calcium, barium, magnesium, and sulfur. These differences may reflect the conditions of the environment in which the bacteria inhabit.
Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations
DEFF Research Database (Denmark)
Witting, Nanna; Werlauff, Ulla; Duno, Morten
2016-01-01
airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....
Physical function and muscle strength in sporadic inclusion body myositis
DEFF Research Database (Denmark)
Jørgensen, Anders N; Aagaard, Per; Nielsen, Jakob L
2017-01-01
INTRODUCTION: In this study, self-reported physical function, functional capacity, and isolated muscle function were investigated in sporadic inclusion body myositis (sIBM) patients. METHODS: The 36-item Short Form (SF-36) Health Survey and 2-min walk test (2MWT), timed up & go test (TUG), and 30-s...
A large planetary body inferred from diamond inclusions in a ureilite meteorite.
Nabiei, Farhang; Badro, James; Dennenwaldt, Teresa; Oveisi, Emad; Cantoni, Marco; Hébert, Cécile; El Goresy, Ahmed; Barrat, Jean-Alix; Gillet, Philippe
2018-04-17
Planetary formation models show that terrestrial planets are formed by the accretion of tens of Moon- to Mars-sized planetary embryos through energetic giant impacts. However, relics of these large proto-planets are yet to be found. Ureilites are one of the main families of achondritic meteorites and their parent body is believed to have been catastrophically disrupted by an impact during the first 10 million years of the solar system. Here we studied a section of the Almahata Sitta ureilite using transmission electron microscopy, where large diamonds were formed at high pressure inside the parent body. We discovered chromite, phosphate, and (Fe,Ni)-sulfide inclusions embedded in diamond. The composition and morphology of the inclusions can only be explained if the formation pressure was higher than 20 GPa. Such pressures suggest that the ureilite parent body was a Mercury- to Mars-sized planetary embryo.
Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo
2014-01-01
Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.
A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome
Directory of Open Access Journals (Sweden)
Kang Won Lee
2015-12-01
Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.
Amyloid-linked cellular toxicity triggered by bacterial inclusion bodies
International Nuclear Information System (INIS)
Gonzalez-Montalban, Nuria; Villaverde, Antonio; Aris, Anna
2007-01-01
The aggregation of proteins in the form of amyloid fibrils and plaques is the characteristic feature of some pathological conditions ranging from neurodegenerative disorders to systemic amyloidoses. The mechanisms by which the aggregation processes result in cell damage are under intense investigation but recent data indicate that prefibrillar aggregates are the most proximate mediators of toxicity rather than mature fibrils. Since it has been shown that prefibrillar forms of the nondisease-related misfolded proteins are highly toxic to cultured mammalian cells we have studied the cytoxicity associated to bacterial inclusion bodies that have been recently described as protein deposits presenting amyloid-like structures. We have proved that bacterial inclusion bodies composed by a misfolding-prone β-galactosidase fusion protein are clearly toxic for mammalian cells but the β-galactosidase wild type enzyme forming more structured thermal aggregates does not impair cell viability, despite it also binds and enter into the cells. These results are in the line that the most cytotoxic aggregates are early prefibrilar assemblies but discard the hypothesis that the membrane destabilization is Key event to subsequent disruption of cellular processes, such as ion balance, oxidative state and the eventually cell death
Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review
Directory of Open Access Journals (Sweden)
V. A. Erokhina
2013-08-01
Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.
Stamm, Anne; Strauß, Sarah; Vogt, Peter; Scheper, Thomas; Pepelanova, Iliyana
2018-04-07
AmbLOXe is a lipoxygenase, which is up-regulated during limb-redevelopment in the Mexican axolotl, Ambystoma mexicanum, an animal with remarkable regeneration capacity. Previous studies have shown that mammalian cells transformed with the gene of this epidermal lipoxygenase display faster migration and wound closure rate during in vitro wound healing experiments. In this study, the gene of AmbLOXe was codon-optimized for expression in Escherichia coli and was produced in the insoluble fraction as protein aggregates. These inclusion bodies or nanopills were shown to be reservoirs containing functional protein during in vitro wound healing assays. For this purpose, functional inclusion bodies were used to coat cell culture surfaces prior cell seeding or were added directly to the medium after cells reached confluence. In both scenarios, AmbLOXe inclusion bodies led to faster migration rate and wound closure, in comparison to controls containing either no AmbLOXe or GFP inclusion bodies. Our results demonstrate that AmbLOXe inclusion bodies are functional and may serve as stable reservoirs of this enzyme. Nevertheless, further studies with soluble enzyme are also necessary in order to start elucidating the exact molecular substrates of AmbLOXe and the biochemical pathways involved in the wound healing effect.
Glucocorticoid-induced myopathy in the intensive care unit
DEFF Research Database (Denmark)
Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner
2015-01-01
Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...
Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme
... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...
Dardis, Christopher; Antezana, Ariel; Tanji, Kurenai; Maccabee, Paul J
2017-06-23
BACKGROUND Sporadic inclusion body myositis (IBM) is the most common acquired myopathy seen in adults aged over 50 years, with a prevalence estimated at between 1 and 70 per million. Weakness of the diaphragm with loss of vital capacity is almost universal in IBM. This is almost always asymptomatic. When respiratory complications occur, they are most often due to aspiration. Respiratory failure due to diaphragmatic weakness is exceptionally rare, particularly as the presenting symptom of the disease. It is not currently considered to be a paraneoplastic syndrome. CASE REPORT Our patient presented with hypercarbic respiratory failure. This is the first such reported case without signs of weakness elsewhere of which we are aware. We suspected IBM based on her history of progressive weakness and findings on electromyography. There was a delay of 5 years in obtaining biopsy for confirmation, during which she presented with recurrent episodes of respiratory failure despite using non-invasive ventilation. An autopsy revealed the presence of papillary thyroid carcinoma with spread to local lymph nodes. On the basis that these co-morbidities are unlikely to have occurred by chance (we estimate 1×10-17), we hypothesize that IBM may be a paraneoplastic condition. We acknowledge that proof would require demonstrating a pathogenic antibody. CONCLUSIONS IBM should be considered in older patients (age >45) presenting with otherwise unexplained respiratory failure. A workup for possible malignancy in this setting appears reasonable.
Epidemiology of inclusion body myositis in the Netherlands : A nationwide study
Badrising, UA; Maat-Schieman, M; van Duinen, SG; Breedveld, F; van Doorn, P; van Engelen, B; van den Hoogen, F; Hoogendijk, J; Howeler, C; de Jager, A; Jennekens, F; Koehler, P; van der Leeuw, H; de Visser, M; Verschuuren, JJ; Wintzen, AR
2000-01-01
Epidemiologic data on inclusion body myositis (IBM) are scarce, and possibly biased, because they are derived from larger neuromuscular centers. The present nationwide collaborative cross-sectional study, which culminated on July 1, 1999, resulted in identification of 76 patients with IBM and the
Genetics Home Reference: idiopathic inflammatory myopathy
... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...
Acute liver failure after recommended doses of acetaminophen in patients with myopathies
I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)
2011-01-01
textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute
Acute liver failure after recommended doses of acetaminophen in patients with myopathies
Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.
2011-01-01
To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We
Congenital myopathy is caused by mutation of HACD1
Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti
2013-01-01
Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...
Maggi, Maristella; Scotti, Claudia
2017-08-01
Single domain antibodies (sdAbs) are small antigen-binding domains derived from naturally occurring, heavy chain-only immunoglobulins isolated from camelid and sharks. They maintain the same binding capability of full-length IgGs but with improved thermal stability and permeability, which justifies their scientific, medical and industrial interest. Several described recombinant forms of sdAbs have been produced in different hosts and with different strategies. Here we present an optimized method for a time-saving, high yield production and extraction of a poly-histidine-tagged sdAb from Escherichia coli classical inclusion bodies. Protein expression and extraction were attempted using 4 different methods (e.g. autoinducing or IPTG-induced soluble expression, non-classical and classical inclusion bodies). The best method resulted to be expression in classical inclusion bodies and urea-mediated protein extraction which yielded 60-70 mg/l bacterial culture. The method we here describe can be of general interest for an enhanced and efficient heterologous expression of sdAbs for research and industrial purposes. Copyright © 2017 Elsevier Inc. All rights reserved.
Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.
Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian
2015-08-01
The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.
Mačinković, Igor S; Abughren, Mohamed; Mrkic, Ivan; Grozdanović, Milica M; Prodanović, Radivoje; Gavrović-Jankulović, Marija
2013-12-01
High levels of recombinant protein expression can lead to the formation of insoluble inclusion bodies. These complex aggregates are commonly solubilized in strong denaturants, such as 6-8M urea, although, if possible, solubilization under milder conditions could facilitate subsequent refolding and purification of bioactive proteins. Commercially available GST-tag assays are designed for quantitative measurement of GST activity under native conditions. GST fusion proteins accumulated in inclusion bodies are considered to be undetectable by such assays. In this work, solubilization of recombinantly produced proteins was performed in 4M urea. The activity of rGST was assayed in 2M urea and it was shown that rGST preserves 85% of its activity under such denaturing conditions. A colorimetric GST activity assay with 1-chloro-2, 4-dinitrobenzene (CDNB) was examined for use in rapid detection of expression targeted to inclusion bodies and for the identification of inclusion body proteins which can be solubilized in low concentrations of chaotropic agents. Applicability of the assay was evaluated by tracking protein expression of two GST-fused allergens of biopharmaceutical value in E. coli, GST-Der p 2 and GST-Mus a 5, both targeted to inclusion bodies. Copyright © 2013 Elsevier B.V. All rights reserved.
CT and the diagnosis of myopathies. Preliminary findings in 42 cases
Energy Technology Data Exchange (ETDEWEB)
Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M
1986-01-01
A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).
Autosomal dominant distal myopathy due to a novel ACTA1 mutation.
Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita
2017-08-01
Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Balduino, Keli Nunes
2009-01-01
The expression of proteins as inclusion bodies in bacteria is a widely used alternative for production of recombinant protein. However, the aggregation is a problem often encountered during refolding of these proteins. High hydrostatic pressure are able to solubilise the inclusion bodies in the presence of low concentrations of denaturant reagents, encouraging refolding protein with high efficiency and reduce costs. This work aims to refolding of recombinant proteins expressed in Escherichia coli from inclusion bodies using high hydrostatic pressure. Three toxins, all featuring five or more disulfide bonds were studied: NXH8, Natterin 2 and Bothropstoxin 1. Suspensions of inclusion bodies of the three proteins were pressurized to 2000 bars for 16 hours. The buffers were optimized for refolding of the three proteins. The buffer used in the refolding of NXH8 was 50 mM Tris HCl, pH 9.0 with proportion of 1GSH: 4GSSG at a concentration of 6 mM and 2 M GdnHCl. Inclusion bodies were used in O.D. (A600nm) of 0.5. After refolding process, dialysis was performed at pH 7.0. The final yield of obtaining soluble NXH8 was 40% (28,6 mg of soluble NXH8/L of culture medium). The refolding of Bothropstoxin 1 was obtained in refolding buffer of Tris HCl 50 mM, pH 7,5 with proportion of 2 GSH: GSSG 3 and concentration of 3 mM and 1 M GdnHCl. Use with a suspension of O.D. (A600nm) of 0.5. The final yield of recovery of Bothropstoxin 1 refolded was 32% (9,2 mg of refolded Bothropstoxin 1/L of culture medium). The refolding of Natterin 2 was performed in the refolding buffer: 20 mM Tris HCl pH 9.0 at a ratio of 2 GSH: 3GSSG and concentration of 10 mM and 1 M GdnHCl and inclusion bodies O.D. (A600nm) of 6.0. The yield of Natterin 2 refolded was 20% (3,7 mg/L of culture medium). Physico-chemical and biological analysis were performed by SDS-PAGE, western blot, scanning electron microscopy, biological tests in vivo and in vitro and structural. The analysis conducted in NXH8 did not show
... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...
Autophagy, inflammation and innate immunity in inflammatory myopathies.
Directory of Open Access Journals (Sweden)
Cristina Cappelletti
Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.
Centronuclear myopathy in a Border collie dog.
Eminaga, S; Cherubini, G B; Shelton, G D
2012-10-01
A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.
Nemaline myopathy and heart failure: role of ivabradine; a case report.
Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A
2015-01-19
Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending
Ude, Christian; Ben-Dov, Nadav; Jochums, André; Li, Zhaopeng; Segal, Ester; Scheper, Thomas; Beutel, Sascha
2016-05-01
The online monitoring of recombinant protein aggregate inclusion bodies during microbial cultivation is an immense challenge. Measurement of scattered and reflected light offers a versatile and non-invasive measurement technique. Therefore, we investigated two methods to detect the formation of inclusion bodies and monitor their production: (1) online 180° scattered light measurement (λ = 625 nm) using a sensor platform during cultivation in shake flask and (2) online measurement of the light reflective interference using a porous Si-based optical biosensor (SiPA). It could be shown that 180° scattered light measurement allows monitoring of alterations in the optical properties of Escherichia coli BL21 cells, associated with the formation of inclusion bodies during cultivation. A reproducible linear correlation between the inclusion body concentration of the non-fluorescent protein human leukemia inhibitory factor (hLIF) carrying a thioredoxin tag and the shift ("Δamp") in scattered light signal intensity was observed. This was also observed for the glutathione-S-transferase-tagged green fluorescent protein (GFP-GST). Continuous online monitoring of reflective interference spectra reveals a significant increase in the bacterium refractive index during hLIF production in comparison to a non-induced reference that coincide with the formation of inclusion bodies. These online monitoring techniques could be applied for fast and cost-effective screening of different protein expression systems.
Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache
Directory of Open Access Journals (Sweden)
R Burnham
2006-01-01
Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.
Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.
Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John
2004-03-01
A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.
Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency
Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John
2004-01-01
A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.
Skeletal muscle repair in a mouse model of nemaline myopathy
Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.
2006-01-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...
Mineralization of alpha-1-antitrypsin inclusion bodies in Mmalton alpha-1-antitrypsin deficiency.
Callea, Francesco; Giovannoni, Isabella; Francalanci, Paola; Boldrini, Renata; Faa, Gavino; Medicina, Daniela; Nobili, Valerio; Desmet, Valeer J; Ishak, Kamal; Seyama, Kuniaki; Bellacchio, Emanuele
2018-05-16
Alpha-1-antitrypsin (AAT) deficiency (AATD) of Z, Mmalton, Siiyama type is associated with liver storage of the mutant proteins and liver disease. The Z variant can be diagnosed on isoelectric focusing (IEF) while Mmalton and Siiyama may be missed or misdiagnosed with this technique. Therefore, molecular analysis is mandatory for their characterization. In particular, that holds true for the Mmalton variant as on IEF profile it resembles the wild M2 subtype. This is a retrospective analysis involving review of medical records and of liver biopsy specimens from a series of Mmalton, Z and Siiyama Alpha-1-antitrypsin deficiency patients. The review has been implemented by additional histological stains, electron microscopic observations and 3-D modeling studies of the sites of the mutations. Z, Mmalton and Siiyama liver specimen contained characteristic intrahepatocytic PAS-D globules. The globules differed in the three variants as only Mmalton cases showed dark basophilic precipitates within the AAT inclusions. The precipitates were visualized in haematoxylin-eosin (H.E.) stained preparations and corresponded to calcium precipitates as demonstrated by von Kossa staining. On immunohistochemistry, ZAAT inclusions were stained by polyclonal as well as monoclonal noncommercial anti-AAT antibody (AZT11), whilst Mmalton and Siiyama inclusion bodies remained negative with the monoclonal anti-Z antibody. 3-D protein analysis allowed to predict more severe misfolding of the Mmalton molecule as compared to Z and Siiyama that could trigger anomalous interaction with endoplasmic reticulum chaperon proteins, namely calcium binding proteins. Mmalton AAT inclusion bodies contain calcium precipitates inside them that allow the differential diagnosis with Siiyama and ZAAT inclusions in routine histological sections. The study has confirmed the specificity of the monoclonal AZT11 for the Z mutant. Thus, the combination of these two features is crucial for the distinction between the
ColVI myopathies: where do we stand, where do we go?
Directory of Open Access Journals (Sweden)
Allamand Valérie
2011-09-01
Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.
The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy
Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.
2016-01-01
HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249
Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.
Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J
1997-05-01
A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.
Identification of a novel myositis-associated antibody directed against cortactin.
Labrador-Horrillo, Moisés; Martínez, Maria Angeles; Selva-O'Callaghan, Albert; Trallero-Araguás, Ernesto; Grau-Junyent, Josep M; Vilardell-Tarrés, Miquel; Juarez, Candido
2014-10-01
The aim of this study is to describe a novel myositis-associated autoantibody (anti-cortactin antibody) and assess related clinical and immunological manifestations and its clinical significance. Adult patients with myositis (dermatomyositis, polymyositis, immune-mediated necrotizing myopathy, and inclusion body myositis), as well as patients with other autoimmune diseases and non-inflammatory myopathies were analyzed for the presence of anti-cortactin antibody using in-house developed ELISA and immunoblotting techniques with a commercial source of purified cortactin. The cut-off for positive status was determined in a group of healthy volunteers. Antibody against cortactin was positive in 7/34 (20%) polymyositis patients, 9/117 (7.6%) dermatomyositis, 2/7 (26%) immune-mediated necrotizing myopathy, and none of the 4 patients with inclusion body myositis. The antibody also tested positive in 3/101 patients with other autoimmune diseases (2 systemic sclerosis and 1 systemic lupus erythematosus), and in 1/29 patients with non-inflammatory myopathy. No relevant association with specific clinical features was found in patients with these antibodies. Anti-cortactin antibody was more frequently positive in patients with polymyositis and immune-mediated necrotizing myopathy than in the remaining myositis patients, and was the only myositis autoantibody found in sera of 3 patients from these groups. Our data indicate that cortactin is a novel target antigen in patients with autoimmune diseases, especially patients with polymyositis or immune-mediated necrotizing myopathy. Anti-cortactin can be considered a new myositis-associated antibody. Copyright © 2014 Elsevier B.V. All rights reserved.
Peterson, Megan J.; Snyder, W. Kalani; Westerman, Shelley; McFarland, Benjamin J.
2011-01-01
We describe how to produce and purify proteins from E. coli inclusion bodies by adapting versatile, preparative-scale techniques to the undergraduate laboratory schedule. This seven-week sequence of experiments fits into an annual cycle of research activity in biochemistry courses. Recombinant proteins are expressed as inclusion bodies, which are collected, washed, then solubilized in urea. Stepwise dialysis to dilute urea over the course of a week produces refolded protein. Column chromatography is used to purify protein into fractions, which are then analyzed with gel electrophoresis and concentration assays. Students culminate the project by designing crystallization trials in sitting-drop trays. Student evaluation of the experience has been positive, listing 5–12 new techniques learned, which are transferrable to graduate research in academia and industry. PMID:21691428
Search for Pompe disease among patients with undetermined myopathies.
Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A
2015-07-20
Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Inclusion bodies induced by bean rugose mosaic virus seen under light microscopy
Directory of Open Access Journals (Sweden)
Carmen Rivera
2000-12-01
Full Text Available Two types of inclusion bodies were consistently observed under light microscopy in bean (Phaseolus vulgaris leaf tissue infected with bean rugose mosaic virus (BRMV, a species of the genus Comovirus, family Comoviridae. One type consisted of vacuolated inclusions found mainly in the cytoplasm of epidermal cells. The other type consisted of abundant crystalloid inclusions of different sizes and shapes found consistently in glandular hairs, guard cells, phloem tissue, xylem elements and occasionally in epidermal and mesophyll tissues. The two types of inclusion bodies stained with Azure A and Luxol Brilliant Green Bl-Calcomine Orange 2RS (O-G, and were similar to those seen to be caused by other species of comoviruses.Se observaron dos tipos de inclusiones virales, mediante microscopia de luz, en hojas de plantas de frijol (Phaseolus vulgaris previamente infectadas con el virus del mosaico rugoso del frijol ("bean rugose mosaic comovirus", BRMV, especie del género Comovirus, familia Comoviridae. Se hallaron inclusiones vesiculadas, principalmente en el citoplasma de células de la epidermis, y abundantes inclusiones cristalinas de diferentes formas y tamaños siempre en células guarda, tricomas glandulares, floema, elementos del xilema y ocasionalmente en células epidérmicas y del mesófilo. Ambos tipos de inclusiones tiñeron con Azure A y con la tinción, verde naranja (Luxol Brilliant Green BL-Calcomine Orange 2 RS conocida como OG, y son similares a las inclusiones inducidas por otras especies del género Comovirus.
Role of the disaggregase ClpB in processing of proteins aggregated as inclusion bodies.
Zblewska, Kamila; Krajewska, Joanna; Zolkiewski, Michal; Kędzierska-Mieszkowska, Sabina
2014-08-01
Overproduction of heterologous proteins in bacterial systems often results in the formation of insoluble inclusion bodies (IBs), which is a major impediment in biochemical research and biotechnology. In principle, the activity of molecular chaperones could be employed to gain control over the IB formation and to improve the recombinant protein yields, but the potential of each of the major bacterial chaperones (DnaK/J, GroEL/ES, and ClpB) to process IBs has not been fully established yet. We investigated the formation of inclusion bodies (IBs) of two aggregation-prone proteins, VP1LAC and VP1GFP, overproduced in Escherichiacoli in the presence and absence of the chaperone ClpB. We found that both ClpB isoforms, ClpB95 and ClpB80 accumulated in E. coli cells during the production of IBs. The amount of IB proteins increased in the absence of ClpB. ClpB supported the resolubilization and reactivation of the aggregated VP1LAC and VP1GFP in E. coli cells. The IB disaggregation was optimal in the presence of both ClpB95 and ClpB80. Our results indicate an essential role of ClpB in controlling protein aggregation and inclusion body formation in bacteria. Copyright © 2014 Elsevier Inc. All rights reserved.
Hoffmann's disease: MR imaging of hypothyroid myopathy
Energy Technology Data Exchange (ETDEWEB)
Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)
2015-11-15
Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)
Hoffmann's disease: MR imaging of hypothyroid myopathy
International Nuclear Information System (INIS)
Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun
2015-01-01
Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)
Zidovudine-induced myopathy: A study in Indian patients.
Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish
2010-07-01
Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.
A study of acute muscle dysfunction with particular reference to dengue myopathy
Directory of Open Access Journals (Sweden)
Rajesh Verma
2017-01-01
Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3
Seborrheic inclusion cyst of the skin positive for cytoplasmic inclusion bodies and HPV antigen.
Terada, Tadashi
2012-01-01
Seborrheic inclusion cyst (SIC) is a very rare variant of epidermal cyst of the skin. SIC shows seborrheic keratosis (SK)-like lesion in epidermal cyst. SIC is extremely rare; only 6 case reports have been published in the English literature. However, no immunohistochemical study of SIC has been reported. A 41-year-old Japanese man noticed a subcutaneous tumor in the neck. Physical examination showed slightly mobile tumor in the subcutaneous tissue, and total excision was performed. Grossly, the tumor (1 x 1 x 0.8 cm) was cyst containing atheromatous keratin. Microscopically, the lesion is a cyst containing keratins. About one half of the cyst showed features of epidermal cyst consisting of mature squamous epithelium with granular layers. The other one half showed SK-like epidermal proliferation. The SK-like area showed basaloid cell proliferation with pseudohorn cysts. No significant atypia was noted. Many eosinophilic cytoplasmic inclusion bodies were noted in the SK-like area. Immunohistochemically, the SK-like area was positive for pancytokeratin AE1/3, pancytokeratin CAM5.2, p63, and Ki-67 (labeling=8%) and HPV, but negative for p53. The pathological diagnosis was SIC.
Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J
2014-03-01
It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.
Inclusion understood from the perspectives of children with disability.
Spencer-Cavaliere, Nancy; Watkinson, E Jane
2010-10-01
This study explored the perspectives of children with disabilities regarding the concept of inclusion in physical activity. Participants were children (two girls, nine boys, Mage = 10 years, five months, age range: 8-12 years) with disabilities, including cerebral palsy, fine and gross motor delays, developmental coordination disorder, muscular dystrophy, nemaline myopathy, brachial plexus injury, and severe asthma. Children's perspectives on inclusion in physical activity (e.g., sports, games, and play) were explored through semistructured interviews. Interviews were digitally audio taped and transcribed verbatim. Data were analyzed through content analysis. Three themes emerged from the data: gaining entry to play, feeling like a legitimate participant, and having friends. These themes were associated with feeling included to varying degrees in sports, games, and play. In essence, it was the actions of others that were the prominent features identified by children that contributed to feeling more or less included in physical activity contexts. These results are discussed in relation to inclusion in physical education, recreation, and unstructured free play.
Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul
2012-10-01
The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-01-01
Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208
Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy
Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert
2013-01-01
Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594
Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.
El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S
2016-06-01
Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Dean vortex membrane microfiltration and diafiltration of rBDNF E. coli inclusion bodies
Schutyser, M.A.I.; Rupp, R.; Wideman, J.; Belfort, G.
2002-01-01
Cross-flow microfiltration (CMF) and diafiltration were used to concentrate and purify recombinant Brain-Derived Neutrophic Factor (rBDNF) inclusion bodies from an E. coli cell suspension and a homogenized E. coli cell suspension (homogenate/lysate). Although these processes have been tested
Flaccid quadriplegia due to thyrotoxic myopathy.
Couillard, Philippe; Wijdicks, Eelco F M
2014-04-01
Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.
Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A
2016-11-01
The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.
Genetic screening in the Persian Jewish community: A pilot study.
Kaback, Michael; Lopatequi, Jean; Portuges, Amin Riley; Quindipan, Cathy; Pariani, Mitchel; Salimpour-Davidov, Nilou; Rimoin, David L
2010-10-01
Israeli investigators have identified several relatively frequent disorders due to founder point mutations in Persian (Iranian) Jews, who, for nearly three centuries up to the Islamic Revolution of 1979, were completely isolated reproductively. Using a community-based model previously employed with Tay-Sachs disease prevention, we developed a pilot program for the Persian Jewish community of greater Los Angeles. We screened for mutations responsible for four relatively frequent autosomal recessive conditions in Persian Jews in which effective interventions are available for each: Pseudocholinesterase deficiency (butyryl cholinesterase deficiency); Congenital hypoaldosteronism (corticosterone methyl oxidase II); Autoimmune polyendocrinopathy (autoimmune regulatory element); and Hereditary Inclusion Body myopathy. One thousand individuals volunteered. Mutations were assessed in saliva-derived DNA and were positive for 121/1000 butyryl cholinesterase deficiency; 92/1000 Hereditary Inclusion Body myopathy; 38/1000 corticosterone methyl oxidase II; and 37/1000 autoimmune regulatory element. Ten homozygous individuals (9 butyryl cholinesterase deficiency and 1 Hereditary Inclusion Body myopathy) and 10 "at-risk" couples (seven for butyryl cholinesterase deficiency and one each for the other three disorders) were identified. These frequencies are comparable with those in Israel and indicate an extraordinary level of inbreeding, as anticipated. A carefully planned effort can be delivered to an "increased risk" community if detailed attention is given to planning and organization. However, availability of an effective intervention for those found to be "at-risk" or possibly affected, is essential before embarking.
Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy
Directory of Open Access Journals (Sweden)
Şenol Kobak
2013-01-01
Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.
Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies
Energy Technology Data Exchange (ETDEWEB)
Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))
1990-07-01
The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.
Chen, Huanhuan; Li, Ninghuan; Xie, Yueqing; Jiang, Hua; Yang, Xiaoyi; Cagliero, Cedric; Shi, Siwei; Zhu, Chencen; Luo, Han; Chen, Junsheng; Zhang, Lei; Zhao, Menglin; Feng, Lei; Lu, Huili; Zhu, Jianwei
2017-07-01
It has been documented that the purification of inclusion bodies from Escherichia coli by size exclusion chromatography (SEC) may benefit subsequent refolding and recovery of recombinant proteins. However, loading volume and the high cost of the column limits its application in large-scale manufacturing of biopharmaceutical proteins. We report a novel process using polyethylene glycol (PEG) precipitation under denaturing conditions to replace SEC for rapid purification of inclusion bodies containing recombinant therapeutic proteins. Using recombinant human interleukin 15 (rhIL-15) as an example, inclusion bodies of rhIL-15 were solubilized in 7 M guanidine hydrochloride, and rhIL-15 was precipitated by the addition of PEG 6000. A final concentration of 5% (w/v) PEG 6000 was found to be optimal to precipitate target proteins and enhance recovery and purity. Compared to the previously reported S-200 size exclusion purification method, PEG precipitation was easier to scale up and achieved the same protein yields and quality of the product. PEG precipitation also reduced manufacturing time by about 50 and 95% of material costs. After refolding and further purification, the rhIL-15 product was highly pure and demonstrated a comparable bioactivity with a rhIL-15 reference standard. Our studies demonstrated that PEG precipitation of inclusion bodies under denaturing conditions holds significant potential as a manufacturing process for biopharmaceuticals from E. coli protein expression systems.
Treatment of critical illness polyneuropathy and/or myopathy - a systematic review
DEFF Research Database (Denmark)
Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg
2012-01-01
The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....
Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.
Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold
2016-12-01
Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.
Michelle, E Harlan; Mammen, Andrew L
2015-10-01
Patients with autoimmune myositis typically present with muscle weakness, elevated serum levels of muscle enzymes, and abnormal muscle biopsies. However, patients with other acquired myopathies or genetic muscle diseases may have remarkably similar presentations. Making the correct diagnosis of another muscle disease can prevent these patients from being exposed to the risks of immunosuppressive medications, which benefit those with myositis, but not those with other types of muscle disease. Here, we review some of the most common acquired and inherited muscle diseases that can mimic autoimmune myositis, including inclusion body myositis, limb girdle muscular dystrophies, metabolic myopathies, mitochondrial myopathies, and endocrine myopathies. We emphasize aspects of the medical history, physical exam, laboratory evaluation, and muscle biopsy analysis that can help clinicians distinguish myositis mimics from true autoimmune myositis.
The genetic basis of pectoralis major myopathies in modern broiler chicken lines
Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago
2015-01-01
This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...
Mackin, Robert B
2014-01-01
The goal of simple, high-yield expression and purification of recombinant human proinsulin has proven to be a considerable challenge. First, proinsulin forms inclusion bodies during bacterial expression. While this phenomenon can be exploited as a capture step, conventionally prepared inclusion bodies contain significant amounts of non-protein contaminants that interfere with subsequent chromatographic purification. Second, the proinsulin molecules within the inclusion bodies are incorrectly folded, and likely cross-linked to one another, making it difficult to quantify the amount of expressed proinsulin. Third, proinsulin is an intermediate between the initial product of ribosomal translation (preproinsulin) and the final product secreted by pancreatic beta cells (insulin). Therefore, to be efficiently produced in bacteria, it must be produced as an N-terminally extended fusion protein, which has to be converted to authentic proinsulin during the purification scheme. To address all three of these problems, while simultaneously streamlining the procedure and increasing the yield of recombinant proinsulin, we have made three substantive modifications to our previous method for producing proinsulin:.•Conditions for the preparation of inclusion bodies have been altered so contaminants that interfere with semi-preparative reversed-phase chromatography are excluded while the proinsulin fusion protein is retained at high yield.•Aliquots are taken following important steps in the procedure and the quantity of proinsulin-related polypeptide in the sample is compared to the amount present prior to that step.•Final purification is performed using a silica-based reversed-phase matrix in place of a polystyrene-divinylbenzene-based matrix.
International Nuclear Information System (INIS)
Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.
2004-01-01
As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate
Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.
Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J
2016-09-01
Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.
Chemical Assistance in Refolding of Bacterial Inclusion Bodies
Directory of Open Access Journals (Sweden)
Mona Alibolandi
2011-01-01
Full Text Available Escherichia coli is one of the most widely used hosts for the production of recombinant proteins but insoluble expression of heterologous proteins is a major bottleneck in production of recombinant proteins in E. coli. In vitro refolding of inclusion body into proteins with native conformations is a solution for this problem but there is a need for optimization of condition for each protein specifically. Several approaches have been described for in vitro refolding; most of them involve the use of additives for assisting correct folding. Cosolutes play a major role in refolding process and can be classified according to their function as aggregation suppressors and folding enhancers. This paper presents a review of additives that are used in refolding process of insoluble recombinant proteins in small scale and industrial processes.
Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina
2014-01-01
Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously
Mutation-specific effects on thin filament length in thin filament myopathy.
Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C
2016-06-01
Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.
Unfolded protein response and activated degradative pathways regulation in GNE myopathy.
Directory of Open Access Journals (Sweden)
Honghao Li
Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.
Secreted Protein Acidic and Rich in Cysteine (SPARC) in Human Skeletal Muscle
DEFF Research Database (Denmark)
Jørgensen, Louise H; Petersson, Stine J; Sellathurai, Jeeva
2009-01-01
indicated a function of SPARC in skeletal muscle. We therefore found it of interest to study SPARC expression in human skeletal muscle during development and in biopsies from Duchenne and Becker muscular dystrophy and congenital muscular dystrophy, congenital myopathy, inclusion body myositis...
Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association
Directory of Open Access Journals (Sweden)
Subasree Ramakrishnan
2012-01-01
Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.
Ogrodnik, Mikołaj; Salmonowicz, Hanna; Brown, Rachel; Turkowska, Joanna; Średniawa, Władysław; Pattabiraman, Sundararaghavan; Amen, Triana; Abraham, Ayelet-chen; Eichler, Noam; Lyakhovetsky, Roman; Kaganovich, Daniel
2014-06-03
Aging is associated with the accumulation of several types of damage: in particular, damage to the proteome. Recent work points to a conserved replicative rejuvenation mechanism that works by preventing the inheritance of damaged and misfolded proteins by specific cells during division. Asymmetric inheritance of misfolded and aggregated proteins has been shown in bacteria and yeast, but relatively little evidence exists for a similar mechanism in mammalian cells. Here, we demonstrate, using long-term 4D imaging, that the vimentin intermediate filament establishes mitotic polarity in mammalian cell lines and mediates the asymmetric partitioning of damaged proteins. We show that mammalian JUNQ inclusion bodies containing soluble misfolded proteins are inherited asymmetrically, similarly to JUNQ quality-control inclusions observed in yeast. Mammalian IPOD-like inclusion bodies, meanwhile, are not always inherited by the same cell as the JUNQ. Our study suggests that the mammalian cytoskeleton and intermediate filaments provide the physical scaffold for asymmetric inheritance of dynamic quality-control JUNQ inclusions. Mammalian IPOD inclusions containing amyloidogenic proteins are not partitioned as effectively during mitosis as their counterparts in yeast. These findings provide a valuable mechanistic basis for studying the process of asymmetric inheritance in mammalian cells, including cells potentially undergoing polar divisions, such as differentiating stem cells and cancer cells.
Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy
... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...
Understanding mitochondrial myopathies: a review
Directory of Open Access Journals (Sweden)
Abhimanyu S. Ahuja
2018-05-01
Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.
Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan
2010-01-01
Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...
Eosinophilic fasciitis in a child mimicking a myopathy.
Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.
2006-01-01
A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,
Genetics Home Reference: CAV3-related distal myopathy
... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...
Badrising, UA; Maat-Schieman, MLC; Ferrari, MD; Zwinderman, AH; Wessels, JAM; Breedveld, FC; van Doorn, PA; van Engelen, BGM; Hoogendijk, JE; Howeler, CJ; de Jager, AE; Jennekens, FGI; Koehler, PJ; de Visser, M; Viddeleer, A; Verschuuren, JJ; Wintzen, AR
We investigated whether 5 to 20mg per week oral methotrexate could slow down disease progression in 44 patients with inclusion body myositis in a randomized double-blind placebo-controlled study over 48 weeks. Mean change of quantitative muscle strength testing sum scores was the primary study
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-07-01
Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.
A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.
Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio
2012-09-01
Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.
Directory of Open Access Journals (Sweden)
C. Magarinos Torres
1934-02-01
Full Text Available Vesiculas e pustulas contendo numerosas inclusões citoplasmicas nas celulas epidermicas, foram regularmente produzidas no macaco (Macacus rhesus, quer com o virus do alastrim, quer com o da vacina, após inoculação endovenosa e sem previa escarificação. O virus do alastrim parece menos virulento para essa especie de macaco que o da vacina. Ao passo que 12 macacos rhesus injetados por via endovenosa com sete amostras diferentes de virus do alastrim, após apresentarem com regularidade um infecção experimental, sobreviveram e se conservaram em boa saúde, a injecção endovenosa do virus da vacina recentemente preparado (polpa bruta produziu a morte em 2, dentre 4 animais experimentados. 2. - Foram notadas diferenças pequenas, mas nitidas, na morfologia das inclusões do alastrim e da vacina, em material fixado no liquido de Helly, incluido em parafina e corado pela hematoxilina-eosina. Dizem elas respeito ao numero de inclusões encontradas em cada celula epidermica e às suas reações de coloração. 3. - As inclusões do alastrim, quando apresentam grandes dimensões, conservam-se unicas ou solitarias no citoplasma das celulas epidermicas do macaco rhesus, e coram-se em tonalidade que varia do azul escuro ao cinzento-azulado. Comtudo, em celulas que sofreram necrose, ou naquelas contendo 2 a 4 inclusões de pequenas dimensões, por vezes elas se mostram coradas em roseo. 4. - As inclusões da vacina, quando em faze adeantada de desenvolvimento, são multiplas nas celulas epidermicas do macaco rhesus e mostram, regularmente, uma policromatofilia caracteristica.1. - Vesicles and pustules containing numerous cytoplasmic inclusion bodies within the epidermal cells were regularly produced in monkeys (Macacus rhesus by intravenous inoculation either of alastrim virus or of recently prepared vaccine emulsion, no previous scarifications being required. Alastrim virus seems less virulent for this species of monkey than the virus of vaccinia is
[Value of MRI in the treatment of Grave's disease orbital myopathy].
Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H
2001-10-01
In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.
Nakamura, R K; Russell, N J; Shelton, G D
2012-06-01
A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.
Miopatia ocular descendente Descending ocular myopathy: a case report
Directory of Open Access Journals (Sweden)
Marcos R. G. de Freitas
1975-06-01
Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.
Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease
International Nuclear Information System (INIS)
Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia
2008-01-01
Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)
Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease
Energy Technology Data Exchange (ETDEWEB)
Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)
2008-11-15
Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)
Directory of Open Access Journals (Sweden)
Hou-min YIN
2014-06-01
Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal neuropathy.like syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected. Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers. Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal neuropathy.like syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007
Zhang, Shengwei; Chen, Longyun; Zhang, Guangyuan; Yan, Qin; Yang, Xiaodan; Ding, Binbin; Tang, Qiaopeng; Sun, Shengjun; Hu, Zhulong
2013-01-01
The nucleoprotein (N) and phosphoprotein (P) interaction of nonsegmented negative-strand RNA viruses is essential for viral replication; this includes N0-P (N0, free of RNA) interaction and the interaction of N-RNA with P. The precise site(s) within N that mediates the N-P interaction and the detailed regulating mechanism, however, are less clear. Using a human parainfluenza virus type 3 (HPIV3) minigenome assay, we found that an N mutant (NL478A) did not support reporter gene expression. Using in vivo and in vitro coimmunoprecipitation, we found that NL478A maintains the ability to form NL478A0-P, to self-assemble, and to form NL478A-RNA but that NL478A-RNA does not interact with P. Using an immunofluorescence assay, we found that N-P interaction provides the minimal requirement for the formation of cytoplasmic inclusion bodies, which contain viral RNA, N, P, and polymerase in HPIV3-infected cells. NL478A was unable to form inclusion bodies when coexpressed with P, but the presence of N rescued the ability of NL478A to form inclusion bodies and the transcriptional function of NL478A, thereby suggesting that hetero-oligomers formed by N and NL478A are functional and competent to form inclusion bodies. Furthermore, we found that NL478A is also defective in virus growth. To our knowledge, we are the first to use a paramyxovirus to identify a precise amino acid within N that is critical for N-RNA and P interaction but not for N0-P interaction for the formation of inclusion bodies, which appear to be bona fide sites of RNA synthesis. PMID:24027324
Li, Ming; Fan, Hua; Liu, Jiahua; Wang, Minhong; Wang, Lili; Wang, Chaozhan
2012-03-01
Recombinant human granulocyte colony-stimulating factor (rhG-CSF) is a very efficient therapeutic protein drug which has been widely used in human clinics to treat cancer patients suffering from chemotherapy-induced neutropenia. In this study, rhG-CSF was solubilized from inclusion bodies by using a high-pH solution containing low concentration of urea. It was found that solubilization of the rhG-CSF inclusion bodies greatly depended on the buffer pH employed; alkalic pH significantly favored the solubilization. In addition, when small amount of urea was added to the solution at high pH, the solubilization was further enhanced. After solubilization, the rhG-CSF was renatured with simultaneous purification by using weak anion exchange, strong anion exchange, and hydrophobic interaction chromatography, separately. The results indicated that the rhG-CSF solubilized by the high-pH solution containing low concentration of urea had much higher mass recovery than the one solubilized by 8 M urea when using anyone of the three refolding methods employed in this work. In the case of weak anion exchange chromatography, the high pH solubilized rhG-CSF could get a mass recovery of 73%. The strategy of combining solubilization of inclusion bodies at high pH with refolding of protein using liquid chromatography may become a routine method for protein production from inclusion bodies.
The effect of coenzyme Q10 in statin myopathy.
Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard
2012-01-01
Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.
Aerobic Training in Patients with Congenital Myopathy
DEFF Research Database (Denmark)
Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen
2016-01-01
INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....
Directory of Open Access Journals (Sweden)
Lalu Rudyat Telly Savalas
2017-12-01
Full Text Available The present study aims at expressing and partially purifying PtpB in active form. To achieve this, Mtb PtpB gene has been cloned into pET30a vector and overexpressed in Escherichia coli BL 21(DE3 under IPTG induction in the form of an inclusion body. Following resolubilization by urea and dialysis, the resulted PtpB has been shown to be active against para-Nitrophenyl phosphate. It is concluded that the resulted PtpB has had been recovered from inclusion body to give the active form of the enzyme, and thus the success in overexpressing PtpB provides the required material to investigate the biochemical properties of the pathogen virulence factor further.
Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1
DEFF Research Database (Denmark)
Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro
2015-01-01
Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...
Van de Vlekkert, J.; Hoogendijk, J. E.; de Visser, M.
2015-01-01
The objective of this study was to investigate if patients with endomysial mononuclear cell infiltrates invading non-necrotic fibers have a disease course consistent with inclusion body myositis (IBM), irrespective of other histopathological and clinical characteristics. All patients with a muscle
Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F
2014-09-01
Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.
Rincheval, Vincent; Lelek, Mickael; Gault, Elyanne; Bouillier, Camille; Sitterlin, Delphine; Blouquit-Laye, Sabine; Galloux, Marie; Zimmer, Christophe; Eleouet, Jean-François; Rameix-Welti, Marie-Anne
2017-09-15
Infection of cells by respiratory syncytial virus induces the formation of cytoplasmic inclusion bodies (IBs) where all the components of the viral RNA polymerase complex are concentrated. However, the exact organization and function of these IBs remain unclear. In this study, we use conventional and super-resolution imaging to dissect the internal structure of IBs. We observe that newly synthetized viral mRNA and the viral transcription anti-terminator M2-1 concentrate in IB sub-compartments, which we term "IB-associated granules" (IBAGs). In contrast, viral genomic RNA, the nucleoprotein, the L polymerase and its cofactor P are excluded from IBAGs. Live imaging reveals that IBAGs are highly dynamic structures. Our data show that IBs are the main site of viral RNA synthesis. They further suggest that shortly after synthesis in IBs, viral mRNAs and M2-1 transiently concentrate in IBAGs before reaching the cytosol and suggest a novel post-transcriptional function for M2-1.Respiratory syncytial virus (RSV) induces formation of inclusion bodies (IBs) sheltering viral RNA synthesis. Here, Rincheval et al. identify highly dynamic IB-associated granules (IBAGs) that accumulate newly synthetized viral mRNA and the viral M2-1 protein but exclude viral genomic RNA and RNA polymerase complexes.
Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M
1991-03-01
A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.
Ma, Dzwokai; George, Cyril X; Nomburg, Jason; Pfaller, Christian K; Cattaneo, Roberto; Samuel, Charles E
2017-12-13
Replication of negative-strand RNA viruses occurs in association with discrete cytoplasmic foci called inclusion bodies. Whereas inclusion bodies represent a prominent subcellular structure induced by viral infection, our knowledge of the cellular protein components involved in inclusion body formation and function is limited. Using measles virus-infected HeLa cells, we found that the WD repeat-containing protein 5 (WDR5), a subunit of histone H3 lysine 4 methyltransferases, was selectively recruited to virus-induced inclusion bodies. Furthermore, WDR5 was found in complexes containing viral proteins associated with RNA replication. WDR5 was not detected with mitochondria, stress granules, or other known secretory or endocytic compartments of infected cells. WDR5 deficiency decreased both viral protein production and infectious virus yields. Interferon production was modestly increased in WDR5 deficient cells. Thus, our study identifies WDR5 as a novel viral inclusion body-associated cellular protein and suggests a role for WDR5 in promoting viral replication. IMPORTANCE Measles virus is a human pathogen that remains a global concern with more than 100,000 measles-related deaths annually despite the availability of an effective vaccine. As measles continues to cause significant morbidity and mortality, understanding the virus-host interactions at the molecular level that affect virus replication efficiency is important for development and optimization of treatment procedures. Measles virus is an RNA virus that encodes six genes and replicates in the cytoplasm of infected cells in discrete cytoplasmic replication bodies, though little is known of the biochemical nature of these structures. Here we show that the cellular protein WDR5 is enriched in the cytoplasmic viral replication factories and enhances virus growth. WDR5-containing protein complex includes viral proteins responsible for viral RNA replication. Thus, we have identified WDR5 as a host factor that
Heiker, John T; Klöting, Nora; Blüher, Matthias; Beck-Sickinger, Annette G
2010-07-16
The adipose tissue derived protein adiponectin exerts anti-diabetic, anti-inflammatory and anti-atherosclerotic effects. Adiponectin serum concentrations are in the microgram per milliliter range in healthy humans and inversely correlate with obesity and metabolic disorders. Accordingly, raising circulating adiponectin levels by direct administration may be an intriguing strategy in the treatment of obesity-related metabolic disorders. However production of large amounts of recombinant adiponectin protein is a primary obstacle so far. Here, we report a novel method for large amount production of globular adiponectin from E. coli inclusion bodies utilizing an alkaline-shock solubilization method without chaotropic agents followed by precipitation of the readily renaturing protein. Precipitation of the mildly solubilized protein capitalizes on advantages of inclusion body formation. This approach of inclusion body protein recovery provides access to gram scale amounts of globular adiponectin with standard laboratory equipment avoiding vast dilution or dialysis steps to neutralize the pH and renature the protein, thus saving chemicals and time. The precipitated protein is readily renaturing in buffer, is of adequate purity without a chromatography step and shows biological activity in cultured MCF7 cells and significantly lowered blood glucose levels in mice with streptozotocin induced type 1 diabetes. Copyright 2010 Elsevier Inc. All rights reserved.
Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.
2015-01-01
Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085
Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark
DEFF Research Database (Denmark)
Witting, Nanna; Werlauff, Ulla; Duno, Morten
2017-01-01
.3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...
Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.
Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils
2016-03-01
Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).
Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J
2017-05-01
Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very
Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.
2012-01-01
Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was
Free radicals in alcoholic myopathy: indices of damage and preventive studies.
Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon
2002-04-15
Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.
Gambarte Tudela, Julian; Capmany, Anahi; Romao, Maryse; Quintero, Cristian; Miserey-Lenkei, Stephanie; Raposo, Graca; Goud, Bruno; Damiani, Maria Teresa
2015-08-15
Given their obligate intracellular lifestyle, Chlamydia trachomatis ensure that they have access to multiple host sources of essential lipids by interfering with vesicular transport. These bacteria hijack Rab6-, Rab11- and Rab14-controlled trafficking pathways to acquire sphingomyelin from the Golgi complex. Another important source of sphingolipids, phospholipids and cholesterol are multivesicular bodies (MVBs). Despite their participation in chlamydial inclusion development and bacterial replication, the molecular mechanisms mediating the interaction between MVBs and chlamydial inclusions remain unknown. In the present study, we demonstrate that Rab39a labels a subset of late endocytic vesicles - mainly MVBs - that move along microtubules. Moreover, Rab39a is actively recruited to chlamydial inclusions throughout the pathogen life cycle by a bacterial-driven process that depends on the Rab39a GTP- or GDP-binding state. Interestingly, Rab39a participates in the delivery of MVBs and host sphingolipids to maturing chlamydial inclusions, thereby promoting inclusion growth and bacterial development. Taken together, our findings indicate that Rab39a favours chlamydial replication and infectivity. This is the first report showing that a late endocytic Rab GTPase is involved in chlamydial infection development. © 2015. Published by The Company of Biologists Ltd.
Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.
Rue, Nana; Vissing, John; Galbo, Henrik
2014-10-01
Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.
Energy Technology Data Exchange (ETDEWEB)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)
1992-03-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.
Energy Technology Data Exchange (ETDEWEB)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))
1992-01-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.
International Nuclear Information System (INIS)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.
1992-01-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques
Nonlinear elastic inclusions in isotropic solids
Yavari, A.; Goriely, A.
2013-01-01
We introduce a geometric framework to calculate the residual stress fields and deformations of nonlinear solids with inclusions and eigenstrains. Inclusions are regions in a body with different reference configurations from the body itself and can
International Nuclear Information System (INIS)
Zvaritch, Elena; MacLennan, David H.
2015-01-01
Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed
Functional impairment in patients with sporadic Inclusion Body Myositis.
Dunlap, Heather V; Macneil, Lauren G; Tarnopolsky, Mark A
2014-03-01
We conducted a retrospective chart review of 53 patients diagnosed with sporadic Inclusion Body Myositis (sIBM) who have been followed at the McMaster Neuromuscular Clinic since 1996. We reviewed patient medical histories in order to compare our findings with similar cohorts, and analyzed quantitative strength data to determine functionality in guiding decisions related to gait assistive devices. Patient information was acquired through retrospective clinic chart review. Our study found knee extension strength decreased significantly as patients transitioned to using more supportive gait assistive devices (P cane)(P Falls and fear of falling poses a significant threat to patient physical well-being. The prevalence of dysphagia increased as patients required more supportive gait devices, and finally a significant negative correlation was found between time after onset and creatine kinase (CK) levels (P falling would be beneficial in preventing future falls and improving long-term patient outcomes.
Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy
Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.
1998-01-01
OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared
Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.
Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z
2001-07-01
Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.
Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts
DEFF Research Database (Denmark)
Witting, Nanna; Krag, Thomas; Werlauff, Ulla
2018-01-01
INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....
DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies
Directory of Open Access Journals (Sweden)
Alessandra Ruggieri
2016-09-01
Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic
Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R
2012-12-01
The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.
Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi
2007-12-01
Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.
Investigation of the phase morphology of bacterial PHA inclusion bodies by contrast variation SANS
International Nuclear Information System (INIS)
Russell, R.A.; Holden, P.J.; Garvey, C.J.; Wilde, K.L.; Hammerton, K.M.; Foster, L.J.
2006-01-01
Under growth-limiting conditions, many bacteria are able to metabolise excess organic acids into polyhydroxyalkanoates (PHA) and store these polymers as intracellular inclusions until the return of favourable conditions. Various models have been proposed for the macromolecular organisation of the boundary layer surrounding the polymer, and contrast-variation small-angle neutron scattering (SANS) was used to study its organisation. Inclusions formed by Pseudomonas oleovorans under hydrogenating conditions showed lowest scattering intensity at ca. 20% D 2 O. The inclusions consist of protein and membrane lipids in the boundary layer and polyhydroxyoctanoate (lipid) in the inclusion body. At 20% D 2 O the contributions of lipids were contrast matched with the solvent, indicating that lipids contributed the bulk of the scattering intensity observed at other D 2 O/H 2 O ratios. These results are inconsistent with a model of the boundary layer which proposed outer and inner layers of crystalline protein lattice sandwiching a membrane lipid membrane layer [E.S. Stuart, R.W. Lenz, R.C. Fuller, Can J Microbiol 41(Suppl 1) (1995) 84-93], and is more consistent with a model consisting of a lipid monolayer containing embedded proteins [U. Pieper-furst, M.H. Madkour, F. Mayer, A. Steinbuchel, J. Bacteriol. 176 (1994) 4328-4337.] By altering the H/D content of the precursors, we were able to collect SANS data from preparations of both deuterated and H/D copolymer inclusions, where initial PHA produced was hydrogenated followed by deuteration. Deuterated inclusions showed minimum intensity above 90% D 2 O/H 2 O whereas the sequentially produced copolymer (assumed to be in a core/shell arrangement) displayed minimum scattering some 20% lower, which is consistent with the increased hydrogenation of the boundary layer expected from its synthesis during supply of hydrogenated followed by deuterated precursors
Treatment Opportunities in Patients With Metabolic Myopathies
DEFF Research Database (Denmark)
Ørngreen, Mette Cathrine; Vissing, John
2017-01-01
the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...
Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.
Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van
2004-01-01
BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on
Directory of Open Access Journals (Sweden)
Petrović Igor N.
2012-01-01
Full Text Available Introduction. Mitochondrial encephalopathy, lactacidosis and stroke-like episodes (MELAS represent a multisystemic dysfunction due to various mutations in mitochondrial DNA. Here we report a patient with genetically confirmed MELAS. Case Outline. A patient is presented whose clinical features involved short stature, easy tendency to fatigue, recurrent seizures, progressive cognitive decline, myopathy, sensorineural deafness, diabetes mellitus as well as stroke-like episodes. The major clinical feature of migraine type headache was not present. Neuroimaging studies revealed signs of ischemic infarctions localized in the posterior regions of the brain cortex. Electron microscopy of the skeletal muscle biopsy showed subsarcolemmal accumulation of a large number of mitochondria with paracristal inclusions in the skeletal muscle cells. The diagnosis of MELAS was definitively confirmed by the detection of a specific point mutation A to G at nucleotide position 3243 of mitochondrial DNA. Conclusion. When a relatively young patient without common risk factors for ischemic stroke presents with signs of occipitally localized brain infarctions accompanied with multisystemic dysfunction, MELAS syndrome, it is necessary to conduct investigations in order to diagnose the disease.
Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo
2012-04-01
Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in
Atypical myopathy in Denmark confirmed with the aTRAQ assay
DEFF Research Database (Denmark)
Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie
2016-01-01
Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...
Directory of Open Access Journals (Sweden)
Tyler Harrigfeld
2017-08-01
Full Text Available Background: Sporadic inclusion body myositis is an autoimmune and degenerative disorder of skeletal muscle that affects people at random. It most commonly begins as progressive weakness and atrophy of lower extremity musculature, beginning with the proximal leg. These impairments in body structure adversely affect the performance of functional activities and mobility, resulting in a progressive decrease in independence and participation both at home and in the community. Physical therapy attempts to minimize these effects through educational and procedural interventions focused on treating impairments and limitations. The purpose of this case study was to provide a description of the physical therapy management of a patient diagnosed with sporadic inclusion body myositis. Case Summary: The patient was a 66-year-old male who was diagnosed with sporadic inclusion body myositis with a chief complaint of weakness and fall risk. He presented with generalized lower extremity weakness and atrophy of bilateral quadriceps, as well as impaired balance and increasing fatigue with activity. Therapeutic exercise, home exercise program, balance, gait, and stair training were delivered to address these impairments. Patient outcomes showed improvement in balance and safety with functional activities. Discussion: The patient was seen for seven visits that were 45 – 60 minutes in length, over a five-week period. The patient made subjective reports of improvement in functional activities and balance; however many objective outcome measures could not be reassessed. There is a need for further research on this population to determine the effectiveness and parameters of physical therapy interventions. Conclusion: Physical therapy may have helped improve balance as well as subjective reports from the patient of increased feeling of confidence while navigating stairs.
[Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].
Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra
2017-11-01
We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.
Effective interactions between inclusions in an active bath
Zaeifi Yamchi, Mahdi; Naji, Ali
2017-11-01
We study effective two- and three-body interactions between non-active colloidal inclusions in an active bath of chiral or non-chiral particles, using Brownian dynamics simulations within a standard, two-dimensional model of disk-shaped inclusions and active particles. In a non-chiral active bath, we first corroborate previous findings on effective two-body repulsion mediated between the inclusions by elucidating the detailed non-monotonic features of the two-body force profiles, including a primary maximum and a secondary hump at larger separations that was not previously reported. We then show that these features arise directly from the formation, and sequential overlaps, of circular layers (or "rings") of active particles around the inclusions, as the latter are brought to small surface separations. These rings extend to radial distances of a few active-particle radii from the surface of inclusions, giving the hard-core inclusions relatively thick, soft, repulsive "shoulders," whose multiple overlaps then enable significant (non-pairwise) three-body forces in both non-chiral and chiral active baths. The resulting three-body forces can even exceed the two-body forces in magnitude and display distinct repulsive and attractive regimes at intermediate to large self-propulsion strengths. In a chiral active bath, we show that, while active particles still tend to accumulate at the immediate vicinity of the inclusions, they exhibit strong depletion from the intervening region between the inclusions and partial depletion from relatively thick, circular zones further away from the inclusions. In this case, the effective, predominantly repulsive interactions between the inclusions turn to active, chirality-induced, depletion-type attractions, acting over an extended range of separations.
Protein misfolding specifies recruitment to cytoplasmic inclusion bodies.
Bersuker, Kirill; Brandeis, Michael; Kopito, Ron R
2016-04-25
Inclusion bodies (IBs) containing aggregated disease-associated proteins and polyubiquitin (poly-Ub) conjugates are universal histopathological features of neurodegenerative diseases. Ub has been proposed to target proteins to IBs for degradation via autophagy, but the mechanisms that govern recruitment of ubiquitylated proteins to IBs are not well understood. In this paper, we use conditionally destabilized reporters that undergo misfolding and ubiquitylation upon removal of a stabilizing ligand to examine the role of Ub conjugation in targeting proteins to IBs that are composed of an N-terminal fragment of mutant huntingtin, the causative protein of Huntington's disease. We show that reporters are excluded from IBs in the presence of the stabilizing ligand but are recruited to IBs after ligand washout. However, we find that Ub conjugation is not necessary to target reporters to IBs. We also report that forced Ub conjugation by the Ub fusion degradation pathway is not sufficient for recruitment to IBs. Finally, we find that reporters and Ub conjugates are stable at IBs. These data indicate that compromised folding states, rather than conjugation to Ub, can specify recruitment to IBs. © 2016 Bersuker et al.
Sporadic inclusion body myositis: the genetic contributions to the pathogenesis
2014-01-01
Sporadic inclusion body myositis (sIBM) is the commonest idiopathic inflammatory muscle disease in people over 50 years old. It is characterized by slowly progressive muscle weakness and atrophy, with typical pathological changes of inflammation, degeneration and mitochondrial abnormality in affected muscle fibres. The cause(s) of sIBM are still unknown, but are considered complex, with the contribution of multiple factors such as environmental triggers, ageing and genetic susceptibility. This review summarizes the current understanding of the genetic contributions to sIBM and provides some insights for future research in this mysterious disease with the advantage of the rapid development of advanced genetic technology. An international sIBM genetic study is ongoing and whole-exome sequencing will be applied in a large cohort of sIBM patients with the aim of unravelling important genetic risk factors for sIBM. PMID:24948216
RYR1-related myopathies: a wide spectrum of phenotypes throughout life
Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.
2015-01-01
BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific
Corticosteroids in Myositis and Scleroderma.
Postolova, Anna; Chen, Jennifer K; Chung, Lorinda
2016-02-01
Idiopathic inflammatory myopathies (IIMs) involve inflammation of the muscles and are classified by the patterns of presentation and immunohistopathologic features on skin and muscle biopsy into 4 categories: dermatomyositis, polymyositis, inclusion body myositis, and immune-mediated necrotizing myopathy. Systemic corticosteroid (CS) treatment is the standard of care for IIM with muscle and organ involvement. The extracutaneous features of systemic sclerosis are frequently treated with CS; however, high doses have been associated with scleroderma renal crisis in high-risk patients. Although CS can be effective first-line agents, their significant side effect profile encourages concomitant treatment with other immunosuppressive medications to enable timely tapering. Published by Elsevier Inc.
Statin-associated myopathy: from genetic predisposition to clinical management.
Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R
2014-01-01
Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.
Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.
Schaars, C.F.; Stalenhoef, A.F.H.
2008-01-01
PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.
Krauss, Ulrich; Jäger, Vera D; Diener, Martin; Pohl, Martina; Jaeger, Karl-Erich
2017-09-20
Bacterial inclusion bodies (IBs) consist of unfolded protein aggregates and represent inactive waste products often accumulating during heterologous overexpression of recombinant genes in Escherichia coli. This general misconception has been challenged in recent years by the discovery that IBs, apart from misfolded polypeptides, can also contain substantial amounts of active and thus correctly or native-like folded protein. The corresponding catalytically-active inclusion bodies (CatIBs) can be regarded as a biologically-active sub-micrometer sized biomaterial or naturally-produced carrier-free protein immobilizate. Fusion of polypeptide (protein) tags can induce CatIB formation paving the way towards the wider application of CatIBs in synthetic chemistry, biocatalysis and biomedicine. In the present review we summarize the history of CatIBs, present the molecular-biological tools that are available to induce CatIB formation, and highlight potential lines of application. In the second part findings regarding the formation, architecture, and structure of (Cat)IBs are summarized. Finally, an overview is presented about the available bioinformatic tools that potentially allow for the prediction of aggregation and thus (Cat)IB formation. This review aims at demonstrating the potential of CatIBs for biotechnology and hopefully contributes to a wider acceptance of this promising, yet not widely utilized, protein preparation. Copyright © 2017 Elsevier B.V. All rights reserved.
Chang, Li-Wen; Fu, Ann; Wozniak, Edward; Chow, Marjorie; Duke, Diane G.; Green, Linda; Kelley, Karen; Hernandez, Jorge A.; Jacobson, Elliott R.
2013-01-01
Inclusion body disease (IBD) is a worldwide disease in captive boa constrictors (boa constrictor) and occasionally in other snakes of the families Boidae and Pythonidae. The exact causative agent(s) and pathogenesis are not yet fully understood. Currently, diagnosis of IBD is based on the light microscopic identification of eosinophilic intracytoplasmic inclusion bodies in hematoxylin and eosin stained tissues or blood smears. An antigenically unique 68 KDa protein was identified within the IBD inclusion bodies, called IBD protein. A validated immuno-based ante-mortem diagnostic test is needed for screening snakes that are at risk of having IBD. In this study, despite difficulties in solubilizing semi-purified inclusion bodies, utilizing hybridoma technology a mouse anti-IBD protein monoclonal antibody (MAB) was produced. The antigenic specificity of the antibody was confirmed and validated by western blots, enzyme-linked immunosorbent assay, immuno-transmission electron microscopy, and immunohistochemical staining. Paraffin embedded tissues of IBD positive and negative boa constrictors (n=94) collected from 1990 to 2011 were tested with immunohistochemical staining. In boa constrictors, the anti-IBDP MAB had a sensitivity of 83% and specificity of 100% in detecting IBD. The antibody also cross-reacted with IBD inclusion bodies in carpet pythons (Morelia spilota) and a ball python (python regius). This validated antibody can serve as a tool for the development of ante-mortem immunodiagnostic tests for IBD. PMID:24340066
Directory of Open Access Journals (Sweden)
Li-Wen Chang
Full Text Available Inclusion body disease (IBD is a worldwide disease in captive boa constrictors (boa constrictor and occasionally in other snakes of the families Boidae and Pythonidae. The exact causative agent(s and pathogenesis are not yet fully understood. Currently, diagnosis of IBD is based on the light microscopic identification of eosinophilic intracytoplasmic inclusion bodies in hematoxylin and eosin stained tissues or blood smears. An antigenically unique 68 KDa protein was identified within the IBD inclusion bodies, called IBD protein. A validated immuno-based ante-mortem diagnostic test is needed for screening snakes that are at risk of having IBD. In this study, despite difficulties in solubilizing semi-purified inclusion bodies, utilizing hybridoma technology a mouse anti-IBD protein monoclonal antibody (MAB was produced. The antigenic specificity of the antibody was confirmed and validated by western blots, enzyme-linked immunosorbent assay, immuno-transmission electron microscopy, and immunohistochemical staining. Paraffin embedded tissues of IBD positive and negative boa constrictors (n=94 collected from 1990 to 2011 were tested with immunohistochemical staining. In boa constrictors, the anti-IBDP MAB had a sensitivity of 83% and specificity of 100% in detecting IBD. The antibody also cross-reacted with IBD inclusion bodies in carpet pythons (Morelia spilota and a ball python (python regius. This validated antibody can serve as a tool for the development of ante-mortem immunodiagnostic tests for IBD.
Columbid herpesvirus-1 in two Cooper's hawks (Accipiter cooperii) with fatal inclusion body disease.
Pinkerton, Marie E; Wellehan, James F X; Johnson, April J; Childress, April L; Fitzgerald, Scott D; Kinsel, Michael J
2008-07-01
We report two separate naturally occurring cases of fatal herpesviral disease in Cooper's Hawks (Accipiter cooperii). Gross lesions included splenomegaly and hepatomegaly, with diffuse pale mottling or scattered small white foci. Histologic lesions included splenic and hepatic necrosis associated with eosinophilic intranuclear inclusion bodies characteristic of herpesvirus. In one case, necrosis and inclusions were also noted in bone marrow, thymus, bursa of Fabricius, thyroid gland, parathyroid gland, ceca, and the enteric system. Transmission electron microscopy demonstrated viral particles typical of herpesvirus within hepatocyte nuclei and budding from the nuclear membrane. Herpesviral DNA was amplified via polymerase chain reaction (PCR) of paraffin-embedded liver and spleen, and sequence data were consistent with columbid herpesvirus-1, an alphaherpesvirus of Rock Pigeons (Columba livia). PCR results provide evidence that this disease is transmitted to raptors via Rock Pigeons, most likely through ingestion of Rock Pigeons as prey.
Price, Mark A.; Barghout, Victoria; Benveniste, Olivier; Christopher-Stine, Lisa; Corbett, Alastair; de Visser, Marianne; Hilton-Jones, David; Kissel, John T.; Lloyd, Thomas E.; Lundberg, Ingrid E.; Mastaglia, Francis; Mozaffar, Tahseen; Needham, Merrilee; Schmidt, Jens; Sivakumar, Kumaraswamy; DeMuro, Carla; Tseng, Brian S.
2016-01-01
Background: There is a paucity of data on mortality and causes of death (CoDs) in patients with sporadic inclusion body myositis (sIBM), a rare, progressive, degenerative, inflammatory myopathy that typically affects those aged over 50 years. Objective: Based on patient records and expertise of clinical specialists, this study used questionnaires to evaluate physicians’ views on clinical characteristics of sIBM that may impact on premature mortality and CoDs in these patients. Methods: Thirteen physicians from seven countries completed two questionnaires online between December 20, 2012 and January 15, 2013. Responses to the first questionnaire were collated and presented in the second questionnaire to seek elaboration and identify consensus. Results: All 13 physicians completed both questionnaires, providing responses based on 585 living and 149 deceased patients under their care. Patients were reported to have experienced dysphagia (60.2%) and injurious falls (44.3%) during their disease. Over half of physicians reported that a subset of their patients with sIBM had a shortened lifespan (8/13), and agreed that bulbar dysfunction/dysphagia/oropharyngeal involvement (12/13), early-onset disease (8/13), severe symptoms (8/13), and falls (7/13) impacted lifespan. Factors related to sIBM were reported as CoDs in 40% of deceased patients. Oropharyngeal muscle dysfunction was ranked as the leading feature of sIBM that could contribute to death. The risk of premature mortality was higher than the age-matched comparison population. Conclusions: In the absence of data from traditional sources, this study suggests that features of sIBM may contribute to premature mortality and may be used to inform future studies. PMID:27854208
Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi
2015-10-23
HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.
Flex Sensor Based Biofeedback Monitoring for Post-Stroke Fingers Myopathy Patients
Garda, Y. R.; Caesarendra, W.; Tjahjowidodo, T.; Turnip, A.; Wahyudati, S.; Nurhasanah, L.; Sutopo, D.
2018-04-01
Hands are one of the crucial parts of the human body in carrying out daily activities. Accidents on the hands decreasing in motor skills of the hand so that therapy is necessary to restore motor function of the hand. In addition to accidents, hand disabilities can be caused by certain diseases, e.g. stroke. Stroke is a partial destruction of the brain. It occurs if the arteries that drain blood to the brain are blocked, or if torn or leak. The purpose of this study to make biofeedback monitoring equipment for post-stroke hands myopathy patients. Biofeedback is an alternative method of treatment that involves measuring body functions measured subjects such as skin temperature, sweat activity, blood pressure, heart rate and hand paralysis due to stroke. In this study, the sensor used for biofeedback monitoring tool is flex sensor. Flex sensor is a passive resistive device that changes its resistance as the sensor is bent. Flex sensor converts the magnitude of the bend into electrical resistance, the greater the bend the greater the resistance value. The monitoring used in this biofeedback monitoring tool uses Graphical User Interface (GUI) in C# programming language. The motivation of the study is to monitor and record the progressive improvement of the hand therapy. Patients who experienced post-stroke can see the therapy progress quantitatively.
[Cardiac myopathy due to overt hypothyroidism].
Harbeck, B; Berndt, M J; Lehnert, H
2014-03-01
A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.
The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy
de Visser, M.; de Voogt, W. G.; la Rivière, G. V.
1992-01-01
We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of
Directory of Open Access Journals (Sweden)
Claudia Capitini
Full Text Available Accumulation of ubiquitin-positive, tau- and α-synuclein-negative intracellular inclusions of TDP-43 in the central nervous system represents the major hallmark correlated to amyotrophic lateral sclerosis and frontotemporal lobar degeneration with ubiquitin-positive inclusions. Such inclusions have variably been described as amorphous aggregates or more structured deposits having an amyloid structure. Following the observations that bacterial inclusion bodies generally consist of amyloid aggregates, we have overexpressed full-length TDP-43 and C-terminal TDP-43 in E. coli, purified the resulting full-length and C-terminal TDP-43 containing inclusion bodies (FL and Ct TDP-43 IBs and subjected them to biophysical analyses to assess their structure/morphology. We show that both FL and Ct TDP-43 aggregates contained in the bacterial IBs do not bind amyloid dyes such as thioflavin T and Congo red, possess a disordered secondary structure, as inferred using circular dichroism and infrared spectroscopies, and are susceptible to proteinase K digestion, thus possessing none of the hallmarks for amyloid. Moreover, atomic force microscopy revealed an irregular structure for both types of TDP-43 IBs and confirmed the absence of amyloid-like species after proteinase K treatment. Cell biology experiments showed that FL TDP-43 IBs were able to impair the viability of cultured neuroblastoma cells when added to their extracellular medium and, more markedly, when transfected into their cytosol, where they are at least in part ubiquitinated and phosphorylated. These data reveal an inherently high propensity of TDP-43 to form amorphous aggregates, which possess, however, an inherently high ability to cause cell dysfunction. This indicates that a gain of toxic function caused by TDP-43 deposits is effective in TDP-43 pathologies, in addition to possible loss of function mechanisms originating from the cellular mistrafficking of the protein.
Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.
Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I
2013-11-01
We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Paula A. Moreno-González
2013-08-01
Full Text Available The use of hens for the production of polyclonal antibodies reduces animal intervention and moreover yields a higher quantity of antibodies than other animal models. The phylogenetic distance between bird and mammal antigens, often leads to more specific avian antibodies than their mammalian counterparts.Since a large amount of antigen is required for avian antibody production, the use of recombinant proteins for this procedure has been growing faster over the last years. Nevertheless, recombinant protein production through heterologous systems frequently prompts the protein to precipitate, forming insoluble aggregates of limited utility (inclusion bodies. A methodology for the production of avian polyclonal antibodies, using recombinant protein from inclusion bodies is presented in this article.In order to produce the antigen, a recombinant Nicotinamide mononucleotide adenylyltransferase from Giardia intestinalis (His-GiNMNAT was expressed in Escherichia coli. The protein was purified through solubilization from inclusion bodies prior to its renaturalization. Antibodies were purified from egg yolk of immunized hens by water dilution, followed by ammonium sulfate precipitation and thiophilic affinity chromatography.The purified antibodies were tested against His-GiNMNAT protein in Western blot essays. From one egg yolk, 14.4 mg of highly pure IgY were obtained; this antibody was able to detect 15ng of His-GiNMNAT. IgY specificity was improved by means of antigen affinity purification, allowing its use for parasite protein recognition.
Chang, L; Fu, D; Stenglein, M D; Hernandez, J A; DeRisi, J L; Jacobson, E R
2016-12-01
Inclusion body disease (IBD) of boas and pythons is characterized by the intracytoplasmic accumulation of an antigenic 68 kDa viral protein IBDP, more recently known as the nucleoprotein (NP) of the reptarenaviruses. Blood samples of 131 captive boas and pythons (53 boa constrictors, Boa constrictor; 35 rainbow boas, Epicrates cenchria; 22 ball pythons, Python regius; 5 carpet pythons, Morelia spilota; 6 Burmese pythons, Python bivittatus; 4 Jamaican boas, Epicrates subflavus; 5 anacondas, Eunectes spp.; and 1 green tree python, Morelia viridis) were obtained from 28 collections in the USA. Diagnosis of IBD was initially made by the identification of eosinophilic intracytoplasmic inclusion bodies in hematoxylin and eosin (HE) stained blood films and isolated peripheral white blood cells (PWBC). The overall prevalence of IBD in study snakes was 25/131 or 19% (95% CI = 12.4%, 25.8%) with boa constrictors being more commonly infected (22/53 or 41.5%; 95% CI = 28.2%, 54.8%) than other species in this study. Of the 22 IBD positive boa constrictors, 87% were clinically healthy, 13% had various signs of chronic illness, and none showed signs of central nervous system disease. Using a validated monoclonal anti-NP antibody, NP was confirmed within the isolated PWBC by immunohistochemical staining and Western blots. The presence of reptarenaviruses within blood samples of 27 boa constrictors and three rainbow boas was also assessed by PCR. Among boa constrictors, very good agreements were shown between the observation of inclusion bodies (by HE stain) and the presence of NP (by immunohistochemistry, kappa = 0.92; and Western blots, kappa = 0.89), or the presence of reptarenaviruses (by PCR; kappa = 0.92). Copyright © 2016 Elsevier Ltd. All rights reserved.
Asymptomatic hyper-creatine-kinase-emia as sole manifestation of inclusion body myositis
Directory of Open Access Journals (Sweden)
Josef Finsterer
2013-06-01
Full Text Available Sporadic inclusion body myositis (sIBM usually manifests with painless weakness of the hand, finger and hip flexors. Absence of symptoms or signs, but mild hyper-CK-emia as the sole manifestation of IBM, has not been reported. We report the case of a 73-year-old male who presented with asymptomatic recurrent hyper-CK-emia ranging from 200 to 1324 U/L (n<171 U/L, since 10 years. Clinical neurologic investigation, nerve conduction studies and EMG were non-informative. Muscle biopsy surprisingly revealed sIBM. sIBM may be asymptomatic and may manifest with hyper-CK-emia exclusively. So, it has to be included in the differential diagnoses of asymptomatic hyper-CK-emia.
Directory of Open Access Journals (Sweden)
Avni Kaya
2013-01-01
Full Text Available A 9-day-old male baby was hospitalized after his birth due to some swells under the skin. The hard consistency nodules observed under the skin all over the body of the patient were of different size, and presented lesions, among which the biggest was 1 × 1 cm. No lesions were observed on the fingers. By superficial ultrasonography, multiple isoechoic hypoechoic lesions were observed among the muscle plan. In thoracolumbar magnetic resonance imaging, multiple massif lesions retaining peripheral contrast (the biggest was 1.7 × 1.4 cm large had been observed under the skin muscle plans, between the muscles of the extremities. The biopsy was positive for smooth muscle actin, but negative for desmin, S100, and CD34. These findings were diagnosed as infantile digital fibromatosis (IDF (inclusion body fibromatosis. The case was presented with an objective to illustrate and remind that IDF can be observed in babies without finger involvement.
Yatabe, K; Hiraguri, M; Sueishi, M; Takeuchi, M; Nonaka, I; Kawai, M
1998-05-01
In the present study, we have reported that Ulex europaeus agglutinin I (UEA I) lectin labeled muscle fibers in distal myopathy with rimmed vacuole formation (DMRV). UEA I binding to muscle fibers was also observed in a small number of biopsies with inflammatory myopathy, but not in other diseases, including neurogenic muscular atrophies and muscular dystrophies. In order to elucidate the relationship between this UEA I binding, rimmed vacuole formation and active autophagocytosis, we examined the UEA I binding fibers in other myopathies which frequently showed rimmed vacuoles, including adult onset acid maltase deficiency, oculo-pharyngo-distal type myopathy and oculopharyngeal muscular dystrophy. No UEA I lectin labeling fiber was observed in the diseases examined. We then studied UEA I binding behavior on 70 biopsies of inflammatory myopathy to characterize the clinical features of UEA I binding positive patients. UEA I binding fibers were observed in 3 of 28 patients (11%) with other collagen diseases, 11 of 36 (31%) without these disorders, and 2 of 6 (33%) with inclusion body myositis. There were no common clinical histories, complications or laboratory findings among the UEA I binding positive patients. In conclusion, a common process may exist between the muscle fiber degeneration in DMRV and subgroups of inflammatory myopathy patients, but the basic mechanism remains to be elucidated.
Congenital Muscle Disease Study of Patient and Family Reported Medical Information
2017-05-05
Congenital Muscular Dystrophy (Including Unspecified/Undiagnosed); Dystroglycanopathy; Congenital Fiber Type Disproportion; Rigid Spine Muscular Dystrophy; Congenital Myopathy (Including Unspecified/Undiagnosed); Collagen VI CMD (Ullrich CMD, Intermediate, Bethlem Myopathy); Laminin Alpha 2 Related Congenital Muscular Dystrophy; LAMA2-CMD/Merosin Deficient/MDC1A; Walker-Warburg Syndrome; Muscle-Eye-Brain Disease; Fukuyama/Fukutin Related Muscular Dystrophy; Integrin Alpha 7 Deficiency; Integrin Alpha 9 Deficiency; LMNA-CMD/Lamin A/C/Laminopathy; SEPN1-Related Myopathy; Bethlem Myopathy; Actin Aggregation Myopathy; Cap Disease; Central Core Disease; Centronuclear Myopathy; Core Rod Myopathy; Hyaline Body Myopathy; Multiminicore Myopathy; Myotubular Myopathy; Nemaline Myopathy; Tubular Aggregate Myopathy; Zebra Body Myopathy; Reducing Body Myopathy; Spheroid Body Myopathy; LGMD1B (LMNA); LGMD1E (DES); LGMD2G (TCAP); LGMD2H (TRIM32); LGMD2I (FKRP); LGMD2J (TTN); LGMD2K (POMT1); LGMD2M (FKTN); LGMD2N (POMT2); LGMD2O (POMGnT1); LGMD2P (DAG1); LGMD2Q (PLEC1); LGMD2R (DES); LGMD2S (TRAPPC11); LGMD2T (GMPPB); LGMD2U (ISPD); LGMD2V (GAA); Ullrich Congenital Muscular Dystrophy; Titinopathy; Choline Kinase B Receptor; Emery-Dreifuss Muscular Dystrophy; RYR1 Related Myopathy; SYNE1/Nesprin Related Muscular Dystrophy; Telethonin Related Muscular Dystrophy (TCAP/Titin-Cap); Congenital Myasthenic Syndrome; Escobar Syndrome; Myofibrillar Myopathy; Malignant Hyperthermia; Alpha-Dystroglycan Related Muscular Dystrophy (DAG1, DPM1, DPM2, DPM3, FKRP, FKTN); Alpha-Dystroglycan Related Muscular Dystrophy (GAA, ISPD, LARGE, POMT1, POMT2, POMGnT1); Alpha-Dystroglycan Related Muscular Dystrophy (Unspecified/Undiagnosed/Other)
Bastin, Jean; Djouadi, Fatima
2016-01-01
Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581
Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun
2013-03-01
Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.
Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy
Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.
2015-01-01
To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide
Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey
2018-06-01
Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3 mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3 mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3 mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.
Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.
Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P
2018-04-10
Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The
Respiratory disorders in patients with polymyositis/dermatomyositis
Directory of Open Access Journals (Sweden)
Olga Alekseyevna Antelava
2014-01-01
Full Text Available Idiopathic inflammatory myopathies (IIM are rare disorders characterized by inflammatory lesions in skeletal muscles. These diseases include polymyositis (PM, dermatomyositis (DM, and inclusion body myositis, which exhibit clinicoimmunological heterogeneity and give different response to therapy. The most frequent manifestation in PM/DM patients is respiratory system dysfunction. The developing respiratory disorders are varied and may outpace the presentation of muscle pathology.
Aerobic Training in Patients with Congenital Myopathy.
Directory of Open Access Journals (Sweden)
Gitte Hedermann
Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.
Association between statin-associated myopathy and skeletal muscle damage.
Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette
2009-01-01
BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...
Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.
Vite, C H; Melniczek, J; Patterson, D; Giger, U
1999-01-01
Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.
Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe
2015-02-03
Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.
Fatigue in patients with spinal muscular atrophy type II and congenital myopathies
DEFF Research Database (Denmark)
Werlauff, Ulla; Højberg, A; Firla-Holme, R
2014-01-01
PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...
Nonlinear elastic inclusions in isotropic solids
Yavari, A.
2013-10-16
We introduce a geometric framework to calculate the residual stress fields and deformations of nonlinear solids with inclusions and eigenstrains. Inclusions are regions in a body with different reference configurations from the body itself and can be described by distributed eigenstrains. Geometrically, the eigenstrains define a Riemannian 3-manifold in which the body is stress-free by construction. The problem of residual stress calculation is then reduced to finding a mapping from the Riemannian material manifold to the ambient Euclidean space. Using this construction, we find the residual stress fields of three model systems with spherical and cylindrical symmetries in both incompressible and compressible isotropic elastic solids. In particular, we consider a finite spherical ball with a spherical inclusion with uniform pure dilatational eigenstrain and we show that the stress in the inclusion is uniform and hydrostatic. We also show how singularities in the stress distribution emerge as a consequence of a mismatch between radial and circumferential eigenstrains at the centre of a sphere or the axis of a cylinder.
Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre
2018-01-18
Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.
Serum and tissue markers of myopathy in patients with colorectal cancer
Directory of Open Access Journals (Sweden)
Nicoletta Adami
2012-09-01
Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin
Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G
2016-06-01
Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.
Deploying and implementing Inclusive Physical Education
Directory of Open Access Journals (Sweden)
Eliana Lúcia Ferreira
2014-04-01
Full Text Available Physical Education, as a curricular component of basic education, is not indifferent to the movement of Inclusive physical education. Differentiated bodies are conquering new social spaces. Our aim through this investigation is to identify the main historical practices regarding Brazilian Policy of Inclusive Education and to point out proposals to implement inclusive Physical education. Our methodology consists of a descriptive study based on two main axes. The first axis is related to a historical discussion whose source was national documents of reference about Inclusive Physical Education. The second axis is related to the experience of 2000 teachers; we have the occasion to analyze their practices on the subject of Inclusive physical education. As a result, this investigation also develops a proposal to inclusive physical education; this proposal is established in another dimension and understanding of work and movement. Concerning the final considerations we suggest a disruption with already crystallized bodily practices and we suggest actions respecting individual differences. Moreover, we point out the fact that Inclusive Physical Education has advocated another meaning for the body, in favor of a more collective physical education and searching for activities in which individuality prevails.
Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy
Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.
2010-01-01
Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...
Bruno, Claudio; Dimauro, Salvatore
2008-10-01
The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.
Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy
Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.
2008-01-01
The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,
Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi
2014-07-01
Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.
Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).
Yamini, B; Schillhorn van Veen, T W
1988-10-01
Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.
Integrated continuous processing of proteins expressed as inclusion bodies: GCSF as a case study.
Kateja, Nikhil; Agarwal, Harshit; Hebbi, Vishwanath; Rathore, Anurag S
2017-07-01
Affordability of biopharmaceuticals continues to be a challenge, particularly in developing economies. This has fuelled advancements in manufacturing that can offer higher productivity and better economics without sacrificing product quality in the form of an integrated continuous manufacturing platform. While platform processes for monoclonal antibodies have existed for more than a decade, development of an integrated continuous manufacturing process for bacterial proteins has received relatively scant attention. In this study, we propose an end-to-end integrated continuous downstream process (from inclusion bodies to unformulated drug substance) for a therapeutic protein expressed in Escherichia coli as inclusion body. The final process consisted of a continuous refolding in a coiled flow inverter reactor directly coupled to a three-column periodic counter-current chromatography for capture of the product followed by a three-column con-current chromatography for polishing. The continuous bioprocessing train was run uninterrupted for 26 h to demonstrate its capability and the resulting output was analyzed for the various critical quality attributes, namely product purity (>99%), high molecular weight impurities (<0.5%), host cell proteins (<100 ppm), and host cell DNA (<10 ppb). All attributes were found to be consistent over the period of operation. The developed assembly offers smaller facility footprint, higher productivity, fewer hold steps, and significantly higher equipment and resin utilization. The complexities of process integration in the context of continuous processing have been highlighted. We hope that the study presented here will promote development of highly efficient, universal, end-to-end, fully continuous platforms for manufacturing of biotherapeutics. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 33:998-1009, 2017. © 2016 American Institute of Chemical Engineers.
Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet
Directory of Open Access Journals (Sweden)
Brianne E. Phillips
2015-01-01
Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.
The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.
Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R
2018-03-01
The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.
Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.
Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J
2018-04-23
Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.
Efficient inclusion body processing using chemical extraction and high gradient magnetic fishing
DEFF Research Database (Denmark)
Heebøll-Nielsen, Anders; Choe, W.S.; Middelberg, A.P.J.
2003-01-01
of the product-loaded supports with the aid of high gradient magnetic fields. The manufacture and testing of two types of micron-sized nonporous superparamagnetic metal chelator particles derivatized with iminodiacetic acid is described. In small-scale adsorption studies conducted with a hexahistidine tagged...... at a 60-fold increased scale using the high gradient magnetic fishing (HGMF) system to collect loaded Cu2+-chelator particles following batch adsorption of L1. Over 70% of the initial Ll present was recovered within the HGMF rig in a highly clarified form in two batch elution cycles with an overall......In this study we introduce a radical new approach for the recovery of proteins expressed in the form of inclusion bodies, involving W chemical extraction from the host cells, (ii) adsorptive capture of the target protein onto small magnetic adsorbents, and (iii) subsequent rapid collection...
Nogalska, Anna; D'Agostino, Carla; Engel, W King; Askanas, Valerie
2014-05-01
Sporadic inclusion-body myositis (s-IBM) is a severe, progressive muscle disease for which there is no enduring treatment. Pathologically characteristic are vacuolated muscle fibers having: accumulations of multi-protein aggregates, including amyloid-β(Aβ) 42 and its toxic oligomers; increased γ-secretase activity; and impaired autophagy. Cultured human muscle fibers with experimentally-impaired autophagy recapitulate some of the s-IBM muscle abnormalities, including vacuolization and decreased activity of lysosomal enzymes, accompanied by increased Aβ42, Aβ42 oligomers, and increased γ-secretase activity. Sodium phenylbutyrate (NaPB) is an orally bioavailable small molecule approved by the FDA for treatment of urea-cycle disorders. Here we describe that NaPB treatment reverses lysosomal dysfunction in an in vitro model of inclusion-body myositis, involving cultured human muscle fibers. NaPB treatment improved lysosomal activity, decreased Aβ42 and its oligomers, decreased γ-secretase activity, and virtually prevented muscle-fiber vacuolization. Accordingly, NaPB might be considered a potential treatment of s-IBM patients. Copyright © 2014 Elsevier Inc. All rights reserved.
Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.
Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H
2008-05-01
The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.
Muscle MRI / whole-body MRI in diagnosis and dynamic evaluation of neuro-muscular disorders
Directory of Open Access Journals (Sweden)
Robert Carlier
2014-01-01
Full Text Available The use of MRI in myopathies dates back to more than 20 years. The first investigations were slow and only allowed segmental and limited studies. Whole-body MRI has emerged over the past twelve years and became a useful diagnostic tool in the etiological diagnosis of myopathies and muscular dystrophies. This study must always be confronted with clinical and whichever other paraclinical data without being able to replace them. Indications to perform such an investigation are getting better and better defined and the diagnostic efficacy has progressed with the increasing number of cases, communications, publications and discussions within multidisciplinary working groups. Its noninvasive nature, the radiation-free exposure and its reasonable cost also enable this technique to be easily accepted by the patient. It also provides a valuable tool for monitoring the natural disease progression or the effectiveness of therapies. The radiology team must be acquainted with the management of neuromuscular patients. Interpreting muscle whole-body MRI requires an excellent knowledge of muscle anatomy whichever body part is examined. The radiologist performing these studies is ideally a specialist of musculoskeletal disorders or a neuroradiologist well trained in muscle anatomy.
DEFF Research Database (Denmark)
Jørgensen, Anders Nørkær; Aagaard, P; Nielsen, J L
2016-01-01
Sporadic inclusion body myositis (sIBM) is a systemic disease that is characterized by substantial skeletal muscle weakness and muscle inflammation, leading to impaired physical function. The objective was to investigate the effect of low-load resistance exercise with concurrent partial blood flow...
Directory of Open Access Journals (Sweden)
Ting Chen
2016-01-01
Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.
Muscle structural changes in mitochondrial myopathy relate to genotype
DEFF Research Database (Denmark)
Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.
2003-01-01
It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...
Griffin, Jacqueline Reedy; Moraes, Luis; Wick, Macdonald; Lilburn, Michael Snell
2018-02-01
The broiler industry has incurred significant economic losses due to two muscle myopathies, white striping (WS) and wooden breast (WB), affecting the Pectoralis major (P. major) of commercial broilers. The present study documented macroscopic changes occurring with age/growth in the P. major and P. minor muscles of commercial broilers from day 2 through day 46 (n = 27/day). Distinct myopathic aberrations observed in both breast muscles corresponded to the onset of WB. These distinct morphological changes were used as determinants in developing a ranking system, defining the ontogeny of WB as the following four stages: (1) WS, (2) petechial epimysium haemorrhages, (3) intramuscular haemorrhages and (4) ischaemia. A cumulative logit proportional odds model was used to relate the rank probabilities with the following growth parameters: body weight, P. major and P. minor weight/yield/length/width/depth. The best-fit model included P. major length/width/depth, P. minor width, P. major and P. minor yield as predictors for rank. Increasing P. major depth, P. minor width and P. major yield increased the odds of falling into higher ranks (more severe myopathy). Conversely, increasing P. major length, P. major width and P. minor yield increased the odds of falling into smaller ranks (less severe myopathy). This study describes the macroscopic changes associated with WB ontogeny in the development of a ranking system and the contribution of growth parameters in the determination of rank (WB severity). Results suggest that physical measurements inherent to selection for high-yielding broiler genotypes are contributing to the occurrence and severity of WS and WB.
DEFF Research Database (Denmark)
van Galen Verwilghen, Gaby; Votion, D.-M.
2013-01-01
Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...
DEFF Research Database (Denmark)
van Galen Verwilghen, Gaby; Votion, D.-M.
2013-01-01
Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...
Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu
2015-01-01
Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.
Yeast prions form infectious amyloid inclusion bodies in bacteria
Directory of Open Access Journals (Sweden)
Espargaró Alba
2012-06-01
Full Text Available Abstract Background Prions were first identified as infectious proteins associated with fatal brain diseases in mammals. However, fungal prions behave as epigenetic regulators that can alter a range of cellular processes. These proteins propagate as self-perpetuating amyloid aggregates being an example of structural inheritance. The best-characterized examples are the Sup35 and Ure2 yeast proteins, corresponding to [PSI+] and [URE3] phenotypes, respectively. Results Here we show that both the prion domain of Sup35 (Sup35-NM and the Ure2 protein (Ure2p form inclusion bodies (IBs displaying amyloid-like properties when expressed in bacteria. These intracellular aggregates template the conformational change and promote the aggregation of homologous, but not heterologous, soluble prionogenic molecules. Moreover, in the case of Sup35-NM, purified IBs are able to induce different [PSI+] phenotypes in yeast, indicating that at least a fraction of the protein embedded in these deposits adopts an infectious prion fold. Conclusions An important feature of prion inheritance is the existence of strains, which are phenotypic variants encoded by different conformations of the same polypeptide. We show here that the proportion of infected yeast cells displaying strong and weak [PSI+] phenotypes depends on the conditions under which the prionogenic aggregates are formed in E. coli, suggesting that bacterial systems might become useful tools to generate prion strain diversity.
Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U
2018-04-13
One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.
Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.
Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello
2016-04-01
Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.
Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T
2017-02-05
Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.
Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular
Directory of Open Access Journals (Sweden)
Rosana Herminia Scola
2007-03-01
Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.
Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.
Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B
2017-11-01
Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R
Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate
Vogel, N.; Renne, P. R.
2004-12-01
The processes that led to the assembly of primitive inclusions in a once molten metal matrix as represented by IAB meteorites have not yet been fully understood [1]. Ar-Ar dating of the inclusions provides important information about the thermal history of the IAB parent body [e.g., 2, 3], but the analysis of bulk inclusions, the standard procedure in the past, is often impaired by excess 40Ar and redistribution or loss of K and/or Ar during the history of the meteoriod and in the reactor. To minimize these problems, we prepared from silicate inclusions of four IABs pure plagioclase separates of different grain sizes and quality grades. On these we performed high resolution stepwise Ar-40-Ar-39 dating. Preliminary ages for the different separates of the inclusions are, in Ma, 4540(11) to 4459(12) for Caddo County, 4500(20) to 4380(30) for Landes, 4440(50) to 4340(30) for Ocotillo, and 4480(40) to 4200(30) and 4430(30) to 4300(30) for CDC2 and CDC1, respectively. The age ranges might reflect the residence time of each inclusion in the K-Ar blocking temperature range (ca. 600 K), and is narrowest for Caddo County, being also the oldest inclusion studied by us. Assuming that IABs resulted from a collision of a molten metal body with a chondritic planetesimal [4], Caddo County could represent a surface sample explaining the early and fast cooling, whereas the other samples might have been buried deeper within the IAB body, subject to prolonged residence at elevated temperatures. If IABs formed in impact metal melt pools peppered with chondritic host material [5] the different cooling ages, and age ranges recorded in each inclusion could reflect residence times in a certain metal melt pool, which indirectly would translate into pool sizes and the energies released by the previous impacts. Also, there may have been more than one IAB parent body. Whatever process led to the formation of IAB meteorites was active already very early in the history of the solar system, in
Dynamic phosphorylation of Ebola virus VP30 in NP-induced inclusion bodies.
Lier, Clemens; Becker, Stephan; Biedenkopf, Nadine
2017-12-01
Zaire Ebolavirus (EBOV) causes a severe feverish disease with high case fatality rates. Transcription of EBOV is dependent on the activity of the nucleocapsid protein VP30 which represents an essential viral transcription factor. Activity of VP30 is regulated via phosphorylation at six N-terminal serine residues. Recent data demonstrated that dynamic phosphorylation and dephosphorylation of serine residue 29 is essential for transcriptional support activity of VP30. To analyze the spatio/temporal dynamics of VP30 phosphorylation, we generated a peptide antibody recognizing specifically VP30 phosphorylated at serine 29. Using this antibody we could demonstrate that (i) the majority of VP30 molecules in EBOV-infected cells is dephosphorylated at the crucial position serine 29, (ii) both, VP30 phosphorylation and dephosphorylation take place in viral inclusion bodies that are induced by the nucleoprotein NP and (iii) NP influences the phosphorylation state of VP30. Copyright © 2017 Elsevier Inc. All rights reserved.
Horiuchi, Noriyuki; Aihara, Naoyuki; Mizutani, Hiroshi; Kousaka, Shinichi; Nagafuchi, Tsuneyuki; Ochiai, Mariko; Ochiai, Kazuhiko; Kobayashi, Yoshiyasu; Furuoka, Hidefumi; Asai, Tetsuo; Oishi, Koji
2014-03-01
We describe a case of human Becker muscular dystrophy (BMD)-like myopathy that was characterized by the declined stainability of dystrophin at sarcolemma in a pig and the immunostaining for dystrophin on the formalin-fixed, paraffin-embedded (FFPE) tissue. The present case was found in a meat inspection center. The pig looked appeared healthy at the ante-mortem inspection. Muscular abnormalities were detected after carcass dressing as pale, discolored skeletal muscles with prominent fat infiltrations and considered so-called "fatty muscular dystrophy". Microscopic examination revealed following characteristics: diffused fat infiltration into the skeletal muscle and degeneration and regeneration of the remaining skeletal muscle fibers. Any lesions that were suspected of neurogenic atrophy, traumatic muscular degeneration, glycogen storage disease or other porcine muscular disorders were not observed. The immunostaining for dystrophin was conducted and confirmed to be applicable on FFPE porcine muscular tissues and revealed diminished stainability of dystrophin at the sarcolemma in the present case. Based on the histological observations and immunostaining results, the present case was diagnosed with BMD-like myopathy associated with dystrophin abnormality in a pig. Although the genetic properties were not clear, the present BMD-like myopathy implied the occurrence of dystrophinopathy in pigs. To the best of our knowledge, this is the first report of a natural case of myopathy associated with dystrophin abnormalities in a pig.
Botulinum toxin alleviates dysphagia of patients with inclusion body myositis.
Schrey, Aleksi; Airas, Laura; Jokela, Manu; Pulkkinen, Jaakko
2017-09-15
Oropharyngeal dysphagia is a disabling and undertreated symptom that often occurs in patients with sporadic inclusion body myositis (s-IBM). In this study, we examined the effect of botulinum neurotoxin A (BoNT-A) injections to the cricopharyngeus muscle (CPM) of patients with s-IBM and dysphagia. A single-center retrospective study involving 40 biopsy-proven s-IBM-patients treated in the District of Southwest Finland from 2000 to 2013. The incidence of dysphagia, rate of aspirations, rate of aspiration pneumonias and treatment results of dysphagia were analyzed. Patients treated for dysphagia were evaluated before and after surgery by video-fluoroscopy and/or using a questionnaire. Twenty-five of the 40 s-IBM patients (62.5%) experienced dysphagia. BoNT-A was injected a median of 2 times (range 1-7) in 12 patients with dysphagia. Before the injections 7 patients reported aspiration, none afterwards. The corresponding figures for aspiration pneumonia were 3 and 0. All of these patients had normal swallowing function 12months (median, range 2-60) after the last injection. BoNT-A injections to the CPM alleviate the dysphagia of s-IBM patients reversibly and appear to reduce the rate of aspiration effectively. Copyright © 2017 Elsevier B.V. All rights reserved.
Packaging protein drugs as bacterial inclusion bodies for therapeutic applications
Directory of Open Access Journals (Sweden)
Villaverde Antonio
2012-06-01
Full Text Available Abstract A growing number of insights on the biology of bacterial inclusion bodies (IBs have revealed intriguing utilities of these protein particles. Since they combine mechanical stability and protein functionality, IBs have been already exploited in biocatalysis and explored for bottom-up topographical modification in tissue engineering. Being fully biocompatible and with tuneable bio-physical properties, IBs are currently emerging as agents for protein delivery into mammalian cells in protein-replacement cell therapies. So far, IBs formed by chaperones (heat shock protein 70, Hsp70, enzymes (catalase and dihydrofolate reductase, grow factors (leukemia inhibitory factor, LIF and structural proteins (the cytoskeleton keratin 14 have been shown to rescue exposed cells from a spectrum of stresses and restore cell functions in absence of cytotoxicity. The natural penetrability of IBs into mammalian cells (reaching both cytoplasm and nucleus empowers them as an unexpected platform for the controlled delivery of essentially any therapeutic polypeptide. Production of protein drugs by biopharma has been traditionally challenged by IB formation. However, a time might have arrived in which recombinant bacteria are to be engineered for the controlled packaging of therapeutic proteins as nanoparticulate materials (nanopills, for their extra- or intra-cellular release in medicine and cosmetics.
Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.
Brown, Bradley D; Rais, Theodore
2015-01-01
The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).
The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.
Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W
2013-07-01
The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high
Skeletal muscle repair in a mouse model of nemaline myopathy.
Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H
2006-09-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.
Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings
International Nuclear Information System (INIS)
Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo
1998-01-01
We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients
Directory of Open Access Journals (Sweden)
Teet Seene
2012-01-01
Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-01-01
Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...
International Nuclear Information System (INIS)
Ikehata, Masaru; Kawashita, Mishio
2010-01-01
The enclosure method was originally introduced for inverse problems concerning non-destructive evaluation governed by elliptic equations. It was developed as one of the useful approaches in inverse problems and applied for various equations. In this paper, an application of the enclosure method to an inverse initial boundary value problem for a parabolic equation with a discontinuous coefficient is given. A simple method to extract the depth of unknown inclusions in a heat conductive body from a single set of the temperature and heat flux on the boundary observed over a finite time interval is introduced. Other related results with infinitely many data are also reported. One of them gives the minimum radius of the open ball centred at a given point that contains the inclusions. The formula for the minimum radius is newly discovered
Sun, Huihui; Gao, Wenyuan; Wang, Hualei; Wei, Dongzhi
2016-03-01
To identify a novel nitrilase with S-selectivity toward mandelonitrile that can produce (S)-mandelic acid in one step. A novel nitrilase PpL19 from Pseudomonas psychrotolerans L19 was discovered by genome mining. It showed S-selectivity with an enantiomeric excess of 52.7 % when used to hydrolyse (R, S)-mandelonitrile. No byproduct was observed. PpL19 was overexpressed in Escherichia coli BL21 (DE3) and formed inclusion bodies that were active toward mandelonitrile and stable across a broad range of temperature and pH. In addition, PpL19 hydrolysed nitriles with diverse structures; arylacetonitriles were the optimal substrates. Homology modelling and docking studies of both enantiomers of mandelonitrile in the active site of nitrilase PpL19 shed light on the enantioselectivity. A novel nitrilase PpL19 from P. psychrotolerans L19 was mined and distinguished from other nitrilases as it was expressed as an active inclusion body and showed S-selectivity toward mandelonitrile.
Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?
Directory of Open Access Journals (Sweden)
Antonia eKaltsatou
2015-03-01
Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.
Anti-Jo-1 antibody-positive patients show a characteristic necrotizing perifascicular myositis.
Mescam-Mancini, Lénaig; Allenbach, Yves; Hervier, Baptiste; Devilliers, Hervé; Mariampillay, Kuberaka; Dubourg, Odile; Maisonobe, Thierry; Gherardi, Romain; Mezin, Paulette; Preusse, Corinna; Stenzel, Werner; Benveniste, Olivier
2015-09-01
Idiopathic inflammatory myopathies can be classified as polymyositis, dermatomyositis, immune-mediated necrotizing myopathy, sporadic inclusion body myositis or non-specific myositis. Anti-Jo-1 antibody-positive patients are assigned to either polymyositis or dermatomyositis suggesting overlapping pathological features. We aimed to determine if anti-Jo-1 antibody-positive myopathy has a specific morphological phenotype. In a series of 53 muscle biopsies of anti-Jo-1 antibody-positive patients, relevant descriptive criteria defining a characteristic morphological pattern were identified. They were tested in a second series of anti-Jo-1 antibody-positive patients and compared to 63 biopsies from patients suffering from other idiopathic inflammatory myopathies. In anti-Jo-1 antibody-positive patients, necrotic fibres, which strongly clustered in perifascicular regions, were frequently observed. Sarcolemmal complement deposition was detected specifically in perifascicular areas. Inflammation was mainly located in the perimysium and around vessels in 90.6%. Perimysial fragmentation was observed in 90% of cases. Major histocompatibility complex class I staining was diffusely positive, with a perifascicular reinforcement. Multivariate analysis showed that criteria defining perifascicular pathology: perifascicular necrosis, atrophy, and perimysial fragmentation allow the distinction of anti-Jo-1 antibody-positive patients, among patients suffering from other idiopathic inflammatory myopathies. Anti-Jo-1 antibody-positive patients displayed perifascicular necrosis, whereas dermatomyositis patients exhibited perifascicular atrophy. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Zaharieva, Irina T; Thor, Michael G; Oates, Emily C
2016-01-01
Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...
MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2015-01-01
Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.
MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2015-09-01
Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.
Inclusões intracitoplasmáticas hialinas na medular da adrenal de bovinos
Directory of Open Access Journals (Sweden)
L.P Mesquita
2011-02-01
Full Text Available Cytoplasmic inclusion bodies in adrenal medullary chromaffin cells have been described in various species including humans. These inclusions are believed to be related to certain infectious, toxic and neurodegenerative diseases. No reports concerning such adrenal inclusions have been described in bovines. Adrenal glands from twenty bovines were evaluated in a retrospective study. Seven of these exhibited inclusions - three cases of rabies, two cases of chronic suppurative bronchopneumonia, one case of chronic suppurative peritonitis, and one case of gangrenous mastitis. The inclusions were present in higher numbers especially in cases of rabies and also in one case of chronic suppurative bronchopneumonia. The inclusions were intracytoplasmic, eosinophilic, rounded, single or multiple, of various sizes, strongly stained by PAS and were present in higher numbers in the external layer of the adrenal medulla. The inclusions were negative when subjected to immunohistochemistry for detection of viral antigens in the cases of rabies. Although inclusion bodies were present in adrenal glands devoid of other histological alterations, they were more abundant in cases in which the adrenal gland had other alterations. The correlation between certain diseases and the development of inclusion bodies is not known, which highlights the importance of further studies on these inclusions in adrenal glands of bovines.
[Autoantibody profile in myositis].
Allenbach, Y; Benveniste, O
2014-07-01
Patients suffering from muscular symptoms or with an increase of creatine kinase levels may present a myopathy. In such situations, clinicians have to confirm the existence of a myopathy and determine if it is an acquired or a genetic muscular disease. In the presence of an acquired myopathy after having ruled out an infectious, a toxic agent or an endocrine cause, physicians must identify which type of idiopathic myopathy the patient is presenting: either a myositis including polymyositis, dermatomyositis, and inclusion body myositis, or an immune-mediated necrotizing myopathy. Histopathology examination of a muscle biopsy is determinant but detection of autoantibody is now also crucial. The myositis-specific antibodies and myositis-associated antibodies lead to a serologic approach complementary to the histological classification, because strong associations of myositis-specific antibodies with clinical features and survival have been documented. The presence of anti-synthetase antibodies is associated with an original histopathologic pattern between polymyositis and dermatomyositis, and defines a syndrome where interstitial lung disease drives the prognosis. Anti-MDA-5 antibody are specifically associated with dermatomyositis, and define a skin-lung syndrome with a frequent severe disease course. Anti-TIF1-γ is also associated with dermatomyositis but its presence is frequently predictive of a cancer association whereas anti-MI2 is associated with the classical dermatomyositis. Two specific antibodies, anti-SRP and anti-HMGCR, are observed in patients with immune-mediated necrotizing myopathies and may be very useful to distinguish acquired myopathies from dystrophic muscular diseases in case of a slow onset and to allow the initiation of effective therapy. Copyright © 2013 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.
Zhao, Mingzhi; Wu, Feilin; Xu, Ping
2015-12-01
Trypsin is one of the most important enzymatic tools in proteomics and biopharmaceutical studies. Here, we describe the complete recombinant expression and purification from a trypsinogen expression vector construct. The Sus scrofa cationic trypsin gene with a propeptide sequence was optimized according to Escherichia coli codon-usage bias and chemically synthesized. The gene was inserted into pET-11c plasmid to yield an expression vector. Using high-density E. coli fed-batch fermentation, trypsinogen was expressed in inclusion bodies at 1.47 g/L. The inclusion body was refolded with a high yield of 36%. The purified trypsinogen was then activated to produce trypsin. To address stability problems, the trypsin thus produced was acetylated. The final product was generated upon gel filtration. The final yield of acetylated trypsin was 182 mg/L from a 5-L fermenter. Our acetylated trypsin product demonstrated higher BAEE activity (30,100 BAEE unit/mg) than a commercial product (9500 BAEE unit/mg, Promega). It also demonstrated resistance to autolysis. This is the first report of production of acetylated recombinant trypsin that is stable and suitable for scale-up. Copyright © 2015 Elsevier Inc. All rights reserved.
Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.
Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore
2016-12-01
Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.
Miao, Jing; Su, Fei-Fei; Liu, Xue-Mei; Wei, Xiao-Jing; Yuan, Yun; Yu, Xue-Fan
2018-06-04
Filamin C-related myofibrillar myopathies (MFM) are progressive skeletal myopathies with an autosomal dominant inheritance pattern. The conditions are caused by mutations of the filamin C gene (FLNC) located in the chromosome 7q32-q35 region. Genetic variations in the FLNC gene result in various clinical phenotypes. We describe a 43-year-old woman who suffered filamin C-related MFM, with symptoms first presenting in the proximal muscles of the lower limbs and eventually spreading to the upper limbs and distal muscles. The patient's serum level of creatine kinase was mildly increased. Mildy myopathic changes in the electromyographic exam and moderate lipomatous alterations in lower limb MRI were found. Histopathological examination revealed increased muscle fiber size variability, disturbances in oxidative enzyme activity, and the presence of abnormal protein aggregates and vacuoles in some muscle fibers. Ultrastructural analysis showed inclusions composed of thin filaments and interspersed granular densities. DNA sequencing analysis detected a novel 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the FLNC gene. The patient's father, sister, brother, three paternal aunts, one paternal uncle, and the uncle's son also had slowly progressive muscle weakness, and thus, we detected an autosomal dominant inheritance pattern of the disorder. A novel heterogeneous 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the Ig-like domain 7 of the FLNC gene was found to cause filamin C-related MFM. This deletion in the FLNC gene causes protein aggregation, abnormalities in muscle structure, and impairment in muscle fiber function, which leads to muscle weakness.
DEFF Research Database (Denmark)
Bajorunaite, Egle; Cirkovas, Andrejus; Radzevicius, Kostas
2009-01-01
Cyclodextrins with different ring size and ring substituents were tested for recombinant mink and porcine growth hormones aggregation suppression in the refolding process from Escherichia coli inclusion bodies. Methyl-β-cyclodextrin and 2-hydroxypropyl-β-cyclodextrin show a positive effect...... on the aggregation suppression of both proteins. The influence of different methyl-β-cyclodextrin and 2-hydroxypropyl-β-cyclodextrin concentrations on the renaturation yield of both growth hormones was investigated. Moreover, methyl-β-cyclodextrin and 2-hydroxypropyl-β-cyclodextrin suppress not only folding...
Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.
Karalliedde, Lakshman; Baker, David; Marrs, Timothy C
2006-01-01
-15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in
Huang, Q.; Su, Y. B.; Li, D. F.; Liu, L.; Huang, C. F.; Zhu, Z. P.; Lai, C. H.
2015-01-01
The objective of this study was to determine the effects of graded inclusions of wheat bran (0%, 9.65%, 48.25% wheat bran) and two growth stages (from 32.5 to 47.2 kg and 59.4 to 78.7 kg, respectively) on the apparent ileal digestibility (AID), apparent total tract digestibility (ATTD) and hindgut fermentation of nutrients and energy in growing pigs. Six light pigs (initial body weight [BW] 32.5±2.1 kg) and six heavy pigs (initial BW 59.4±3.2 kg) were surgically prepared with a T-cannula in the distal ileum. A difference method was used to calculate the nutrient and energy digestibility of wheat bran by means of comparison with a basal diet consisting of corn-soybean meal (0% wheat bran). Two additional diets were formulated by replacing 9.65% and 48.25% wheat bran by the basal diet, respectively. Each group of pigs was allotted to a 6×3 Youden square design, and pigs were fed to three experimental diets during three 11-d periods. Hindgut fermentation values were calculated as the differences between ATTD and AID values. For the wheat bran diets, the AID and ATTD of dry matter (DM), ash, organic matter (OM), carbohydrates (CHO), gross energy (GE), and digestible energy (DE) decreased with increasing inclusion levels of wheat bran (pdigestibility of wheat bran in 9.65% inclusion level due to the coefficient of variation (CV) of the nutrient and energy digestibility being higher at 9.65% compared to 48.25% inclusion level of wheat bran. Digestible energy content of wheat bran at 48.25% inclusion level (4.8 and 6.7 MJ/kg of DM, respectively) fermented by hindgut was significantly higher (pdigestibility of some nutrients in pigs, while it positively affects the DE fermentation in the hindgut. PMID:25925062
International Nuclear Information System (INIS)
Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa
1992-01-01
Myocardial imaging with β-methyl-p-( 123 I)-iodophenyl-pentadecanoic acid ( 123 I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with 201 Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of 123 I-BMIPP compared to 201 Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of 123 I-BMIPP was higher than that of 201 Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of 123 I-BMIPP was lower than that of 201 Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of 123 I-BMIPP, these results suggest that 123 I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)
Refolding of proteins from inclusion bodies: rational design and recipes.
Basu, Anindya; Li, Xiang; Leong, Susanna Su Jan
2011-10-01
The need to develop protein biomanufacturing platforms that can deliver proteins quickly and cost-effectively is ever more pressing. The rapid rate at which genomes can now be sequenced demands efficient protein production platforms for gene function identification. There is a continued need for the biotech industry to deliver new and more effective protein-based drugs to address new diseases. Bacterial production platforms have the advantage of high expression yields, but insoluble expression of many proteins necessitates the development of diverse and optimised refolding-based processes. Strategies employed to eliminate insoluble expression are reviewed, where it is concluded that inclusion bodies are difficult to eliminate for various reasons. Rational design of refolding systems and recipes are therefore needed to expedite production of recombinant proteins. This review article discusses efforts towards rational design of refolding systems and recipes, which can be guided by the development of refolding screening platforms that yield both qualitative and quantitative information on the progression of a given refolding process. The new opportunities presented by light scattering technologies for developing rational protein refolding buffer systems which in turn can be used to develop new process designs armed with better monitoring and controlling functionalities are discussed. The coupling of dynamic and static light scattering methodologies for incorporation into future bioprocess designs to ensure delivery of high-quality refolded proteins at faster rates is also discussed.
Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R
2016-07-01
Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.
Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek
2006-01-01
Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.
Diversity ? Inclusion: Promoting Integration in Higher Education
Tienda, Marta
2013-01-01
I argue that enrollment of a diverse student body is but a pragmatic first step toward the broader social goal of inclusion and ask whether motives for campus diversification are aligned with pedagogic goals. I address this question by focusing on inclusion, namely, organizational strategies and practices that promote meaningful social and…
Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.
2013-01-01
Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855
Diagnosis, pathogenesis and treatment of myositis: recent advances.
Carstens, P-O; Schmidt, J
2014-03-01
Dermatomyositis (DM), polymyositis (PM), necrotizing myopathy (NM) and inclusion body myositis (IBM) are four distinct subtypes of idiopathic inflammatory myopathies - in short myositis. Recent studies have shed some light on the unique pathogenesis of each entity. Some of the clinical features are distinct, but muscle biopsy is indispensable for making a reliable diagnosis. The use of magnetic resonance imaging of skeletal muscles and detection of myositis-specific autoantibodies have become useful additions to our diagnostic repertoire. Only few controlled trials are available to substantiate current treatment approaches for myositis and hopes are high that novel modalities will become available within the next few years. In this review we provide an up-to-date overview of the pathogenesis and diagnostic approach of myositis. We aim to present a guide towards therapeutic and general management. © 2013 British Society for Immunology.
Xu, Li; Song, Xiaoyu; Jia, Lingyun
2017-11-01
Using anti-EGFR (epidermal growth factor receptor) nanobody is a good choice for diagnoses and therapeutics for high EGFR expression diseases. In the present study, the percentage composition of anti-EGFR nanobody attained 25% of the total cell protein expressed in Escherichia coli BL21 (DE3). However, almost all nanobodies were expressed as inclusion bodies. To acquire active nanobodies, a series of dilution refolding procedures were optimized after inclusion bodies were dissolved into 6 M urea and purified with immobilized metal affinity chromatography. The results showed the refolding rate of the anti-EGFR nanobodies attained to 73%, and about 100 mg nanobodies were refolded from 1 L cells under the conditions that the initial nanobody concentration was 0.3 mg/mL, the dilution speed was 2.5 mL/Min, the dilution buffer was Tris-HCl at pH 8.0, the additives were 0.2 M Arg, 5 mM reduced glutathione (GSH), and 1 mM oxidized glutathione (GSSG). Then the activity of the refolded nanobodies was confirmed. The results showed that the refolded anti-EGFR nanobodies, in a dose-dependent manner, bounded to the tumor cell surface of A431 and MCF-7 and significantly inhibited the proliferation of A431 caused by the epidermal growth factor. Our study provides a facile method to rapidly, efficiently, and massively prepare anti-EGFR antibodies and promotes anti-EGFR-based recognition in cancer diagnoses and therapeutics. © 2016 International Union of Biochemistry and Molecular Biology, Inc.
Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy
Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans
2016-01-01
The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)
Dietary intervention rescues myopathy associated with neurofibromatosis type 1.
Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron
2018-02-15
Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For
Dermatomyositis and Polymyositis
DEFF Research Database (Denmark)
Diederichsen, Louise C. Pyndt Raun; Sanner, Helga; Sjaastad, Ivar
2017-01-01
Idiopathic inflammatory myopathies (IIMs), collectively called myositis, are a heterogeneous group of diseases affecting adults and children. The IIMs are characterized by symmetrical, proximal muscle weakness and by inflammatory infiltrates in skeletal muscles. Based on differences in clinical...... and histopathological features, they can be divided into different subgroups, the most common forms being dermatomyositis (DM), polymyositis (PM), sporadic inclusion body myositis (sIBM), and in children juvenile dermatomyositis (JDM). Other organs are frequently involved in patients with IIM eg, lungs...
Exome sequencing reveals VCP mutations as a cause of familial ALS
Johnson, Janel O.; Mandrioli, Jessica; Benatar, Michael; Abramzon, Yevgeniya; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Gibbs, J Raphael; Brunetti, Maura; Gronka, Susan; Wuu, Joanne; Ding, Jinhui; McCluskey, Leo; Martinez-Lage, Maria; Falcone, Dana; Hernandez, Dena G.
2010-01-01
Using exome sequencing, we identified a p.R191Q amino acid change in the valosin-containing protein (VCP) gene in an Italian family with autosomal dominantly inherited amyotrophic lateral sclerosis (ALS). Mutations in VCP have previously been identified in families with Inclusion Body Myopathy, Paget’s disease and Frontotemporal Dementia (IBMPFD). Screening of VCP in a cohort of 210 familial ALS cases and 78 autopsy-proven ALS cases identified four additional mutations including a p.R155H mut...
Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu
2016-01-01
Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...
Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.
Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun
2015-06-01
We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.
Padhiar, Arshad Ahmed; Chanda, Warren; Joseph, Thomson Patrick; Guo, Xuefang; Liu, Min; Sha, Li; Batool, Samana; Gao, Yifan; Zhang, Wei; Huang, Min; Zhong, Mintao
2018-03-01
The formation of inclusion bodies (IBs) is considered as an Achilles heel of heterologous protein expression in bacterial hosts. Wide array of techniques has been developed to recover biochemically challenging proteins from IBs. However, acquiring the active state even from the same protein family was found to be an independent of single established method. Here, we present a new strategy for the recovery of wide sub-classes of recombinant protein from harsh IBs. We found that numerous methods and their combinations for reducing IB formation and producing soluble proteins were not effective, if the inclusion bodies were harsh in nature. On the other hand, different practices with mild solubilization buffers were able to solubilize IBs completely, yet the recovery of active protein requires large screening of refolding buffers. With the integration of previously reported mild solubilization techniques, we proposed an improved method, which comprised low sarkosyl concentration, ranging from 0.05 to 0.1% coupled with slow freezing (- 1 °C/min) and fast thaw (room temperature), resulting in greater solubility and the integrity of solubilized protein. Dilution method was employed with single buffer to restore activity for every sub-class of recombinant protein. Results showed that the recovered protein's activity was significantly higher compared with traditional solubilization/refolding approach. Solubilization of IBs by the described method was proved milder in nature, which restored native-like conformation of proteins within IBs.
Restrictive extraocular myopathy: A presenting feature of acromegaly
Directory of Open Access Journals (Sweden)
Steven Heireman
2011-01-01
Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.
Directory of Open Access Journals (Sweden)
Massimo Vecchiato
2012-03-01
Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of
Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.
Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo
2012-12-01
In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.
Rodríguez, M A; Del Rio Barquero, Luís M; Ortez, Carlos I; Jou, Cristina; Vigo, Meritxell; Medina, Julita; Febrer, Anna; Ramon-Krauel, Marta; Diaz-Manera, Jorge; Olive, Montse; González-Mera, Laura; Nascimento, Andres; Jimenez-Mallebrera, Cecilia
2017-01-01
Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM) characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD) and Bethlem Myopathy (BM). Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM). We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may be relevant to
Directory of Open Access Journals (Sweden)
M. A. Rodríguez
2017-08-01
Full Text Available Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD and Bethlem Myopathy (BM. Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM. We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may
DEFF Research Database (Denmark)
Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T
2012-01-01
Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...
How Can We Make Computing Lessons More Inclusive?
Shelton , Chris
2017-01-01
Part 3: Computer Science Education and Its Future Focus and Development; International audience; Whilst there is a substantial body of research that shows how Information and Communications Technologies (ICTs) can support schools and teachers to make their classrooms more inclusive, there is a need for more evidence describing how best to ensure that the teaching of computing itself is inclusive. This paper reports on a literature review of inclusive education in school computing lessons. It ...
Evaluation and construction of diagnostic criteria for inclusion body myositis
Mammen, Andrew L.; Amato, Anthony A.; Weiss, Michael D.; Needham, Merrilee
2014-01-01
Objective: To use patient data to evaluate and construct diagnostic criteria for inclusion body myositis (IBM), a progressive disease of skeletal muscle. Methods: The literature was reviewed to identify all previously proposed IBM diagnostic criteria. These criteria were applied through medical records review to 200 patients diagnosed as having IBM and 171 patients diagnosed as having a muscle disease other than IBM by neuromuscular specialists at 2 institutions, and to a validating set of 66 additional patients with IBM from 2 other institutions. Machine learning techniques were used for unbiased construction of diagnostic criteria. Results: Twenty-four previously proposed IBM diagnostic categories were identified. Twelve categories all performed with high (≥97%) specificity but varied substantially in their sensitivities (11%–84%). The best performing category was European Neuromuscular Centre 2013 probable (sensitivity of 84%). Specialized pathologic features and newly introduced strength criteria (comparative knee extension/hip flexion strength) performed poorly. Unbiased data-directed analysis of 20 features in 371 patients resulted in construction of higher-performing data-derived diagnostic criteria (90% sensitivity and 96% specificity). Conclusions: Published expert consensus–derived IBM diagnostic categories have uniformly high specificity but wide-ranging sensitivities. High-performing IBM diagnostic category criteria can be developed directly from principled unbiased analysis of patient data. Classification of evidence: This study provides Class II evidence that published expert consensus–derived IBM diagnostic categories accurately distinguish IBM from other muscle disease with high specificity but wide-ranging sensitivities. PMID:24975859
Directory of Open Access Journals (Sweden)
Asok Kumar Mariappan
2018-02-01
Full Text Available Aim: Mortality in a broiler chicken farm was investigated for identifying the cause of mortality. Materials and Methods: A broiler farm with a population of 16000 succumbed to a disease outbreak. Clinical signs, vaccination history and mortality, were recorded. Necropsy examination and microscopic examination were carried out along with toxicological and molecular studies. Results: The clinical signs in the affected broiler birds were of non-specific nature with a total mortality of 26.39%. Postmortem examination and microscopical findings revealed hepatitis with basophilic intranuclear inclusion, splenitis, myocarditis, and nephritis. Glomerulonephritis was the prominent renal pathology recorded in this study. Polymerase chain reaction test confirmed the presence of fowl adenovirus (FAdV genome in the target organs, and toxicological examination by thin-layer chromatography revealed the presence of a toxic level of citrinin in the feed samples. Conclusion: Based on various diagnostic investigations, the mortality in the flock was attributed to inclusion body hepatitis (IBH complicated with citrinin mycotoxicosis. Thus, apart from liver pathology which occurs in a classical IBH cases, glomerulonephritis too occurs which are also a prominent finding which pathologists often miss. Thus, kidneys should also be examined histologically to assess the microscopic tissue alterations in poultry suspected for IBH along with a mycotoxicological analysis of feed. This will definitely throw light on the synergistic pathology elicited and exhibited by FAdV and mycotoxins in the poultry.
Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.
2004-01-01
Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,
Váncsa, Andrea; Dankó, Katalin
2016-07-01
Myositis, which means inflammation of the muscles, is a general term used for inflammatory myopathies. Myositis is a rare idiopathic autoimmune disease. It is believed that environmental factors such as virus, bacteria, parasites, direct injuries, drugs side effect can trigger the immune system of genetically susceptible individuals to act against muscle tissues. There are several types of myositis with the same systemic symptoms such as muscle weakness, fatigue, muscle pain and inflammation. These include dermatomyositis, juvenile dermatomyositis, inclusion-body myositis, polymyositis, orbital myositis and myositis ossificans. Juvenile and adult dermatomyositis are chronic, immune-mediated inflammatory myopathies characterized by progressive proximal muscle weakness and typical skin symptoms. The aim of the authors was to compare the symptoms, laboratory and serological findings and disease course in children and adult patients with idiopathic inflammatory myopathy. Early diagnosis and aggressive immunosuppressive treatment improve the mortality of these patients. Myositis-specific autoantibodies have predictive and prognostic values regarding the associated overlap disease, response to treatment and disease course. The authors intend to lighten the clinical and pathogenetic significance of the new target autoantigens. Orv. Hetil., 2016, 157(29), 1179-1184.
Inclusions and inhomogeneities under stress
CSIR Research Space (South Africa)
Nabarro, FRN
1996-02-01
Full Text Available Some general theorems, new and old, concerning the behaviour of elastic inclusions and inhomogeneities in bodies without or with external stress, are assembled. The principal new result is that arbitrary external tractions cannot influence the shape...
Maseko, Sibusiso B; Natarajan, Satheesh; Sharma, Vikas; Bhattacharyya, Neelakshi; Govender, Thavendran; Sayed, Yasien; Maguire, Glenn E M; Lin, Johnson; Kruger, Hendrik G
2016-06-01
Human immunodeficiency virus (HIV) infections in sub-Saharan Africa represent about 56% of global infections. Many studies have targeted HIV-1 protease for the development of drugs against AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. Along with the wild type (C-SA) we also over-expressed and characterized two mutant forms from patients that had shown resistance to protease inhibitors. Using recombinant DNA technology, we constructed three recombinant plasmids in pGEX-6P-1 and expressed them containing a sequence encoding wild type HIV protease and two mutants (I36T↑T contains 100 amino acids and L38L↑N↑L contains 101 amino acids). These recombinant proteins were isolated from inclusion bodies by using QFF anion exchange and GST trap columns. In SDS-PAGE, we obtained these HIV proteases as single bands of approximately 11.5, 11.6 and 11.7 kDa for the wild type, I36T↑Tand L38L↑N↑L mutants, respectively. The enzyme was recovered efficiently (0.25 mg protein/L of Escherichia coli culture) and had high specific activity of 2.02, 2.20 and 1.33 μmol min(-1) mg(-1) at an optimal pH of 5 and temperature of 37 °C for the wild type, I36T↑T and L38L↑N↑L, respectively. The method employed here provides an easy and rapid purification of the HIV-1(C-SA) protease from the inclusion bodies, with high yield and high specific activities. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alessandra eZulian
2014-11-01
Full Text Available Ullrich congenital muscular dystrophy and Bethlem myopathy are caused by mutations in collagen VI genes, which encode an extracellular matrix protein; yet mitochondria play a major role in disease pathogenesis through a short circuit caused by inappropriate opening of the permeability transition pore, a high conductance channel which causes a shortage in ATP production. We find that melanocytes do not produce collagen VI yet they bind it at the cell surface, suggesting that this protein may play a trophic role and that its absence may cause lesions similar to those seen in skeletal muscle. We show that mitochondria in melanocytes of Ullrich congenital muscular dystrophy and Bethlem myooathy patients display increased size, reduced matrix density and disrupted cristae, findings that suggest a functional impairment. In keeping with this hypothesis, mitochondria (i underwent anomalous depolarization after inhibition of the F-ATP synthase with oligomycin, and (ii displayed decreased respiratory reserve capacity. The non-immunosuppressive cyclophilin inhibitor NIM811 prevented mitochondrial depolarization in response to oligomycin in melanocytes from both Ullrich congenital muscular dystrophy and Bethlem myopathy patients, and partially restored the respiratory reserve of melanocytes from one Bethlem myopathy patient. These results match our recent findings on melanocytes from patients affected by Duchenne muscular dystrophy (Pellegrini et al., 2013 Melanocytes--a novel tool to study mitochondrial dysfunction in Duchenne muscular dystrophy. J Cell Physiol 228, 1323-1331, and suggest that skin biopsies may represent a minimally invasive tool to investigate mitochondrial dysfunction and to evaluate drug efficacy in collagen VI-related myopathies and possibly in other muscle wasting conditions like aging sarcopenia.
Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.
2017-01-01
To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for
Elevated risk of venous thromboembolic events in patients with inflammatory myopathies
Directory of Open Access Journals (Sweden)
Nowak M
2016-06-01
Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state
Pereira, Larissa M; Silva, Luana R; Alves, Joseane F; Marin, Nélida; Silva, Flavio Sousa; Morganti, Ligia; Silva, Ismael D C G; Affonso, Regina
2014-09-01
The L10 ribosomal protein (RPL10) plays a role in the binding of the 60 S and 40 S ribosomal subunits and in mRNA translation. The evidence indicates that RPL10 also has multiple extra-ribosomal functions, including tumor suppression. Recently, the presence of RPL10 in prostate and ovarian cancers was evaluated, and it was demonstrated to be associated with autistic disorders and premature ovarian failure. In the present work, we successfully cloned and expressed full-length human RPL10 (hRPL10) protein and isolated inclusion bodies containing this protein that had formed under mild growth conditions. The culture produced 376mg of hRPL10 protein per liter of induced bacterial culture, of which 102.4mg was present in the soluble fraction, and 25.6mg was recovered at approximately 94% purity. These results were obtained using a two-step process of non-denaturing protein extraction from pelleted inclusion bodies. We studied the characteristics of this protein using circular dichroism spectroscopy and by monitoring the changes induced by the presence or absence of zinc ions using fluorescence spectrometry. The results demonstrated that the protein obtained using these non-conventional methods retained its secondary and tertiary structure. The conformational changes induced by the incorporation of zinc suggested that this protein could interact with Jun or the SH3 domain of c-yes. The results suggested that the strategy used to obtain hRPL10 is simple and could be applied to obtaining other proteins that are susceptible to degradation. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.
1987-01-01
Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)
DEFF Research Database (Denmark)
Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H
2009-01-01
, DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...
König, P; Ambrose, N S; Scott, N
2000-01-01
Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.
Energy Technology Data Exchange (ETDEWEB)
Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa (Kagoshima Univ. (Japan). Faculty of Medicine) (and others)
1992-04-01
Myocardial imaging with {beta}-methyl-p-({sup 123}I)-iodophenyl-pentadecanoic acid ({sup 123}I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with {sup 201}Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of {sup 123}I-BMIPP compared to {sup 201}Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of {sup 123}I-BMIPP was higher than that of {sup 201}Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of {sup 123}I-BMIPP was lower than that of {sup 201}Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of {sup 123}I-BMIPP, these results suggest that {sup 123}I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)
Energy Technology Data Exchange (ETDEWEB)
Balduino, Keli Nunes
2009-07-01
The expression of proteins as inclusion bodies in bacteria is a widely used alternative for production of recombinant protein. However, the aggregation is a problem often encountered during refolding of these proteins. High hydrostatic pressure are able to solubilise the inclusion bodies in the presence of low concentrations of denaturant reagents, encouraging refolding protein with high efficiency and reduce costs. This work aims to refolding of recombinant proteins expressed in Escherichia coli from inclusion bodies using high hydrostatic pressure. Three toxins, all featuring five or more disulfide bonds were studied: NXH8, Natterin 2 and Bothropstoxin 1. Suspensions of inclusion bodies of the three proteins were pressurized to 2000 bars for 16 hours. The buffers were optimized for refolding of the three proteins. The buffer used in the refolding of NXH8 was 50 mM Tris HCl, pH 9.0 with proportion of 1GSH: 4GSSG at a concentration of 6 mM and 2 M GdnHCl. Inclusion bodies were used in O.D. (A600nm) of 0.5. After refolding process, dialysis was performed at pH 7.0. The final yield of obtaining soluble NXH8 was 40% (28,6 mg of soluble NXH8/L of culture medium). The refolding of Bothropstoxin 1 was obtained in refolding buffer of Tris HCl 50 mM, pH 7,5 with proportion of 2 GSH: GSSG 3 and concentration of 3 mM and 1 M GdnHCl. Use with a suspension of O.D. (A600nm) of 0.5. The final yield of recovery of Bothropstoxin 1 refolded was 32% (9,2 mg of refolded Bothropstoxin 1/L of culture medium). The refolding of Natterin 2 was performed in the refolding buffer: 20 mM Tris HCl pH 9.0 at a ratio of 2 GSH: 3GSSG and concentration of 10 mM and 1 M GdnHCl and inclusion bodies O.D. (A600nm) of 6.0. The yield of Natterin 2 refolded was 20% (3,7 mg/L of culture medium). Physico-chemical and biological analysis were performed by SDS-PAGE, western blot, scanning electron microscopy, biological tests in vivo and in vitro and structural. The analysis conducted in NXH8 did not show
Directory of Open Access Journals (Sweden)
C. Magarinos Torres
1935-09-01
Full Text Available Resulta das descripções e documentos examinados que as inclusões cytoplasmaticas da variola vera, no material humano examinado, apresentam caracteres geraes que poderão ser assim resumidos: 1. intensa coloração pela safranina nos preparados pelo methodo de Unna modificado (Fig. 42, mostrando a inclusão matiz semelhante ao dos nucleolos da mesma cellula. 2. reacção predominantemente acidophila nos preparados pela hematoxylina-eosina, traduzida pela tonalidade rosea ou vermelha de coloração (Figs. 27, 29, 30, 31 e 31. 3. frequente multiplicidade de inclusões de fórma e dimensões variadas na mesma cellula (Figs. 29 e 30, as maiores inclusões (Figs. 29 e 32, sendo menores que as grandes inclusões cytoplasmaticas solitarias do alastrim (Figs. 15, 16 e 18. É a regra, ainda, observar-se desapparecimento de qualquer estructura no cytoplasma das cellulas com inclusões em zona muito extensa, tornando-se difficil explicar tal aspecto unicamente pela retracção das inclusões no acto da fixação (Figs. 31 e 32. Quanto ás inclusões intranucleares, ellas se apresentam sob tres aspectos, dois dos quaes bem reconhecidos por Luger e Lauda (1926. Em um primeiro aspecto, o nucleo conserva, em parte, o reticulo de linina e encerra uma massa irregular (Fig. 35 ou, então, pequenas massas e granulos de dimensões variaveis (Figs. 33 e 34 constituidos por material acidophilo que ali não existe em condições normaes. A membrana nuclear tem espessura visinha do normal. Em um segundo aspecto, a inclusão occupa a totalidade do nucleoplasma (Fig. 3, apenas separado da membrana nuclear, em alguns casos (Fig. 38, por um estreito espaço claro (zona de retracção. Por vezes apresenta um aspecto homogeneo (Fig. 37; outras vezes a inclusão mostra pequenas areas chromophobas ( Fig. 38. A hyperchromatose da membrana nuclear é accentuada, tanto neste como no aspecto seguinte. No terceiro aspecto (aspecto corpuscular (Figs. 39, 40, 48 e 50, a inclus
Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana
2016-02-01
TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.
DEFF Research Database (Denmark)
Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt
2015-01-01
inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...
Difference, inclusion, and mathematics education
DEFF Research Database (Denmark)
Figueiras, Lourdes; Healy, Lulu; Skovsmose, Ole
2016-01-01
The round-table discussion on Difference, Inclusion and Mathematics Education was in included in the scientific programme of VI SIPEM in recognition and celebration of the emerging body of research into the challenges of building a culture of mathematics education which values and respects the di...
Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.
2018-01-01
Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of
Quality control of inclusion bodies in Escherichia coli
Directory of Open Access Journals (Sweden)
Schweder Thomas
2010-05-01
Full Text Available Abstract Background Bacterial inclusion bodies (IBs are key intermediates for protein production. Their quality affects the refolding yield and further purification. Recent functional and structural studies have revealed that IBs are not dead-end aggregates but undergo dynamic changes, including aggregation, refunctionalization of the protein and proteolysis. Both, aggregation of the folding intermediates and turnover of IBs are influenced by the cellular situation and a number of well-studied chaperones and proteases are included. IBs mostly contain only minor impurities and are relatively homogenous. Results IBs of α-glucosidase of Saccharomyces cerevisiae after overproduction in Escherichia coli contain a large amount of (at least 12 different major product fragments, as revealed by two-dimensional polyacrylamide gel electrophoresis (2D PAGE. Matrix-Assisted-Laser-Desorption/Ionization-Time-Of-Flight Mass-Spectrometry (MALDI-ToF MS identification showed that these fragments contain either the N- or the C-terminus of the protein, therefore indicate that these IBs are at least partially created by proteolytic action. Expression of α-glucosidase in single knockout mutants for the major proteases ClpP, Lon, OmpT and FtsH which are known to be involved in the heat shock like response to production of recombinant proteins or to the degradation of IB proteins, clpP, lon, ompT, and ftsH did not influence the fragment pattern or the composition of the IBs. The quality of the IBs was also not influenced by the sampling time, cultivation medium (complex and mineral salt medium, production strategy (shake flask, fed-batch fermentation process, production strength (T5-lac or T7 promoter, strain background (K-12 or BL21, or addition of different protease inhibitors during IB preparation. Conclusions α-glucosidase is fragmented before aggregation, but neither by proteolytic action on the IBs by the common major proteases, nor during downstream IB
Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud
This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at
Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.
BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure
Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.
2016-01-01
Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To
Inclusion bodies as potential vehicles for recombinant protein delivery into epithelial cells
2012-01-01
Background We present the potential of inclusion bodies (IBs) as a protein delivery method for polymeric filamentous proteins. We used as cell factory a strain of E. coli, a conventional host organism, and keratin 14 (K14) as an example of a complex protein. Keratins build the intermediate filament cytoskeleton of all epithelial cells. In order to build filaments, monomeric K14 needs first to dimerize with its binding partner (keratin 5, K5), which is then followed by heterodimer assembly into filaments. Results K14 IBs were electroporated into SW13 cells grown in culture together with a “reporter” plasmid containing EYFP labeled keratin 5 (K5) cDNA. As SW13 cells do not normally express keratins, and keratin filaments are built exclusively of keratin heterodimers (i.e. K5/K14), the short filamentous structures we obtained in this study can only be the result of: a) if both IBs and plasmid DNA are transfected simultaneously into the cell(s); b) once inside the cells, K14 protein is being released from IBs; c) released K14 is functional, able to form heterodimers with EYFP-K5. Conclusions Soluble IBs may be also developed for complex cytoskeletal proteins and used as nanoparticles for their delivery into epithelial cells. PMID:22624805
Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.
2017-01-01
In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp
Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.
2017-01-01
Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We
McKenzie, R K; Hill, F I; Habyarimana, J A; Boemer, F; Votion, D M
2016-05-01
During April and May 2014 four horses aged between 5 months and 9 years, located in the Canterbury, Marlborough and Southland regions, presented with a variety of clinical signs including recumbency, stiffness, lethargy, dehydration, depression, and myoglobinuria suggestive of acute muscle damage. Two horses were subjected to euthanasia and two recovered. In all cases seeds of sycamore maple (Acer pseudoplatanus) or box elder (A. negundo) were present in the area where the horse had been grazing. The samaras (seeds) of some Acer spp. may contain hypoglycin A, that has been associated with cases of atypical myopathy in Europe and North America. To determine if hypoglycin A is present in the samaras of Acer spp. in New Zealand, samples were collected from trees throughout the country that were associated with historical and/or current cases of atypical myopathy, and analysed for hypoglycin A. Serum samples from the four cases and four unaffected horses were analysed for the presence of hypoglycin A, profiles of acylcarnitines (the definitive diagnosis for atypical myopathy) and activities of creatine kinase and aspartate aminotransferase.Markedly elevated serum activities of creatine kinase and aspartate aminotransferase, and increased concentrations of selected acylcarnitines were found in the case horses. Hypoglycin A was detected in the serum of those horses but not in the healthy controls. Hypoglycin A was detected in 10/15 samples of samaras from sycamore maple and box elder from throughout New Zealand. Cases of atypical myopathy were diagnosed on properties where samaras containing hypoglycin A were also found. Sycamore and box elder trees in New Zealand are a source of hypoglycin A associated with the development of atypical myopathy. If pastured horses present with clinical and biochemical signs of severe muscle damage then the environment should be checked for the presence of these trees. Horses should be prevented from grazing samaras from Acer spp. in the
BAG3 myofibrillar myopathy presenting with cardiomyopathy.
Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P
2015-05-01
Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.
Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R
2000-01-01
Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.
DEFF Research Database (Denmark)
Frederiksen, A.L.; Jeppesen, T.D.; Vissing, J.
2009-01-01
controls were subjected to an oral glucose tolerance test. Twenty-six adult 3243A>G carriers with unknown myopathy status and 17 healthy controls had a maximal cycle test and a muscle biopsy performed. The mutation loads were quantified in blood and muscle biopsies and correlated to the clinical......INTRODUCTION: The point mutation of 3243A>G mtDNA is the most frequent cause of mitochondrial diabetes, often presenting as the syndrome maternally inherited diabetes and deafness (MIDD). The mutation may also cause myopathy, ataxia, strokes, ophthalmoplegia, epilepsy, and cardiomyopathy in various...... combinations. Consequently, it is difficult to predict the "phenotypic risk profile" of 3243A>G mutation-positive subjects. The 3243A>G mutation coexists in cells with wild-type mtDNA, a phenomenon called heteroplasmy. The marked variability in mutation loads in different tissues is the main explanation...
DEFF Research Database (Denmark)
Klein, H H; Müller, R; Vestergaard, H
1999-01-01
We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...
Corticosteroids in Myositis and Scleroderma
Postolova, Anna; Chen, Jennifer K; Chung, Lorinda
2017-01-01
Synopsis Idiopathic inflammatory myopathies (IIM) involve inflammation of the muscles and are classified based on the patterns of presentation and immunohistopathologic features on skin and muscle biopsy into four categories: dermatomyositis, polymyositis, inclusion body myositis, and immune mediated necrotizing myopathy. The term “scleroderma” refers to fibrosis of the skin. Localized scleroderma (morphea) is skin-limited, while systemic sclerosis (SSc) is associated with vascular and internal organ involvement. Although there is a paucity of randomized clinical trials, treatment with systemic corticosteroids (CS) is the standard of care for IIM with muscle and organ involvement. The extra-cutaneous features of systemic sclerosis are frequently treated with CS, however high doses have been associated with scleroderma renal crisis in high-risk patients. CS monotherapy is neither recommended for the cutaneous manifestations of dermatomyositis nor scleroderma. While CS can be effective first line agents, their significant side effect profile encourages concomitant treatment with other immunosuppressive medications to enable timely tapering. PMID:26611554
Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu
2017-01-01
Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Wiendl, Heinz; Mitsdoerffer, Meike; Schneider, Dagmar; Chen, Lieping; Lochmüller, Hanns; Melms, Arthur; Weller, Michael
2003-10-01
B7-H1 is a novel B7 family protein attributed to costimulatory and immune regulatory functions. Here we report that human myoblasts cultured from control subjects and patients with inflammatory myopathies as well as TE671 muscle rhabdomyosarcoma cells express high levels of B7-H1 after stimulation with the inflammatory cytokine IFN-gamma. Coculture experiments of MHC class I/II-positive myoblasts with CD4 and CD8 T cells in the presence of antigen demonstrated the functional consequences of muscle-related B7-H1 expression: production of inflammatory cytokines, IFN-gamma and IL-2, by CD4 as well CD8 T cells was markedly enhanced in the presence of a neutralizing anti-B7-H1 antibody. This observation was paralleled by an augmented expression of the T cell activation markers CD25, ICOS, and CD69, thus showing B7-H1-mediated inhibition of T cell activation. Further, we investigated 23 muscle biopsy specimens from patients with polymyositis (PM), inclusion body myositis (IBM), dermatomyositis (DM), and nonmyopathic controls for B7-H1 expression by immunohistochemistry: B7-H1 was expressed in PM, IBM, and DM specimens but not in noninflammatory and nonmyopathic controls. Staining was predominantly localized to areas of strong inflammation and to muscle cells as well as mononuclear cells. These data highlight the immune regulatory properties of muscle cells and suggest that B7-H1 expression represents an inhibitory mechanism induced upon inflammatory stimuli and aimed at protecting muscle fibers from immune aggression.
Directory of Open Access Journals (Sweden)
Q. Huang
2015-06-01
Full Text Available The objective of this study was to determine the effects of graded inclusions of wheat bran (0%, 9.65%, 48.25% wheat bran and two growth stages (from 32.5 to 47.2 kg and 59.4 to 78.7 kg, respectively on the apparent ileal digestibility (AID, apparent total tract digestibility (ATTD and hindgut fermentation of nutrients and energy in growing pigs. Six light pigs (initial body weight [BW] 32.5±2.1 kg and six heavy pigs (initial BW 59.4±3.2 kg were surgically prepared with a T-cannula in the distal ileum. A difference method was used to calculate the nutrient and energy digestibility of wheat bran by means of comparison with a basal diet consisting of corn-soybean meal (0% wheat bran. Two additional diets were formulated by replacing 9.65% and 48.25% wheat bran by the basal diet, respectively. Each group of pigs was allotted to a 6×3 Youden square design, and pigs were fed to three experimental diets during three 11-d periods. Hindgut fermentation values were calculated as the differences between ATTD and AID values. For the wheat bran diets, the AID and ATTD of dry matter (DM, ash, organic matter (OM, carbohydrates (CHO, gross energy (GE, and digestible energy (DE decreased with increasing inclusion levels of wheat bran (p<0.05. While only AID of CHO and ATTD of DM, ash, OM, CHO, GE, and DE content differed (p<0.05 when considering the BW effect. For the wheat bran ingredient, there was a wider variation effect (p<0.01 on the nutrient and energy digestibility of wheat bran in 9.65% inclusion level due to the coefficient of variation (CV of the nutrient and energy digestibility being higher at 9.65% compared to 48.25% inclusion level of wheat bran. Digestible energy content of wheat bran at 48.25% inclusion level (4.8 and 6.7 MJ/kg of DM, respectively fermented by hindgut was significantly higher (p<0.05 than that in 9.65% wheat bran inclusion level (2.56 and 2.12 MJ/kg of DM, respectively, which was also affected (p<0.05 by two growth stages
Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E
1995-01-01
We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the
Bodewes, R; Kik, M J L; Raj, V Stalin; Schapendonk, C M E; Haagmans, B L; Smits, S L; Osterhaus, A D M E
2013-06-01
Arenaviruses are bi-segmented negative-stranded RNA viruses, which were until recently only detected in rodents and humans. Now highly divergent arenaviruses have been identified in boid snakes with inclusion body disease (IBD). Here, we describe the identification of a new species and variants of the highly divergent arenaviruses, which were detected in tissues of captive boid snakes with IBD in The Netherlands by next-generation sequencing. Phylogenetic analysis of the complete sequence of the open reading frames of the four predicted proteins of one of the detected viruses revealed that this virus was most closely related to the recently identified Golden Gate virus, while considerable sequence differences were observed between the highly divergent arenaviruses detected in this study. These findings add to the recent identification of the highly divergent arenaviruses in boid snakes with IBD in the United States and indicate that these viruses also circulate among boid snakes in Europe.
Benedix, G. K.; McCoy, T. J.; Keil, K.
1995-09-01
IAB irons are the largest group of iron meteorites, exhibit a large range of siderophile element concentrations in their metal, and commonly contain silicate inclusions with roughly chondritic composition. They are closely related to IIICD irons [1,2] and their inclusions resemble winonaites [3]. It has been suggested that IAB's and IIICD's formed in individual impact melt pools [4,2] on a common parent body. However, it has also been suggested that fractional crystallization [5,6] of a S-saturated core could produce the observed siderophile element trends. Metal composition is correlated with silicate inclusion mineralogy in IIICD's [1], indicating reactions between solid silicates and the metallic magma in a core. These trends observed in IIICD's differ from those in IAB's, suggesting different parent bodies. A bi-modal grouping, based primarily on mineralogy and mineral abundances, was suggested for IAB inclusions [7]. However, recent recoveries of several new silicate-bearing IAB's, along with the emergence of new ideas on their origins, prompted a comprehensive study to document more fully the range of inclusions within IAB irons, to examine possible correlations between the compositions of the metallic host and the silicate inclusions, and to elucidate the origin of IAB irons. We are studying troilite-graphite-silicate inclusions in 24 IAB irons with Ni concentrations ranging from 6.6-25.0%. These include Odessa and Copiapo types [7], newly recovered meteorites (e.g., Lueders [8]) and meteorites with extreme Ni contents (e.g., Jenny's Creek, 6.8%; San Cristobal, 25.0% [9]). The inclusions exhibit a range of textures from recrystallized to partial melts (e.g., Caddo County [10]). Rigorous classification [7] is hampered by heterogeneities between group meteorites, between different samples of distinct meteorites, and within individual inclusions. While intergroup heterogeneities make comparisons between the suite of IAB's somewhat difficult, some general trends
Molecular markers for granulovacuolar degeneration are present in rimmed vacuoles.
Directory of Open Access Journals (Sweden)
Masahiro Nakamori
Full Text Available BACKGROUND: Rimmed vacuoles (RVs are round-oval cytoplasmic inclusions, detected in muscle cells of patients with myopathies, such as inclusion body myositis (IBM and distal myopathy with RVs (DMRV. Granulovacuolar degeneration (GVD bodies are spherical vacuoles containing argentophilic and hematoxyphilic granules, and are one of the pathological hallmarks commonly found in hippocampal pyramidal neurons of patients with aging-related neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease. These diseases are common in the elderly and share some pathological features. Therefore, we hypothesized that mechanisms of vacuolar formation in RVs and GVD bodies are common despite their role in two differing pathologies. We explored the components of RVs by immunohistochemistry, using antibodies for GVD markers. METHODS: Subjects included one AD case, eight cases of sporadic IBM, and three cases of DMRV. We compared immunoreactivity and staining patterns for GVD markers. These markers included: (1 tau-modifying proteins (caspase 3, cyclin-dependent kinase 5 [CDK5], casein kinase 1δ [CK1δ], and c-jun N-terminal kinase [JNK], (2 lipid raft-associated materials (annexin 2, leucine-rich repeat kinase 2 [LRRK2], and flotillin-1, and (3 other markers (charged multi-vesicular body protein 2B [CHMP2B] and phosphorylated transactive response DNA binding protein-43 [pTDP43] in both GVD bodies and RVs. Furthermore, we performed double staining of each GVD marker with pTDP43 to verify the co-localization. RESULTS: GVD markers, including lipid raft-associated proteins and tau kinases, were detected in RVs. CHMP2B, pTDP43, caspase 3, LRRK2, annexin 2 and flotillin-1 were detected on the rim and were diffusely distributed in the cytoplasm of RV-positive fibers. CDK5, CK1δ and JNK were detected only on the rim. In double staining experiments, all GVD markers colocalized with pTDP43 in RVs. CONCLUSIONS: These results suggest that RVs of muscle
Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Chen, Jianping
2014-06-01
Viruses commonly modify host endomembranes to facilitate biological processes in the viral life cycle. Infection by viruses belonging to the genus Bymovirus (family Potyviridae) has long been known to induce the formation of large membranous inclusion bodies in host cells, but their assembly and biological roles are still unclear. Immunoelectron microscopy of cells infected with the bymovirus Wheat yellow mosaic virus (WYMV) showed that P1, P2 and P3 are the major viral protein constituents of the membranous inclusions, whereas NIa-Pro (nuclear inclusion-a protease) and VPg (viral protein genome-linked) are probable minor components. P1, P2 and P3 associated with the endoplasmic reticulum (ER), but only P2 was able to rearrange ER and form large aggregate structures. Bioinformatic analyses and chemical experiments showed that P2 is an integral membrane protein and depends on the active secretory pathway to form aggregates of ER membranes. In planta and in vitro assays demonstrated that P2 interacts with P1, P3, NIa-Pro or VPg and recruits these proteins into the aggregates. In vivo RNA labelling using WYMV-infected wheat protoplasts showed that the synthesis of viral RNAs occurs in the P2-associated inclusions. Our results suggest that P2 plays a major role in the formation of membranous compartments that house the genomic replication of WYMV. © 2013 BSPP AND JOHN WILEY & SONS LTD.
Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S
2016-08-12
Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.
Directory of Open Access Journals (Sweden)
Louis WC Liu
2004-01-01
Full Text Available Inclusion body myositis (IBM is a progressive degenerative skeletal muscle disease leading to weakening and atrophy of both proximal and distal muscles. Dysphagia is reported in up to 86% of IBM patients. Surgical cricopharyngeal myotomy may be effective for cricopharyngeal dysphagia and there is one published report that botulinum toxin A, injected into the cricopharyngeus muscle using a hypopharyngoscope under general anesthesia, relieved IBM-associated dysphagia. This report presents the first documentation of botulinum toxin A injection into the upper esophageal sphincter using a flexible esophagogastroduodenoscope under conscious sedation, to reduce upper esophageal sphincter pressure and successfully alleviate oropharyngeal dysphagia in two IBM patients.
DEFF Research Database (Denmark)
Vestergaard, H; Klein, H H; Hansen, T
1995-01-01
Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...
Inclusive breakup of three-fragment weakly bound nuclei
International Nuclear Information System (INIS)
Carlson, B.V.; Frederico, T.; Hussein, M.S.
2017-01-01
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
Inclusive breakup of three-fragment weakly bound nuclei
Energy Technology Data Exchange (ETDEWEB)
Carlson, B.V.; Frederico, T. [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Hussein, M.S., E-mail: hussein@if.usp.br [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Instituto de Estudos Avançados, Universidade de São Paulo, C.P. 72012, 05508-970 São Paulo, SP (Brazil); Instituto de Física, Universidade de São Paulo, C.P. 66318, 05314-970 São Paulo, SP (Brazil)
2017-04-10
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
Directory of Open Access Journals (Sweden)
Hina N. Khan
2016-02-01
Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.
Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.
Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with
Rocchiccioli, F.; Wanders, R. J.; Aubourg, P.; Vianey-Liaud, C.; IJlst, L.; Fabre, M.; Cartier, N.; Bougneres, P. F.
1990-01-01
A child presented in early childhood with episodes of coma and hypoglycemia and a rapidly evolutive myopathy and cardiomyopathy leading to death at 9 mo of age. Ketosis was decreased (blood beta-hydroxybutyrate: 0.07 mmol/L) despite normal plasma levels of fatty acids (0.81 mmol/L). The patient's
Microvillus Inclusion Disease Associated with Necrotizing Enterocolitis in a Premature Infant
Directory of Open Access Journals (Sweden)
Ersin Sayar
2014-11-01
Full Text Available Microvillus inclusion disease is one of the congenital diarrheal disorders characterized by the appearance of inclusion bodies on the intestinal epithelium. To date there are a few cases and also a few other associated finding reports related to this life-threatening disease in literature. In this report, we present a premature infant with microvillus inclusion disease that was associated with necrotizing enterocolitis. Thus, we should be aware of the appearance of necrotizing enterocolitis in patients with microvillus inclusion disease, especially when contributing factors are present.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E
2006-01-01
Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.
Santa, Kristin M
2010-11-01
Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.
Directory of Open Access Journals (Sweden)
Benech Philippe
2009-08-01
Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.
Directory of Open Access Journals (Sweden)
Pari Basharat
2016-07-01
Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.
[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].
Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong
2014-10-18
To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in
Ata, Rheanna N; Thompson, J Kevin; Small, Brent J
2013-09-01
The current study was designed to determine whether the inclusion of a disclaimer (i.e., "Retouched photograph aimed at changing a person's physical appearance.") or warning (i.e., "Warning: Trying to look as thin as this model may be dangerous to your health.") added to images of thin/attractive models would affect body dissatisfaction and intent to diet in female undergraduate students (n=342). Participants were randomly assigned to one of four groups: (a) disclaimer, (b) warning, (c) model control, or (d) car control. Results revealed a significant interaction between group and time, whereby only the car control group reported a significant change (i.e., decrease) in body dissatisfaction over time. Groups did not differ on intent to diet measured at post-exposure. The results largely replicate other findings in this area and call into question advocacy efforts to label media images as a strategy to decrease women's identification with the stimuli. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jennifer Settergren
Full Text Available To investigate the extent to which clinicians avoid well-established drug-drug interactions that cause statin-induced myopathy. We hypothesised that clinicians would avoid combining erythromycin or verapamil/diltiazem respectively with atorvastatin or simvastatin. In patients with statin-fibrate combination therapy, we hypothesised that gemfibrozil was avoided to the preference of bezafibrate or fenofibrate. When combined with verapamil/diltiazem or fibrates, we hypothesized that the dispensed doses of atorvastatin/simvastatin would be decreased.Cross-sectional analysis of nationwide dispensing data. Odds ratios of interacting erythromycin, verapamil/diltiazem versus respective prevalence of comparator drugs doxycycline, amlodipine/felodipine in patients co-dispensed interacting statins simvastatin/atorvastatin versus patients unexposed (pravastatin/fluvastatin/rosuvastatin was calculated. For fibrates, OR of gemfibrozil versus fenofibrate/bezafibrate in patients co-dispensed any statin was assessed.OR of interacting erythromycin versus comparator doxycycline did not differ between patients on interacting and comparator statins either in patients dispensed high or low statin doses (adjusted OR 0.87; 95% CI 0.60-1.25 and 0.92; 95% CI 0.69-1.23. Interacting statins were less common among patients dispensed verapamil/diltiazem as compared to patients on amlodipine/felodipine (OR high dose 0.62; CI 0.56-0.68 and low dose 0.63; CI 0.58-0.68. Patients on any statin were to a lesser extent dispensed gemfibrozil compared to patients not dispensed a statin (OR high dose 0.65; CI 0.55-0.76 and low dose 0.70; CI 0.63-0.78. Mean DDD (SD for any statin was substantially higher in patients co-dispensed gemfibrozil 178 (149 compared to patients on statin monotherapy 127 (93, (p<0.001.Prescribers may to some extent avoid co-prescription of statins with calcium blockers and fibrates with an increased risk of myopathy. We found no evidence for avoiding co
Estimating body weight and body composition of chickens by using noninvasive measurements.
Latshaw, J D; Bishop, B L
2001-07-01
The major objective of this research was to develop equations to estimate BW and body composition using measurements taken with inexpensive instruments. We used five groups of chickens that were created with different genetic stocks and feeding programs. Four of the five groups were from broiler genetic stock, and one was from sex-linked heavy layers. The goal was to sample six males from each group when the group weight was 1.20, 1.75, and 2.30 kg. Each male was weighed and measured for back length, pelvis width, circumference, breast width, keel length, and abdominal skinfold thickness. A cloth tape measure, calipers, and skinfold calipers were used for measurement. Chickens were scanned for total body electrical conductivity (TOBEC) before being euthanized and frozen. Six females were selected at weights similar to those for males and were measured in the same way. Each whole chicken was ground, and a portion of ground material of each was used to measure water, fat, ash, and energy content. Multiple linear regression was used to estimate BW from body measurements. The best single measurement was pelvis width, with an R2 = 0.67. Inclusion of three body measurements in an equation resulted in R2 = 0.78 and the following equation: BW (g) = -930.0 + 68.5 (breast, cm) + 48.5 (circumference, cm) + 62.8 (pelvis, cm). The best single measurement to estimate body fat was abdominal skinfold thickness, expressed as a natural logarithm. Inclusion of weight and skinfold thickness resulted in R2 = 0.63 for body fat according to the following equation: fat (%) = 24.83 + 6.75 (skinfold, ln cm) - 3.87 (wt, kg). Inclusion of the result of TOBEC and the effect of sex improved the R2 to 0.78 for body fat. Regression analysis was used to develop additional equations, based on fat, to estimate water and energy contents of the body. The body water content (%) = 72.1 - 0.60 (body fat, %), and body energy (kcal/g) = 1.097 + 0.080 (body fat, %). The results of the present study
Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report
International Nuclear Information System (INIS)
Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub
2006-01-01
Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess
Yuasa, Noriyuki; Koyama, Tsubasa; Fujita-Yamaguchi, Yoko
2014-02-01
T-antigen (Galβ1-3GalNAcα-1-Ser/Thr) is an oncofetal antigen that is commonly expressed as a carbohydrate determinant in many adenocarcinomas. Since it is associated with tumor progression and metastasis, production of recombinant antibodies specific for T-antigen could lead to the development of cancer diagnostics and therapeutics. Previously, we isolated and characterized 11 anti-T-antigen phage clones from a phage library displaying human single-chain antibodies (scFvs) and purified one scFv protein, 1G11. More recently, we purified and characterized 1E8 scFv protein using a Drosophila S2 expression system. In the current study, four anti-T-antigen scFv genes belonging to Groups 1-4 were purified from inclusion bodies expressed in Escherichia coli cells. Inclusion bodies isolated from E. coli cells were denatured in 3.5 M Gdn-HCl. Solubilized His-tagged scFv proteins were purified using Ni(2+)-Sepharose column chromatography in the presence of 3.5 M Gdn-HCl. Purified scFv proteins were refolded according to a previously published method of step-wise dialysis. Two anti-T-antigen scFv proteins, 1E6 and 1E8 that belong to Groups 1 and 2, respectively, were produced in sufficient amounts, thus allowing further characterization of their binding activity with T-antigen. Specificity and affinity constants determined using enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (SPR), respectively, provided evidence that both 1E8 and 1E6 scFv proteins are T-antigen specific and suggested that 1E8 scFv protein has a higher affinity for T-antigen than 1E6 scFv protein.
A case of congenital myopathy masquerading as paroxysmal dyskinesia
Directory of Open Access Journals (Sweden)
Harsh Patel
2014-01-01
Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.
Suzuki, Nobuaki; Kunishima, Shinji; Ikejiri, Makoto; Maruyama, Shoichi; Sone, Michihiko; Takagi, Akira; Ikawa, Masahito; Okabe, Masaru; Kojima, Tetsuhito; Saito, Hidehiko; Naoe, Tomoki; Matsushita, Tadashi
2013-01-01
Nonmuscle myosin heavy chain IIA (NMMHCIIA) encoded by MYH9 is associated with autosomal dominantly inherited diseases called MYH9 disorders. MYH9 disorders are characterized by macrothrombocytopenia and very characteristic inclusion bodies in granulocytes. MYH9 disorders frequently cause nephritis, sensorineural hearing disability and cataracts. One of the most common and deleterious mutations causing these disorders is the R702C missense mutation. We generated knock-in mice expressing the Myh9 R702C mutation. R702C knock-in hetero mice (R702C+/- mice) showed macrothrombocytopenia. We studied megakaryopoiesis of cultured fetal liver cells of R702C+/- mice and found that proplatelet formation was impaired: the number of proplatelet tips was decreased, proplatelet size was increased, and proplatelet shafts were short and enlarged. Although granulocyte inclusion bodies were not visible by May-Grünwald Giemsa staining, immunofluorescence analysis indicated that NMMHCIIA proteins aggregated and accumulated in the granulocyte cytoplasm. In other organs, R702C+/- mice displayed albuminuria which increased with age. Renal pathology examination revealed glomerulosclerosis. Sensory hearing loss was indicated by lowered auditory brainstem response. These findings indicate that Myh9 R702C knock-in mice mirror features of human MYH9 disorders arising from the R702C mutation.
Natali, Andrea; Gastaldelli, Amalia; Camastra, Stefania; Baldi, Simona; Quagliarini, Fabiana; Minicocci, Ilenia; Bruno, Claudio; Pennisi, Elena; Arca, Marcello
2013-09-01
The role of adipose triglyceride lipase (ATGL) in intermediate substrates metabolism has not been fully elucidated in humans. Our objective was to evaluate the consequences of ATGL deficiency on body fat distribution, insulin sensitivity, fatty acids metabolism, and energy substrate utilization. Body composition and organ fat content were measured by bioimpedance and (1)H nuclear magnetic resonance spectroscopy; heart glucose metabolism by [(18)F]deoxyglucose positron emission tomography and insulin sensitivity and β-cell function by oral glucose tolerance and 2-step euglycemic-hyperinsulinemic clamp. Lipolysis ([(2)H5]glycerol turnover) and indirect calorimetry were evaluated at fasting, after oral glucose load, during the clamp, and also during an iv epinephrine infusion. These metabolic investigations were carried out during hospitalization. Three patients affected by neutral lipid storage disease with myopathy (NLSDM) due to homozygosity for loss-of-function mutations in the ATGL gene and 6 sex-, age-, and body mass index-matched controls were studied. As expected, NLSDM patients showed diffuse, although heterogeneous, fat infiltration in skeletal muscles associated with increased visceral fat. Although heart and liver were variably affected, fat content in the pancreas was increased in all patients. Compared with healthy controls, NLSDM patients showed impaired insulin response to glucose possibly related to the severe pancreatic steatosis, preserved whole-body insulin sensitivity, and a shift toward glucose metabolism in the heart. Fasting nonesterified fatty acid concentrations as well as basal lipolytic rates and the antilipolytic effect of insulin were normal in NLSDM patients, whereas the lipolytic effect of norepinephrine was impaired. Finally, no significant abnormality in the respiratory quotient was noted in NLSDM patients. In humans, ATGL has a remarkable effect on cellular lipid droplet handling, and its lack causes both perivisceral, skeletal
Bochnia, M.; Ziegler, J.; Sander, J.; Uhlig, A.; Schaefer, S.; Vollstedt, S.; Glatter, M.; Abel, S.; Recknagel, S.; Schusser, G. F.; Wensch-Dorendorf, M.; Zeyner, A.
2015-01-01
Hypoglycin A (HGA) in seeds of Acer spp. is suspected to cause seasonal pasture myopathy in North America and equine atypical myopathy (AM) in Europe, fatal diseases in horses on pasture. In previous studies, this suspicion was substantiated by the correlation of seed HGA content with the concentrations of toxic metabolites in urine and serum (MCPA-conjugates) of affected horses. However, seed sampling was conducted after rather than during an outbreak of the disease. The aim of this study was to further confirm the causality between HGA occurrence and disease outbreak by seed sampling during an outbreak and the determination of i) HGA in seeds and of ii) HGA and MCPA-conjugates in urine and serum of diseased horses. Furthermore, cograzing healthy horses, which were present on AM affected pastures, were also investigated. AM-pastures in Germany were visited to identify seeds of Acer pseudoplatanus and serum (n = 8) as well as urine (n = 6) from a total of 16 diseased horses were analyzed for amino acid composition by LC-ESI-MS/MS, with a special focus on the content of HGA. Additionally, the content of its toxic metabolite was measured in its conjugated form in body fluids (UPLC-MS/MS). The seeds contained 1.7–319.8 μg HGA/g seed. The content of HGA in serum of affected horses ranged from 387.8–8493.8 μg/L (controls horses on AM-pastures showed higher serum (108.8 ± 83.76 μg/L) and urine concentrations (26.9 ± 7.39 μg/L) compared to control horses, but lower concentrations compared to diseased horses. The range of MCPA-carnitine and creatinine concentrations found in diseased horses in serum and urine were 0.17–0.65 mmol/L (controls horses were higher compared to controls. Thus, the causal link between HGA intoxication and disease outbreak could be further substantiated, and the early detection of HGA in cograzing horses, which are clinically normal, might be a promising step in prophylaxis. PMID:26378918
Wellhoefer, Martin; Sprinzl, Wolfgang; Hahn, Rainer; Jungbauer, Alois
2013-12-06
An integrated process which combines continuous inclusion body dissolution with NaOH and continuous matrix-assisted refolding based on closed-loop simulated moving bed size exclusion chromatography was designed and experimentally evaluated at laboratory scale. Inclusion bodies from N(pro) fusion pep6His and N(pro) fusion MCP1 from high cell density fermentation were continuously dissolved with NaOH, filtered and mixed with concentrated refolding buffer prior to refolding by size exclusion chromatography (SEC). This process enabled an isocratic operation of the simulated moving bed (SMB) system with a closed-loop set-up with refolding buffer as the desorbent buffer and buffer recycling by concentrating the raffinate using tangential flow filtration. With this continuous refolding process, we increased the refolding and cleavage yield of both model proteins by 10% compared to batch dilution refolding. Furthermore, more than 99% of the refolding buffer of the raffinate could be recycled which reduced the buffer consumption significantly. Based on the actual refolding data, we compared throughput, productivity, and buffer consumption between two batch dilution refolding processes - one using urea for IB dissolution, the other one using NaOH for IB dissolution - and our continuous refolding process. The higher complexity of the continuous refolding process was rewarded with higher throughput and productivity as well as significantly lower buffer consumption compared to the batch dilution refolding processes. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sudhakar Veeranki
2015-01-01
Full Text Available Although hyperhomocysteinemia (HHcy elicits lower than normal body weights and skeletal muscle weakness, the mechanisms remain unclear. Despite the fact that HHcy-mediated enhancement in ROS and consequent damage to regulators of different cellular processes is relatively well established in other organs, the nature of such events is unknown in skeletal muscles. Previously, we reported that HHcy attenuation of PGC-1α and HIF-1α levels enhanced the likelihood of muscle atrophy and declined function after ischemia. In the current study, we examined muscle levels of homocysteine (Hcy metabolizing enzymes, anti-oxidant capacity and focused on protein modifications that might compromise PGC-1α function during ischemic angiogenesis. Although skeletal muscles express the key enzyme (MTHFR that participates in re-methylation of Hcy into methionine, lack of trans-sulfuration enzymes (CBS and CSE make skeletal muscles more susceptible to the HHcy-induced myopathy. Our study indicates that elevated Hcy levels in the CBS−/+ mouse skeletal muscles caused diminished anti-oxidant capacity and contributed to enhanced total protein as well as PGC-1α specific nitrotyrosylation after ischemia. Furthermore, in the presence of NO donor SNP, either homocysteine (Hcy or its cyclized version, Hcy thiolactone, not only increased PGC-1α specific protein nitrotyrosylation but also reduced its association with PPARγ in C2C12 cells. Altogether these results suggest that HHcy exerts its myopathic effects via reduction of the PGC-1/PPARγ axis after ischemia.
DEFF Research Database (Denmark)
Citirak, Gülsenay; Witting, Nanna; Duno, Morten
2014-01-01
, two related female patients and two sporadic, male patients were found to carry mutations in the tropomyosin 2 (TPM2) and tropomyosin 3 (TPM3) genes, respectively. This indicates a low (4.3%) frequency of TPM2 and TPM3 mutations as a cause of congenital myopathy. Compared to previously described...... patients carrying the same mutations as found in our study (c.503G>A, and c.502C>T in TPM3, and c.415_417delGAG in TPM2), clinical presentation and muscle morphological findings differed in our patients. Differences included variation in distribution of muscle weakness, presence of scoliosis and ptosis...... had nemaline myopathy and fiber size disproportion, while three patients had congenital fiber type disproportion (CFTD) on muscle biopsies. TPM2-related CFTD has only been described in two cases, indicating that mutations in TPM2 are rare causes of CFTD....
Cacciottolo, M; Nogalska, A; D'Agostino, C; Engel, W K; Askanas, V
2013-12-01
Sporadic inclusion-body myositis (s-IBM) is an age-associated degenerative muscle disease. Characteristic features are muscle-fibre vacuolization and intramuscle-fibre accumulations of multiprotein aggregates, which may result from the demonstrated impairments of the 26S proteasome and autophagy. Chaperone-mediated autophagy (CMA) is a selective form of lysosomal degradation targeting proteins carrying the KFERQ motif. Lysosome-associated membrane protein type 2A (LAMP2A) and the heat-shock cognate protein 70 (Hsc70) constitute specific CMA components. Neither CMA components nor CMA activity has been studied in normal or disease human muscle, to our knowledge. We studied CMA components by immunocytochemistry, immunoblots, real-time PCR and immunoprecipitation in: (a) 16 s-IBM, nine aged-matched normal and nine disease control muscle biopsies; and (b) cultured human muscle fibres (CHMFs) with experimentally inhibited activities of either the 26S proteasome or autophagy. Compared with age-matched controls, in s-IBM muscle, LAMP2A and Hsc70 were on a given transverse section accumulated as aggregates in approximately 5% of muscle fibres, where they (a) colocalized with each other and α-synuclein (α-syn), a CMA-targeted protein; and (b) were bound to each other and to α-syn by immunoprecipitation. By immunoblots, LAMP2A was increased sevenfold P pathogenic aspect in s-IBM. © 2013 British Neuropathological Society.
Chen, J; Hong, D; Wang, Z; Yuan, Y
2010-01-01
Neutral lipid storage disease with myopathy (NLSDM) is a type of lipid storage myopathy arising due to a mutation in the PNPLA2 gene encoding an adipose triglyceride lipase responsible for the degradation of intracellular triglycerides. Herein, we report the cases of two siblings manifesting slowly progressive proximal and distal limb weakness in adulthood. One of the patients had dilated cardiomyopathy, hearing loss and short stature. Muscle specimens of the 2 patients revealed muscular dystrophic features with massive lipid droplets and numerous rimmed vacuoles in the fibers. A novel homozygous mutation IVS2+1G > A in the PNPLA2 gene was identified in the 2 cases, but not in the healthy familial individuals. The presence of massive lipid droplets with muscular dystrophic changes and rimmed vacuoles in muscle fibers might be one of the characteristic pathological changes of NLSDM.
Bai, Yuxiang; van der Kaaij, Rachel Maria; Woortman, Albert Jan Jacob; Jin, Zhengyu; Dijkhuizen, Lubbert
2015-06-09
The GTFB enzyme of the probiotic bacterium Lactobacillus reuteri 121 is a 4,6-α-glucanotransferase of glycoside hydrolase family 70 (GH70; http://www.cazy.org ). Contrary to the glucansucrases in GH70, GTFB is unable to use sucrose as substrate, but instead converts malto-oligosaccharides and starch into isomalto-/malto- polymers that may find application as prebiotics and dietary fibers. The GTFB enzyme expresses well in Escherichia coli BL21 Star (DE3), but mostly accumulates in inclusion bodies (IBs) which generally contain wrongly folded protein and inactive enzyme. Denaturation followed by refolding, as well as ncIB preparation were used for isolation of active GTFB protein from inclusion bodies. Soluble, refolded and ncIB GTFB were compared using activity assays, secondary structure analysis by FT-IR, and product analyses by NMR, HPAEC and SEC. Expression of GTFB in E. coli yielded > 100 mg/l relatively pure and active but mostly insoluble GTFB protein in IBs, regardless of the expression conditions used. Following denaturing, refolding of GTFB protein was most efficient in double distilled H2O. Also, GTFB ncIBs were active, with approx. 10 % of hydrolysis activity compared to the soluble protein. When expressed as units of activity obtained per liter E. coli culture, the total amount of ncIB GTFB expressed possessed around 180 % hydrolysis activity and 100 % transferase activity compared to the amount of soluble GTFB enzyme obtained from one liter culture. The product profiles obtained for the three GTFB enzyme preparations were similar when analyzed by HPAEC and NMR. SEC investigation also showed that these 3 enzyme preparations yielded products with similar size distributions. FT-IR analysis revealed extended β-sheet formation in ncIB GTFB providing an explanation at the molecular level for reduced GTFB activity in ncIBs. The thermostability of ncIB GTFB was relatively high compared to the soluble and refolded GTFB. In view of their relatively high yield
Idiopathic inflammatory myopathies and the lung
Directory of Open Access Journals (Sweden)
Jean-Christophe Lega
2015-06-01
Full Text Available Idiopathic inflammatory myositis (IIM is a group of rare connective tissue diseases (CTDs characterised by muscular and extramuscular signs, in which lung involvement is a challenging issue. Interstitial lung disease (ILD is the hallmark of pulmonary involvement in IIM, and causes morbidity and mortality, resulting in an estimated excess mortality of 50% in some series. Except for inclusion body myositis, these extrapulmonary disorders are associated with the general and visceral involvement frequently found in other CTDs including fever, Raynaud's phenomenon, arthralgia, nonspecific cutaneous modifications and ILD, for which the prevalence is estimated to be up to 65%. Substantial heterogeneity exists within the spectrum of IIMs, and each condition is associated with various frequencies and subtypes of pulmonary involvement. This heterogeneity is partly related to the presence of various autoantibodies encompassing anti-synthetase, anti-MDA5 and anti-PM/Scl. ILD is present in all subsets of IIM including juvenile myositis, but is more frequent in dermatomyositis and overlap myositis. IIM can also be associated with other presentations of respiratory involvement, namely pulmonary arterial hypertension, pleural disease, infections, drug-induced toxicity, malignancy and respiratory muscle weakness. Here, we critically review the current knowledge about adult and juvenile myositis-associated lung disease with a detailed description of therapeutics for chronic and rapidly progressive ILD.
Wholistic and Ethical: Social Inclusion with Indigenous Peoples
Directory of Open Access Journals (Sweden)
Kathleen E. Absolon
2016-02-01
Full Text Available This paper begins with a poem and is inclusive of my voice as Anishinaabekwe (Ojibway woman and is authored from my spirit, heart, mind and body. The idea of social inclusion and Indigenous peoples leave more to the imagination and vision than what is the reality and actuality in Canada. This article begins with my location followed with skepticism and hope. Skepticism deals with the exclusion of Indigenous peoples since colonial contact and the subsequent challenges and impacts. Hope begins to affirm the possibilities, strengths and Indigenous knowledge that guides wholistic cultural frameworks and ethics of social inclusion. A wholistic cultural framework is presented; guided by seven sacred teachings and from each element thoughts for consideration are guided by Indigenous values and principles. From each element this paper presents a wholistic and ethical perspective in approaching social inclusion and Indigenous peoples.
International Nuclear Information System (INIS)
Sone, Shinsuke
1989-01-01
It has recently been demonstrated that several 99m Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of 99m Tc-methylendiphosphonate ( 99m Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of 99m Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of 99m Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of 99m Tc-MDP reflects the early degenerative changes of skeletal muscle. (author)
Sporadic late-onset nemaline myopathy with MGUS: long-term follow-up after melphalan and SCT.
Voermans, Nicol C; Benveniste, Olivier; Minnema, Monique C; Lokhorst, Henk; Lammens, Martin; Meersseman, Wouter; Delforge, Michel; Kuntzer, Thierry; Novy, Jan; Pabst, Thomas; Bouhour, Françoise; Romero, Norma; Leblond, Veronique; Bergh, Peter van den; Vekemans, Marie-Christiane; van Engelen, Baziel G; Eymard, Bruno
2014-12-02
Sporadic late-onset nemaline myopathy (SLONM) is a rare, late-onset myopathy that progresses subacutely. If associated with a monoclonal gammopathy of unknown significance (MGUS), the outcome is unfavorable: the majority of these patients die within 1 to 5 years of respiratory failure. This study aims to qualitatively assess the long-term treatment effect of high-dose melphalan (HDM) followed by autologous stem cell transplantation (SCT) in a series of 8 patients with SLONM-MGUS. We performed a retrospective case series study (n = 8) on the long-term (1-8 years) treatment effect of HDM followed by autologous SCT (HDM-SCT) on survival, muscle strength, and functional capacities. Seven patients showed a lasting moderate-good clinical response, 2 of them after the second HDM-SCT. All of them had a complete, a very good partial, or a partial hematologic response. One patient showed no clinical or hematologic response and died. This case series shows the positive effect of HDM-SCT in this rare disorder. Factors that may portend an unfavorable outcome are a long disease course before the hematologic treatment and a poor hematologic response. Age at onset, level and type of M protein (κ vs λ), and severity of muscle weakness were not associated with a specific outcome. This study provides Class IV evidence that for patients with SLONM-MGUS, HDM-SCT increases the probability of survival and functional improvement. © 2014 American Academy of Neurology.
Missaglia, Sara; Maggi, Lorenzo; Mora, Marina; Gibertini, Sara; Blasevich, Flavia; Agostoni, Piergiuseppe; Moro, Laura; Cassandrini, Denise; Santorelli, Filippo Maria; Gerevini, Simonetta; Tavian, Daniela
2017-05-01
Neutral lipid storage disease with myopathy (NLSDM) presents with skeletal muscle myopathy and severe dilated cardiomyopathy in nearly 40% of cases. NLSDM is caused by mutations in the PNPLA2 gene, which encodes the adipose triglyceride lipase (ATGL). Here we report clinical and genetic findings of a patient carrying two novel PNPLA2 mutations (c.696+4A>G and c.553_565delGTCCCCCTTCTCG). She presented at age 39 with right upper limb abduction weakness slowly progressing over the years with asymmetric involvement of proximal upper and lower limb muscles. Cardiological evaluation through ECG and heart echo scan was normal until the age 53, when mild left ventricular diastolic dysfunction was detected. Molecular analysis revealed that only one type of PNPLA2 transcript, with exon 5 skipping, was expressed in patient cells. Such aberrant mRNA causes the production of a shorter ATGL protein, lacking part of the catalytic domain. This is an intriguing case, displaying severe PNPLA2 mutations with clinical presentation characterized by slight cardiac impairment and full expression of severe asymmetric myopathy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rivkees ScottA
2010-08-01
Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal
X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.
Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H
1990-01-01
We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...
Energy Technology Data Exchange (ETDEWEB)
Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)
2017-12-15
Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen
Social inclusion and inclusive education
Directory of Open Access Journals (Sweden)
Marsela Robo
2014-07-01
In line with global debate on social inclusion and exclusion, the author brings the way this debate has now pervaded both the official and development policy discourse in Albania.Social inclusion is considered as one of the priorities of the current government, with poverty reduction as its main focus, which will be ensured not only through economic development. In the end, the article focuses on the role of education as a very important and useful tool for ensuring social inclusion.Social inclusion through education, in particular through vocational education, considered by the author as the only way towards sustainable development of Albanian society.
A young lady with swelling and stiffness of calf muscles
Directory of Open Access Journals (Sweden)
H S Kiran
2011-01-01
Full Text Available Hypothyroidism causes a variety of changes in the body. Though uncommon, hypothyroidism can present as myopathy. Hoffman′s syndrome is a specific, rare form of hypothyroid myopathy, which causes proximal weakness and pseudohypertrophy of muscles.
DEFF Research Database (Denmark)
Olsen, Rikke Katrine Jentoft; Pourfarzam, M; Morris, A A M
2004-01-01
response to treatment, she developed respiratory insufficiency at age 14 years and has required long-term overnight ventilation. Thus, MADD is one of the few conditions that can cause a myopathy with weakness of the respiratory muscles out of proportion to the limb muscles. Udgivelsesdato: 2004-null...
Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W
1998-01-01
Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...
Controlling inclusions through filtration in investment casting process
International Nuclear Information System (INIS)
Ahmad, R.; Marshall, R.I.
2004-01-01
A technique for the placement of a ceramic foam filter in the feeding up of investment mould was developed which proved quite efficient in removing smaller and major inclusions through various filtration modes. Contaminated old aluminum scrap was used to prepare the melt without the addition of any cleansing and covering fluxes and the main reason was to produce more and more inclusions. Vigorous stirring was also intentionally carried out to form as much oxides as possible. During present research work effective filtration was observed. No leakage through sides of the filter occurred and similarly no choking was seen during feeding of molten metal. Microstructural studies showed the maximum retention of inclusions not only on the surface of filters but also within the various channels of the main body of the filter. The microstructures taken from the filtered test pieces were free from inclusions, which showed the effectiveness and proper placement of the filter. (author)
Espinosa-de la Garza, Carlos E; Perdomo-Abúndez, Francisco C; Campos-García, Víctor R; Pérez, Néstor O; Flores-Ortiz, Luis F; Medina-Rivero, Emilio
2013-09-01
In this work, a high-resolution CGE method for quantification and purity determination of recombinant proteins was developed, involving a single-component inclusion bodies (IBs) solubilization solution. Different recombinant proteins expressed as IBs were used to show method capabilities, using recombinant interferon-β 1b as the model protein for method validation. Method linearity was verified in the range from 0.05 to 0.40 mg/mL and a determination coefficient (r(2) ) of 0.99 was obtained. The LOQs and LODs were 0.018 and 0.006 mg/mL, respectively. RSD for protein content repeatability test was 2.29%. In addition, RSD for protein purity repeatability test was 4.24%. Method accuracy was higher than 90%. Specificity was confirmed, as the method was able to separate recombinant interferon-β 1b monomer from other aggregates and impurities. Sample content and purity was demonstrated to be stable for up to 48 h. Overall, this method is suitable for the analysis of recombinant proteins in IBs according to the attributes established on the International Conference for Harmonization guidelines. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Characterization of a Fe inclusion in beryllium-matrix using auger electron spectroscopy
International Nuclear Information System (INIS)
Arkusk, R.; Moreno, D.; Simca, F.; Yeheskel, O.; Utzmoni, U.
1991-04-01
The auger electron spectroscopy techniques was employed to investigate the nature of an inclusion that had been revealed by radiography in a beryllium body produced by the hot isostatic press technique. The investigation's are that the inclusion is composed of several different iron-beryllium intermetallic compounds (BeFe 3 , BeFe 5 , Be 7 Fe). The conclusion drawn is that iron metal impurity was imbedded in the Be powder and that interdiffusion under the process's conditions gave rise to the enlarged inclusion. (author)
Acylcarnitines profile best predicts survival in horses with atypical myopathy.
Directory of Open Access Journals (Sweden)
François Boemer
Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.
Acylcarnitines profile best predicts survival in horses with atypical myopathy
Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie
2017-01-01
Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683
Directory of Open Access Journals (Sweden)
Andriy V. Shatillo
2014-12-01
Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC
Energy Technology Data Exchange (ETDEWEB)
Sone, Shinsuke
1989-02-01
It has recently been demonstrated that several /sup 99m/Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of /sup 99m/Tc-methylendiphosphonate (/sup 99m/Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of /sup 99m/Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of /sup 99m/Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of /sup 99m/Tc-MDP reflects the early degenerative changes of skeletal muscle.
Directory of Open Access Journals (Sweden)
Teet Seene
2016-05-01
Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.
Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion
2018-05-04
Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.
Directory of Open Access Journals (Sweden)
Vincent Lepori
2018-05-01
Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.
LENUS (Irish Health Repository)
Thabit, Hood
2011-05-13
Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.
Directory of Open Access Journals (Sweden)
Sreenan Seamus
2011-05-01
Full Text Available Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.
LENUS (Irish Health Repository)
Thabit, Hood
2012-02-01
INTRODUCTION: Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. CASE PRESENTATIONS: We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. CONCLUSION: These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.
COMPOSITION OF FOWLPOX VIRUS AND INCLUSION MATRIX.
RANDALL, C C; GAFFORD, L G; DARLINGTON, R W; HYDE, J
1964-04-01
Randall, Charles C. (University of Mississippi School of Medicine, Jackson), Lanelle G. Gafford, Robert W. Darlington, and James M. Hyde. Composition of fowlpox virus and inclusion matrix. J. Bacteriol. 87:939-944. 1964.-Inclusion bodies of fowlpox virus infection are especially favorable starting material for the isolation of virus and inclusion matrix. Electron micrographs of viral particles and matrix indicated a high degree of purification. Density-gradient centrifugation of virus in cesium chloride and potassium tartrate was unsatisfactory because of inactivation, and clumping or disintegration. Chemical analyses of virus and matrix revealed significant amounts of lipid, protein, and deoxyribonucleic acid, but no ribonucleic acid or carbohydrate. Approximately 47% of the weight of the virus and 83% of the matrix were extractable in chloroform-methanol. The lipid partitions of the petroleum ether extracts were similar, except that the phospholipid content of the matrix was 2.2 times that of the virus. Viral particles were sensitive to diethyl ether and chloroform.
Mitsuhashi, Wataru; Asano, Shoji; Miyamoto, Kazuhisa; Wada, Sanae
2014-01-01
Entomopoxviruses (EVs) form two types of inclusion body: spheroids, which contain virions, and spindles, which do not. The authors tested whether the spindles from a coleopteran EV, Anomala cuprea EV (ACEV), enhanced the insecticidal activity of a commercial Bacillus thuringiensis (Bt) formulation and the susceptibility of scarabaeid pest species in Japan to the virus's spheroids, to assess whether ACEV inclusion bodies are potential biological control agents for pest insects. Peroral inoculation with both ACEV spindles and the Bt toxin only or the complete Bt formulation shortened the survival and increased the mortality of treated insects compared with those of insects inoculated with Bt without the spindles (8-38 h of decrease in LT50 values among assays). ACEV showed high infectivity to a major scarabaeid pest species in Japanese sugar cane fields. The results suggest that spindles or the constituent protein fusolin can be used as a coagent with Bt formulations, and that fusolin coexpression with a Bt toxin in crops might improve the insecticidal efficacy. In addition, the spheroids are potential biocontrol agents for some scarabaeid pests that are not easy to control because of their underground habitation. © 2013 Society of Chemical Industry.
Whole-body intravoxel incoherent motion imaging
Energy Technology Data Exchange (ETDEWEB)
Filli, Lukas; Wurnig, Moritz C.; Eberhardt, Christian; Guggenberger, Roman; Boss, Andreas [University Hospital Zurich, Department of Radiology, Zurich (Switzerland); Luechinger, Roger [University and ETH Zurich, Institute of Biomedical Technology, Zurich (Switzerland)
2015-07-15
To investigate the technical feasibility of whole-body intravoxel incoherent motion (IVIM) imaging. Whole-body MR images of eight healthy volunteers were acquired at 3T using a spin-echo echo-planar imaging sequence with eight b-values. Coronal parametrical whole-body maps of diffusion (D), pseudodiffusion (D*), and the perfusion fraction (F{sub p}) were calculated. Image quality was rated qualitatively by two independent radiologists, and inter-reader reliability was tested with intra-class correlation coefficients (ICCs). Region of interest (ROI) analysis was performed in the brain, liver, kidney, and erector spinae muscle. Depiction of anatomic structures was rated as good on D maps and good to fair on D* and F{sub p} maps. Exemplary mean D (10{sup -3} mm{sup 2}/s), D* (10{sup -3} mm{sup 2}/s) and F{sub p} (%) values (± standard deviation) of the renal cortex were as follows: 1.7 ± 0.2; 15.6 ± 6.5; 20.9 ± 4.4. Inter-observer agreement was ''substantial'' to ''almost perfect'' (ICC = 0.80 - 0.92). The coefficient of variation of D* was significantly lower with the proposed algorithm compared to the conventional algorithm (p < 0.001), indicating higher stability. The proposed IVIM protocol allows computation of parametrical maps with good to fair image quality. Potential future clinical applications may include characterization of widespread disease such as metastatic tumours or inflammatory myopathies. (orig.)
Directory of Open Access Journals (Sweden)
D. A. Sychev
2015-09-01
Full Text Available The clinical significance of the SLCO1B1 gene polymorphism (encoding an organic anion transport polipeptide in the development of statin induced myopathy is considered. Possible tactics of statin dose determination on the basis of pharmacogenetic testing is discussed. Indications for the use of this approach in clinical practice that should increase the efficacy and safety of the statin therapy are also considered.
Measuring Nurse Educators' Willingness to Adopt Inclusive Teaching Strategies.
Levey, Janet A
The purpose of the study was to examine the characteristics and relationships of nurse educators' teaching practices, knowledge, support, and willingness to adopt inclusive teaching strategies (WillAdITS). Adopting more inclusive teaching strategies based on universal design for instruction is an innovative way for educators to reach today's diverse student body. However, the pedagogy has not diffused into nursing education. Descriptive statistics and hierarchical multiple regression were used for analyzing data from 311 nurse educators in prelicensure and RN to BSN programs. The model explained 44.8 percent of the variance in WillAdITS. The best indicators for this pedagogy were knowledge of universal design for instruction, social system support for inclusive teaching strategies, multiple instructional formats, and years of teaching. Knowing factors influencing the adoption of inclusive teaching strategies can inform schools of nursing of areas needing further development in the preparation of novice to experienced educators to teach diverse learners.
International Nuclear Information System (INIS)
Foster, L.J.R.; Holden, P.J.; Garvey, C.J.; Russell, R.A.; Stone, D.J.M.
2003-01-01
Full text: Polyhydroxyalkanoates (PHAs) are a diverse family of bacterially produced biopolyesters. Their biodegradability, and in some cases biocompatibility, suggest applications ranging from bioplastics to biomedical implantation devices. Despite extensive interest in their production and potential applications, little is known about their intracellular organisation. Microbial PHAs are synthesised by microorganisms under conditions of nutrient stress and can comprise up to 90% of the dry cell mass. The formation and organisation of these PHA inclusion bodies requires clarification. Such investigations have important implications for the biotechnological production of PHAs in microbes and other organisms, for downstream processing and in vitro precision polymerisation. Morphological and biochemical evidence supports two different models for the intracellular organisation of PHAs. Steinbuchel and coworkers propose a simple model of amorphous PHA enclosed by a single protein membrane consisting of structural proteins (PHAsins) and enzymes responsible for synthesis and degradation. In contrast, Fuller and coworkers have theorised a more complex system of PHA encompassed by a PHAsin bilayer separated by phospholipid. The polymerase and depolymerase enzymes are proposed to be associated with an incomplete inner PHAsin layer. It may be that such models are genera or species specific, since both proposals were derived from research on different species producing different types of PHA. Our initial investigations have focussed on in vivo deuteration of polyhydroxyoctanoate, produced by Pseudomonas oleovorans, both in fermentation on natural and deuterated substrates and during Small Angle Neutron Scattering by whole cells using AUSANS. The nature of the structural questions and our preliminary findings including contrast variation data will be discussed