WorldWideScience

Sample records for included kaplan-meier curves

  1. About an adaptively weighted Kaplan-Meier estimate.

    Science.gov (United States)

    Plante, Jean-François

    2009-09-01

    The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.

  2. The Kaplan-Meier Theatre

    Science.gov (United States)

    Gerds, Thomas A.

    2016-01-01

    Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.

  3. Competing risk bias was common in Kaplan-Meier risk estimates published in prominent medical journals.

    Science.gov (United States)

    van Walraven, Carl; McAlister, Finlay A

    2016-01-01

    Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Understanding survival analysis: Kaplan-Meier estimate.

    Science.gov (United States)

    Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal

    2010-10-01

    Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.

  5. Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A

    2015-11-01

    Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and

  6. The Kaplan-Meier Integral in the Presence of Covariates

    DEFF Research Database (Denmark)

    Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis

    2017-01-01

    In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...

  7. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves.

    Science.gov (United States)

    Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J

    2012-02-01

    The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  8. Modified Weighted Kaplan-Meier Estimator

    Directory of Open Access Journals (Sweden)

    Mohammad Shafiq

    2007-01-01

    Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.

  9. Kaplan-Meier survival analysis overestimates cumulative incidence of health-related events in competing risk settings: a meta-analysis.

    Science.gov (United States)

    Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A

    2018-01-01

    Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Enhanced secondary analysis of survival data: reconstructing the data from published Kaplan-Meier survival curves

    Directory of Open Access Journals (Sweden)

    Guyot Patricia

    2012-02-01

    Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.

  11. The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method

    NARCIS (Netherlands)

    Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia

    2011-01-01

    Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the

  12. A versatile test for equality of two survival functions based on weighted differences of Kaplan-Meier curves.

    Science.gov (United States)

    Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J

    2015-12-10

    With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.

  13. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    International Nuclear Information System (INIS)

    Mould, Richard F.

    1995-01-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method

  14. Biostatistics with emphasis on life table survival rate calculations (including Kaplan Meier) and the logrank test

    Energy Technology Data Exchange (ETDEWEB)

    Mould, Richard F

    1995-07-01

    Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.

  15. The Kaplan-Meier theatre

    DEFF Research Database (Denmark)

    Gerds, Thomas Alexander

    2016-01-01

    Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...

  16. Application of Kaplan-Meier analysis in reliability evaluation of products cast from aluminium alloys

    OpenAIRE

    J. Szymszal; A. Gierek; J. Kliś

    2010-01-01

    The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...

  17. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  18. KMWin--a convenient tool for graphical presentation of results from Kaplan-Meier survival time analysis.

    Directory of Open Access Journals (Sweden)

    Arnd Gross

    Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.

  19. Verification of Kaplan turbine cam curves realization accuracy at power plant

    Directory of Open Access Journals (Sweden)

    Džepčeski Dane

    2016-01-01

    Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.

  20. KMWin – A Convenient Tool for Graphical Presentation of Results from Kaplan-Meier Survival Time Analysis

    Science.gov (United States)

    Gross, Arnd; Ziepert, Marita; Scholz, Markus

    2012-01-01

    Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912

  1. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    International Nuclear Information System (INIS)

    Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.

    1996-01-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs

  2. Gastric emptying of solids in humans: improved evaluation by Kaplan-Meier plots, with special reference to obesity and gender

    Energy Technology Data Exchange (ETDEWEB)

    Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)

    1996-12-01

    It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.

  3. Bias and precision of methods for estimating the difference in restricted mean survival time from an individual patient data meta-analysis

    Directory of Open Access Journals (Sweden)

    Béranger Lueza

    2016-03-01

    Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect

  4. Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

    Science.gov (United States)

    2017-08-01

    28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival

  5. RBPJ and EphrinB2 as Molecular Targets to Treat Brain Arteriovenous Malformation in Notch4 Induced Mouse Model

    Science.gov (United States)

    2017-10-01

    of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to

  6. Third-line Targeted Therapy in Metastatic Renal Cell Carcinoma: Results from the International Metastatic Renal Cell Carcinoma Database Consortium

    DEFF Research Database (Denmark)

    Wells, J Connor; Stukalin, Igor; Norton, Craig

    2017-01-01

    and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...

  7. Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

    Directory of Open Access Journals (Sweden)

    Jie Zhao

    2015-01-01

    Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.

  8. C-reactive protein-to-albumin ratio is a predictor of hepatitis B virus related decompensated cirrhosis: time-dependent receiver operating characteristics and decision curve analysis.

    Science.gov (United States)

    Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing

    2017-04-01

    Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.

  9. A review and comparison of methods for recreating individual patient data from published Kaplan-Meier survival curves for economic evaluations: a simulation study.

    Science.gov (United States)

    Wan, Xiaomin; Peng, Liubao; Li, Yuanjian

    2015-01-01

    In general, the individual patient-level data (IPD) collected in clinical trials are not available to independent researchers to conduct economic evaluations; researchers only have access to published survival curves and summary statistics. Thus, methods that use published survival curves and summary statistics to reproduce statistics for economic evaluations are essential. Four methods have been identified: two traditional methods 1) least squares method, 2) graphical method; and two recently proposed methods by 3) Hoyle and Henley, 4) Guyot et al. The four methods were first individually reviewed and subsequently assessed regarding their abilities to estimate mean survival through a simulation study. A number of different scenarios were developed that comprised combinations of various sample sizes, censoring rates and parametric survival distributions. One thousand simulated survival datasets were generated for each scenario, and all methods were applied to actual IPD. The uncertainty in the estimate of mean survival time was also captured. All methods provided accurate estimates of the mean survival time when the sample size was 500 and a Weibull distribution was used. When the sample size was 100 and the Weibull distribution was used, the Guyot et al. method was almost as accurate as the Hoyle and Henley method; however, more biases were identified in the traditional methods. When a lognormal distribution was used, the Guyot et al. method generated noticeably less bias and a more accurate uncertainty compared with the Hoyle and Henley method. The traditional methods should not be preferred because of their remarkable overestimation. When the Weibull distribution was used for a fitted model, the Guyot et al. method was almost as accurate as the Hoyle and Henley method. However, if the lognormal distribution was used, the Guyot et al. method was less biased compared with the Hoyle and Henley method.

  10. Applying Kaplan-Meier to Item Response Data

    Science.gov (United States)

    McNeish, Daniel

    2018-01-01

    Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…

  11. Deciphering the Adaptive Immune Response to Ovarian Cancer

    Science.gov (United States)

    2013-10-01

    positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By KaplanMeier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, KaplanMeier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor

  12. Kaplan SpellRead. What Works Clearinghouse Intervention Report

    Science.gov (United States)

    What Works Clearinghouse, 2007

    2007-01-01

    "Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…

  13. Meier-Gorlin syndrome

    NARCIS (Netherlands)

    Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

  14. Interview with Danny Kaplan

    Science.gov (United States)

    Rossman, Allan; Kaplan, Danny

    2017-01-01

    Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…

  15. Meier-Gorlin syndrome

    OpenAIRE

    de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...

  16. Dose-response curves from incomplete data

    International Nuclear Information System (INIS)

    Groer, P.G.

    1978-01-01

    Frequently many different responses occur in populations (animal or human) exposed to ionizing radiation. To obtain a dose-response curve, the exposed population is first divided into sub-groups whose members received the same radiation dose. To estimate the response, the fraction of subjects in each sub-group that showed the particular response of interest is determined. These fractions are plotted against dose to give the dose-response curve. This procedure of plotting the fractions versus the radiation dose is not the correct way to estimate the time distribution for a particular response at the different dose levels. Other observed responses competed for the individuals in the exposed population and therefore prevented manifestation of the complete information on the response-time distribution for one specific response. Such data are called incomplete in the statistical literature. A procedure is described which uses the by now classical Kaplan-Meier estimator, to establish dose-response curves from incomplete data under the assumption that the different observed responses are statistically independent. It is demonstrated that there is insufficient information in the observed survival functions to estimate the time distribution for one particular response if the assumption of independence is dropped. In addition, it is not possible to determine from the data (i.e. type of response and when it occurred) whether or not the different response-time distributions are independent. However, it is possible to give sharp bounds between which the response has to lie. This implies that for incomplete data, only a 'dose-response band' can be established if independence of the competing responses cannot be assumed. Examples are given using actual data to illustrate the estimation procedures

  17. Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study

    DEFF Research Database (Denmark)

    Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars

    2015-01-01

    patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...

  18. Maternal smoking during pregnancy and the risk of pediatric cardiovascular diseases of the offspring: A population-based cohort study with up to 18-years of follow up.

    Science.gov (United States)

    Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal

    2018-06-01

    Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Analyzing survival curves at a fixed point in time for paired and clustered right-censored data

    Science.gov (United States)

    Su, Pei-Fang; Chi, Yunchan; Lee, Chun-Yi; Shyr, Yu; Liao, Yi-De

    2018-01-01

    In clinical trials, information about certain time points may be of interest in making decisions about treatment effectiveness. Rather than comparing entire survival curves, researchers can focus on the comparison at fixed time points that may have a clinical utility for patients. For two independent samples of right-censored data, Klein et al. (2007) compared survival probabilities at a fixed time point by studying a number of tests based on some transformations of the Kaplan-Meier estimators of the survival function. However, to compare the survival probabilities at a fixed time point for paired right-censored data or clustered right-censored data, their approach would need to be modified. In this paper, we extend the statistics to accommodate the possible within-paired correlation and within-clustered correlation, respectively. We use simulation studies to present comparative results. Finally, we illustrate the implementation of these methods using two real data sets. PMID:29456280

  20. Age at sexual initiation and factors associated with it among youths ...

    African Journals Online (AJOL)

    Bernt Lindtjorn

    Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.

  1. Epilepsy in Rett syndrome--lessons from the Rett networked database

    DEFF Research Database (Denmark)

    Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori

    2015-01-01

    collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...

  2. Genetics Home Reference: Meier-Gorlin syndrome

    Science.gov (United States)

    ... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...

  3. Birth interval and its predictors among married women in Dabat ...

    African Journals Online (AJOL)

    2008-12-30

    Birth intervals (time between two successive live births) if short are associated with diverse complications. We assessed birth interval and its predictors among 613 married women who gave birth from January 1 to December 30, 2008. Data were collected in April 2012. Life table and Kaplan-Meier curve were used to ...

  4. Reporting of loss to follow-up information in randomised controlled trials with time-to-event outcomes: a literature survey

    Directory of Open Access Journals (Sweden)

    Bender Ralf

    2011-09-01

    Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.

  5. Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System

    Science.gov (United States)

    Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola

    2011-01-01

    Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…

  6. Role of IKK-alpha in the EGFR Signaling Regulation

    Science.gov (United States)

    2014-09-01

    expression. (E) Kaplan -Meier overall survival curves of IKKin breast cancer patient data set. 16 Reference 1. Lo, H. W., Xia, W., Wei, Y...150- 100- 50- 150- 100- Twist1 AKT1-p AKT-T C 250- 150- 100- N-cad P1 P2 P3 TGFβ - - - + + - + + - - + - - + + + - - + - - + + + 50- Vimentin 150- 100

  7. MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY

    OpenAIRE

    Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar

    2016-01-01

    Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...

  8. Persistent fatigue in young athletes: measuring the clinical course and identifying variables affecting clinical recovery.

    Science.gov (United States)

    Locke, S; Osborne, M; O'Rourke, P

    2011-02-01

    The objective of this paper is to measure the clinical course (months) in young athletes with persistent fatigue and to identify any covariates affecting the duration of recovery. This was a prospective longitudinal study of 68 athletes; 87% were elite (42 males, 26 females), aged 20.5±3.74 years (SD), who presented with the symptom of persistent fatigue. The collective duration to full clinical recovery was estimated using Kaplan-Meier product-limit curves, and covariates associated with prolonging recovery were identified from Cox proportional hazard models. The median recovery was 5 months (range 1-60 months). The range of presenting symptom duration was 0.5-36 months. The covariates identified were an increased duration of presenting symptoms [hazard ratio (HR), 1.06; 95% confidence interval (CI), 1.02-1.12; P=0.005] and the response of serum cortisol concentration to a standard exercise challenge (HR, 1.92; 95% CI, 1.09-3.38; P=0.03). Delay in recovery was not associated with categories of fatigue that included medical, training-related diagnoses, or other causes. In conclusion, the fatigued athlete represents a significant clinical problem with a median recovery of 5 months, whose collective clinical course to recovery can be estimated by Kaplan-Meier curves and appears to be a continuum. © 2009 John Wiley & Sons A/S.

  9. Análisis de supervivencia en presencia de riesgos competitivos: estimadores de la probabilidad de suceso Survival analysis with competing risks: estimating failure probability

    Directory of Open Access Journals (Sweden)

    Javier Llorca

    2004-10-01

    Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

  10. [Survival analysis with competing risks: estimating failure probability].

    Science.gov (United States)

    Llorca, Javier; Delgado-Rodríguez, Miguel

    2004-01-01

    To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.

  11. Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

    International Nuclear Information System (INIS)

    Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H

    2012-01-01

    The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

  12. Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet

    Science.gov (United States)

    Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.

    2012-11-01

    The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.

  13. Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer

    DEFF Research Database (Denmark)

    Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim

    2017-01-01

    OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...

  14. Meier-Gorlin syndrome Clinical genetics and genomics

    NARCIS (Netherlands)

    S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)

    2015-01-01

    textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia

  15. Meier-Gorlin syndrome Clinical genetics and genomics

    NARCIS (Netherlands)

    De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf

    2015-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females

  16. Optimization of Kaplan turbines. A contribution to economic efficiency; Optimierung von Kaplan-Turbinen. Ein Beitrag zur Betriebswirtschaftlichkeit

    Energy Technology Data Exchange (ETDEWEB)

    Sevcik, Petr

    2009-07-01

    The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.

  17. Design of a Kaplan turbine for a wide range of operating head -Curved draft tube design and model test verification-

    Science.gov (United States)

    KO, Pohan; MATSUMOTO, Kiyoshi; OHTAKE, Norio; DING, Hua

    2016-11-01

    As for turbomachine off-design performance improvement is challenging but critical for maximising the performing area. In this paper, a curved draft tube for a medium head Kaplan type hydro turbine is introduced and discussed for its significant effect on expanding operating head range. Without adding any extra structure and working fluid for swirl destruction and damping, a carefully designed outline shape of draft tube with the selected placement of center-piers successfully supresses the growth of turbulence eddy and the transport of the swirl to the outlet. Also, more kinetic energy is recovered and the head lost is improved. Finally, the model test results are also presented. The obvious performance improvement was found in the lower net head area, where the maximum efficiency improvement was measured up to 20% without compromising the best efficiency point. Additionally, this design results in a new draft tube more compact in size and so leads to better construction and manufacturing cost performance for prototype. The draft tube geometry parameter designing process was concerning the best efficiency point together with the off-design points covering various water net heads and discharges. The hydraulic performance and flow behavior was numerically previewed and visualized by solving Reynolds-Averaged Navier-Stokes equations with Shear Stress Transport turbulence model. The simulation was under the assumption of steady-state incompressible turbulence flow inside the flow passage, and the inlet boundary condition was the carefully simulated flow pattern from the runner outlet. For confirmation, the corresponding turbine efficiency performance of the entire operating area was verified by model test.

  18. ["That flesh, pink and perishable": analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain) in the presence of competing risks].

    Science.gov (United States)

    Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel

    2009-01-01

    To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

  19. Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

    International Nuclear Information System (INIS)

    Ko, P; Kurosawa, S

    2014-01-01

    The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine

  20. Numerical simulation of turbulence flow in a Kaplan turbine -Evaluation on turbine performance prediction accuracy-

    Science.gov (United States)

    Ko, P.; Kurosawa, S.

    2014-03-01

    The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.

  1. Numerical investigation of hub clearance flow in a Kaplan turbine

    Science.gov (United States)

    Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.

    2012-11-01

    In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.

  2. Numerical investigation of hub clearance flow in a Kaplan turbine

    International Nuclear Information System (INIS)

    Wu, H; Feng, J J; Wu, G K; Luo, X Q

    2012-01-01

    In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.

  3. Multi-objective shape optimization of runner blade for Kaplan turbine

    International Nuclear Information System (INIS)

    Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V

    2014-01-01

    Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads

  4. Multi-objective shape optimization of runner blade for Kaplan turbine

    Science.gov (United States)

    Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.

    2014-03-01

    Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.

  5. Role of IKK-alpha in EGFR Signaling Regulation

    Science.gov (United States)

    2013-09-01

    heatmap. (B) Low expression of ΙΚΚα in TNBC cell lines. (C) Low expression of ΙΚΚα in TNBC cell lines. (D) Kaplan -Meier overall survival curves of...0.2 150- 100- 50- 150- 100- 0.5 50- 50- - - + + - + - + Vimentin E-cad N-cad 150- 100- 50- 150- 100- Twist1 AKT-p AKT-T C 250- 150- 100- N-cad P1 P2 P3

  6. Short-term mortality in patients with myocardial injury and myocardial infarction type 1 and type 2

    DEFF Research Database (Denmark)

    Sarkisian, Laura; Saaby, L.; Poulsen, T. S.

    2015-01-01

    -year period we prospectively studied hospitalized patients having cardiac troponin I (cTnI) measured on clinical indication. The diagnosis of type 1 and type 2 MI was according to the universal definition involving a rising and/or falling pattern of cTnI values above the decision limit of 30 ng/L. c....... The results are depicted in the figure (Kaplan-Meier curves, log-rank-test; p-value...

  7. Meier-Gorlin syndrome Clinical genetics and genomics

    OpenAIRE

    Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie

    2015-01-01

    textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...

  8. Prior history of non-melanoma skin cancer is associated with increased mortality in patients with chronic lymphocytic leukemia

    Science.gov (United States)

    Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola

    2009-01-01

    We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092

  9. Water hammer 2 phase analysis hydraulic system with a Kaplan turbine

    OpenAIRE

    Dudlik, A.; Koutnik, J.

    2009-01-01

    This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...

  10. Computer Aided Design of Kaplan Turbine Piston with SolidWorks

    OpenAIRE

    Camelia Jianu

    2010-01-01

    The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

  11. Survival of Patients With Cervical Cancer in Rural India

    OpenAIRE

    Vinoda Thulaseedharan, Jissa; Malila, Nea; Swaminathan, Rajaraman; Esmy Pulikottil, Okuru; Hakama, Matti; Muwonge, Richard; Sankaranarayanan, Rengaswamy

    2015-01-01

    Background: Patients’ survival after diagnosis of cervical cancer is indirectly influenced by socio-economic factors. We evaluated this survival and its socio-economic determinants in a rural population in south India. Methods: We assessed 165 women diagnosed with cervical cancer from the routine care control arm of a randomized screening trial conducted in rural south India. Kaplan-Meier curves were plotted to illustrate the observed survival of cancer patients. The effect of socio-econom...

  12. Left ventricular dyssynchrony assessed by gated SPECT phase analysis is an independent predictor of death in patients with advanced coronary artery disease and reduced left ventricular function not undergoing cardiac resynchronization therapy

    Energy Technology Data Exchange (ETDEWEB)

    Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)

    2012-10-15

    Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)

  13. Compliance with Supportive Periodontal Treatment in Patients with Dental Implants.

    Science.gov (United States)

    Hu, Kai-Fang; Lin, Ying-Chu; Ho, Kun-Yen; Chou, Yu-Hsiang

    The need for dental implants is increasing, and supportive periodontal treatment can achieve long-term success and prevent peri-implantitis. Contributing factors to noncompliance with long-term scheduled supportive periodontal treatment remain unclear. To investigate whether demographic and clinical characteristics are associated with noncompliance, the authors analyzed data for patients who had received dental implants. The authors recruited patients participating in a supportive periodontal treatment program after receiving permanent prostheses on implants placed from 2005 to 2013. Demographic data and dental treatment histories were collected. Compliance was defined as a record of participation in a standard supportive periodontal treatment program for at least 1 year. The chi-square test, log-rank test, Kaplan-Meier survival curve, and Cox proportional hazards model were used for statistical analysis. The study included 120 patients (259 implants, 60% compliance). The two groups (compliant and noncompliant) differed significantly in frequency distributions for sex (P = .0017), educational level (P = .0325), and histories of substance use (P = .0016), periodontitis (P = .0005), and root planing or flap surgery (P = .0002). The Kaplan-Meier survival curves and log-rank test showed that increases in cumulative continuation rates were significantly associated with male sex (P = .0025); body mass index ≥ 24 kg/m² (P = .0093); and a history of periodontitis (P implant placement, root planing or flap surgery was the crucial factor in determining compliance with supportive periodontal treatment. However, well-designed large-scale studies with a larger sample size are needed to confirm the findings of this study.

  14. Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

    Energy Technology Data Exchange (ETDEWEB)

    Petit, O; Nilsson, H [Division of Fluid Mechanics, Chalmers University of Technology, Hoersalsvaegen 7A, SE-41296 Goeteborg (Sweden); Mulu, B; Cervantes, M, E-mail: olivierp@chalmers.s [Division of Fluid Mechanics, Luleaa University of Technology, SE-971 87 Luleaa (Sweden)

    2010-08-15

    The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

  15. Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

    Science.gov (United States)

    Petit, O.; Mulu, B.; Nilsson, H.; Cervantes, M.

    2010-08-01

    The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

  16. Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model

    International Nuclear Information System (INIS)

    Petit, O; Nilsson, H; Mulu, B; Cervantes, M

    2010-01-01

    The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Alvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

  17. Predicting long-term graft survival in adult kidney transplant recipients

    Directory of Open Access Journals (Sweden)

    Brett W Pinsky

    2012-01-01

    Full Text Available The ability to accurately predict a population′s long-term survival has important implications for quantifying the benefits of transplantation. To identify a model that can accurately predict a kidney transplant population′s long-term graft survival, we retrospectively studied the United Network of Organ Sharing data from 13,111 kidney-only transplants completed in 1988- 1989. Nineteen-year death-censored graft survival (DCGS projections were calculated and com-pared with the population′s actual graft survival. The projection curves were created using a two-part estimation model that (1 fits a Kaplan-Meier survival curve immediately after transplant (Part A and (2 uses truncated observational data to model a survival function for long-term projection (Part B. Projection curves were examined using varying amounts of time to fit both parts of the model. The accuracy of the projection curve was determined by examining whether predicted sur-vival fell within the 95% confidence interval for the 19-year Kaplan-Meier survival, and the sample size needed to detect the difference in projected versus observed survival in a clinical trial. The 19-year DCGS was 40.7% (39.8-41.6%. Excellent predictability (41.3% can be achieved when Part A is fit for three years and Part B is projected using two additional years of data. Using less than five total years of data tended to overestimate the population′s long-term survival, accurate prediction of long-term DCGS is possible, but requires attention to the quantity data used in the projection method.

  18. Estimating a population cumulative incidence under calendar time trends

    DEFF Research Database (Denmark)

    Hansen, Stefan N; Overgaard, Morten; Andersen, Per K

    2017-01-01

    BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date....... It is common practice to apply the Kaplan-Meier or Aalen-Johansen estimator to the total sample and report either the estimated cumulative incidence curve or just a single point on the curve as a description of the disease risk. METHODS: We argue that, whenever the disease or disorder of interest is influenced...

  19. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

  20. Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis

    OpenAIRE

    Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu

    2015-01-01

    Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...

  1. The Educational Philosophies of Mordecai Kaplan and Michael Rosenak: Surprising Similarities and Illuminating Differences

    Science.gov (United States)

    Schein, Jeffrey; Caplan, Eric

    2014-01-01

    The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…

  2. Exponential Decay Nonlinear Regression Analysis of Patient Survival Curves: Preliminary Assessment in Non-Small Cell Lung Cancer

    Science.gov (United States)

    Stewart, David J.; Behrens, Carmen; Roth, Jack; Wistuba, Ignacio I.

    2010-01-01

    Background For processes that follow first order kinetics, exponential decay nonlinear regression analysis (EDNRA) may delineate curve characteristics and suggest processes affecting curve shape. We conducted a preliminary feasibility assessment of EDNRA of patient survival curves. Methods EDNRA was performed on Kaplan-Meier overall survival (OS) and time-to-relapse (TTR) curves for 323 patients with resected NSCLC and on OS and progression-free survival (PFS) curves from selected publications. Results and Conclusions In our resected patients, TTR curves were triphasic with a “cured” fraction of 60.7% (half-life [t1/2] >100,000 months), a rapidly-relapsing group (7.4%, t1/2=5.9 months) and a slowly-relapsing group (31.9%, t1/2=23.6 months). OS was uniphasic (t1/2=74.3 months), suggesting an impact of co-morbidities; hence, tumor molecular characteristics would more likely predict TTR than OS. Of 172 published curves analyzed, 72 (42%) were uniphasic, 92 (53%) were biphasic, 8 (5%) were triphasic. With first-line chemotherapy in advanced NSCLC, 87.5% of curves from 2-3 drug regimens were uniphasic vs only 20% of those with best supportive care or 1 drug (p<0.001). 54% of curves from 2-3 drug regimens had convex rapid-decay phases vs 0% with fewer agents (p<0.001). Curve convexities suggest that discontinuing chemotherapy after 3-6 cycles “synchronizes” patient progression and death. With postoperative adjuvant chemotherapy, the PFS rapid-decay phase accounted for a smaller proportion of the population than in controls (p=0.02) with no significant difference in rapid-decay t1/2, suggesting adjuvant chemotherapy may move a subpopulation of patients with sensitive tumors from the relapsing group to the cured group, with minimal impact on time to relapse for a larger group of patients with resistant tumors. In untreated patients, the proportion of patients in the rapid-decay phase increased (p=0.04) while rapid-decay t1/2 decreased (p=0.0004) with increasing

  3. Estimating Loss to Follow-Up in HIV-Infected Patients on Antiretroviral Therapy: The Effect of the Competing Risk of Death in Zambia and Switzerland

    Science.gov (United States)

    Mwango, Albert; Stringer, Jeffrey; Ledergerber, Bruno; Mulenga, Lloyd; Bucher, Heiner C.; Westfall, Andrew O.; Calmy, Alexandra; Boulle, Andrew; Chintu, Namwinga; Egger, Matthias; Chi, Benjamin H.

    2011-01-01

    Background Loss to follow-up (LTFU) is common in antiretroviral therapy (ART) programmes. Mortality is a competing risk (CR) for LTFU; however, it is often overlooked in cohort analyses. We examined how the CR of death affected LTFU estimates in Zambia and Switzerland. Methods and Findings HIV-infected patients aged ≥18 years who started ART 2004–2008 in observational cohorts in Zambia and Switzerland were included. We compared standard Kaplan-Meier curves with CR cumulative incidence. We calculated hazard ratios for LTFU across CD4 cell count strata using cause-specific Cox models, or Fine and Gray subdistribution models, adjusting for age, gender, body mass index and clinical stage. 89,339 patients from Zambia and 1,860 patients from Switzerland were included. 12,237 patients (13.7%) in Zambia and 129 patients (6.9%) in Switzerland were LTFU and 8,498 (9.5%) and 29 patients (1.6%), respectively, died. In Zambia, the probability of LTFU was overestimated in Kaplan-Meier curves: estimates at 3.5 years were 29.3% for patients starting ART with CD4 cells Switzerland since only few patients died. The results from Cox and Fine and Gray models were similar: in Zambia the risk of loss to follow-up and death increased with decreasing CD4 counts at the start of ART, whereas in Switzerland there was a trend in the opposite direction, with patients with higher CD4 cell counts more likely to be lost to follow-up. Conclusions In ART programmes in low-income settings the competing risk of death can substantially bias standard analyses of LTFU. The CD4 cell count and other prognostic factors may be differentially associated with LTFU in low-income and high-income settings. PMID:22205933

  4. Prognostic value of MLH1 promoter methylation in male patients with esophageal squamous cell carcinoma.

    Science.gov (United States)

    Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei

    2017-04-01

    The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.

  5. Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

    International Nuclear Information System (INIS)

    Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao

    2017-01-01

    The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

  6. Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks

    Directory of Open Access Journals (Sweden)

    Camelia Jianu

    2010-10-01

    Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.

  7. Analysis of the Kaplan turbine draft tube effect

    International Nuclear Information System (INIS)

    Motycak, L; Skotak, A; Obrovsky, J

    2010-01-01

    The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

  8. Analysis of the Kaplan turbine draft tube effect

    Energy Technology Data Exchange (ETDEWEB)

    Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)

    2010-08-15

    The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

  9. Analysis of the Kaplan turbine draft tube effect

    Science.gov (United States)

    Motycak, L.; Skotak, A.; Obrovsky, J.

    2010-08-01

    The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.

  10. Survival curves to support quality improvement in hospitals with excess 30-day mortality after acute myocardial infarction, cerebral stroke and hip fracture: a before-after study.

    Science.gov (United States)

    Kristoffersen, Doris Tove; Helgeland, Jon; Waage, Halfrid Persdatter; Thalamus, Jacob; Clemens, Dirk; Lindman, Anja Schou; Rygh, Liv Helen; Tjomsland, Ole

    2015-03-25

    To evaluate survival curves (Kaplan-Meier) as a means of identifying areas in the clinical pathway amenable to quality improvement. Observational before-after study. In Norway, annual public reporting of nationwide 30-day in-and-out-of-hospital mortality (30D) for three medical conditions started in 2011: first time acute myocardial infarction (AMI), stroke and hip fracture; reported for 2009. 12 of 61 hospitals had statistically significant lower/higher mortality compared with the hospital mean. Three hospitals with significantly higher mortality requested detailed analyses for quality improvement purposes: Telemark Hospital Trust Skien (AMI and stroke), Østfold Hospital Trust Fredrikstad (stroke), Innlandet Hospital Trust Gjøvik (hip fracture). Survival curves, crude and risk-adjusted 30D before (2008-2009) and after (2012-2013). Unadjusted survival curves for the outlier hospitals were compared to curves based on pooled data from the other hospitals for the 30-day period 2008-2009. For patients admitted with AMI (Skien), stroke (Fredrikstad) and hip fracture (Gjøvik), the curves suggested increased mortality from the initial part of the clinical pathway. For stroke (Skien), increased mortality appeared after about 8 days. The curve profiles were thought to reflect suboptimal care in various phases in the clinical pathway. This informed improvement efforts. For 2008-2009, hospital-specific curves differed from other hospitals: borderline significant for AMI (p=0.064), highly significant (p≤0.005) for the remainder. After intervention, no difference was found (p>0.188). Before-after comparison of the curves within each hospital revealed a significant change for Fredrikstad (p=0.006). For the three hospitals, crude 30D declined and they were non-outliers for risk-adjusted 30D for 2013. Survival curves as a supplement to 30D may be useful for identifying suboptimal care in the clinical pathway, and thus informing design of quality improvement projects

  11. Numerical and in-situ investigations of water hammer effects in Drava river Kaplan turbine hydropower plants

    International Nuclear Information System (INIS)

    Bergant, A; Gregorc, B; Gale, J

    2012-01-01

    This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.

  12. Numerical and in-situ investigations of water hammer effects in Drava river Kaplan turbine hydropower plants

    Science.gov (United States)

    Bergant, A.; Gregorc, B.; Gale, J.

    2012-11-01

    This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.

  13. Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids

    OpenAIRE

    Gustafsson, Martin

    2013-01-01

    To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...

  14. Adjuvant Medications That Improve Survival after Locoregional Therapy.

    Science.gov (United States)

    Boas, F Edward; Ziv, Etay; Yarmohammadi, Hooman; Brown, Karen T; Erinjeri, Joseph P; Sofocleous, Constantinos T; Harding, James J; Solomon, Stephen B

    2017-07-01

    To determine if outpatient medications taken at the time of liver tumor embolization or ablation affect survival. A retrospective review was done of 2,032 liver tumor embolization, radioembolization, and ablation procedures performed in 1,092 patients from June 2009 to April 2016. Pathology, hepatocellular carcinoma (HCC) stage (American Joint Committee on Cancer), neuroendocrine tumor (NET) grade, initial locoregional therapy, overall survival after initial locoregional therapy, Child-Pugh score, Eastern Cooperative Oncology Group performance status, Charlson Comorbidity Index, and outpatient medications taken at the time of locoregional therapy were analyzed for each patient. Kaplan-Meier survival curves were calculated for patients taking 29 medications or medication classes (including prescription and nonprescription medications) for reasons unrelated to their primary cancer diagnosis. Kaplan-Meier curves were compared using the log-rank test. For patients with HCC initially treated with embolization (n = 304 patients), the following medications were associated with improved survival when taken at the time of embolization: beta-blockers (P = .0007), aspirin (P = .0008) and other nonsteroidal antiinflammatory drugs (P = .009), proton pump inhibitors (P = .004), and antivirals for hepatitis B or C (P = .01). For colorectal liver metastases initially treated with ablation (n = 172 patients), beta-blockers were associated with improved survival when taken at the time of ablation (P = .02). Aspirin and beta-blockers are associated with significantly improved survival when taken at the time of embolization for HCC. Aspirin was not associated with survival differences after locoregional therapy for NET or colorectal liver metastases, suggesting an HCC-specific effect. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

  15. Kaplan og Norton bør læses af hele ledelsen

    DEFF Research Database (Denmark)

    Bukh, Per Nikolaj

    2009-01-01

    Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...

  16. Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test

    International Nuclear Information System (INIS)

    Aoki, S.; Levien, R.B.

    1995-01-01

    We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories

  17. Comparative evaluation of fracture and defect in reciproc and rotary files in severe curved root canals

    Directory of Open Access Journals (Sweden)

    Mahdis Bagherian

    2015-03-01

    Full Text Available Introduction: Root canal instrumentation is an important phase in root canal therapy. Since success in endodontic treatment depends on file defect and fracture, the aim of this study was to compare the evaluation of defect and fracture in rotary and reciproc files in severe curved root canals. Materials & Methods: In this experimental study, 60 mesial canals of human closed apex molars with more than 30° canal curvature were randomly divided into two groups. In first group M-two rotary files number# 15, 20, and 25 and in second group R25 reciproc file were used for filing, respectively. A ×8 magnifier was applied to evaluate the defect or fracture presence in each side and if it were observed, a new file would be replaced. Therefore, the number of prepared canals with each file and fractured or defective files and the place of fracture in root canal were recorded. Kaplan Meier curve and log rank test were done by using SPSS v.22. Results: In rotary group, seven and two files were fractured and defected, respectively and four files were fractured and no defect was observed in reciproc group. Although the mean of the number of prepared canals until fracture or defect in rotary and reciproc groups was 3.3 and 7.06, respectively, there were no significant differences between two systems. All file’s fractures occurred in apical regions . Conclusion: The results showed that there was no significant difference in defects or fractures of rotary and reciproc systems. Reciproc instruments can be more effective than rotary ones because the root canal preparation in rotary instruments is longer than in reciproc system.

  18. Case Report: Meier-Gorlin syndrome: Report of an additional patient ...

    African Journals Online (AJOL)

    We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.

  19. Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin

    OpenAIRE

    Fjærvold, Lars

    2012-01-01

    The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...

  20. «Esa corporeidad mortal y rosa»: análisis del tiempo libre de enfermedad del cáncer de mama en Gipuzkoa en presencia de riesgos competitivos "That deadly and pink corporeity": Analysis of disease-free survival analysis in breast cancer in Gipuzkoa (Spain in the presence of competing risks

    Directory of Open Access Journals (Sweden)

    Pablo Martínez-Camblor

    2009-12-01

    sobrestimación tanto de la probabilidad de recidiva como de la mortalidad debida a la enfermedad.Objective: To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. Methods: All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival were also studied. Results: Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Conclusions: Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.

  1. Chest computed tomography scores are predictive of survival in patients with cystic fibrosis awaiting lung transplantation

    DEFF Research Database (Denmark)

    Loeve, Martine; Hop, Wim C. J.; de Bruijne, Marleen

    2012-01-01

    Rationale: Up to a third of cystic fibrosis (CF) patients awaiting lung transplantation (LTX) die while waiting. Inclusion of computed tomography (CT) scores may improve survival prediction models such as the lung allocation score (LAS). Objectives: This study investigated the association between...... CT and survival in CF patients screened for LTX. Methods: Clinical data and chest CTs of 411 CF patients screened for LTX between 1990 and 2005 were collected from 17 centers. CTs were scored with the Severe Advanced Lung Disease (SALD) 4-category scoring system, including the components "infection....../inflammation" (INF), air trapping/hypoperfusion (AT), normal/hyperperfusion (NOR) and bulla/cysts (BUL). The volume of each component was computed using semi-automated software. Survival analysis included Kaplan-Meier curves, and Cox-regression models. Measurements and main results: 366 (186 males) out of 411...

  2. Metastatic volume: an old oncologic concept and a new prognostic factor for stage IV melanoma patients.

    Science.gov (United States)

    Panasiti, V; Curzio, M; Roberti, V; Lieto, P; Devirgiliis, V; Gobbi, S; Naspi, A; Coppola, R; Lopez, T; di Meo, N; Gatti, A; Trevisan, G; Londei, P; Calvieri, S

    2013-01-01

    The last melanoma staging system of the 2009 American Joint Committee on Cancer takes into account, for stage IV disease, the serum levels of lactate dehydrogenase (LDH) and the site of distant metastases. Our aim was to compare the significance of metastatic volume, as evaluated at the time of stage IV melanoma diagnosis, with other clinical predictors of prognosis. We conducted a retrospective multicentric study. To establish which variables were statistically correlated both with death and survival time, contingency tables were evaluated. The overall survival curves were compared using the Kaplan-Meier method. Metastatic volume and number of affected organs were statistically related to death. In detail, patients with a metastatic volume >15 cm(3) had a worse prognosis than those with a volume lower than this value (survival probability at 60 months: 6.8 vs. 40.9%, respectively). The Kaplan-Meier method confirmed that survival time was significantly related to the site(s) of metastases, to elevated LDH serum levels and to melanoma stage according to the latest system. Our results suggest that metastatic volume may be considered as a useful prognostic factor for survival among melanoma patients.

  3. Eigentumors for prediction of treatment failure in patients with early-stage breast cancer using dynamic contrast-enhanced MRI: a feasibility study

    Science.gov (United States)

    Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.

    2017-08-01

    We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P  <  0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P  <  0.0001) and the triple-negative subtype tumors (P  =  0.0039), but not for tumors of the HER2 subtype (P  =  0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.

  4. The effect of quitting smoking on the risk of unfavorable events after surgical treatment of oral potentially malignant lesions

    DEFF Research Database (Denmark)

    Vladimirov, B S; Schiødt, Morten

    2009-01-01

    smokers at the time of diagnosis and were treated surgically. Patients were advised to quit smoking at each visit. The change of smoking habits and occurrence of unfavorable events were noted during follow-up. Descriptive statistics, Fischer's exact test, Kaplan-Meier curves with log-rank test, and Cox......The aim of this study was to examine if cessation of smoking after surgical excision of oral potentially malignant lesions in smokers reduced the risk of recurrences, development of new lesions or malignancies. 51 patients with oral leukoplakia or erythroplakia were included. They were daily...... proportional hazards model were used for analysis. 16 patients (31%) quit smoking during the observation period. Only one quitter (6%) developed recurrence compared with 11 continuing smokers (33%) (p

  5. Learning curve for the management of tyrosine kinase inhibitors as the first line of treatment for patients with metastatic renal cancer.

    Science.gov (United States)

    Lendínez-Cano, G; Osman García, I; Congregado Ruiz, C B; Conde Sánchez, J M; Medina López, R A

    2018-03-07

    To analyse the learning curve for the management of tyrosine kinase inhibitors as the first line of treatment for patients with metastatic renal cancer. We evaluated 32 consecutive patients treated in our department for metastatic renal cancer with tyrosine kinase inhibitors (pazopanib or sunitinib) as first-line treatment between September 2012 and November 2015. We retrospectively analysed this sample. We measured the time to the withdrawal of the first-line treatment, the time to progression and overall survival using Kaplan-Meier curves. The learning curve was analysed with the cumulative sum (CUSUM) methodology. In our series, the median time to the withdrawal of the first-line treatment was 11 months (95% CI 4.9-17.1). The mean time to progression was 30.4 months (95% CI 22.7-38.1), and the mean overall survival was 34.9 months (95% CI 27.8-42). By applying the CUSUM methodology, we obtained a graph for the CUSUM value of the time to withdrawal of the first-line treatment (CUSUM TW), observing 3 well-differentiated phases: phase 1 or initial learning phase (1-15), phase 2 (16-26) in which the management of the drug progressively improved and phase 3 (27-32) of maximum experience or mastery of the management of these drugs. The number of treated patients needed to achieve the proper management of these patients was estimated at 15. Despite the limitations of the sample size and follow-up time, we estimated (in 15 patients) the number needed to reach the necessary experience in the management of these patients with tyrosine kinase inhibitors. We observed no relationship between the time to the withdrawal of the first-line treatment for any cause and progression. Copyright © 2018 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

  6. Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)

    2017-03-15

    The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)

  7. A reconstructed melanoma data set for evaluating differential treatment benefit according to biomarker subgroups

    Directory of Open Access Journals (Sweden)

    Jaya M. Satagopan

    2017-06-01

    Full Text Available The data presented in this article are related to the research article entitled “Measuring differential treatment benefit across marker specific subgroups: the choice of outcome scale” (Satagopan and Iasonos, 2015 [1]. These data were digitally reconstructed from figures published in Larkin et al. (2015 [2]. This article describes the steps to digitally reconstruct patient-level data on time-to-event outcome and treatment and biomarker groups using published Kaplan-Meier survival curves. The reconstructed data set and the corresponding computer programs are made publicly available to enable further statistical methodology research.

  8. The 434(G>C) polymorphism in the eosinophil cationic protein gene and its association with tissue eosinophilia in oral squamous cell carcinomas

    DEFF Research Database (Denmark)

    Pereira, Michele C; Oliveira, Denise T; Olivieri, Eloísa H R

    2010-01-01

    OBJECTIVE: The aim of this study was to investigate the prevalence of the Eosinophil cationic protein (ECP)-gene polymorphism 434(G>C) in oral squamous cell carcinoma (OSCC) patients and its association with tumor-associated tissue eosinophilia (TATE), demographic, clinical, and microscopic...... of ECP-gene polymorphism 434(G>C) with TATE, demographic, clinical, and microscopic variables in OSCC patients. Disease-free survival and overall survival were calculated by the Kaplan-Meier product-limit actuarial method and the comparison of the survival curves were performed using log rank test...

  9. Restaging and Survival Analysis of 4036 Ovarian Cancer Patients According to the 2013 FIGO Classification for Ovarian, Fallopian Tube, and Primary Peritoneal Cancer

    DEFF Research Database (Denmark)

    Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul

    2016-01-01

    OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...

  10. Prognostic value of preoperative dynamic contrast-enhanced MRI perfusion parameters for high-grade glioma patients

    Energy Technology Data Exchange (ETDEWEB)

    Ulyte, Agne [Vilnius University, Faculty of Medicine, Vilnius (Lithuania); Katsaros, Vasileios K. [General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Advanced Imaging Modalities - CT and MRI, Athens (Greece); University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Liouta, Evangelia; Stranjalis, Georgios [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Boskos, Christos [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Radiation Oncology, Athens (Greece); Papanikolaou, Nickolas [Champalimaud Foundation, Department of Radiology, Centre for the Unknown, Lisbon (Portugal); Usinskiene, Jurgita [National Cancer Institute, Vilnius (Lithuania); Affidea Lietuva, Vilnius (Lithuania); Bisdas, Sotirios [University College London Hospitals, Department of Neuroradiology, The National Hospital for Neurology and Neurosurgery, London (United Kingdom)

    2016-12-15

    The prognostic value of the dynamic contrast-enhanced (DCE) MRI perfusion and its histogram analysis-derived metrics is not well established for high-grade glioma (HGG) patients. The aim of this prospective study was to investigate DCE perfusion transfer coefficient (K{sup trans}), vascular plasma volume fraction (v{sub p}), extracellular volume fraction (v{sub e}), reverse transfer constant (k{sub ep}), and initial area under gadolinium concentration time curve (IAUGC) as predictors of progression-free (PFS) and overall survival (OS) in HGG patients. Sixty-nine patients with suspected anaplastic astrocytoma or glioblastoma underwent preoperative DCE-MRI scans. DCE perfusion whole tumor region histogram parameters, clinical details, and PFS and OS data were obtained. Univariate, multivariate, and Kaplan-Meier survival analyses were conducted. Receiver operating characteristic (ROC) curve analysis was employed to identify perfusion parameters with the best differentiation performance. On univariate analysis, v{sub e} and skewness of v{sub p} had significant negative impacts, while k{sub ep} had significant positive impact on OS (P < 0.05). v{sub e} was also a negative predictor of PFS (P < 0.05). Patients with lower v{sub e} and IAUGC had longer median PFS and OS on Kaplan-Meier analysis (P < 0.05). K{sup trans} and v{sub e} could also differentiate grade III from IV gliomas (area under the curve 0.819 and 0.791, respectively). High v{sub e} is a consistent predictor of worse PFS and OS in HGG glioma patients. v{sub p} skewness and k{sub ep} are also predictive for OS. K{sup trans} and v{sub e} demonstrated the best diagnostic performance for differentiating grade III from IV gliomas. (orig.)

  11. Kaplan turbine tip vortex cavitation - analysis and prevention

    Science.gov (United States)

    Motycak, L.; Skotak, A.; Kupcik, R.

    2012-11-01

    The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

  12. Optimal FDG PET/CT volumetric parameters for risk stratification in patients with locally advanced non-small cell lung cancer: results from the ACRIN 6668/RTOG 0235 trial

    Energy Technology Data Exchange (ETDEWEB)

    Salavati, Ali [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); University of Minnesota, Department of Radiology, Minneapolis, MN (United States); Duan, Fenghai [Brown University School of Public Health, Department of Biostatistics and Center for Statistical Sciences, Providence, RI (United States); Snyder, Bradley S. [Brown University School of Public Health, Center for Statistical Sciences, Providence, RI (United States); Wei, Bo [Emory University, Department of Biostatistics, Rollins School of Public Health, Atlanta, GA (United States); Houshmand, Sina; Alavi, Abass [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Khiewvan, Benjapa [Hospital of the University of Pennsylvania, Department of Radiology, Philadelphia, PA (United States); Mahidol University, Division of Nuclear Medicine, Department of Radiology, Faculty of Medicine Siriraj Hospital, Bangkok (Thailand); Opanowski, Adam [ACR Center for Research and Innovation, American College of Radiology, Philadelphia, PA (United States); Simone, Charles B. [University of Maryland Medical Center, Department of Radiation Oncology, Baltimore, MD (United States); Siegel, Barry A. [Washington University School of Medicine, Mallinckrodt Institute of Radiology and the Alvin J. Siteman Cancer Center, St, Louis, MO (United States); Machtay, Mitchell [Case Western Reserve University and University Hospitals Case Medical Center, Department of Radiation Oncology, Cleveland, OH (United States)

    2017-11-15

    In recent years, multiple studies have demonstrated the value of volumetric FDG-PET/CT parameters as independent prognostic factors in patients with non-small cell lung cancer (NSCLC). We aimed to determine the optimal cut-off points of pretreatment volumetric FDG-PET/CT parameters in predicting overall survival (OS) in patients with locally advanced NSCLC and to recommend imaging biomarkers appropriate for routine clinical applications. Patients with inoperable stage IIB/III NSCLC enrolled in ACRIN 6668/RTOG 0235 were included. Pretreatment FDG-PET scans were quantified using semiautomatic adaptive contrast-oriented thresholding and local-background partial-volume-effect-correction algorithms. For each patient, the following indices were measured: metabolic tumor volume (MTV), total lesion glycolysis (TLG), SUVmax, SUVmean, partial-volume-corrected TLG (pvcTLG), and pvcSUVmean for the whole-body, primary tumor, and regional lymph nodes. The association between each index and patient outcome was assessed using Cox proportional hazards regression. Optimal cut-off points were estimated using recursive binary partitioning in a conditional inference framework and used in Kaplan-Meier curves with log-rank testing. The discriminatory ability of each index was examined using time-dependent receiver operating characteristic (ROC) curves and corresponding area under the curve (AUC(t)). The study included 196 patients. Pretreatment whole-body and primary tumor MTV, TLG, and pvcTLG were independently prognostic of OS. Optimal cut-off points were 175.0, 270.9, and 35.5 cm{sup 3} for whole-body TLG, pvcTLG, and MTV, and were 168.2, 239.8, and 17.4 cm{sup 3} for primary tumor TLG, pvcTLG, and MTV, respectively. In time-dependent ROC analysis, AUC(t) for MTV and TLG were uniformly higher than that of SUV measures over all time points. Primary tumor and whole-body parameters demonstrated similar patterns of separation for those patients above versus below the optimal cut

  13. Clinical outcomes in patients with node-negative breast cancer treated based on the recurrence score results: evidence from a large prospectively designed registry.

    Science.gov (United States)

    Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky

    2017-01-01

    The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n  = 304) and 11-25 ( n  = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.

  14. Meier-Gorlin syndrome.

    Science.gov (United States)

    de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F

    2015-09-17

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.

  15. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

    DEFF Research Database (Denmark)

    Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

  16. Treatment-dependent and treatment-independent risk factors associated with the risk of diabetes-related events

    DEFF Research Database (Denmark)

    Wilke, Thomas; Mueller, Sabrina; Groth, Antje

    2015-01-01

    BACKGROUND: The aim of this study was to analyse which factors predict the real-world macro-/microvascular event, hospitalisation and death risk in patients with type 2 diabetes mellitus. Furthermore, we aimed to investigate whether there exists both an under- and over-treatment risk...... of these patients. METHODS: We used a German claims/clinical data set covering the years 2010-12. Diabetes-related events were defined as (1) macro-, (2) microvascular events leading to inpatient hospitalisation, (3) other hospitalisations with type 2 diabetes mellitus as main diagnosis, (4) all-cause death and (5......) a composite outcome including all event categories 1-4. Factors associated with event risk were analysed by a Kaplan-Meier curve analysis and by multivariable Cox regression models. RESULTS: 229,042 patients with type 2 diabetes mellitus (mean age 70.2 years; mean CCI 6.03) were included. Among factors...

  17. Prita Meier, Swahili Port Cities: The Architecture of Elsewhere

    OpenAIRE

    Longair, Sarah

    2018-01-01

    Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...

  18. Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post

    Index Scriptorium Estoniae

    Nikiforov, Raivo

    2005-01-01

    Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest

  19. Unsteady numerical simulation of the flow in the U9 Kaplan turbine model

    International Nuclear Information System (INIS)

    Javadi, Ardalan; Nilsson, Håkan

    2014-01-01

    The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation

  20. Unsteady numerical simulation of the flow in the U9 Kaplan turbine model

    Science.gov (United States)

    Javadi, Ardalan; Nilsson, Håkan

    2014-03-01

    The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.

  1. Carbonic anhydrase IX and response to postmastectomy radiotherapy in high-risk breast cancer: a subgroup analysis of the DBCG82 b and c trials

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...

  2. Comparison of Exposure in the Kaplan Versus the Kocher Approach in the Treatment of Radial Head Fractures.

    Science.gov (United States)

    Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P

    2018-01-01

    The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.

  3. Neoadjuvant treatment and adjuvant radiotherapy for patients with high risk prostate cancer and radical prostatectomy

    International Nuclear Information System (INIS)

    Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo

    2009-01-01

    Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es

  4. Individualism, Nationalism, and Universalism: The Educational Ideals of Mordecai M. Kaplan's Philosophy of Jewish Education

    Science.gov (United States)

    Ackerman, Ari

    2008-01-01

    This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…

  5. Kaplan turbine tip vortex cavitation – analysis and prevention

    International Nuclear Information System (INIS)

    Motycak, L; Skotak, A; Kupcik, R

    2012-01-01

    The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.

  6. De 'wraak van de geografie' volgens Robert D. Kaplan

    NARCIS (Netherlands)

    Mamadouh, V.

    2013-01-01

    De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor

  7. The Association of Individual and Regional Socioeconomic Status on Initial Peritonitis and Outcomes in Peritoneal Dialysis Patients: A Propensity Score-Matched Cohort Study.

    Science.gov (United States)

    Wang, Qin; Hu, Ke-Jie; Ren, Ye-Ping; Dong, Jie; Han, Qing-Feng; Zhu, Tong-Ying; Chen, Jiang-Hua; Zhao, Hui-Ping; Chen, Meng-Hua; Xu, Rong; Wang, Yue; Hao, Chuan-Ming; Zhang, Xiao-Hui; Wang, Mei; Tian, Na; Wang, Hai-Yan

    2016-01-01

    ♦ Research indicates that the socioeconomic status (SES) of individuals and the area where they live are related to initial peritonitis and outcomes in peritoneal dialysis (PD). We conducted a retrospective, multi-center cohort study in China to examine these associations. ♦ Data on 2,171 PD patients were collected from 7 centers, including baseline demographic, socioeconomic, and laboratory data. We explored the potential risk factors for initial peritonitis and outcomes using univariate Cox regression and unadjusted binary logistic regression. Then, we used propensity score matching to balance statistically significant risk factors for initial peritonitis and outcomes, and Kaplan-Meier survival analysis to compare differences in peritonitis-free rates between different groups of participants after matching. ♦ A total of 563 (25.9%) initial episodes of peritonitis occurred during the study period. The Kaplan-Meier peritonitis-free rate curve showed high-income patients had a significantly lower risk than low-income patients (p = 0.007) after matching for age, hemoglobin, albumin, and regional SES and PD center. The risk of treatment failure was significantly lower in the high-income than the low-income group after matching for the organism causing peritonitis and PD center: odds ratio (OR) = 0.27 (0.09 - 0.80, p = 0.018). Regional SES and education were not associated with initial peritonitis and outcomes. ♦ Our study demonstrates low individual income is a risk factor for the initial onset of peritonitis and treatment failure after initial peritonitis. Copyright © 2016 International Society for Peritoneal Dialysis.

  8. Unsteady load on an oscillating Kaplan turbine runner

    Science.gov (United States)

    Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.

    2013-02-01

    A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.

  9. Carotid flow velocity/diameter ratio is a predictor of cardiovascular events in hypertensive patients

    DEFF Research Database (Denmark)

    Bellinazzi, Vera R; Cipolli, José A; Pimenta, Marcio V

    2015-01-01

    AD) greater than the median value presented the worst clinical outcome compared to those with isolated sFV less than the median value or sAD greater than the median value, suggesting an additive effect of these two variables. Further, Kaplan-Meier analysis demonstrated worse outcome for individuals with s...... intima-media thickness and clinically defined high cardiovascular risk did not. Furthermore, area under the receiver-operating characteristic curve for sFV/sAD was higher than that for Framingham risk score (0.77 versus 0.64; P = 0.045), whereas adding sFV/sAD to the Framingham risk factors resulted...

  10. Growth pattern of colorectal liver metastasis as a marker of recurrence risk

    DEFF Research Database (Denmark)

    Eefsen, R L; Vermeulen, P B; Christensen, I J

    2015-01-01

    from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...

  11. Mortality impact of positive blood cultures in patients with suspected community-acquired bacteraemia. A Danish population-based cohort study

    DEFF Research Database (Denmark)

    Søgaard, Mette; Nørgaard, Mette; Sørensen, Henrik Toft

    2009-01-01

    for age, gender, coexisting chronic diseases, marital status, use of immunosuppressives, and calendar period. Further, we conducted analyses restricted to patients a discharge diagnose of infectious diseases (ICD-10 codes A00-B99). Results: In total, 1,665 (8.2%) patients had positive blood culture...... System. We computed Kaplan-Meier curves and product limit estimates for the main study variables. Next, time-dependent Cox regression analyses was used to compare the risk of death in patients with positive blood cultures and patients with negative cultures at days 0-7, 8-30, and 31-180, controlling...

  12. Prognostic significance of transient myocardial ischaemia after first acute myocardial infarction: five year follow up study

    DEFF Research Database (Denmark)

    Mickley, H; Nielsen, J R; Berning, J

    1995-01-01

    infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...

  13. Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines

    Directory of Open Access Journals (Sweden)

    Ana-Maria Budai

    2010-10-01

    Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.

  14. ASURV: Astronomical SURVival Statistics

    Science.gov (United States)

    Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.

    2014-06-01

    ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.

  15. Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

    International Nuclear Information System (INIS)

    Weili, L; Jinling, L; Xingqi, L; Yuan, L

    2010-01-01

    The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

  16. Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

    Energy Technology Data Exchange (ETDEWEB)

    Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)

    2010-08-15

    The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

  17. Research on the cavitation characteristic of Kaplan turbine under sediment flow condition

    Science.gov (United States)

    Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.

    2010-08-01

    The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.

  18. Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

    Science.gov (United States)

    Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

    2011-03-28

    The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  19. The development of a new algorithm to calculate a survival function in non-parametric ways

    International Nuclear Information System (INIS)

    Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo

    2001-01-01

    In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory

  20. Clinical Significance of Preoperative Albumin and Globulin Ratio in Patients with Gastric Cancer Undergoing Treatment

    Directory of Open Access Journals (Sweden)

    Min-jie Mao

    2017-01-01

    Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.

  1. Registry of Hospital das Clínicas of the University of São Paulo Medical School: first official solid organ and tissue transplantation report - 2008

    Directory of Open Access Journals (Sweden)

    Estela Azeka

    2009-02-01

    Full Text Available OBJECTIVE: The aim of this study was to report a single center experience of organ and tissue transplantation INTRODUCTION: This is the first report of organ and tissue transplantation at the Hospital das Clínicas of the University of Sao Paulo Medical School. METHODS: We collected data from each type of organ transplantation from 2002 to 2007. The data collected were patient characteristics and actuarial survival Kaplan-Meier curves at 30 days, one year, and five years RESULTS: There were a total of 3,321 transplants at our institution and the 5-year survival curve ranged from 53% to 88%. CONCLUSION: This report shows that solid organ and tissue transplants are feasible within the institution and allow us to expect that the quality of transplantation will improve in the future.

  2. Isogeometric analysis of free-form Timoshenko curved beams including the nonlinear effects of large deformations

    Science.gov (United States)

    Hosseini, Seyed Farhad; Hashemian, Ali; Moetakef-Imani, Behnam; Hadidimoud, Saied

    2018-03-01

    In the present paper, the isogeometric analysis (IGA) of free-form planar curved beams is formulated based on the nonlinear Timoshenko beam theory to investigate the large deformation of beams with variable curvature. Based on the isoparametric concept, the shape functions of the field variables (displacement and rotation) in a finite element analysis are considered to be the same as the non-uniform rational basis spline (NURBS) basis functions defining the geometry. The validity of the presented formulation is tested in five case studies covering a wide range of engineering curved structures including from straight and constant curvature to variable curvature beams. The nonlinear deformation results obtained by the presented method are compared to well-established benchmark examples and also compared to the results of linear and nonlinear finite element analyses. As the nonlinear load-deflection behavior of Timoshenko beams is the main topic of this article, the results strongly show the applicability of the IGA method to the large deformation analysis of free-form curved beams. Finally, it is interesting to notice that, until very recently, the large deformations analysis of free-form Timoshenko curved beams has not been considered in IGA by researchers.

  3. Comparison of Pathologic Response Evaluation Systems after Anthracycline with/without Taxane-Based Neoadjuvant Chemotherapy among Different Subtypes of Breast Cancers.

    Directory of Open Access Journals (Sweden)

    Hee Jin Lee

    Full Text Available Several methods are used to assess the pathologic response of breast cancer after neoadjuvant chemotherapy (NAC to predict clinical outcome. However, the clinical utility of these systems for each molecular subtype of breast cancer is unclear. Therefore, we applied six pathologic response assessment systems to specific subtypes of breast cancer and compared the results.Five hundred and eighty eight breast cancer patients treated with anthracycline with/without taxane-based NAC were retrospectively analyzed, and the ypTNM stage, residual cancer burden (RCB, residual disease in breast and nodes (RDBN, tumor response ratio, Sataloff's classification, and Miller-Payne grading system were evaluated. The results obtained for each assessment system were analyzed in terms of patient survival.In triple-negative tumors, all systems were significantly associated with disease-free survival and Kaplan-Meier survival curves for disease-free survival were clearly separated by all assessment methods. For HR+/HER2- tumors, systems assessing the residual tumor (ypTNM stage, RCB, and RDBN had prognostic significance. However, for HER2+ tumors, the association between patient survival and the pathologic response assessment results varied according to the system used, and none resulted in distinct Kaplan-Meier curves.Most of the currently available pathologic assessment systems used after anthracycline with/without taxane-based NAC effectively classified triple-negative breast cancers into groups showing different prognoses. The pathologic assessment systems evaluating residual tumors only also had prognostic significance in HR+/HER2- tumors. However, new assessment methods are required to effectively evaluate the pathologic response of HR+/HER2+ and HR-/HER2+ tumors to anthracycline with/without taxane-based NAC.

  4. The Veterans Affairs Saint Louis University mental status exam (SLUMS exam) and the Mini-mental status exam as predictors of mortality and institutionalization.

    Science.gov (United States)

    Cruz-Oliver, D M; Malmstrom, T K; Allen, C M; Tumosa, N; Morley, J E

    2012-07-01

    To evaluate predictive validity of cognitive dysfunction of the Saint Louis University mental status (SLUMS) exam or mini-mental state exam (MMSE) for institutionalization and mortality after 7.5-years. Longitudinal study. Geriatric Research, Education and Clinical Center Veterans Affairs Hospital St. Louis, MO. Patients (N=705) were screened for cognitive dysfunction in 2003 using the SLUMS exam and MMSE, and mortality and institutionalization up to 7.5-years later were evaluated as outcome measures. The associations between outcome measures and MMSE and SLUMS exam total scores, and cognitive status were examined using Kaplan-Meier curves and Cox proportional-hazards regression. Five hundred thirty-three charts were reviewed, 176/533(33%) patients had died and 31/526 (6%) were institutionalized during 7.5-year follow-up period. All subjects were male with a mean age of 75 years and most had high school education or greater (71%). MMSE dementia, SLUMS dementia (ps<.001) and MCI (p<.05) groups had significantly lower survival rates than normal cognition group in the Kaplan-Meier curves. Scores classified as dementia on SLUMS (HR=2.4, 95% CI 1.6-3.7; p <.001) or MMSE (HR=2.3, 95% CI 1.5-3.6; p <.001) both predicted mortality and, also, institutionalization (SLUMS: HR=3.5, 95% CI 1.3-9.1; p <.01; MMSE: HR=3.8, 95% CI 1.6-9.0; p <.001) after adjustment for covariates. Unadjusted SLUMS exam MCI predicted morality (HR=1.5, 95% CI 1.1-2.2; p <.019) but not institutionalization. The SLUMS exam and MMSE both predict mortality and institutionalization for male patients screened as positive for dementia.

  5. Retinitis pigmentosa reduces the risk of proliferative diabetic retinopathy: a nationwide population-based cohort study.

    Directory of Open Access Journals (Sweden)

    Yuh-Fang Chen

    Full Text Available PURPOSE: To study the association between retinitis pigmentosa (RP and the progression of diabetic retinopathy (DR. METHODS: Using the Longitudinal Health Insurance Database 2000 of Taiwan, we identified individuals with an initial diagnosis for RP during the period of 1997-2008. A non-RP comparison group, 10-fold frequency matched by sex, age, index year and the year of diabetes diagnosed, were randomly selected from the same database. The occurrence of DR was observed for all subjects until the end of 2009. The Kaplan-Meier curves were used to illustrate the cumulative probability of developing DR for the RP group and comparison groups. The hazard ratio (HR of DR for the RP group relative to the comparison group was estimated using Cox proportional hazards model after adjusting for potential confounders. RESULTS: The Kaplan-Meier curves were not statistically significant different between the RP group and the comparison group. However, the RP group had a higher cumulative probability of developing DR during the first six to seven years. The cumulative probability kept increasing and became higher in the comparison group but remained unchanged in the RP group. The HR for the RP patients comparing with the comparison group was 0.96 (95% confidence interval (CI = 0.43-2.14. Stratified by severity, RP was associated with a non-statistically significant reduced risk of proliferative DR (PDR (HR = 0.70, 95% CI = 0.16-3.14. The HR for non-proliferative DR (NPDR was 1.08 (95% CI = 0.40-2.86. CONCLUSION: In this study, RP was not statistically significant associated with the incidence of DR.

  6. Predictive Factors for Visual Field Conversion: Comparison of Scanning Laser Polarimetry and Optical Coherence Tomography.

    Science.gov (United States)

    Diekmann, Theresa; Schrems-Hoesl, Laura M; Mardin, Christian Y; Laemmer, Robert; Horn, Folkert K; Kruse, Friedrich E; Schrems, Wolfgang A

    2018-02-01

    The purpose of this study was to compare the ability of scanning laser polarimetry (SLP) and spectral-domain optical coherence tomography (SD-OCT) to predict future visual field conversion of subjects with ocular hypertension and early glaucoma. All patients were recruited from the Erlangen glaucoma registry and examined using standard automated perimetry, 24-hour intraocular pressure profile, and optic disc photography. Peripapillary retinal nerve fiber layer thickness (RNFL) measurements were obtained by SLP (GDx-VCC) and SD-OCT (Spectralis OCT). Positive and negative predictive values (PPV, NPV) were calculated for morphologic parameters of SLP and SD-OCT. Kaplan-Meier survival curves were plotted and log-rank tests were performed to compare the survival distributions. Contingency tables and Venn-diagrams were calculated to compare the predictive ability. The study included 207 patients-75 with ocular hypertension, 85 with early glaucoma, and 47 controls. Median follow-up was 4.5 years. A total of 29 patients (14.0%) developed visual field conversion during follow-up. SLP temporal-inferior RNFL [0.667; 95% confidence interval (CI), 0.281-0.935] and SD-OCT temporal-inferior RNFL (0.571; 95% CI, 0.317-0.802) achieved the highest PPV; nerve fiber indicator (0.923; 95% CI, 0.876-0.957) and SD-OCT mean (0.898; 95% CI, 0.847-0.937) achieved the highest NPV of all investigated parameters. The Kaplan-Meier curves confirmed significantly higher survival for subjects within normal limits of measurements of both devices (P<0.001). Venn diagrams tested with McNemar test statistics showed no significant difference for PPV (P=0.219) or NPV (P=0.678). Both GDx-VCC and SD-OCT demonstrate comparable results in predicting future visual field conversion if taking typical scans for GDx-VCC. In addition, the likelihood ratios suggest that GDx-VCC's nerve fiber indicator<30 may be the most useful parameter to confirm future nonconversion. (http://www.ClinicalTrials.gov number, NTC

  7. Complementary Chinese herbal medicine therapy improves survival of patients with gastric cancer in Taiwan: A nationwide retrospective matched-cohort study.

    Science.gov (United States)

    Hung, Kuo-Feng; Hsu, Ching-Ping; Chiang, Jen-Huai; Lin, Hung-Jen; Kuo, Yi-Ting; Sun, Mao-Feng; Yen, Hung-Rong

    2017-03-06

    Many patients with gastric cancer seek traditional medicine consultations in Asian countries. This study aimed to investigate the prescription of Chinese herbal medicine (CHM) and its benefits for the patients with gastric cancer in Taiwan. From the Registry for Catastrophic Illness Patients Database, we included all patients with gastric cancer whose age at diagnosis was ≥18 from 1997 to 2010 in Taiwan. We used 1:1 frequency matching by age, sex, Charlson comorbidity score, treatment and index year to compare the CHM users and non-CHM users. We used the Cox regression model to compare the hazard ratios (HR) for the risk of mortality and the Kaplan-Meier curve for the survival time. There was a total of 1333 patients in the CHM-cohort and 44786 patients in the non-CHM cohort. After matching, we compared 962 newly diagnosed CHM users and 962 non-CHM users. Adjusted HRs (aHR) were higher among patients of above 60-year-old group, with a Charlson Comorbidity Index score ≥2 before the index date, and those who need surgery combined with chemotherapy or radiotherapy. CHM users had a lower HR of mortality risk (adjusted HR: 0.55, 95% CI: 0.48-0.62). Compared to the non-CHM users, the aHR among CHM-users is 0.37 (95% CI:0.2-0.67) for those who used CHM more than 180 days annually. The Kaplan-Meier curve revealed that the survival probability was higher for complementary CHM-users. Bai-Hua-She-She-Cao (Herba Hedyotidis Diffusae) was the most commonly used single herb and Xiang-Sha-Liu-Jun-Zi-Tang was the most commonly used herbal formula among CHM prescriptions. Complementary CHM improves the overall survival among patients with gastric cancer in Taiwan. Further ethnopharmacological investigations and clinical trials are required to validate the efficacy and safety. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  8. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

    International Nuclear Information System (INIS)

    Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

    2008-01-01

    Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

  9. Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks

    Directory of Open Access Journals (Sweden)

    Camelia Jianu

    2010-10-01

    Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.

  10. Detection of angiogenesis-dependent parameters by functional MRI: Correlation between histomorphology and evaluation of clinical relevance as prognostic factor for the example of cervical carcinoma

    International Nuclear Information System (INIS)

    Hawighorst, H.; Knopp, M.V.; Schoenberg, S.O.; Essig, M.; Kaick, G. van; Schaeffer, U.; Knapstein, P.G.; Weikel, W.

    1998-01-01

    Purpose: Purpose of this study is to compare functional MRI parameters with histomorphological markers of tumor microvessel density (MVD) and permeability (vascular endothelial growth factor) and to determine the ultimate value of both approaches by correlation with disease outcome in patients with primary cancer of the uterine cervix. Method: Pharmacokinetic parameters were calculated from contrast-enhanced dynamic MR imaging series in 37 patients with biopsy-proven primary cervical cancer. On the operative whole mount specimens, histomorphological markers of tumor angiogenesis (MVD, VEGF) were compared with the MRI-derived parameters. For MRI and histomorphological data, Kaplan-Meier survival curves were calculated and compared using logrank statistics. Results: Significant (p [de

  11. Magnitude of bacteraemia predicts one-year mortality

    DEFF Research Database (Denmark)

    Gradel, Kim Oren; Schønheyder, Henrik Carl; Søgaard, Mette

    Objectives: All hospitals in our region use the BacT/Alert® blood culture (BC) system with a 3-bottle BC set for adults. We hypothesized that the magnitude of bacteremia (i.e., number of positive bottles in the initial BC set) predicted one-year mortality. Methods In a population-based study we...... with a BC index of 1 (i.e., one positive bottle) were chosen as the reference group. We computed Kaplan-Meier curves and performed Cox regression analyses to estimate mortality rate ratios (MRRs) with 95 % confidence intervals [CIs] 30 and 365 days after the initial BC sampling date, first in crude analyses...... mortality....

  12. Anterolateral Knee Extra-articular Stabilizers: A Robotic Sectioning Study of the Anterolateral Ligament and Distal Iliotibial Band Kaplan Fibers.

    Science.gov (United States)

    Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F

    2018-05-01

    The individual kinematic roles of the anterolateral ligament (ALL) and the distal iliotibial band Kaplan fibers in the setting of anterior cruciate ligament (ACL) deficiency require further clarification. This will improve understanding of their potential contribution to residual anterolateral rotational laxity after ACL reconstruction and may influence selection of an anterolateral extra-articular reconstruction technique, which is currently a matter of debate. Hypothesis/Purpose: To compare the role of the ALL and the Kaplan fibers in stabilizing the knee against tibial internal rotation, anterior tibial translation, and the pivot shift in ACL-deficient knees. We hypothesized that the Kaplan fibers would provide greater tibial internal rotation restraint than the ALL in ACL-deficient knees and that both structures would provide restraint against internal rotation during a simulated pivot-shift test. Controlled laboratory study. Ten paired fresh-frozen cadaveric knees (n = 20) were used to investigate the effect of sectioning the ALL and the Kaplan fibers in ACL-deficient knees with a 6 degrees of freedom robotic testing system. After ACL sectioning, sectioning was randomly performed for the ALL and the Kaplan fibers. An established robotic testing protocol was utilized to assess knee kinematics when the specimens were subjected to a 5-N·m internal rotation torque (0°-90° at 15° increments), a simulated pivot shift with 10-N·m valgus and 5-N·m internal rotation torque (15° and 30°), and an 88-N anterior tibial load (30° and 90°). Sectioning of the ACL led to significantly increased tibial internal rotation (from 0° to 90°) and anterior tibial translation (30° and 90°) as compared with the intact state. Significantly increased internal rotation occurred with further sectioning of the ALL (15°-90°) and Kaplan fibers (15°, 60°-90°). At higher flexion angles (60°-90°), sectioning the Kaplan fibers led to significantly greater internal rotation

  13. Improvements in scaling of counter-current imbibition recovery curves using a shape factor including permeability anisotropy

    Science.gov (United States)

    Abbasi, Jassem; Sarafrazi, Shiva; Riazi, Masoud; Ghaedi, Mojtaba

    2018-02-01

    Spontaneous imbibition is the main oil production mechanism in the water invaded zone of a naturally fractured reservoir (NFR). Different scaling equations have been presented in the literature for upscaling of core scale imbibition recovery curves to field scale matrix blocks. Various scale dependent parameters such as gravity effects and boundary influences are required to be considered in the upscaling process. Fluid flow from matrix blocks to the fracture system is highly dependent on the permeability value in the horizontal and vertical directions. The purpose of this study is to include permeability anisotropy in the available scaling equations to improve the prediction of imbibition assisted oil production in NFRs. In this paper, a commercial reservoir simulator was used to obtain imbibition recovery curves for different scenarios. Then, the effect of permeability anisotropy on imbibition recovery curves was investigated, and the weakness of the existing scaling equations for anisotropic rocks was demonstrated. Consequently, an analytical shape factor was introduced that can better scale all the curves related to anisotropic matrix blocks.

  14. Aplicación y técnicas del análisis de supervivencia en las investigaciones clínicas Application and techniques of survival analysis in clinical research

    Directory of Open Access Journals (Sweden)

    Anissa Gramatges Ortiz

    2002-08-01

    Full Text Available Se realizó una actualización sobre el análisis de supervivencia en las investigaciones clínicas. Se expusieron algunos de los conceptos más generales sobre este tipo de análisis y las características de los tiempos de supervivencia.Se abordan temas relacionados con los diferentes métodos que facilitan la estimación de las probabilidades de supervivencia para uno o más grupos de individuos, con la ejemplificación del cálculo de las probabilidades para el método de Kaplan-Meier. Se destaca la comparación de la supervivencia de varios grupos atendiendo a distintos factores que los diferencian, así como también se enuncian algunas de las pruebas estadísticas que nos posibilitan la comparación, como son la prueba log rank y la Breslow, como alternativa de esta cuando se evidencia una divergencia del azar proporcional, es decir, cuando las curvas de supe DE SUPERVI rvivencia se cruzanconcepts of this type of analyses and the characteristics of survival times were presented. Aspects related with the different methods facilitating the estimation of survival probabilities for one or more groups of subjects, including the example of calculation of Kaplan Meier method´s probabilities were dealt with . The survival rates of several groups were compared, taking into consideration various factors that differentiate them. Some of the statistical tests making the comparison possible such as log rank test, and the Breslow test as an alternative of the former when there is a proportional random divergence, that is, when survival curves cross were stated

  15. Association between age at antiretroviral therapy initiation and 24-month immune response in West-African HIV-infected children

    DEFF Research Database (Denmark)

    Desmonde, Sophie; Dicko, Fatoumata; Koueta, Fla

    2014-01-01

    measurements, including one at ART initiation (baseline) were included. CD4 cell gain on ART was estimated using a multivariable linear mixed model adjusted for baseline variables: age, CD4 cell count, sex, first-line ART regimen. Kaplan-Meier survival curves and a Cox proportional hazards regression model...... compared immune recovery for age within 24 months post-ART. RESULTS: Of the 4808 children initiated on ART, 3014 were enrolled at a median age of 5.6 years; 61.2% were immunodeficient. After 12 months, children at least 4 years at baseline had significantly lower CD4 cell gains compared with children less...... these children, 75% reached immune recovery: 12-month rates were significantly highest in all those aged 2-5 years at ART initiation compared with those less than 2 years. Beyond 12 months on ART, immune recovery was significantly lower in children initiated more than 5 years (adjusted hazard ratio: 0.69, 95...

  16. Can a polynomial interpolation improve on the Kaplan-Yorke dimension?

    International Nuclear Information System (INIS)

    Richter, Hendrik

    2008-01-01

    The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems

  17. Adding gauge fields to Kaplan's fermions

    International Nuclear Information System (INIS)

    Blum, T.; Kaerkkaeinen, L.

    1994-01-01

    We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)

  18. Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

    NARCIS (Netherlands)

    de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.

    2012-01-01

    MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex

  19. Meier-Gorlin syndrome: Growth and secondary sexual development of a microcephalic primordial dwarfism disorder

    NARCIS (Netherlands)

    de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.

    2012-01-01

    Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This

  20. Challenges in risk estimation using routinely collected clinical data: The example of estimating cervical cancer risks from electronic health-records.

    Science.gov (United States)

    Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A

    2018-06-01

    Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Time trends in recurrence of juvenile nasopharyngeal angiofibroma: Experience of the past 4 decades.

    Science.gov (United States)

    Mishra, Anupam; Mishra, Subhash Chandra

    2016-01-01

    An analysis of time distribution of juvenile nasopharyngeal angiofibroma (JNA) from the last 4 decades is presented. Sixty recurrences were analyzed as per actuarial survival. SPSS software was used to generate Kaplan-Meier (KM) curves and time distributions were compared by Log-rank, Breslow and Tarone-Ware test. The overall recurrence rate was 17.59%. Majority underwent open transpalatal approach(es) without embolization. The probability of detecting a recurrence was 95% in first 24months and comparison of KM curves of 4 different time periods was not significant. This is the first and largest series to address the time-distribution. The required follow up period is 2years. Our recurrence is just half of the largest series (reported so far) suggesting the superiority of transpalatal techniques. The similarity of curves suggests less likelihood for recent technical advances to influence the recurrence that as per our hypothesis is more likely to reflect tumor biology per se. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. XRF and XANES Data for Kaplan U Paper

    Science.gov (United States)

    The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).

  3. Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine

    Directory of Open Access Journals (Sweden)

    Doina Frunzaverde

    2011-01-01

    Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.

  4. Calculating the dielectric anisotropy of nematic liquid crystals: a reinvestigation of the Maier–Meier theory

    International Nuclear Information System (INIS)

    Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan

    2009-01-01

    This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)

  5. Serum level of soluble urokinase-type plasminogen activator receptor is a strong and independent predictor of survival in human immunodeficiency virus infection

    DEFF Research Database (Denmark)

    Sidenius, N; Sier, C.F.M.; Ullum, H

    2000-01-01

    levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...

  6. Increased risk of revision for infection in rheumatoid arthritis patients with total hip replacements

    DEFF Research Database (Denmark)

    Schrama, Johannes Cornelis; Fenstad, Anne M; Dale, Håvard

    2015-01-01

    Background and purpose-Medical treatment of rheumatoid arthritis (RA) has changed dramatically over the last 15 years, including immune modulation. We investigated the risk of revision for infection after primary total hip replacement (THR) in patients with rheumatoid arthritis over a 16-year...... period, and compared it with that in THR patients with osteoarthritis (OA).Patients and methods-We identified 13,384 THRs in RA patients and 377,287 THRs in OA patients from 1995 through 2010 in a dataset from the Nordic Arthroplasty Register Association (NARA). Kaplan-Meier survival curves......, with revision for infection as the endpoint, were constructed. Cox regression analyses were performed to calculate the relative risk (RR) of revision for infection adjusted for age, sex, fixation technique, and year of primary surgery.Results-RA patients had a 1.3 times (95% CI 1.0-1.6) higher risk of revision...

  7. Perturbative analysis for Kaplan's lattice chiral fermions

    International Nuclear Information System (INIS)

    Aoki, S.; Hirose, H.

    1994-01-01

    Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls

  8. Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies

    International Nuclear Information System (INIS)

    Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.

    2007-01-01

    Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients

  9. Red cell distribution width and its association with mortality in neonatal sepsis.

    Science.gov (United States)

    Martin, Snehal L; Desai, Saumil; Nanavati, Ruchi; Colah, Roshan B; Ghosh, Kanjaksha; Mukherjee, Malay B

    2018-01-08

    Neonatal sepsis is a major cause of mortality in the developing countries. However, with current severity scores and laboratory parameters, predicting outcomes of neonatal sepsis is a serious challenge. Red cell distribution width (RDW) is a readily available pragmatic means to predict outcomes of various comorbidities in adults and children, without causing any additional blood loss. However, its utility in neonates remains unexplored. Hence, the objective of the present study was to evaluate the association of RDW with neonatal sepsis and its role as a predictive marker for mortality. This Prospective observational study was carried out in a Level IIIB NICU for a period of 3 years. It involved comparison of RDW values of septic neonates with those of controls (matched for gestational age and birth weight) with an equal allocation ratio. A total of 251 septic neonates along with 251 controls >28 weeks of gestational age were enrolled. The RDW was derived from complete blood count done within first 6 hours of life. After arranging the RDW (median; interquartile range (IQR)), the values were categorized as those above the 50th percentile i.e. ≥20% and those below the 50th percentile i.e. rates of the above two groups were assessed using the Kaplan-Meier curve and the log rank test. RDW levels were significantly higher among the neonatal sepsis cases (19.90%) as compared to the controls (18.90%) with a p value of < .001. RDW was significantly higher amongst the nonsurvivors than survivors (p < .003). Kaplan-Meier curve showed that septic neonates having RDW values ≥20% had significantly increased mortality (p < .02) with a hazard ratio of 0.5. High RDW is associated with neonatal sepsis and is an independent outcome predictor for mortality associated with neonatal sepsis.

  10. A crowdsourced nickel-and-dime approach to analog OBM research: A behavioral economic framework for understanding workforce attrition.

    Science.gov (United States)

    Henley, Amy J; DiGennaro Reed, Florence D; Reed, Derek D; Kaplan, Brent A

    2016-09-01

    Incentives are a popular method to achieve desired employee performance; however, research on optimal incentive magnitude is lacking. Behavioral economic demand curves model persistence of responding in the face of increasing cost and may be suitable to examine the reinforcing value of incentives on work performance. The present use-inspired basic study integrated an experiential human operant task within a crowdsourcing platform to evaluate the applicability of behavioral economics for quantifying changes in workforce attrition. Participants included 88 Amazon Mechanical Turk Workers who earned either a $0.05 or $0.10 incentive for completing a progressively increasing response requirement. Analyses revealed statistically significant differences in breakpoint between the two groups. Additionally, a novel translation of the Kaplan-Meier survival-curve analyses for use within a demand curve framework allowed for examination of elasticity of workforce attrition. Results indicate greater inelastic attrition in the $0.05 group. We discuss the benefits of a behavioral economic approach to modeling employee behavior, how the metrics obtained from the elasticity of workforce attrition analyses (e.g., P max ) may be used to set goals for employee behavior while balancing organizational costs, and how economy type may have influenced observed outcomes. © 2016 Society for the Experimental Analysis of Behavior.

  11. Axial U(1) current in Grabowska and Kaplan's formulation

    Science.gov (United States)

    Hamada, Yu; Kawai, Hikaru

    2017-06-01

    Recently, Grabowska and Kaplan [Phys. Rev. Lett. 116, 211602 (2016); Phys. Rev. D 94, 114504 (2016)] suggested a nonperturbative formulation of a chiral gauge theory, which consists of the conventional domain-wall fermion and a gauge field that evolves by gradient flow from one domain wall to the other. We introduce two sets of domain-wall fermions belonging to complex conjugate representations so that the effective theory is a 4D vector-like gauge theory. Then, as a natural definition of the axial-vector current, we consider a current that generates simultaneous phase transformations for the massless modes in 4 dimensions. However, this current is exactly conserved and does not reproduce the correct anomaly. In order to investigate this point precisely, we consider the mechanism of the conservation. We find that this current includes not only the axial current on the domain wall but also a contribution from the bulk, which is nonlocal in the sense of 4D fields. Therefore, the local current is obtained by subtracting the bulk contribution from it.

  12. A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines

    Science.gov (United States)

    Pennacchi, P.; Borghesani, P.; Chatterton, S.

    2015-08-01

    Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.

  13. Comparison of colorectal and gastric cancer: Survival and prognostic factors

    International Nuclear Information System (INIS)

    Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R

    2009-01-01

    Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)

  14. The preoperative plasma fibrinogen level is an independent prognostic factor for overall survival of breast cancer patients who underwent surgical treatment.

    Science.gov (United States)

    Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming

    2015-12-01

    Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Correlations of Hemoglobin Level and Perioperative Blood Transfusion with the Prognosis of Gastric Cancer: A Retrospective Study.

    Science.gov (United States)

    Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng

    2017-05-23

    BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.

  16. Large mass limit of the continuum theories in Kaplan's formulation

    International Nuclear Information System (INIS)

    Kawano, T.; Kikukawa, Y.

    1994-01-01

    Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense

  17. Prevalence and mortality of cancer among HIV-infected inpatients in Beijing, China.

    Science.gov (United States)

    Yang, Jun; Su, Shu; Zhao, Hongxin; Wang, Dennis; Wang, Jiali; Zhang, Fujie; Zhao, Yan

    2016-02-16

    Cancer is responsible for elevated HIV-related morbidity and mortality. Research on HIV-infected patients with concurrent cancer is rare in China. The purpose of our study was to investigate the prevalence and risk factors associated with cancer among HIV-infected inpatients in Beijing, and to investigate the mortality and risk factors among HIV-infected inpatients with cancer. Hospital records from a total of 1946 HIV-infected patients were collected from the Beijing Ditan Hospital. The data, from 2008 to 2013, were collected retrospectively. The cancer diagnoses included AIDS-defining cancers (ADC) and non-AIDS defining cancers (NADC). Logistic regression was used to identify risk factors predicting the concurrence of cancer with HIV. Mortality was examined using Kaplan-Meier estimates and Cox proportional hazards models. 7.7 % (149 cases) of all HIV-infected inpatients had concurrent cancer at their first hospital admission; of those, 33.6 % (50 cases) had ADCs, and 66.4 % (99 cases) had NADCs. The most prevalent NADCs were Hodgkin's lymphoma, gastrointestinal cancer, liver cancer, and lung cancer. Patients who did not accept antiretroviral therapy (ART) were more likely to suffer from cancer [AOR = 2.07 (1.42-3.01), p = 0.001]. Kaplan-Meier curves indicated that the survival probability of HIV-positive cancer patients was significantly lower than that of HIV-positive cancer-free patients (log-rank test, p cancer, the mortality was also higher among those who did not receive ART [AHR = 2.19 (1.84-2.61), p cancer concurrence among hospitalized HIV-infected patients was 7.7 %. Concurrent cancer also increased mortality among HIV-infected patients. ART was protective against concurrent cancer as well as mortality among HIV-infected cancer patients. These results highlight the importance of promoting cancer screening and early ART initiation among HIV-infected patients.

  18. Heart transplant outcomes in recipients of Centers for Disease Control (CDC) high risk donors.

    Science.gov (United States)

    Tsiouris, Athanasios; Wilson, Lynn; Sekar, Rajesh B; Mangi, Abeel A; Yun, James J

    2016-12-01

    A lack of donor hearts remains a major limitation of heart transplantation. Hearts from Centers for Disease Control (CDC) high-risk donors can be utilized with specific recipient consent. However, outcomes of heart transplantation with CDC high-risk donors are not well known. We sought to define outcomes, including posttransplant hepatitis and human immunodeficiency virus (HIV) status, in recipients of CDC high-risk donor hearts at our institution. All heart transplant recipients from August 2010 to December 2014 (n = 74) were reviewed. Comparison of 1) CDC high-risk donor (HRD) versus 2) standard-risk donor (SRD) groups were performed using chi-squared tests for nominal data and Wilcoxon two-sample tests for continuous variables. Survival was estimated with Kaplan-Meier curves. Of 74 heart transplant recipients reviewed, 66 (89%) received a SRD heart and eight (11%) received a CDC HRD heart. We found no significant differences in recipient age, sex, waiting list 1A status, pretransplant left ventricular assist device (LVAD) support, cytomegalovirus (CMV) status, and graft ischemia times (p = NS) between the HRD and SRD groups. All of the eight HRD were seronegative at the time of transplant. Postoperatively, there was no significant difference in rejection rates at six and 12 months posttransplant. Importantly, no HRD recipients acquired hepatitis or HIV. Survival in HRD versus SRD recipients was not significantly different by Kaplan-Meier analysis (log rank p = 0.644) at five years posttransplant. Heart transplants that were seronegative at the time of transplant had similar posttransplant graft function, rejection rates, and five-year posttransplant survival versus recipients of SRD hearts. At our institution, no cases of hepatitis or HIV occurred in HRD recipients in early follow-up. © 2016 Wiley Periodicals, Inc.

  19. Statins Reduces the Risk of Dementia in Patients with Late-Onset Depression: A Retrospective Cohort Study.

    Science.gov (United States)

    Yang, Ya-Hsu; Teng, Hao-Wei; Lai, Yen-Ting; Li, Szu-Yuan; Lin, Chih-Ching; Yang, Albert C; Chan, Hsiang-Lin; Hsieh, Yi-Hsuan; Lin, Chiao-Fan; Hsu, Fu-Ying; Liu, Chih-Kuang; Liu, Wen-Sheng

    2015-01-01

    Patients with late-onset depression (LOD) have been reported to run a higher risk of subsequent dementia. The present study was conducted to assess whether statins can reduce the risk of dementia in these patients. We used the data from National Health Insurance of Taiwan during 1996-2009. Standardized Incidence Ratios (SIRs) were calculated for LOD and subsequent dementia. The criteria for LOD diagnoses included age ≥65 years, diagnosis of depression after 65 years of age, at least three service claims, and treatment with antidepressants. The time-dependent Cox proportional hazards model was applied for multivariate analyses. Propensity scores with the one-to-one nearest-neighbor matching model were used to select matching patients for validation studies. Kaplan-Meier curve estimate was used to measure the group of patients with dementia living after diagnosis of LOD. Totally 45,973 patients aged ≥65 years were enrolled. The prevalence of LOD was 12.9% (5,952/45,973). Patients with LOD showed to have a higher incidence of subsequent dementia compared with those without LOD (Odds Ratio: 2.785; 95% CI 2.619-2.958). Among patients with LOD, lipid lowering agent (LLA) users (for at least 3 months) had lower incidence of subsequent dementia than non-users (Hazard Ratio = 0.781, 95% CI 0.685-0.891). Nevertheless, only statins users showed to have reduced risk of dementia (Hazard Ratio = 0.674, 95% CI 0.547-0.832) while other LLAs did not, which was further validated by Kaplan-Meier estimates after we used the propensity scores with the one-to-one nearest-neighbor matching model to control the confounding factors. Statins may reduce the risk of subsequent dementia in patients with LOD.

  20. Chemokine-like factor-like MARVEL transmembrane domain-containing 3 expression is associated with a favorable prognosis in esophageal squamous cell carcinoma.

    Science.gov (United States)

    Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin

    2017-05-01

    Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic

  1. Safety, tolerability, and initial efficacy of AZD6140, the first reversible oral adenosine diphosphate receptor antagonist, compared with clopidogrel, in patients with non-ST-segment elevation acute coronary syndrome: primary results of the DISPERSE-2 trial

    DEFF Research Database (Denmark)

    Cannon, Christopher P; Husted, Steen; Harrington, Robert A

    2007-01-01

    , or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...

  2. Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease

    Directory of Open Access Journals (Sweden)

    Rabah M. Shawky

    2014-10-01

    Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.

  3. Air injection test on a Kaplan turbine: prototype - model comparison

    Science.gov (United States)

    Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.

    2016-11-01

    Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.

  4. Repair of a Kaplan blade sealing surface without dismantling the turbine; Instandsetzung einer Kaplanschaufel-Dichtflaeche ohne Turbinendemontage

    Energy Technology Data Exchange (ETDEWEB)

    Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)

    2008-07-01

    In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)

  5. A void ratio dependent water retention curve model including hydraulic hysteresis

    Directory of Open Access Journals (Sweden)

    Pasha Amin Y.

    2016-01-01

    Full Text Available Past experimental evidence has shown that Water Retention Curve (WRC evolves with mechanical stress and structural changes in soil matrix. Models currently available in the literature for capturing the volume change dependency of WRC are mainly empirical in nature requiring an extensive experimental programme for parameter identification which renders them unsuitable for practical applications. In this paper, an analytical model for the evaluation of the void ratio dependency of WRC in deformable porous media is presented. The approach proposed enables quantification of the dependency of WRC on void ratio solely based on the form of WRC at the reference void ratio and requires no additional parameters. The effect of hydraulic hysteresis on the evolution process is also incorporated in the model, an aspect rarely addressed in the literature. Expressions are presented for the evolution of main and scanning curves due to loading and change in the hydraulic path from scanning to main wetting/drying and vice versa as well as the WRC parameters such as air entry value, air expulsion value, pore size distribution index and slope of the scanning curve. The model is validated using experimental data on compacted and reconstituted soils subjected to various hydro-mechanical paths. Good agreement is obtained between model predictions and experimental data in all the cases considered.

  6. Mini-mental state examination as a predictor of mortality among older people referred to secondary mental healthcare.

    Science.gov (United States)

    Su, Yu-Ping; Chang, Chin-Kuo; Hayes, Richard D; Perera, Gayan; Broadbent, Matthew; To, David; Hotopf, Matthew; Stewart, Robert

    2014-01-01

    Lower levels of cognitive function have been found to be associated with higher mortality in older people, particularly in dementia, but the association in people with other mental disorders is still inconclusive. Data were analysed from a large mental health case register serving a geographic catchment of 1.23 million residents, and associations were investigated between cognitive function measured by the Mini-Mental State Examination (MMSE) and survival in patients aged 65 years old and over. Cox regressions were carried out, adjusting for age, gender, psychiatric diagnosis, ethnicity, marital status, and area-level socioeconomic index. A total of 6,704 subjects were involved, including 3,368 of them having a dementia diagnosis and 3,336 of them with depression or other diagnoses. Descriptive outcomes by Kaplan-Meier curves showed significant differences between those with normal and impaired cognitive function (MMSE scoremental health services regardless of a dementia diagnosis. Causal pathways between this exposure and outcome (for example, suboptimal healthcare) need further investigation.

  7. PRAME gene expression profile in medulloblastoma

    Directory of Open Access Journals (Sweden)

    Tânia Maria Vulcani-Freitas

    2011-02-01

    Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.

  8. TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier

    Index Scriptorium Estoniae

    Tursk, Eda

    2004-01-01

    Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan

  9. Atlas of stress-strain curves

    CERN Document Server

    2002-01-01

    The Atlas of Stress-Strain Curves, Second Edition is substantially bigger in page dimensions, number of pages, and total number of curves than the previous edition. It contains over 1,400 curves, almost three times as many as in the 1987 edition. The curves are normalized in appearance to aid making comparisons among materials. All diagrams include metric (SI) units, and many also include U.S. customary units. All curves are captioned in a consistent format with valuable information including (as available) standard designation, the primary source of the curve, mechanical properties (including hardening exponent and strength coefficient), condition of sample, strain rate, test temperature, and alloy composition. Curve types include monotonic and cyclic stress-strain, isochronous stress-strain, and tangent modulus. Curves are logically arranged and indexed for fast retrieval of information. The book also includes an introduction that provides background information on methods of stress-strain determination, on...

  10. Moderate precision of prognostic scoring systems in a consecutive, prospective cohort of 544 patients with metastatic spinal cord compression

    DEFF Research Database (Denmark)

    Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck

    2014-01-01

    and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....

  11. Equity and improvement in outcome of breast cancer in Denmark

    DEFF Research Database (Denmark)

    Andreasen, A H; Mouridsen, H T; Andersen, K W

    1994-01-01

    The trend in the prognosis for female breast cancer patients was investigated by comparing Kaplan-Meier survival curves of different patient cohorts diagnosed during the period 1948-87. The study is based on 71,448 patients from the Danish Cancer Registry. The cohorts were defined by age...... in other parts of Denmark. For patients diagnosed in 1978-87 the prognosis, however, reached an equal level in all parts of the country. Thus, it is reasonable to assume that the national programme introduced in 1977 by the Danish Breast Cancer Cooperative Group (DBCG) has played an important role...... and not only brought about therapeutic improvements in breast cancer treatment in Denmark, but also ensured equity in the outcome on a national scale....

  12. Going Large or Going Small in Plant Design: Comparison between a P.P. with three small Kaplan turbines and a P.P. with just one Large Kaplan turbine

    Science.gov (United States)

    Castro-Otero, C.

    2017-04-01

    Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.

  13. High mortality risk among individuals assumed to be TB-negative can be predicted using a simple test

    DEFF Research Database (Denmark)

    Rabna, Paulo; Andersen, Andreas; Wejse, Christian

    2009-01-01

    1007 aTBneg individuals who were enrolled from 2004 to 2006; 4983 age-matched controls were followed for comparison. Plasma suPAR levels were measured using the suPARnostic ELISA. Survival was analysed using Cox regression, ROC curves and Kaplan-Meier analysis. RESULTS: After 3 months of follow......-up, mortality was 21 per 100 person-year-observation (PYO) among aTBneg individuals and three per 100 PYO among the control population [mortality rate ratio (MRR) = 6.92 (95% CI 4.48-10.7)]. SuPAR values ranged between 0.9 and 45 ng/ml in aTBneg individuals. A log-linear relationship was found between su......PAR levels linear range, a 1 ng/ml increase was associated with a 46% increase in the mortality rate: MRR = 1.46 (95% CI 1.34-1.59). The area under the ROC curves was 0.88 for HIV-positive individuals and 0.79 for HIV-negative individuals. CONCLUSIONS: Our study showed...

  14. On the Importance of Accounting for Competing Risks in Pediatric Cancer Trials Designed to Delay or Avoid Radiotherapy: I. Basic Concepts and First Analyses

    International Nuclear Information System (INIS)

    Tai, Bee-Choo; Grundy, Richard G.; Machin, David

    2010-01-01

    Purpose: In trials designed to delay or avoid irradiation among children with malignant brain tumor, although irradiation after disease progression is an important event, patients who have disease progression may decline radiotherapy (RT), or those without disease progression may opt for elective RT. To accurately describe the cumulative need for RT in such instances, it is crucial to account for these distinct events and to evaluate how each contributes to the delay or advancement of irradiation via a competing risks analysis. Methods and Materials: We describe the summary of competing events in such trials using competing risks methods based on cumulative incidence functions and Gray's test. The results obtained are contrasted with standard survival methods based on Kaplan-Meier curves, cause-specific hazard functions and log-rank test. Results: The Kaplan-Meier method overestimates all event-specific rates. The cause-specific hazard analysis showed reduction in hazards for all events (A: RT after progression; B: no RT after progression; C: elective RT) among children with ependymoma. For event A, a higher cumulative incidence was reported for ependymoma. Although Gray's test failed to detect any difference (p = 0.331) between histologic subtypes, the log-rank test suggested marginal evidence (p = 0.057). Similarly, for event C, the log-rank test found stronger evidence of reduction in hazard among those with ependymoma (p = 0.005) as compared with Gray's test (p = 0.086). Conclusions: To evaluate treatment differences, failing to account for competing risks using appropriate methodology may lead to incorrect interpretations.

  15. pFAK-Y397 overexpression as both a prognostic and a predictive biomarker for patients with metastatic osteosarcoma.

    Science.gov (United States)

    Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit

    2017-01-01

    Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.

  16. The prognostic value of metabolic tumor volume in FDG PET/CT evaluation of post-operative survival in patients with esophageal squamous cell cancer

    International Nuclear Information System (INIS)

    Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li

    2011-01-01

    Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)

  17. Pesticide mixtures in the Swedish streams: Environmental risks, contributions of individual compounds and consequences of single-substance oriented risk mitigation.

    Science.gov (United States)

    Gustavsson, Mikael; Kreuger, Jenny; Bundschuh, Mirco; Backhaus, Thomas

    2017-11-15

    This paper presents the ecotoxicological assessment and environmental risk evaluation of complex pesticide mixtures occurring in freshwater ecosystems in southern Sweden. The evaluation is based on exposure data collected between 2002 and 2013 by the Swedish pesticide monitoring program and includes 1308 individual samples, detecting mixtures of up to 53 pesticides (modal=8). Pesticide mixture risks were evaluated using three different scenarios for non-detects (best-case, worst-case and using the Kaplan-Meier method). The risk of each scenario was analyzed using Swedish Water Quality Objectives (WQO) and trophic-level specific environmental thresholds. Using the Kaplan-Meier method the environmental risk of 73% of the samples exceeded acceptable levels, based on an assessment using Concentration-Addition and WQOs for the individual pesticides. Algae were the most sensitive organism group. However, analytical detection limits, especially for insecticides, were insufficient to analyze concentrations at or near their WQO's. Thus, the risk of the analyzed pesticide mixtures to crustaceans and fish is systematically underestimated. Treating non-detects as being present at their individual limit of detection increased the estimated risk by a factor 100 or more, compared to the best-case or the Kaplan-Meier scenario. Pesticide mixture risks are often driven by only 1-3 compounds. However, the risk-drivers (i.e., individual pesticides explaining the largest share of potential effects) differ substantially between sites and samples, and 83 of the 141 monitored pesticides need to be included in the assessment to account for 95% of the risk at all sites and years. Single-substance oriented risk mitigation measures that would ensure that each individual pesticide is present at a maximum of 95% of its individual WQO, would also reduce the mixture risk, but only from a median risk quotient of 2.1 to a median risk quotient of 1.8. Also, acceptable total risk levels would still

  18. Censoring: a new approach for detection limits in total-reflection X-ray fluorescence

    International Nuclear Information System (INIS)

    Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.

    2004-01-01

    It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for

  19. 18F-Fluorodeoxyglucose PET/CT and dynamic contrast-enhanced MRI as imaging biomarkers in malignant pleural mesothelioma.

    Science.gov (United States)

    Hall, David O; Hooper, Clare E; Searle, Julie; Darby, Michael; White, Paul; Harvey, John E; Braybrooke, Jeremy P; Maskell, Nick A; Masani, Vidan; Lyburn, Iain D

    2018-02-01

    The purpose of this study was to compare the use of fluorine-18-fluorodeoxyglucose (F-FDG) PET with computed tomography (CT) and dynamic contrast-enhanced (DCE) MRI to predict prognosis and monitor treatment in malignant pleural mesothelioma. F-FDG PET/CT and DCE-MRI studies carried out as part of the South West Area Mesothelioma Pemetrexed trial were used. F-FDG PET/CT and DCE-MRI studies were carried out before treatment, and after two cycles of chemotherapy, on patients treated with pemetrexed and cisplatin. A total of 73 patients were recruited, of whom 65 had PET/CT and DCE-MRI scans. Baseline measurements from F-FDG PET/CT (maximum standardized uptake value, metabolic tumour volume and total lesion glycolysis) and DCE-MRI (integrated area under the first 90s of the curve and washout slope) were compared with overall survival (OS) using Kaplan-Meier and Cox regression analyses, and changes in imaging measurements were compared with disease progression. PET/CT and DCE-MRI measurements were not correlated with each other. Maximum standardized uptake value, metabolic tumour volume and total lesion glycolysis were significantly related to OS with Cox regression analysis and Kaplan-Meir analysis, and DCE-MRI washout curve shape was significantly related to OS. DCE-MRI curve shape can be combined with F-FDG PET/CT to give additional prognostic information. Changes in measurements were not related to progression-free survival. F-FDG PET/CT and DCE-MRI give prognostic information in malignant pleural mesothelioma. Neither PET/CT nor DCE-MRI is useful for monitoring disease progression.

  20. Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study

    DEFF Research Database (Denmark)

    Kammersgaard, Lars Peter; Olsen, Tom Skyhøj

    2005-01-01

    population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...

  1. Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study

    DEFF Research Database (Denmark)

    Kammersgaard, Lars Peter; Olsen, Tom Skyhøj

    2005-01-01

    population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...

  2. Numerical investigation of tip clearance cavitation in Kaplan runners

    Science.gov (United States)

    Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.

    2016-11-01

    There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.

  3. Nested Cohort - R software package

    Science.gov (United States)

    NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.

  4. Increased expression of CD133 and reduced dystroglycan expression are strong predictors of poor outcome in colon cancer patients

    Directory of Open Access Journals (Sweden)

    Coco Claudio

    2012-09-01

    Full Text Available Abstract Background Expression levels of CD133, a cancer stem cell marker, and of the α-subunit of the dystroglycan (α-DG complex, have been previously reported to be altered in colorectal cancers. Methods Expression levels of CD133 and α-DG were assessed by immunohistochemistry in a series of colon cancers and their prognostic significance was evaluated. Results Scattered cells positive for CD133 were rarely detected at the bases of the crypts in normal colonic mucosa while in cancer cells the median percentage of positive cells was 5% (range 0–80. A significant correlation was observed with pT parameter and tumor stage but not with tumor grade and N status. Recurrence and death from disease were significantly more frequent in CD133-high expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor groups for both disease-free (p = 0.002 and overall (p = 0.008 survival. Expression of α-DG was reduced in a significant fraction of tumors but low α-DG staining did not correlate with any of the classical clinical-pathological parameters. Recurrence and death from the disease were significantly more frequent in α-DG-low expressing tumors and Kaplan-Meier curves showed a significant separation between high vs low expressor tumors for both disease-free (p = 0.02 and overall (p = 0.02 survival. Increased expression of CD133, but not loss of α-DG, confirmed to be an independent prognostic parameters at a multivariate analysis associated with an increased risk of recurrence (RR = 2.4; p = 0.002 and death (RR = 2.3; p = 0.003. Conclusions Loss of α-DG and increased CD133 expression are frequent events in human colon cancer and evaluation of CD133 expression could help to identify high-risk colon cancer patients.

  5. A network-based predictive gene-expression signature for adjuvant chemotherapy benefit in stage II colorectal cancer.

    Science.gov (United States)

    Cao, Bangrong; Luo, Liping; Feng, Lin; Ma, Shiqi; Chen, Tingqing; Ren, Yuan; Zha, Xiao; Cheng, Shujun; Zhang, Kaitai; Chen, Changmin

    2017-12-13

    The clinical benefit of adjuvant chemotherapy for stage II colorectal cancer (CRC) is controversial. This study aimed to explore novel gene signature to predict outcome benefit of postoperative 5-Fu-based therapy in stage II CRC. Gene-expression profiles of stage II CRCs from two datasets with 5-Fu-based adjuvant chemotherapy (training dataset, n = 212; validation dataset, n = 85) were analyzed to identify the indicator. A systemic approach by integrating gene-expression and protein-protein interaction (PPI) network was implemented to develop the predictive signature. Kaplan-Meier curves and Cox proportional hazards model were used to determine the survival benefit of adjuvant chemotherapy. Experiments with shRNA knock-down were carried out to confirm the signature identified in this study. In the training dataset, we identified 44 PPI sub-modules, by which we separate patients into two clusters (1 and 2) having different chemotherapeutic benefit. A predictor of 11 PPI sub-modules (11-PPI-Mod) was established to discriminate the two sub-groups, with an overall accuracy of 90.1%. This signature was independently validated in an external validation dataset. Kaplan-Meier curves showed an improved outcome for patients who received adjuvant chemotherapy in Cluster 1 sub-group, but even worse survival for those in Cluster 2 sub-group. Similar results were found in both the training and the validation dataset. Multivariate Cox regression revealed an interaction effect between 11-PPI-Mod signature and adjuvant therapy treatment in the training dataset (RFS, p = 0.007; OS, p = 0.006) and the validation dataset (RFS, p = 0.002). From the signature, we found that PTGES gene was up-regulated in CRC cells which were more resistant to 5-Fu. Knock-down of PTGES indicated a growth inhibition and up-regulation of apoptotic markers induced by 5-Fu in CRC cells. Only a small proportion of stage II CRC patients could benefit from adjuvant therapy. The 11-PPI-Mod as

  6. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  7. MO-DE-207B-03: Improved Cancer Classification Using Patient-Specific Biological Pathway Information Via Gene Expression Data

    Energy Technology Data Exchange (ETDEWEB)

    Young, M; Craft, D [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States)

    2016-06-15

    Purpose: To develop an efficient, pathway-based classification system using network biology statistics to assist in patient-specific response predictions to radiation and drug therapies across multiple cancer types. Methods: We developed PICS (Pathway Informed Classification System), a novel two-step cancer classification algorithm. In PICS, a matrix m of mRNA expression values for a patient cohort is collapsed into a matrix p of biological pathways. The entries of p, which we term pathway scores, are obtained from either principal component analysis (PCA), normal tissue centroid (NTC), or gene expression deviation (GED). The pathway score matrix is clustered using both k-means and hierarchical clustering, and a clustering is judged by how well it groups patients into distinct survival classes. The most effective pathway scoring/clustering combination, per clustering p-value, thus generates various ‘signatures’ for conventional and functional cancer classification. Results: PICS successfully regularized large dimension gene data, separated normal and cancerous tissues, and clustered a large patient cohort spanning six cancer types. Furthermore, PICS clustered patient cohorts into distinct, statistically-significant survival groups. For a suboptimally-debulked ovarian cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00127) showed significant improvement over that of a prior gene expression-classified study (p = .0179). For a pancreatic cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00141) showed significant improvement over that of a prior gene expression-classified study (p = .04). Pathway-based classification confirmed biomarkers for the pyrimidine, WNT-signaling, glycerophosphoglycerol, beta-alanine, and panthothenic acid pathways for ovarian cancer. Despite its robust nature, PICS requires significantly less run time than current pathway scoring methods. Conclusion: This work validates the PICS method to improve

  8. Establishment and validation of a predictive nomogram model for non-small cell lung cancer patients with chronic hepatitis B viral infection.

    Science.gov (United States)

    Chen, Shulin; Lai, Yanzhen; He, Zhengqiang; Li, Jianpei; He, Xia; Shen, Rui; Ding, Qiuying; Chen, Hao; Peng, Songguo; Liu, Wanli

    2018-05-04

    This study aimed to establish an effective predictive nomogram for non-small cell lung cancer (NSCLC) patients with chronic hepatitis B viral (HBV) infection. The nomogram was based on a retrospective study of 230 NSCLC patients with chronic HBV infection. The predictive accuracy and discriminative ability of the nomogram were determined by a concordance index (C-index), calibration plot and decision curve analysis and were compared with the current tumor, node, and metastasis (TNM) staging system. Independent factors derived from Kaplan-Meier analysis of the primary cohort to predict overall survival (OS) were all assembled into a Cox proportional hazards regression model to build the nomogram model. The final model included age, tumor size, TNM stage, treatment, apolipoprotein A-I, apolipoprotein B, glutamyl transpeptidase and lactate dehydrogenase. The calibration curve for the probability of OS showed that the nomogram-based predictions were in good agreement with the actual observations. The C-index of the model for predicting OS had a superior discrimination power compared with the TNM staging system [0.780 (95% CI 0.733-0.827) vs. 0.693 (95% CI 0.640-0.746), P  20.0). The proposed nomogram model resulted in more accurate prognostic prediction for NSCLC patients with chronic HBV infection.

  9. ORIGINAL ARTICLES Antiretroviral treatment for children

    African Journals Online (AJOL)

    Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.

  10. Analyzing repeated data collected by mobile phones and frequent text messages. An example of Low back pain measured weekly for 18 weeks

    DEFF Research Database (Denmark)

    Axén, Iben; Bodin, Lennart; Kongsted, Alice

    2012-01-01

    to recovery? This question was answered using survival analysis, illustrated in Kaplan-Meier curves, Proportional Hazard regression analyses and spline regression analyses. 4: How is the repeatedly measured data associated with baseline (predictor) variables? This question was answered using generalized...... involves some challenges. Vital issues to consider are the within-subject correlation, the between measurement occasion correlation and the presence of missing values. The overall aim of this commentary is to describe different methods of analyzing repeated data. It is meant to give an overview...... for the clinical researcher in order for complex outcome measures to be interpreted in a clinically meaningful way. METHODS: A model data set was formed using data from two clinical studies, where patients with low back pain were followed with weekly text messages for 18 weeks. Different research questions...

  11. Protective effect of Asparagus racemosus root extract against lethal total - body electron beam radiation induced damage in Swiss albino mice

    International Nuclear Information System (INIS)

    Sharmila, K.P.; Bhandary, B. Satheesh Kumar; Suchetha Kumari, N.; Bhat, Vadish S.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.; Fernandes, Ronald

    2016-01-01

    To investigate the protective effect of Asparagus Racemosus Root ethanolic extract (ARE) in Swiss albino mice against acute lethal total - body Electron beam irradiation. Swiss Albino mice were used for the assessment of radiation induced sickness and 30 day survival analysis. Survival studies were determined using the Kaplan-Meier survival curves. The maximum survival was observed in the experimental mice pretreated with 200 mg/kg.b.wt. of ARE which also reduced the radiation sickness characteristics. This dose was considered as an optimal dose for radioprotection. Treatment of mice with ARE before irradiation delayed the onset of mortality as compared with the untreated irradiated controls. Present findings demonstrate the potential of ARE in mitigating radiation-induced mortality, which may be attributed to its free radical scavenging and increased antioxidant potential

  12. Real-world effectiveness of everolimus-based therapy versus fulvestrant monotherapy in HR(+)/HER2(-) metastatic breast cancer.

    Science.gov (United States)

    Hao, Yanni; Lin, Peggy L; Xie, Jipan; Li, Nanxin; Koo, Valerie; Ohashi, Erika; Wu, Eric Q; Rogerio, Jaqueline

    2015-08-01

    Assessing real-world effectiveness of everolimus-based therapy (EVE) versus fulvestrant monotherapy (FUL) among postmenopausal women with hormone receptor-positive (HR(+))/HER2(-) metastatic breast cancer (mBC) after progression on nonsteroidal aromatase inhibitor (NSAI). Medical charts of community-based patients who received EVE or FUL for mBC after NSAI were examined. Progression-free survival (PFS), time on treatment and time to chemotherapy were compared using Kaplan-Meier curves and Cox proportional hazards models adjusting for line of therapy and patient characteristics. 192 patients received EVE and 156 FUL. After adjusting for patient characteristics, EVE was associated with significantly longer PFS than FUL (hazard ratio: 0.71; p = 0.045). EVE was associated with better PFS than FUL among NSAI-refractory postmenopausal HR(+)/HER2(-) mBC patients.

  13. Competing approaches to analysis of failure times with competing risks.

    Science.gov (United States)

    Farley, T M; Ali, M M; Slaymaker, E

    2001-12-15

    For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.

  14. Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage

    OpenAIRE

    Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung

    2014-01-01

    In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...

  15. Checking the predictive accuracy of basic symptoms against ultra high-risk criteria and testing of a multivariable prediction model: Evidence from a prospective three-year observational study of persons at clinical high-risk for psychosis.

    Science.gov (United States)

    Hengartner, M P; Heekeren, K; Dvorsky, D; Walitza, S; Rössler, W; Theodoridou, A

    2017-09-01

    The aim of this study was to critically examine the prognostic validity of various clinical high-risk (CHR) criteria alone and in combination with additional clinical characteristics. A total of 188 CHR positive persons from the region of Zurich, Switzerland (mean age 20.5 years; 60.2% male), meeting ultra high-risk (UHR) and/or basic symptoms (BS) criteria, were followed over three years. The test battery included the Structured Interview for Prodromal Syndromes (SIPS), verbal IQ and many other screening tools. Conversion to psychosis was defined according to ICD-10 criteria for schizophrenia (F20) or brief psychotic disorder (F23). Altogether n=24 persons developed manifest psychosis within three years and according to Kaplan-Meier survival analysis, the projected conversion rate was 17.5%. The predictive accuracy of UHR was statistically significant but poor (area under the curve [AUC]=0.65, Pthinking of binary at-risk criteria is necessary in order to improve the prognosis of psychotic disorders. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. P wave dispersion and maximum P wave duration are independently associated with rapid renal function decline.

    Science.gov (United States)

    Su, Ho-Ming; Tsai, Wei-Chung; Lin, Tsung-Hsien; Hsu, Po-Chao; Lee, Wen-Hsien; Lin, Ming-Yen; Chen, Szu-Chia; Lee, Chee-Siong; Voon, Wen-Chol; Lai, Wen-Ter; Sheu, Sheng-Hsiung

    2012-01-01

    The P wave parameters measured by 12-lead electrocardiogram (ECG) are commonly used as noninvasive tools to assess for left atrial enlargement. There are limited studies to evaluate whether P wave parameters are independently associated with decline in renal function. Accordingly, the aim of this study is to assess whether P wave parameters are independently associated with progression to renal end point of ≥25% decline in estimated glomerular filtration rate (eGFR). This longitudinal study included 166 patients. The renal end point was defined as ≥25% decline in eGFR. We measured two ECG P wave parameters corrected by heart rate, i.e. corrected P wave dispersion (PWdisperC) and corrected P wave maximum duration (PWdurMaxC). Heart function and structure were measured from echocardiography. Clinical data, P wave parameters, and echocardiographic measurements were compared and analyzed. Forty-three patients (25.9%) reached renal end point. Kaplan-Meier curves for renal end point-free survival showed PWdisperC > median (63.0 ms) (log-rank P = 0.004) and PWdurMaxC > median (117.9 ms) (log-rank Pfunction decline.

  17. Communicating projected survival with treatments for chronic kidney disease: patient comprehension and perspectives on visual aids.

    Science.gov (United States)

    Dowen, Frances; Sidhu, Karishma; Broadbent, Elizabeth; Pilmore, Helen

    2017-09-21

    Mortality in end stage renal disease (ESRD) is higher than many malignancies. There is no data about the optimal way to present information about projected survival to patients with ESRD. In other areas, graphs have been shown to be more easily understood than narrative. We examined patient comprehension and perspectives on graphs in communicating projected survival in chronic kidney disease (CKD). One hundred seventy-seven patients with CKD were shown 4 different graphs presenting post transplantation survival data. Patients were asked to interpret a Kaplan Meier curve, pie chart, histogram and pictograph and answer a multi-choice question to determine understanding. We measured interpretation, usefulness and preference for the graphs. Most patients correctly interpreted the graphs. There was asignificant difference in the percentage of correct answers when comparing different graph types (p = 0.0439). The pictograph was correctly interpreted by 81% of participants, the histogram by 79%, pie chart by 77% and Kaplan Meier by 69%. Correct interpretation of the histogram was associated with educational level (p = 0.008) and inversely associated with age > 65 (p = 0.008). Of those who interpreted all four graphs correctly, there was an association with employment (p = 0.001) and New Zealand European ethnicity (p = 0.002). 87% of patients found the graphs useful. The pie chart was the most preferred graph (p 0.002). The readability of the graphs may have been improved with an alternative colour choice, especially in the setting of visual impairment. Visual aids, can be beneficial adjuncts to discussing survival in CKD.

  18. Endolymphatic sac surgery versus tenotomy of the stapedius and tensor tympani muscles in the management of patients with unilateral definite Meniere's disease.

    Science.gov (United States)

    Albu, Silviu; Babighian, Gregorio; Amadori, Maurizio; Trabalzini, Franco

    2015-12-01

    This study aims to compare the outcomes of patients with Meniere's disease submitted to either endolymphatic mastoid shunt (ES) or tenotomy of the stapedius and tensor tympani muscles (TSTM). This is a retrospective chart review of patients treated with ES or TSTM between 2000 and 2010 and followed up for at least 12 months. The main outcomes were represented by: (1) vertigo class, hearing stage and functional level according to the American Academy of Otolaryngology-Head and Neck Surgery criteria; (2) adjustment of dizziness handicap inventory (DHI) and (3) complete and substantial vertigo control using the Kaplan-Meier survival method. Sixty-three patients met the inclusion criteria: 34 underwent ES and 29 TSTM. The baseline demographic characteristics, the hearing stage, the functional level, the DHI and hearing levels were not different between the two groups. No significant difference in vertigo class was demonstrated: 66 % of TSTM patients attained class A compared to 44 % in the ES group (p = 0.14). Kaplan-Meier survival curves specific to class A showed significant differences, favoring TSTM (log-rank test, p = 0.022). TSTM patients demonstrated significantly improved functional level (p = 0.0004) and improved DHI scores (p = 0.001). Eight ES patients (25 %) demanded a second surgical attempt compared to none in the TSTM. Aural fullness was significantly improved in TSTM group (p = 0.01), while the difference in tinnitus improvement was non-significant. Hearing preservation was significantly better in TSTM group (p = 0.001). TSTM is a safe surgical procedure, with significant vertigo control rates, and important hearing preservation rates. More patients and longer follow-up are needed to support our preliminary findings.

  19. Prognostic value of 18F-fluorodeoxyglucose positron emission tomography/computed tomography in patients with Barcelona Clinic Liver Cancer stages 0 and A hepatocellular carcinomas: a multicenter retrospective cohort study

    International Nuclear Information System (INIS)

    Hyun, Seung Hyup; Choi, Joon Young; Lee, Kyung-Han; Eo, Jae Seon; Lee, Jeong Won; Na, Sae Jung; Hong, Il Ki; Oh, Jin Kyoung; Chung, Yong An; Song, Bong-Il; Kim, Tae-Sung; Kim, Kyung Sik; Moon, Dae Hyuk; Yun, Mijin

    2016-01-01

    We evaluated the prognostic value of pretreatment 18 F-fluorodeoxyglucose positron emission tomography with computed tomography (FDG PET/CT) in patients with Barcelona Clinic Liver Cancer (BCLC) stage 0 or A hepatocellular carcinoma (HCC) who had received curative treatment or transarterial chemoembolization (TACE). Between 2009 and 2010, 317 patients diagnosed with HCC at seven hospitals were enrolled. Among these, 195 patients underwent curative treatments including resection, liver transplantation, and radiofrequency ablation. TACE was performed in 122 patients. The tumor-to-normal liver standardized uptake value ratio (TLR) of the primary tumor was measured using pretreatment FDG PET/CT. The prognostic significance of TLR and other clinical variables was assessed using Cox regression models. Differences in the overall survival (OS) associated with TLR or other significant clinical factors were examined using the Kaplan-Meier method. Over a median follow-up period of 46 months, 77 patients died from cancer. In the curative cohort, higher TLR (≥2) was significantly associated with death (hazard ratio [HR] = 2.68; 95 % CI, 1.16-6.15; P = 0.020) in multivariable analysis. Patients with a higher TLR had significantly worse OS than patients with a lower TLR (5-year overall survival, 61 % vs. 79.4 %; P = 0.006). In the TACE cohort, the Model for End-Stage Liver Disease (MELD) score (≥8) was a significant independent prognostic factor for OS (HR = 3.34; 95 % CI, 1.49-7.48; P = 0.003), whereas TLR was not associated with OS. The Kaplan-Meier curves showed significantly poorer OS in patients with higher MELD scores (≥8) than in those with lower MELD scores (5-year survival rate, 33.1 % vs. 79.6 %; P < 0.001). Pretreatment TLR measured using FDG PET/CT was an independent prognostic factor for OS in patients with BCLC stage 0 or A HCC undergoing curative treatment. In contrast, underlying liver function appeared to be important in predicting the prognosis of patients

  20. Predictors of biochemical failure in patients undergoing prostate whole-gland salvage cryotherapy: a novel risk stratification model.

    Science.gov (United States)

    Spiess, Philippe E; Levy, David A; Mouraviev, Vladimir; Pisters, Louis L; Jones, J Stephen

    2013-08-01

    What's known on the subject? and what does the study add?: Previous studies have identified the most important prognostic factors of the likely outcomes of salvage prostate whole-gland ablation, including initial clinical stage, biopsy Gleason score, and PSA (total and doubling time). There is potential for further optimization of candidate selection for salvage cryoablation with curative intent and nadir PSA achieved after whole-gland cryotherapy may provide additional prognostic value. The study shows that the most important prognostic factors of biochemical progression-free survival for patients who have undergone whole-gland salvage prostate cryotherapy are nadir PSA achieved after therapy and pre-therapy biopsy Gleason score. Based on these two prognostic variables, we have identified risk stratification groups (low, intermediate and high) which help predict the expected outcomes of salvage whole-gland prostate cryotherapy in a given patient. This risk stratification constitutes a useful clinical tool in defining which patients maybe best suited for this local salvage treatment method. To assess the prognostic variables predicting the risk of biochemical progression-free survival (bPFS) after salvage prostate whole-gland cryotherapy using the Phoenix definition of bPFS. A total of 132 patients underwent prostate whole-gland salvage cryotherapy with curative intent. No patient underwent neoadjuvant/adjuvant hormonal ablative therapy, and all had extended post-salvage prostate-specific antigen (PSA) follow-up data. Cox univariate and multivariate logistic regression analyses of potential predictors of bPFS were conducted. Kaplan-Meier analyses of bPFS was also performed. At a mean (range) follow-up of 4.3 (0.9-12.7) years, the median (range) post-cryotherapy nadir PSA achieved was 0.17 (0-33.9) ng/mL. On multivariate analysis, predictors of bPFS were nadir PSA post-cryotherapy and pre-salvage biopsy Gleason score (P 2.5 ng/mL or biopsy Gleason score ≥ 7, with

  1. Graft survival rate of renal transplantation during a period of 10 years in Iran

    Directory of Open Access Journals (Sweden)

    Fatemeh Shahbazi

    2015-01-01

    Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.

  2. Outcome of Acute Prosthetic Joint Infections Due to Gram-Negative Bacilli Treated with Open Debridement and Retention of the Prosthesis▿

    Science.gov (United States)

    Martínez-Pastor, Juan C.; Muñoz-Mahamud, Ernesto; Vilchez, Félix; García-Ramiro, Sebastián; Bori, Guillem; Sierra, Josep; Martínez, José A.; Font, Lluis; Mensa, Josep; Soriano, Alex

    2009-01-01

    The aim of our study was to evaluate the outcome of acute prosthetic joint infections (PJIs) due to gram-negative bacilli (GNB) treated without implant removal. Patients with an acute PJI due to GNB diagnosed from 2000 to 2007 were prospectively registered. Demographics, comorbidity, type of implant, microbiology data, surgical treatment, antimicrobial therapy, and outcome were recorded. Classification and regression tree analysis, the Kaplan-Meier survival method, and the Cox regression model were applied. Forty-seven patients were included. The mean age was 70.7 years, and there were 15 hip prostheses and 32 knee prostheses. The median number of days from the time of arthroplasty was 20. The most frequent pathogens were members of the Enterobacteriaceae family in 41 cases and Pseudomonas spp. in 20 cases. Among the Enterobacteriaceae, 14 were resistant to ciprofloxacin, while all Pseudomonas aeruginosa isolates were susceptible to ciprofloxacin. The median durations of intravenous and oral antibiotic treatment were 14 and 64 days, respectively. A total of 35 (74.5%) patients were in remission after a median follow-up of 463 days (interquartile range, 344 to 704) days. By use of the Kaplan-Meier survival curve, a C-reactive protein (CRP) concentration of ≤15 mg/dl (P = 0.03) and receipt of a fluoroquinolone, when all GNB isolated were susceptible (P = 0.0009), were associated with a better outcome. By use of a Cox regression model, a CRP concentration of ≤15 mg/dl (odds ratio [OR], 3.57; 95% confidence interval [CI], 1.05 to 12.5; P = 0.043) and receipt of a fluoroquinolone (OR, 9.09; 95% CI, 1.96 to 50; P = 0.005) were independently associated with better outcomes. Open debridement without removal of the implant had a success rate of 74.5%, and the factors associated with good prognosis were a CRP concentration at the time of diagnosis ≤15 mg/dl and treatment with a fluoroquinolone. PMID:19687237

  3. The effect of semirigid dressings on below-knee amputations.

    Science.gov (United States)

    MacLean, N; Fick, G H

    1994-07-01

    The effect of using semirigid dressings (SRDs) on the residual limb of individuals who have had below-knee amputations as a consequence of peripheral vascular disease was investigated, with the primary question being: Does the time to readiness for prosthetic fitting for patients treated with the SRDs differ from that of patients treated with soft dressings? Forty patients entered the study and were alternately assigned to one of two groups. Nineteen patients were assigned to the SRD group, and 21 patients were assigned to the soft dressing group. The time from surgery to readiness for prosthetic fitting was recorded for each patient. Kaplan-Meier survival curves were generated for each group, and the results were analyzed with the log-rank test. There was a difference between the two curves, and an examination of the curves suggests that the expected time to readiness for prosthetic fitting for patients treated with the SRDs would be less than half that of patients treated with soft dressings. The results suggest that a patient may be ready for prosthetic fitting sooner if treated with SRDs instead of soft dressings.

  4. Survival and mortality among users and non-users of hydroxyurea with sickle cell disease.

    Science.gov (United States)

    de Araujo, Olinda Maria Rodrigues; Ivo, Maria Lúcia; Ferreira Júnior, Marcos Antonio; Pontes, Elenir Rose Jardim Cury; Bispo, Ieda Maria Gonçalves Pacce; de Oliveira, Eveny Cristine Luna

    2015-01-01

    to estimate survival, mortality and cause of death among users or not of hydroxyurea with sickle cell disease. cohort study with retrospective data collection, from 1980 to 2010 of patients receiving inpatient treatment in two Brazilian public hospitals. The survival probability was determined using the Kaplan-Meier estimator, survival calculations (SPSS version 10.0), comparison between survival curves, using the log rank method. The level of significance was p=0.05. of 63 patients, 87% had sickle cell anemia, with 39 using hydroxyurea, with a mean time of use of the drug of 20.0±10.0 years and a mean dose of 17.37±5.4 to 20.94±7.2 mg/kg/day, raising the fetal hemoglobin. In the comparison between those using hydroxyurea and those not, the survival curve was greater among the users (p=0.014). A total of 10 deaths occurred, with a mean age of 28.1 years old, and with Acute Respiratory Failure as the main cause. the survival curve is greater among the users of hydroxyurea. The results indicate the importance of the nurse incorporating therapeutic advances of hydroxyurea in her care actions.

  5. Application of the standard lymphadenectomy in gastric adenocarcinoma

    International Nuclear Information System (INIS)

    Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro

    2011-01-01

    The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined

  6. Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy

    International Nuclear Information System (INIS)

    Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.

    2000-01-01

    Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de

  7. Comparative pathogenicity of Vibrio spp., Photobacterium damselae ssp. damselae and five isolates of Aeromonas salmonicida ssp. achromogenes in juvenile Atlantic halibut (Hippoglossus hippoglossus).

    Science.gov (United States)

    Bowden, T J; Bricknell, I R; Preziosi, B M

    2018-01-01

    Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.

  8. Effect of combination therapy with irradiation and ACNU on rectal cancer in mice

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Masahiko; Nakajima, Atsushi; Kato, Koichiro; Eiraku, Hitoshi (Tokyo Medical Coll. (Japan))

    1992-03-01

    Colon 26, a transplantable strain of colon cancer, was implanted in BALB/C mice, and the effect of combination therapy with irradiation and ACNU on the mice was studied. Regional irradiation with 9 MeV electron beams was administered once without anesthetization, and ACNU was injected intraperitoneally. The 102 mice used as subjects were divided into 6 groups: nontreated group, 3 Gy irradiation group, 9 Gy irradiation group, 20 mg/kg ACNU group, 40 mg/kg ACNU group, and 3 Gy irradiation + 20 mg/kg ACNU group. Antitumor effects were evaluated based on survival time and inhibition of tumor volume growth, which were calculated from mean days of survival, Kaplan-Meier survival rate curves, and tumor volume growth curves, and the results were compared among these 6 groups. In addition, pathological and cytological studies were performed. As a result, antitumor effect was found to be significantly remarkable in the group receiving the combination of irradiation and ACNU compared to any other group given either irradiation or ACNU alone, suggesting that the antitumor effect of irradiation was potentiated by ACNU. (author).

  9. Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

    International Nuclear Information System (INIS)

    Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho

    2010-01-01

    We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate

  10. High serum uric acid concentration predicts poor survival in patients with breast cancer.

    Science.gov (United States)

    Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min

    2017-10-01

    Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Censoring approach to the detection limits in X-ray fluorescence analysis

    International Nuclear Information System (INIS)

    Pajek, M.; Kubala-Kukus, A.

    2004-01-01

    We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples

  12. Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)

    2010-08-15

    We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.

  13. Comparison of transmission dynamics between Streptococcus uberis and Streptococcus agalactiae intramammary infections.

    Science.gov (United States)

    Leelahapongsathon, Kansuda; Schukken, Ynte Hein; Pinyopummintr, Tanu; Suriyasathaporn, Witaya

    2016-02-01

    The objectives of study were to determine the transmission parameters (β), durations of infection, and basic reproductive numbers (R0) of both Streptococcus agalactiae and Streptococcus uberis as pathogens causing mastitis outbreaks in dairy herds. A 10-mo longitudinal study was performed using 2 smallholder dairy herds with mastitis outbreaks caused by Strep. agalactiae and Strep. uberis, respectively. Both herds had poor mastitis control management and did not change their milking management during the entire study period. Quarter milk samples were collected at monthly intervals from all lactating animals in each herd for bacteriological identification. The durations of infection for Strep. uberis intramammary infection (IMI) and Strep. agalactiae IMI were examined using Kaplan-Meier survival curves, and the Kaplan-Meier survival functions for Strep. uberis IMI and Strep. agalactiae IMI were compared using log rank survival-test. The spread of Strep. uberis and Strep. agalactiae through the population was determined by transmission parameter, β, the probability per unit of time that one infectious quarter will infect another quarter, assuming that all other quarters are susceptible. For the Strep. uberis outbreak herd (31 cows), 56 new infections and 28 quarters with spontaneous cure were observed. For the Strep. agalactiae outbreak herd (19 cows), 26 new infections and 9 quarters with spontaneous cure were observed. The duration of infection for Strep. agalactiae (mean=270.84 d) was significantly longer than the duration of infection for Strep. uberis (mean=187.88 d). The transmission parameters (β) estimated (including 95% confidence interval) for Strep. uberis IMI and Strep. agalactiae IMI were 0.0155 (0.0035-0.0693) and 0.0068 (0.0008-0.0606), respectively. The R0 (including 95% confidence interval) during the study were 2.91 (0.63-13.47) and 1.86 (0.21-16.61) for Strep. uberis IMI and Strep. agalactiae IMI, respectively. In conclusion, the transmission

  14. Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines

    Energy Technology Data Exchange (ETDEWEB)

    Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)

    2015-10-01

    Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.

  15. Do clinical data and human papilloma virus genotype influence spontaneous regression in grade I cervical intraepithelial neoplasia?

    Science.gov (United States)

    Cortés-Alaguero, Caterina; González-Mirasol, Esteban; Morales-Roselló, José; Poblet-Martinez, Enrique

    2017-03-15

    To determine whether medical history, clinical examination and human papilloma virus (HPV) genotype influence spontaneous regression in cervical intraepithelial neoplasia grade I (CIN-I). We retrospectively evaluated 232 women who were histologically diagnosed as have CIN-I by means of Kaplan-Meier curves, the pattern of spontaneous regression according to the medical history, clinical examination, and HPV genotype. Spontaneous regression occurred in most patients and was influenced by the presence of multiple HPV genotypes but not by the HPV genotype itself. In addition, regression frequency was diminished when more than 50% of the cervix surface was affected or when an abnormal cytology was present at the beginning of follow-up. The frequency of regression in CIN-I is high, making long-term follow-up and conservative management advisable. Data from clinical examination and HPV genotyping might help to anticipate which lesions will regress.

  16. Trends in adult leukemia incidence and survival in Denmark, 1943-2003

    DEFF Research Database (Denmark)

    Thygesen, Lau Caspar; Nielsen, Ove Juul; Johansen, Christoffer

    2009-01-01

    The etiology of leukemia is largely unknown. Ecological data indicating trends in incidence and survival can provide information about changes in risk factors, can reflect underlying changes in diagnostic classification, and can measure therapeutic advances. From the records of the Danish Cancer...... Registry with registration starting from 1943, we calculated age-specific, period-specific, and age-standardized (world standard) incidence rates of chronic lymphoid leukemia (CLL), acute lymphoid leukemia (ALL), chronic myeloid leukemia (CML), and acute myeloid leukemia (AML) for persons above the age...... of 18. Kaplan-Meier survival curves and median survival times were calculated. Between 1943 and 2003, there were 26,036 cases of leukemia reported. The age-specific incidence rates of CLL, CML, and AML were higher for older men and women, while the incidence rates of ALL by age were more homogeneous...

  17. Measuring the success of combined intravesical dimethyl sulfoxide and triamcinolone for treatment of bladder pain syndrome/interstitial cystitis.

    Science.gov (United States)

    Gafni-Kane, Adam; Botros, Sylvia M; Du, Hongyan; Sand, Robert I; Sand, Peter K

    2013-02-01

    The purpose of this study was to investigate change in bladder capacity as a measure of response to combined intravesical dimethyl sulfoxide (DMSO) and triamcinolone instillations for the treatment of newly diagnosed bladder pain syndrome/interstitial cystitis (BPS/IC). 141 newly diagnosed women were identified retrospectively. 79 were treated with weekly DMSO/triamcinolone instillations. Change in bladder capacity with bladder retrofill, daytime urinary frequency, nocturia episodes per night, and Likert scale symptom scores were reviewed. Wilcoxon signed-rank tests, Wilcoxon rank-sum tests, Spearman's rank correlations, COX regression analysis, and a Kaplan-Meier survival curve were performed. Significant changes (median (25(th)-percentile to 75(th)-percentile) were noted for bladder capacity (75 mL (25 to 130 mL), p measure of response to intravesical DMSO/triamcinolone for newly diagnosed BPS/IC. Clinical outcomes do not differ based upon presence of DO.

  18. Long-Term Safety of In Utero Exposure to Anti-TNFα Drugs for the Treatment of Inflammatory Bowel Disease

    DEFF Research Database (Denmark)

    Chaparro, M; Verreth, A; Lobaton, T

    2018-01-01

    OBJECTIVES: The long-term safety of exposure to anti-tumor necrosis factor (anti-TNFα) drugs during pregnancy has received little attention. We aimed to compare the relative risk of severe infections in children of mothers with inflammatory bowel disease (IBD) who were exposed to anti-TNFα drugs...... in utero with that of children who were not exposed to the drugs. METHODS: Retrospective multicenter cohort study. Exposed cohort: children from mothers with IBD receiving anti-TNFα medication (with or without thiopurines) at any time during pregnancy or during the 3 months before conception. Non......-exposed cohort: children from mothers with IBD not treated with anti-TNFα agents or thiopurines at any time during pregnancy or the 3 months before conception. The cumulative incidence of severe infections after birth was estimated using Kaplan-Meier curves, which were compared using the log-rank test. Cox...

  19. Survival pathological prognosis factors in breast cancer

    International Nuclear Information System (INIS)

    Gonzalez-Longoria Boada, Lourdes B.

    2012-01-01

    A descriptive and longitudinal study of 273 women with breast cancer belonging to Granma province was carried out from 2003 to 2004, in order to analyze the survival of this female population, reason why the method of Kaplan Meier was used for the calculation of the mentioned variable and the Log Rank test was used for the comparison of curves. Patients with higher survival at 5 years were those who had tumors of 2 cm or less (87.5%), histological grade I (90.3%), nuclear grade I (88.3%), as well as the absence of vascular, lymphatic or lymph node invasion (with 80.6; 74.9 and 6.1% respectively). Also, tumor size, histological and nuclear grade, nodal status, as well as lymphatic and vascular invasion constituted prognosis factors, which favored the individualization of therapeutic behaviors

  20. Modelling the survivorship of Nigeria children in their first 10 years of ...

    African Journals Online (AJOL)

    Fagbamigbe

    Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...

  1. Experiences with environmentally adapted Kaplan runners; Erfarenheter med miljoeanpassade Kaplanloephjul

    Energy Technology Data Exchange (ETDEWEB)

    Ukonsaari; Jan

    2012-08-15

    This study concerns environmentally adapted Kaplan runners, which have no oil for lubricating the blade regulation mechanisms and bearings. The runners are water or air filled with self lubricated bearings. Recent design also includes regulation system pressure increase and servo motor placement below runner centre and environmentally adapted synthetic ester as hydraulic fluid. These together with power output increase and efficiency optimization are suspected sources of poor runner function. Of 37 runners 43 % have had some kind of problem and 30 % bearing or mechanism related ones. When the axial blade bearing problems are excluded the problems occurred at 16 %. Deeper look into the design of newer runners shows that only bronze based runner hubs is significantly more problem dense regarding regulation mechanisms (50 %). Hidden figures of increased runner regulation forces are suspected. All problems cannot be explained and the young machines limit the experiences. The working group's opinion and bring ups of historical and present examples during the work show evidence that the old oil filled runners function is far from perfect, nor the life length. The future is not with oil filled runner hubs. Main parts of the discovered problems have been solved and can be resolved by thorough design analysis. One future concern is what effects the recent design changes will cause due to increase demand for power output changes including the number of starts and stops. That is why the working group's recommendation is to put joint effort into material fatigue and in which a first step is to identify the real forces the runners are exposed to.

  2. Examining the Latent Structure of the Delis-Kaplan Executive Function System.

    Science.gov (United States)

    Karr, Justin E; Hofer, Scott M; Iverson, Grant L; Garcia-Barrera, Mauricio A

    2018-05-04

    The current study aimed to determine whether the Delis-Kaplan Executive Function System (D-KEFS) taps into three executive function factors (inhibition, shifting, fluency) and to assess the relationship between these factors and tests of executive-related constructs less often measured in latent variable research: reasoning, abstraction, and problem solving. Participants included 425 adults from the D-KEFS standardization sample (20-49 years old; 50.1% female; 70.1% White). Eight alternative measurement models were compared based on model fit, with test scores assigned a priori to three factors: inhibition (Color-Word Interference, Tower), shifting (Trail Making, Sorting, Design Fluency), and fluency (Verbal/Design Fluency). The Twenty Questions, Word Context, and Proverb Tests were predicted in separate structural models. The three-factor model fit the data well (CFI = 0.938; RMSEA = 0.047), although a two-factor model, with shifting and fluency merged, fit similarly well (CFI = 0.929; RMSEA = 0.048). A bifactor model fit best (CFI = 0.977; RMSEA = 0.032) and explained the most variance in shifting indicators, but rarely converged among 5,000 bootstrapped samples. When the three first-order factors simultaneously predicted the criterion variables, only shifting was uniquely predictive (p measuring executive-related constructs and provide a framework through which clinicians can interpret D-KEFS results.

  3. C-reactive protein and homocysteine predict long-term mortality in young ischemic stroke patients.

    Science.gov (United States)

    Naess, Halvor; Nyland, Harald; Idicula, Titto; Waje-Andreassen, Ulrike

    2013-11-01

    We investigated the relationship between C-reactive protein (CRP) and homocysteine on follow-up and subsequent mortality in young ischemic stroke patients in a population-based study. Young ischemic stroke patients were followed-up on average 6 years after the index stroke. CRP and homocysteine levels were measured and risk factors were recorded, including myocardial infarction, diabetes mellitus, hypertension, smoking, alcoholism, and cancer. Stroke outcome was measured using the modified Rankin Scale score. Subsequent survival was obtained by examining the official population registry. Cox regression analyses were performed. In total, 198 patients were included in this study (82 [41%] women and 116 [59%] men). The mean age on follow-up was 47.8 years. In total, 36 (18.2%) patients died during the subsequent mean follow-up of 12.4 years. Cox regression analysis revealed that mortality was associated with CRP (hazard ratio [HR] 1.05; P=.001) and homocysteine levels (HR 1.04; P=.02) in patients without dissection. Kaplan-Meier curves grouped by dichotomized CRP (CRP≤1 v >1 mg/L) showed increasing separation between the survival curves, and likewise for dichotomized homocysteine (≤9 v >9 μg/L). There is an independent association between CRP and homocysteine levels obtained several years after ischemic stroke in young adults and subsequent mortality, even when adjusting for traditional risk factors. This association seems to continue for at least 12 years after the measurements. Copyright © 2013 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  4. Survival analysis II: Cox regression

    NARCIS (Netherlands)

    Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.

    2011-01-01

    In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the

  5. STAT3 inhibitor enhances chemotherapy drug efficacy by ...

    African Journals Online (AJOL)

    Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.

  6. The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis

    DEFF Research Database (Denmark)

    Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik

    2016-01-01

    OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...

  7. Is there racial/ethnic variance in cervical cancer- specific survival of ...

    African Journals Online (AJOL)

    incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...

  8. Survival Analysis of Patients with End Stage Renal Disease

    Science.gov (United States)

    Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.

    2015-06-01

    This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.

  9. Exclusive breastfeeding duration and determinants among Brazilian children under two years of age

    Directory of Open Access Journals (Sweden)

    Sarah Warkentin

    2013-06-01

    Full Text Available OBJECTIVE: The present study described the duration and identified the determinants of exclusive breastfeeding. METHODS: The study used data from the Pesquisa Nacional de Demografia e Saúde da Criança e da Mulher 2006 (National Demographic and Health Survey on Women and Children 2006. Data were collected using questionnaires administered by trained professionals and refer to a subsample of 1,704 children aged less than 24 months. The estimated durations of exclusive breastfeeding are presented according to socioeconomic, demographic and epidemiological variables. Kaplan Meier estimator curves were used to produce valid estimates of breastfeeding duration and the Cox's proportional hazards model was fitted to identify risks. RESULTS: The median estimated duration of exclusive breastfeeding was 60 days. The final Cox model consisted of mother's age <20 years (hazard ratio=1.53, 95% confidence interval=1.11-1.48, use of pacifier (hazard ratio=1.53, 95% confidence interval=1.37-1.71, not residing in the country's southeast region (hazard ratio=1.22, 95% confidence interval=1.07-1.40 and socioeconomic status (hazard ratio=1.28, 95% confidence interval=1.06-1.55. CONCLUSION: The Kaplan Meier estimator corrected the underestimated duration of breastfeeding in the country when calculated by the current status methodology. Despite the national efforts done in the last decades to promote breastfeeding, the results indicate that the duration of exclusive breastfeeding is still half of that recommended for this dietary practice to promote health. Ways to revert this situation would be ongoing educational activities involving the educational and health systems, associated with advertising campaigns on television and radio mainly targeting young mothers with low education level and low income, identified as those at high risk of weaning their children early.

  10. A prospective observational study comparing a physiological scoring system with time-based discharge criteria in pediatric ambulatory surgical patients.

    Science.gov (United States)

    Armstrong, James; Forrest, Helen; Crawford, Mark W

    2015-10-01

    Discharge criteria based on physiological scoring systems can be used in the postanesthesia care unit (PACU) to fast-track patients after ambulatory surgery; however, studies comparing physiological scoring systems with traditional time-based discharge criteria are lacking. The purpose of this study was to compare PACU discharge readiness times using physiological vs time-based discharge criteria in pediatric ambulatory surgical patients. We recorded physiological observations from consecutive American Society of Anesthesiologists physical status I-III patients aged 1-18 yr who were admitted to the PACU after undergoing ambulatory surgery in a tertiary academic pediatric hospital. The physiological score was a combination of the Aldrete and Chung systems. Scores were recorded every 15 min starting upon arrival in the PACU. Patients were considered fit for discharge once they attained a score ≥12 (maximum score, 14), provided no score was zero, with the time to achieve a score ≥12 defining the criteria-based discharge (CBD) time. Patients were discharged from the PACU when both the CBD and the existing time-based discharge (TBD) criteria were met. The CBD and TBD data were compared using Kaplan-Meier and log-rank analysis. Observations from 506 children are presented. Median (interquartile range [IQR]) age was 5.5 [2.8-9.9] yr. Median [IQR] CBD and TBD PACU discharge readiness times were 30 [15-45] min and 60 [45-60] min, respectively. Analysis of Kaplan-Meier curves indicated a significant difference in discharge times using the different criteria (hazard ratio, 5.43; 95% confidence interval, 4.51 to 6.53; P < 0.001). All patients were discharged home without incident. This prospective study suggests that discharge decisions based on physiological criteria have the potential for significantly speeding the transit of children through the PACU, thereby enhancing PACU efficiency and resource utilization.

  11. Lymph node density as a prognostic predictor in patients with betel nut-related oral squamous cell carcinoma.

    Science.gov (United States)

    Chang, Wei-Chin; Lin, Chun-Shu; Yang, Cheng-Yu; Lin, Chih-Kung; Chen, Yuan-Wu

    2018-04-01

    Lymph node metastasis in oral squamous cell carcinoma (OSCC) is a poor prognostic factor. The histopathologic stage (e.g., pN) is used to evaluate the severity of lymph node metastasis; however, the current staging system insufficiently predicts survival and recurrence. We investigated clinical outcomes and lymph node density (LND) in betel nut-chewing individuals. We retrospectively analyzed 389 betel nut-exposed patients with primary OSCC who underwent surgical resection in 2002-2015. The prognostic significance of LND was evaluated by overall survival (OS) and disease-free survival (DFS) using the Kaplan-Meier method. Kaplan-Meier analyses showed that the 5-year OS and DFS rates in all patients were 60.9 and 48.9%, respectively. Multivariate analysis showed that variables independently prognostic for OS were aged population (hazard ratio [HR] = 1.6, 95% confidence interval [95% CI] = 1.1-2.5; P = .025), and cell differentiation classification (HR = 2.4, 95% CI = 1.4-4.2; P = .002). In pathologic N-positive patients, a receiver operating characteristic (ROC) curve for OS was used and indicated the best cutoff of 0.05, and the multivariate analysis showed that LND was an independent predictor of OS (HR = 2.2, 95% CI = 1.3-3.7; P = .004). Lymph node density, at a cutoff of 0.05, was an independent predictor of OS and DFS. OS and DFS underwent multiple analyses, and LND remained significant. The pathologic N stage had no influence in the OS analysis. LND is a more reliable predictor of survival in betel nut-chewing patients for further post operation adjuvant treatment, such as reoperation or adjuvant radiotherapy.

  12. ITGA3 and ITGB4 expression biomarkers estimate the risks of locoregional and hematogenous dissemination of oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Nagata, Masaki; Takahashi, Katsu; Kodama, Naoki; Kawase, Tomoyuki; Hoshina, Hideyuki; Ikeda, Nobuyuki; Shingaki, Susumu; Takagi, Ritsuo; Noman, Arhab A; Suzuki, Kenji; Kurita, Hiroshi; Ohnishi, Makoto; Ohyama, Tokio; Kitamura, Nobutaka; Kobayashi, Takanori; Uematsu, Kohya

    2013-01-01

    Molecular biomarkers are essential for monitoring treatment effects, predicting prognosis, and improving survival rate in oral squamous cell carcinoma. This study sought to verify the effectiveness of two integrin gene expression ratios as biomarkers. Gene expression analyses of integrin α3 (ITGA3), integrin β4 (ITGB4), CD9 antigen (CD9), and plakoglobin (JUP) by quantitative real-time PCR were conducted on total RNA from 270 OSCC cases. The logrank test, Cox proportional hazards model, and Kaplan-Meier estimates were performed on the gene expression ratios of ITGA3/CD9 and ITGB4/JUP and on the clinicopathological parameters for major clinical events. A high rate (around 80%) of lymph node metastasis was found in cases with a high ITGA3/CD9 ratio (high-ITGA3/CD9) and invasive histopathology (YK4). Primary site recurrence (PSR) was associated with high-ITGA3/CD9, T3-4 (TNM class), and positive margin, indicating that PSR is synergistically influenced by treatment failure and biological malignancy. A high ITGB4/JUP ratio (high-ITGB4/JUP) was revealed to be a primary contributor to distant metastasis without the involvement of clinicopathological factors, suggesting intervention of a critical step dependent on the function of the integrin β4 subunit. Kaplan-Meier curves revealed positive margin as a lethal treatment consequence in high-ITGA3/CD9 and YK4 double-positive cases. Two types of metastatic trait were found in OSCC: locoregional dissemination, which was reflected by high-ITGA3/CD9, and distant metastasis through hematogenous dissemination, uniquely distinguished by high-ITGB4/JUP. The clinical significance of the integrin biomarkers implies that biological mechanisms such as cancer cell motility and anchorage-independent survival are vital for OSCC recurrence and metastasis

  13. Assessing the effect of quantitative and qualitative predictors on gastric cancer individuals survival using hierarchical artificial neural network models.

    Science.gov (United States)

    Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat

    2013-01-01

    There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer

  14. Survival of Root-filled Teeth in the Swedish Adult Population

    DEFF Research Database (Denmark)

    Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik

    2016-01-01

    INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...

  15. Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan

    Science.gov (United States)

    Krikun, Andrew

    2010-01-01

    Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…

  16. Initial high anti-emetic efficacy of granisetron with dexamethasone is not maintained over repeated cycles.

    Science.gov (United States)

    de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.

    1998-01-01

    We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766

  17. [Comparative evaluation of survival prognosis using MELD or Child-Pugh scores in patients with liver cirrhosis in Chile].

    Science.gov (United States)

    Sanhueza, Edgar; Contreras, Jorge; Zapata, Rodrigo; Sanhueza, Matías; Elgueta, Fabián; López, Constanza; Jerez, Sigrid; Jerez, Verónica; Delgado, Iris

    2017-01-01

    Currently, most liver units use the Child-Pugh (CP) or the Model for End-Stage Liver Disease (MELD) scores to establish survival prognosis among patients with liver cirrhosis. Which classification is superior, is not well defined. To compare CP and MELD classification scores to predict survival among adult patients with liver cirrhosis in Chile. Follow-up of 137 consecutive adult patients with liver cirrhosis aged 59 ± 12 years (55% women). The diagnosis was reached by clinical, laboratory and image studies at three different centers of Santiago. Patients were staged with CP and MELD classification scores at baseline and followed over a period of 12 months. The predictive capacity of the scores for survival was analyzed using a multivariate statistical analysis (Kaplan-Meier curves). The most common etiology was alcohol (37.9%). The actuarial survival rate was 79.6% at 12 months of follow-up. When comparing groups with areas under curve of receiver operating characteristic curves (AUROC), there was no statistically significant difference in survival between less severe and advanced disease, assessed with both survival scales. The AUROC for MELD and CP were 0.80 and 0.81, respectively. This clinical study did not find a statistically significant difference between the two classifications for the prediction of 12 months survival in patients with cirrhosis.

  18. Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents; Interdisziplinaere interventionelle Therapie tracheobronchialer Stenosen mit modernen Metallmaschenstents

    Energy Technology Data Exchange (ETDEWEB)

    Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik

    2002-08-01

    Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent

  19. The association of donor and recipient age with graft survival in paediatric renal transplant recipients in a European Society for Paediatric Nephrology/European Renal Association-European Dialysis and Transplantation Association Registry study

    DEFF Research Database (Denmark)

    Chesnaye, Nicholas C.; Van Stralen, Karlijn J.; Bonthuis, Marjolein

    2017-01-01

    from the ESPN/ERA-EDTA Registry. The effect of donor and recipient age combinations on 5-year graft-failure risk, stratified by donor source, was estimated using Kaplan-Meier survival curves and Cox regression, while adjusting for sex, primary renal diseases with a high risk of recurrence, pre......Background The impact of donor age in paediatric kidney transplantation is unclear. We therefore examined the association of donor-recipient age combinations with graft survival in children. Methods Data for 4686 first kidney transplantations performed in 13 countries in 1990-2013 were extracted......-emptive transplantation, year of transplantation and country. Results The risk of graft failure in older living donors (50-75 years old) was similar to that of younger living donors {adjusted hazard ratio [aHR] 0.74 [95% confidence interval (CI) 0.38-1.47]}. Deceased donor (DD) age was non-linearly associated with graft...

  20. The influence of unilateral oophorectomy on the age of menopause

    DEFF Research Database (Denmark)

    Rosendahl, M; Simonsen, M K; Kjer, J J

    2017-01-01

    OBJECTIVE: To determine the age of menopause after premenopausal unilateral oophorectomy (UO) and to establish whether UO at a young age leads to menopause at a younger age than if UO occurs at an older age. METHODS: A cohort of 28 731 women, of whom 17 781 (62%) were menopausal, was investigated....... Information on menopause was obtained from self-reported questionnaires. Surgical data were obtained from the National Patient Register to avoid recollection bias. Age of menopause after UO/not UO was determined using Kaplan-Meier curves. Cox regression was used to identify factors of importance for early...... menopause. RESULTS: UO was performed in 1148 women. Women with UO after the age of 45 years, premenopausal hysterectomy, bilateral oophorectomy and cancer were excluded, leaving 236 in the analysis. Menopause occurred 1.8 years earlier after UO compared to women with two intact ovaries (mean 49.5 vs. 51...

  1. Outcome of lithium prophylaxis: a prospective follow-up of affective disorder patients assigned to high and low serum lithium levels

    DEFF Research Database (Denmark)

    Vestergaard, Per; Licht, Rasmus Wentzer; Brodersen, Anders Torp

    1998-01-01

    The purpose of the study was to examine the outcome of long-term lithium treatment in consecutively admitted affective disorder patients assigned to high and low serum lithium levels. A total of 91 patients were diagnosed according to DSM-III criteria and randomly allocated to two open treatment...... groups in which prophylactic lithium was administered in high (serum lithium 0.8-1.0 mmol L-1) and low (serum lithium 0.5-0.8 mmol L-1) doses, respectively. The patients were followed for 2 years or until discontinuation of lithium treatment or readmission to hospital for recurrence of affective illness....... The main outcome of the treatment groups was compared with Kaplan-Meier survival curves and by Cox regression analysis. A total of 31 patients (34%) completed 24 months of prophylactic lithium treatment without recurrence and readmission to hospital. In total, 18 patients (20%) suffered a recurrence...

  2. Estimating a population cumulative incidence under calendar time trends

    DEFF Research Database (Denmark)

    Hansen, Stefan N; Overgaard, Morten; Andersen, Per K

    2017-01-01

    BACKGROUND: The risk of a disease or psychiatric disorder is frequently measured by the age-specific cumulative incidence. Cumulative incidence estimates are often derived in cohort studies with individuals recruited over calendar time and with the end of follow-up governed by a specific date...... by calendar time trends, the total sample Kaplan-Meier and Aalen-Johansen estimators do not provide useful estimates of the general risk in the target population. We present some alternatives to this type of analysis. RESULTS: We show how a proportional hazards model may be used to extrapolate disease risk...... estimates if proportionality is a reasonable assumption. If not reasonable, we instead advocate that a more useful description of the disease risk lies in the age-specific cumulative incidence curves across strata given by time of entry or perhaps just the end of follow-up estimates across all strata...

  3. Association between poor clinical prognosis and sleep duration among breast cancer patients

    Directory of Open Access Journals (Sweden)

    Thalyta Cristina Mansano-Schlosser

    Full Text Available ABSTRACT Objective: to investigate the association between clinical progression and the quality and duration of sleep in women with breast cancer. Method: longitudinal study, with 114 participants, conducted in a hospital in Brazil. The instruments used were: questionnaire for sociodemographic and clinical characterization, Pittsburgh Sleep Quality Index; Beck Depression Inventory and Herth Hope Scale. Data were analyzed through descriptive statistics and survival analyses (outcome: poor clinical progression, using the Kaplan-Meier curve, Log-rank test and Cox proportional model. Results: a higher probability of poor clinical progression was verified in women with sleep durations of less than six hours or nine hours and over (p=.0173. Conclusion: the results suggest the importance of further studies that seek to verify whether the quantitative management of sleep disorders would have an impact on the progression of breast cancer. Women should be encouraged to report sleep problems to nurses.

  4. Predictors of antiviral treatment initiation in hepatitis C virus-infected patients: a Danish cohort study

    DEFF Research Database (Denmark)

    Hansen, N; Obel, N; Christensen, P B

    2009-01-01

    Predictive factors for initiation of antiviral therapy in chronically infected hepatitis C virus (HCV) patients are not fully elucidated. The aim of this study was to determine predictive factors for initiation of treatment with standard or pegylated interferon either alone or combined...... with ribavirin. A Danish cohort of individuals chronically infected with HCV was used and observation time was calculated from the date of inclusion in the cohort to date of death, last clinical observation, 1 January 2007, or start of HCV antiviral treatment in treatment-naïve patients. Kaplan-Meier survival...... analysis was used to construct time to event curves. Cox regression was used to determine the incidence rate ratios as estimates of relative risk (RR) and 95% confidence intervals (CI). A total of 1780 patients were enrolled in the study. The cumulative chance of treatment initiation over 5 years was 33...

  5. First line chemotherapy plus trastuzumab in metastatic breast cancer ...

    African Journals Online (AJOL)

    First line chemotherapy plus trastuzumab in metastatic breast cancer HER2 positive - Observational institutional study. ... The progression free survival was estimated by the Kaplan-Meier method, from the date of first cycle to the date of progression or at the last consultation, and the median was 12.8 months. Trastuzumab ...

  6. Influence of antiviral therapy on survival of patients with hepatitis B ...

    African Journals Online (AJOL)

    The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...

  7. Clinical outcome among HIV-infected patients starting saquinavir hard gel compared to ritonavir or indinavir

    DEFF Research Database (Denmark)

    Kirk, O; Mocroft, A; Pradier, C

    2001-01-01

    -up within the EuroSIDA study. METHODS: Changes in plasma viral load (pVL) and CD4 cell count from baseline were compared between treatment groups. Time to new AIDS-defining events and death were compared in Kaplan--Meier models, and Cox models were established to further assess differences in clinical...

  8. Impact of tumour volume on prediction of progression-free survival in sinonasal cancer

    International Nuclear Information System (INIS)

    Hennersdorf, Florian; Mauz, Paul-Stefan; Adam, Patrick; Welz, Stefan; Sievert, Anne; Ernemann, Ulrike; Bisdas, Sotirios

    2015-01-01

    The present study aimed to analyse potential prognostic factors, with emphasis on tumour volume, in determining progression free survival (PFS) for malignancies of the nasal cavity and the paranasal sinuses. Retrospective analysis of 106 patients with primary sinonasal malignancies treated and followed-up between March 2006 and October 2012. Possible predictive parameters for PFS were entered into univariate and multivariate Cox regression analysis. Kaplan-Meier curve analysis included age, sex, baseline tumour volume (based on MR imaging), histology type, TNM stage and prognostic groups according to the American Joint Committee on Cancer (AJCC) classification. Receiver operating characteristic (ROC) curve analysis concerning the predictive value of tumour volume for recurrence was also conducted. The main histological subgroup consisted of epithelial tumours (77%). The majority of the patients (68%) showed advanced tumour burden (AJCC stage III–IV). Lymph node involvement was present in 18 cases. The mean tumour volume was 26.6 ± 21.2 cm 3 . The median PFS for all patients was 24.9 months (range: 2.5–84.5 months). The ROC curve analysis for the tumour volume showed 58.1% sensitivity and 75.4% specificity for predicting recurrence. Tumour volume, AJCC staging, T- and N- stage were significant predictors in the univariate analysis. Positive lymph node status and tumour volume remained significant and independent predictors in the multivariate analysis. Radiological tumour volume proofed to be a statistically reliable predictor of PFS. In the multivariate analysis, T-, N- and overall AJCC staging did not show significant prognostic value

  9. Titration Curves: Fact and Fiction.

    Science.gov (United States)

    Chamberlain, John

    1997-01-01

    Discusses ways in which datalogging equipment can enable titration curves to be measured accurately and how computing power can be used to predict the shape of curves. Highlights include sources of error, use of spreadsheets to generate titration curves, titration of a weak acid with a strong alkali, dibasic acids, weak acid and weak base, and…

  10. Increasing trends in kidney cancer over the last 2 decades in Saudi Arabia.

    Science.gov (United States)

    Alkhateeb, Sultan S; Alkhateeb, Jawaher M; Alrashidi, Eman A

    2015-06-01

    To examine the trends of kidney cancer over the last 2 decades in a subset of a Saudi Arabian population.   We conducted a retrospective study in a tertiary care center including all adult patients with primary kidney cancer who presented and were managed between 1990 and 2010. The time period was split into 4 quartiles, and variables tested and compared using chi-square, T-test, and Kaplan-Meier curves for survival.   The total was 215 patients with a mean age of 57.8 years. There was an increase in the number of kidney cancer cases over the last 2 decades. There was no significant difference in the mode of presentation or stage distribution between quartiles. A significant change was observed in the management towards minimally invasive and nephron-sparing surgeries (p less than 0.001). There was no change in recurrence-free and disease-specific survival over the last 20 years.   There have been an increasing number of kidney cancer patients over the last 2 decades with no observed migration towards more incidental and low stage tumors as compared with developed countries.

  11. Long-term radiographic follow-up of bisphosphonate-associated atypical femur fractures

    Energy Technology Data Exchange (ETDEWEB)

    Favinger, Jennifer L. [University of Washington, Department of Radiology, 1959 N.E. Pacific Street, Box 357115, Seattle, WA (United States); Hippe, Daniel [University of Washington, Department of Radiology, Seattle, WA (United States); Ha, Alice S. [University of Washington, Department of Radiology, 4245 Roosevelt Way NE, Box 354755, Seattle, WA (United States)

    2016-05-15

    To evaluate the appearance of bisphosphonate-related femur insufficiency fractures on long-term follow-up radiographic studies and to describe the rate of fracture line obscuration and cortical beak healing over time. In this retrospective study, bisphosphonate-related femur fracture radiographs were reviewed by two radiologists for the presence of a fracture line, callus, and the characteristic cortical beak. Kaplan-Meier curves were used to analyze the time to first indication of healing. Femurs were also subdivided into those who underwent early versus late surgical fixation and those who underwent early versus late discontinuation of bisphosphonate. Clinical data including pain level and medication history were collected. Forty-seven femurs with a bisphosphonate-related femur fracture were identified in 28 women. Eighty-five percent took a bisphosphonate for greater than 5 years and 59 % for greater than 10 years. The median time to beak healing was 265 weeks and the median time to fracture line healing was 56 weeks in the 31 femurs with a baseline fracture. No statistically significant difference was identified between surgical fixation and conservative management. Bisphosphonate-related fractures demonstrate notably prolonged healing time on long-term follow-up. (orig.)

  12. Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation: long-term results from the Bio-CAPTURE registry.

    Science.gov (United States)

    van den Reek, J M P A; Tummers, M; Zweegers, J; Seyger, M M B; van Lümig, P P M; Driessen, R J B; van de Kerkhof, P C M; Kievit, W; de Jong, E M G J

    2015-03-01

    Drug survival is an indicator for treatment success; insight in predictors associated with drug survival is important. To analyse the long-term drug survival for adalimumab in patients with psoriasis treated in daily practice and (II) to identify predictors of prolonged drug survival for adalimumab split for different reasons of discontinuation. Data were extracted from a prospective psoriasis cohort and analysed using Kaplan-Meier survival curves split for reasons of discontinuation. Baseline predictors associated with longer drug survival were identified using multivariate Cox-regression analysis. One hundred and sixteen patients were included with a total of 208 patient-years. Overall drug survival was 76% after 1 year and 52% after 4.5 years. In patients who stopped due to ineffectiveness, longer drug survival was associated with the absence of specific comorbidities (P = 0.03). In patients who stopped due to side-effects, longer drug survival was associated with male gender (P = 0.02). Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation. Strong, specific predictors can lead to patient-tailored treatment. © 2014 European Academy of Dermatology and Venereology.

  13. The association between gender and pediatric respiratory morbidity.

    Science.gov (United States)

    Ben-Shmuel, Atar; Sheiner, Eyal; Wainstock, Tamar; Landau, Daniella; Vaknin, Flear; Walfisch, Asnat

    2018-06-26

    To evaluate the association between newborn gender and the risk for later pediatric respiratory morbidity. A population based cohort analysis was performed by comparing the risk of long-term respiratory morbidity (until 18 years of age) according to gender. Respiratory morbidity included hospitalizations involving pneumonia, asthma, bronchitis, bronchiolitis, upper respiratory tract infection (URTI), influenza, and bronchiectasis. Deliveries occurred between the years 1991 and 2014 in a tertiary medical center. Kaplan-Meier survival curves were constructed to compare cumulative respiratory morbidity. A Cox proportional hazards model controlled for confounders. During the study period 240 953 newborns met the inclusion criteria. Among them, 118 113 were females (49.0%) and 122 840 were males (51.0%). During the 18 years of follow-up, 13 719 (5.7%) different newborns were hospitalized with respiratory related morbidity. Males had significantly higher rates of respiratory morbidity as compared with females (6.4% vs 4.9% respectively, P respiratory morbidity (log rank P respiratory morbidity while adjusting for gestational age, birthweight, and other confounders (HR 1.29, 95% CI 1.25-1.34, P respiratory morbidity, independent of obstetrical characteristics such as gestational age and birthweight. © 2018 Wiley Periodicals, Inc.

  14. Effects of marital status on survival of hepatocellular carcinoma by race/ethnicity and gender.

    Science.gov (United States)

    Wu, Wenrui; Fang, Daiqiong; Shi, Ding; Bian, Xiaoyuan; Li, Lanjuan

    2018-01-01

    It is well demonstrated that being married is associated with a better prognosis in multiple types of cancer. However, whether the protective effect of marital status varied across race/ethnicity and gender in patients with hepatocellular carcinoma remains unclear. Therefore, we aimed to evaluate the roles of race/ethnicity and gender in this relationship. We identified eligible patients from Surveillance, Epidemiology and End Results (SEER) database during 2004-2012. Overall and cancer-specific survival differences across marital status were compared by Kaplan-Meier curves. We also estimated crude hazard ratios (CHRs) and adjusted hazard ratios (AHRs) with 95% confidence intervals (CIs) for marital status associated with survival by race/ethnicity and gender in Cox proportional hazard models. A total of 12,168 eligible patients diagnosed with hepatocellular carcinoma were included. We observed that married status was an independent protective prognostic factor for overall and cancer-specific survival. In stratified analyses by race/ethnicity, the AHR of overall mortality (unmarried vs married) was highest for Hispanic (AHR =1.25, 95% CI, 1.13-1.39; P married patients obtained better survival advantages. Race/ethnicity and gender could influence the magnitude of associations between marital status and risk of mortality.

  15. Decreased graft survival in liver transplant recipients of donors with positive blood cultures: a review of the United Network for Organ Sharing dataset.

    Science.gov (United States)

    Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto

    2017-06-01

    Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.

  16. Natural history definition and a suggested clinical approach to Buerger's disease: a case-control study with survival analysis.

    Science.gov (United States)

    Fazeli, Bahare; Ravari, Hassan; Assadi, Reza

    2012-08-01

    The aim of this study was first to describe the natural history of Buerger's disease (BD) and then to discuss a clinical approach to this disease based on multivariate analysis. One hundred eight patients who corresponded with Shionoya's criteria were selected from 2000 to 2007 for this study. Major amputation was considered the ultimate adverse event. Survival analyses were performed by Kaplan-Meier curves. Independent variables including gender, duration of smoking, number of cigarettes smoked per day, minor amputation events and type of treatments, were determined by multivariate Cox regression analysis. The recorded data demonstrated that BD may present in four forms, including relapsing-remitting (75%), secondary progressive (4.6%), primary progressive (14.2%) and benign BD (6.2%). Most of the amputations occurred due to relapses within the six years after diagnosis of BD. In multivariate analysis, duration of smoking of more than 20 years had a significant relationship with further major amputation among patients with BD. Smoking cessation programs with experienced psychotherapists are strongly recommended for those areas in which Buerger's disease is common. Patients who have smoked for more than 20 years should be encouraged to quit smoking, but should also be recommended for more advanced treatment for limb salvage.

  17. Coupled skinny baker's maps and the Kaplan-Yorke conjecture

    Science.gov (United States)

    Gröger, Maik; Hunt, Brian R.

    2013-09-01

    The Kaplan-Yorke conjecture states that for ‘typical’ dynamical systems with a physical measure, the information dimension and the Lyapunov dimension coincide. We explore this conjecture in a neighborhood of a system for which the two dimensions do not coincide because the system consists of two uncoupled subsystems. We are interested in whether coupling ‘typically’ restores the equality of the dimensions. The particular subsystems we consider are skinny baker's maps, and we consider uni-directional coupling. For coupling in one of the possible directions, we prove that the dimensions coincide for a prevalent set of coupling functions, but for coupling in the other direction we show that the dimensions remain unequal for all coupling functions. We conjecture that the dimensions prevalently coincide for bi-directional coupling. On the other hand, we conjecture that the phenomenon we observe for a particular class of systems with uni-directional coupling, where the information and Lyapunov dimensions differ robustly, occurs more generally for many classes of uni-directionally coupled systems (also called skew-product systems) in higher dimensions.

  18. The Factor Structure and Age-Related Factorial Invariance of the Delis-Kaplan Executive Function System (D-KEFS)

    Science.gov (United States)

    Latzman, Robert D.; Markon, Kristian E.

    2010-01-01

    There has been an increased interest in the structure of and relations among executive functions.The present study examined the factor structure as well as age-related factorial invariance of the Delis-Kaplan Executive Function System (D-KEFS), a widely used inventory aimed at assessing executive functions. Analyses were first conducted using data…

  19. Part 5: Receiver Operating Characteristic Curve and Area under the Curve

    Directory of Open Access Journals (Sweden)

    Saeed Safari

    2016-04-01

    Full Text Available Multiple diagnostic tools are used by emergency physicians,every day. In addition, new tools are evaluated to obtainmore accurate methods and reduce time or cost of conventionalones. In the previous parts of this educationalseries, we described diagnostic performance characteristicsof diagnostic tests including sensitivity, specificity, positiveand negative predictive values, and likelihood ratios. Thereceiver operating characteristics (ROC curve is a graphicalpresentation of screening characteristics. ROC curve is usedto determine the best cutoff point and compare two or moretests or observers by measuring the area under the curve(AUC. In this part of our educational series, we explain ROCcurve and two methods to determine the best cutoff value.

  20. MNS16A minisatellite genotypes in relation to risk of glioma and meningioma and to glioblastoma outcome

    DEFF Research Database (Denmark)

    Andersson, U.; Osterman, P.; Sjostrom, S.

    2009-01-01

    was analysed using Kaplan-Meier estimates and equality of survival distributions using the log-rank test and Cox proportional hazard ratios. The MNS16A genotype was not associated with risk of occurrence of glioma, glioblastoma (GBM) or meningioma. For GBM there were median survivals of 15.3, 11.0 and 10...

  1. Pressure pulsation in Kaplan turbines: Prototype-CFD comparison

    International Nuclear Information System (INIS)

    Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F

    2012-01-01

    Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.

  2. Pressure pulsation in Kaplan turbines: Prototype-CFD comparison

    Science.gov (United States)

    Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.

    2012-11-01

    Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.

  3. Socialization into a Civilization: The Dewey-Kaplan Synthesis in American Jewish Schooling in the Early 20th Century

    Science.gov (United States)

    Jacobs, Benjamin M.

    2009-01-01

    This historical study focuses on how John Dewey's theory of education as socialization and Mordecai Kaplan's theory of Judaism as a civilization together served as an ideological base and pedagogical framework for the creation of "progressive," "reconstructed" American Jewish school programs in the early 20th century…

  4. Technological change in energy systems. Learning curves, logistic curves and input-output coefficients

    International Nuclear Information System (INIS)

    Pan, Haoran; Koehler, Jonathan

    2007-01-01

    Learning curves have recently been widely adopted in climate-economy models to incorporate endogenous change of energy technologies, replacing the conventional assumption of an autonomous energy efficiency improvement. However, there has been little consideration of the credibility of the learning curve. The current trend that many important energy and climate change policy analyses rely on the learning curve means that it is of great importance to critically examine the basis for learning curves. Here, we analyse the use of learning curves in energy technology, usually implemented as a simple power function. We find that the learning curve cannot separate the effects of price and technological change, cannot reflect continuous and qualitative change of both conventional and emerging energy technologies, cannot help to determine the time paths of technological investment, and misses the central role of R and D activity in driving technological change. We argue that a logistic curve of improving performance modified to include R and D activity as a driving variable can better describe the cost reductions in energy technologies. Furthermore, we demonstrate that the top-down Leontief technology can incorporate the bottom-up technologies that improve along either the learning curve or the logistic curve, through changing input-output coefficients. An application to UK wind power illustrates that the logistic curve fits the observed data better and implies greater potential for cost reduction than the learning curve does. (author)

  5. The value of molecular expression of KIT and KIT ligand analysed using real-time polymerase chain reaction and immunohistochemistry as a prognostic indicator for canine cutaneous mast cell tumours.

    Science.gov (United States)

    Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M

    2015-03-01

    This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.

  6. Usefulness of midregional pro-adrenomedullin as a marker of organ damage and predictor of mortality in patients with sepsis.

    Science.gov (United States)

    Bernal-Morell, Enrique; García-Villalba, Eva; Vera, Maria Del Carmen; Medina, Blanca; Martinez, Monica; Callejo, Victoria; Valero, Salvador; Cinesi, Cesar; Piñera, Pascual; Alcaraz, Antonia; Marin, Irene; Muñoz, Angeles; Cano, Alfredo

    2018-03-01

    Midregional proadrenomedullin (MR-proADM) is a prognostic biomarker in patients with community-acquired pneumonia (CAP) and sepsis. In this paper, we examined the ability of MR-proADM to predict organ damage and long-term mortality in sepsis patients, compared to that of procalcitonin, C-reactive protein and lactate. This was a prospective observational cohort, enrolling severe sepsis or septic shock patients admitted to internal service department. The association between biomarkers and 90-day mortality was assessed by Cox regression analysis and Kaplan-Meier curves. The accuracy of biomarkers for mortality was determined by area under the receiver operating characteristic curve (AUROC) analysis. A total of 148 patients with severe sepsis, according to the criteria of the campaign to survive sepsis, were enrolled. Eighty-five (57.4%) had sepsis according to the new criteria of Sepsis-3. MR-proADM showed the best AUROC to predict sepsis as defined by the Sepsis-3 criteria (AUROC of 0.771, 95% CI 0.692-0.850, p scale, especially when scores are low. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  7. Multiple myeloma in Nigeria: An insight to the clinical, laboratory ...

    African Journals Online (AJOL)

    The average percentage of bone marrow plasmacytosis at diagnosis ... of autologous stem cell transplantation (ASCT) for white, black, and ... Hospital Cancer Registry and Data Collation Institute. .... Figure 1: (a) Kaplan‑Meier survival curve for all myeloma patients, (b) Kaplan‑Meier survival curve for the different sexes b a ...

  8. Differential geometry and topology of curves

    CERN Document Server

    Animov, Yu

    2001-01-01

    Differential geometry is an actively developing area of modern mathematics. This volume presents a classical approach to the general topics of the geometry of curves, including the theory of curves in n-dimensional Euclidean space. The author investigates problems for special classes of curves and gives the working method used to obtain the conditions for closed polygonal curves. The proof of the Bakel-Werner theorem in conditions of boundedness for curves with periodic curvature and torsion is also presented. This volume also highlights the contributions made by great geometers. past and present, to differential geometry and the topology of curves.

  9. The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

    International Nuclear Information System (INIS)

    Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.

    2016-01-01

    Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

  10. The Short-Term and Intermediate-Term Risk of Second Neoplasms After Diagnosis and Treatment of Unilateral Vestibular Schwannoma: Analysis of 9460 Cases

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)

    2016-07-15

    Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases

  11. Simplified tools for measuring retention in care in antiretroviral treatment program in Ethiopia: cohort and current retention in care.

    Science.gov (United States)

    Assefa, Yibeltal; Worku, Alemayehu; Wouters, Edwin; Koole, Olivier; Haile Mariam, Damen; Van Damme, Wim

    2012-01-01

    Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.

  12. Simplified tools for measuring retention in care in antiretroviral treatment program in Ethiopia: cohort and current retention in care.

    Directory of Open Access Journals (Sweden)

    Yibeltal Assefa

    Full Text Available INTRODUCTION: Patient retention in care is a critical challenge for antiretroviral treatment programs. This is mainly because retention in care is related to adherence to treatment and patient survival. It is therefore imperative that health facilities and programs measure patient retention in care. However, the currently available tools, such as Kaplan Meier, for measuring retention in care have a lot of practical limitations. The objective of this study was to develop simplified tools for measuring retention in care. METHODS: Retrospective cohort data were collected from patient registers in nine health facilities in Ethiopia. Retention in care was the primary outcome for the study. Tools were developed to measure "current retention" in care during a specific period of time for a specific "ART-age group" and "cohort retention" in care among patients who were followed for the last "Y" number of years on ART. "Probability of retention" based on the tool for "cohort retention" in care was compared with "probability of retention" based on Kaplan Meier. RESULTS: We found that the new tools enable to measure "current retention" and "cohort retention" in care. We also found that the tools were easy to use and did not require advanced statistical skills. Both "current retention" and "cohort retention" are lower among patients in the first two "ART-age groups" and "ART-age cohorts" than in subsequent "ART-age groups" and "ART-age cohorts". The "probability of retention" based on the new tools were found to be similar to the "probability of retention" based on Kaplan Meier. CONCLUSION: The simplified tools for "current retention" and "cohort retention" will enable practitioners and program managers to measure and monitor rates of retention in care easily and appropriately. We therefore recommend that health facilities and programs start to use these tools in their efforts to improve retention in care and patient outcomes.

  13. Mixture models for undiagnosed prevalent disease and interval-censored incident disease: applications to a cohort assembled from electronic health records.

    Science.gov (United States)

    Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A

    2017-09-30

    For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  14. Risk factors affecting survival in heart transplant patients.

    Science.gov (United States)

    Almenar, L; Cardo, M L; Martínez-Dolz, L; García-Palomar, C; Rueda, J; Zorio, E; Arnau, M A; Osa, A; Palencia, M

    2005-11-01

    Certain cardiovascular risk factors have been linked to morbidity and mortality in heart transplant (HT) patients. The sum of various risk factors may have a large cumulative negative effect, leading to a substantially worse prognosis and the need to consider whether HT is contraindicated. The objective of this study was to determine whether the risk factors usually available prior to HT result in an excess mortality in our setting that contraindicates transplantation. Consecutive patients who underwent heart transplantation from November 1987 to January 2004 were included. Heart-lung transplants, retransplants, and pediatric transplants were excluded. Of the 384 patients, 89% were men. Mean age was 52 years (range, 12 to 67). Underlying disease included ischemic heart disease (52%), idiopathic dilated cardiomyopathy (36%), valvular disease (8%), and other (4%). Variables considered risk factors were obesity (BMI >25), dyslipidemia, hypertension, prior thoracic surgery, diabetes, and history of ischemic heart disease. Survival curves by number of risk factors using Kaplan-Meier and log-rank for comparison of curves. Overall patient survival at 1, 5, 10, and 13 years was 76%, 68%, 54%, and 47%, respectively. Survival at 10 years, if fewer than two risk factors were present, was 69%; 59% if two or three factors were present; and 37% if more than three associated risk factors were present (P = .04). The presence of certain risk factors in patients undergoing HT resulted in lower survival rates. The combination of various risk factors clearly worsened outcomes. However, we do not believe this should be an absolute contraindication for transplantation.

  15. [Application of Competing Risks Model in Predicting Smoking Relapse Following Ischemic Stroke].

    Science.gov (United States)

    Hou, Li-Sha; Li, Ji-Jie; Du, Xu-Dong; Yan, Pei-Jing; Zhu, Cai-Rong

    2017-07-01

    To determine factors associated with smoking relapse in men who survived from their first stroke. Data were collected through face to face interviews with stroke patients in the hospital, and then repeated every three months via telephone over the period from 2010 to 2014. Kaplan-Meier method and competing risk model were adopted to estimate and predict smoking relapse rates. The Kaplan-Meier method estimated a higher relapse rate than the competing risk model. The four-year relapse rate was 43.1% after adjustment of competing risk. Exposure to environmental tobacco smoking outside of home and workplace (such as bars and restaurants) ( P =0.01), single ( P <0.01), and prior history of smoking at least 20 cigarettes per day ( P =0.02) were significant predictors of smoking relapse. When competing risks exist, competing risks model should be used in data analyses. Smoking interventions should give priorities to those without a spouse and those with a heavy smoking history. Smoking ban in public settings can reduce smoking relapse in stroke patients.

  16. Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis

    DEFF Research Database (Denmark)

    Egeberg, Alexander; Skov, Lone; Zachariae, Claus

    2018-01-01

    It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....

  17. Preoperative serum lipid profile and outcome in nonmetastatic colorectal cancer

    Directory of Open Access Journals (Sweden)

    Ting-Ting Hong

    2016-12-01

    , histological grade, tumor deposits, LVI, PNI, and adjuvant treatment (all P > 0.05. In agreement, the Kaplan-Meier curves for OS according to the lipid quartiles were not significantly different, as confirmed by the log-rank test (all P > 0.05. MFP analysis also found no significant associations between lipid levels and OS (all P > 0.05. A prognostic model that included lipids had a higher Harrell's C-statistic and a lower AIC value than did a model that did not include lipids (for Harrell's C-statistic: 0.82 vs. 0.77; for AIC: 398 vs. 432. Conclusion: Measuring preoperative serum lipid levels may be a simple and cost-effective way of increasing prognostic accuracy in patients with non-mCRC treated with curative surgery. Keywords: Serum lipids, Colorectal cancer, Overall survival, Prognostic model

  18. Simulating Supernova Light Curves

    Energy Technology Data Exchange (ETDEWEB)

    Even, Wesley Paul [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dolence, Joshua C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-05-05

    This report discusses supernova light simulations. A brief review of supernovae, basics of supernova light curves, simulation tools used at LANL, and supernova results are included. Further, it happens that many of the same methods used to generate simulated supernova light curves can also be used to model the emission from fireballs generated by explosions in the earth’s atmosphere.

  19. Simulating Supernova Light Curves

    International Nuclear Information System (INIS)

    Even, Wesley Paul; Dolence, Joshua C.

    2016-01-01

    This report discusses supernova light simulations. A brief review of supernovae, basics of supernova light curves, simulation tools used at LANL, and supernova results are included. Further, it happens that many of the same methods used to generate simulated supernova light curves can also be used to model the emission from fireballs generated by explosions in the earth's atmosphere.

  20. European column buckling curves and finite element modelling including high strength steels

    DEFF Research Database (Denmark)

    Jönsson, Jeppe; Stan, Tudor-Cristian

    2017-01-01

    Eurocode allows for finite element modelling of plated steel structures, however the information in the code on how to perform the analysis or what assumptions to make is quite sparse. The present paper investigates the deterministic modelling of flexural column buckling using plane shell elements...... imperfections may be very conservative if considered by finite element analysis as described in the current Eurocode code. A suggestion is given for a slightly modified imperfection formula within the Ayrton-Perry formulation leading to adequate inclusion of modern high grade steels within the original four...... bucking curves. It is also suggested that finite element or frame analysis may be performed with equivalent column bow imperfections extracted directly from the Ayrton-Perry formulation....

  1. Increased Persistence of Initial Treatment for HIV Infection With Modern Antiretroviral Therapy.

    Science.gov (United States)

    Davy-Mendez, Thibaut; Eron, Joseph J; Zakharova, Oksana; Wohl, David A; Napravnik, Sonia

    2017-10-01

    Initiating antiretroviral therapy (ART) early improves clinical outcomes and prevents transmission. Guidelines for first-line therapy have changed with the availability of newer ART agents. In this study, we compared persistence and virologic responses with initial ART according to the class of anchor agent used. An observational clinical cohort study in the Southeastern United States. All HIV-infected patients participating in the UNC Center for AIDS Research Clinical Cohort (UCHCC) and initiating ART between 1996 and 2014 were included. Separate time-to-event analyses with regimen discontinuation and virologic failure as outcomes were used, including Kaplan-Meier survival curves and adjusted Cox proportional hazards models. One thousand six hundred twenty-four patients were included (median age of 37 years at baseline, 28% women, 60% African American, and 28% white). Eleven percent initiated integrase strand transfer inhibitor (INSTI), 33% non-nucleoside reverse transcriptase inhibitor (NNRTI), 20% boosted protease inhibitor, 27% other, and 9% NRTI only regimens. Compared with NNRTI-containing regimens, INSTI-containing regimens had an adjusted hazard ratio of 0.49 (95% confidence interval, 0.35 to 0.69) for discontinuation and 0.70 (95% confidence interval, 0.46 to 1.06) for virologic failure. All other regimen types were associated with increased rates of discontinuation and failure compared with NNRTI. Initiating ART with an INSTI-containing regimen was associated with lower rates of regimen discontinuation and virologic failure.

  2. Miners’ return to work following injuries in coal mines

    Directory of Open Access Journals (Sweden)

    Ashis Bhattacherjee

    2016-12-01

    Full Text Available Background: The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW following a miner’s injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person’s social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners’ injuries. Material and Methods: A study was conducted for 109 injured workers from an underground coal mine in the years 2000–2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. Results: According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners’ return to work included presence of disease, job satisfaction and injury type. Conclusions: The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6:729–742

  3. Technique-associated outcomes in horses following large colon resection.

    Science.gov (United States)

    Pezzanite, Lynn M; Hackett, Eileen S

    2017-11-01

    To compare survival and complications in horses undergoing large colon resection with either sutured end-to-end or stapled functional end-to-end anastomoses. Retrospective cohort study. Twenty-six client-owned horses with gastrointestinal disease. Retrospective data were retrieved from the medical records of 26 horses undergoing colectomy, including 14 horses with sutured end-to-end and 12 horses with stapled functional end-to-end anastomoses, between 2003 and 2016. Records were evaluated for signalment, medical and surgical treatments, and survival to hospital discharge. Long-term follow-up was obtained through owner contact. Continuous variables were compared with Mann-Whitney tests. Fisher's exact testing was used to compare survival to hospital discharge. Survival time was compared by constructing Kaplan-Meier survival curves and performing log-rank curve comparison testing. Mean age of horses undergoing colectomy was 13 years. Reason for colectomy was prophylaxis (12) or salvage (14). Mean surgical time was 169 minutes. Mean hospitalization time was 9 days, which did not differ with anastomosis type (P = .62). Nine of 12 horses undergoing stapled functional end-to-end anastomosis and 12 of 14 horses undergoing sutured end-to-end anastomosis survived to hospital discharge (P = .63). Survival time did not differ with anastomosis technique (P = .35). Short- and long-term survival outcomes are not different between sutured end-to-end or stapled functional end-to-end anastomoses in horses undergoing colectomy. © 2017 The American College of Veterinary Surgeons.

  4. Prognostic classification index in Iranian colorectal cancer patients: Survival tree analysis

    Directory of Open Access Journals (Sweden)

    Amal Saki Malehi

    2016-01-01

    Full Text Available Aims: The aim of this study was to determine the prognostic index for separating homogenous subgroups in colorectal cancer (CRC patients based on clinicopathological characteristics using survival tree analysis. Methods: The current study was conducted at the Research Center of Gastroenterology and Liver Disease, Shahid Beheshti Medical University in Tehran, between January 2004 and January 2009. A total of 739 patients who already have been diagnosed with CRC based on pathologic report were enrolled. The data included demographic and clinical-pathological characteristic of patients. Tree-structured survival analysis based on a recursive partitioning algorithm was implemented to evaluate prognostic factors. The probability curves were calculated according to the Kaplan-Meier method, and the hazard ratio was estimated as an interest effect size. Result: There were 526 males (71.2% of these patients. The mean survival time (from diagnosis time was 42.46± (3.4. Survival tree identified three variables as main prognostic factors and based on their four prognostic subgroups was constructed. The log-rank test showed good separation of survival curves. Patients with Stage I-IIIA and treated with surgery as the first treatment showed low risk (median = 34 months whereas patients with stage IIIB, IV, and more than 68 years have the worse survival outcome (median = 9.5 months. Conclusion: Constructing the prognostic classification index via survival tree can aid the researchers to assess interaction between clinical variables and determining the cumulative effect of these variables on survival outcome.

  5. Risk factors associated with prognosis of progressive stages of acute-on-chronic hepatitis B liver failure

    Directory of Open Access Journals (Sweden)

    YE Peiyan

    2013-04-01

    Full Text Available ObjectiveTo identify the risk factors associated with progression of acute-on-chronic liver failure (ACLF occurring in patients with chronic hepatitis B virus (HBV infection (CHB. MethodsThe clinical, demographic, treatment and outcome data of 180 ACLF patients with concomitant CHB managed in our hospital between June 2009 and September 2012 were retrospectively reviewed. Clinical data, taken at baseline, included markers of inflammation/infection (white blood cell (WBC count, coagulation (prothrombin time (PT and prothrombin activity (PTA, and liver function (alanine aminotransferase (ALT, aspartate aminotransferase (AST, total bilirubin (TBil, direct bilirubin (DBil, choninesterase (CHE, albumin (Alb, globulin (Glb, total cholesterol (TC, and ammonia. In-hospital treatments included supplementation with traditional Chinese medicine-based therapies, such as Tuihuang decoction and detoxification enema. The primary outcome was survival during hospitalization. The patients were grouped for analysis according to ACLF stage (early, n=93; mid, n=61; late, n=26 and the risk factors associated with each stage were identified by using univariate (log-rank test and multivariate (Cox’s test regression analyses. The association of risk factors with patient survival was assessed by Kaplan-Meier curve analysis. ResultsThe three ACLF groups showed significantly different amounts of leukocytes, with the late ACLF group showing the highest WBC. The late ACLF group also showed significantly lower Glb and TC. There was a trend in reduced cumulative survival rate and shorter time to death that significantly corresponded to progressive stages of ACLF (early ACLF>mid ACLF>late ACLF; all P<0.001. One-hundred-and-twenty-six (70.0% of the patients died during their hospitalization, and multivariate regression analysis of this entire patient population identified absence of colonic enema, presence of hepatic encephalopathy, presence of hepatorenal syndrome, PTA

  6. Association of the AA genotype of the BCL2 (-938C>A) promoter polymorphism with better survival in ovarian cancer.

    Science.gov (United States)

    Heubner, Martin; Wimberger, Pauline; Otterbach, Friedrich; Kasimir-Bauer, Sabine; Siffert, Winfried; Kimmig, Rainer; Nückel, Holger

    2009-01-01

    Bcl-2 plays a key role in the regulation of apoptosis. Recently, a novel regulatory single nucleotide polymorphism (-938C>A) in the inhibitory P2 BCL2 promoter was described. In this study we investigated its potential association with survival in epithelial ovarian cancer. Patients (n=110) with primary epithelial ovarian cancer were retrospectively genotyped by pyrosequencing. Genotype distribution was not significantly different between 110 ovarian cancer patients and 120 healthy controls, suggesting that genotypes of this polymorphism do not increase the susceptibility to ovarian cancer. Kaplan-Meier curves showed a significant association of the AA genotype with increased survival (p=0.002). Multivariate analysis revealed that the BCL2-938AC/CC genotype (hazard ratio 4.5; p=0.003) was an independent prognostic factor compared to other prognostic factors such as age, histological grade or tumor stage. The results suggest a role for the BCL2-938C>A polymorphism as a marker for survival in patients with epithelial ovarian cancer.

  7. Randomized controlled study on the effect of adjuvant immunotherapy with OK-432 on malignant gliomas

    International Nuclear Information System (INIS)

    Shibata, Shobu; Mori, Kazuo; Moriyama, Tadayoshi; Tanaka, Keisei; Moroki, Jiro.

    1985-01-01

    During periods from January, 1981 to December, 1983, 51 patients (31 malignant astrocytomas, 17 glioblastomas, and others 3) were treated with radiochemotherapy using Nimustine hydrochloride, ACNU (group B) and radiochemoimmunotherapy with Picibanil, OK-432 (group A) by randomized controlled study. Group A consisted of 24 patients and group B of 27 patients. The differences in the background of the two groups were not statistically significant. Survival curves of both groups were shown by the Kaplan-Meier method. The postoperative survival rate at 1 year and 2 years were 70 % and 30 %, respectively, equal in both groups, and the differences between groups A and B were not statistically significant by the Cox-Mantel test. The side effects by group B therapy were most prominent in the bone marrow, and severe leukopenia occurred. However, group A therapy suppressed leukopenia after 2 months. Immunological parameters, such as purified protein derivative skin reaction test did not change, but streptococcal Su-polysaccharide skin reaction test became positive after group A therapy. (author)

  8. Prognostic role of ABO blood type in patients with extranodal natural killer/T cell lymphoma, nasal type: a triple-center study.

    Science.gov (United States)

    Li, Ya-Jun; Yi, Ping-Yong; Li, Ji-Wei; Liu, Xian-Ling; Tang, Tian; Zhang, Pei-Ying; Jiang, Wen-Qi

    2017-07-31

    The prognostic significance of ABO blood type for lymphoma is largely unknown. We evaluated the prognostic role of ABO blood type in patients with extranodal natural killer (NK)/T-cell lymphoma (ENKTL). We retrospectively analyzed clinical data of 697 patients with newly diagnosed ENKTL from three cancer centers. The prognostic value of ABO blood type was evaluated using Kaplan-Meier curves and Cox proportional hazard models. The prognostic values of the International Prognostic Index (IPI) and the Korean Prognostic Index (KPI) were also evaluated. Compared with patients with blood type O, those with blood type non-O tended to display elevated baseline serum C-reactive protein levels (P = 0.038), lower rate of complete remission (P = 0.005), shorter progression-free survival (PFS, P 60 years (P KPI in distinguishing between the intermediate-to-low- and high-to-intermediate-risk groups. ABO blood type was an independent predictor of clinical outcome for patients with ENKTL.

  9. Colistin-resistant Enterobacteriaceae infections: clinical and molecular characterization and analysis of in vitro synergy.

    Science.gov (United States)

    de Maio Carrillho, Claudia M D; Gaudereto, Juliana J; Martins, Roberta Cristina Ruedas; de Castro Lima, Victor Augusto Camarinha; de Oliveira, Larissa M; Urbano, Mariana R; Perozin, Jamile S; Levin, Anna Sara; Costa, Silvia F

    2017-03-01

    We described 27 polyclonal colistin-resistant Enterobacteriaceae (MIC 4-16 μg/mL) infections (12 pneumonia, 12 urinary tract infection (UTI), two Bacteremia, and one skin/soft tissue infection) in which 74% harbored KPC. The isolates were polyclonal, 6 STs were identified and the colistin resistance was due to chromosome mutations. Eight patients with UTI received monotherapy, and combination therapy was given to 19 patients. Overall mortality was 37%. In vitro synergy using time-kill assay was observed in 14 of 19 (74%) isolates tested; the synergistic effect was observed for almost all isolates for the combination of three drugs: colistin, amikacin, and tigecycline. The Kaplan-Meier survival curve showed no significant difference comparing combination therapy with 2, 3, or more drugs and risk factors associated with death were dialysis and shock. These findings reinforce the fact that colistin in combination with other classes of drugs can be useful in treating infections caused by colistin-resistant CRE. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. ALLOGENEIC STEM CELL TRANSPLANTATION FOR ADULT PATIENTS WITH ACUTE LEUKEMIA – 14 YEARS EXPERIENCE

    Directory of Open Access Journals (Sweden)

    Jože Pretnar

    2004-12-01

    Full Text Available Background. This study was designed to evaluate the impact of various prognostic factors on long-term survival and event free survival after allogeneic hematopoietic stem cell transplantation for patients with acute leukemia.Methods and patients. Between years 1989 and 2002 44 patients with acute leukemia (30 with AML and 14 with ALL were transplanted. Survival curves using the Kaplan-Meier method were calculated for patients transplanted with two different sources of stem cells – bone marrow and peripheral blood and separately for patients with female donor.Results. Estimated 10 years survival for AML is 43% and 64% for ALL patients which is not statistically different. There are no significant differences in outcome regarding source of stem cells and in donors’ gender.Conclusions. To conclude, our results show that neither source of stem cells nor donor’s gender has impact on the long-term survival after hematopoietic stem cell transplantation. As published previously patients transplanted beyond the first remission have significantly worse outcome.

  11. Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center

    Directory of Open Access Journals (Sweden)

    Claudio Calazan do Carmo

    2011-08-01

    Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (p<0.001. There was seen a dose-response relationship between mortality and clinical staging, ranging from 27.8 to 749.6 per 1,000 cases-year in women stage I and IV, respectively. CONCLUSIONS: The study showed that early detection through prevention programs is crucial to increase cervical cancer survival.

  12. Lagrangian Curves on Spectral Curves of Monopoles

    International Nuclear Information System (INIS)

    Guilfoyle, Brendan; Khalid, Madeeha; Ramon Mari, Jose J.

    2010-01-01

    We study Lagrangian points on smooth holomorphic curves in TP 1 equipped with a natural neutral Kaehler structure, and prove that they must form real curves. By virtue of the identification of TP 1 with the space LE 3 of oriented affine lines in Euclidean 3-space, these Lagrangian curves give rise to ruled surfaces in E 3 , which we prove have zero Gauss curvature. Each ruled surface is shown to be the tangent lines to a curve in E 3 , called the edge of regression of the ruled surface. We give an alternative characterization of these curves as the points in E 3 where the number of oriented lines in the complex curve Σ that pass through the point is less than the degree of Σ. We then apply these results to the spectral curves of certain monopoles and construct the ruled surfaces and edges of regression generated by the Lagrangian curves.

  13. Epidemiology of Massive Transfusion

    DEFF Research Database (Denmark)

    Halmin, Märit; Chiesa, Flaminia; Vasan, Senthil K

    2016-01-01

    in Sweden from 1987 and in Denmark from 1996. A total of 92,057 patients were included. Patients were followed until the end of 2012. MEASUREMENTS AND MAIN RESULTS: Descriptive statistics were used to characterize the patients and indications. Post transfusion mortality was expressed as crude 30-day...... mortality and as long-term mortality using the Kaplan-Meier method and using standardized mortality ratios. The incidence of massive transfusion was higher in Denmark (4.5 per 10,000) than in Sweden (2.5 per 10,000). The most common indication for massive transfusion was major surgery (61.2%) followed...

  14. Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer

    DEFF Research Database (Denmark)

    Fransgaard, T; Thygesen, L C; Gögenur, I

    2016-01-01

    with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...

  15. A conversation with Drs. Kaplan and Moser about conflicting data, confusing results, and some recent treatment recommendations for the management of hypertension.

    Science.gov (United States)

    Post, Wendy; Moser, Marvin; Kaplan, Norman

    2005-10-01

    Following a hypertension symposium in Baltimore, MD, on June 1, 2005, Dr. Wendy Post from the Johns Hopkins University School of Medicine, Baltimore, MD, had the opportunity to interview two of the outstanding hypertension experts in the United States on several controversial issues in hypertension management. Dr. Norman Kaplan is Clinical Professor of Medicine at the Southwestern Health Science Center in Dallas, TX, and Dr. Marvin Moser is Clinical Professor of Medicine at the Yale University School of Medicine, New Haven, CT. Both have been leaders in the field of hypertension treatment and education for more than 40 years. Dr. Kaplan's book Clinical Hypertension has been a standard textbook since 1973 and is now in its ninth edition. Dr. Marvin Moser was the Senior Medical Consultant to the National High Blood Pressure Education Program from 1974 to 2002 and was Chairman of the first Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure and a member of the six subsequent committees. His book Clinical Management of Hypertension is in its seventh edition. Drs. Moser and Kaplan were corecipients of the 2004 International Society of Hypertension Award for Outstanding Contributions to Hypertension Treatment and Education and have lectured extensively throughout the United States and overseas.

  16. Ab initio effective core potentials including relativistic effects. II. Potential energy curves for Xe2, Xe+2, and Xe*2

    International Nuclear Information System (INIS)

    Ermler, W.C.; Lee, Y.S.; Pitzer, K.S.; Winter, N.W.

    1978-01-01

    Potential energy curves for the ground 1 Σ + /sub g/ state of Xe 2 , the first four states of the Xe + 2 ions, and the eight Xe* 2 excimer states corresponding to the addition of a 6ssigma/sub g/ Rydberg electron to these ion cores have been computed using averaged relativistic effective core potentials (AREP) and the self-consistent field approximation for the valence electrons. The calculations were carried out using the LS-coupling scheme with the effects of spin--orbit coupling included in the resulting potential energy curves using an empirical procedure. A comparison of nonrelativistic and averaged relativistic EP's and subsequent molecular calculations indicates that relativistic effects arising from the mass--velocity and Darwin terms are not important for these properties of Xe 2 molecules. Spectroscopic constants for Xe + 2 are in good agreement with all electron CI calculations suggesting that the computed values for Xe* 2 excimers should be reliable. The lifetime for the O/sub u/ + state of the Xe 2 * is computed to be 5.6 nsec which is in the range of the experimentally determined values

  17. Contribution of serum FGF21 level to the identification of left ventricular systolic dysfunction and cardiac death.

    Science.gov (United States)

    Shen, Yun; Zhang, Xueli; Pan, Xiaoping; Xu, Yiting; Xiong, Qin; Lu, Zhigang; Ma, Xiaojing; Bao, Yuqian; Jia, Weiping

    2017-08-18

    The relationship between fibroblast growth factor 21 (FGF21) and cardiovascular disease has been well established in recent studies. This study aimed to investigate the relationship between FGF21 and left ventricular systolic dysfunction and cardiac death. Two-dimensional echocardiography was used to measure the left ventricular ejection fraction (LVEF) to estimate left ventricular systolic function. The optimal cutoff of FGF21 for identifying left ventricular systolic dysfunction at baseline was analyzed via receiver operating characteristic (ROC) curves. The identification of different serum levels of FGF21 and their association with cardiac death was analyzed via Kaplan-Meier survival curves. Serum FGF21 level was measured by an enzyme-linked immunosorbent assay kit, and serum N-terminal pro-brain natriuretic peptide (NT-pro-BNP) level was determined by a chemiluminescent immunoassay. A total of 253 patients were recruited for this study at baseline. Patients were excluded if they lacked echocardiography or laboratory measurement data, and there were 218 patients enrolled in the final analysis. The average age was 66.32 ± 10.10 years. The optimal cutoff values of FGF21 and NT-pro-BNP for identifying left ventricular systolic dysfunction at baseline were 321.5 pg/mL and 131.3 ng/L, respectively, determined separately via ROC analysis. The areas under the curves were non-significant among FGF21, NT-pro-BNP and FGF21 + NT-pro-BNP as determined by pairwise comparisons. Both a higher serum level of FGF21 and a higher serum level of NT-pro-BNP were independent risk factors for left ventricular systolic dysfunction at baseline (odd ratio (OR) 3.138 [1.037-9.500], P = 0.043, OR 9.207 [2.036-41.643], P = 0.004, separately). Further Kaplan-Meier survival analysis indicated an association between both a higher serum level of FGF21 and a higher serum level of NT-pro-BNP with cardiac death in 5 years [RR 5.000 (1.326-18.861), P = 0.026; RR 9.643 (2

  18. Development of low head Kaplan turbine for power station rehabilitation project

    Science.gov (United States)

    Lim, S. M.; Ohtake, N.; Kurosawa, S.; Suzuki, T.; Yamasaki, T.; Nishi, H.

    2012-11-01

    This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.

  19. Development of low head Kaplan turbine for power station rehabilitation project

    International Nuclear Information System (INIS)

    Lim, S M; Ohtake, N; Kurosawa, S; Suzuki, T; Yamasaki, T; Nishi, H

    2012-01-01

    This paper presents the latest Kaplan turbine rehabilitation project for Funagira Power Station in Japan completed by J-POWER Group in collaboration with Toshiba Corporation. Area of rehabilitation was restricted to guide vane and runner. The main goal of the rehabilitation project was to expand the operating range of the existing turbine in terms of discharge and power with high operational stability, low noise as well as high cavitation performance. Computational Fluids Dynamics and model test were used to optimize the shape of guide vane and runner in development stage. Finally, field tests and runner inspection were carried out to confirm the performance of the new turbine. It was found that the new turbine has excellent performance in efficiency, power output, operational stability compared with existing turbine. Moreover, no sign of cavitation on the runner blade surface was observed after 5078 hours of operation near 100% load.

  20. Relationship between Activities of Daily Living and Readmission within 90 Days in Hospitalized Elderly Patients with Heart Failure

    Directory of Open Access Journals (Sweden)

    Masahiro Kitamura

    2017-01-01

    Full Text Available Aims. To examine the relationship between activities of daily living (ADL and readmission within 90 days and assess the cutoff value of ADL to predict readmission in hospitalized elderly patients with heart failure (HF. Methods. This cohort study comprised 589 consecutive patients with HF aged ≥65 years, who underwent cardiac rehabilitation from May 2012 to May 2016 and were discharged home. We investigated patients’ characteristics, basic attributes, and ADL (motor and cognitive Functional Independence Measure [FIM]. We analyzed the data using the unpaired t-test, χ2 test, Cox proportional hazard model, receiver operating characteristic (ROC curve, and Kaplan-Meier method. Results. Of 589 patients, 113 met the criteria, and they were divided into the nonreadmission (n=90 and readmission groups (n=23. Age, body mass index, New York Heart Association class, hemoglobin level, and motor FIM score were significantly different between the two groups (p<0.05. The body mass index (hazard ratio [HR]: 0.87; p<0.05 and motor FIM score (HR: 0.94; p<0.01 remained statistically significant. The cutoff value for the motor FIM score determined by ROC curve analysis was 74.5 points (area under the curve = 0.78; p<0.001. Conclusion. The motor FIM score in elderly patients with HF was an independent predictor of rehospitalization within 90 days.

  1. Implementation of pressurized air injection system in a Kaplan prototype for the reduction of vibration caused by tip vortex cavitation

    Science.gov (United States)

    Rivetti, A.; Angulo, M.; Lucino, C.; Hene, M.; Capezio, O.; Liscia, S.

    2016-11-01

    Blade tip cavitation is a well-known phenomenon that affects the performance of large-diameter Kaplan turbines and induces structural vibration. Injection of pressurized air has been found to yield promising results in reducing those damaging effects. In this work, the results of an experimental test of air injection on a 9.5-m-diameter Kaplan turbine are reported. Experiments were performed for several load conditions and for two different net heads. Accelerations, pressure pulsation and noise emission were monitored for every tested condition. Results show that, at the expense of a maximum efficiency drop of 0.2%, air injection induces a decrease on the level of vibration from 57% up to 84%, depending on the load condition. Such decrease is seen to be proportional to the air flow rate, in the range from 0.06 to 0.8‰ (respect to the discharge at the best efficiency point).

  2. Glycolytic activity in breast cancer using 18F-FDG PET/CT as prognostic predictor: A molecular phenotype approach.

    Science.gov (United States)

    Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V

    2016-01-01

    To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.

  3. The Prognostic Impact of NK/NKT Cell Density in Periampullary Adenocarcinoma Differs by Morphological Type and Adjuvant Treatment.

    Science.gov (United States)

    Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin

    2016-01-01

    Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.

  4. The impact of engagement in street-based income generation activities on stimulant drug use cessation among people who inject drugs.

    Science.gov (United States)

    Ti, Lianping; Richardson, Lindsey; DeBeck, Kora; Nguyen, Paul; Montaner, Julio; Wood, Evan; Kerr, Thomas

    2014-08-01

    Despite the growing prevalence of illicit stimulant drug use internationally, and the widespread involvement of people who inject drugs (IDU) within street-based drug markets, little is known about the impact of different types of street-based income generation activities on the cessation of stimulant use among IDU. Data were derived from an open prospective cohort of IDU in Vancouver, Canada. We used Kaplan-Meier methods and Cox proportional hazards regression to examine the effect of different types of street-based income generation activities (e.g., sex work, drug dealing, and scavenging) on time to cessation of stimulant use. Between December, 2005 and November, 2012, 887 IDU who use stimulant drugs (cocaine, crack cocaine, or crystal methamphetamine) were prospectively followed-up for a median duration of 47 months. In Kaplan-Meier analyses, compared to those who did not engage in street-based income generation activities, participants who reported sex work, drug dealing, scavenging, or more than one of these activities were significantly less likely to report stimulant drug use cessation (all pstreet-based income generation activity remained significantly associated with a slower time to stimulant drug cessation (all p<0.005). Our findings highlight the urgent need for strategies to address stimulant dependence, including novel pharmacotherapies. Also important, structural interventions, such as low-threshold employment opportunities, availability of supportive housing, legal reforms regarding drug use, and evidence-based approaches that reduce harm among IDU are urgently required. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. A Bayesian CUSUM plot: Diagnosing quality of treatment.

    Science.gov (United States)

    Rosthøj, Steen; Jacobsen, Rikke-Line

    2017-12-01

    To present a CUSUM plot based on Bayesian diagnostic reasoning displaying evidence in favour of "healthy" rather than "sick" quality of treatment (QOT), and to demonstrate a technique using Kaplan-Meier survival curves permitting application to case series with ongoing follow-up. For a case series with known final outcomes: Consider each case a diagnostic test of good versus poor QOT (expected vs. increased failure rates), determine the likelihood ratio (LR) of the observed outcome, convert LR to weight taking log to base 2, and add up weights sequentially in a plot showing how many times odds in favour of good QOT have been doubled. For a series with observed survival times and an expected survival curve: Divide the curve into time intervals, determine "healthy" and specify "sick" risks of failure in each interval, construct a "sick" survival curve, determine the LR of survival or failure at the given observation times, convert to weights, and add up. The Bayesian plot was applied retrospectively to 39 children with acute lymphoblastic leukaemia with completed follow-up, using Nordic collaborative results as reference, showing equal odds between good and poor QOT. In the ongoing treatment trial, with 22 of 37 children still at risk for event, QOT has been monitored with average survival curves as reference, odds so far favoring good QOT 2:1. QOT in small patient series can be assessed with a Bayesian CUSUM plot, retrospectively when all treatment outcomes are known, but also in ongoing series with unfinished follow-up. © 2017 John Wiley & Sons, Ltd.

  6. Computational aspects of algebraic curves

    CERN Document Server

    Shaska, Tanush

    2005-01-01

    The development of new computational techniques and better computing power has made it possible to attack some classical problems of algebraic geometry. The main goal of this book is to highlight such computational techniques related to algebraic curves. The area of research in algebraic curves is receiving more interest not only from the mathematics community, but also from engineers and computer scientists, because of the importance of algebraic curves in applications including cryptography, coding theory, error-correcting codes, digital imaging, computer vision, and many more.This book cove

  7. Learning curves in health professions education.

    Science.gov (United States)

    Pusic, Martin V; Boutis, Kathy; Hatala, Rose; Cook, David A

    2015-08-01

    Learning curves, which graphically show the relationship between learning effort and achievement, are common in published education research but are not often used in day-to-day educational activities. The purpose of this article is to describe the generation and analysis of learning curves and their applicability to health professions education. The authors argue that the time is right for a closer look at using learning curves-given their desirable properties-to inform both self-directed instruction by individuals and education management by instructors.A typical learning curve is made up of a measure of learning (y-axis), a measure of effort (x-axis), and a mathematical linking function. At the individual level, learning curves make manifest a single person's progress towards competence including his/her rate of learning, the inflection point where learning becomes more effortful, and the remaining distance to mastery attainment. At the group level, overlaid learning curves show the full variation of a group of learners' paths through a given learning domain. Specifically, they make overt the difference between time-based and competency-based approaches to instruction. Additionally, instructors can use learning curve information to more accurately target educational resources to those who most require them.The learning curve approach requires a fine-grained collection of data that will not be possible in all educational settings; however, the increased use of an assessment paradigm that explicitly includes effort and its link to individual achievement could result in increased learner engagement and more effective instructional design.

  8. Mannheim Partner D-Curves in the Euclidean 3-space

    Directory of Open Access Journals (Sweden)

    Mustafa Kazaz

    2015-02-01

    Full Text Available In this paper, we consider the idea of Mannheim partner curves for curves lying on surfaces. By considering the Darboux frames of surface curves, we define Mannheim partner D-curves and give the characterizations for these curves. We also find the relations between geodesic curvatures, normal curvatures and geodesic torsions of these associated curves. Furthermore, we show that definition and characterizations of Mannheim partner D-curves include those of Mannheim partner curves in some special cases.

  9. Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome.

    Science.gov (United States)

    Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A

    2011-02-27

    Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.

  10. Application of willis covered stent in the treatment of aneurysms located in the cisternal segment of the internal carotid artery: a pilot comparative study with long-term follow-up results

    International Nuclear Information System (INIS)

    Zhu Yueqi; Li Minghua; Fang Chun; Wang Wu; Zhang Peilei; Cheng Yingsheng; Tan Huaqiao; Wang Jianbo

    2010-01-01

    Objective: Complicated aneurysms located in the cisternal segment of the internal carotid artery(ICA-CSA) present unique therapeutic difficulties. This study is to discuss the feasibility of the Willis stent-graft in treating complicated ICA-CSA by comparing its effect with that of coiling therapy. Methods: Willis covered stents were employed in 19 complicated ICA-CSAs (group A), while coils were used in 17 complicated ICA-CSAs (group B). Follow-up angiography was performed to investigate aneurysm recurrence, endoleak and parent artery (PA) stenosis. Kaplan-Meier curves were constructed to compare the recurrence-free and PA stenosis-free rate in both groups. Results: Total exclusion was immediately achieved in 13 ICA-CSAs and minor endoleaks presented in 5 cases in group A. Total or near-total occlusion was achieved in 7 ICA-CSAs, subtotal occlusion in 8 and partial occlusion in 2 cases in group B after coiling. Acute thrombosis occurred in 1 patient in either group and re-hemorrhage happened in 1 patient after coiling. Follow-up angiography in group A revealed that 16 ICA-CSAs were completely isolated, with two parent arteries showing mild in-stent stenosis. Eighteen months after the procedure, Kaplan-Meier analysis showed that the recurrence-free rate was 93.3% and 50%, while the stenosis-free rate of parent artery was 87.5% and 100% in group A and in Group B, respectively. In group A and group Bthe clinical neurological symptoms were fully recovered in 9 and 9, obviously improved in 3 and 5, unchanged in 2 and 2, and aggravated in one and 0 patients, respectively. Conclusion: The implantation of Willis stent-graft is a feasible endovascular therapy for complicated ICA-CSAs. When the parent artery is very tortuous or when the risk that a main collateral branch may be wrongly covered and occluded is present, the implantation of Willis covered stent can not be taken as the treatment of first choice. (authors)

  11. Evaluation of batroxobin in preventing vascular restenosis in diabetic patients after infrapopliteal arterial angioplasty: a randomized comparative study

    International Nuclear Information System (INIS)

    Xue Bo; Zhang Peilei; Wang Jue; Li Minghua; Zhao Jungong; Zhu Yueqi; Tan Huaqiao; Wang Jianbo

    2011-01-01

    Objective: To evaluate batroxobin in preventing vascular restenosis in diabetic patients after infrapopliteal arterial angioplasty through comparing the clinical results of the combination use of batroxobin and aspirin with that of simple use of aspirin. Methods: After a successful angioplasty, fifty-two diabetic patients with symptomatic infrapopliteal obstructions were randomly divided into the study group (n=26) and the control group (n=26). Patients in both groups received 100 aspirin everyday, but the patients in study group additionally received 5 IU batroxobin intravenous drip every day for six times. At the end of the follow-up period lasting for 12 months, magnetic resonance angiography (MRA) or Doppler ultrasonic angiography was performed to check the vessels to see if there was any restenosis or reocclusion. The relief degree of clinical symptoms were observed, and both preoperative and postoperative ankle-brachial index (ABI) were regularly determined and compared. Kaplan-Meier curves were constructed to evaluate restenosis/reocclusion-free rate, limb salvage rate and amputation-free rate. Results: During the follow-up period the occurrence of restenosis/reocclusion in study group and control group was 22.0% and 34.5% respectively (P=0.0307). Statistically significant difference in ABI existed between two groups both after the procedure (P<0.05) and at 12 months after the treatment (P=0.0094). Clinical improvement and tissue healing in study group and control group were observed in 23 and 19 patients respectively (P=0.0544). Twelve months after angioplasty, Kaplan-Meier analysis showed that the restenosis/reocclusion-free rate, the limb salvage rate and the amputation-free rate for study group were 74.0%, 96.2% and 84.6% respectively, while they was 54.8%, 92.3% and 84.6% respectively for control group. Conclusion: The results of this study indicate that the use of the clinical therapeutic efficacy and markedly relieve the symptoms, although this

  12. Hyperfractionation in carcinoma of the cervix: tumor control and late bowel complications

    International Nuclear Information System (INIS)

    Viswanathan, Faith Rangad; Varghese, Cherian; Peedicayil, Abraham; Lakshmanan, Jeyaseelan; Narayan, Viswanathan Perungulam

    1999-01-01

    Purpose: Hyperfractionation has been advocated to improve local tumor control by increasing radiation dose without increasing late normal tissue complications. The aim of this study was to determine if hyperfractionation decreased late bowel complications. Methods and Materials: Thirty patients with Stage II and III cervical cancer were randomized to receive either hyperfractionation or conventional fractionation. Patients were followed for 5 years and monitored for tumor control, recurrence, and bowel complications. The relative risks of tumor control and bowel complications were computed at 1 year and 5 years of follow-up. Kaplan-Meier survival curves were plotted to determine probabilities of being tumor-free and bowel complication-free. Results: There were 15 patients in each group. At 1 year of follow-up, 2 patients in the hyperfractionation group (13%) and 7 patients in the conventional treatment group (45%) had tumor (relative risk [RR] 0.3; 95% confidence interval [CI] 0.1, 1.1; p = 0.054). Delayed bowel complications were seen in 8 patients in the hyperfractionation group and 1 patient in the conventional treatment group (RR 7.5; 95% CI 1.1, 52; p = 0.014). At 5 years, 2 patients in the hyperfractionation group and 8 patients in the conventional treatment group had tumor (RR 0.3; 95% CI 0.1, 1.1; p = 0.04). Delayed bowel complications (Grades 2 and 3) occurred in 9 women in the hyperfractionation group and 2 patients in the conventional group (RR 5.4; 95% CI 1.5, 19.5; p 0.0006). Kaplan-Meier analysis showed that the hyperfractionation group had significantly more bowel complications over the 5 years of follow-up (p 0.024). Conclusion: Hyperfractionation may result in better tumor control both at 1 year and at 5 years following treatment of cervical cancer. However, hyperfractionation could lead to increased late bowel complications and must be used judiciously in the treatment of cervical cancer

  13. Relapse risk assessment of transplantation for patients with chronic myeloid leukaemia

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective To analyse the risk factors of relapse before bone marrow transplantation (BMT) and to present the prognostic information as good as possible.Methods A total of 3142 patients, who underwent the allogeneic blood or bone marrow tran splantation between 1989 and 1997 and were documented in the European Group for Blood and Marrow transplantation (EBMT), were included. Six possible risk factors including type of donor, stage of disease, age, gender, donor@#-recipient sex co mbination and the waiting time from diagnosis to transplation of relapse were co nsidered. The time to relapse was analysed by Kaplan-Meier curves and Coxregre ssion with stratification on prognostic factors that did not satisfy the Proport ional Hazard Assumption.Results An amount of 447 patients relapsed out of all 3142 patients. The relapse rate was 14.2%. Type of donor and stage of disease showed a clear prognostic effect, but failed the proportional hazard assumption. Therefore, the data were stratified on the combination of type of donor and stage of disease. Within these strata a n additional significant effect of age could be observed. Relative risk of age ≥40 vs age <40 was 1.32 (95% confidence interval 1.09-1.59). The prognostic model is summarized graphically.Conclusions The combination of type of donor, stage of disease and age of recipient at transplantation are important prognostic factors for relapse after BMT.

  14. Effect of Automobile Travel Time Between Patients' Homes and Ophthalmologists' Offices on Screening for Diabetic Retinopathy.

    Science.gov (United States)

    Macon, Céline; Carrier, Hélène; Janczewski, Aurélie; Verger, Pierre; Casanova, Ludovic

    2018-01-01

    The accessibility of ophthalmologists appears to influence the quality of screening for diabetic retinopathy (DR). The principal objective of this study was to analyze the effect of automobile travel time to the closest ophthalmologist on the time to DR screening. This historical cohort study used reimbursement databases from the principal national health insurance fund. Patients were included if they had been reimbursed at least thrice for oral antidiabetic medications in the 12 months before the study start date. Patients were followed up from January 1, 2008, for 4 years. The expected event was a DR screening by an ocular fundus examination. The automobile travel time to the nearest ophthalmologist was calculated by the distance between communes, estimated by appropriate software. A Kaplan-Meier curve and a multivariate Cox model were used to model the effect of travel time on the time until DR screening. A sensitivity analysis of travel time described the results of the Cox model. At the start of 2008, 6,573 patients living in 328 different municipalities were included. The multivariate model found that patients living 60 min or more away from an ophthalmologist had a lower instantaneous probability of DR screening than those living travel time. Increased automobile travel time for patients with diabetes to the nearest ophthalmologist was associated with a longer time to DR screening.

  15. Development of a statistically-based lower bound fracture toughness curve (Ksub(IR) curve)

    International Nuclear Information System (INIS)

    Wullaert, R.A.; Server, W.L.; Oldfield, W.; Stahlkopf, K.E.

    1977-01-01

    A program of initiation fracture toughness measurements on fifty heats of nuclear pressure vessel production materials (including weldments) was used to develop a methodology for establishing a revised reference toughness curve. The new methodology was statistically developed and provides a predefined confidence limit (or tolerance limit) for fracture toughness based upon many heats of a particular type of material. Overall reference curves were developed for seven specific materials using large specimen static and dynamic fracture toughness results. The heat-to-heat variation was removed by normalizing both the fracture toughness and temperature data with the precracked Charpy tanh curve coefficients for each particular heat. The variance and distribution about the curve were determined, and lower bounds of predetermined statistical significance were drawn based upon a Pearson distribution in the lower shelf region (since the data were skewed to high values) and a t-distribution in the transition temperature region (since the data were normally distributed)

  16. Mortality of first world war military personnel: comparison of two military cohorts.

    Science.gov (United States)

    Wilson, Nick; Clement, Christine; Summers, Jennifer A; Bannister, John; Harper, Glyn

    2014-12-16

    To identify the impact of the first world war on the lifespan of participating military personnel (including in veterans who survived the war). Comparison of two cohorts of military personnel, followed to death. Military personnel leaving New Zealand to participate in the first world war. From a dataset of the New Zealand Expeditionary Forces, we randomly selected participants who embarked on troopships in 1914 and a comparison non-combat cohort who departed on troopships in late 1918 (350 in each group). Lifespan based on dates of birth and death from a range of sources (such as individual military files and an official database of birth and death records). A quarter of the 1914 cohort died during the war, with deaths from injury predominating (94%) over deaths from disease (6%). This cohort had a significantly shorter lifespan than the late 1918 "non-combat" cohort, with median ages of death being 65.9 versus 74.2, respectively (a difference of 8.3 years shown also in Kaplan-Meier survival curves, log rank Pworld war in 1914 from New Zealand lost around eight years of life (relative to a comparable military cohort). In the postwar period they continued to have an increased risk of premature death. © Wilson et al 2014.

  17. The prognostic value of right ventricular long axis strain in non-ischaemic dilated cardiomyopathies using standard cardiac magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Arenja, Nisha [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Kantonsspital Olten, Department of Cardiology, Solothurner Spitaeler AG, Olten (Switzerland); Riffel, Johannes H.; Halder, Manuel; Djiokou, Charly N.; Fritz, Thomas; Andre, Florian; Siepen, Fabian aus dem; Zelniker, Thomas; Meder, Benjamin; Kayvanpour, Elham; Korosoglou, Grigorios [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Katus, Hugo A. [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); DZHK (German Centre for Cardiovascular Research), partner site Heidelberg, Heidelberg (Germany); Buss, Sebastian J. [University of Heidelberg, Department of Cardiology, Angiology and Pneumology, Heidelberg (Germany); Das Radiologische Zentrum - Radiology Center, Sinsheim-Eberbach-Erbach-Walldorf-Heidelberg (Germany)

    2017-09-15

    To investigate the association of right ventricular long axis strain (RV-LAS), a parameter of longitudinal function, with outcome in patients with non-ischaemic dilated cardiomyopathy (NIDCM). In 441 patients with NIDCM, RV-LAS was analysed retrospectively by measuring the length between the epicardial border of the left ventricular apex and the middle of a line connecting the origins of the tricuspidal valve leaflets in end-diastole and end-systole on non-contrast standard cine sequences. The primary endpoint (cardiac death or heart transplantation) occurred in 41 patients, whereas 95 reached the combined endpoint (including cardiac decompensation and sustained ventricular arrhythmias) during a median follow-up of 4.2 years. Kaplan-Meier survival curves showed a poor outcome in patients with RV-LAS values below -10% (log-rank, p < 0.0001). In a risk stratification model RV-LAS improved prediction of outcome in addition to RV ejection fraction (RVEF) and presence of late gadolinium enhancement. Assessment of RV-LAS offered incremental information compared to clinical symptoms, biomarkers and RVEF. Even in the subgroup with normal RVEF (>45%, n = 213) reduced RV-LAS was still associated with poor outcome. Assessment of RV-LAS is an independent indicator of outcome in patients with NIDCM and offers incremental information beyond clinical and cardiac MR parameters. (orig.)

  18. Nutritional prognostic scores in patients with hilar cholangiocarcinoma treated by percutaneous transhepatic biliary stenting combined with 125I seed intracavitary irradiation: A retrospective observational study.

    Science.gov (United States)

    Cui, Peiyuan; Pang, Qing; Wang, Yong; Qian, Zhen; Hu, Xiaosi; Wang, Wei; Li, Zongkuang; Zhou, Lei; Man, Zhongran; Yang, Song; Jin, Hao; Liu, Huichun

    2018-06-01

    We mainly aimed to preliminarily explore the prognostic values of nutrition-based prognostic scores in patients with advanced hilar cholangiocarcinoma (HCCA).We retrospectively analyzed 73 cases of HCCA, who underwent percutaneous transhepatic biliary stenting (PTBS) combined with I seed intracavitary irradiation from November 2012 to April 2017 in our department. The postoperative changes of total bilirubin (TBIL), direct bilirubin (DBIL), alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and albumin (ALB) were observed. The preoperative clinical data were collected to calculate the nutrition-based scores, including controlling nutritional status (CONUT), C-reactive protein/albumin ratio (CAR), and prognostic nutritional index (PNI). Kaplan-Meier curve and Cox regression model were used for overall survival (OS) analyses.The serum levels of TBIL, DBIL, ALT, AST, and ALP significantly reduced, and ALB significantly increased at 1 month and 3 months postoperatively. The median survival time of the cohort was 12 months and the 1-year survival rate was 53.1%. Univariate analysis revealed that the statistically significant factors related to OS were CA19-9, TBIL, ALB, CONUT, and PNI. Multivariate analysis further identified CA19-9, CONUT, and PNI as independent prognostic factors.Nutrition-based prognostic scores, CONUT and PNI in particular, can be used as predictors of survival in unresectable HCCA.

  19. Comparison between gastrostomy feeding and self-expandable metal stent insertion for patients with esophageal cancer and dysphagia.

    Science.gov (United States)

    Min, Yang Won; Jang, Eun Young; Jung, Ji Hey; Lee, Hyuk; Min, Byung-Hoon; Lee, Jun Haeng; Rhee, Poong-Lyul; Kim, Jae J

    2017-01-01

    Self-expandable metal stent (SEMS) insertion and percutaneous gastrostomy (PG) feeding are commonly used for patients with esophageal cancer and dysphagia. This study aimed to compare outcomes between SEMS insertion and PG feeding for them. We retrospectively analyzed 308 patients with esophageal cancer who underwent fully covered SEMS insertion (stent group) or PG (gastrostomy group) for dysphagia due to tumor. Patients with other causes of dysphagia, such as radiation-induced or postoperative stricture, were excluded from the study. Clinical outcomes were compared between the two groups, including overall survival and need for additional intervention and postprocedural nutritional status. At baseline, the stent group (n = 169) had more stage IV patients, less cervical cancers, and received radiotherapy and esophagectomy less often than the gastrostomy group (n = 64). The Kaplan-Meier curves showed higher overall survival in the gastrostomy group than in the stent group. Multivariate analysis revealed that PG was associated with better survival compared with SEMS insertion (hazard ratio 0.541, 95% confidence interval 0.346-0.848, p = 0.007). In addition, the gastrostomy group needed additional intervention less often (3.1% vs. 21.9%, p esophageal cancer and dysphagia. Stabilized nutritional status by PG may play a role in improving patient survival.

  20. Comparison of minocycline and azithromycin for the treatment of mild scrub typhus in northern China.

    Science.gov (United States)

    Zhao, Minxing; Wang, Ting; Yuan, Xiaoyu; Du, Weiming; Lin, Miaoxin; Shen, Yanbo

    2016-09-01

    Scrub typhus, caused by Orientia tsutsugamushi, has recently emerged in northern China where the disease had not been known to exist. Although doxycycline and azithromycin are the recommended agents for the treatment of scrub typhus, clinical responses depend both on the susceptibilities of various O. tsutsugamushi strains and the severity of the disease. A retrospective analysis was conducted on patients diagnosed with mild scrub typhus from August 2013 to January 2016 in the Affiliated Hospital of Nantong University, northern China. A total of 40 patients who received minocycline treatment and 34 patients who received azithromycin treatment were included in the analysis. All patients except one defervesced within 120 h after initiating antimicrobial therapy. Kaplan-Meier curves in association with log-rank test showed that the median time to defervescence was significantly shorter for the minocycline-treated group than the azithromycin-treated group (P = 0.003). There were no serious adverse events during treatment. No relapse occurred in either group during the 1-month follow-up period. In conclusion, both minocycline and azithromycin are effective and safe for the treatment of mild scrub typhus, but minocycline is more active than azithromycin against O. tsutsugamushi infection acquired in northern China. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  1. Prognostic value of pathological response to chemo radiotherapy of locally advanced low rectal cancer

    International Nuclear Information System (INIS)

    Bannura C, Guillermo; Vargas N, Claudio; Barrera E, Alejandro; Melo L, Carlos; Illanes F, Felipe

    2013-01-01

    Background: Preoperative chemo radiotherapy improves the prognosis of locally advanced low rectal cancer and induces a pathological response in the tumor, which may have prognostic value. Aim: To assess the results of rectal cancer treatment according to the degree of pathological response of the tumor after chemo radiotherapy. Patients and Methods: All patients with a locally advanced rectal cancer located within 11 cm of the rectal margin, subjected to preoperative chemo radiotherapy followed by surgical treatment in a period of 13 years, were included. Pathological response was classified as complete, intermediate and poor. The tumor was staged according to TNM 2002 classification. Survival was analyzed with Kaplan Meier curves and Cox regression. Results: Patients were followed for a mean of 50 months (range 18-156). Exclusive and global local relapse was observed in 3 and 9.6% of patients, respectively. Pathological response was complete in 13 patients (none died), intermediate in 23 (three died) and poor in 68 (22 died). Global five years survival was 74%. There was a concordance of 0.64 between survival and pathological response. The concordance between survival and TNM classification was 0.69. Conclusions: The pathological response of the tumor to chemo radiotherapy has a good concordance with prognosis, although it is not superior to the final pathological status

  2. Cardiac Iodine-123 metaiodobenzylguanidine (123I-MIBG) scintigraphy parameter predicts cardiac and cerebrovascular events in type 2 diabetic patients without structural heart disease

    International Nuclear Information System (INIS)

    Yufu, Kunio; Takahashi, Naohiko; Okada, Norihiro; Shinohara, Tetsuji; Nakagawa, Mikiko; Hara, Masahide; Yoshimatsu, Hironobu; Saikawa, Tetsunori

    2012-01-01

    Cardiac iodine-123 metaiodobenzylguanidine ( 123 I-MIBG) scintigraphy is an established method of assessment of cardiovascular sympathetic function. The aim of the present study was to investigate the long-term cardiovascular predictive value of cardiac 123 I-MIBG scintigraphy parameters in Japanese type 2 diabetic patients without structural heart disease. Cardiac 123 I-MIBG scintigraphy in 108 patients with type 2 diabetes who did not have structural heart disease, was evaluated. The washout rate (WR) was considered enhanced if it was ≥40%. Accurate follow-up information for 4.6 years was obtained in 54 enhanced WR patients (27 male; mean age, 61±11 years) and in 54 sex- and age-matched preserved WR patients (27 male; mean age, 61±10 years). Major adverse cardiac and cerebrovascular events (MACCE) were investigated. During follow-up, 10 enhanced WR patients developed MACCE including cardiac death, coronary revascularization, stroke, and congestive heart failure, while MACCE occurred in only 3 male patients. The Kaplan-Meier curves indicated that enhanced WR patients had higher incidence of MACCE than those with preserved WR (P 123 I-MIBG scintigraphy at baseline has long-term cardiovascular predictive value in Japanese patients with type 2 diabetes without structural heart disease. (author)

  3. Comparison of Long-Term Outcomes of Postmastectomy Radiotherapy between Breast Cancer Patients with and without Immediate Flap Reconstruction.

    Directory of Open Access Journals (Sweden)

    Hsin-Hua Lee

    Full Text Available To compare the long-term clinical outcomes of postmastectomy radiotherapy (PMRT between breast cancer patients with and without immediate transverse rectus abdominis myocutaneous (TRAM flap reconstruction.The study included 492 patients with stage II or III breast cancer who underwent modified radical mastectomy (MRM and chemotherapy followed by PMRT between 1997 and 2011. Cox regression model and Kaplan-Meier curves were calculated, and the log-rank test was used to evaluate the differences between overall and disease-free survival rates in the 2 groups.Among 492 patients, 213 patients had immediate TRAM flap reconstruction. The mean follow-up was 7.2 years (range, 11-191 months. The 5-year and 10-year disease free survival rates were 81% and 76% for the TRAM flap group and 78% and 73% for the non-flap group. The 5-year and 10-year overall survival rates were 89% and 73% for the TRAM flap group and 83% and 74% for the non-flap group.There exists no statistically significant difference in the rates of local recurrence, distant metastasis, disease-free and overall survival when comparing immediate TRAM flap reconstruction with no reconstruction. Our results suggest that immediate TRAM flap reconstruction does not compromise long term clinical outcomes in breast cancer patients requiring PMRT.

  4. Body size and longitudinal body weight changes do not increase mortality in incident peritoneal dialysis patients of the Brazilian peritoneal dialysis multicenter study

    Science.gov (United States)

    da Silva Fernandes, Natália Maria; Bastos, Marcus Gomes; Franco, Márcia Regina Gianotti; Chaoubah, Alfredo; da Glória Lima, Maria; Divino-Filho, José Carolino; Qureshi, Abdul Rashid

    2013-01-01

    OBJECTIVES: To determine the roles of body size and longitudinal body weight changes in the survival of incident peritoneal dialysis patients. PATIENTS AND METHODS: Patients (n = 1911) older than 18 years of age recruited from 114 dialysis centers (Dec/2004-Oct/2007) and participating in the Brazilian Peritoneal Dialysis Multicenter Cohort Study were included. Clinical and laboratory data were collected monthly (except if the patient received a transplant, recovered renal function, was transferred to hemodialysis, or died). RESULTS: Survival analyses were performed using Kaplan-Meier survival curves and Cox proportional hazards. Total follow-up was 34 months. The mean age was 59 years (54% female). The weight category percentages were as follows: underweight: 8%; normal: 51%; overweight: 29%; and obese 12%. The multivariate model showed a higher risk of death for a body mass index 30 kg/m2. Patients were divided into five categories according to quintiles of body weight changes during the first year of dialysis: +7.1%. Patients in the lowest quintile had significantly higher mortality, whereas no negative impact was observed in the other quintiles. CONCLUSION: These findings suggest that overweight/obesity and a positive body weight variation during the first year of peritoneal dialysis therapy do not increase mortality in incident dialysis patients in Brazil. PMID:23420157

  5. The Influence of Phacoemulsification on Surgical Outcomes of Trabeculectomy with Mitomycin-C for Uveitic Glaucoma.

    Directory of Open Access Journals (Sweden)

    Asaho Nishizawa

    Full Text Available To evaluate the influence of phacoemulsification after trabeculectomy on the postoperative intraocular pressure (IOP in eyes with uveitic glaucoma (UG.Kumamoto University Hospital, Kumamoto, Japan.A retrospective cohort study.The medical records of patients with UG who had trabeculectomy with mitomycin-C (MMC were reviewed. Complete and qualified surgical failures were defined by an IOP of ≥21 mmHg (condition A, ≥18 mmHg (condition B, or ≥15 mmHg (condition C without and with glaucoma eye drops, respectively. Kaplan-Meier survival analysis, generalized by the Wilcoxon test, and the Cox proportional hazards model analysis were conducted. Post-trabeculectomy phacoemulsification was treated as a time-dependent variable. In 24 (30% of the included 80 eyes, phacoemulsification was included, and they were divided into two groups: groups I (8 eyes with phacoemulsification within 1 year after trabeculectomy and group II (16 eyes after 1 year following trabeculectomy.Multivariable Cox proportional hazards model analysis showed post-trabeculectomy phacoemulsification was a significant factor in both complete success and qualified success based upon condition C (P = 0.0432 and P = 0.0488, respectively, but not for the other conditions. Kaplan-Meier survival analyses indicated significant differences in success probabilities between groups I and group II for complete success and qualified success based upon condition C (P = 0.020 and P = 0.013, respectively. There was also a significant difference for qualified success based upon condition B (P = 0.034, while there was no significant difference for the other conditions.Post-trabeculectomy phacoemulsification, especially within 1 year, can cause poor prognosis of IOP control of UG eyes after trabeculectomy with MMC.

  6. Light extraction block with curved surface

    Science.gov (United States)

    Levermore, Peter; Krall, Emory; Silvernail, Jeffrey; Rajan, Kamala; Brown, Julia J.

    2016-03-22

    Light extraction blocks, and OLED lighting panels using light extraction blocks, are described, in which the light extraction blocks include various curved shapes that provide improved light extraction properties compared to parallel emissive surface, and a thinner form factor and better light extraction than a hemisphere. Lighting systems described herein may include a light source with an OLED panel. A light extraction block with a three-dimensional light emitting surface may be optically coupled to the light source. The three-dimensional light emitting surface of the block may includes a substantially curved surface, with further characteristics related to the curvature of the surface at given points. A first radius of curvature corresponding to a maximum principal curvature k.sub.1 at a point p on the substantially curved surface may be greater than a maximum height of the light extraction block. A maximum height of the light extraction block may be less than 50% of a maximum width of the light extraction block. Surfaces with cross sections made up of line segments and inflection points may also be fit to approximated curves for calculating the radius of curvature.

  7. Bias Correction Methods Explain Much of the Variation Seen in Breast Cancer Risks of BRCA1/2 Mutation Carriers.

    Science.gov (United States)

    Vos, Janet R; Hsu, Li; Brohet, Richard M; Mourits, Marian J E; de Vries, Jakob; Malone, Kathleen E; Oosterwijk, Jan C; de Bock, Geertruida H

    2015-08-10

    Recommendations for treating patients who carry a BRCA1/2 gene are mainly based on cumulative lifetime risks (CLTRs) of breast cancer determined from retrospective cohorts. These risks vary widely (27% to 88%), and it is important to understand why. We analyzed the effects of methods of risk estimation and bias correction and of population factors on CLTRs in this retrospective clinical cohort of BRCA1/2 carriers. The following methods to estimate the breast cancer risk of BRCA1/2 carriers were identified from the literature: Kaplan-Meier, frailty, and modified segregation analyses with bias correction consisting of including or excluding index patients combined with including or excluding first-degree relatives (FDRs) or different conditional likelihoods. These were applied to clinical data of BRCA1/2 families derived from our family cancer clinic for whom a simulation was also performed to evaluate the methods. CLTRs and 95% CIs were estimated and compared with the reference CLTRs. CLTRs ranged from 35% to 83% for BRCA1 and 41% to 86% for BRCA2 carriers at age 70 years width of 95% CIs: 10% to 35% and 13% to 46%, respectively). Relative bias varied from -38% to +16%. Bias correction with inclusion of index patients and untested FDRs gave the smallest bias: +2% (SD, 2%) in BRCA1 and +0.9% (SD, 3.6%) in BRCA2. Much of the variation in breast cancer CLTRs in retrospective clinical BRCA1/2 cohorts is due to the bias-correction method, whereas a smaller part is due to population differences. Kaplan-Meier analyses with bias correction that includes index patients and a proportion of untested FDRs provide suitable CLTRs for carriers counseled in the clinic. © 2015 by American Society of Clinical Oncology.

  8. Miners' return to work following injuries in coal mines.

    Science.gov (United States)

    Bhattacherjee, Ashis; Kunar, Bijay Mihir

    2016-12-22

    The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW) following a miner's injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person's social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners' injuries. A study was conducted for 109 injured workers from an underground coal mine in the years 2000-2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners' return to work included presence of disease, job satisfaction and injury type. The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6):729-742. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  9. Nonlinear method for including the mass uncertainty of standards and the system measurement errors in the fitting of calibration curves

    International Nuclear Information System (INIS)

    Pickles, W.L.; McClure, J.W.; Howell, R.H.

    1978-01-01

    A sophisticated nonlinear multiparameter fitting program was used to produce a best fit calibration curve for the response of an x-ray fluorescence analyzer to uranium nitrate, freeze dried, 0.2% accurate, gravimetric standards. The program is based on unconstrained minimization subroutine, VA02A. The program considers the mass values of the gravimetric standards as parameters to be fit along with the normal calibration curve parameters. The fitting procedure weights with the system errors and the mass errors in a consistent way. The resulting best fit calibration curve parameters reflect the fact that the masses of the standard samples are measured quantities with a known error. Error estimates for the calibration curve parameters can be obtained from the curvature of the ''Chi-Squared Matrix'' or from error relaxation techniques. It was shown that nondispersive XRFA of 0.1 to 1 mg freeze-dried UNO 3 can have an accuracy of 0.2% in 1000 s. 5 figures

  10. Calibration curves for biological dosimetry

    International Nuclear Information System (INIS)

    Guerrero C, C.; Brena V, M. . E-mail cgc@nuclear.inin.mx

    2004-01-01

    The generated information by the investigations in different laboratories of the world, included the ININ, in which settles down that certain class of chromosomal leisure it increases in function of the dose and radiation type, has given by result the obtaining of calibrated curves that are applied in the well-known technique as biological dosimetry. In this work is presented a summary of the work made in the laboratory that includes the calibrated curves for gamma radiation of 60 Cobalt and X rays of 250 k Vp, examples of presumed exposure to ionizing radiation, resolved by means of aberration analysis and the corresponding dose estimate through the equations of the respective curves and finally a comparison among the dose calculations in those people affected by the accident of Ciudad Juarez, carried out by the group of Oak Ridge, USA and those obtained in this laboratory. (Author)

  11. Abnormal early cleavage events predict early embryo demise: sperm oxidative stress and early abnormal cleavage.

    Science.gov (United States)

    Burruel, Victoria; Klooster, Katie; Barker, Christopher M; Pera, Renee Reijo; Meyers, Stuart

    2014-10-13

    Human embryos resulting from abnormal early cleavage can result in aneuploidy and failure to develop normally to the blastocyst stage. The nature of paternal influence on early embryo development has not been directly demonstrated although many studies have suggested effects from spermatozoal chromatin packaging, DNA damage, centriolar and mitotic spindle integrity, and plasma membrane integrity. The goal of this study was to determine whether early developmental events were affected by oxidative damage to the fertilizing sperm. Survival analysis was used to compare patterns of blastocyst formation based on P2 duration. Kaplan-Meier survival curves demonstrate that relatively few embryos with short (P2 times reached blastocysts, and the two curves diverged beginning on day 4, with nearly all of the embryos with longer P2 times reaching blastocysts by day 6 (p < .01). We determined that duration of the 2nd to 3rd mitoses were sensitive periods in the presence of spermatozoal oxidative stress. Embryos that displayed either too long or too short cytokineses demonstrated an increased failure to reach blastocyst stage and therefore survive for further development. Although paternal-derived gene expression occurs later in development, this study suggests a specific role in early mitosis that is highly influenced by paternal factors.

  12. Elevated levels of serum nidogen-2 in esophageal squamous cell carcinoma.

    Science.gov (United States)

    Chai, Annie Wai Yeeng; Cheung, Arthur Kwok Leung; Dai, Wei; Ko, Josephine Mun Yee; Lee, Nikki Pui Yue; Chan, Kin Tak; Law, Simon Ying-Kit; Lung, Maria Li

    2018-02-14

    Nidogen-2 (NID2), a secretory basement membrane protein, has been implicated as a potential biomarker in ovarian cancer and hepatocellular carcinoma. In this study, we aimed to investigate the utility of detecting serum NID2 levels for identification of esophageal squamous cell carcinoma (ESCC) patients and prediction of poor survival outcome. Using an in-house NID2 enzyme-linked immunosorbent assay (ELISA), serum samples from 101 ESCC patients and 50 healthy controls were screened for their NID2 levels. The serum NID2 levels in ESCC patients (median 24.4 μg/L) are significantly higher (p= 4.3e-09) than that of the healthy controls (median 15.85 μg/L). The receiver operating characteristic (ROC) curve demonstrated an area under the curve of 0.756. At the threshold of 17.95 μg/L, the sensitivity and specificity achieved are 0.76 and 0.63, respectively. Kaplan-Meier survival analysis revealed that patients with high serum NID2 levels (⩾ 32.6 μg/L) have significantly higher risk of death (HR = 1.984, 95% CI: 1.175-3.349; log-rank p-value = 0.012) compared to those with low serum NID2 levels (levels has potential diagnostic and prognostic value for ESCC patients.

  13. PARP-1 serves as a novel molecular marker for hepatocellular carcinoma in a Southern Chinese Zhuang population.

    Science.gov (United States)

    Li, Jiatong; Dou, Dongwei; Li, Ping; Luo, Wenqi; Lv, Wenxin; Zhang, Chengdong; Song, Xiaowei; Yang, Yuan; Zhang, Yuening; Xu, Yanzhen; Xiao, Feifan; Wei, Yan; Qin, Jian; Li, Hongtao; Yang, Xiaoli

    2017-07-01

    PARP-1 (poly(ADP-ribose) polymerase-1) plays an important role in tumorigenesis. Since its effects on different populations are varied, this study investigated the impact of PARP-1 on primary hepatocellular carcinoma in a Southern Chinese Zhuang population. We assessed the global PARP-1 messenger RNA expression in patients with hepatocellular carcinoma using The Cancer Genome Atlas dataset. Increased PARP-1 expression, related to alpha-fetoprotein level, was observed. The area under the receiver operating characteristic curve value was 0.833. Kaplan-Meier survival curves indicated that higher PARP-1 expression was not correlated with poorer overall survival and recurrence-free survival. In a Zhuang population, PARP-1 messenger RNA and protein levels were increased in the hepatocellular carcinoma tissue and its adjacent liver tissues as assessed by quantitative polymerase chain reaction, immunohistochemistry, and western blotting. Higher PARP-1 level was associated with a higher tumor stage (p  0.05). Further analysis suggested that H2AX, a PARP-1 protein interaction partner, was coordinated with PARP-1 in hepatocellular carcinoma tumorigenesis. Overall, some new characteristics of PARP-1 expression were noted in the Zhuang population. PARP-1 is a novel promising diagnostic marker for hepatocellular carcinoma in the Southern Chinese Zhuang population.

  14. The new Wuerzburg data base for radiation therapy

    International Nuclear Information System (INIS)

    Richter, J.; Richter, E.; Tausch, J.

    1991-01-01

    Conception, structure and realisation of a new data base for radiation therapy are present. The data base utilizes the commercial data base system ORACLE and the data base language SQL. A program package for statistical analyses including Kaplan-Meier-calculations, logrank test and Gehan/Breslow test was elaborated. The input of the data recorded on form sheets is carried out on a data base of the Tumor Centre in the first instance. From there the data are transfered to the ORACLE data base. Up to now the courses of disease of about 13 000 patients are stored. Therefore, extensive and detailed statistical analyses are practicable. (orig.) [de

  15. Numerical Analysis of Flow in Kaplan Turbine Runner Blades Anticavitation Lip with Modified Hydro-dynamic Profile

    Directory of Open Access Journals (Sweden)

    Vasile Cojocaru

    2011-09-01

    Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.

  16. Improved long-term survival after intra-operative single high-dose ATG-Fresenius induction in renal transplantation: a single centre experience.

    Science.gov (United States)

    Kaden, Jürgen; May, Gottfried; Völp, Andreas; Wesslau, Claus

    2009-01-01

    In organ grafts donor-specific sensitization is initiated immediately after revascularization. Therefore, in 1990 we introduced the intra-operative single high-dose ATG-Fresenius (ATG-F) induction in addition to standard triple drug therapy (TDT) consisting of steroids, azathioprine and cyclosporin. A total of 778 first renal transplantations from deceased donors, performed between 1987 and 1998, were included in this evaluation. This retrospective analysis of clinic records and electronic databases presents data of all recipients of first kidney grafts who received two different ATG-F inductions (1(st) group: 9 mg/kg body weight as single high-dose intra-operatively, n=484; 2(nd) group: 3 mg/kg body weight on 7 or 8 consecutive days as multiple-dose starting also intra-operatively, n=78) and standard TDT alone (3(rd) group: TDT alone, n=216). The 10-year patient survival rates were 72.6+/-2.6% (TDT + ATG-F single high-dose), 79.5+/-5.1% (TDT + ATG-F multiple-dose) and 67.2+/-3.7%% (TDT alone; Kaplan-Meier estimates with standard errors; ATG-F vs TDT alone, p=0.001). The 10-year graft survival rates with censoring of patients that died with a functioning graft were 73.8+/-2.4%, 57.7+/-5.8% and 58.4+/-3.6% (Kaplan-Meier estimates with standard errors; 1(st) vs 2(nd )and 3(rd) group, respectively, p<0.001) and the 10-year graft survival rates with patient death counted as graft failure were 58.3+/-2.7%, 55.7+/-5.8% and 48.2+/-3.5% (Kaplan-Meier estimates with standard errors; ATG-F single high-dose vs TDT, p=0.023). In pre-sensitized recipients there were also significant differences in favour of ATG-F, more notably in the single high-dose ATG-F induction. A total of 69% of the patients in the two cohorts receiving ATG-F did not experience any transplant rejections compared to 56% in patients undergoing TDT alone (p=0.018). The incidence of infectious complications was comparable across all groups. According to evidence obtained from the routine documentation of 778

  17. MEKK1 is a Novel Regulator of the Dmp1-Arf-p53 Pathway and Prognostic Indicator in Breast Cancer

    Science.gov (United States)

    2012-12-01

    hDMP1, INK4a/ARF, p53 or Hdm2 amplification. Kaplan -Meier analyses have been conducted to study the impact for the impact of loss or gain of each locus on...Palma P, Pellegrini S, Fina P et al. Mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995; 175: 31–38. 21 Turbin DA

  18. Application of Enlisted Force Retention Levels and Career Field Stability

    Science.gov (United States)

    2017-03-23

    APPLICATION OF ENLISTED FORCE RETENTION LEVELS AND CAREER FIELD STABILITY THESIS Presented to the Faculty Department of Operational Sciences ...Fulfillment of the Requirements for the Degree of Master of Science in Operations Research Jamie T. Zimmermann, MS, BS Captain, USAF March 2017...Appendix B. The function proc lifetest is a nonparametric estimate of the survivor function using either the Kaplan-Meier method or the actuarial

  19. Modelos estimados de análisis de supervivencia para el tiempo de permanencia de los estudiantes de la Universidad Francisco de Paula Santander

    OpenAIRE

    Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón

    2016-01-01

    The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...

  20. Rational points on elliptic curves

    CERN Document Server

    Silverman, Joseph H

    2015-01-01

    The theory of elliptic curves involves a pleasing blend of algebra, geometry, analysis, and number theory. This book stresses this interplay as it develops the basic theory, thereby providing an opportunity for advanced undergraduates to appreciate the unity of modern mathematics. At the same time, every effort has been made to use only methods and results commonly included in the undergraduate curriculum. This accessibility, the informal writing style, and a wealth of exercises make Rational Points on Elliptic Curves an ideal introduction for students at all levels who are interested in learning about Diophantine equations and arithmetic geometry. Most concretely, an elliptic curve is the set of zeroes of a cubic polynomial in two variables. If the polynomial has rational coefficients, then one can ask for a description of those zeroes whose coordinates are either integers or rational numbers. It is this number theoretic question that is the main subject of this book. Topics covered include the geometry and ...

  1. Resultado do tratamento cirúrgico das neoplasias do seio piriforme

    Directory of Open Access Journals (Sweden)

    Costa Claudiney C.

    2003-01-01

    Full Text Available Os tumores da laringe e hipofaringe apresentam alta incidência no Brasil, sendo o sexto sítio mais comum entre os tumores malignos no sexo masculino. O diagnóstico inicial geralmente é realizado com lesões em estadio clínicos avançados diminuindo o sucesso do tratamento instituído. OBJETIVOS: Avaliar a evolução de 60 pacientes com carcinoma epidermóide de seio piriforme, considerando tratamento instituído, complicações e sobrevida estimada em 5 anos. FORMA DE ESTUDO: Estudo retrospectivo. MÉTODO: Os testes estatístico utilizados foram o método de Kaplan-Meier e o teste exato de Fisher. RESULTADOS: Dos 60 pacientes, 43 foram submetidos a tratamento cirúrgico seguido de radioterapia. Atualmente 27,9% estão vivos sem doença, 11,6% vivos com doença, 9,4% mortos sem doença, 34,8% mortos com doença e perda de seguimento de 16,3%. A complicação pós-operatória mais freqüente foi a fístula cutânea. A recidiva local ocorreu em 5 pacientes, regional em 6, loco-regional em 3 e metástase à distância em 6. Não houve correlação entre margem cirúrgica comprometida e sobrevida em 20 pacientes com recidiva tumoral (Teste de Fisher. Aplicando a curva de sobrevida atuarial pelo método Kaplan-Meier, obtivemos média de sobrevida em 5 anos de 23,2 meses. CONCLUSÃO: A principal complicação pós-operatória foi a fístula cutânea, sendo tratada clinicamente. A margem cirúrgica comprometida não alterou o prognóstico, apesar de ser sempre um dos princípios da cirurgia oncológica. A principal falha no tratamento foi a recidiva locorregional. A curva de sobrevida atuarial (Kaplan-Meier em cinco anos apresentou média de 23,2 meses.

  2. La chiesa di Richard Meier a Tor Tre Teste e il suo contributo al consolidamento identitario dei nuovi quartieri romani oltre il GRA / The church designed by Richard Meier in Tor Tre Teste and the identity consolidation in the new roman neighbourhoods beyond the Great Circular Road

    Directory of Open Access Journals (Sweden)

    Giuseppe Bonaccorso

    2014-06-01

    Full Text Available Il contributo proposto ha l’obiettivo di analizzare alcuni significativi brani del tessuto urbano della periferia est di Roma, adottando metodi interpretativi legati alla storia, alla società, alla programmazione urbanistica e alla costruzione. Gli aspetti salienti del quadrante orientale della periferia romana verranno così delineati partendo “dal di dentro”, sottolineandone i percorsi, gli spazi e i nuclei compositivi che sono all’origine della struttura e della forma stessa dei quartieri disposti a cavallo del Grande Raccordo Anulare. In questo ambito, si pone l’attenzione su alcuni episodi chiave che vedono protagoniste le nuove chiese che riescono a creare una centralità all’interno dei quartieri periferici sostituendo le biblioteche, le piazze e i centri commerciali.  Analizzando da vicino questi esempi, si scopre come di recente sono state realizzate chiese firmate da architetti di fama internazionale proprio allo scopo di rafforzare, o meglio di costruire, un fattore identitario per ciascun quartiere ubicato nel settore orientale della città. Partendo quindi dal generale si arriva a indagare una chiesa e un quartiere che possono essere considerati un modello da seguire per tutta la periferia a ridosso del GRA: la chiesa giubilare di Dio Padre Misericordioso progettata da Richard Meier nel quartiere di Tor Tre Teste. La sequenzialità degli eventi che hanno contraddistinto il concorso per la progettazione della chiesa, la scelta della proposta di Richard Meier, la complessità del cantiere, l’analisi tecnica, stilistica e simbolica della realizzazione finale sono quindi analizzate nell’ambito del rapporto con il quartiere e del tentativo di realizzare (attraverso di essa un centro di attrazione per tutta la periferia.   The article analyses some significant parts of the urban tissue at the eastern periphery of Rome, using the interpretative methods inherent to history, society, urban programming and construction

  3. Resistance within hemodialysis shunts predicts patency.

    Science.gov (United States)

    Bui, Trung D; Gordon, Ian L; Parashar, Amish; Vo, David; Wilson, Samuel E

    2006-01-01

    The authors examined the relationship between patency after thrombectomy of clotted dialysis grafts and intraoperative measurements of flow (Q), pressure gradient (PGR), and longitudinal resistance (RL). Eighteen thrombosed arteriovenous (AV) grafts underwent 21 thrombectomies. Pressures at arterial (P1) and venous (P2) ends of the AV grafts were determined with 22-gauge catheters and standard transducers; flow was measured with transit-time probes; arithmetic averaging of waveforms was used to compute mean Q, PGR, and RL. Kaplan-Meier patency curves were analyzed by using log rank methods. Mean patency for all grafts was 164 +/-152 days. For each variable, the 21 measurements were split and the patency curve for the grafts with the 11 lowest value grafts was compared to the curve representing the 10 highest value grafts. The difference between high RL versus low RL patency curves was significant with high-resistance grafts having a median patency of 55 days and low-resistance grafts having a median patency greater than 151 days (p = 0.0089). In contrast, the high Q group median patency was 151 days versus 174 days for the low Q group (p = 0.86). Median patency for the low PGR group was 115 days compared to 62 days for the high PGR group (p = 0.162). Longitudinal resistance within AV grafts, but not flow or pressure gradient, showed a significant correlation with patency after thrombectomy. Increased resistance to flow within AV grafts appears to be an important factor affecting the propensity of dialysis grafts to thrombose.

  4. Increased Transfusion of Fresh Frozen Plasma is Associated with Mortality or Worse Functional Outcomes After Severe Traumatic Brain Injury: A Retrospective Study.

    Science.gov (United States)

    Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao

    2017-08-01

    The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Cefepime restriction improves gram-negative overall resistance patterns in neonatal intensive care unit

    Directory of Open Access Journals (Sweden)

    Orlei Ribeiro de Araujo

    Full Text Available Antibiotic restriction can be useful in maintaining bacterial susceptibility. The objective of this study was verify if restriction of cefepime, the most frequently used cephalosporin in our neonatal intensive care unit (NICU, would ameliorate broad-spectrum susceptibility of Gram-negative isolates. Nine hundred and ninety-five premature and term newborns were divided into 3 cohorts, according to the prevalence of cefepime use in the unit: Group 1 (n=396 comprised patients admitted from January 2002 to December 2003, period in which cefepime was the most used broad-spectrum antibiotic. Patients in Group 2 (n=349 were admitted when piperacillin/tazobactam replaced cefepime (January to December 2004 and in Group 3 (n=250 when cefepime was reintroduced (January to September 2005. Meropenem was the alternative third-line antibiotic for all groups. Multiresistance was defined as resistance to 2 or more unrelated antibiotics, including necessarily a third or fourth generation cephalosporin, piperacillin/tazobactam or meropenem. Statistics involved Kruskal-Wallis, Mann-Whitney and logrank tests, Kaplan-Meier analysis. Groups were comparable in length of stay, time of mechanical ventilation, gestational age and birth weight. Ninety-eight Gram-negative isolates were analyzed. Patients were more likely to remain free of multiresistant isolates by Kaplan-Meier analysis in Group 2 when compared to Group 1 (p=0.017 and Group 3 (p=0.003. There was also a significant difference in meropenem resistance rates. Cefepime has a greater propensity to select multiresistant Gram-negative pathogens than piperacillin/tazobactam and should not be used extensively in neonatal intensive care.

  6. Survival of a cohort of women with cervical cancer diagnosed in a Brazilian cancer center Sobrevida de mujeres con cáncer de cuello uterino diagnosticadas en un centro brasileño Sobrevida de mulheres com câncer de colo uterino diagnosticadas em um centro brasileiro

    Directory of Open Access Journals (Sweden)

    Claudio Calazan do Carmo

    2011-08-01

    Full Text Available OBJECTIVE: To assess overall survival of women with cervical cancer and describe prognostic factors associated. METHODS: A total of 3,341 cases of invasive cervical cancer diagnosed at the Brazilian Cancer Institute, Rio de Janeiro, southeastern Brazil, between 1999 and 2004 were selected. Clinical and pathological characteristics and follow-up data were collected. There were performed a survival analysis using Kaplan-Meier curves and a multivariate analysis through Cox model. RESULTS: Of all cases analyzed, 68.3% had locally advanced disease at the time of diagnosis. The 5-year overall survival was 48%. After multivariate analysis, tumor staging at diagnosis was the single variable significantly associated with prognosis (pOBJETIVO: Evaluar la sobrevida global de mujeres con cáncer de cuello uterino e identificar factores pronósticos relacionados. MÉTODOS: Todos los 3.341 casos tratados en el Instituto Nacional de Cáncer, Rio de Janeiro, Sureste de Brasil, entre 1999 y 2004 fueron seleccionados y sus datos clínicos, anatomo-patológicos y de seguimiento fueron colectados. Se utilizaron la curva de Kaplan-meier y el modelo de Cox par evaluación de la sobrevida y para análisis logística múltiple, respectivamente. RESULTADOS: De los casos estudiados, 68,3% presentaban enfermedad localmente avanzada. La sobrevida en cinco años fue de 48%. Posterior al análisis múltiple, el estadio clínico al diagnóstico fue la única variable significativamente asociada con el pronóstico (pOBJETIVO: Avaliar a sobrevida global de mulheres com câncer de colo uterino e identificar fatores prognósticos relacionados. MÉTODOS: Todos os 3.341 casos tratados no Instituto Nacional de Câncer, Rio de Janeiro, RJ, entre 1999 e 2004 foram selecionados e seus dados clínicos, anatomo-patológicos e de seguimento foram coletados. Foram utilizados a curva de Kaplan-Meier e o modelo de Cox para avaliação da sobrevida e para análise logística m

  7. Respiratory muscle dysfunction in congestive heart failure: clinical correlation and prognostic significance.

    Science.gov (United States)

    Meyer, F J; Borst, M M; Zugck, C; Kirschke, A; Schellberg, D; Kübler, W; Haass, M

    2001-05-01

    In congestive heart failure (CHF), the prognostic significance of impaired respiratory muscle strength has not been established. Maximal inspiratory pressure (Pi(max)) was prospectively determined in 244 consecutive patients (207 men) with CHF (ischemic, n=75; idiopathic dilated cardiomyopathy, n=169; age, 54+/-11 years; left ventricular ejection fraction [LVEF], 22+/-10%). Pi(max) was lower in the 244 patients with CHF than in 25 control subjects (7.6+/-3.3 versus 10.5+/-3.7 kPa; P=0.001). The 57 patients (23%) who died during follow-up (23+/-16 months; range, 1 to 48 months) had an even more reduced Pi(max) (6.3+/-3.2 versus 8.1+/-3.2 kPa in survivors; P=0.001). Kaplan-Meier survival curves differentiated between patients subdivided according to quartiles for Pi(max) (P=0.014). Pi(max) was a strong risk predictor in both univariate (P=0.001) and multivariate Cox proportional hazard analyses (P=0.03); multivariate analyses also included NYHA functional class, LVEF, peak oxygen consumption (peak VO(2)), and norepinephrine plasma concentration. The areas under the receiver-operating characteristic curves for prediction of 1-year survival were comparable for Pi(max) and peak VO(2) (area under the curve [AUC], 0.68 versus 0.73; P=0.28), and they improved with the triple combination of Pi(max), peak VO(2), and LVEF (AUC, 0.82; P=0.004 compared with AUC of Pi(max)). In patients with CHF, inspiratory muscle strength is reduced and emerges as a novel, independent predictor of prognosis. Because testing for Pi(max) is simple in clinical practice, it might serve as an additional factor to improve risk stratification and patient selection for cardiac transplantation.

  8. Algebraic curves and cryptography

    CERN Document Server

    Murty, V Kumar

    2010-01-01

    It is by now a well-known paradigm that public-key cryptosystems can be built using finite Abelian groups and that algebraic geometry provides a supply of such groups through Abelian varieties over finite fields. Of special interest are the Abelian varieties that are Jacobians of algebraic curves. All of the articles in this volume are centered on the theme of point counting and explicit arithmetic on the Jacobians of curves over finite fields. The topics covered include Schoof's \\ell-adic point counting algorithm, the p-adic algorithms of Kedlaya and Denef-Vercauteren, explicit arithmetic on

  9. How Do We Defend Democratic Education? Lois Weiner and Andy Kaplan Respond to Diane Ravitch's "The Reign of Error"

    Science.gov (United States)

    Weiner, Lois; Kaplan, Andy

    2014-01-01

    In this commentary, Andy Kaplan discusses with Lois Weiner, Diane Ravitch's latest book "The Reign of Error," which combines scholarly argument and scrupulous research in defense of democratic education. Weiner notes, the book will prove an important resource in the ongoing struggle for the survival of public schooling. Weiner adds,…

  10. Reflected Light Curves of Extrasolar Planets

    Science.gov (United States)

    Green, D.; Matthews, J.; Kuschnig, R.; Seager, S.

    The planned launches of ultra-precise photometric satellites such as MOST, COROT and MONS should provide the first opportunity to study the reflected light curves from extrasolar planets. To predict the capabilities of these missions, we have constructed a series of models of such light curves, improving upon the Monte Carlo simulations by Seager et al. (2000). These models include more realistic features such limb darkening of the star and broad band photometry. For specific models, the resulting planet light curves exhibit unique behavior with the variation of radius, inclination and presence or absence of clouds.

  11. Tetranectin positive expression in tumour tissue leads to longer survival in Danish women with ovarian cancer. Results from the 'Malova' ovarian cancer study

    DEFF Research Database (Denmark)

    Heeran, Mel C; Rask, Lene; Høgdall, Claus K

    2015-01-01

    of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...

  12. Cetuximab Concomitant with Second-Line Radiation Therapy in Patients with Locally Advanced Recurrent Squamous Cell Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    Muge Akmansu

    2010-12-01

    Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.

  13. Theoretical melting curve of caesium

    International Nuclear Information System (INIS)

    Simozar, S.; Girifalco, L.A.; Pennsylvania Univ., Philadelphia

    1983-01-01

    A statistical-mechanical model is developed to account for the complex melting curve of caesium. The model assumes the existence of three different species of caesium defined by three different electronic states. On the basis of this model, the free energy of melting and the melting curve are computed up to 60 kbar, using the solid-state data and the initial slope of the fusion curve as input parameters. The calculated phase diagram agrees with experiment to within the experimental error. Other thermodynamic properties including the entropy and volume of melting were also computed, and they agree with experiment. Since the theory requires only one adjustable constant, this is taken as strong evidence that the three-species model is satisfactory for caesium. (author)

  14. Tanacetum parthenium leaf extract mediated survival protection in lethally irradiated Swiss albino mice

    International Nuclear Information System (INIS)

    Shetty, Prashanth; Pooja, S.; Suchetha Kumari, N.; Shetty, Jayaram; Peter, Alex John; Jose, Jerish M.

    2016-01-01

    Search for less-toxic radioprotectors has spurred interest in the development of natural products. In Ayurveda, the traditional medicine, Tanacetum species have been used to treat ailments since ancient times throughout the world. Effects of the administration of different concentrations of Tanacetum parthenium leaf aqueous extract (TPLA), Tanacetum parthenium leaf ethanolic extract (TPLE) were investigated in Swiss albino mice. Mice (20-25 g) were randomly divided into 8 groups of ten animals each. The control group and the radiation group were treated daily with oral administration of saline for 15 days. Each subgroups of TPLA and TPLE were treated with doses of 50, 100 and 250 mg/kg daily for 15 days. On the 15th day, all were irradiated with 10 Gy whole body irradiation. Survival was observed daily up to 30th post-irradiation day. Data were analysed using the Kaplan-Meier survival curves. The significance difference in survival between control, radiation and treatment groups were observed (P < 0.001). Current studies revealed the protective effect of Tanacetum parthenium rendering high survivability in lethally irradiated mice. (author)

  15. Serum tetranectin is an independent prognostic marker in colorectal cancer and weakly correlated with plasma suPAR, plasma PAI-1 and serum CEA

    DEFF Research Database (Denmark)

    Høgdall, Claus K; Christensen, Ib J; Stephens, Ross W

    2002-01-01

    PAR and CEA had a 2.43 increased risk as compared to a patient with median levels of these biochemical markers. Significant correlations were found with Dukes' stages for all the biochemical markers and between the respective biochemical markers. The findings confirm that TN is a strong prognostic factor...... activator (uPAR) and carcinoembryonic antigen (CEA). Significantly shorter survival was found for patients with TN levels below a cut-off point of 7.5 mg/l compared to patients with levels above, as illustrated by Kaplan-Meier curves. By Cox analyses, log TN, log soluble uPAR as well as log CEA were found...... to have an independent prognostic value for survival (log TN: HR = 0.47, 95% CI: 0.29-0.76); log soluble uPAR: HR = 1.65, 95% CI: 1.18-2.31; log CEA: HR = 1.I1, 95% CI: 1.03-1.20). Based on the multivariate model, a patient with a combination of low levels of TN and PAI-1 and elevated levels of soluble u...

  16. Sarcopenia is not associated with morbidity, mortality, or recurrence after esophagectomy for cancer.

    Science.gov (United States)

    Siegal, Steve R; Dolan, James P; Dewey, Elizabeth N; Guimaraes, Alexander R; Tieu, Brandon H; Schipper, Paul H; Hunter, John G

    2018-05-01

    Sarcopenia is associated with increased morbidity and mortality in hepatic, pancreatic and colorectal cancer. We examined the effect of sarcopenia on morbidity, mortality, and recurrence after resection for esophageal cancer. Retrospective review of consecutive esophagectomies from 2010 to 2015. Computed tomography studies were analyzed for sarcopenia. Morbidity was analyzed using Fischer's test and survival data with Kaplan Meier curves. The sarcopenic group (n = 127) had lower BMI, later stage disease, and higher incidence of neoadjuvant radiation than those without sarcopenia (n = 46). There were no differences in morbidity or mortality between the groups (p = .75 and p = .31, respectively). Mean length of stay was similar (p = .70). Disease free and overall survival were similar (p = .20 and p = .39, respectively). There is no association between sarcopenia and increased morbidity, mortality and disease-free survival in patients undergoing esophagectomy for cancer. Sarcopenia in esophageal cancer may not portend worse outcomes that have been reported in other solid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Patient factors associated with lung transplant referral and waitlist for patients with cystic fibrosis and pulmonary fibrosis.

    Science.gov (United States)

    Liu, Yuan; Vela, Monica; Rudakevych, Tanya; Wigfield, Christopher; Garrity, Edward; Saunders, Milda R

    2017-03-01

    Since 2005, the Lung Allocation Score (LAS) has prioritized patient benefit and post-transplant survival, reducing waitlist to transplant time to fibrosis (CF) and pulmonary fibrosis (PF). We analyzed the times from transplant eligibility to referral, work-up and waitlisting using Kaplan-Meier curves and log-rank tests. Overall, the referral rate for transplant-eligible patients was 64%. Of those referred, approximately 36% reach the lung transplant waitlist. Referred CF patients were significantly more likely to reach the transplant waitlist than PF patients (CF 60% vs PF 22%, p < 0.05). In addition, CF patients had a shorter wait from transplant eligibility to waitlist than PF patients (329 vs 2,369 days, respectively [25th percentile], p < 0.05). Patients with PF and CF both faced delays from eligibility to referral and waitlist. Quality improvement efforts are needed to better identify and refer appropriate patients for lung transplant evaluation. Targeted interventions may facilitate more efficient evaluation completion and waitlist appearance. Copyright © 2017 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  18. Predicting risk of nonmelanoma skin cancer and premalignant skin lesions in renal transplant recipients.

    Science.gov (United States)

    Urwin, Helen R; Jones, Peter W; Harden, Paul N; Ramsay, Helen M; Hawley, Carmel M; Nicol, David L; Fryer, Anthony A

    2009-06-15

    Nonmelanoma skin cancer (NMSC) and associated premalignant lesions represent a major complication after transplantation, particularly in areas with high ultraviolet radiation (UVR) exposure. The American Society of Transplantation has proposed annual NMSC screening for all renal transplant recipients. The aim of this study was to develop a predictive index (PI) that could be used in targeted screening. Data on patient demographics, UVR exposure, and other clinical parameters were collected on 398 adult recipients recruited from the Princess Alexandra Hospital, Brisbane. Structured interview, skin examination, biopsy of lesions, and review of medical/pathologic records were performed. Time to presentation with the first NMSC was assessed using Cox's regression models and Kaplan-Meier estimates used to assess detection of NMSC during screening. Stepwise selection identified age, outdoor UVR exposure, living in a hot climate, pretransplant NMSC, childhood sunburning, and skin type as predictors. The PI generated was used to allocate patients into three screening groups (6 months, 2 years, and 5 years). The survival curves of these groups were significantly different (PPI to enable development of targeted NMSC surveillance strategies.

  19. CXCR4 expression varies significantly among different subtypes of glioblastoma multiforme (GBM) and its low expression or hypermethylation might predict favorable overall survival.

    Science.gov (United States)

    Ma, Xinlong; Shang, Feng; Zhu, Weidong; Lin, Qingtang

    2017-09-01

    CXCR4 is an oncogene in glioblastoma multiforme (GBM) but the mechanism of its dysregulation and its prognostic value in GBM have not been fully understood. Bioinformatic analysis was performed by using R2 and the UCSC Xena browser based on data from GSE16011 in GEO datasets and in GBM cohort in TCGA database (TCGA-GBM). Kaplan Meier curves of overall survival (OS) were generated to assess the association between CXCR4 expression/methylation and OS in patients with GBM. GBM patients with high CXCR4 expression had significantly worse 5 and 10 yrs OS (p GBM subtypes, there was an inverse relationship between overall DNA methylation and CXCR4 expression. CXCR4 expression was significantly lower in CpG island methylation phenotype (CIMP) group than in non CIMP group. Log rank test results showed that patients with high CXCR4 methylation (first tertile) had significantly better 5 yrs OS (p = 0.038). CXCR4 expression is regulated by DNA methylation in GBM and its low expression or hypermethylation might indicate favorable OS in GBM patients.

  20. [Expression and clinical significance of KIAA1199 in primary hepatocellular carcinoma].

    Science.gov (United States)

    Gu, C J; Ni, Q C; Ni, K; Zhang, S; Qian, H X

    2018-05-29

    Objective: To investigate the expression and clinical significance of KIAA1199 in primary hepatocellular carcinoma. Methods: A total of 136 cases of primary hepatocellular carcinoma tissues and paired adjacent tissues were collected. Immunohistochemistry and Western blot were used to detect the expression of KIAA1199 in primary hepatocellular carcinoma tissues and paired adjacent tissues. The relationship between KIAA1199 and clinicopathological parameter of primary hepatocellular carcinoma was analyzed. Results: The positive rate of KIAA1199 in primary hepatocellular carcinoma was 82.3% (112/136), which was higher than that in paired para-cancerous tissues (14.7%, 20/136). High expression of KIAA1199 was significantly correlated with age, cirrhosis history, tumor size, tumor number, degree of differentiation, TNM staging and microvenous invasion (MVI) ( P 0.05). The Kaplan-Meier survival curves indicated that high KIAA1199 expression was associated with poor survival ( P hepatocellular carcinoma, which is significantly correlated with the clinicopathological features and prognosis, high expression of KIAA1199 increased the risk of death in patients with primary hepatocellular carcinoma.

  1. SPECT myocardial perfusion imaging. Long-term prognostic value in diabetic patients with and without coronary artery disease

    International Nuclear Information System (INIS)

    Koehli, M.; Monbaron, D.; Gaillard, R.C.; Ruiz, J.; Prior, J.O.; Bischof Delaloye, A.; Calcagni, M.L.; Fivaz-Arbane, M.; Stauffer, J.C.

    2006-01-01

    Aim: To determine the long-term prognostic value of SPECT myocardial perfusion imaging (MPI) for the occurrence of cardiovascular events in diabetic patients. Patients, methods: SPECT MPI of 210 consecutive Caucasian diabetic patients were analysed using Kaplan-Meier event-free survival curve and independent predictors were determined by Cox multivariate analyses. Results: Follow-up was complete in 200 (95%) patients with a median period of 3.0 years (0.8-5.0). The population was composed of 114 (57%) men, age 65 ± 10 years, 181 (90.5%) type 2 diabetes mellitus, 50 (25%) with a history of coronary artery disease (CAD) and 98 (49%) presenting chest pain prior to MPI. The prevalence of abnormal MPI was 58%. Patients with a normal MPI had neither cardiac death, nor myocardial infarction, independently of a history of coronary artery disease or chest pain. Among the independent predictors of cardiac death and myocardial infarction, the strongest was abnormal MPI (p 5-fold increase in cardiovascular events. This emphasizes the value of SPECT MPI in predicting and risk-stratifying cardiovascular events in diabetic patients. (orig.)

  2. Increased Prognostic Value of Query Amyloid Late Enhancement Score in Light-Chain Cardiac Amyloidosis.

    Science.gov (United States)

    Wan, Ke; Sun, Jiayu; Han, Yuchi; Liu, Hong; Yang, Dan; Li, Weihao; Wang, Jie; Cheng, Wei; Zhang, Qing; Zeng, Zhi; Chen, Yucheng

    2018-02-23

    Late gadolinium enhancement (LGE) pattern is a powerful imaging biomarker for prognosis of cardiac amyloidosis. It is unknown if the query amyloid late enhancement (QALE) score in light-chain (AL) amyloidosis could provide increased prognostic value compared with LGE pattern.Methods and Results:Seventy-eight consecutive patients with AL amyloidosis underwent contrast-enhanced cardiovascular magnetic resonance imaging. Patients with cardiac involvement were grouped by LGE pattern and analyzed using QALE score. Receiver operating characteristic curve was used to identify the optimal cut-off for QALE score in predicting all-cause mortality. Survival of these patients was analyzed with the Kaplan-Meier method and multivariate Cox regression. During a median follow-up of 34 months, 53 of 78 patients died. The optimal cut-off for QALE score to predict mortality at 12-month follow-up was 9.0. On multivariate Cox analysis, QALE score ≥9 (HR, 5.997; 95% CI: 2.665-13.497; Pvalue in AL cardiac amyloidosis. QALE score ≥9 has added value to differentiate prognosis in AL amyloidosis patients with a subendocardial LGE pattern.

  3. Over-expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene expression correlates with shortened survival

    Directory of Open Access Journals (Sweden)

    Lincoln Douglas

    2006-06-01

    Full Text Available Abstract Background Increased expression of Eph receptor tyrosine kinases and their ephrin ligands has been implicated in tumor progression in a number of malignancies. This report describes aberrant expression of these genes in ovarian cancer, the commonest cause of death amongst gynaecological malignancies. Methods Eph and ephrin expression was determined using quantitative real time RT-PCR. Correlation of gene expression was measured using Spearman's rho statistic. Survival was analysed using log-rank analysis and (was visualised by Kaplan-Meier survival curves. Results Greater than 10 fold over-expression of EphA1 and a more modest over-expression of EphA2 were observed in partially overlapping subsets of tumors. Over-expression of EphA1 strongly correlated (r = 0.801; p Conclusion These data imply that increased levels of ephrins A1 and A5 in the presence of high expression of Ephs A1 and A2 lead to a more aggressive tumor phenotype. The known functions of Eph/ephrin signalling in cell de-adhesion and movement may explain the observed correlation of ephrin expression with poor prognosis.

  4. Runaway transient simulation of a model Kaplan turbine

    Energy Technology Data Exchange (ETDEWEB)

    Liu, S; Liu, D; Wu, Y [State Key Laboratory of Hydroscience and Engineering, Department of Thermal Eng., Tsinghua University, Beijing, 100084 (China); Zhou, D [Water Conservancy and Hydropower Eng., Hohai University, Nanjing. 210098 (China); Nishi, M, E-mail: liushuhong@tsinghua.edu.c [Kyushu Inst. Tech. Senior Academy, Kitakyushu, 804-8550 (Japan)

    2010-08-15

    The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-{epsilon} turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

  5. Runaway transient simulation of a model Kaplan turbine

    Science.gov (United States)

    Liu, S.; Zhou, D.; Liu, D.; Wu, Y.; Nishi, M.

    2010-08-01

    The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-epsilon turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

  6. Runaway transient simulation of a model Kaplan turbine

    International Nuclear Information System (INIS)

    Liu, S; Liu, D; Wu, Y; Zhou, D; Nishi, M

    2010-01-01

    The runaway transient is a typical transient process of a hydro power unit, where the rotational speed of a turbine runner rapidly increases up to the runaway speed under a working head as the guide vanes cannot be closed due to some reason at the load rejection. In the present paper, the characteristics of the runaway transient of a model Kaplan turbine having ns = 479(m-kW) is simulated by using a time-dependent CFD technique where equation of rotational motion of runner, continuity equation and unsteady RANS equations with RNG k-ε turbulence model are solved iteratively. In the calculation, unstructured mesh is used to the whole flow passage, which consists of several sub-domains: entrance, casing, stay vanes + guide vanes, guide section, runner and draft tube. And variable speed sliding mesh technique is used to exchange interface flow information between moving part and stationary part, and three-dimensional unstructured dynamic mesh technique is also adopted to ensure mesh quality. Two cases were treated in the simulation of runaway transient characteristics after load rejection: one is the rated operating condition as the initial condition, and the other is the condition at the maximum head. Regarding the runaway speed, the experimental speed is 1.45 times the initial speed and the calculation is 1.47 times the initial for the former case. In the latter case, the experiment and the calculation are 1.67 times and 1.69 times respectively. From these results, it is recognized that satisfactorily prediction will be possible by using the present numerical method. Further, numerical results show that the swirl in the draft-tube flow becomes stronger in the latter part of the transient process so that a vortex rope will occur in the draft tube and its precession will cause the pressure fluctuations which sometimes affect the stability of hydro power system considerably.

  7. Analytical Method to Estimate Fatigue Life Time Duration in Service for Runner Blade Mechanism of Kaplan Turbines

    Directory of Open Access Journals (Sweden)

    Ana – Maria Budai

    2010-10-01

    Full Text Available The paper present an analytical method that can be used to determianted fatigue life time duration in service for runner blade mechanism of Kaplan turbines. The study was made for lever button of runer blade mechanism using two analytical relation to calculate the maximum number of stress cycles whereupon the mechanism work without any damage. To estimate fatigue life time duration will be used a formula obtained from one of most comon cumulative damage methodology taking in consideration the real exploatation conditions of a specified Kapaln turbine.

  8. Mortality, Causes of Death and Associated Factors Relate to a Large HIV Population-Based Cohort.

    Science.gov (United States)

    Garriga, César; García de Olalla, Patricia; Miró, Josep M; Ocaña, Inma; Knobel, Hernando; Barberá, Maria Jesús; Humet, Victoria; Domingo, Pere; Gatell, Josep M; Ribera, Esteve; Gurguí, Mercè; Marco, Andrés; Caylà, Joan A

    2015-01-01

    Antiretroviral therapy has led to a decrease in HIV-related mortality and to the emergence of non-AIDS defining diseases as competing causes of death. This study estimates the HIV mortality rate and their risk factors with regard to different causes in a large city from January 2001 to June 2013. We followed-up 3137 newly diagnosed HIV non-AIDS cases. Causes of death were classified as HIV-related, non-HIV-related and external. We examined the effect of risk factors on survival using mortality rates, Kaplan-Meier plots and Cox models. Finally, we estimated survival for each main cause of death groups through Fine and Gray models. 182 deaths were found [14.0/1000 person-years of follow-up (py); 95% confidence interval (CI):12.0-16.1/1000 py], 81.3% of them had a known cause of death. Mortality rate by HIV-related causes and non-HIV-related causes was the same (4.9/1000 py; CI:3.7-6.1/1000 py), external was lower [1.7/1000 py; (1.0-2.4/1000 py)]. Kaplan-Meier estimate showed worse survival in intravenous drug user (IDU) and heterosexuals than in men having sex with men (MSM). Factors associated with HIV-related causes of death include: IDU male (subHazard Ratio (sHR):3.2; CI:1.5-7.0) and causes of death include: ageing (sHR:1.5; CI:1.4-1.7) and heterosexual female (sHR:2.8; CI:1.1-7.3) versus MSM. Factors associated with external causes of death were IDU male (sHR:28.7; CI:6.7-123.2) and heterosexual male (sHR:11.8; CI:2.5-56.4) versus MSM. There are important differences in survival among transmission groups. Improved treatment is especially necessary in IDUs and heterosexual males.

  9. Perioperative and mid-term oncologic outcomes of robotic assisted radical cystectomy with totally intracorporeal neobladder: Results of a propensity score matched comparison with open cohort from a single-centre series.

    Science.gov (United States)

    Simone, Giuseppe; Tuderti, Gabriele; Misuraca, Leonardo; Anceschi, Umberto; Ferriero, Mariaconsiglia; Minisola, Francesco; Guaglianone, Salvatore; Gallucci, Michele

    2018-04-17

    In this study, we compared perioperative and oncologic outcomes of patients treated with either open or robot-assisted radical cystectomy and intracorporeal neobladder at a tertiary care center. The institutional prospective bladder cancer database was queried for "cystectomy with curative intent" and "neobladder". All patients underwent robot-assisted radical cystectomy and intracorporeal neobladder or open radical cystectomy and orthotopic neobladder for high-grade non-muscle invasive bladder cancer or muscle invasive bladder cancer with a follow-up length ≥2 years were included. A 1:1 propensity score matching analysis was used. Kaplan-Meier method was performed to compare oncologic outcomes of selected cohorts. Survival rates were computed at 1,2,3 and 4 years after surgery and the log rank test was applied to assess statistical significance between the matched groups. Overall, 363 patients (299 open and 64 robotic) were included. Open radical cystectomy patients were more frequently male (p = 0.08), with higher pT stages (p = 0.003), lower incidence of urothelial histologies (p = 0.05) and lesser adoption of neoadjuvant chemotherapy (open radical cystectomy cases (all p ≥ 0.22). Open cohort showed a higher rate of perioperative overall complications (91.3% vs 42.2%, p 0.001). At Kaplan-Meier analysis robotic and open cohorts displayed comparable disease-free survival (log-rank p = 0.746), cancer-specific survival (p = 0.753) and overall-survival rates (p = 0.909). Robot-assisted radical cystectomy and intracorporeal neobladder provides comparable oncologic outcomes of open radical cystectomy and orthotopic neobladder at intermediate term survival analysis. Copyright © 2018 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

  10. Proton Beam Radiotherapy for Uveal Melanomas at Nice Teaching Hospital: 16 Years' Experience

    International Nuclear Information System (INIS)

    Caujolle, Jean-Pierre; Mammar, Hamid; Chamorey, Emmanuel Phar; Pinon, Fabien; Herault, Joel; Gastaud, Pierre

    2010-01-01

    Purpose: To present the results of uveal melanomas treated at Nice Teaching Hospital. Methods and Materials: This retrospective study included 886 consecutive patients referred to our clinic for the treatment of uveal melanomas by proton beam radiotherapy from June 1991 to December 2007. Survival rates were determined by using Kaplan-Meier estimates, and prognostic factors were evaluated using the log-rank test or Cox model. Results: The number (percent total) of subjects staged according to the TNM classification system (6th edition) of malignant tumors included 39 stage T1 (4.4%), 420 stage T2 (47.40%), 409 stage T3 (46.16%), and 18 stage T4 (2.03%) patients. The median follow-up was 63.7 months. The Kaplan-Meier overall survival rate at 5 years according to the sixth edition TNM classification was 92% for T1, 89% for T2, 67% for T3, and 62% for T4; and at 10 years, 86% for T1, 78% for T2, 43% for T3, and 41% for T4. Five factors were found to be associated with an increased death rate: advanced age, tumor thickness, largest tumor basal diameter, tumor volume, and tumor volume-to-eyeball volume ratio. The metastasis-free survival rates were 88.3 % at 5 years and 76.4 % at 10 years. The local control rates were 93.9% at 5 years and 92.1% at 10 years. The ocular conservation rates were 91.1% at 5 years and 87.3% at 10 years. Conclusions: We report the results of a large series of patients treated for uveal melanomas with a very long follow-up. Despite the large tumor volume treated, our results were similar to previously published findings relating to proton beam therapy.

  11. IGMtransmission: Transmission curve computation

    Science.gov (United States)

    Harrison, Christopher M.; Meiksin, Avery; Stock, David

    2015-04-01

    IGMtransmission is a Java graphical user interface that implements Monte Carlo simulations to compute the corrections to colors of high-redshift galaxies due to intergalactic attenuation based on current models of the Intergalactic Medium. The effects of absorption due to neutral hydrogen are considered, with particular attention to the stochastic effects of Lyman Limit Systems. Attenuation curves are produced, as well as colors for a wide range of filter responses and model galaxy spectra. Photometric filters are included for the Hubble Space Telescope, the Keck telescope, the Mt. Palomar 200-inch, the SUBARU telescope and UKIRT; alternative filter response curves and spectra may be readily uploaded.

  12. Blade profile optimization of kaplan turbine using cfd analysis

    International Nuclear Information System (INIS)

    Janjua, A.B.; Khalil, M.S.

    2013-01-01

    Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)

  13. Blade Profile Optimization of Kaplan Turbine Using CFD Analysis

    Directory of Open Access Journals (Sweden)

    Aijaz Bashir Janjua

    2013-10-01

    Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.

  14. Statistical evaluation of a project to estimate fish trajectories through the intakes of Kaplan hydropower turbines

    Science.gov (United States)

    Sutton, Virginia Kay

    This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.

  15. Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents

    International Nuclear Information System (INIS)

    Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.

    2002-01-01

    Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de

  16. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Science.gov (United States)

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

    2011-12-01

    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  17. Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.

    Science.gov (United States)

    Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak

    Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  18. [Expression and clinical significance of 5hmC in bladder urothelial carcinoma].

    Science.gov (United States)

    Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing

    2016-02-01

    To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.

  19. Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.

    Science.gov (United States)

    Pion, J; Lenoir, M; Vandorpe, B; Segers, V

    2015-11-01

    This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.

  20. Approaches and perioperative management in periacetabular osteotomy surgery

    DEFF Research Database (Denmark)

    Søballe, Kjeld; Troelsen, Anders

    2012-01-01

    .9 to 8.1 years) of 209 PAOs performed using this approach have shown Kaplan-Meier survivorship rates of 94.7% at 5 years and 88.6% at 8.1 years, with conversion to total hip arthroplasty as the end point. Perioperative management includes a patient education program, optimized pain treatment strategies...... (local infiltration analgesia), and a progressive mobilization and exercise program. The transsartorial approach coupled with a specific perioperative management program has proved successful for PAO surgery.......In the early days of periacetabular osteotomy (PAO), surgical approaches were characterized by extensive soft-tissue dissection. The Smith-Petersen approach (and iliofemoral modifications) and the ilioinguinal approach have traditionally been used for PAO. The optimal surgical approach for PAO...

  1. Primary mediastinal large B-cell lymphoma: Clinical features, prognostic factors and survival with RCHOP in Arab patients in the PET scan era.

    Science.gov (United States)

    Al Shemmari, Salem; Sankaranarayanan, Sreedharan P; Krishnan, Yamini

    2014-07-01

    PMBCL is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. To clarify clinical features, treatment alternatives and outcomes, we evaluated 28 Arab patients treated with chemotherapy or radiotherapy between 2006 and 2011. PMBCL lymphoma patients identified according to WHO classification and treated at KCCC between 2006 and 2011 were included in this study. Demographic and clinical data are presented as means or medians. Overall survival was estimated using the Kaplan-Meier method. Survival rates were compared using the log-rank test. A P lymphoma entity seen in the young with good survival. The role of PET scan for response evaluation and the type of consolidation therapy needs to be further clarified.

  2. Natural frequencies of the frames having curved member

    International Nuclear Information System (INIS)

    Tekelioglu, M.; Ozyigit, H.A.; Ridvan, H.

    2001-01-01

    In-plane and out-of-plane vibrations of a frame having a curved member are studied. Although the analysis is carried out on a frame having a straight and a curve beam, it can be applicable for all the frame type structures. Different end conditions are considered for the system. Rotary inertia and extensional effects are included for the curved member. Finite element method is used as analysis tool. Natural frequencies of the curved beams for different end conditions are calculated first, and then the frequencies of the frames are investigated. The transformation from local coordinates to global coordinates for curved beams needs special attention in the analysis. The results are compared with other methods. (author)

  3. Anterior Overgrowth in Primary Curves, Compensatory Curves and Junctional Segments in Adolescent Idiopathic Scoliosis.

    Science.gov (United States)

    Schlösser, Tom P C; van Stralen, Marijn; Chu, Winnie C W; Lam, Tsz-Ping; Ng, Bobby K W; Vincken, Koen L; Cheng, Jack C Y; Castelein, René M

    2016-01-01

    Although much attention has been given to the global three-dimensional aspect of adolescent idiopathic scoliosis (AIS), the accurate three-dimensional morphology of the primary and compensatory curves, as well as the intervening junctional segments, in the scoliotic spine has not been described before. A unique series of 77 AIS patients with high-resolution CT scans of the spine, acquired for surgical planning purposes, were included and compared to 22 healthy controls. Non-idiopathic curves were excluded. Endplate segmentation and local longitudinal axis in endplate plane enabled semi-automatic geometric analysis of the complete three-dimensional morphology of the spine, taking inter-vertebral rotation, intra-vertebral torsion and coronal and sagittal tilt into account. Intraclass correlation coefficients for interobserver reliability were 0.98-1.00. Coronal deviation, axial rotation and the exact length discrepancies in the reconstructed sagittal plane, as defined per vertebra and disc, were analyzed for each primary and compensatory curve as well as for the junctional segments in-between. The anterior-posterior difference of spinal length, based on "true" anterior and posterior points on endplates, was +3.8% for thoracic and +9.4% for (thoraco)lumbar curves, while the junctional segments were almost straight. This differed significantly from control group thoracic kyphosis (-4.1%; P<0.001) and lumbar lordosis (+7.8%; P<0.001). For all primary as well as compensatory curves, we observed linear correlations between the coronal Cobb angle, axial rotation and the anterior-posterior length difference (r≥0.729 for thoracic curves; r≥0.485 for (thoraco)lumbar curves). Excess anterior length of the spine in AIS has been described as a generalized growth disturbance, causing relative anterior spinal overgrowth. This study is the first to demonstrate that this anterior overgrowth is not a generalized phenomenon. It is confined to the primary as well as the

  4. Deriving Area-storage Curves of Global Reservoirs

    Science.gov (United States)

    Mu, M.; Tang, Q.

    2017-12-01

    Basic information including capacity, dam height, and largest water area on global reservoirs and dams is well documented in databases such as GRanD (Global Reservoirs and Dams), ICOLD (International Commission on Large Dams). However, though playing a critical role in estimating reservoir storage variations from remote sensing or hydrological models, area-storage (or elevation-storage) curves of reservoirs are not publicly shared. In this paper, we combine Landsat surface water extent, 1 arc-minute global relief model (ETOPO1) and GRanD database to derive area-storage curves of global reservoirs whose area is larger than 1 km2 (6,000 more reservoirs are included). First, the coverage polygon of each reservoir in GRanD is extended to where water was detected by Landsat during 1985-2015. Second, elevation of each pixel in the reservoir is extracted from resampled 30-meter ETOPO1, and then relative depth and frequency of each depth value is calculated. Third, cumulative storage is calculated with increasing water area by every one percent of reservoir coverage area and then the uncalibrated area-storage curve is obtained. Finally, the area-storage curve is linearly calibrated by the ratio of calculated capacity over reported capacity in GRanD. The derived curves are compared with in-situ reservoir data collected in Great Plains Region in US, and the results show that in-situ records are well captured by the derived curves even in relative small reservoirs (several square kilometers). The new derived area-storage curves have the potential to be employed in global monitoring or modelling of reservoirs storage and area variations.

  5. Tracing a planar algebraic curve

    International Nuclear Information System (INIS)

    Chen Falai; Kozak, J.

    1994-09-01

    In this paper, an algorithm that determines a real algebraic curve is outlined. Its basic step is to divide the plane into subdomains that include only simple branches of the algebraic curve without singular points. Each of the branches is then stably and efficiently traced in the particular subdomain. Except for the tracing, the algorithm requires only a couple of simple operations on polynomials that can be carried out exactly if the coefficients are rational, and the determination of zeros of several polynomials of one variable. (author). 5 refs, 4 figs

  6. Early Right Ventricular Assist Device Use in Patients Undergoing Continuous-Flow Left Ventricular Assist Device Implantation: Incidence and Risk Factors From the Interagency Registry for Mechanically Assisted Circulatory Support.

    Science.gov (United States)

    Kiernan, Michael S; Grandin, E Wilson; Brinkley, Marshall; Kapur, Navin K; Pham, Duc Thinh; Ruthazer, Robin; Rame, J Eduardo; Atluri, Pavan; Birati, Edo Y; Oliveira, Guilherme H; Pagani, Francis D; Kirklin, James K; Naftel, David; Kormos, Robert L; Teuteberg, Jeffrey J; DeNofrio, David

    2017-10-01

    To investigate preimplant risk factors associated with early right ventricular assist device (RVAD) use in patients undergoing continuous-flow left ventricular assist device (LVAD) surgery. Patients in the Interagency Registry for Mechanically Assisted Circulatory Support who underwent primary continuous-flow-LVAD surgery were examined for concurrent or subsequent RVAD implantation within 14 days of LVAD. Risk factors for RVAD implantation and the combined end point of RVAD or death within 14 days of LVAD were assessed with stepwise logistic regression. We compared survival between patients with and without RVAD using Kaplan-Meier method and Cox proportional hazards modeling. Of 9976 patients undergoing continuous-flow-LVAD implantation, 386 patients (3.9%) required an RVAD within 14 days of LVAD surgery. Preimplant characteristics associated with RVAD use included interagency registry for mechanically assisted circulatory support patient profiles 1 and 2, the need for preoperative extracorporeal membrane oxygenation or renal replacement therapy, severe preimplant tricuspid regurgitation, history of cardiac surgery, and concomitant procedures other than tricuspid valve repair at the time of LVAD. Hemodynamic determinants included elevated right atrial pressure, reduced pulmonary artery pulse pressure, and reduced stroke volume. The final model demonstrated good performance for both RVAD implant (area under the curve, 0.78) and the combined end point of RVAD or death within 14 days (area under the curve, 0.73). Compared with patients receiving an isolated LVAD, patients requiring RVAD had decreased 1- and 6-month survival: 78.1% versus 95.8% and 63.6% versus 87.9%, respectively ( P The need for RVAD implantation after LVAD is associated with indices of global illness severity, markers of end-organ dysfunction, and profiles of hemodynamic instability. © 2017 American Heart Association, Inc.

  7. Prognostic value of cell cycle regulatory proteins in muscle-infiltrating bladder cancer.

    Science.gov (United States)

    Galmozzi, Fabia; Rubagotti, Alessandra; Romagnoli, Andrea; Carmignani, Giorgio; Perdelli, Luisa; Gatteschi, Beatrice; Boccardo, Francesco

    2006-12-01

    The aims of this study were to investigate the expression levels of proteins involved in cell cycle regulation in specimens of bladder cancer and to correlate them with the clinicopathological characteristics, proliferative activity and survival. Eighty-two specimens obtained from patients affected by muscle-invasive bladder cancer were evaluated immunohistochemically for p53, p21 and cyclin D1 expression, as well as for the tumour proliferation index, Ki-67. The statistical analysis included Kaplan-Meier curves with log-rank test and Cox proportional hazards models. In univariate analyses, low Ki-67 proliferation index (P = 0.045) and negative p21 immunoreactivity (P = 0.04) were associated to patient's overall survival (OS), but in multivariate models p21 did not reach statistical significance. When the combinations of the variables were assessed in two separate multivariate models that included tumour stage, grading, lymph node status, vascular invasion and perineural invasion, the combined variables p21/Ki-67 or p21/cyclin D1 expression were independent predictors for OS; in particular, patients with positive p21/high Ki-67 (P = 0.015) or positive p21/negative cyclin D1 (P = 0.04) showed the worst survival outcome. Important alterations in the cell cycle regulatory pathways occur in muscle-invasive bladder cancer and the combined use of cell cycle regulators appears to provide significant prognostic information that could be used to select the patients most suitable for multimodal therapeutic approaches.

  8. Modeling survival: application of the Andersen-Gill model to Yellowstone grizzly bears

    Science.gov (United States)

    Johnson, Christopher J.; Boyce, Mark S.; Schwartz, Charles C.; Haroldson, Mark A.

    2004-01-01

     Wildlife ecologists often use the Kaplan-Meier procedure or Cox proportional hazards model to estimate survival rates, distributions, and magnitude of risk factors. The Andersen-Gill formulation (A-G) of the Cox proportional hazards model has seen limited application to mark-resight data but has a number of advantages, including the ability to accommodate left-censored data, time-varying covariates, multiple events, and discontinuous intervals of risks. We introduce the A-G model including structure of data, interpretation of results, and assessment of assumptions. We then apply the model to 22 years of radiotelemetry data for grizzly bears (Ursus arctos) of the Greater Yellowstone Grizzly Bear Recovery Zone in Montana, Idaho, and Wyoming, USA. We used Akaike's Information Criterion (AICc) and multi-model inference to assess a number of potentially useful predictive models relative to explanatory covariates for demography, human disturbance, and habitat. Using the most parsimonious models, we generated risk ratios, hypothetical survival curves, and a map of the spatial distribution of high-risk areas across the recovery zone. Our results were in agreement with past studies of mortality factors for Yellowstone grizzly bears. Holding other covariates constant, mortality was highest for bears that were subjected to repeated management actions and inhabited areas with high road densities outside Yellowstone National Park. Hazard models developed with covariates descriptive of foraging habitats were not the most parsimonious, but they suggested that high-elevation areas offered lower risks of mortality when compared to agricultural areas.

  9. 3D Quantitative tumour burden analysis in patients with hepatocellular carcinoma before TACE: comparing single-lesion vs. multi-lesion imaging biomarkers as predictors of patient survival

    International Nuclear Information System (INIS)

    Fleckenstein, Florian N.; Schernthaner, Ruediger E.; Duran, Rafael; Sohn, Jae Ho; Sahu, Sonia; Zhao, Yan; Hamm, Bernd; Gebauer, Bernhard; Lin, MingDe; Geschwind, Jean-Francois; Chapiro, Julius

    2016-01-01

    To compare the ability of single- vs. multi-lesion assessment on baseline MRI using 1D- and 3D-based measurements to predict overall survival (OS) in patients with hepatocellular carcinoma (HCC) before transarterial chemoembolization (TACE). This retrospective analysis included 122 patients. A quantitative 3D analysis was performed on baseline MRI to calculate enhancing tumour volume (ETV [cm 3 ]) and enhancing tumour burden (ETB [%]) (ratio between ETV [cm 3 ] and liver volume). Furthermore, enhancing and overall tumour diameters were measured. Patients were stratified into two groups using thresholds derived from the BCLC staging system. Statistical analysis included Kaplan-Meier plots, uni- and multivariate cox proportional hazard ratios (HR) and concordances. All methods achieved good separation of the survival curves (p < 0.05). Multivariate analysis showed an HR of 5.2 (95 % CI 3.1-8.8, p < 0.001) for ETV [cm 3 ] and HR 6.6 (95 % CI 3.7-11.5, p < 0.001) for ETB [%] vs. HR 2.6 (95 % CI 1.2-5.6, p = 0.012) for overall diameter and HR 3.0 (95 % CI 1.5-6.3, p = 0.003) for enhancing diameter. Concordances were highest for ETB [%], with no added predictive power for multi-lesion assessment (difference between concordances not significant). 3D quantitative assessment is a stronger predictor of survival as compared to diameter-based measurements. Assessing multiple lesions provides no substantial improvement in predicting OS than evaluating the dominant lesion alone. (orig.)

  10. Conservative neck dissection in oral cancer patients: A 5 years retrospective study

    Directory of Open Access Journals (Sweden)

    Wan Mahadzir Wan Mustafa

    2016-06-01

    Full Text Available The impact of ablative oral cancer surgery was studied, with reference to recurrence and nodal metastasis,  survival probability and prognostic indicators and to determine if ethnicity influences the survival of patients. Patients who underwent major ablative surgery of the head and neck region with neck dissection were identified and assessed. Those with stage I-IV oral and oropharyngeal malignancies necessitating resection with or without radiotherapy from 2004 to 2009 were included in this study. All individuals had a pre-operative assessment and post operative assessment. Survival distributions were analyzed using Kaplan-Meier curves. Eighty seven patients (males: 38%; females: 62% were included in this study, with an age range of 21-85 years. Some 78% underwent neck dissections while 63% had surgery and radiotherapy. Nodal and primary site recurrence was 5.7% and 20.5%. The median survival time was 57 months. One year Overall Survival (OS rate was 72.7% and three year overall survival rate 61.5%. The log-rank test showed a significant difference of survival between Malay and Chinese patients (Bonferroni correction p=0.033. Recurrence-Free Survival (RFS analysis revealed that 25% of the patients have reached the event of recurrence at 46 months. The three year survival rate was 76.1%. In the RFS analysis, the log-rank test showed a significant difference in the event of recurrence and nodal metastasis (p<0.001. Conservative neck effectively controls neck metastases. Ethnicity influence  survival.

  11. Neutron cross sections: Book of curves

    International Nuclear Information System (INIS)

    McLane, V.; Dunford, C.L.; Rose, P.F.

    1988-01-01

    Neuton Cross Sections: Book of Curves represents the fourth edition of what was previously known as BNL-325, Neutron Cross Sections, Volume 2, CURVES. Data is presented only for (i.e., intergrated) reaction cross sections (and related fission parameters) as a function of incident-neutron energy for the energy range 0.01 eV to 200 MeV. For the first time, isometric state production cross sections have been included. 11 refs., 4 figs

  12. Melanoma Patients with Unknown Primary Site or Nodal Recurrence after Initial Diagnosis Have a Favourable Survival Compared to Those with Synchronous Lymph Node Metastasis and Primary Tumour

    OpenAIRE

    Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus

    2013-01-01

    BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...

  13. Survival analysis

    International Nuclear Information System (INIS)

    Badwe, R.A.

    1999-01-01

    The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model

  14. Meritev izkoristka in nastavitev krmilnih parametrov kaplanove turbine z dolgim cevnim sistemom s primerjalno metodo: Measurement of relative turbine efficiency and adjustment of governing parameters on long penstock Kaplan turbine with comparative method:

    OpenAIRE

    Trebše, Andrej J.

    2004-01-01

    The paper deals with efficiency measurement of Kaplan turbine with relative method (index test) and adjustment of operating of runner and guide vane governing system. At certain longer penstocks the looses in conduit at turbineload operation change the net head. On basis of model test on Kaplan turbine and relative turbine efficiency measurement on prototype the turbine governing system was optimized in accordance with comparative method. Prispevek obravnava meritev izkoristka kaplanove tu...

  15. Risk of tumor transmission after thoracic allograft transplantation from adult donors with central nervous system neoplasm-A UNOS database study.

    Science.gov (United States)

    Hynes, Conor F; Ramakrishnan, Karthik; Alfares, Fahad A; Endicott, Kendal M; Hammond-Jack, Katrina; Zurakowski, David; Jonas, Richard A; Nath, Dilip S

    2017-04-01

    We analyzed the UNOS database to better define the risk of transmission of central nervous system (CNS) tumors from donors to adult recipients of thoracic organs. Data were procured from the Standard Transplant Analysis and Research dataset files. Donors with CNS tumors were identified, and recipients from these donors comprised the study group (Group I). The remaining recipients of organs from donors who did not have CNS tumors formed the control group (Group II). Incidence of recipient CNS tumors, donor-related malignancies, and overall survival were calculated and compared in addition to multivariable logistic regression. A cohort of 58 314 adult thoracic organ recipients were included, of which 337 received organs from donors who had documented CNS tumors (Group I). None of these recipients developed CNS tumors at a median follow-up of 72 months (IR: 30-130 months). Although overall mortality in terms of the percentage was higher in Group I than Group II (163/320=51% vs 22 123/52 691=42%), Kaplan-Meier curves indicate no significant difference in the time to death between the two groups (P=.92). There is little risk of transmission of the common nonaggressive CNS tumors to recipients of thoracic organs. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Long-term success of dental implants in patients with head and neck cancer after radiation therapy.

    Science.gov (United States)

    Curi, M M; Condezo, A F B; Ribeiro, K D C B; Cardoso, C L

    2018-06-01

    The purpose of this study was to analyze the long-term success and factors potentially influencing the success of dental implants placed in patients with head and neck cancer who underwent radiation therapy with a minimum total dose of 50Gy during the years 1995-2010. Thirty-five patients (169 dental implants) were included in this study. Data on demographic characteristics, tumour type, radiation therapy, implant sites, implant dimensions, and hyperbaric oxygen therapy (HBOT) were obtained from the medical records and analyzed. Implant survival was estimated using Kaplan-Meier survival curves. Seventy-nine dental implants were placed in the maxilla and 90 in the mandible. The mean follow-up after implant installation was 7.4 years (range 0.3-14.7 years). The overall 5-year survival rate for all implants was 92.9%. Sex (Pradiation therapy delivery (P=0.005) had a statistically significant influence on implant survival. Age, time of implantation after irradiation, implant brand and dimensions, and HBOT had no statistically significant influence on implant survival. Osseointegrated dental implants can be used successfully in the oral rehabilitation of patients with head and neck cancer with a history of radiation therapy. Risk factors such as sex and the mode of radiation therapy delivery can affect implant survival. Copyright © 2018 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  17. Gender differences among recidivist trauma patients.

    Science.gov (United States)

    Kwan, Rita O; Cureton, Elizabeth L; Dozier, Kristopher C; Victorino, Gregory P

    2011-01-01

    Gender differences among trauma recidivist patients are not well-understood. We hypothesized that males are more likely to be repeatedly involved in the trauma system and have a shorter time to recurrence between repeat episodes of injury compared with females. A retrospective analysis of trauma patients treated at an urban university-based trauma center was performed. Variables including gender, race, insurance status, age, mechanism of injury, outcomes, and injury secondary to domestic violence were compared. Differences were compared using χ(2) tests and log-rank (Mantel-Cox) Kaplan-Meier cumulative event curves. We identified 689 trauma recidivist patients (4.0% of all trauma visits) over a 10-y period. Compared to single-visit patients, recidivist patients were more likely to be male (87% versus 73%), uninsured (78% versus 66%), and have injuries secondary to assaults (54% versus 37%) (P trauma visit was shorter for females compared with males (23 ± 2.5 versus 30 ± 1.2 mo, P trauma than were male recidivists (69% versus 43%, P trauma patients have a much shorter time to recurrence for a second traumatic injury than do males. Female recidivists have a high likelihood of assault-associated injuries and domestic violence. Trauma centers should screen for domestic violence among trauma patients to aid in preventing further repeat episodes of injury. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. An early validation of the Society for Vascular Surgery lower extremity threatened limb classification system.

    Science.gov (United States)

    Cull, David L; Manos, Ginger; Hartley, Michael C; Taylor, Spence M; Langan, Eugene M; Eidt, John F; Johnson, Brent L

    2014-12-01

    The Society for Vascular Surgery (SVS) recently established the Lower Extremity Threatened Limb Classification System, a staging system using Wound characteristic, Ischemia, and foot Infection (WIfI) to stratify the risk for limb amputation at 1 year. Although intuitive in nature, this new system has not been validated. The purpose of the following study was to determine whether the WIfI system is predictive of limb amputation and wound healing. Between 2007 and 2010, we prospectively obtained data related to wound characteristics, extent of infection, and degree of postrevascularization ischemia in 139 patients with foot wounds who presented for lower extremity revascularization (158 revascularization procedures). After adapting those data to the WIfI classifications, we analyzed the influence of wound characteristics, extent of infection, and degree of ischemia on time to wound healing; empirical Kaplan-Meier survival curves were compared with theoretical outcomes predicted by WIfI expert consensus opinion. Of the 158 foot wounds, 125 (79%) healed. The median time to wound healing was 2.7 months (range, 1-18 months). Factors associated with wound healing included presence of diabetes mellitus (P = .013), wound location (P = .049), wound size (P = .007), wound depth (P = .004), and degree of ischemia (P valid. Further validation of the WIfI classification system with multicenter data is justified. Copyright © 2014 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

  19. Clinical and Radiologic Outcomes of Submerged and Nonsubmerged Bone-Level Implants with Internal Hexagonal Connections in Immediate Implantation: A 5-Year Retrospective Study.

    Science.gov (United States)

    Wu, Shiyu; Wu, Xiayi; Shrestha, Rachana; Lin, Jinying; Feng, Zhicai; Liu, Yudong; Shi, Yunlin; Huang, Baoxin; Li, Zhipeng; Liu, Quan; Zhang, Xiaocong; Hu, Mingxuan; Chen, Zhuofan

    2018-02-01

    To evaluate the 5-year clinical and radiologic outcome of immediate implantation using submerged and nonsubmerged techniques with bone-level implants and internal hexagonal connections and the effects of potential influencing factors. A total of 114 bone-level implants (XiVE S plus) with internal hexagonal connections inserted into 72 patients were included. Patients were followed up for 5 years. A t-test was used to statistically evaluate the marginal bone loss between the submerged and nonsubmerged groups. The cumulative survival rate (CSR) was calculated according to the life table method and illustrated with Kaplan-Meier survival curves. Comparisons of the CSR between healing protocols, guided bone regeneration, implants with different sites, lengths, and diameters were performed using log-rank tests. The 5-year cumulative implant survival rates with submerged and nonsubmerged healing were 94% and 96%, respectively. No statistically significant differences in terms of marginal bone loss, healing protocol, application of guided bone regeneration, implant site, or length were observed. High CSRs and good marginal bone levels were achieved 5 years after immediate implantation of bone-level implants with internal hexagonal connections using both the submerged and nonsubmerged techniques. Factors such as implant length, site, and application of guided bone regeneration did not have an impact on the long-term success of the implants. © 2017 by the American College of Prosthodontists.

  20. Removal of Endobronchial Malignant Mass by Cryotherapy Improved Performance Status to Receive Chemotherapy

    Science.gov (United States)

    Hsieh, Meng-Heng; Wang, Tsai-Yu; Yu, Chih-Teng; Chou, Chun-Liang; Lin, Shu-Min; Kuo, Chih-Hsi; Chung, Fu-Tsai

    2014-01-01

    Although malignant endobronchial mass (MEM) has poor prognosis, cryotherapy is reportedly a palliative treatment. Clinical data on postcryotherapy MEM patients in a university-affiliated hospital between 2007 and 2011 were evaluated. Survival curve with or without postcryotherapy chemotherapy and performance status (PS) improvement of these subjects were analyzed using the Kaplan-Meier method. There were 59 patients (42 males), with median age of 64 years (range, 51–76, and median performance status of 2 (interquartile range [IQR], 2-3). Postcryotherapy complications included minor bleeding (n = 12) and need for multiple procedures (n = 10), while outcomes were relief of symptoms (n = 51), improved PS (n = 45), and ability to receive chemotherapy (n = 40). The survival of patients with chemotherapy postcryotherapy was longer than that of patients without such chemotherapy (median, 534 versus 106 days; log-rank test, P = 0.007; hazard ratio, 0.25; 95% confidence interval, 0.10–0.69). The survival of patients with PS improvement postcryotherapy was longer than that of patients without PS improvement (median, 406 versus 106 days; log-rank test, P = 0.02; hazard ratio, 0.28; 95% confidence interval, 0.10–0.81). Cryotherapy is a feasible treatment for MEM. With better PS after cryotherapy, further chemotherapy becomes possible for patients to improve survival when MEM caused dyspnea and poor PS. PMID:25383370

  1. Improved survival in HIV treatment programs in Asia

    Science.gov (United States)

    De La Mata, Nicole L; Kumarasamy, Nagalingeswaran; Khol, Vohith; Ng, Oon Tek; Van Nguyen, Kinh; Merati, Tuti Parwati; Pham, Thuy Thanh; Lee, Man Po; Durier, Nicolas; Law, Matthew

    2016-01-01

    Background Antiretroviral treatment (ART) for HIV-positive patients has expanded rapidly in Asia over the last ten years. Our study aimed to describe the time trends and risk factors for overall survival in patients receiving first-line ART in Asia. Methods We included HIV-positive adult patients who initiated ART between 2003–2013 (n=16 546), from seven sites across six Asia-Pacific countries. Patient follow-up was to May 2014. We compared survival for each country and overall by time period of ART initiation using Kaplan-Meier curves. Factors associated with mortality were assessed using Cox regression, stratified by site. We also summarized first-line ART regimens, CD4 count at ART initiation, and CD4 and HIV viral load testing frequencies. Results There were 880 deaths observed over 54 532 person-years of follow-up, a crude rate of 1.61 (1.51, 1.72) per 100 person-years. Survival significantly improved in more recent years of ART initiation. The survival probabilities at 4 years follow-up for those initiating ART in 2003–05 was 92.1%, 2006–09 was 94.3% and 2010–2013 was 94.5% (pAsia have improved survival in more recent years of ART initiation. This is likely a consequence of improvements in treatment and, patient management and monitoring over time. PMID:26961354

  2. GNAS1 T393C Polymorphism Is Associated with Clinical Course in Patients with Intrahepatic Cholangiocarcinoma

    Directory of Open Access Journals (Sweden)

    Klaus J. Schmitz

    2007-02-01

    Full Text Available BACKGROUND/AIMS: The GNAS1 locus encodes the Gas protein, which stimulates the formation of cycloadenosinemonophosphate (cAMP. The cAMP pathway mediates pleiotropic effects, including the regulation of apoptosis and proliferation. We have recently shown that TT genotypes of the single-nucleotide polymorphism T393C in the gene GNAS1 predict the clinical outcome of patients with various carcinomas. METHODS: Eighty-seven patients with intrahepatic cholangiocarcinoma (ICC were retrospectively genotyped to elucidate a potential association between T393C genotypes and clinical outcome. RESULTS: ICCs of patients with homozygous TT genotypes revealed a higher proliferation rate and a lower apoptotic rate. Homozygous TT patients were at highest risk for cancer-related deaths (hazard ratio = 2.74; 95% confidence interval = 1.03-7.28 compared with C-allele carriers. Kaplan-Meier curves for disease-specific overall and local recurrence-free survival in a subgroup with Ro-resected ICC showed a significant association of T393 homozygosity with outcome, which was confirmed in multivariate Cox regression analysis. CONCLUSIONS: GNAS1 T393C is a novel independent host factor for disease progression in patients with ICC. Our finding that TT homozygosity (and not CC homozygosity was associated with unfavorable clinical outcome points to the complex and differing functional effects induced by GNAS1 T393C polymorphism in various human carcinomas.

  3. The Role of Vaginal Brachytherapy in the Treatment of Surgical Stage I Papillary Serous or Clear Cell Endometrial Cancer

    International Nuclear Information System (INIS)

    Barney, Brandon M.; Petersen, Ivy A.; Mariani, Andrea; Dowdy, Sean C.; Bakkum-Gamez, Jamie N.; Haddock, Michael G.

    2013-01-01

    Objectives: The optimal adjuvant therapy for International Federation of Gynecology and Obstetrics (FIGO) stage I papillary serous (UPSC) or clear cell (CC) endometrial cancer is unknown. We report on the largest single-institution experience using adjuvant high-dose-rate vaginal brachytherapy (VBT) for surgically staged women with FIGO stage I UPSC or CC endometrial cancer. Methods and Materials: From 1998-2011, 103 women with FIGO 2009 stage I UPSC (n=74), CC (n=21), or mixed UPSC/CC (n=8) endometrial cancer underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy followed by adjuvant high-dose-rate VBT. Nearly all patients (n=98, 95%) also underwent extended lymph node dissection of pelvic and paraortic lymph nodes. All VBT was performed with a vaginal cylinder, treating to a dose of 2100 cGy in 3 fractions. Thirty-five patients (34%) also received adjuvant chemotherapy. Results: At a median follow-up time of 36 months (range, 1-146 months), 2 patients had experienced vaginal recurrence, and the 5-year Kaplan Meier estimate of vaginal recurrence was 3%. The rates of isolated pelvic recurrence, locoregional recurrence (vaginal + pelvic), and extrapelvic recurrence (including intraabdominal) were similarly low, with 5-year Kaplan-Meier estimates of 4%, 7%, and 10%, respectively. The estimated 5-year overall survival was 84%. On univariate analysis, delivery of chemotherapy did not affect recurrence or survival. Conclusions: VBT is effective at preventing vaginal relapse in women with surgical stage I UPSC or CC endometrial cancer. In this cohort of patients who underwent comprehensive surgical staging, the risk of isolated pelvic or extrapelvic relapse was low, implying that more extensive adjuvant radiation therapy is likely unnecessary.

  4. Basal 18F-fluoro-2-deoxy-d-glucose positron emission tomography/computed tomography as a prognostic biomarker in patients with locally advanced breast cancer

    International Nuclear Information System (INIS)

    Garcia Vicente, Ana Maria; Soriano Castrejon, Angel; Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano; Mar Munoz Sanchez, Maria del; Alvarez Cabellos, Ruth; Espinosa Aunion, Ruth

    2015-01-01

    To explore the relationship between basal 18 F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent 18 F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with 18 F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)

  5. Adjuvant Ab Interno Tumor Treatment After Proton Beam Irradiation.

    Science.gov (United States)

    Seibel, Ira; Riechardt, Aline I; Heufelder, Jens; Cordini, Dino; Joussen, Antonia M

    2017-06-01

    This study was performed to show long-term outcomes concerning globe preservation in uveal melanoma patients after proton beam therapy with the main focus on outcomes according to different adjuvant ab interno surgical procedures. Retrospective cohort study. All patients treated with primary proton beam therapy for choroidal or ciliary body melanoma between June 1998 and June 2015 were included. A total of 2499 patients underwent primary proton beam therapy, with local tumor control and globe preservation rates of 95.9% and 94.8% after 5 years, respectively. A total of 110 (4.4%) patients required secondary enucleation. Unresponsive neovascular glaucoma was the leading cause of secondary enucleation in 78 of the 2499 patients (3.1%). The 5-year enucleation-free survival rate was 94.8% in the endoresection group, 94.3% in the endodrainage group, and 93.5% in the comparator group. The log-rank test showed P = .014 (comparator group vs endoresection group) and P = .06 (comparator group vs endodrainage-vitrectomy group). Patients treated with endoresection or endodrainage-vitrectomy developed less radiation retinopathy (30.5% and 37.4% after 5 years, P = .001 and P = .048 [Kaplan-Meier], respectively) and less neovascular glaucoma (11.6% and 21.3% after 5 years, P = .001 and P = .01 [Kaplan-Meier], respectively) compared with the comparator group (52.3% radiation retinopathy and 57.8% neovascular glaucoma after 5 years). This study suggests that in larger tumors the enucleation and neovascular glaucoma rates might be reduced by adjuvant surgical procedures. Although endoresection is the most promising adjuvant treatment option, the endodrainage-vitrectomy is recommended in patients who are ineligible for endoresection. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. High Expression of PHGDH Predicts Poor Prognosis in Non–Small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jinhong Zhu

    2016-12-01

    Full Text Available Tumors have exceptionally high demands for energy and anabolism because of their rapid growth. The de novo serine synthesis pathway initiated by phosphoglycerate dehydrogenase (PHGDH has been recognized as a hallmark of metabolic adaption in carcinogenesis. The oncogenic role and prognostic value of PHGDH have been investigated in multiple cancer types, including breast cancer, melanoma, cervical cancer, and colon cancer. Due to the importance of PHGDH in cancer, we attempted to determine the clinical significance of PHGDH in 319 patients with non–small cell lung cancer (NSCLC. We evaluated the mRNA and protein expression levels of PHGDH gene, using quantitative reverse transcriptase polymerase chain reaction and tissue array–based immunohistochemistry, respectively. Significantly increased PHGDH expression in mRNA and protein levels was identified in tumor tissues versus matched adjacent nontumor tissues. More interestingly, immunohistochemical expression of PHGDH was significantly associated with lymph node metastasis (P = .021 and TNM stage (P = .016. Kaplan-Meier survival analysis indicated that NSCLC patients with low levels of PHGDH outperformed patients with high levels of PHGDH regarding 5-year overall survival. Significantly longer survival in the former suggested the prognostic implication of PHGDH in NSCLC. Multivariate survival analysis using Cox regression model demonstrated that high PHGDH levels and advanced TNM stage (III + IV were independent predictors of prognosis in NSCLC. Moreover, bioinformatics analysis confirmed the increase in PHGDH transcripts (data from The Cancer Genome Atlas and its prognostic value (Kaplan-Meier plotter in NSCLC. In conclusion, this study suggested the clinical implication of PHGDH in NSCLC. PHGDH may be a promising therapeutic target in NSCLC.

  7. Basal {sup 18}F-fluoro-2-deoxy-d-glucose positron emission tomography/computed tomography as a prognostic biomarker in patients with locally advanced breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Garcia Vicente, Ana Maria; Soriano Castrejon, Angel [University General Hospital, Nuclear Medicine Department, Ciudad Real (Spain); Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano [University of Castilla-La Mancha, Department of Mathematics, Ciudad Real (Spain); Mar Munoz Sanchez, Maria del [Virgen de la Luz Hospital, Oncology Department, Cuenca (Spain); Alvarez Cabellos, Ruth [Virgen de la Salud Hospital, Oncology Department, Toledo (Spain); Espinosa Aunion, Ruth [La Mancha Centro Hospital, Oncology Department, Ciudad Real (Spain)

    2015-11-15

    To explore the relationship between basal {sup 18}F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent {sup 18}F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with {sup 18}F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)

  8. A Point System to Forecast Hepatocellular Carcinoma Risk Before and After Treatment Among Persons with Chronic Hepatitis C.

    Science.gov (United States)

    Xing, Jian; Spradling, Philip R; Moorman, Anne C; Holmberg, Scott D; Teshale, Eyasu H; Rupp, Loralee B; Gordon, Stuart C; Lu, Mei; Boscarino, Joseph A; Schmidt, Mark A; Trinacty, Connie M; Xu, Fujie

    2017-11-01

    Risk of hepatocellular carcinoma (HCC) may be difficult to determine in the clinical setting. Develop a scoring system to forecast HCC risk among patients with chronic hepatitis C. Using data from the Chronic Hepatitis Cohort Study collected during 2005-2014, we derived HCC risk scores for males and females using an extended Cox model with aspartate aminotransferase-to-platelet ratio index (APRI) as a time-dependent variables and mean Kaplan-Meier survival functions from patient data at two study sites, and used data collected at two separate sites for external validation. For model calibration, we used the Greenwood-Nam-D'Agostino goodness-of-fit statistic to examine differences between predicted and observed risk. Of 12,469 patients (1628 with a history of sustained viral response [SVR]), 504 developed HCC; median follow-up was 6 years. Final predictors in the model included age, alcohol abuse, interferon-based treatment response, and APRI. Point values, ranging from -3 to 14 (males) and -3 to 12 (females), were established using hazard ratios of the predictors aligned with 1-, 3-, and 5-year Kaplan-Meier survival probabilities of HCC. Discriminatory capacity was high (c-index 0.82 males and 0.84 females) and external calibration demonstrated no differences between predicted and observed HCC risk for 1-, 3-, and 5-year forecasts among males (all p values >0.97) and for 3- and 5-year risk among females (all p values >0.87). This scoring system, based on age, alcohol abuse history, treatment response, and APRI, can be used to forecast up to a 5-year risk of HCC among hepatitis C patients before and after SVR.

  9. Quaternion wave equations in curved space-time

    Science.gov (United States)

    Edmonds, J. D., Jr.

    1974-01-01

    The quaternion formulation of relativistic quantum theory is extended to include curvilinear coordinates and curved space-time in order to provide a framework for a unified quantum/gravity theory. Six basic quaternion fields are identified in curved space-time, the four-vector basis quaternions are identified, and the necessary covariant derivatives are obtained. Invariant field equations are derived, and a general invertable coordinate transformation is developed. The results yield a way of writing quaternion wave equations in curvilinear coordinates and curved space-time as well as a natural framework for solving the problem of second quantization for gravity.

  10. The advanced geometry of plane curves and their applications

    CERN Document Server

    Zwikker, C

    2005-01-01

    ""Of chief interest to mathematicians, but physicists and others will be fascinated ... and intrigued by the fruitful use of non-Cartesian methods. Students ... should find the book stimulating."" - British Journal of Applied PhysicsThis study of many important curves, their geometrical properties, and their applications features material not customarily treated in texts on synthetic or analytic Euclidean geometry. Its wide coverage, which includes both algebraic and transcendental curves, extends to unusual properties of familiar curves along with the nature of lesser known curves.Informativ

  11. The South Carolina bridge-scour envelope curves

    Science.gov (United States)

    Benedict, Stephen T.; Feaster, Toby D.; Caldwell, Andral W.

    2016-09-30

    The U.S. Geological Survey, in cooperation with the South Carolina Department of Transportation, conducted a series of three field investigations to evaluate historical, riverine bridge scour in the Piedmont and Coastal Plain regions of South Carolina. These investigations included data collected at 231 riverine bridges, which lead to the development of bridge-scour envelope curves for clear-water and live-bed components of scour. The application and limitations of the South Carolina bridge-scour envelope curves were documented in four reports, each report addressing selected components of bridge scour. The current investigation (2016) synthesizes the findings of these previous reports into a guidance manual providing an integrated procedure for applying the envelope curves. Additionally, the investigation provides limited verification for selected bridge-scour envelope curves by comparing them to field data collected outside of South Carolina from previously published sources. Although the bridge-scour envelope curves have limitations, they are useful supplementary tools for assessing the potential for scour at riverine bridges in South Carolina.

  12. Complexity of Curved Glass Structures

    Science.gov (United States)

    Kosić, T.; Svetel, I.; Cekić, Z.

    2017-11-01

    Despite the increasing number of research on the architectural structures of curvilinear forms and technological and practical improvement of the glass production observed over recent years, there is still a lack of comprehensive codes and standards, recommendations and experience data linked to real-life curved glass structures applications regarding design, manufacture, use, performance and economy. However, more and more complex buildings and structures with the large areas of glass envelope geometrically complex shape are built every year. The aim of the presented research is to collect data on the existing design philosophy on curved glass structure cases. The investigation includes a survey about how architects and engineers deal with different design aspects of curved glass structures with a special focus on the design and construction process, glass types and structural and fixing systems. The current paper gives a brief overview of the survey findings.

  13. Design fatigue curve for Hastelloy-X

    International Nuclear Information System (INIS)

    Nishiguchi, Isoharu; Muto, Yasushi; Tsuji, Hirokazu

    1983-12-01

    In the design of components intended for elevated temperature service as the experimental Very High-Temperature gas-cooled Reactor (VHTR), it is essential to prevent fatigue failure and creep-fatigue failure. The evaluation method which uses design fatigue curves is adopted in the design rules. This report discussed several aspects of these design fatigue curves for Hastelloy-X (-XR) which is considered for use as a heat-resistant alloy in the VHTR. Examination of fatigue data gathered by a literature search including unpublished data showed that Brinkman's equation is suitable for the design curve of Hastelloy-X (-XR), where total strain range Δ epsilon sub(t) is used as independent variable and fatigue life Nsub(f) is transformed into log(log Nsub(f)). (author)

  14. Fibulin-3 as a diagnostic biomarker in patients with malignant mesothelioma.

    Science.gov (United States)

    Kaya, Halide; Demir, Melike; Taylan, Mahsuk; Sezgi, Cengizhan; Tanrikulu, Abdullah Cetin; Yilmaz, Sureyya; Bayram, Mehmet; Kaplan, Ibrahim; Senyigit, Abdurrahman

    2015-01-01

    New tumour biomarkers are being intensely investigated for malignant mesothelioma (MM). Fibulin-3 is produced in MM but its role remains uncertain. The aim of this study was to evaluate the validity of measuring serum fibulin-3 in the diagnosis and prognosis of MM. This prospective study was performed on 43 patients and 40 healthy controls who were admitted to our hospital between January 2012 and January 2014. Data from MM patients, including demographic and clinical features, routine laboratory data, levels of serum fibulin-3, and treatment outcomes were defined as potential prognostic factors. The receiver operating characteristic (ROC) curve for fibulin-3 was used to detect the cut-off value with highest sensitivity and specificity. Univariate survival analysis was performed using the Kaplan-Meier method in patients with MM. Afterwards, the possible factors identified with univariate analyses were entered into the cox regression analysis. Our results revealed that patients with MM had significantly higher serum levels of fibulin-3 than controls. The results showed that the best cut-off point was 36.6 ng/ml with an AUC (area under the curve)=0.976, sensitivity=93.0% and specificity=90.0. In our study, the initial significant poor prognostic factors were advanced stage, high white blood cell count, high platelet count, high C-reactive protein (p<0.05 for each variable). Later, according to multivariate analysis the results showed only advanced stage as significant parameter (p=0.040). We determined that real use for serum fibulin-3 was not for prognosis but for diagnosis in MM. Also advanced stage was associated with poor MM prognosis.

  15. Impact of Different Surgeons on Dental Implant Failure.

    Science.gov (United States)

    Chrcanovic, Bruno Ramos; Kisch, Jenö; Albrektsson, Tomas; Wennerberg, Ann

    To assess the influence of several factors on the prevalence of dental implant failure, with special consideration of the placement of implants by different dental surgeons. This retrospective study is based on 2,670 patients who received 10,096 implants at one specialist clinic. Only the data of patients and implants treated by surgeons who had inserted a minimum of 200 implants at the clinic were included. Kaplan-Meier curves were stratified with respect to the individual surgeon. A generalized estimating equation (GEE) method was used to account for the fact that repeated observations (several implants) were placed in a single patient. The factors bone quantity, bone quality, implant location, implant surface, and implant system were analyzed with descriptive statistics separately for each individual surgeon. A total of 10 surgeons were eligible. The differences between the survival curves of each individual were statistically significant. The multivariate GEE model showed the following variables to be statistically significant: surgeon, bruxism, intake of antidepressants, location, implant length, and implant system. The surgeon with the highest absolute number of failures was also the one who inserted the most implants in sites of poor bone and used turned implants in most cases, whereas the surgeon with the lowest absolute number of failures used mainly modern implants. Separate survival analyses of turned and modern implants stratified for the individual surgeon showed statistically significant differences in cumulative survival. Different levels of failure incidence could be observed between the surgeons, occasionally reaching significant levels. Although a direct causal relationship could not be ascertained, the results of the present study suggest that the surgeons' technique, skills, and/or judgment may negatively influence implant survival rates.

  16. Modelling antagonic effect of lactic acid eacteria supernatants on some pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Augustus Caeser Franke Portella

    2009-11-01

    Full Text Available This work presents a statistical model of survival analysis for three pathogenic bacterial strains (Escherichia coli, Listeria monocytogenes and Staphylococcus aureus, when treated with neutralized and non-neutralized filtered supernatants broth from cultures of Lactobacillus acidhophilus, Lactobacillus rhamnosus and Lactobacillus sake. Survival analysis is a method employed to determine the period of time from an initial stage up to the occurrence of a particular event of interest, as death or a particular culture growth failure. In order to evaluate the potential efficacy of the ahead mentioned lactic acid bacteria when used as bioprotective starters in foods, experimental data were statistically treated and expressed by simple representative curves. Following the methodology of Cox and Kaplan-Meier, it was possible to make the selection of the best bioprotective lactic starter, as a predictive tool for evaluation of shelf life and prevention of eventual risks in fresh sausages and other similar food products.Este trabalho apresenta um modelo estatístico de análise de sobrevivência para três bactérias patogénicas (Escherichia coli, Listeria monocytogenes e Staphylococcus aureus, quando tratados com sobrenadantes filtrados neutralizado e não neutralizado provenientes de culturas de Lactobacillus acidhophilus, Lactobacillus rhamnosus e Lactobacillus sake. A Análise de sobrevivência é um método utilizado para determinar o período de tempo a partir de uma fase inicial até a ocorrência de um determinado evento de interesse, como a morte ou a inibição de uma particular cultura, a fim de avaliar a eficácia potencial das referidas bactérias lácticas quando usadas como bioproteção em alimentos. Os dados experimentais foram tratados estatisticamente, seguindo a metodologia de Cox e Kaplan-Meier e foi possível fazer a seleção dos melhores fermentos láticos bioprotectivos, como uma ferramenta para avaliação preditiva, vida de

  17. Relationship between LAPTM4B Gene Polymorphism and Prognosis of Patients following Tumor Resection for Colorectal and Esophageal Cancers

    Science.gov (United States)

    Xing, Xiaofang; Du, Hong; Zhou, Chunlian; Zhang, Qingyun; Hao, Chunyi; Wen, Xianzi; Ji, Jiafu

    2016-01-01

    Background Lysosome-associated transmembrane-4 beta (LAPTM4B) is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients. Method Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort), 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher’s exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model. Results LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts). LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045). Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS) in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively), but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively). Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR) = 0.432; 95% confidence interval (CI) = 0.243–0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638–1.804 and 0.998, HR = 1.000, 95% CI = 0.663–1.530, respectively). Conclusion These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might

  18. Relationship between LAPTM4B Gene Polymorphism and Prognosis of Patients following Tumor Resection for Colorectal and Esophageal Cancers.

    Directory of Open Access Journals (Sweden)

    Xiaojing Cheng

    Full Text Available Lysosome-associated transmembrane-4 beta (LAPTM4B is an oncogene that participates tumorgenesis in a variety of human solid tumors, and it has two alleles named as LAPTM4B*1 and *2. The present study aimed to identify the association of LAPTM4B genotype with clinicopathological features and prognosis in colorectal and esophageal cancer patients.Genotypes of LAPTM4B were determined by PCR in 167 colon cancer cases (72 patients in a discovery cohort and 95 patients in a testing cohort, 160 rectal cancer cases and 164 esophageal cancer cases. Association between the LAPTM4B gene polymorphism and clinicopathological variables was calculated by Chi-square test or Fisher's exact test. Patient survival differences were calculated by the Kaplan-Meier method. Prognostic factors were determined with Log-rank test and Cox regression model.LAPTM4B *1/1 was more frequently detected in colon cancer patients with lymph node metastasis and TNM III+IV stages in total colon cancer (discovery + testing cohorts. LAPTM4B *2/2 decreased in recurrent patients in total colon cancer patients (P = 0.045. Kaplan-Meier survival curves and Log-rank test showed that LAPTM4B*1 was correlated with shorter overall survival (OS in discovery and testing cohorts of colon cancer (P = 0.0254 and 0.0292, respectively, but not in rectal and esophageal cancer cases (P = 0.7669 and 0.9356, respectively. Multivariate analysis showed that LAPTM4B genotype was an independent prognostic factor for OS in total colon cancer [P = 0.004, hazard ratio (HR = 0.432; 95% confidence interval (CI = 0.243-0.768], but not in rectal and esophageal cancers (P = 0.791, HR = 1.073, 95% CI = 0.638-1.804 and 0.998, HR = 1.000, 95% CI = 0.663-1.530, respectively.These findings suggested that LAPTM4B allele *1 was a risk factor associated with poor prognosis in patients with colon cancer, but not in patients with rectal or esophageal cancers. LAPTM4B genotype status might be a useful prognostic indicator for

  19. Subintimal angioplasty for below-the-ankle arterial occlusion in diabetic patients with chronic critical limb ischemia

    International Nuclear Information System (INIS)

    Xu Ying; Zhu Yueqi; Zhao Jungong; Wang Jianbo; Tan Huaqiao; Cheng Yingsheng; Li Minghua; Wang Jue; Cheng Yongde

    2011-01-01

    Objective: To assess the feasibility and efficacy of subintimal angioplasty (SA) for the treatment of below-the-arterial occlusion in diabetic patients with chronic critical limb ischemia (CLI). Methods: SA was adopted for 57 diseased lower limbs in 37 diabetic patients with chronic CLI and occlusive disease of the dorsalis pedis artery (DPA) and/or planter artery (PA), who were not suitable candidates for intraluminal angioplasty or bypass surgery. Of the total 57 diseased lower limbs, tissue loss was seen in 31 (54.4%) and pain was reported in 51 (89.5%). SA was carried out to create continuous arterial flow to the foot for limb salvage. Both before and after the procedure the clinical symptoms, DPA or PA pulse volume scores and ankle-brachial indexes (ABI) were determined in all patients, the results were compared and statistically analysed. During the follow-up period, the healing of the wound, the salvage of the diseased limb and the re-stenosis occurrence of the target vessels were evaluated. Kaplan-Meier curves were constructed to evaluate limb salvage, survival rate and freedom from amputation. Results: A total of 66 below-the-ankle arterial lesions were detected in 57 affected limbs. Of the 66 lesions, SA was successfully performed in 55 (83.3%). Before SA the median pulse volume scores and ABIs were 0.33±0.54 and 0.31±0.19 respectively, which became 2.04±1.05 and 0.80±0.14 respectively after SA, the differences in both median pulse volume scores and ABI were statistically significant (P<0.01 for both). One patient (2.7%) died within 30 days after the procedure. Mild complications, such as bleeding, thrombosis or angiospasm etc. occurred in five patents (13.5%). Twelve months after SA. Kaplan-Meier analysis showed that the limb salvage rate was 94.6%, the freedom from amputation was 89.2% and the survival rate was 97.3%. Conclusion: SA of the dorsalis pedis artery and/or planter artery is an effective technique for lower limb salvage in diabetic

  20. Prognostic value of {sup 18}F-DOPA PET/CT at the time of recurrence in patients affected by neuroblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Piccardo, Arnoldo [Galliera Hospital, Nuclear Medicine Unit, Genoa (Italy); E.O. Ospedali Galliera, Department of Nuclear Medicine, Genoa (Italy); Puntoni, Matteo [Galliera Hospital, Clinical Trial Research Unit, Genoa (Italy); Lopci, Egesta; Fanti, Stefano [Sant' Orsola-Malpighi Hospital, Nuclear Medicine Unit, Bologna (Italy); Conte, Massimo; Sorrentino, Stefania; Garaventa, Alberto [G. Gaslini Children' s Hospital, Department of Hematology-Oncology, Genoa (Italy); Foppiani, Luca [Galliera Hospital, Internal Medicine, Genoa (Italy); Morana, Giovanni [G. Gaslini Children' s Hospital, Department of Pathology and Radiology, Genoa (Italy); Naseri, Mehrdad; Villavecchia, Giampiero [Galliera Hospital, Nuclear Medicine Unit, Genoa (Italy); Cistaro, Angelina [IRMET, PET Centre, Turin (Italy)

    2014-06-15

    The aim of this study was to investigate the relationship between {sup 123}I-metaiodobenzylguanidine (MIBG) scan semi-quantification and a new {sup 18}F-DOPA positron emission tomography (PET)/CT score in patients with suspected or documented neuroblastoma (NB) relapse and to assess the association between these two parameters and progression-free survival (PFS)/overall survival (OS). We analysed 24 NB patients who had undergone {sup 123}I-MIBG and {sup 18}F-DOPA PET/CT scans at the time of suspected relapse, after applying a proper scoring system for each scan. In time-to-event analyses, the score distributions were regarded as continuous and were categorized in tertiles and medians. We used Kaplan-Meier curves and Cox proportional hazard models for PFS and OS in order to estimate the independent prognostic impact of {sup 123}I-MIBG and {sup 18}F-DOPA PET/CT scans. The {sup 123}I-MIBG and {sup 18}F-DOPA scores were highly and positively correlated (Spearman's rho = 0.8, p < 0.001). Over a median follow-up of 14 months (range 6-82), 12 cases of disease progression and 6 deaths occurred. Multivariate Cox models showed a higher risk of disease progression [hazard ratio (HR) 17.0, 95 % confidence interval (CI) 2.7-109] in NB patients with {sup 123}I-MIBG score > 3 (3rd tertile) and an even higher risk (HR:37.2, 95 % CI 2.4-574) in those with {sup 18}F-DOPA whole-body metabolic burden (WBMB) >7.5 (median), after adjustment for all main clinical/pathological factors considered. Kaplan-Meier analyses showed a significant association with OS (log-rank p = 0.01 and p = 0.03 for {sup 123}I-MIBG and {sup 18}F-DOPA WBMB, respectively). Our results confirm the good agreement between {sup 18}F-DOPA PET/CT and {sup 123}I-MIBG scan in patients affected by NB relapse. In time-to-event analyses, {sup 123}I-MIBG scan and {sup 18}F-DOPA PET/CT scores were independently and significantly associated with disease progression. (orig.)

  1. Gamma-Ray Light Curves from Pulsar Magnetospheres with Finite Conductivity

    Science.gov (United States)

    Harding, A. K.; Kalapotharakos, C.; Kazanas, D.; Contopoulos, I.

    2012-01-01

    The Fermi Large Area Telescope has provided an unprecedented database for pulsar emission studies that includes gamma-ray light curves for over 100 pulsars. Modeling these light curves can reveal and constrain the geometry of the particle accelerator, as well as the pulsar magnetic field structure. We have constructed 3D magnetosphere models with finite conductivity, that bridge the extreme vacuum and force-free solutions used in previous light curves modeling. We are investigating the shapes of pulsar gamma-ray light curves using these dissipative solutions with two different approaches: (l) assuming geometric emission patterns of the slot gap and outer gap, and (2) using the parallel electric field provided by the resistive models to compute the trajectories and . emission of the radiating particles. The light curves using geometric emission patterns show a systematic increase in gamma-ray peak phase with increasing conductivity, introducing a new diagnostic of these solutions. The light curves using the model electric fields are very sensitive to the conductivity but do not resemble the observed Fermi light curves, suggesting that some screening of the parallel electric field, by pair cascades not included in the models, is necessary

  2. TELECOMMUNICATIONS INFRASTRUCTURE AND GDP /JIPP CURVE/

    Directory of Open Access Journals (Sweden)

    Mariana Kaneva

    2016-07-01

    Full Text Available The relationship between telecommunications infrastructure and economic activity is under discussion in many scientific papers. Most of the authors use for research and analysis the Jipp curve. A lot of doubts about the correctness of the Jipp curve appear in terms of applying econometric models. The aim of this study is a review of the Jipp curve, refining the possibility of its application in modern conditions. The methodology used in the study is based on dynamic econometric models, including tests for nonstationarity and tests for causality. The focus of this study is directed to methodological problems in measuring the local density types of telecommunication networks. This study offers a specific methodology for assessing the Jipp law, through VAR-approach and Granger causality tests. It is proved that mechanical substitution of momentary aggregated variables (such as the number of subscribers of a telecommunication network at the end of the year and periodically aggregated variables (such as GDP per capita in the Jipp�s curve is methodologically wrong. Researchers have to reconsider the relationship set in the Jipp�s curve by including additional variables that characterize the Telecommunications sector and the economic activity in a particular country within a specified time period. GDP per capita should not be regarded as a single factor for the local density of telecommunications infrastructure. New econometric models studying the relationship between the investments in telecommunications infrastructure and economic development may be not only linear regression models, but also other econometric models. New econometric models should be proposed after testing and validating with sound economic theory and econometric methodology.

  3. Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions

    International Nuclear Information System (INIS)

    Lakatos, K; Szamosi, Z; Bereczkei, S

    2012-01-01

    This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.

  4. Repair of Kaplan turbine shaft sealing based on evaluation of hydraulic conditions

    Science.gov (United States)

    Lakatos, K.; Szamosi, Z.; Bereczkei, S.

    2012-11-01

    This paper has been written to call attention to a potential danger what may occur in Kaplan turbine refurbishments. In Tiszalök hydropower plant, Hungary, the shaft sealing of the refurbished turbine was damaged. In searching for the reasons it was assumed that due to increased internal velocities in the turbine, the pressure at the hub clearance became lower than the atmospheric pressure, and therefore the sealing, which always operated satisfactorily before the refurbishment, had uncertain water supply, dry-running occurred, and after some time the sealing was burnt. First the flow conditions in the turbine and the pressure at the hub clearance were calculated by a one-dimensional flow model. Later this was refined by a two-dimensional approach. The above conclusion was also justified by the data acquisition system and by observing the operation of the small dewatering pump. When the turbine operated at a larger discharge than a certain limit value, then the dewatering pump remained standstill, indicating that no water passed through the shaft sealing. External water supply was then applied, and after this the turbine operated all right.

  5. Análisis de la recurrencia de cáncer de lengua considerando la presencia de eventos competitivos.

    Directory of Open Access Journals (Sweden)

    Raúl Vicente Mantilla Quispe

    2008-10-01

    Full Text Available Objetivo: Estimar la probabilidad de recurrencia en pacientes con cáncer de lengua según la edad, el estado ganglionar patológico y el tipo de tratamiento de los pacientes considerando la muerte antes de la recurrencia como evento competitivo. Material y métodos: Serie de casos retrospectiva de 290 pacientes con cáncer de lengua, con tratamiento en el INEN, entre los años 1977 y 2000. Se excluyeron del estudio 29 pacientes tratados solo con radioterapia. De los 261 pacientes, 31 solo tuvieron tratamiento del tumor primario. Resultados: La recurrencia fue 36,8%, la recurrencia local fue la más frecuente. La incidencia acumulada de la recurrencia a los 5 años, con el método de Kaplan Meier, se estimó en 44,7%, y según el análisis de riesgos competitivos en 42,4%. En el análisis univariado considerando riesgos competitivos, las incidencias acumuladas fueron: 56,8 y 38,9% en pacientes menores o iguales que 45 y mayores que 45 años respectivamente (p = 0,1556, 29,4% y 50,5% en pacientes con ganglios patológicos negativos y positivos, respectivamente (p = 0,0002, y 37,5% en pacientes con cirugía, y 47,4% con radioterapia (p = 0,03. En el análisis multivariado, con regresión de riesgos competitivos, no se encontró diferencia entre los tipos de tratamiento sobre la recurrencia (RR = 1,146, p = 0,620. Conclusiones: La pequeña diferencia entre los resultados del método Kaplan Meier y el que toma en cuenta eventos competitivos se debe a la baja tasa del evento competitivo, más aún por que se trata de muerte no relacionada con la enfermedad. La tasa de recurrencia fue similar al reportado en la literatura. Sólo se encontró diferencia significativa en la tasa de recurrencia en el grupo con compromiso ganglionar positivo. Aunque la comparación con los métodos estándar, Kaplan Meier y Regresión de Cox, muestra resultados similares se deben tener en cuenta los eventos competitivos. (Rev Med Hered 2008;19: 145-151.

  6. Comparison of wind turbines based on power curve analysis

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-02-01

    In the study measured power curves for 46 wind turbines were analyzed with the purpose to establish the basis for a consistent comparison of the efficiency of the wind turbines. Emphasis is on wind turbines above 500 kW rated power, with power curves measured after 1994 according to international recommendations. The available power curves fulfilling these requirements were smoothened according to a procedure developed for the purpose in such a way that the smoothened power curves are equally representative as the measured curves. The resulting smoothened power curves are presented in a standardized format for the subsequent processing. Using wind turbine data from the power curve documentation the analysis results in curves for specific energy production (kWh/M{sup 2}/yr) versus specific rotor load (kW/M{sup 2}) for a range of mean wind speeds. On this basis generalized curves for specific annual energy production versus specific rotor load are established for a number of generalized wind turbine concepts. The 46 smoothened standardized power curves presented in the report, the procedure developed to establish them, and the results of the analysis based on them aim at providers of measured power curves as well as users of them including manufacturers, advisors and decision makers. (au)

  7. Long-term outcomes in patients with early stage nodular lymphocyte-predominant Hodgkin's lymphoma treated with radiotherapy.

    Directory of Open Access Journals (Sweden)

    Abhishek A Solanki

    Full Text Available PURPOSE: Radiation therapy (RT is commonly used as definitive treatment for early-stage nodular lymphocyte-predominant Hodgkin's lymphoma (NLPHL. We evaluated the cause-specific survival (CSS, overall survival (OS, and second malignancy (SM rates in patients with early-stage NLPHL treated with RT. METHODS AND MATERIALS: Patients with stage I-II NLPHL between 1988 and 2009 who underwent RT were selected from the Surveillance, Epidemiology and End Results database. Univariate analysis (UVA for CSS and Os was performed using the Kaplan-Meier method and included age, gender, involved site, year of diagnosis, presence of B-symptoms, and extranodal involvement (ENI. Multivariable analysis (MVA was performed using Cox Proportional Hazards modeling and included the above clinical variables. SM were classified as RT-related or non-RT-related. Freedom from SM and freedom from RT-related SM were determined using the Kaplan-Meier method. RESULTS: The study cohort included 469 patients. Median age was 37 years. The most common involved sites were the head and neck (36%, axilla/arm (26%, and multiple lymph node regions (18%. Sixty-eight percent had stage I disease, 70% were male, 4% had ENI, and 7% had B-symptoms. Median follow-up was 6 years. Ten-year CSS and Os were 98% and 88%, respectively. On UVA, none of the covariates was associated with CSS. Increasing age (p<0.01 and female gender (p<0.01 were associated with worse Os. On MVA, older age (p<0.01, female gender (p=0.04, multiple regions of involvement (p=0.03, stage I disease (p=0.02, and presence of B-symptoms (p=0.02 were associated with worse Os. Ten-year freedom from SM and freedom from RT-related SM were 89% and 99%, respectively. CONCLUSIONS: This is the largest series to evaluate the outcomes of stage I-II NLPHL patients treated with RT and found that this patient population has an excellent long-term prognosis and a low rate of RT-related second malignancies.

  8. Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment

    Science.gov (United States)

    2010-08-01

    overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10

  9. Impact of Comorbidities on Tumor Necrosis Factor Inhibitor Therapy in Psoriatic Arthritis

    DEFF Research Database (Denmark)

    Ballegaard, Christine; Højgaard, Pil; Dreyer, Lene

    2017-01-01

    characteristics, disease activity and treatment response and persistence was obtained from the DANBIO registry. Information on comorbidities according to the Charlson Comorbidity Index (CCI) was obtained through linkage with the Danish National Patient Register. Kaplan-Meier plots and Cox proportional hazard...... compared with patients without comorbidities (hazard ratio 1.72, [1.26 to 2.37], p = 0.001). A smaller proportion of patients with a CCI score ≥ 2 achieved European League Against Rheumatism (EULAR) good response (p

  10. Measuring survival time: a probability-based approach useful in healthcare decision-making.

    Science.gov (United States)

    2011-01-01

    In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.

  11. High income, employment, postgraduate education, and marriage. A suicidal cocktail among psychiatric patients

    DEFF Research Database (Denmark)

    Agerbo, Esben

    2007-01-01

    longitudinal data on income, labor market affiliation, educational attainment, and marital and cohabitational status (96,369 patients, 256,619 admissions, and 2727 suicides). MAIN OUTCOME MEASURES: Suicide risks after hospital discharge were depicted using Kaplan-Meier product-limit methods. Hazard ratios (HRs...... is generally associated with low income, unemployment, educational underachievement, and singleness, but this study suggests that the opposite is true among psychiatric patients. However, loss of income, labor market status, and marriage increase the suicide risk....

  12. Improve T Cell Therapy in Neuroblastoma

    Science.gov (United States)

    2015-09-01

    bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and

  13. Experience in the management of ECMO therapy as a mortality risk factor.

    Science.gov (United States)

    Guilló Moreno, V; Gutiérrez Martínez, A; Romero Berrocal, A; Sánchez Castilla, M; García-Fernández, J

    2018-02-01

    The extracorporeal oxygenation membrane (ECMO) is a system that provides circulatory and respiratory assistance to patients in cardiac or respiratory failure refractory to conventional treatment. It is a therapy with numerous associated complications and high mortality. Multidisciplinary management and experienced teams increase survival. Our purpose is to evaluate and analyse the effect of the learning curve on mortality. Retrospective and observational study of 31 patients, from January 2012 to December 2015. Patients were separated into 2periods. These periods were divided by the establishment of an ECMO protocol. We compared the quantitative variables by performing the Mann-Whitney U test. For the categorical qualitative variables we performed the chi-square test or Fisher exact statistic as appropriate. The survival curve was computed using the Kaplan-Meier method, and the analysis of statistical significance using the Log-rank test. Data analysis was performed with the STATA programme 14. Survival curves show the tendency to lower mortality in the subsequent period (P=0.0601). The overall mortality rate in the initial period was higher than in the subsequent period (P=0.042). In another analysis, we compared the characteristics of the 2groups and concluded that they were homogeneous. The degree of experience is an independent factor for mortality. The application of a care protocol is fundamental to facilitate the management of ECMO therapy. Copyright © 2017 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Fractal properties of critical invariant curves

    International Nuclear Information System (INIS)

    Hunt, B.R.; Yorke, J.A.; Khanin, K.M.; Sinai, Y.G.

    1996-01-01

    We examine the dimension of the invariant measure for some singular circle homeomorphisms for a variety of rotation numbers, through both the thermodynamic formalism and numerical computation. The maps we consider include those induced by the action of the standard map on an invariant curve at the critical parameter value beyond which the curve is destroyed. Our results indicate that the dimension is universal for a given type of singularity and rotation number, and that among all rotation numbers, the golden mean produces the largest dimension

  15. Stenting for curved lesions using a novel curved balloon: Preliminary experimental study.

    Science.gov (United States)

    Tomita, Hideshi; Higaki, Takashi; Kobayashi, Toshiki; Fujii, Takanari; Fujimoto, Kazuto

    2015-08-01

    Stenting may be a compelling approach to dilating curved lesions in congenital heart diseases. However, balloon-expandable stents, which are commonly used for congenital heart diseases, are usually deployed in a straight orientation. In this study, we evaluated the effect of stenting with a novel curved balloon considered to provide better conformability to the curved-angled lesion. In vitro experiments: A Palmaz Genesis(®) stent (Johnson & Johnson, Cordis Co, Bridgewater, NJ, USA) mounted on the Goku(®) curve (Tokai Medical Co. Nagoya, Japan) was dilated in vitro to observe directly the behavior of the stent and balloon assembly during expansion. Animal experiment: A short Express(®) Vascular SD (Boston Scientific Co, Marlborough, MA, USA) stent and a long Express(®) Vascular LD stent (Boston Scientific) mounted on the curved balloon were deployed in the curved vessel of a pig to observe the effect of stenting in vivo. In vitro experiments: Although the stent was dilated in a curved fashion, stent and balloon assembly also rotated conjointly during expansion of its curved portion. In the primary stenting of the short stent, the stent was dilated with rotation of the curved portion. The excised stent conformed to the curved vessel. As the long stent could not be negotiated across the mid-portion with the balloon in expansion when it started curving, the mid-portion of the stent failed to expand fully. Furthermore, the balloon, which became entangled with the stent strut, could not be retrieved even after complete deflation. This novel curved balloon catheter might be used for implantation of the short stent in a curved lesion; however, it should not be used for primary stenting of the long stent. Post-dilation to conform the stent to the angled vessel would be safer than primary stenting irrespective of stent length. Copyright © 2014 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  16. Numerical Investigation of the Flow Structure in a Kaplan Draft Tube at Part Load

    Science.gov (United States)

    Maddahian, R.; Cervantes, M. J.; Sotoudeh, N.

    2016-11-01

    This research presents numerical simulation of the unsteady flow field inside the draft tube of a Kaplan turbine at part load condition. Due to curvature of streamlines, the ordinary two-equations turbulence models fail to predict the flow features. Therefore, a modification of the Shear Stress Transport (SST-SAS) model is utilized to approximate the turbulent stresses. A guide vane, complete runner and draft tube are considered to insure the real boundary conditions at the draft tube inlet. The outlet boundary is assumed to discharge into the atmosphere. The obtained pressure fluctuations inside the draft tube are in good agreement with available experimental data. In order to further investigate the RVR formation and its movement, the λ2 criterion, relating the position of the vortex core and strength to the second largest Eigen value of the velocity gradient tensor, is employed. The method used for vortex identification shows the flow structure and vortex motion inside the draft tube accurately.

  17. Prognostic impact of tumor MET expression among patients with stage IV gastric cancer

    DEFF Research Database (Denmark)

    Erichsen, Rune; Kelsh, Michael A; Oliner, Kelly S

    2016-01-01

    PURPOSE: We aimed to investigate the prevalence and prognostic impact of tumor mesenchymal epithelial transition factor (MET) expression in stage IV gastric cancers in a real-world clinical setting because existing evidence is sparse. METHODS: The study included archived cancer specimens from 103...... stage IV gastric cancer patients (2003-2010). We analyzed MET-protein expression by immunohistochemistry (MET-positive if ≥25% of tumor cells showed MET expression). We calculated overall survival using the Kaplan-Meier method and hazard ratios comparing mortality among MET-positive and MET.......6 months), corresponding to an adjusted hazard ratio of 2.2 (95% confidence interval, 1.3-3.7). CONCLUSIONS: Tumor MET expression is prevalent and has substantial prognostic impact in stage IV gastric cancer patients....

  18. Demographic, Clinical, and Prognostic Factors of Ovarian Clear Cell Adenocarcinomas According to Endometriosis Status

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard

    2017-01-01

    OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...... to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher...

  19. Curve Boxplot: Generalization of Boxplot for Ensembles of Curves.

    Science.gov (United States)

    Mirzargar, Mahsa; Whitaker, Ross T; Kirby, Robert M

    2014-12-01

    In simulation science, computational scientists often study the behavior of their simulations by repeated solutions with variations in parameters and/or boundary values or initial conditions. Through such simulation ensembles, one can try to understand or quantify the variability or uncertainty in a solution as a function of the various inputs or model assumptions. In response to a growing interest in simulation ensembles, the visualization community has developed a suite of methods for allowing users to observe and understand the properties of these ensembles in an efficient and effective manner. An important aspect of visualizing simulations is the analysis of derived features, often represented as points, surfaces, or curves. In this paper, we present a novel, nonparametric method for summarizing ensembles of 2D and 3D curves. We propose an extension of a method from descriptive statistics, data depth, to curves. We also demonstrate a set of rendering and visualization strategies for showing rank statistics of an ensemble of curves, which is a generalization of traditional whisker plots or boxplots to multidimensional curves. Results are presented for applications in neuroimaging, hurricane forecasting and fluid dynamics.

  20. JUMPING THE CURVE

    Directory of Open Access Journals (Sweden)

    René Pellissier

    2012-01-01

    Full Text Available This paper explores the notion ofjump ing the curve,following from Handy 's S-curve onto a new curve with new rules policies and procedures. . It claims that the curve does not generally lie in wait but has to be invented by leadership. The focus of this paper is the identification (mathematically and inferentially ofthat point in time, known as the cusp in catastrophe theory, when it is time to change - pro-actively, pre-actively or reactively. These three scenarios are addressed separately and discussed in terms ofthe relevance ofeach.

  1. Quaternion orders, quadratic forms, and Shimura curves

    CERN Document Server

    Alsina, Montserrat

    2004-01-01

    Shimura curves are a far-reaching generalization of the classical modular curves. They lie at the crossroads of many areas, including complex analysis, hyperbolic geometry, algebraic geometry, algebra, and arithmetic. The text provides an introduction to the subject from a theoretic and algorithmic perspective. The main topics covered in it are Shimura curves defined over the rational number field, the construction of their fundamental domains, and the determination of their complex multiplication points. The study of complex multiplication points in Shimura curves leads to the study of families of binary quadratic forms with algebraic coefficients and to their classification by arithmetic Fuchsian groups. In this regard, the authors develop a theory full of new possibilities which parallels Gauss' theory on the classification of binary quadratic forms with integral coefficients by the action of the modular group. Each topic covered in the book begins with a theoretical discussion followed by carefully worked...

  2. Intraoperative length and tension curves of human eye muscles. Including stiffness in passive horizontal eye movement in awake volunteers

    NARCIS (Netherlands)

    H.J. Simonsz (Huib); G.H. Kolling (Gerold); H. Kaufmann (Herbert); B. van Dijk (Bob)

    1986-01-01

    textabstractIntraoperative continuous-registration length and tension curves of attached and detached eye muscles were made in 18 strabismic patients under general anesthesia. For relaxed eye muscles, we found an exponential relation between length and tension. An increased stiffness was quantified

  3. Linear transform of the multi-target survival curve

    Energy Technology Data Exchange (ETDEWEB)

    Watson, J V [Cambridge Univ. (UK). Dept. of Clinical Oncology and Radiotherapeutics

    1978-07-01

    A completely linear transform of the multi-target survival curve is presented. This enables all data, including those on the shoulder region of the curve, to be analysed. The necessity to make a subjective assessment about which data points to exclude for conventional methods of analysis is, therefore, removed. The analysis has also been adapted to include a 'Pike-Alper' method of assessing dose modification factors. For the data cited this predicts compatibility with the hypothesis of a true oxygen 'dose-modification' whereas the conventional Pike-Alper analysis does not.

  4. Bragg Curve, Biological Bragg Curve and Biological Issues in Space Radiation Protection with Shielding

    Science.gov (United States)

    Honglu, Wu; Cucinotta, F.A.; Durante, M.; Lin, Z.; Rusek, A.

    2006-01-01

    The space environment consists of a varying field of radiation particles including high-energy ions, with spacecraft shielding material providing the major protection to astronauts from harmful exposure. Unlike low-LET gamma or X-rays, the presence of shielding does not always reduce the radiation risks for energetic charged particle exposure. Since the dose delivered by the charged particle increases sharply as the particle approaches the end of its range, a position known as the Bragg peak, the Bragg curve does not necessarily represent the biological damage along the particle traversal since biological effects are influenced by the track structure of both primary and secondary particles. Therefore, the biological Bragg curve is dependent on the energy and the type of the primary particle, and may vary for different biological endpoints. To achieve a Bragg curve distribution, we exposed cells to energetic heavy ions with the beam geometry parallel to a monolayer of fibroblasts. Qualitative analyses of gamma-H2AX fluorescence, a known marker of DSBs, indicated increased clustering of DNA damage before the Bragg peak, enhanced homogenous distribution at the peak, and provided visual evidence of high linear energy transfer (LET) particle traversal of cells beyond the Bragg peak. A quantitative biological response curve generated for micronuclei (MN) induction across the Bragg curve did not reveal an increased yield of MN at the location of the Bragg peak. However, the ratio of mono-to bi-nucleated cells, which indicates inhibition in cell progression, increased at the Bragg peak location. These results, along with other biological concerns, show that space radiation protection with shielding can be a complicated issue.

  5. Dual Smarandache Curves of a Timelike Curve lying on Unit dual Lorentzian Sphere

    OpenAIRE

    Kahraman, Tanju; Hüseyin Ugurlu, Hasan

    2016-01-01

    In this paper, we give Darboux approximation for dual Smarandache curves of time like curve on unit dual Lorentzian sphere. Firstly, we define the four types of dual Smarandache curves of a timelike curve lying on dual Lorentzian sphere.

  6. Prognostic significance of hemoglobin level in patients with congestive heart failure and normal ejection fraction.

    Science.gov (United States)

    Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G

    2006-10-01

    Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.

  7. Stent placement with the monorail technique for treatment of mesenteric artery stenosis.

    Science.gov (United States)

    Schaefer, Philipp J; Schaefer, Fritz K W; Hinrichsen, Holger; Jahnke, Thomas; Charalambous, Nikolas; Heller, Martin; Mueller-Huelsbeck, Stefan

    2006-04-01

    To analyze the immediate and midterm success of stenting of mesenteric arteries by a monorail technique in patients with chronic mesenteric ischemia. In this prospective case series, 19 patients (11 male, 8 female; mean age, 62.9 +/- 10.4 y; range, 36-82 y) with 23 symptomatic stenoses of mesenteric arteries were treated with stent placement by a monorail technique in a radiologic intervention center over a period of 4.5 years. Clinical examinations and duplex sonography were used to evaluate the stents' patency and clinical success. Kaplan-Meier graphs were calculated to analyze the patency and freedom-from-symptom rate. Initial technical success rate was 22/23 (96%). Mean follow-up was 17 months (range, 1-58 mo). Primary patency and primary clinical success rates were 82% and 78%, respectively. According to Kaplan-Meier tables, the patency rates were 96%, 87%, 76%, and 61% at 0, 1, 15, and 24 months, respectively, and the freedom-from-symptom rates were 95%, 90%, 72%, and 54% at 0, 1, 24, and 30 months, respectively. No peri-interventional complications occurred. Two patients died of cardiac failure in the hospital within 30 days after intervention; deaths were not related to the intervention. Stent placement by a monorail technique in mesenteric arteries is an effective and safe treatment for symptomatic stenoses in patients with chronic mesenteric ischemia after a mean follow-up of 17 months.

  8. Nonlinear Dynamic of Curved Railway Tracks in Three-Dimensional Space

    Science.gov (United States)

    Liu, X.; Ngamkhanong, C.; Kaewunruen, S.

    2017-12-01

    On curved tracks, high-pitch noise pollution can often be a considerable concern of rail asset owners, commuters, and people living or working along the rail corridor. Inevitably, wheel/rail interface can cause a traveling source of sound and vibration, which spread over a long distance of rail network. The sound and vibration can be in various forms and spectra. The undesirable sound and vibration on curves is often called ‘noise,’ includes flanging and squealing noises. This paper focuses on the squeal noise phenomena on curved tracks located in urban environments. It highlights the effect of curve radii on lateral track dynamics. It is important to note that rail freight curve noises, especially for curve squeals, can be observed almost everywhere and every type of track structures. The most pressing noise appears at sharper curved tracks where excessive lateral wheel/rail dynamics resonate with falling friction states, generating a tonal noise problem, so-call ‘squeal’. Many researchers have carried out measurements and simulations to understand the actual root causes of the squeal noise. Most researchers believe that wheel resonance over falling friction is the main cause, whilst a few others think that dynamic mode coupling of wheel and rail may also cause the squeal. Therefore, this paper is devoted to systems thinking the approach and dynamic assessment in resolving railway curve noise problems. The simulations of railway tracks with different curve radii will be carried out to develop state-of-the-art understanding into lateral track dynamics, including rail dynamics, cant dynamics, gauge dynamics and overall track responses.

  9. LCC: Light Curves Classifier

    Science.gov (United States)

    Vo, Martin

    2017-08-01

    Light Curves Classifier uses data mining and machine learning to obtain and classify desired objects. This task can be accomplished by attributes of light curves or any time series, including shapes, histograms, or variograms, or by other available information about the inspected objects, such as color indices, temperatures, and abundances. After specifying features which describe the objects to be searched, the software trains on a given training sample, and can then be used for unsupervised clustering for visualizing the natural separation of the sample. The package can be also used for automatic tuning parameters of used methods (for example, number of hidden neurons or binning ratio). Trained classifiers can be used for filtering outputs from astronomical databases or data stored locally. The Light Curve Classifier can also be used for simple downloading of light curves and all available information of queried stars. It natively can connect to OgleII, OgleIII, ASAS, CoRoT, Kepler, Catalina and MACHO, and new connectors or descriptors can be implemented. In addition to direct usage of the package and command line UI, the program can be used through a web interface. Users can create jobs for ”training” methods on given objects, querying databases and filtering outputs by trained filters. Preimplemented descriptors, classifier and connectors can be picked by simple clicks and their parameters can be tuned by giving ranges of these values. All combinations are then calculated and the best one is used for creating the filter. Natural separation of the data can be visualized by unsupervised clustering.

  10. ECM using Edwards curves

    DEFF Research Database (Denmark)

    Bernstein, Daniel J.; Birkner, Peter; Lange, Tanja

    2013-01-01

    -arithmetic level are as follows: (1) use Edwards curves instead of Montgomery curves; (2) use extended Edwards coordinates; (3) use signed-sliding-window addition-subtraction chains; (4) batch primes to increase the window size; (5) choose curves with small parameters and base points; (6) choose curves with large...

  11. Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response : Patrick Meier, 2015, CRC Press (Boca Raton, FL, 978-1-4822-4839-5, 259 pp.).

    Science.gov (United States)

    Dave, Anushree

    2017-12-01

    This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.

  12. Evaluation of Hydraulic Loads on the Runner Blades of a Kaplan Turbine using CFD Simulation and Model Test

    Directory of Open Access Journals (Sweden)

    Zoltan-Iosif Korka

    2016-10-01

    Full Text Available CFD (Computational Fluid Dynamic is today a standard procedure for analyzing and simulating the flow through several hydraulic machines. In this process, the fluid flow domain is divided into small volumes where the governing equations are converted into algebraic ones, which are numerically solved. Computational results strongly depend on the applied mathematical model and on the numerical methods used for converting the governing equations into the algebraic ones. The goal of the paper is to evaluate, by numerical simulation, the hydraulic loads (forces and torques on the runner blades of an existent Kaplan turbine and to compare them with the experimental results obtained from model test.

  13. A population-based study of survival and discharge status for survivors after head injury

    DEFF Research Database (Denmark)

    Engberg, Aase Worså; Teasdale, T W

    2004-01-01

    and cerebral lesion was described quantitatively through Kaplan-Meier survival distributions. Besides, patterns of severity, neurophysical and mental sequelae among survivors 5, 10 and 15 years post-injury were described. It was shown by examples how the study has been useful already for the planning......-Meier survival functions were calculated for these two categories. Hospital records for a random sample of 389 survivors in 1997 after cranial fracture, acute brain lesion or chronical subdural haematoma, which occurred in 1982, 1987 and 1992 in patients aged 15 years or more at injury, were reviewed. Survivors...... the decreasing incidence with time, the point prevalence of survivors in 1997 after brain lesions occurring in 1982, 1987 or 1992 was nearly the same, averaging 8.4 per 100 000 of the population above age 14. Half of them were severe, as defined by initial Glasgow Coma Score

  14. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    OpenAIRE

    Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

    2009-01-01

    Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...

  15. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  16. Syncytin immunoreactivity in colorectal cancer

    DEFF Research Database (Denmark)

    Larsen, Julie Mou; Christensen, Ib Jarle; Nielsen, Hans Jørgen

    2009-01-01

    monoclonal syncytin antibody we have assessed syncytin expression in a retrospective series of 140 colorectal cancer patients. Variable degrees of syncytin expression were detected in both colonic and rectal tumors and the prognostic impact of such expression was analysed with the Kaplan-Meier method...... and the Cox proportional hazard model. Interestingly, increased syncytin expression was associated with decreased overall survival in rectal but not in colonic cancer patients. Thus, the prognostic impact of syncytin expression appears to vary with the tumor type....

  17. [Short-term curative effects of Tantalum rod treatment in early avascular necrosis].

    Science.gov (United States)

    Ye, Fu-Sheng; Ni, Zhe-Ji; Chu, Xiao-Bing; He, Bang-Jian; Li, Ju; Tong, Pei-Jian

    2013-08-01

    To explore the recent clinical curative effect of Tantalum rod in treating the early avascular necrosis. From January 2008 to November 2008, the 25 patients (39 hips) with early avascular necrosis accepted tantalum rod placement and included 9 males (11 hips) and 16 females (28 hips) with an average age of 37 years old ranging from 18 to 74 years old. Four patients (6 hips) caused by Alcoholic, 6 patients (8 hips) by hormone, 2 cases (2 hips) by traumatic, 13 cases (23 hips) by idiopathic. Steinberg preoperative stage involved 7 hips in period I, 24 hips in period II, 8 hips in period III. Curative effect analysis included preoperative and postoperative Harris score, radiographic changes and hip replacement for follow-up to accept the end of the femoral head survival rate. All patients were followed up for 6 to 47 months (averaged 37.4 months). All 12 hips imaging appeard progress,including tantalum rod exit in 1 hip, hip hemiarthroplasty collapse in 3 hips, the area increased to avascular necrosis in 8 hips. Six hips accepted total hip replacement, including imaging progress in 5 hips (41.7%, 5/12), no imaging progress in 1 hip (3.7%,1/27). All hips' Kaplan-Meier survival curves showed 6-month survival rate was (97.4 +/- 2.5)% after tantalum stick insertion, 1-year survival rate was (94.7 +/- 3.6), and 2-year survival rate was (88.6 +/- 5.4)%, 3-year survival rate was (72.5 +/- 11.2). It is effective for treatment of avascular necrosis of femoral head in Steinberg I and II by Tantalum rod, and it can effectively relieve femoral head replacement time.

  18. Regional Marginal Abatement Cost Curves for NOx

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data underlying the figures included in the manuscript "Marginal abatement cost curve for NOx incorporating controls, renewable electricity, energy efficiency and...

  19. Peak Serum AST Is a Better Predictor of Acute Liver Graft Injury after Liver Transplantation When Adjusted for Donor/Recipient BSA Size Mismatch (ASTi

    Directory of Open Access Journals (Sweden)

    Kyota Fukazawa

    2014-01-01

    Full Text Available Background. Despite the marked advances in the perioperative management of the liver transplant recipient, an assessment of clinically significant graft injury following preservation and reperfusion remains difficult. In this study, we hypothesized that size-adjusted AST could better approximate real AST values and consequently provide a better reflection of the extent of graft damage, with better sensitivity and specificity than current criteria. Methods. We reviewed data on 930 orthotopic liver transplant recipients. Size-adjusted AST (ASTi was calculated by dividing peak AST by our previously reported index for donor-recipient size mismatch, the BSAi. The predictive value of ASTi of primary nonfunction (PNF and graft survival was assessed by receiver operating characteristic curve, logistic regression, Kaplan-Meier survival, and Cox proportional hazard model. Results. Size-adjusted peak AST (ASTi was significantly associated with subsequent occurrence of PNF and graft failure. In our study cohort, the prediction of PNF by the combination of ASTi and PT-INR had a higher sensitivity and specificity compared to current UNOS criteria. Conclusions. We conclude that size-adjusted AST (ASTi is a simple, reproducible, and sensitive marker of clinically significant graft damage.

  20. Intraoperative blood loss independently predicts survival and recurrence after resection of colorectal cancer liver metastasis.

    Directory of Open Access Journals (Sweden)

    Wu Jiang

    Full Text Available BACKGROUND: Although numerous prognostic factors have been reported for colorectal cancer liver metastasis (CRLM, few studies have reported intraoperative blood loss (IBL effects on clinical outcome after CRLM resection. METHODS: We retrospectively evaluated the clinical and histopathological characteristics of 139 patients who underwent liver resection for CRLM. The IBL cutoff volume was calculated using receiver operating characteristic curves. Overall survival (OS and recurrence free survival (RFS were assessed using the Kaplan-Meier and Cox regression methods. RESULTS: All patients underwent curative resection. The median follow up period was 25.0 months (range, 2.1-88.8. Body mass index (BMI and CRLM number and tumor size were associated with increased IBL. BMI (P=0.01; 95% CI = 1.3-8.5 and IBL (P500mL were 71%, 33%, and 0%, respectively (P<0.01. RFS of patients within three IBL volumes at the end of the first year were 67%, 38%, and 18%, respectively (P<0.01. CONCLUSIONS: IBL during CRLM resection is an independent predictor of long term survival and tumor recurrence, and its prognostic value was confirmed by a dose-response relationship.

  1. Atrial Fibrillation and Coronary Artery Disease as Risk Factors of Retinal Artery Occlusion: A Nationwide Population-Based Study

    Directory of Open Access Journals (Sweden)

    Ju-Chuan Yen

    2015-01-01

    Full Text Available We use Taiwanese national health insurance research database (NHIRD to investigate whether thrombolism (carotid artery disease (CAD as a surrogate or embolism (atrial fibrillation (AF as a surrogate plays roles in later retinal artery occlusion (RAO development and examine their relative weights. The relative risks of RAO between AF and CAD patients and controls were compared by estimating the crude hazard ratio with logistic regression. Kaplan-Meier analysis was used to calculate the cumulative incidence rates of developing RAO, and a log-rank test was used to analyze the differences between the survival curves. Separate Cox proportional hazard regressions were done to compute the RAO-free rate after adjusting for possible confounding factors such as age and sex. The crude hazard ratios were 7.98 for the AF group and 5.27 for the CAD group, and the adjusted hazard ratios were 8.32 and 5.34 for the AF and CAD groups, respectively. The observation time with RAO-free was shorter for AF compared with CAD group (1490 versus 1819 days. AF and CAD were both risk factors for RAO with different hazard ratios. To tackle both AF and CAD is crucial for curbing RAO.

  2. The Impact of a Junior Faculty Fellowship Award on Academic Advancement and Retention.

    Science.gov (United States)

    Connelly, Maureen T; Sullivan, Amy M; Chinchilla, Manuel; Dale, Margaret L; Emans, S Jean; Nadelson, Carol Cooperman; Notman, Malkah Tolpin; Tarbell, Nancy J; Zigler, Corwin M; Shore, Eleanor G

    2017-08-01

    Academic faculty experience barriers to career development and promotion. In 1996, Harvard Medical School (HMS) initiated an intramural junior faculty fellowship to address these obstacles. The authors sought to understand whether receiving a fellowship was associated with more rapid academic promotion and retention. Junior faculty fellowship recipients and all other instructor and assistant professors at HMS between 1996 and 2011 were identified. Using propensity score modeling, the authors created a matched comparison group for the fellowship recipients based on educational background, training, academic rank, department, hospital affiliation, and demographics. Time to promotion and time to leaving were assessed by Kaplan-Meier curves. A total of 622 junior faculty received fellowships. Faculty who received fellowships while instructors (n = 480) had shorter times to promotion to assistant professor (P Women instructors advanced more quickly than matched controls, while male instructors' rates of promotions did not differ. Fellowships to support junior faculty were associated with shorter times to promotion for instructors and more sustained faculty retention for both instructors and assistant professors. This suggests that relatively small amounts of funding early in faculty careers can play a critical role in supporting academic advancement and retention.

  3. Prognostic significance of epidermal growth factor receptor (EGFR) over expression in urothelial carcinoma of urinary bladder.

    Science.gov (United States)

    Hashmi, Atif Ali; Hussain, Zubaida Fida; Irfan, Muhammad; Khan, Erum Yousuf; Faridi, Naveen; Naqvi, Hanna; Khan, Amir; Edhi, Muhammad Muzzammil

    2018-06-07

    Epidermal growth factor receptor (EGFR) has been shown to have abnormal expression in many human cancers and is considered as a marker of poor prognosis. Frequency of over expression in bladder cancer has not been studied in our population; therefore we aimed to evaluate the frequency and prognostic significance of EGFR immunohistochemical expression in locoregional population. We performed EGFR immunohistochemistry on 126 cases of bladder cancer and association of EGFR expression with tumor grade, lamina propria invasion, deep muscle invasion and recurrence of disease was evaluated. High EGFR expression was noted in 26.2% (33 cases), 15.1% (19 cases) and 58.7% (74 cases) revealed low and no EGFR expression respectively. Significant association of EGFR expression was noted with tumor grade, lamina propria invasion, deep muscle invasion and recurrence status while no significant association was seen with age, gender and overall survival. Kaplan- Meier curves revealed significant association of EGFR expression with recurrence while no significant association was seen with overall survival. Significant association of EGFR overexpression with tumor grade, muscularis propria invasion and recurrence signifies its prognostic value; therefore EGFR can be used as a prognostic biomarker in Urothelial bladder carcinoma.

  4. The impact of socioeconomic status on the association between biomedical and psychosocial well-being and all-cause mortality in older Spanish adults.

    Science.gov (United States)

    Doménech-Abella, Joan; Mundó, Jordi; Moneta, Maria Victoria; Perales, Jaime; Ayuso-Mateos, José Luis; Miret, Marta; Haro, Josep Maria; Olaya, Beatriz

    2018-03-01

    The aim of this paper was to analyze the effect of biomedical and psychosocial well-being, based on distinct successful aging models (SA), on time to mortality, and determine whether this effect was modified by socioeconomic status (SES) in a nationally representative sample of older Spanish adults. Data were taken from a 3-year follow-up study with 2783 participants aged 50 or over. Vital status was ascertained using national registers or asking participants' relatives. Kaplan-Meier curves were used to estimate the time to death by SES, and levels of biomedical and psychosocial SA. Cox proportional hazard regression models were conducted to explore interactions between SES and SA models while adjusting for gender, age, and marital status. Lower levels of SES and biomedical and psychosocial SA were associated with low probability of survival. Only the interaction between SES and biomedical SA was significant. Biomedical SA impacted on mortality rates among individuals with low SES but not on those with medium or high SES, whereas psychosocial SA affected mortality regardless of SES. Promoting equal access to health care system and improved psychosocial well-being could be a protective factor against premature mortality in older Spanish adults with low SES.

  5. Greater Activity in the Frontal Cortex on Left Curves: A Vector-Based fNIRS Study of Left and Right Curve Driving.

    Directory of Open Access Journals (Sweden)

    Noriyuki Oka

    Full Text Available In the brain, the mechanisms of attention to the left and the right are known to be different. It is possible that brain activity when driving also differs with different horizontal road alignments (left or right curves, but little is known about this. We found driver brain activity to be different when driving on left and right curves, in an experiment using a large-scale driving simulator and functional near-infrared spectroscopy (fNIRS.The participants were fifteen healthy adults. We created a course simulating an expressway, comprising straight line driving and gentle left and right curves, and monitored the participants under driving conditions, in which they drove at a constant speed of 100 km/h, and under non-driving conditions, in which they simply watched the screen (visual task. Changes in hemoglobin concentrations were monitored at 48 channels including the prefrontal cortex, the premotor cortex, the primary motor cortex and the parietal cortex. From orthogonal vectors of changes in deoxyhemoglobin and changes in oxyhemoglobin, we calculated changes in cerebral oxygen exchange, reflecting neural activity, and statistically compared the resulting values from the right and left curve sections.Under driving conditions, there were no sites where cerebral oxygen exchange increased significantly more during right curves than during left curves (p > 0.05, but cerebral oxygen exchange increased significantly more during left curves (p < 0.05 in the right premotor cortex, the right frontal eye field and the bilateral prefrontal cortex. Under non-driving conditions, increases were significantly greater during left curves (p < 0.05 only in the right frontal eye field.Left curve driving was thus found to require more brain activity at multiple sites, suggesting that left curve driving may require more visual attention than right curve driving. The right frontal eye field was activated under both driving and non-driving conditions.

  6. Greater Activity in the Frontal Cortex on Left Curves: A Vector-Based fNIRS Study of Left and Right Curve Driving

    Science.gov (United States)

    Oka, Noriyuki; Yoshino, Kayoko; Yamamoto, Kouji; Takahashi, Hideki; Li, Shuguang; Sugimachi, Toshiyuki; Nakano, Kimihiko; Suda, Yoshihiro; Kato, Toshinori

    2015-01-01

    Objectives In the brain, the mechanisms of attention to the left and the right are known to be different. It is possible that brain activity when driving also differs with different horizontal road alignments (left or right curves), but little is known about this. We found driver brain activity to be different when driving on left and right curves, in an experiment using a large-scale driving simulator and functional near-infrared spectroscopy (fNIRS). Research Design and Methods The participants were fifteen healthy adults. We created a course simulating an expressway, comprising straight line driving and gentle left and right curves, and monitored the participants under driving conditions, in which they drove at a constant speed of 100 km/h, and under non-driving conditions, in which they simply watched the screen (visual task). Changes in hemoglobin concentrations were monitored at 48 channels including the prefrontal cortex, the premotor cortex, the primary motor cortex and the parietal cortex. From orthogonal vectors of changes in deoxyhemoglobin and changes in oxyhemoglobin, we calculated changes in cerebral oxygen exchange, reflecting neural activity, and statistically compared the resulting values from the right and left curve sections. Results Under driving conditions, there were no sites where cerebral oxygen exchange increased significantly more during right curves than during left curves (p > 0.05), but cerebral oxygen exchange increased significantly more during left curves (p right premotor cortex, the right frontal eye field and the bilateral prefrontal cortex. Under non-driving conditions, increases were significantly greater during left curves (p right frontal eye field. Conclusions Left curve driving was thus found to require more brain activity at multiple sites, suggesting that left curve driving may require more visual attention than right curve driving. The right frontal eye field was activated under both driving and non-driving conditions

  7. Perioperative Blood Transfusion as a Significant Predictor of Biochemical Recurrence and Survival after Radical Prostatectomy in Patients with Prostate Cancer.

    Directory of Open Access Journals (Sweden)

    Jung Kwon Kim

    Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.

  8. Intraoperative Radiation Therapy for Locally Advanced and Recurrent Soft-Tissue Sarcomas in Adults

    International Nuclear Information System (INIS)

    Tran, Phuoc T.; Hara, Wendy; Su Zheng; Lin, H. Jill; Bendapudi, Pavan K.; Norton, Jeffrey; Teng, Nelson; King, Christopher R.; Kapp, Daniel S.

    2008-01-01

    Purpose: To analyze the outcomes of and identify prognostic factors for patients treated with surgery and intraoperative radiotherapy (IORT) for locally advanced and recurrent soft-tissue sarcoma in adults from a single institution. Methods and Materials: We retrospectively reviewed 50 consecutive patients treated with IORT to 62 sites of disease. Primary sites included retroperitoneum-pelvis (78%), extremity (8%), and other (14%). Seventy percent of patients had recurrent disease failing prior surgery (70%) and/or radiation (32%). Mean disease-free interval (DFI) before IORT was 1.9 years (range, 2 weeks-5.4 years). The IORT was delivered with orthovoltage X-rays using individually sized beveled cone applicators. Clinical characteristics were as follows: mean tumor size, 10 cm (range, 1-25 cm); high-grade histologic subtype (72%); and mean dose, 1,159 cGy (range, 600-1,600 cGy). Postoperative radiation or chemotherapy was administered to 37% of IORT Sites and 32% of patients, respectively. Outcomes measured were infield control (IFC), locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Mean and median follow-up of alive patients were 59 and 35 months, respectively. Results: Kaplan-Meier 5-year IFC, LRC, DMFS, and DSS probabilities for the entire group were 55%, 26%, 51%, and 25%, respectively. Prognostic factors found to be significant (p < 0.05) on multivariate analysis were prior DFI and tumor size for LRC, extremity location and leiomyosarcoma histologic subtype for DMFS, and prior DFI for DSS. Our cohort had five Grade 3/4 complications associated with treatment or a 5-year Kaplan-Meier Grade 3/4 complication-free survival rate of 85%. Conclusions: IORT after tumor reductive surgery is well tolerated and seems to confer IFC in carefully selected patients

  9. Satisfactory Results of the Exeter Revision Femoral Stem Used for Primary Total Hip Arthroplasty.

    Science.gov (United States)

    Desy, Nicholas M; Johnson, Joshua D; Sierra, Rafael J

    2017-02-01

    The Exeter cemented femoral stem has demonstrated excellent clinical and radiographic outcomes as well as long-term survivorship free from aseptic loosening. A shorter revision stem (125 mm) with a 44 offset became available for the purpose of cement-in-cement revision situations. In certain cases, this shorter revision stem may be used for various primary total hip arthroplasties (THAs) where the standard length stem would require distally reaming the femoral canal. We sought to report on the early to midterm results of this specific stem when used for primary THA regarding (1) clinical and radiographic outcomes, (2) complications, and (3) survivorship. Twenty-nine patients (33 hips) underwent a hybrid THA using the smaller revision Exeter cemented femoral stem. Twenty-five patients (28 hips) had at least 2 years of follow-up and were assessed for clinical and radiographic outcomes. All 33 hips were included in the analysis of complications and survivorship. The Kaplan-Meier survivorship was performed using revision for all causes and for aseptic loosening as the end points. The average clinical follow-up was 4 years (range, 2-7). Harris Hip Scores improved from a mean preoperative value of 56 (range, 23-96) to 90 (range, 51-100) at the latest follow-up. All patients demonstrated superior cement mantles with no signs of loosening. One patient suffered a B2 periprosthetic fracture and 1 patient experienced 2 episodes of instability. The 5-year Kaplan-Meier survivorship was 96.7% for all causes of revision and was 100% using aseptic loosening as the end point. The shorter Exeter revision cemented femoral stem has favorable early to midterm clinical and radiographic outcomes when used for primary THA with a low complication rate and is a viable option in patients with narrow femoral canals where uncemented stem fixation is not desired. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Exercise Capacity and the Obesity Paradox in Heart Failure: The FIT (Henry Ford Exercise Testing) Project.

    Science.gov (United States)

    McAuley, Paul A; Keteyian, Steven J; Brawner, Clinton A; Dardari, Zeina A; Al Rifai, Mahmoud; Ehrman, Jonathan K; Al-Mallah, Mouaz H; Whelton, Seamus P; Blaha, Michael J

    2018-05-03

    To assess the influence of exercise capacity and body mass index (BMI) on 10-year mortality in patients with heart failure (HF) and to synthesize these results with those of previous studies. This large biracial sample included 774 men and women (mean age, 60±13 years; 372 [48%] black) with a baseline diagnosis of HF from the Henry Ford Exercise Testing (FIT) Project. All patients completed a symptom-limited maximal treadmill stress test from January 1, 1991, through May 31, 2009. Patients were grouped by World Health Organization BMI categories for Kaplan-Meier survival analyses and stratified by exercise capacity (<4 and ≥4 metabolic equivalents [METs] of task). Associations of BMI and exercise capacity with all-cause mortality were assessed using multivariable-adjusted Cox proportional hazards models. During a mean follow-up of 10.1±4.6 years, 380 patients (49%) died. Kaplan-Meier survival plots revealed a significant positive association between BMI category and survival for exercise capacity less than 4 METs (log-rank, P=.05), but not greater than or equal to 4 METs (P=.76). In the multivariable-adjusted models, exercise capacity (per 1 MET) was inversely associated, but BMI was not associated, with all-cause mortality (hazard ratio, 0.89; 95% CI, 0.85-0.94; P<.001 and hazard ratio, 0.99; 95% CI, 0.97-1.01; P=.16, respectively). Maximal exercise capacity modified the relationship between BMI and long-term survival in patients with HF, upholding the presence of an exercise capacity-obesity paradox dichotomy as observed over the short-term in previous studies. Copyright © 2018 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  11. Long-Term Efficacy, Tolerability, and Renal Safety of Atazanavir/Ritonavir-based Antiretroviral Therapy in a Cohort of Treatment-Naïve Patients with HIV-1 Infection: the REMAIN Study.

    Science.gov (United States)

    Teófilo, Eugénio; Rocha-Pereira, Nuno; Kuhlmann, Birger; Antela, Antonio; Knechten, Heribert; Santos, Jesús; Jiménez-Expósito, Maria Jesús

    2016-02-01

    Boosted protease inhibitors (PIs), including ritonavir-boosted atazanavir (ATV/r), are a recommended option for the initial treatment of HIV-1 infection based upon clinical trial data; however, long-term real-life clinical data are limited. We evaluated the long-term use of ATV/r as a component of antiretroviral combination therapy in the real-life setting in the REMAIN study. This was an observational cohort study conducted at sites across Germany, Portugal, and Spain. Retrospective historical and prospective longitudinal follow-up data were extracted every six months from medical records of HIV-infected treatment-naïve patients aged ≥ 18 years initiating a first-line ATV/r-containing regimen. Eligible patients (n = 517) were followed up for a median of 3.4 years. The proportion remaining on ATV/r at 5 years was 51.5% with an estimated Kaplan-Meier median time to treatment discontinuation of 4.9 years. Principal reasons for discontinuation were adverse events (15.9%; 8.9% due to hyperbilirubinemia) and virologic failure (6.8%). The Kaplan-Meier probability of not having virologic failure (HIV-1 RNA treatment-emergent major PI resistance occurred. ATV/r was generally well tolerated during long-term treatment with no significant changes in estimated glomerular filtration rate over five years. In a real-life clinical setting over five years, treatment-naïve patients with HIV-1 infection initiating an ATV/r-based regimen showed sustained virologic suppression, an overall treatment persistence rate of 51.5%, an absence of treatment-emergent major PI resistance mutations at virologic failure, a long-term safety profile consistent with that observed in clinical trials, and no significant decline in renal function.

  12. Computerised curve deconvolution of TL/OSL curves using a popular spreadsheet program.

    Science.gov (United States)

    Afouxenidis, D; Polymeris, G S; Tsirliganis, N C; Kitis, G

    2012-05-01

    This paper exploits the possibility of using commercial software for thermoluminescence and optically stimulated luminescence curve deconvolution analysis. The widely used software package Microsoft Excel, with the Solver utility has been used to perform deconvolution analysis to both experimental and reference glow curves resulted from the GLOw Curve ANalysis INtercomparison project. The simple interface of this programme combined with the powerful Solver utility, allows the analysis of complex stimulated luminescence curves into their components and the evaluation of the associated luminescence parameters.

  13. Computerised curve deconvolution of TL/OSL curves using a popular spreadsheet program

    International Nuclear Information System (INIS)

    Afouxenidis, D.; Polymeris, G. S.; Tsirliganis, N. C.; Kitis, G.

    2012-01-01

    This paper exploits the possibility of using commercial software for thermoluminescence and optically stimulated luminescence curve deconvolution analysis. The widely used software package Microsoft Excel, with the Solver utility has been used to perform deconvolution analysis to both experimental and reference glow curves resulted from the Glow Curve Analysis Intercomparison project. The simple interface of this programme combined with the powerful Solver utility, allows the analysis of complex stimulated luminescence curves into their components and the evaluation of the associated luminescence parameters. (authors)

  14. A Probabilistic Framework for Curve Evolution

    DEFF Research Database (Denmark)

    Dahl, Vedrana Andersen

    2017-01-01

    approach include ability to handle textured images, simple generalization to multiple regions, and efficiency in computation. We test our probabilistic framework in combination with parametric (snakes) and geometric (level-sets) curves. The experimental results on composed and natural images demonstrate...

  15. The learning curve for hip arthroscopy: a systematic review.

    Science.gov (United States)

    Hoppe, Daniel J; de Sa, Darren; Simunovic, Nicole; Bhandari, Mohit; Safran, Marc R; Larson, Christopher M; Ayeni, Olufemi R

    2014-03-01

    The learning curve for hip arthroscopy is consistently characterized as "steep." The purpose of this systematic review was to (1) identify the various learning curves reported in the literature, (2) examine the evidence supporting these curves, and (3) determine whether this evidence supports an accepted number of cases needed to achieve proficiency. The electronic databases Embase and Medline were screened for any clinical studies reporting learning curves in hip arthroscopy. Two reviewers conducted a full-text review of eligible studies and a hand search of conference proceedings and reference sections of the included articles. Inclusion/exclusion criteria were applied, and a quality assessment was completed for each included article. Descriptive statistics were compiled. We identified 6 studies with a total of 1,063 patients. Studies grouped surgical cases into "early" versus "late" in a surgeon's experience, with 30 cases being the most common cutoff used. Most of these studies used descriptive statistics and operative time and complication rates as measures of competence. Five of 6 studies showed improvement in these measures between early and late experience, but only one study proposed a bona fide curve. This review shows that when 30 cases was used as the cutoff point to differentiate between early and late cases in a surgeon's experience, there were significant reductions in operative time and complication rates. However, there was insufficient evidence to quantify the learning curve and validate 30, or any number of cases, as the point at which the learning curve plateaus. As a result, this number should be interpreted with caution. Level IV, systematic review of Level IV studies. Copyright © 2014 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  16. Long-term results of pneumatic dilatation for relapsing symptoms of achalasia after Heller myotomy.

    Science.gov (United States)

    Legros, Ludivine; Ropert, Alain; Brochard, Charlène; Bouguen, Guillaume; Pagenault, Maël; Siproudhis, Laurent; Bretagne, Jean-François

    2014-09-01

    The aim of this study was to assess the efficacy and safety of pneumatic dilatation (PD) to treat symptom recurrence after Heller myotomy (HM). Consecutive patients receiving PD for relapsing symptoms following prior HM were included in this retrospective single-center study. Eckardt score ≤3 and/or ∆ Eckardt (difference between Eckardt score before and after dilatation) ≥3 defined the success of initial dilatation. Patients who maintained response longer than 2 months after initial dilatation were defined as short-term responders. Relapsers were offered further on-demand dilatation. Remission was defined as an Eckardt score ≤3 at the study endpoint. Kaplan-Meier survival curves were used to determine relapse rates. Eighteen patients (11 women, seven men) were included from January 2004 to January 2013. Ten patients had type I achalasia, and seven had type III, according to the Chicago classification. Thirty-nine PDs were performed (1.5 [1-2.25] per patient). All patients had short-term responses. The remission rate at the endpoint, after a median follow-up of 33 months, was 78%, but 44% were treated with on-demand PD during the follow-up interval. The proportions of patients without relapse and subsequent PD were 72% at 12 months, 65% at 24 and 36 months, and 49% at 48 months. No factors predictive of long-term response, particularly the type of achalasia, could be identified in this series. There were no perforations. In treating symptom recurrence following HM, PD was safe and effective over the long term when combined with subsequent PD. © 2014 John Wiley & Sons Ltd.

  17. Osteo-Odonto-Keratoprosthesis in Severe Thermal and Chemical Injuries.

    Science.gov (United States)

    Vasquez-Perez, Alfonso; Zarei-Ghanavati, Mehran; Avadhanam, Venkata; Liu, Christopher

    2018-05-16

    To report the results of osteo-odonto-keratoprosthesis (OOKP) surgery in patients who sustained severe chemical and thermal injuries. This is a noncomparative retrospective case series of 14 patients who underwent OOKP surgery between 2001 and 2016 at the Sussex Eye Hospital, Brighton, UK, because of severe chemical and thermal injuries RESULTS:: OOKP surgery was performed in 14 eyes of 14 patients. Eight patients (57%) sustained thermal injuries and 6 patients (43%) chemical injuries. Every eye had previously undergone adnexal or ocular surgery, including 2 cases that underwent synthetic keratoprosthesis implantation. One case had choroidal hemorrhage during stage 2. Laminar retention was observed in 11 cases (85%) at the end of the study. The Kaplan-Meier curve showed a probability of 81% of laminar retention at 5 years and a decrease at 15 years to 61%. Functional visual success was observed in only 7 patients (50%) because of end-stage glaucomatous optic neuropathy in 4 cases and macular scar in 1 case. Two cases developed endophthalmitis. Two cases required removal of laminae, one because of endophthalmitis, bone resorption and aqueous leak and the other because of development of a retroprosthetic membrane. Glaucoma was the most frequent complication (79%) and required surgical intervention with tube shunts in 5 cases. Six cases (43%) required buccal mucosal repair, which included two cases that developed endophthalmitis. Anatomic success was achieved in 11 of 13 cases in this series of OOKP surgery after severe chemical and thermal trauma; 8 of these cases had at least 5 years of follow-up and thus qualified as long-term.

  18. Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province

    Directory of Open Access Journals (Sweden)

    Reza Zamani

    2015-05-01

    Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.

  19. Late outcomes of subcostal exchange of the HeartMate II left ventricular assist device: a word of caution.

    Science.gov (United States)

    Yu, Sarah N; Takayama, Hiroo; Han, Jiho; Garan, Arthur R; Kurlansky, Paul; Yuzefpolskaya, Melana; Colombo, Paolo C; Naka, Yoshifumi; Takeda, Koji

    2018-04-10

    Previous studies have shown the usefulness of the subcostal exchange of the HeartMate II left ventricular assist device for device malfunction. However, long-term data are still limited. Between March 2004 and July 2017, 41 of 568 (7.2%) patients who had received a HeartMate II implant at our institution had a device exchange via a subcostal incision. We summarized early and late outcomes. Forty-one patients had a total of 48 subcostal pump exchanges. Indications for device exchange included device thrombosis (n = 31, 76%), driveline infection (n = 2, 5%) and driveline injury (n = 8, 19%). All of the procedures were successful, and there were no in-hospital deaths. A Kaplan-Meier survival curve showed 30-day and 1-year survival rates after subcostal exchange of 100% and 94.6%, respectively. However, 10 (25%) patients had left ventricular assist device-related infections following subcostal exchange that included 7 pump pocket infections and 3 driveline infections. Freedom from left ventricular assist device-related infection at 1 year after subcostal exchange was 79.3%. Thirteen (32%) patients had device malfunction due to pump thrombosis that required a 2nd device exchange. Seven patients had recurrent thrombosis. Three (7%) patients had a stroke. Freedom from device thrombosis and from a stroke event at 1 year was 74.4%. Subcostal pump exchange can be safely performed. However, there is a substantial risk of infection and recurrent thrombosis. Careful follow-up for late complications is mandatory.

  20. Total elbow arthroplasty: a radiographic outcome study

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Xue Susan [University of Washington, Department of Radiology, Box 357115, Seattle, WA (United States); Petscavage-Thomas, Jonelle M. [Penn State Hershey Medical Center, Department of Radiology, Hershey, PA (United States); Ha, Alice S. [University of Washington, Department of Radiology, Box 354755, Seattle, WA (United States)

    2016-06-15

    Total elbow arthroplasty (TEA) is becoming a popular alternative to arthrodesis for patients with end-stage elbow arthrosis and comminuted distal humeral fractures. Prior outcome studies have primarily focused on surgical findings. Our purpose is to determine the radiographic outcome of TEA and to correlate with clinical symptoms such as pain. This is an IRB-approved retrospective review from 2005 to 2015 of all patients with semiconstrained TEA. All available elbow radiographs and clinical data were reviewed. Data analysis included descriptive statistics and Kaplan-Meier survival curves for radiographic and clinical survival. A total of 104 total elbow arthroplasties in 102 patients were reviewed; 75 % were in women and the mean patient age was 63.1 years. Mean radiographic follow-up was 826 days with average of four radiographs per patient. Seventy TEAs (67 %) developed radiographic complications, including heterotopic ossification (48 %), perihardware lucency (27 %), periprosthetic fracture (23 %), hardware subluxation/dislocation (7 %), polyethylene wear (3 %), and hardware fracture/dislodgement (3 %); 56 patients (55 %) developed symptoms of elbow pain or instability and 30 patients (30 %) underwent at least one reoperation. In patients with radiographic complications, 66 % developed elbow pain, compared to 19 % of patients with no radiologic complications (p = 0.001). Of the patients with radiographic complications, 39 % had at least one additional surgery compared to 0 % of patients without radiographic complications (p = 0.056). Radiographic complications are common in patients after total elbow arthroplasty. There is a strong positive association between post-operative radiographic findings and clinical outcome. Knowledge of common postoperative radiographic findings is important for the practicing radiologist. (orig.)