Cluster Analysis of Maize Inbred Lines
Directory of Open Access Journals (Sweden)
Jiban Shrestha
2016-12-01
Full Text Available The determination of diversity among inbred lines is important for heterosis breeding. Sixty maize inbred lines were evaluated for their eight agro morphological traits during winter season of 2011 to analyze their genetic diversity. Clustering was done by average linkage method. The inbred lines were grouped into six clusters. Inbred lines grouped into Clusters II had taller plants with maximum number of leaves. The cluster III was characterized with shorter plants with minimum number of leaves. The inbred lines categorized into cluster V had early flowering whereas the group into cluster VI had late flowering time. The inbred lines grouped into the cluster III were characterized by higher value of anthesis silking interval (ASI and those of cluster VI had lower value of ASI. These results showed that the inbred lines having widely divergent clusters can be utilized in hybrid breeding programme.
Morphological variation in maize inbred lines
Directory of Open Access Journals (Sweden)
Jiban Shrestha
2014-05-01
Full Text Available In order to identify morphological variation in maize inbred lines, one hundred five inbred lines were planted under randomized complete block design with two replications at research field of National Maize Research Program, Rampur, Chitwan, Nepal during summer season (March to June, 2010. Descriptive statistics and cluster analysis were done. The results revealed a wide range of morphological variation among the tested inbred lines. The inbred lines grouped in cluster 4 namely PUTU-13, L-9, RL-105, RL-197, RL-103, RML-9, RML-41, RL-165, RL-36, RL-76, RL-125, RL-30-3, L-6, RL-107, RL-174, RL-41, L-13, RML-76 and L-5 had 0.833 days anthesis-silking interval and earlier in flowering (tasseling in 54.50 days and silking in 55.33 days. Moreover they consisted of 1.16 plant aspect, 1.25 ear aspect, 33.08 cm tassel length and 13.5 tassel branch number. Among tested lines, the above inbred lines had better morphological traits, so it was concluded that they were good candidates for development of hybrids and synthetic varieties. DOI: http://dx.doi.org/10.3126/ije.v3i2.10521 International Journal of the Environment Vol.3(2 2014: 98-107
Studies on maize inbred lines susceptibility to herbicides
Directory of Open Access Journals (Sweden)
Stefanović Lidija
2010-01-01
Full Text Available This paper presents the analysis of results obtained during long- term studies on the response of maize inbred lines to herbicides. Under the agroecological conditions of Zemun Polje the response (reaction of maize inbred lines to herbicides of different classes was investigated. Biological tests were performed and some agronomic, morphological, physiological and biochemical parameters were determined when the response of maize inbred lines to herbicides was estimated. The use of active ingredients of herbicides from triazine, acetanilide, thiocarbamate to new chemical groups (sulfonylurea etc., have been resulted in changes in weed suppression and susceptibility of inbred lines. Obtained results show that effects of herbicides on susceptible maize genotypes can be different: they can slowdown the growth and development and affect the plant height; they can also affect the stages of the tassel and ear development and at the end they can reduced grain yield of the tested inbreds. Numerous studies confirmed the existence of differences in susceptibility level of maize genotypes in relation to herbicides. According to gained results the recommendations for growers are made on the possibility of the application of new herbicides in the hybrid seed production.
Effective selection criteria for screening drought tolerant recombinant inbred lines of sunflower
Directory of Open Access Journals (Sweden)
Abdi Nishtman
2013-01-01
Full Text Available In this study, seventy two sunflower recombinant inbred lines were tested for their yielding ability under both water-stressed and well-watered states. The inbred lines were evaluated in a rectangular 8´9 lattice design with two replications in both well-watered and water-stressed conditions, separately. Eight drought tolerance indices including stability tolerance index (STI, mean productivity (MP, geometric mean productivity (GMP, harmonic mean (HM, stress susceptibility index (SSI, tolerance index (TOL, yield index (YI and yield stability index (YSI were calculated based on grain yield for every genotype. Results showed the highest values of mean productivity (MP index, geometric mean productivity (GMP, yield index (YI, harmonic mean (HM and stress tolerance index (STI indices for ‘C134a’ inbred line and least values of stress susceptibility index (SSI and tolerance (TOL for C61 inbred line. According to correlation of indices with yield performance under both drought stress and non-stress states and principle component analysis, indices including HM, MP, GMP and STI could properly distinguish drought tolerant sunflower inbred lines with high yield performance under both states. Cluster analysis of inbred lines using Ys, Yp and eight indices, categorized them into four groups including 19, 6, 26 and 19 inbred lines.
Quantitative Trait Loci in Inbred Lines
Jansen, R.C.
2001-01-01
Quantitative traits result from the influence of multiple genes (quantitative trait loci) and environmental factors. Detecting and mapping the individual genes underlying such 'complex' traits is a difficult task. Fortunately, populations obtained from crosses between inbred lines are relatively
Directory of Open Access Journals (Sweden)
Deoclecio Domingos Garbuglio
2017-10-01
Full Text Available Inbreeding can potentially be used for the development of inbred lines containing alleles of interest, but the genetic causes that control inbreeding depression are not completely known, and there are few studies found in the literature. The present study aimed to obtain estimates of inbreeding depression for eight traits in seven tropical maize populations, analyze the effects of inbreeding over generations and environments, and predict the behavior of inbred lines in future generation S? through linear regression methods. It was found that regardless of the base population used, prediction values could vary when the model was based on only 2 generations of inbreeding due to the environmental component. The influence of the environment in this type of study could be reduced when considering 3 generations of inbreeding, allowing greater precision in predicting the phenotypes of inbred lines. The use of linear regression was effective for inbred line prediction for the different agronomic traits evaluated. The use of 3 levels of inbreeding minimizes the effects of the environmental component in inbred line prediction for grain yield. GO-S was the most promising population for inbred line extraction.
Resistance Evaluation of Radish (Raphanus sativus L. Inbred Lines against Turnip mosaic virus
Directory of Open Access Journals (Sweden)
Ju-Yeon Yoon
2017-03-01
Full Text Available Leaves of twenties radish (Raphanus sativus L. inbred lines were mechanically inoculated with Turnip mosaic virus (TuMV strain HY to evaluate TuMV resistance of the radish inbred lines. The inoculated radish plants were incubated at 22°C±3°C and resistance assessment was examined using symptom development for 4 weeks. Based on the reactions of differential radish inbred lines, 16 radish lines were produced mild mosaic, mottling, mosaic and severe mosaic symptoms by TuMV infection. These results were confirmed by RT-PCR analysis of TuMV coat protein gene, suggesting that TuMV is responsible for the disease symptoms. Four resistant radish lines did not induce systemic mosaic symptoms on upper leaves and chlorosis in stem tissues for 4 weeks, showing they were symptomless by 8 weeks. Further examination of TuMV infection in the 4 radish lines showed no TuMV infection in all systemic leaves. These results suggest that the 4 radish lines are highly resistant to TuMV.
Evaluation of Drought Tolerance of Bread Wheat Recombinant Inbred Lines
Directory of Open Access Journals (Sweden)
N Zafar Naderi
2014-10-01
Full Text Available To evaluateresponse of bread wheat recombinant inbred lines to water deficit, a split plot experiment arranged in randomized complete block design (CRBD was conducted using eight recombinant inbred lines and their parental cultivars (Roshan and Super Head with three replications under three irrigation levels (80, 120 and 160 mm evaporation from class A pan at the Agriculture Research Station of Islamic Azad University, Tabriz Branch during 2009. The results of analysis of variance data collected revealed significant difference among lines and irrigation levels for grain yield. While line × irrigation level interaction was non significant for grain yield. Based on SSI and TOL, drought tolerance indices lines number 1, 7, 41 and Roshan cultivar under 120 mm evaporation, and lines number 7 and 19 under 160 mm evaporation were the tolerant lines. Under both stress conditions according to STI, MP and GMP indices, lines number 37, 38 and Roshan cultivar were recognized as the tolerant lines to water deficiet. Cluster analyses based on grain yield and drought tolerance indices recognized the lines number 1, 30, 32, 37, 38, 41 and Roshan cultivar under 120 mm and lines number 30, 37 and 38 and Roshan under 160 mm evaporation as the most drought tolerants and higher producers.
Gordon, Stuart G; Lipps, Patrick E; Pratt, Richard C
2006-06-01
ABSTRACT Gray leaf spot (GLS), caused by the fungus Cercospora zeae-maydis, is one of the most important foliar diseases of maize. This study was undertaken to estimate heritability of C. zeae-maydis resistance and examine the relationship between previously identified resistance loci and certain components of resistance including incubation period, lesion number, and maximum lesion length. Partially inbred progenies arising from hybridization between maize inbred lines VO613Y (high level of partial resistance) and Pa405 (susceptible) were examined in Ohio and South Africa. Heritability estimates of resistance were calculated based on severity and incubation period values. The range of heritability estimates based on severity was broad, with values ranging from approximately 0.46 to 0.81 (mean = 0.59). Estimates of mean heritability for incubation period were lowest (0.18), indicating that this component would likely be unsuitable for selection of germ plasm intended for deployment in diverse regions. Length of GLS lesions was significantly affected by host genotype, with resistant genotypes having shorter lesions from one site in Ohio during two seasons. Genotype also had a significant effect on incubation period and lesion number; the lower values for these components also were associated with resistant genotypes. The combined action of these resistance components resulted in lower overall disease severity.
Directory of Open Access Journals (Sweden)
Yujing Cheng
2014-12-01
Full Text Available Salt stress is one of the severest growth limited-factors to agriculture production. To gain in-depth knowledge of salt-stress response mechanisms, the proteomics analysis from two maize (Zea mays L. inbred lines was carried out using two-dimensional gel electrophoresis (2-DGE and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/TOF-MS. There were 57 salt-regulated proteins identified, 21 and 36 proteins were differentially regulated in inbred lines 'Nongda 1145' (salt-resistant and 'D340' (salt-sensitive, respectively. The identified proteins were distributed in 11 biological processes and seven molecular functions. Under salt stress, proteins related to antioxidation and lignin synthesis were increased in both inbred lines. The relative abundance of proteins involved in translation initiation, elongation, and protein proteolysis increased in 'Nongda 1145' and decreased in 'D340'. In addition, the abundance of proteins involved in carbohydrate metabolism, protein refolding, ATP synthase and transcription differed between the two inbred lines. Our results suggest that the enhanced ability of salt-tolerant inbred line 'Nongda 1145' to combat salt stress occurs via regulation of transcription factors promoting increased antioxidation and lignin biosynthesis, enhanced energy production, and acceleration of protein translation and protein proteolysis.
Zhu, Yu-xi; Yang, Qun-fang; Huang, Yu-bi; Li, Qing
2015-09-01
In the present study, we investigated the systematically induced production of defense-related compounds, including DIMBOA, total phenol, trypsin inhibitors (TI) and chymotrypsin inhibitor (CI), by Tetranychus cinnabarinus infestation in Zea mays. The first leaves of two corn in-bred line seedlings, the mite-tolerant line ' H1014168' and the mite-sensitive line 'H1014591', were sucked by T. cinnabarinus adult female for seven days, and then the contents of DIMBOA, total phenol, TI and CI were measured in the second leaf and in the roots, respectively. Results showed that as compared to the unsucked control, all contents of DIMBOA, total phenol, TI and CI induced by T. cinnabarinus sucking were significantly higher in the second leaf of both inbred lines as well as in the roots of the mite-tolerant 'H1014168'. However, in the roots of 'H1014591', these defense compounds had different trends, where there was a higher induction of TI and a lower level of total phenol than that of the healthy control, while had almost no difference in DIMBOA and CI. These findings suggested that the infestation of T. cinnabarinus could systematically induce accumulation of defense-related compounds, and this effect was stronger in the mite-tolerant inbred line than in the mite-sensitive inbred line.
Analysis of genetic diversity among the maize inbred lines (Zea mays L. under heat stress condition
Directory of Open Access Journals (Sweden)
Manoj Kandel
2017-12-01
Full Text Available High temperature adversely affects the plant physiological processes: limits plant growth and reduction in grain yield. Heat stress is often encountered to spring sowing of maize in spring season. Twenty maize inbred lines were studied for days to 50 % anthesis and silking, anthesis–silking interval, leaf firing, tassel blast, SPAD reading and leaf senescence, plant and ear height, leaf area index, ear per plant, cob length and diameter, number of kernel/ear, number of kernel row/ear, number of kernel row, silk receptivity, shelling percentage, thousand kernel weight and grain yield in alpha lattice design at National Maize Research Program at Rampur, Chitwan,Nepal with the objective to identify superior heat stress tolerant lines. Analysis of variance showed significant difference for all the traits. Result of multivariable analysis revealed that twenty inbred lines formed four clusters. The resistance inbred lines and susceptible inbred lines formed different clusters. The members of cluster 4 were found to be tolerant to heat stress due to they had lowest value of tassel blast, leaf firing, and leaf area index with highest value of cob diameter and length, ear per plant, number of kernel row/ear, number of kernel/ear, number of kernel row, shelling percentage, silk receptivity and grain yield whereas as members of cluster 1were found most susceptible due to they had longer anthesis silking interval, with maximum tassel blast and leaf firing along with no grain yield under heat stress condition. From this study inbred lines RL-140, RML-76, RML-91 and RML-40 were found most tolerant to heat stress. These inbred lines belonging to superior cluster could be considered very useful in developing heat tolerant variety and other breeding activities.
Regeneration of Sudanese maize inbred lines and open pollinated ...
African Journals Online (AJOL)
STORAGESEVER
2008-06-03
Jun 3, 2008 ... Callus induction capacity was highest in inbred lines IL3, IL15 and IL1. The. Varieties Hudiba-2 and ... Maize plant regeneration can take place through two avenues, that is ..... regenerants were tussel ear formation and dwarfism. These abnormalities are typical of tissue-cultured cells, plants derived from ...
Estimation of genetic variability level in inbred CF1 mouse lines ...
Indian Academy of Sciences (India)
To estimate the genetic variability levels maintained by inbred lines selected for body weight and to compare them with a nonselected population from which the lines were derived, we calculated the per cent polymorphic loci (P) and marker diversity (MD) index from data on 43 putative loci of inter simple sequence repeats ...
Assessment of genetic variability of maize inbred lines and their ...
African Journals Online (AJOL)
Assessment of genetic variability of maize inbred lines and their hybrids under normal and drought conditions. ... Nigeria Agricultural Journal ... Analysis of variance revealed significant differences for most of the characters under study which indicates the presence of sufficient amount of variability offering ample scope for ...
Agronomic and molecular evaluation of maize inbred lines for drought tolerance
International Nuclear Information System (INIS)
Mikić, S.; Zorić, M.; Stanisavljević, D.; Kondić-Špika, A.; Brbaklić, L.; Kobiljski, B.; Nastasić, A.; Mitrović, B.; Šurlan-Momirović, G.
2016-01-01
Drought is a severe threat to maize yield stability in Serbia and other temperate Southeast European countries occurring occasionally but with significant yield losses. The development of resilient genotypes that perform well under drought is one of the main focuses of maize breeding programmes. To test the tolerance of newly developed elite maize inbred lines to drought stress, field trials for grain yield performance and anthesis silk interval (ASI) were set in drought stressed environments in 2011 and 2012. Inbred lines performing well under drought, clustered into a group with short ASI and a smaller group with long ASI, were considered as a potential source for tolerance. The former contained inbreds from different heterotic groups and with a proportion of local germplasm. The latter consisted of genotypes with mixed exotic and Lancaster germplasm, which performed better in more drought-affected environments. Three inbreds were selected for their potential drought tolerance, showing an above-average yield and small ASI in all environments. Association analysis indicated significant correlations between ASI and grain yield and three microsatellites (bnlg1525, bnlg238 and umc1025). Eight alleles were selected for their favourable concurrent effect on yield increase and ASI decrease. The proportion of phenotypic variation explained by the markers varied across environments from 5.7% to 22.4% and from 4.6% to 8.1% for ASI and yield, respectively. The alleles with strongest effect on performance of particular genotypes and their interactions in specific environments were identified by the mean of partial least square interactions analysis indicating potential suitability of the makers for tolerant genotype selection.
Agronomic and molecular evaluation of maize inbred lines for drought tolerance
Energy Technology Data Exchange (ETDEWEB)
Mikić, S.; Zorić, M.; Stanisavljević, D.; Kondić-Špika, A.; Brbaklić, L.; Kobiljski, B.; Nastasić, A.; Mitrović, B.; Šurlan-Momirović, G.
2016-07-01
Drought is a severe threat to maize yield stability in Serbia and other temperate Southeast European countries occurring occasionally but with significant yield losses. The development of resilient genotypes that perform well under drought is one of the main focuses of maize breeding programmes. To test the tolerance of newly developed elite maize inbred lines to drought stress, field trials for grain yield performance and anthesis silk interval (ASI) were set in drought stressed environments in 2011 and 2012. Inbred lines performing well under drought, clustered into a group with short ASI and a smaller group with long ASI, were considered as a potential source for tolerance. The former contained inbreds from different heterotic groups and with a proportion of local germplasm. The latter consisted of genotypes with mixed exotic and Lancaster germplasm, which performed better in more drought-affected environments. Three inbreds were selected for their potential drought tolerance, showing an above-average yield and small ASI in all environments. Association analysis indicated significant correlations between ASI and grain yield and three microsatellites (bnlg1525, bnlg238 and umc1025). Eight alleles were selected for their favourable concurrent effect on yield increase and ASI decrease. The proportion of phenotypic variation explained by the markers varied across environments from 5.7% to 22.4% and from 4.6% to 8.1% for ASI and yield, respectively. The alleles with strongest effect on performance of particular genotypes and their interactions in specific environments were identified by the mean of partial least square interactions analysis indicating potential suitability of the makers for tolerant genotype selection.
Screening of recombinant inbred lines for salinity tolerance in bread ...
African Journals Online (AJOL)
Screening a large number of plants for salinity tolerance is not easy, therefore this investigation was performed to evaluate and screen 186 F8 recombinant inbred lines (RILs) derived from a cross between Superhead#2 (Super Seri) and Roshan wheat varieties for salinity tolerance. All the individuals were evaluated under ...
Analysis of the genetic diversity of super sweet corn inbred lines using SSR and SSAP markers.
Ko, W R; Sa, K J; Roy, N S; Choi, H-J; Lee, J K
2016-01-22
In this study, we compared the efficiency of simple sequence repeat (SSR) and sequence specific amplified polymorphism (SSAP) markers for analyzing genetic diversity, genetic relationships, and population structure of 87 super sweet corn inbred lines from different origins. SSR markers showed higher average gene diversity and Shannon's information index than SSAP markers. To assess genetic relationships and characterize inbred lines using SSR and SSAP markers, genetic similarity (GS) matrices were constructed. The dendrogram using SSR marker data showed a complex pattern with nine clusters and a GS of 53.0%. For SSAP markers, three clusters were observed with a GS of 50.8%. Results of combined marker data showed six clusters with 53.5% GS. To analyze the genetic population structure of SSR and SSAP marker data, the 87 inbred lines were divided into groups I, II, and admixed based on the membership probability threshold of 0.8. Using combined marker data, the population structure was K = 3 and was divided into groups I, II, III, and admixed. This study represents a comparative analysis of SSR and SSAP marker data for the study of genetic diversity and genetic relationships in super sweet corn inbred lines. Our results would be useful for maize-breeding programs in Korea.
Directory of Open Access Journals (Sweden)
Jambrović Antun
2014-01-01
Full Text Available Here we describe the results of the detailed array-based genotyping obtained by using the Illumina MaizeSNP50 BeadChip of eleven inbred lines belonging to different heterotic groups relevant for maize breeding in Southeast Europe - European Corn Belt. The objectives of this study were to assess the utility of the MaizeSNP50 BeadChip platform by determining its descriptive power and to assess genetic dissimilarity of the inbred lines. The distribution of the SNPs was found not completely uniform among chromosomes, but average call rate was very high (97.9% and number of polymorphic loci was 33200 out of 50074 SNPs with known mapping position indicating descriptive power of the MaizeSNP50 BeadChip. The dendrogram obtained from UPGMA cluster analysis as well as principal component analysis (PCA confirmed pedigree information, undoubtedly distinguishing lines according to their background in two population varieties of Reid Yellow Dent and Lancaster Sure Crop. Dissimilarity analysis showed that all of the inbred lines could be distinguished from each other. Whereas cluster analysis did not definitely differentiate Mo17 and Ohio inbred lines, PCA revealed clear genetic differences between them. The studied inbred lines were confirmed to be genetically diverse, representing a large proportion of the genetic variation occurring in two maize heterotic groups.
Maize forage aptitude: Combining ability of inbred lines and stability of hybrids
Directory of Open Access Journals (Sweden)
Luis Máximo Bertoia
2014-12-01
Full Text Available Breeding of forage maize should combine improvement achieved for grain with the specific needs of forage hybrids. Production stability is important when maize is used for silage if the planting area is not in the ideal agronomic environment. The objectives of the present research were: (i to quantify environmental and genetic and their interaction effects on maize silage traits; (ii to identify possible heterotic groups for forage aptitude and suggest the formation of potential heterotic patterns, and (iii to identify suitable inbred line combinations for producing hybrids with forage aptitude. Forty-five hybrids derived from diallelic crosses (without reciprocals among ten inbred lines of maize were evaluated in this study. Combined ANOVA over environments showed differences between genotypes (G, environments (E, and their interactions (GEI. Heritability (H2, and genotypic and phenotypic correlations were estimated to evaluate the variation in and relationships between forage traits. Postdictive and predictive AMMI models were fitted to determine the importance of each source of variation, G, E, and GEI, and to select genotypes simultaneously on yield, quality and stability. A predominance of additive effects was found in the evaluated traits. The heterotic pattern Reid-BSSS × Argentine flint was confirmed for ear yield (EY and harvest index (HI. High and broad genetic variation was found for stover and whole plant traits. Some inbred lines had genes with differential breeding aptitude for ear and stover. Stover and ear yield should be the main breeding objectives in maize forage breeding.
The Combining Ability of Maize Inbred Lines for Grain Yield and ...
African Journals Online (AJOL)
The Combining Ability of Maize Inbred Lines for Grain Yield and Reaction to Grey ... East African Journal of Sciences ... (GLS) to maize production, the national maize research program of Ethiopia ... The information from this study will be useful for the development of high-yielding and GLS disease-resistant maize varieties.
Determination of the Heterotic groups of Maize inbred lines and the ...
African Journals Online (AJOL)
Maize weevil (Sitophilus zeamais Motschulsky) is a major maize (Zea mays L) storage insect pest in the tropics. Fifty-two inbred lines developed for weevil resistance were crossed to two testers, A and B, to determine their heterotic groups and inheritance of resistance to maize weevil. For 10 testcrosses selected for ...
Combing Ability Analysis ofamong Early Generation Maize Inbred ...
African Journals Online (AJOL)
dagne.cimdom
estimate combining ability effects of locally developed and introduced early generation maize inbred lines for grain yield, yield .... mass selection followed by self-pollination for generating inbred lines. The inbred lines ... for the experiment was an alpha (0, 1) lattice (Patterson and Williams, 1996) with two replications at each ...
Directory of Open Access Journals (Sweden)
Stevanovic Milan
2016-01-01
Full Text Available A total of seven maize inbred lines of different origin and maturity group were used in the trial set up according to the split-plot randomized complete block design in five environments. Each inbred was observed in five variants: original inbred (N; cytoplasmic male sterile C-type (CMS-C; restorer for CMS-C (RfC; cytoplasmic male sterile S-type (CMS-S and restorer for CMS-S (RfS. The objective was to compare grain yield of original inbreds and their CMS and Rf variants and to apply Isoelectric focusing (IEF to determine whether the conversion of original inbreds to their CMS and Rf counterparts have been done completely. Protein markers have shown that conversion of almost all inbreds was done good and completely. Only original inbreds ZPL2 and ZPL5 did not concur on banding patterns with their RfC variants. The type of cytoplasm had a very significant impact on grain yield. Namely, CMS-C counterparts significantly out yielded their CMS-S versions, while the inbreds with C and S cytoplasm over yielded inbreds with N cytoplasm, as well as their RfC and RfS versions.
Registration of Wyandot × PI 567301B soybean recombinant inbred line population
A soybean [Glycine max (L.) Merr] mapping population (Reg. No., SNL MAP) consisting of 357 F7-derived recombinant inbred lines (RILs) was jointly developed by the USDA-Agricultural Research Service and the Ohio Agricultural Research and Development Center (OARDC) in Wooster, OH. The population was ...
Nakkanong, Korakot; Yang, Jing Hua; Zhang, Ming Fang
2012-06-13
Carotenoid levels and composition during squash fruit development were compared in Cucurbita moschata , Cucurbita maxima , and two lines of their interspecific inbred lines, namely, Maxchata1 and Maxchata2. Eight genes associated with carotenoid biosynthesis were analyzed by quantitative RT-PCR. The two squash species and their interspecific inbred lines exhibited different qualitative and quantitative carotenoid profiles and regulatory mechanisms. C. moschata had the lowest total carotenoid content and mainly accumulated α-carotene and β-carotene, as expected in a fruit with pale-orange flesh. Low carotenoid content in this species was probably due to the comparatively low expression of all genes investigated, especially PSY1 gene, compared to the other squashes. The predominant carotenoids in C. maxima were violaxanthin and lutein, which produced a corresponding yellow flesh color in mature fruit. The relationship between the expression of the CHYB and ZEP genes may result in almost equal concentrations of violaxanthin and lutein in C. maxima at fruit ripening. In contrast, their interspecific inbred lines principally accumulated lutein and β-carotene, leading to orange flesh color. The PSY1 gene exhibited higher expression levels at earlier stages of fruit development in the Maxchata lines, potentially triggering the increased carotenoid accumulation seen in these fruits. Likewise, the higher transcription level of CHYB gene observed in the two interspecific inbred lines might be correlated with high lutein in these hybrids. However, this study could not explain the observed β-carotene accumulation on the basis of gene expression.
Identification of resistance to Maize rayado fino virus in maize inbred lines
Maize rayado fino virus (MRFV) is one of the most important virus diseases of maize in America. Severe yield losses, ranging from 10 to 50% in landraces to nearly 100% in contemporary cultivars, have been reported. Resistance has been reported in populations, but few inbred lines have been identifie...
Ni, Xinzhi; Krakowsky, Matthew D; Buntin, G David; Rector, Brian G; Guo, Baozhu; Snook, Maurice E
2008-08-01
Ninety four corn inbred lines selected from International Center for the Improvement of Maize and Wheat (CIMMYT) in Mexico were evaluated for levels of silk maysin in 2001 and 2002. Damage by major ear-feeding insects [i.e., corn earworm, Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae); maize weevil, Sitophilus zeamais (Motschulsky) (Coleoptera: Curculionidae); brown stink bug, Euschistus servus (Say); southern green stink bugs, Nezara viridula (L.) (Heteroptera: Pentatomidae)], and common smut [Ustilago maydis DC (Corda)] infection on these inbred lines were evaluated in 2005 and 2006 under subtropical conditions at Tifton, GA. Ten inbred lines possessing good agronomic traits were also resistant to the corn earworm. The correlation between ear-feeding insect damage or smut infection and three phenotypic traits (silk maysin level, husk extension, and husk tightness of corn ears) was also examined. Corn earworm and stink bug damage was negatively correlated to husk extension, but not to either silk maysin levels or husk tightness. In combination with the best agronomic trait ratings that show the least corn earworm and stink bug damage, lowest smut infection rate, and good insect-resistant phenotypic traits (i.e., high maysin and good husk coverage and husk tightness), 10 best inbred lines (CML90, CML92, CML94, CML99, CML104, CML108, CML114, CML128, CML137, and CML373) were identified from the 94 lines examined. These selected inbred lines will be used for further examination of their resistance mechanisms and development of new corn germplasm that confers multiple ear-colonizing pest resistance.
Directory of Open Access Journals (Sweden)
Arif Hasan Khan Robin
2016-06-01
Full Text Available Glucosinolates are the biochemical compounds that provide defense to plants against pathogens and herbivores. In this study, the relative expression level of 48 glucosinolate biosynthesis genes was explored in four morphologically-different cabbage inbred lines by qPCR analysis. The content of aliphatic and indolic glucosinolate molecules present in those cabbage lines was also estimated by HPLC analysis. The possible association between glucosinolate accumulation and related gene expression level was explored by principal component analysis (PCA. The genotype-dependent variation in the relative expression level of different aliphatic and indolic glucosinolate biosynthesis genes is the novel result of this study. A total of eight different types of glucosinolates, including five aliphatic and three indolic glucosinolates, was detected in four cabbage lines. Three inbred lines BN3383, BN4059 and BN4072 had no glucoraphanin, sinigrin and gluconapin detected, but the inbred line BN3273 had these three aliphatic glucosinolate compounds. PCA revealed that a higher expression level of ST5b genes and lower expression of GSL-OH was associated with the accumulation of these three aliphatic glucosinolate compounds. PCA further revealed that comparatively higher accumulation of neoglucobrassicin in the inbred line, BN4072, was associated with a high level of expression of MYB34 (Bol017062 and CYP81F1 genes. The Dof1 and IQD1 genes probably trans-activated the genes related to biosynthesis of glucoerucin and methoxyglucobrassicin for their comparatively higher accumulation in the BN4059 and BN4072 lines compared to the other two lines, BN3273 and BN3383. A comparatively higher progoitrin level in BN3273 was probably associated with the higher expression level of the GSL-OH gene. The cabbage inbred line BN3383 accounted for the significantly higher relative expression level for the 12 genes out of 48, but this line had comparatively lower total
Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.
Directory of Open Access Journals (Sweden)
Enying Zhang
Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.
Directory of Open Access Journals (Sweden)
K. V. Derkach
2017-08-01
Full Text Available The objective of this article is the grouping and clustering of maize inbred lines based on the results of SNP-genotyping for the verification of a separate cluster of Lancaster germplasm inbred lines. As material for the study, we used 91 maize (Zea mays L. inbred lines, including 31 Lancaster germplasm lines and 60 inbred lines of other germplasms (23 Iodent inbreds, 15 Reid inbreds, 7 Lacon inbreds, 12 Mix inbreds and 3 exotic inbreds. The majority of the given inbred lines are included in the Dnipro breeding programme. The SNP-genotyping of these inbred lines was conducted using BDI-III panel of 384 SNP-markers developed by BioDiagnostics, Inc. (USA on the base of Illumina VeraCode Bead Plate. The SNP-markers of this panel are biallelic and are located on all 10 maize chromosomes. Their range of conductivity was >0.6. The SNP-analysis was made in completely automated regime on Illumina BeadStation equipment at BioDiagnostics, Inc. (USA. A principal component analysis was applied to group a general set of 91 inbreds according to allelic states of SNP-markers and to identify a cluster of Lancaster inbreds. The clustering and determining hierarchy in 31 Lancaster germplasm inbreds used quantitative cluster analysis. The share of monomorphic markers in the studied set of 91 inbred lines equaled 0.7%, and the share of dimorphic markers equaled 99.3%. Minor allele frequency (MAF > 0.2 was observed for 80.6% of dimorphic markers, the average index of shift of gene diversity equaled 0.2984, PIC on average reached 0.3144. The index of gene diversity of markers varied from 0.1701 to 0.1901, pairwise genetic distances between inbred lines ranged from 0.0316–0.8000, the frequencies of major alleles of SNP-markers were within 0.5085–0.9821, and the frequencies of minor alleles were within 0.0179–0.4915. The average homozygosity of inbred lines was 98.8%. The principal component analysis of SNP-distances confirmed the isolation of the Lancaster
Directory of Open Access Journals (Sweden)
Radenović Čedomir N.
2003-01-01
Full Text Available The initial idea of this study was a hypothesis that erect leaf maize inbred lines were characterized by properties of an efficient photo-model and that as such were very desirable in increasing the number of plants per area unit (plant density in the process of contemporary selection and seed production. The application of a non-invasive bioluminescence-photosynthetic method, suitable for the efficiency estimation of the photo-model, verified the hypothesis. Obtained photosynthetic properties of observed erect leaf maize inbred lines were based on the effects and characteristics of thermal processes of delayed chlorophyll fluorescence occurring in their thylakoid membranes. The temperature dependence of the delayed chlorophyll fluorescence intensity phase transitions (critical temperatures in the thylakoid membranes and activation energy are the principal parameters of the thermal processes. Based on obtained photosynthetic properties it is possible to select erect leaf maize inbred lines that are resistant and tolerant to high and very high temperatures, as well as, to drought. They could be good and efficient photo-models wherewith.
QTL analysis of seed dormancy in Arabidopsis using recombinant inbred lines and MQM mapping
Schaar, Wybe van der; Alonso-Blanco, Carlos; Léon-Kloosterziel, Karen M.; Jansen, Ritsert C.; Ooijen, Johan W. van; Koornneef, Maarten
1997-01-01
The genetic differences for seed germination between two commonly used Arabidopsis thaliana ecotypes Ler and Col, both showing a low level of seed dormancy, were investigated. The analysis was performed with 98 recombinant inbred lines (RILs) derived from the cross between the two ecotypes, and
Genetic Analysis of Recombinant Inbred Lines for Sorghum bicolor ? Sorghum propinquum
Kong, Wenqian; Jin, Huizhe; Franks, Cleve D.; Kim, Changsoo; Bandopadhyay, Rajib; Rana, Mukesh K.; Auckland, Susan A.; Goff, Valorie H.; Rainville, Lisa K.; Burow, Gloria B.; Woodfin, Charles; Burke, John J.; Paterson, Andrew H.
2013-01-01
We describe a recombinant inbred line (RIL) population of 161 F5 genotypes for the widest euploid cross that can be made to cultivated sorghum (Sorghum bicolor) using conventional techniques, S. bicolor ? Sorghum propinquum, that segregates for many traits related to plant architecture, growth and development, reproduction, and life history. The genetic map of the S. bicolor ? S. propinquum RILs contains 141 loci on 10 linkage groups collectively spanning 773.1 cM. Although the genetic map ha...
Bagheri, H.; Soda, El M.; Kim, H.K.; Fritsche, S.; Jung, C.; Aarts, M.G.M.
2013-01-01
The genetic basis of the wide variation for nutritional traits in Brassica rapa is largely unknown. A new Recombinant Inbred Line (RIL) population was profiled using High Performance Liquid Chromatography (HPLC) and Nuclear Magnetic Resonance (NMR) analysis to detect quantitative trait loci (QTLs)
Avaliação de linhagens de melão Evaluation of melon inbred lines for plant and fruit characteristics
Directory of Open Access Journals (Sweden)
Waldelice Oliveira de Paiva
2000-07-01
Full Text Available Com o objetivo de produzir híbridos de melão adaptados à região Nordeste do Brasil, foi avaliado, em Pacajús-CE o comportamento de 29 linhagens, sendo 23 do grupo cantalupensis, cinco do inodorus e uma do grupo momordica. Para efeito de comparação, foram utilizadas cultivares comerciais: o híbrido Hy-mark e a cultivar Eldorado-300. Na avaliação da precocidade a maturação das linhagens do grupo cantalupensis levaram em média 35,1 dias, as do grupo inodorus 30,6 dias e as do grupo momordica 24,4 dias. A concentração da produção, estimada aos 70 dias, foi mais elevada (75,8% numa linhagem que não produz frutos comerciais. A produção das linhagens variou de 16,2 t/ha a 65,1 t/ha, enquanto a média das testemunhas comerciais foi de 28,4 t/ha. Três linhagens do grupo cantalupensis e todas do grupo inodorus mostraram-se mais produtivas que as testemunhas. O teor de sólidos solúveis entre linhagens e testemunhas foi semelhante (8,6%, sendo que uma das linhagens, M46-00 se destacou pelos altos teores (Brix=12,2%. Em geral, os frutos das linhagens tardias mostraram elevado teor de sólidos solúveis.In order to obtain melon hybrids adapted for growing in the Northeast of Brazil, 29 inbred lines (23 belonging to the cantaloupensis group, 5 to the inodorus and 1 to the momordica group were evaluated in Pacajus, in the state of Ceará. Two commercial varieties, the hybrid Hy-mark and the cultivar Eldorado-300, were used as checks. It was observed that the average period for fruit ripening was 35.1 days for the cantalupensis group, 30.6 days for the inodorus group and 24.4 days for the momordica group. The highest yield concentration (75.8%, evaluated 70 days after sowing, was attained in a inbred line that does not produce commercial fruits. The yield of the lines ranged from 16.2 t/ha up to 65.1 t/ha, whereas the two commercial varieties produced 28.0 t/ha. Three of the cantalupensis group and all inbred lines of the inodorus group
Ni, Xinzhi; Xu, Wenwei; Krakowsky, Matthew D; Buntin, G David; Brown, Steve L; Lee, R Dewey; Coy, Anton E
2007-10-01
Identifying and using native insect resistance genes is the core of integrated pest management. In this study, 10 experimental corn, Zea mays L., hybrids and 10 inbred lines were screened for resistance to major ear-feeding insects in the southeastern Coastal Plain region of the United States during 2004 and 2005. Ear-feeding insect damage was assessed at harvest by visual damage rating for the corn earworm, Helicoverpa zea (Boddie), and by the percentage of kernels damaged by the maize weevil, Sitophilus zeamais Motschulsky, and stink bugs [combination of Euschistus servus (Say) and southern green stink bug, Nezara viridula (L.)]. Among the eight inbred lines and two control populations examined, C3S1B73-5b was resistant to corn earworm, maize weevil, and stink bugs. In contrast, C3S1B73-4 was resistant to corn earworm and stink bugs, but not to maize weevil. In a similar manner, the corn hybrid S1W*CML343 was resistant to all three ear-feeding insects, whereas hybrid C3S1B73-3*Tx205 was resistant to corn earworm and maize weevil in both growing seasons, but susceptible to stink bugs in 2005. The silk-feeding bioassay showed that corn earworm developed better on corn silk than did fall armyworm. Among all phenotypic traits examined (i.e., corn ear size, husk extension, and husk tightness), only corn ear size was negatively correlated to corn earworm damage in the inbred lines examined, whereas only husk extension (i.e., coverage) was negatively correlated to both corn earworm and maize weevil damage on the experimental hybrids examined. Such information could be used to establish a baseline for developing agronomically elite corn germplasm that confers multiple ear-feeding insect resistance.
Fine-mapping of qGW4.05, a major QTL for kernel weight and size in maize.
Chen, Lin; Li, Yong-xiang; Li, Chunhui; Wu, Xun; Qin, Weiwei; Li, Xin; Jiao, Fuchao; Zhang, Xiaojing; Zhang, Dengfeng; Shi, Yunsu; Song, Yanchun; Li, Yu; Wang, Tianyu
2016-04-12
Kernel weight and size are important components of grain yield in cereals. Although some information is available concerning the map positions of quantitative trait loci (QTL) for kernel weight and size in maize, little is known about the molecular mechanisms of these QTLs. qGW4.05 is a major QTL that is associated with kernel weight and size in maize. We combined linkage analysis and association mapping to fine-map and identify candidate gene(s) at qGW4.05. QTL qGW4.05 was fine-mapped to a 279.6-kb interval in a segregating population derived from a cross of Huangzaosi with LV28. By combining the results of regional association mapping and linkage analysis, we identified GRMZM2G039934 as a candidate gene responsible for qGW4.05. Candidate gene-based association mapping was conducted using a panel of 184 inbred lines with variable kernel weights and kernel sizes. Six polymorphic sites in the gene GRMZM2G039934 were significantly associated with kernel weight and kernel size. The results of linkage analysis and association mapping revealed that GRMZM2G039934 is the most likely candidate gene for qGW4.05. These results will improve our understanding of the genetic architecture and molecular mechanisms underlying kernel development in maize.
The Genetic Basis of Plant Architecture in 10 Maize Recombinant Inbred Line Populations.
Pan, Qingchun; Xu, Yuancheng; Li, Kun; Peng, Yong; Zhan, Wei; Li, Wenqiang; Li, Lin; Yan, Jianbing
2017-10-01
Plant architecture is a key factor affecting planting density and grain yield in maize ( Zea mays ). However, the genetic mechanisms underlying plant architecture in diverse genetic backgrounds have not been fully addressed. Here, we performed a large-scale phenotyping of 10 plant architecture-related traits and dissected the genetic loci controlling these traits in 10 recombinant inbred line populations derived from 14 diverse genetic backgrounds. Nearly 800 quantitative trait loci (QTLs) with major and minor effects were identified as contributing to the phenotypic variation of plant architecture-related traits. Ninety-two percent of these QTLs were detected in only one population, confirming the diverse genetic backgrounds of the mapping populations and the prevalence of rare alleles in maize. The numbers and effects of QTLs are positively associated with the phenotypic variation in the population, which, in turn, correlates positively with parental phenotypic and genetic variations. A large proportion (38.5%) of QTLs was associated with at least two traits, suggestive of the frequent occurrence of pleiotropic loci or closely linked loci. Key developmental genes, which previously were shown to affect plant architecture in mutant studies, were found to colocalize with many QTLs. Five QTLs were further validated using the segregating populations developed from residual heterozygous lines present in the recombinant inbred line populations. Additionally, one new plant height QTL, qPH3 , has been fine-mapped to a 600-kb genomic region where three candidate genes are located. These results provide insights into the genetic mechanisms controlling plant architecture and will benefit the selection of ideal plant architecture in maize breeding. © 2017 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Carlotta BALCONI
2014-05-01
Full Text Available Mycotoxin contamination of maize (Zea mays L. grain is a global threat to the safety of both human food and animal feed. Hence, the development of maize genotypes with reduced mycotoxin accumulation in grain is of major importance. In order to find maize germplasm sources of resistance to Fusarium ear rot, 34 Italian and six public inbred lines were evaluated by means of artificial inoculation in field experiments during 2009 and 2010. Relationships between ear rot and fumonisin concentration in the ears were investigated. Primary ears were challenged with a mixture of two Fusarium verticillioides isolates from Northern Italy, through kernel inoculation, and ear rot severity was assessed.The average number of visibly infected kernels per ear, after inoculation, ranged from 2 to 68 in 2009 and from 0 to 120 in 2010. Fumonisin concentrations in the inoculated ears were greater than in the experimental controls for both years. Variability was found between the inbred lines: fumonisin accumulation ranged from 0.56 to 240.83 mg kg-1 in 2009 and from 1.09 to 190.60 mg kg-1 in 2010. In both years, six inbred lines showed high fumonisin content (≥100 mg kg-1, while the other genotypes were almost equally split into two groups, low (≤10 mg kg-1 and medium (from 11 to 100 mg kg-1 fumonisin content. The number of infected kernels after artificial inoculation correlated with fumonisin concentration both in 2009 (r = 0.94; P≤0.01 and 2010 (r = 0.67; P≤0.01. Additionally, the percentage of internally infected kernels correlated positively with fumonisin concentration (r = 0.37; P≤0.01 and with the number of infected kernels (r = 0.29; P≤0.05. This research has demonstrated that Italian maize germplasm is a valid source of resistance to Fusarium ear rot. Furthermore, there is a strong association of visible Fusarium symptoms with fumonisin concentration, suggesting that selection in maize for reduced visible moulds should reduce the risk of
Directory of Open Access Journals (Sweden)
S. Mohammad zadeh
2013-11-01
Full Text Available The effects some traits on seed yield of recombinant inbred lines of wheat under water deficit stress was studied. This research was done at the Agricultural Research Stations, Islamic Azad University, Tabriz Branch in 2010- 2011. 28 recombinant inbred lines of wheat bread with two parents (Norstar and Zagros in split plot experiment based on a randomized complete block design with three replications at two irrigation levels (70 and 140 mm evaporation from pan class A were studied. Analysis of variance indicated a significant genetic differences in all traits under study among the lines. Lines No. 32, 163 and 182 produced highest yield under both irrigation levels. Number of spikes, grains per spike and harvest index had the highest positive correlation with grain yield. Path analysis based on stepwise regression showed that under the normal irrigation conditions, number spike (0.556, number of grains per spike (0.278, weight of 1000 grain (0.259 and the drought stress number spike (0.430, straw yield (0.276 and peduncle length (0.323 had the most direct and positive effect on yield respectively.
Directory of Open Access Journals (Sweden)
Thomas Degen
Full Text Available Plant volatiles induced by insect feeding are known to attract natural enemies of the herbivores. Six maize inbred lines that showed distinctly different patterns of volatile emission in laboratory assays were planted in randomized plots in the Central Mexican Highlands to test their ability to recruit parasitic wasps under field conditions. The plants were artificially infested with neonate larvae of the fall armyworm Spodoptera frugiperda, and two of its main endoparasitoids, Campoletis sonorensis and Cotesia marginiventris, were released in the plots. Volatiles were collected from equally treated reference plants in the neighbourhood of the experimental field. The cumulative amount of 36 quantified volatile compounds determined for each line was in good accordance with findings from the laboratory; there was an almost 15-fold difference in total emission between the two extreme lines. We found significant differences among the lines with respect to the numbers of armyworms recovered from the plants, their average weight gain and parasitism rates. Average weight of the caterpillars was negatively correlated with the average total amount of volatiles released by the six inbred lines. However, neither total volatile emission nor any specific single compound within the blend could explain the differential parasitism rates among the lines, with the possible exception of (E-2-hexenal for Campoletis sonorensis and methyl salicylate for Cotesia marginiventris. Herbivore-induced plant volatiles and/or correlates thereof contribute to reducing insect damage of maize plants through direct plant defence and enhanced attraction of parasitoids, alleged indirect defence. The potential to exploit these volatiles for pest control deserves to be further evaluated.
Directory of Open Access Journals (Sweden)
Hye Sun Cho
2016-12-01
Full Text Available Late bolting after cold exposure is an economically important characteristic of radish (Raphanus sativus L., an important Brassicaceae root vegetable crop. However, little information is available regarding the genes and pathways that govern flowering time in this species. We performed high-throughput RNA sequencing analysis to elucidate the molecular mechanisms that determine the differences in flowering times between two radish lines, NH-JS1 (late bolting and NH-JS2 (early bolting. In total, 71,188 unigenes were identified by reference-guided assembly, of which 309, 788, and 980 genes were differentially expressed between the two inbred lines after 0, 15, and 35 days of vernalization, respectively. Among these genes, 218 homologs of Arabidopsis flowering-time (Ft genes were identified in the radish, and 49 of these genes were differentially expressed between the two radish lines in the presence or absence of vernalization treatment. Most of the Ft genes up-regulated in NH-JS1 vs NH-JS2 were repressors of flowering, such as RsFLC, consistent with the late-bolting phenotype of NH-JS1. Although the functions of genes down-regulated in NH-JS1 were less consistent with late-bolting characteristics than the up-regulated Ft genes, several Ft enhancer genes, including RsSOC1, a key floral integrator, showed an appropriate expression to the late-bolting phenotype. In addition, the patterns of gene expression related to the vernalization pathway closely corresponded with the different bolting times of the two inbred lines. These results suggest that the vernalization pathway is conserved between radish and Arabidopsis.
Variability among inbred lines and RFLP mapping of sunflower isozymes
Directory of Open Access Journals (Sweden)
Carrera Alicia D.
2002-01-01
Full Text Available Eight isozyme systems were used in this study: acid phosphatase (ACP, alcohol dehydrogenase (ADH, esterase (EST, glutamate dehydrogenase (GDH, malate dehydrogenase (MDH, phosphoglucoisomerase (PGI, 6-phosphogluconate dehydrogenase (PGD, and phosphoglucomutase (PGM. The polymorphism of these enzyme systems was studied in 25 elite inbred lines. A total of 19 loci were identified, but only eight of them were polymorphic in the germplasm tested. The polymorphic index for the eight informative markers ranged from 0.08 to 0.57, with a mean value of 0.36. Five isozyme loci were mapped in F2:3 populations with existing RFLP data. Est-1, Gdh-2 and Pgi-2 were mapped to linkage groups 3, 14 and 9, respectively. As in previous reports, an ACP locus and a PGD locus were found to be linked, both located in linkage group 2 of the public sunflower map.
Induced cytomictic diversity in maize (Zea mays L.) inbred.
Rai, Prashant Kumar; Kumar, Girjesh; Tripathi, Avinash
2010-01-01
Mutation breeding has been used for improving oligogenic and polygenic characters, disease resistance and quantitative characters including yielding ability. The cytological stability of maize inbred lines is an important consideration in view of their extensive use in genetics and plant breeding research. Investigation in Zea mays L. confirms that the migration of chromosomes is a real event that cannot be misunderstood as an artifact produced by fixation or mechanical injuries. During present investigation, we found that out of six inbred lines of Zea mays L. viz. CM-135, CM-136, CM-137, CM-138, CM-142 and CM-213 at various treatment doses of gamma irradiations viz. 200, 400 and 600 Gy, some of the plants of inbred line CM- 138 at 200 Gy dose displayed characteristic cytoplasmic connections during all the stages of meiosis. Four plants from this treatment set were found to be engaged in a rare phenomenon reported as "Cytomixis". It elucidates that in inbred of Zea mays L., induced cytomixis through gamma rays treatment may be considered to be a possible source of production of aneuploid and polyploid gametes. This phenomenon may have several applications in Zea mays L. improvement in the sense of diversity and ever yield potential.
Directory of Open Access Journals (Sweden)
Heinz Ruth A
2008-01-01
Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop
Evaluation of Spring Wheat Recombinant Inbred Lines under Drought Stress
Directory of Open Access Journals (Sweden)
M. Moghaddaszadeh-Ahrabi
2012-07-01
Full Text Available Iran is one of arid and semi-arid regions of the world. Wheat as a strategic agricultural products faces water deficiency in most areas of the country. Therefore, identification of the resistant varieties to drought stress is one of main aims for breeders. To assess effect of drought stress at heading on 72 spring wheat recombinant inbred lines derived from American Yecora Rojo (high yielder, dwarf and early maturity as paternal parent and Iranian No. 49 line (tall and late maturiting as maternal parent cross were studied. The experiment was conducted at the Research Station of the University of Tabriz using a randomized complete block design with two replications during 2009 growing season. Based on the results from combined analysis of variance significant difference was observed among lines for all of traits studied, except for harvest index, grain number per spike and days to heading. There was significant difference between normal and drought stress conditions. Since the interaction between line and conditions was insignificant for all traits, it does therefore, provide the possibility of comparing the lines without regard to irrigation levels. Based on the means of, the traits it was found that the lines 96, 122, 123 and 155 were superior. MP, GMP and STI indices were recognized to be suitable indices to identify superior lines. With respect to these indices, lines 96, 122, 123, 138, 149 and 155 were found superior as compared with remaining lines. Based on stepwise regression analysis of grain yield with other traits, respectively grain number per spike, number of spikes/m2 and 1000 kernel weight were inserted into final model as effective variables on grain yield, which made 81/9 percent of the grain yield variation. Path analysis of grain yield and related traits, based on stepwise regression, demonstrated the significant positive direct effect for grain number per spike, number of spikes/m2 and 1000 kernel weight on grain yield
Czech Academy of Sciences Publication Activity Database
Soukup, Tomáš; Zachařová, Gisela; Smerdu, V.
2002-01-01
Roč. 104, č. 4 (2002), s. 399-405 ISSN 0065-1281 R&D Projects: GA ČR GA304/00/1653 Grant - others:CZ - SI Czech-Slovenian Intergovernmental S&T Co-operation(XC) - Institutional research plan: CEZ:AV0Z5011922 Keywords : inbred Lewis rats * skeletal muscles * soleus and EDL muscles Subject RIV: FH - Neurology Impact factor: 0.867, year: 2002
Comparative Cytotoxicity of the Herbicide Atrazine to Four Inbred Maize Lines (Zea mays L.)
International Nuclear Information System (INIS)
Shehata, Afaf I; AlGhethar, Haila A; AlHomaidan, Ali A; Arif, Ibrahim A
2008-01-01
Atrazine is one of the most widely used herbicides in the world. Recent reports have indicated that it has adverse impacts on the endocrine systems and on the early developments of wild animals and it has been banned in many European countries including Switzerland, the home of the manufacturing company. The genotoxic effects of Atrazine on four inbred lines of maize (Zea mays L.) were investigated. The herbicide showed mitoinhibition and clastogenic effects on the mitotic index of maize lines and they were proportional to the concentrations and time. The frequency of abnormality, chromosomal breakage, stickiness, lagging, C-metaphase and C-anaphase were observed at different stages of mitosis in treated cells. The harmful effect of this environmental pollutant proved that it may act as a strong mutagen. (author)
Farhanah, Mohd Isa; Yasmin, Abd Rahaman; Mat Isa, Nurulfiza; Hair-Bejo, Mohd; Ideris, Aini; Powers, Claire; Oladapo, Omobolanle; Nair, Venugopal; Khoo, Jia-Shiun; Ghazali, Ahmad-Kamal; Yee, Wai-Yan; Omar, Abdul Rahman
2018-01-01
Infectious bursal disease is a highly contagious disease in the poultry industry and causes immunosuppression in chickens. Genome-wide regulations of immune response genes of inbred chickens with different genetic backgrounds, following very virulent infectious bursal disease virus (vvIBDV) infection are poorly characterized. Therefore, this study aims to analyse the bursal tissue transcriptome of six inbred chicken lines 6, 7, 15, N, O and P following infection with vvIBDV strain UK661 using strand-specific next-generation sequencing, by highlighting important genes and pathways involved in the infected chicken during peak infection at 3 days post-infection. All infected chickens succumbed to the infection without major variations among the different lines. However, based on the viral loads and bursal lesion scoring, lines P and 6 can be considered as the most susceptible lines, while lines 15 and N were regarded as the least affected lines. Transcriptome profiling of the bursa identified 4588 genes to be differentially expressed, with 2985 upregulated and 1642 downregulated genes, in which these genes were commonly or uniquely detected in all or several infected lines. Genes that were upregulated are primarily pro-inflammatory cytokines, chemokines and IFN-related. Various genes that are associated with B-cell functions and genes related to apoptosis were downregulated, together with the genes involved in p53 signalling. In conclusion, bursal transcriptome profiles of different inbred lines showed differential expressions of pro-inflammatory cytokines and chemokines, Th1 cytokines, JAK-STAT signalling genes, MAPK signalling genes, and their related pathways following vvIBDV infection.
Directory of Open Access Journals (Sweden)
Joseph A Ross
2011-07-01
Full Text Available The nematode Caenorhabditis briggsae is an emerging model organism that allows evolutionary comparisons with C. elegans and exploration of its own unique biological attributes. To produce a high-resolution C. briggsae recombination map, recombinant inbred lines were generated from reciprocal crosses between two strains and genotyped at over 1,000 loci. A second set of recombinant inbred lines involving a third strain was also genotyped at lower resolution. The resulting recombination maps exhibit discrete domains of high and low recombination, as in C. elegans, indicating these are a general feature of Caenorhabditis species. The proportion of a chromosome's physical size occupied by the central, low-recombination domain is highly correlated between species. However, the C. briggsae intra-species comparison reveals striking variation in the distribution of recombination between domains. Hybrid lines made with the more divergent pair of strains also exhibit pervasive marker transmission ratio distortion, evidence of selection acting on hybrid genotypes. The strongest effect, on chromosome III, is explained by a developmental delay phenotype exhibited by some hybrid F2 animals. In addition, on chromosomes IV and V, cross direction-specific biases towards one parental genotype suggest the existence of cytonuclear epistatic interactions. These interactions are discussed in relation to surprising mitochondrial genome polymorphism in C. briggsae, evidence that the two strains diverged in allopatry, the potential for local adaptation, and the evolution of Dobzhansky-Muller incompatibilities. The genetic and genomic resources resulting from this work will support future efforts to understand inter-strain divergence as well as facilitate studies of gene function, natural variation, and the evolution of recombination in Caenorhabditis nematodes.
Directory of Open Access Journals (Sweden)
Baozhu Guo
2017-06-01
Full Text Available Two important mycotoxins, aflatoxin and fumonisin, are among the most potent naturally occurring carcinogens, contaminating maize (Zea mays and affecting crop yield and quality. Resistance of maize to pre-harvest mycotoxin contamination, specifically aflatoxin produced by Aspergillus flavus and fumonisin produced by Fusarium verticillioides, is a goal in breeding programs that screen for these important traits with the aim of developing resistant commercial hybrids. We conducted two years of field evaluations on 87 inbred lines originating primarily in China and Mexico and not previously screened for resistance. The objectives of our study were to identify resistant germplasm for breeding purposes and to examine possible relationships between resistances to the two mycotoxins. Aflatoxin and fumonisin were present in samples harvested from all lines in both years. Concentrations of total aflatoxin ranged from 52.00 ± 20.00 to 1524.00 ± 396.00 μg kg−1, while those of fumonisin ranged from 0.60 ± 0.06 to 124.00 ± 19.50 mg kg−1. The inbred lines TUN15, TUN61, TUN37, CY2, and TUN49 showed the lowest aflatoxin accumulation and CN1, GT601, TUN09, TUN61, and MP717 the lowest fumonisin accumulation. TUN61 showed the lowest accumulation of both mycotoxins. This study confirmed previous observations that high levels of aflatoxin can coexist with fumonisin, with 55 maize lines showing a positive correlation coefficient between the concentrations of aflatoxin and fumonisin and 32 lines showing a negative correlation coefficient. These selected lines, particularly TUN61, may provide sources of resistance to mycotoxin contamination in breeding programs. However, the mechanism of resistance in this germplasm remains to be identified. Future research should also address factors that influence the fungus–plant interaction, such as herbivory and environmental stress.
International Nuclear Information System (INIS)
Zhang Caibo; Wu Zhangdong; Xu Wei; Rong Tingzhao; Cao Moju
2013-01-01
In order to discover and utilize the valuable resources from spaceflight mutagenesis maize offspring effectively, cross combinations derived from the offspring of three different maize inbred lines induced by space flight were made to investigate the yield and related agronomic traits under different environmental conditions. Correlation and path analysis indicated that the factors affecting the yield of combinations varied with different mutagenic materials and environmental effects with larger effect coming from environment. Therefore, different selection strategies should be chosen for different induced maize. For the 08-641 mutagenic material, the 100-kernel weight should be first considered to select while taking into account the number of rows per ear and kernels per row. For the RP125 mutagenic material, the kernels per row should be first selected, and then to select the 100-kernels weight and the number of rows per ear traits. For 18-599 mutagenic material, the 100-seed weight should be first selected, then the plant height, ear diameter, ear height, kernels rate and other traits should be selected in different environments. Combined with field resistance, plant types and other traits, excellent maize inbred lines with high yield potential from space mutagenesis offspring were selected. Thus study has obtained some breeding materials useful for further breeding purpose, and provide a reference method as how to use the spaceflight induced materials for for maize breeding. (authors)
Directory of Open Access Journals (Sweden)
Suguru E Tanaka
Full Text Available The pine wood nematode, Bursaphelenchus xylophilus, is the causal agent of pine wilt disease. This nematode has two developmental forms in its life cycle; i.e., the propagative and dispersal forms. The former is the form that builds up its population inside the host pine. The latter is specialized for transport by the vector. This form is separated into two dispersal stages (third and fourth; the third-stage dispersal juvenile (JIII is specialized for survival under unfavorable conditions, whereas the fourth-stage juvenile (JIV, which is induced by a chemical signal from the carrier Monochamus beetle, is transported to new host pines and invades them. Because of its importance in the disease cycle, molecular and chemical aspects of the JIV have been investigated, while the mechanism of JIII induction has not been sufficiently investigated. In an effort to clarify the JIII induction process, we established inbred lines of B. xylophilus and compared their biological features. We found that the total number of nematodes (propagation proportion was negatively correlated with the JIII emergence proportion, likely because nematode development was arrested at JIII; i.e., they could not develop to adults via the reproductive stage. In addition, JIII induction seemed to be regulated by a small number of genes because the JIII induction proportion varied among inbred lines despite the high homozygosity of the parental line. We also demonstrated that JIII can be artificially induced by the nematode's secreted substances. This is the first report of artificial induction of JIII in B. xylophilus. The dauer (dispersal juvenile of the model organism Caenorhabditis elegans corresponds functionally to JIII of B. xylophilus, and this stage is known to be induced by a chemical signal referred to as daumone, derived from the nematodes' secretion. The artificial induction of JIII suggests the presence of daumone-like material in B. xylophilus.
Effects of the time of application and the form of nitrogen on two maize inbred lines seed yield
Directory of Open Access Journals (Sweden)
Hojka Zdravko
2005-01-01
Full Text Available The study was carried out in the experimental filed of the Maize Research Institute, Zemun Polje, on calcareous chernozem in the period 2001-2003. The traits of two maize inbred lines (L1-FAO 400 and L2-FAO 600 were observed in dependence on the time of the nitrogen application (No-control without fertilizing; Nautumn - 60 kg P2O5 ha-1 and 60 kg K2O ha-1 applied in autumn (const + 100 kg N ha-1 (applied in autumn; Nspring - PK (const + 100 kg N ha-1 (applied in spring; N1/2 - PK (const + 100 kg N ha-1 (half of which was applied in autumn and the other half in spring; N1/2-PK (const 100 kg N ha-1 (1/3 of which was applied in autumn, 1/3 in spring and 1/3 through soil dressing; Nmin - PK (const + fertilizing in spring on the basis of the Nmin method, and forms of applied nitrogen: Urea (amide form KAN (ammonium-nitrate form and (NH42SO4 (ammonium form. The highest average yield was obtained by the use of Nmin method (3,486 kg ha-1, as well as, 100 kg N ha-1 applied in sprig (Nspring (3,337 kg ha-1, 100 kg N ha-1 applied in autumn and spring (N1/2 (3,020 kgha-1 and 100 kg N ha-1 applied in autumn, spring and soil dressing (N1/3 (3,005 kg ha-1 in the ammonium-nitrate form (KAN. The highest average seed yield of observed maize inbred lines (3,264 kg ha-1 was obtained by the application of ammonium-sulphate in the primary tillage (Nautumn. The use of the Nmin method (N ranging from 17 to 35 kg ha-1, in dependence on the soil mineral nitrogen content, especially in years with lower precipitation sums resulted in the highest increase in seed yield (39.2% of observed maize inbred lines in relation to the control.
Research of genetic mapping of QTLs for macronutrient accumulation in soybean seed is limited. Therefore, the objective of this research was to identify QTLs related to macronutrients (N, C, S, P, K, Ca, and Mg) in seeds in 92 F5:7 recombinant inbred lines developed from a cross between MD 96-5722 (...
SNP frequency, haplotype structure and linkage disequilibrium in elite maize inbred lines
Directory of Open Access Journals (Sweden)
Smith Oscar
2002-10-01
Full Text Available Abstract Background Recent studies of ancestral maize populations indicate that linkage disequilibrium tends to dissipate rapidly, sometimes within 100 bp. We set out to examine the linkage disequilibrium and diversity in maize elite inbred lines, which have been subject to population bottlenecks and intense selection by breeders. Such population events are expected to increase the amount of linkage disequilibrium, but reduce diversity. The results of this study will inform the design of genetic association studies. Results We examined the frequency and distribution of DNA polymorphisms at 18 maize genes in 36 maize inbreds, chosen to represent most of the genetic diversity in U.S. elite maize breeding pool. The frequency of nucleotide changes is high, on average one polymorphism per 31 bp in non-coding regions and 1 polymorphism per 124 bp in coding regions. Insertions and deletions are frequent in non-coding regions (1 per 85 bp, but rare in coding regions. A small number (2–8 of distinct and highly diverse haplotypes can be distinguished at all loci examined. Within genes, SNP loci comprising the haplotypes are in linkage disequilibrium with each other. Conclusions No decline of linkage disequilibrium within a few hundred base pairs was found in the elite maize germplasm. This finding, as well as the small number of haplotypes, relative to neutral expectation, is consistent with the effects of breeding-induced bottlenecks and selection on the elite germplasm pool. The genetic distance between haplotypes is large, indicative of an ancient gene pool and of possible interspecific hybridization events in maize ancestry.
Mascher, Martin; Gerlach, Nina; Gahrtz, Manfred; Bucher, Marcel; Scholz, Uwe; Dresselhaus, Thomas
2014-01-01
Maize (Zea mays) is the most widely grown crop species in the world and a classical model organism for plant research. The completion of a high-quality reference genome sequence and the advent of high-throughput sequencing have greatly empowered re-sequencing studies in maize. In this study, plants of maize inbred line B73 descended from two different sets of seed material grown for several generations either in the field or in the greenhouse were found to show a different growth phenotype and ionome under phosphate starvation conditions and moreover a different responsiveness towards mycorrhizal fungi of the species Glomus intraradices (syn: Rhizophagus irregularis). Whole genome re-sequencing of individuals from both sets and comparison to the B73 reference sequence revealed three cryptic introgressions on chromosomes 1, 5 and 10 in the line grown in the greenhouse summing up to a total of 5,257 single-nucleotide polymorphisms (SNPs). Transcriptome sequencing of three individuals from each set lent further support to the location of the introgression intervals and confirmed them to be fixed in all sequenced individuals. Moreover, we identified >120 genes differentially expressed between the two B73 lines. We thus have found a nearly-isogenic line (NIL) of maize inbred line B73 that is characterized by an altered growth phenotype under phosphate starvation conditions and an improved responsiveness towards symbiosis with mycorrhizal fungi. Through next-generation sequencing of the genomes and transcriptomes we were able to delineate exact introgression intervals. Putative de novo mutations appeared approximately uniformly distributed along the ten maize chromosomes mainly representing G:C -> A:T transitions. The plant material described in this study will be a valuable tool both for functional studies of genes differentially expressed in both B73 lines and for research on growth behavior especially in response to symbiosis between maize and mycorrhizal fungi.
Directory of Open Access Journals (Sweden)
Martin Mascher
Full Text Available Maize (Zea mays is the most widely grown crop species in the world and a classical model organism for plant research. The completion of a high-quality reference genome sequence and the advent of high-throughput sequencing have greatly empowered re-sequencing studies in maize. In this study, plants of maize inbred line B73 descended from two different sets of seed material grown for several generations either in the field or in the greenhouse were found to show a different growth phenotype and ionome under phosphate starvation conditions and moreover a different responsiveness towards mycorrhizal fungi of the species Glomus intraradices (syn: Rhizophagus irregularis. Whole genome re-sequencing of individuals from both sets and comparison to the B73 reference sequence revealed three cryptic introgressions on chromosomes 1, 5 and 10 in the line grown in the greenhouse summing up to a total of 5,257 single-nucleotide polymorphisms (SNPs. Transcriptome sequencing of three individuals from each set lent further support to the location of the introgression intervals and confirmed them to be fixed in all sequenced individuals. Moreover, we identified >120 genes differentially expressed between the two B73 lines. We thus have found a nearly-isogenic line (NIL of maize inbred line B73 that is characterized by an altered growth phenotype under phosphate starvation conditions and an improved responsiveness towards symbiosis with mycorrhizal fungi. Through next-generation sequencing of the genomes and transcriptomes we were able to delineate exact introgression intervals. Putative de novo mutations appeared approximately uniformly distributed along the ten maize chromosomes mainly representing G:C -> A:T transitions. The plant material described in this study will be a valuable tool both for functional studies of genes differentially expressed in both B73 lines and for research on growth behavior especially in response to symbiosis between maize and
Hong, Liang-Li; Tian, Dong-Ping; Su, Min; Shen, Xiu-Na; Gao, Yuxia
2006-01-01
To establish the selenium (Se) deficient animal model on F344 inbred line rats and observe the effects of a long-term Se-deficiency on the offspring's neuro-behavior, abilities of learning and memory. Feeding F344 inbred line rats on Se-deficient diet to establish Se-deficient animal model. For the offspring, the body weight, physiological indexes nervous reflections for growth and development were monitored during the early postnatal period. The Se-deficient diet contained less than 0.01 mg/kg and the glutathione peroxidase (GSH-Px) activity in blood of the Se-deficient group rats is lower than the Se-normal group after feeding on Se-deficient diet for 4 weeks. For the offspring, the birth weight and the body weight of Se-deficient group were obviously lower than the Se-normal group before weaning. Se-deficient offspring rats differed from Se-normal controls in lower scores in surface righting reflex (RR) test at postnatal 4th day after delivery, cliff avoidance test at postnatal 7th day and auditory acuity trial at postnatal 10th day respectively. But these differences disappear after a few days in the same tests. In addition, no significant differences between two groups in suspending test and walking ability test at postnatal 12th and 14th day. In open field test, Se-deficient male offspring stayed less time in the middle grid and moved less. In Morris water maze test, the Se-deficient offspring spent more time to find the hidden platform at the 6th and 9th training tests in the place navigation trial. Furthermore, the Se-deficient group spent less time in target quadrant when giving the spatial probe trial. A Se-deficient animal model have been established on F344 inbred line rats successfully. A long-term Se deficiency could retard the development of the offspring in uterus and after delivery. Se deficiency also decreased the offspring's abilities of spatial learning and memory in Morris water maze test and resulted in the male offspring's nervousness to new
Preliminary study on mutagenic effects of heavy ions irradiation on maize inbred lines
International Nuclear Information System (INIS)
Yu Lixia; Li Wenjian; Xie Hongmei; Chen Xuejun; Chen Jing
2010-01-01
In order to study mutagenic effects of different heavy ions irradiation on maize inbred lines,corn seeds of Zheng58, Lu9801, Jinxiang4C-1, CSR24001, 308 and 478 were irradiated with 12 C 6+ and 36 Ar 18+ ions. The experimental results showed that the germination rate and planting percent were different after irradiation. The wettish seeds had higher sensibility to heavy ion irradiation. The leaf type of the plant appeared visible changes in M 1 generation. In M 2 generation, great changes had taken place in economic traits, many of which are beneficial mutation. Some beneficia1 mutation could be stably inherited in M 3 generation. From the above, it can be predicted that heavy ions irradiation is an effective means of genetic improvement of maize. (authors)
International Nuclear Information System (INIS)
Li Qi; Shi Haichun; Ke Yongpei; Yuan Jichao; Yu Xuejie
2011-01-01
Analyzing the biological effects and the genetic variations of maize mutagenic progenies is important to facilitate effective selections and utilization of the mutants. In this study, the genetic variation of 103 mutagenic progenies of M 3 lines of inbred lines 48-2 and R08 with 60 Co γ-rays inducement were evaluated with SSR molecular markers. The results indicated that, the amplitude of polymorphism information content (PIC) of the 48-2 and R08 M 3 lines ranged 0.307 ∼ 0.948 and 0.108 ∼ 0.955, with an average of 0.762 and 0.701, respectively. The amplitude of genetic diversity indexes (H') ranged 0.552 ∼ 2.830 and 0.254 ∼ 3.309, with an average of 1.830 and 1.777, respectively. The average value of genetic similarity coefficient of the 49 M 3 lines of 48-2 with its check (M673) was 0.8194. However, the average value of genetic similarity coefficient of the M 3 lines of R08 with its check (M487) was 0.8373. Based on the genetic similarity coefficient, inbred lines 48-2, R08 and their 101 M 3 lines were clustered in 7 and 5 populations respectively. This phenomenon indicated that massive genetic variation could appear in progenies due to irradiation. The strengthen of selection and utilization of mutants based on the breeding objectives and in accordance with the feature and regularity on genetic variations of main characteristics of mutant lines in various populations could be enhanced in breeding program, to some extent, which can increase the breeding efficiency of irradiation induced mutation in maize. (authors)
Comparison of RAPD, RFLP, AFLP and SSR markers for diversity studies in tropical maize inbred lines
Directory of Open Access Journals (Sweden)
Antonio A. F. Garcia
2004-01-01
Full Text Available In order to compare their relative efficiencies as markers and to find the most suitable marker for maize diversity studies we evaluated 18 inbred tropical maize lines using a number of different loci as markers. The loci used were: 774 amplified fragment length polymorphisms (AFLPs; 262 random amplified polymorphic DNAs (RAPDs; 185 restriction fragment length polymorphisms (RFLPs; and 68 simple sequence repeats (SSR. For estimating genetic distance the AFLP and RFLP markers gave the most correlated results, with a correlation coefficient of r = 0.87. Bootstrap analysis were used to evaluate the number of loci for the markers and the coefficients of variation (CV revealed a skewed distribution. The dominant markers (AFLP and RAPD had small CV values indicating a skewed distribution while the codominant markers gave high CV values. The use of maximum values of genetic distance CVs within each sample size was efficient in determining the number of loci needed to obtain a maximum CV of 10%. The number of RFLP and AFLP loci used was enough to give CV values of below 5%, while the SSRs and RAPD loci gave higher CV values. Except for the RAPD markers, all the markers correlated genetic distance with single cross performance and heterosis which showed that they could be useful in predicting single cross performance and heterosis in intrapopulation crosses for broad-based populations. Our results indicate that AFLP seemed to be the best-suited molecular assay for fingerprinting and assessing genetic relationships among tropical maize inbred lines with high accuracy.
Directory of Open Access Journals (Sweden)
Antônio Régis de Oliveira
2009-12-01
Full Text Available Vinte e nove linhagens de tomateiro rasteiro foram avaliadas quanto à eficiência de absorção de nutrientes e resposta à adubação, em dois ensaios, no ano de 2006, na Embrapa Hortaliças. No primeiro ensaio aplicou-se 1/3 da dosagem de fertilizante utilizada no segundo. O delineamento experimental foi inteiramente casualizado, com três repetições. As linhagens foram classificadas quanto à eficiência na absorção de nutrientes e reposta à adubação baseando-se nos incrementos de índice DRIS e nos incrementos de produtividade. Os valores críticos para eficiência na absorção e resposta à adubação foram as médias de incremento de índice DRIS e produtividade, respectivamente. As linhagens diferenciaram-se quanto à eficiência na absorção dos nutrientes e quanto à resposta à adubação. Foram consideradas responsivas à adubação e eficientes na absorção de nutrientes as linhagens 03, 04, 05, 09 e 22, para o N; 03, 04, 09, 13, 15 e 29, para o P; 03, 05, 10, 21, 22, 25 e 27, para o K; 05, 10, 21, 22, 25, 27 e 29, para o Ca; 04, 13, 15, 27 e 29, para o S e B; e 03, 05, 09, 10 e 27, para o Cu. As linhagens com os melhores desempenhos foram a 27, na absorção dos nutrientes, e 03, 04, 05 e 29, na responsividade à adubação.Twenty nine processing tomato inbred lines were evaluated for their efficiency in nutrient uptake and in their response to fertilization. Two field assays were carried out at Embrapa Hortaliças, Brazil, with distinct fertilization dosages in 2006. In the first assay 1/3 of the total fertilization was applied when compared with the second assay. The experiments were conducted using a completely randomized design with three replications. The criteria to rank the inbred lines in both assays were the DRIS (Diagnosis and Recommendation Integrated System index value and fruit yield. The critical values in order to distinguish efficient versus non-efficient as well as responsive versus non-responsive inbred
Gershman, S N; Barnett, C A; Pettinger, A M; Weddle, C B; Hunt, J; Sakaluk, S K
2010-09-01
Inbreeding is assumed to have negative effects on fitness, including the reduced ability to withstand immune challenges. We examined the immunological consequences of inbreeding in decorated crickets, Gryllodes sigillatus, by comparing lytic activity, phenoloxidase (PO) activity, and encapsulation ability of crickets from eight inbred lines with that of crickets from the outbred founder population. Surprisingly, crickets from inbred lines had a greater encapsulation ability compared with crickets from the outbred population. We suggest that because inbred crickets have reduced reproductive effort, they may, therefore, have the option of devoting more resources to this form of immunity than outbred individuals. We also found that both inbred and outbred females had higher immunity than males in PO activity and implant darkness. This result supports the hypothesis that females should devote more effort to somatic maintenance and immunity than males. PO activity and implant darkness were heritable in both males and females, but lytic activity was only heritable in females. Males and females differed in the heritability of, and genetic correlations among, immune traits, suggesting that differences in selective pressures on males and females may have resulted in a sexual conflict over optimal immune trait values.
DEFF Research Database (Denmark)
Baum, M.; Grando, S.; Backes, G.
2003-01-01
A genetic linkage map has been developed for recombinant inbred lines (RILs) of the cross 'Arta' x Hordeum spontaneum 41-1. One hundred and ninety four RILs, randomly chosen from a population of 494 RILs, were mapped with 189 markers including one morphological trait (btr = brittle rachis locus...
Physiological and photosynthesis response of popcorn inbred seedings to waterlogging stress
International Nuclear Information System (INIS)
Zhu, M.; Wang, J.; Li, F.; Shi, Z.
2015-01-01
Waterlogging is one of the most severe global problems, which affects crop growth and yield worldwide, especially in the low-lying rainfed areas, and irrigated and heavy rainfall environment. Our objective was to study the physiological and photosynthetic characteristics of two popcorn genotypes under waterlogging conditions. The experiment was carried out in pots with two contrasting inbred lines differing in waterlogging tolerance: Q5 (tolerant) and Q10 (sensitive). Leaf gas exchange, oxidative stress, and chlorophyll (Chl) fluorescence were measured at 0, 2, 4, and 6d in the control and waterlogged plants. A decrease in net photosynthesis, stomatal conductance, and transpiration was observed in both genotypes. The waterlogging-sensitive plants showed reduced chlorophyll fluorescence, chlorophyll content and increased activity of peroxidase and polyphenol oxidase. Response curves for the relationship between photosynthetically active radiation (PAR) and net photosynthetic rate (P /subN/ ) for waterlogged plants were similar in both genotypes. The different physiological and photosynthetic response in the two popcorn inbred lines might be responsible for higher tolerance of Q5 than Q10. These results suggest that Q5 popcorn inbred lines are a source of genetic diversity for important traits such as P /subN/ and WUE. (author)
Directory of Open Access Journals (Sweden)
Pedram Kashiani
2012-01-01
Full Text Available A study of genetic variation among 10 pairs of chromosomes extracted from 13 tropical sweet corn inbred lines, using 99 microsatellite markers, revealed a wide range of genetic diversity. Allelic richness and the number of effective alleles per chromosome ranged from 2.78 to 4.33 and 1.96 to 3.47, respectively, with respective mean values of 3.62 and 2.73. According to the Shannon's information index (I and Nei's gene diversity coefficient (Nei, Chromosome 10 was the most informative chromosome (I = 1.311 and Nei = 0.703, while Chromosome 2 possessed the least (I = 0.762 and Nei = 0.456. Based on linkage disequilibrium (LD measurements for loci less than 50 cM apart on the same chromosome, all loci on Chromosomes 1, 6 and 7 were in equilibrium. Even so, there was a high proportion of genetic variation in Chromosomes 4, 5, 8, 9 and 10, thereby revealing their appropriateness for use in the genetic diversity investigations among tropical sweet corn lines. Chromosome 4, with the highest number of loci in linkage disequilibrium, was considered the best for marker-phenotype association and QTL mapping, followed by Chromosomes 5, 8, 9 and 10.
Combing Ability Analysis ofamong Early Generation Maize Inbred ...
African Journals Online (AJOL)
dagne.cimdom
estimate combining ability effects of locally developed and introduced early generation maize inbred lines for grain ... variance revealed significant difference among the hybrids for all studied traits. General ... Guto LMS5, L15 x SC22 and L20 x TSC22) gave significantly higher grain yield advantage over the two standard ...
Energy Technology Data Exchange (ETDEWEB)
Carneiro, Ana [Vanderbilt University; Airey, David [University of Tennessee Health Science Center, Memphis; Thompson, Brent [Vanderbilt University; Zhu, C [Vanderbilt University; Rinchik, Eugene M [ORNL; Lu, Lu [University of Tennessee Health Science Center, Memphis; Chesler, Elissa J [ORNL; Erikson, Keith [University of North Carolina; Blakely, Randy [Vanderbilt University
2009-01-01
The human serotonin (5-hydroxytryptamine, 5-HT) transporter (hSERT, SLC6A4) figures prominently in the etiology or treatment of many prevalent neurobehavioral disorders including anxiety, alcoholism, depression, autism and obsessive-compulsive disorder (OCD). Here we utilize naturally occurring polymorphisms in recombinant inbred (RI) lines to identify novel phenotypes associated with altered SERT function. The widely used mouse strain C57BL/6J, harbors a SERT haplotype defined by two nonsynonymous coding variants (Gly39 and Lys152 (GK)). At these positions, many other mouse lines, including DBA/2J, encode Glu39 and Arg152 (ER haplotype), assignments found also in hSERT. Synaptosomal 5-HT transport studies revealed reduced uptake associated with the GK variant. Heterologous expression studies confirmed a reduced SERT turnover rate for the GK variant. Experimental and in silico approaches using RI lines (C57Bl/6J X DBA/2J=BXD) identifies multiple anatomical, biochemical and behavioral phenotypes specifically impacted by GK/ER variation. Among our findings are multiple traits associated with anxiety and alcohol consumption, as well as of the control of dopamine (DA) signaling. Further bioinformatic analysis of BXD phenotypes, combined with biochemical evaluation of SERT knockout mice, nominates SERT-dependent 5-HT signaling as a major determinant of midbrain iron homeostasis that, in turn, dictates ironregulated DA phenotypes. Our studies provide a novel example of the power of coordinated in vitro, in vivo and in silico approaches using murine RI lines to elucidate and quantify the system-level impact of gene variation.
Cho, Myeong-Je; Wu, Emily; Kwan, Jackie; Yu, Maryanne; Banh, Jenny; Linn, Wutt; Anand, Ajith; Li, Zhi; TeRonde, Susan; Register, James C; Jones, Todd J; Zhao, Zuo-Yu
2014-10-01
An improved Agrobacterium -mediated transformation protocol is described for a recalcitrant commercial maize elite inbred with optimized media modifications and AGL1. These improvements can be applied to other commercial inbreds. This study describes a significantly improved Agrobacterium-mediated transformation protocol in a recalcitrant commercial maize elite inbred, PHR03, using optimal co-cultivation, resting and selection media. The use of green regenerative tissue medium components, high copper and 6-benzylaminopurine, in resting and selection media dramatically increased the transformation frequency. The use of glucose in resting medium further increased transformation frequency by improving the tissue induction rate, tissue survival and tissue proliferation from immature embryos. Consequently, an optimal combination of glucose, copper and cytokinin in the co-cultivation, resting and selection media resulted in significant improvement from 2.6 % up to tenfold at the T0 plant level using Agrobacterium strain LBA4404 in transformation of PHR03. Furthermore, we evaluated four different Agrobacterium strains, LBA4404, AGL1, EHA105, and GV3101 for transformation frequency and event quality. AGL1 had the highest transformation frequency with up to 57.1 % at the T0 plant level. However, AGL1 resulted in lower quality events (defined as single copy for transgenes without Agrobacterium T-DNA backbone) when compared to LBA4404 (30.1 vs 25.6 %). We propose that these improvements can be applied to other recalcitrant commercial maize inbreds.
Jiang, Tingbo; Zhou, Boru; Luo, Meng; Abbas, Hamed K.; Kemerait, Robert; Lee, Robert Dewey; Scully, Brian T.; Guo, Baozhu
2011-01-01
This research examined the expression patterns of 94 stress-related genes in seven maize inbred lines with differential expressions of resistance to aflatoxin contamination. The objective was to develop a set of genes/probes associated with resistance to A. flavus and/or aflatoxin contamination. Ninety four genes were selected from previous gene expression studies with abiotic stress to test the differential expression in maize lines, A638, B73, Lo964, Lo1016, Mo17, Mp313E, and Tex6, using real-time RT-PCR. Based on the relative-expression levels, the seven maize inbred lines clustered into two different groups. One group included B73, Lo1016 and Mo17, which had higher levels of aflatoxin contamination and lower levels of overall gene expression. The second group which included Tex6, Mp313E, Lo964 and A638 had lower levels of aflatoxin contamination and higher overall levels of gene expressions. A total of six “cross-talking” genes were identified between the two groups, which are highly expressed in the resistant Group 2 but down-regulated in susceptible Group 1. When further subjected to drought stress, Tex6 expressed more genes up-regulated and B73 has fewer genes up-regulated. The transcript patterns and interactions measured in these experiments indicate that the resistant mechanism is an interconnected process involving many gene products and transcriptional regulators, as well as various host interactions with environmental factors, particularly, drought and high temperature. PMID:22069724
International Nuclear Information System (INIS)
Iwakiri, Takeharu; Ishihara, Hideta; Terao, Hiromitsu; Lork, Enno; Gesing, Thorsten M.
2017-01-01
The crystal structures of [C 2 H 5 NH 3 ] 4 InBr 7 (1), [C(NH 2 ) 3 ] 3 InBr 6 (2), and [H 3 NCH 2 C(CH 3 ) 2 CH 2 NH 3 ]InBr 5 (3) were determined at 100(2) K: monoclinic, P2 1 /n, a=1061.94(3), b=1186.40(4), c=2007.88(7) pm, β= 104.575(1) , Z=4 for 1; monoclinic, C2/c, a=3128.81(12), b=878.42(3), c=2816.50(10) pm, β=92.1320(10) , Z=16 for 2; orthorhombic, P2 1 2 1 2 1 , a=1250.33(5), b=1391.46(6), c=2503.22(9) pm, Z=4 for 3. The structure of 1 contains an isolated octahedral [InBr 6 ] 3- ion and a Br - ion. The structure of 2 contains three different isolated octahedral [InBr 6 ] 3- ions. The structure of 3 has a corner-shared double-octahedral [In 2 Br 11 ] 5- ion and an isolated tetrahedral [InBr 4 ] - ion. The 81 Br nuclear quadrupole resonance (NQR) lines of the terminal Br atoms of the compounds are widely spread in frequency, and some of them show unusual positive temperature dependence. These observations manifest the N-H..Br-In hydrogen bond networks developed between the cations and anions to stabilize the crystal structures. The 81 Br NQR and differential thermal analysis (DTA) measurements have revealed the occurrence of unique phase transitions in 1 and 3. When the bond angles were estimated from the electric field gradient (EFG) directions calculated by the molecular orbital (MO) methods, accurate values were obtained for [InBr 6 ] 3- of 1 and for [In 2 Br 11 ] 5- and [InBr 4 ] - of 3, except for several exceptions in those for the latter two ions. On the other hand, the calculations of 81 Br NQR frequencies have produced up to 1.4 times higher values than the observed ones.
Directory of Open Access Journals (Sweden)
Josipovic Marko
2014-01-01
Full Text Available Four inbred lines of maize (Os 438-95 = C1, Os 30-8 = C2, Os 6 = C3 and Os 1-44 =C4 were grown for 4-year period (2006-2009 in the stationary field experiment on Osijek eutric cambisol. Impact of irrigation, nitrogen fertilization and genotype were tested. Soil moisture was maintained by two irrigation rates from 60-100% and 80-100% of the field water capacity. Two steps of N (0, 100 and 200 kg N ha-1 were applied, while P and K fertilization was equal (500 kg/ha NPK 0:30:20. Eight maize genotypes (four inbred lines and four hybrids were grown on each basic plot of fertilization. The experiment was duplicated for maize - soybean rotation. The experiment was set by split-split plot method according to randomized block design in three replicates. The basic plot areas were 617.2 m2 (irrigation, 313.6 m2 (fertilization and 39.2 m2 (genotype. Selection of N non-fertilized treatment and four inbred lines were made for this study with aim of testing year (A irrigation (B and genotype (C effects under natural N-soil conditions. Average grain yield in level 1809 kg ha-1without N fertilization is indication of very high fertility of the soil. Differences of yield among the years were from 823 (2007 to 2450 (2006 kg ha-1. Excessive drought and high air-temperature stress is responsible for the low maize yield in 2007. Irrigation considerable affected on maize yields (4-year averages: 1500, 1809 and 2118 kg ha-1, for B1, B2 and B3, respectively. Differences of the 4-year average yields among the genotypes were from 1259 (C3 to 2765 (C1 kg ha-1. Differences of yield among the genotypes in the different years were also considerable because the lowest yield was for 71% (A1, 23% (A2, 63% (A3 and 40% (A4 lower in comparison to the highest yield. The genotype effects under different water supplies were less influencing factor because the high-yielding C1 had for 128%, 129% and 106% the higher yield compared to the low-yielding C3, for B1, B2 and B3, respectively
Directory of Open Access Journals (Sweden)
Hedayat eBagheri
2012-08-01
Full Text Available A recombinant inbred line (RIL population was produced based on a wide cross between the rapid-cycling and self-compatible genotypes L58, a Caixin vegetable type, and R-o-18, a yellow sarson oil type. A linkage map based on 160 F7 lines was constructed using 100 SNP, 130 AFLP®, 27 InDel and 13 publicly available SSR markers. The map covers a total length of 1150 cM with an average resolution of 4.3 cM/marker. To demonstrate the versatility of this new population, 17 traits, related to plant architecture and seed characteristics, were subjected to QTL analysis. A total of 47 QTLs were detected, each explaining between 6 to 54% of the total phenotypic variance for the concerned trait. The genetic analysis shows that this population is a useful new tool for analyzing genetic variation for interesting traits in B. rapa, and for further exploitation of the recent availability of the B. rapa whole genome sequence for gene cloning and gene function analysis.
A new set of BXD recombinant inbred lines from advanced intercross populations in mice
Directory of Open Access Journals (Sweden)
Gu Jing
2004-04-01
Full Text Available Abstract Background Recombinant inbred (RI strains are an important resource for mapping complex traits in many species. While large RI panels are available for Arabidopsis, maize, C. elegans, and Drosophila, mouse RI panels typically consist of fewer than 30 lines. This is a severe constraint on the power and precision of mapping efforts and greatly hampers analysis of epistatic interactions. Results In order to address these limitations and to provide the community with a more effective collaborative RI mapping panel we generated new BXD RI strains from two independent advanced intercrosses (AI between C57BL/6J (B6 and DBA/2J (D2 progenitor strains. Progeny were intercrossed for 9 to 14 generations before initiating inbreeding, which is still ongoing for some strains. Since this AI base population is highly recombinant, the 46 advanced recombinant inbred (ARI strains incorporate approximately twice as many recombinations as standard RI strains, a fraction of which are inevitably shared by descent. When combined with the existing BXD RI strains, the merged BXD strain set triples the number of previously available unique recombinations and quadruples the total number of recombinations in the BXD background. Conclusion The combined BXD strain set is the largest mouse RI mapping panel. It is a powerful tool for collaborative analysis of quantitative traits and gene function that will be especially useful to study variation in transcriptome and proteome data sets under multiple environments. Additional strains also extend the value of the extensive phenotypic characterization of the previously available strains. A final advantage of expanding the BXD strain set is that both progenitors have been sequenced, and approximately 1.8 million SNPs have been characterized. This provides unprecedented power in screening candidate genes and can reduce the effective length of QTL intervals. It also makes it possible to reverse standard mapping strategies and
Highly efficient generation of GGTA1 biallelic knockout inbred mini-pigs with TALENs.
Directory of Open Access Journals (Sweden)
Jige Xin
Full Text Available Inbred mini-pigs are ideal organ donors for future human xenotransplantations because of their clear genetic background, high homozygosity, and high inbreeding endurance. In this study, we chose fibroblast cells from a highly inbred pig line called Banna mini-pig inbred line (BMI as donor nuclei for nuclear transfer, combining with transcription activator-like effector nucleases (TALENs and successfully generated α-1,3-galactosyltransferase (GGTA1 gene biallelic knockout (KO pigs. To validate the efficiency of TALEN vectors, in vitro-transcribed TALEN mRNAs were microinjected into one-cell stage parthenogenetically activated porcine embryos. The efficiency of indel mutations at the GGTA1-targeting loci was as high as 73.1% (19/26 among the parthenogenetic blastocysts. TALENs were co-transfected into porcine fetal fibroblasts of BMI with a plasmid containing neomycin gene. The targeting efficiency reached 89.5% (187/209 among the survived cell clones after a 10 d selection. More remarkably 27.8% (58/209 of colonies were biallelic KO. Five fibroblast cell lines with biallelic KO were chosen as nuclear donors for somatic cell nuclear transfer (SCNT. Three miniature piglets with biallelic mutations of the GGTA1 gene were achieved. Gal epitopes on the surface of cells from all the three biallelic KO piglets were completely absent. The fibroblasts from the GGTA1 null piglets were more resistant to lysis by pooled complement-preserved normal human serum than those from wild-type pigs. These results indicate that a combination of TALENs technology with SCNT can generate biallelic KO pigs directly with high efficiency. The GGTA1 null piglets with inbred features created in this study can provide a new organ source for xenotransplantation research.
Slovin, Janet P; Schmitt, Kyle; Folta, Kevin M
2009-10-31
The diploid woodland strawberry (Fragaria vesca) is an attractive system for functional genomics studies. Its small stature, fast regeneration time, efficient transformability and small genome size, together with substantial EST and genomic sequence resources make it an ideal reference plant for Fragaria and other herbaceous perennials. Most importantly, this species shares gene sequence similarity and genomic microcolinearity with other members of the Rosaceae family, including large-statured tree crops (such as apple, peach and cherry), and brambles and roses as well as with the cultivated octoploid strawberry, F. xananassa. F. vesca may be used to quickly address questions of gene function relevant to these valuable crop species. Although some F. vesca lines have been shown to be substantially homozygous, in our hands plants in purportedly homozygous populations exhibited a range of morphological and physiological variation, confounding phenotypic analyses. We also found the genotype of a named variety, thought to be well-characterized and even sold commercially, to be in question. An easy to grow, standardized, inbred diploid Fragaria line with documented genotype that is available to all members of the research community will facilitate comparison of results among laboratories and provide the research community with a necessary tool for functionally testing the large amount of sequence data that will soon be available for peach, apple, and strawberry. A highly inbred line, YW5AF7, of a diploid strawberry Fragaria vesca f. semperflorens line called "Yellow Wonder" (Y2) was developed and examined. Botanical descriptors were assessed for morphological characterization of this genotype. The plant line was found to be rapidly transformable using established techniques and media formulations. The development of the documented YW5AF7 line provides an important tool for Rosaceae functional genomic analyses. These day-neutral plants have a small genome, a seed to seed
Directory of Open Access Journals (Sweden)
Folta Kevin M
2009-10-01
Full Text Available Abstract Background The diploid woodland strawberry (Fragaria vesca is an attractive system for functional genomics studies. Its small stature, fast regeneration time, efficient transformability and small genome size, together with substantial EST and genomic sequence resources make it an ideal reference plant for Fragaria and other herbaceous perennials. Most importantly, this species shares gene sequence similarity and genomic microcolinearity with other members of the Rosaceae family, including large-statured tree crops (such as apple, peach and cherry, and brambles and roses as well as with the cultivated octoploid strawberry, F. ×ananassa. F. vesca may be used to quickly address questions of gene function relevant to these valuable crop species. Although some F. vesca lines have been shown to be substantially homozygous, in our hands plants in purportedly homozygous populations exhibited a range of morphological and physiological variation, confounding phenotypic analyses. We also found the genotype of a named variety, thought to be well-characterized and even sold commercially, to be in question. An easy to grow, standardized, inbred diploid Fragaria line with documented genotype that is available to all members of the research community will facilitate comparison of results among laboratories and provide the research community with a necessary tool for functionally testing the large amount of sequence data that will soon be available for peach, apple, and strawberry. Results A highly inbred line, YW5AF7, of a diploid strawberry Fragaria vesca f. semperflorens line called "Yellow Wonder" (Y2 was developed and examined. Botanical descriptors were assessed for morphological characterization of this genotype. The plant line was found to be rapidly transformable using established techniques and media formulations. Conclusion The development of the documented YW5AF7 line provides an important tool for Rosaceae functional genomic analyses
Directory of Open Access Journals (Sweden)
Odair Bison
2003-04-01
Full Text Available A utilização de híbridos simples comerciais de milho é uma das opções de populações para a extração de linhagens, porque são adaptados e provavelmente concentram alta freqüência de alelos favoráveis já fixados. Mesmo nos locos que estão segregando, a freqüência de alelos favoráveis é 0,5. Assim, a identificação de populações promissoras, derivadas de híbridos simples superiores, é uma boa estratégia para aumentar a eficiência dos programas de melhoramento. As populações derivadas dos híbridos simples comerciais AG9012 e C333 foram avaliadas com o objetivo de verificar o potencial dessas para extração de linhagens superiores, por meio das estimativas de parâmetros genéticos e fenotípicos, da estimativa de m+a e a metodologia proposta por Jinks & Pooni (1976. Foram avaliadas 169 famílias S1 de cada população, durante a safra agrícola de 1999/2000, na área experimental do Departamento de Biologia da UFLA, em Lavras - MG, em látice simples 13x13, sendo as parcelas constituídas por uma linha de 3 m. As características analisadas foram incidência de Phaeosphaeria maydis em duas épocas, altura de plantas, altura de espigas e produtividade de espigas despalhadas. Foi constatado que há possibilidade de se obterem linhagens com bom desempenho per se, sendo a população derivada do C333 a mais promissora, por associar resistência a Phaeosphaeria maydis e possuir média mais alta e maior probabilidade de obtenção de linhagens superiores. A metodologia proposta por Jinks & Pooni (1976 mostrou-se mais informativa do que a estimativa de m+a para a escolha de populações, mas, quando possível, as duas podem ser utilizadas simultaneamente para auxiliar na decisão dos melhoristas.Populations derived from commercial single hybrids are one of the breeder options for inbred line extraction because of their adaptation and probable high frequency of loci with fixed favorable alleles. Even the segregating loci carry
Shou, Jian-guo; Mi, Jian-hong; Ying, Da-jun
2002-09-01
To investigate the expression and distribution of xenoantigen in intervertebral disk of Chinese banna minipig inbred line, and to study the availability of xenograft transplantation of intervertebral disk. Samples of intervertebral disk were collected from six Banna pigs of 8 to 11-month-old. The fixation, embedment and slice were performed. alpha-Gal specific binding lection (BSI-B4) were used as affinity reagents and affinity-immunohistochemistry assays (SABC methods and DAB stain) were conducted to detect the expression and distribution of xenoantigen (alpha-Gal). alpha-Gal was found in chondrocyte cell and chondrocyte-like cell in intervertebral disk which have the positive yellow-stained particulate aggradation. There was no stain in the matrix, elastic fiber and collagen fiber. The distribution of xenoantigen is locally in the tissue of intervertebral disk and its expression is weak. This suggests that the intervertebral disk of Banna pig may be alternative donor for xenotransplantation.
Energy Technology Data Exchange (ETDEWEB)
Gomolka, M.; Hornhardt, S.; Jung, T. [Bundesamt fuer Strahlenschutz Oberschleissheim (Germany). Institut fuer Strahlenhygiene
2000-07-01
Variation in radiation sensitivity and radiation resistance is influenced by the genetic constitution of an individual. Loss of function of genes involved in DNA repair, cell cycle or controlled cell death can have serious consequences on individual radiation sensitivity. For example, individuals suffering on the clinical syndrome of Ataxia telangiectasia exhibit radiation sensitivity in the order of 2-3 magnitudes higher than other cancer patients. For radiation protection it is important to clarify the role of genetic predisposition for radiation sensitivity in clinical healthy people. Therefore, data were collected from the literature describing the genetic variation (heritability) of radiation sensitivity in the mouse model. A heritability of 30-50% was calculated for 27 inbred mice lines by Roderick (1963) based on days of survival after a daily dose of 1 Gy {gamma}-irradiation. The following inbred lines were described in the literature as radiation sensitive (phenotypical markers were e.g., time of survival, mortality, reduction in fertility post exposure): SWR, RIII, NC, K, HLG, DBA, CBA, BALB/c, A, AKR. Radiation resistance was demonstrated in SJL, SEC, RF, MA, C58, C57BR, BDP and 129. Parameter of longevity, some physiological, biochemical and immunological parameters as given in the data bank of the Jackson Laboratory, U.S.A., were compared between radiation sensitive and radiation resistant inbred strains. No correlation was seen for the most of the parameters except for the development of breast cancer. In 6 out of 10 radiosensitive inbred strains breast cancer is described while only 1 of 8 strains exhibits breast cancer. The higher heritability of 30-50% in spite of a very complex phenotype like survival and the correlation between radiosensitivity and tumour incidence show that individual genetic susceptibility is important on the biological radiation reaction. (orig.) [German] Die phaenotypische Variation der Strahlensensitivitaet und
Diallel analysis of leaf disease resistance in inbred Brazilian popcorn cultivars.
Vieira, R A; Scapim, C A; Moterle, L M; Tessmann, D J; Conrado, T V; Amaral Júnior, A T
2009-12-01
We estimated general and specific combining abilities and examined resistance to northern leaf blight (Exserohilum turcicum) and to gray leaf spot (Cercospora zeae-maydis) in a set of nine inbred popcorn lines. These inbreds were crossed in a complete diallel scheme without reciprocals, which produced 36 F(1) hybrids. Two experiments with a square lattice design and three replications were conducted during the 2008/2009 crop season, in Maringá, PR, Brazil. The severity of northern leaf blight and gray leaf spot was assessed under natural infestation conditions. Data were examined by individual and joint analysis of variance. Individual and joint Griffing's diallel analyses were carried out for adjusted means. General combining ability and specific combining ability were significant (P < 0.10) by the F-test for northern leaf blight and gray leaf spot infestation levels. This denotes that additive and non-additive gene effects both contributed to resistance to these diseases, but that the additive gene effects were more important. Among the inbred lines, P(8) and P(9) gave the highest resistance to northern leaf blight, and P(3) and P(4.3) gave the highest resistance to gray leaf spot. The hybrids P(7.4) x P(8) and P(4.3) x P(9) could be exploited by reciprocal recurrent selection to provide genotypes with both northern leaf blight and gray leaf spot resistance. Significant interaction between general combining ability and crop season (P < 0.10) denotes the importance of environment, even though the disease levels in the hybrids were quite consistent.
Naegele, R P; Ashrafi, H; Hill, T A; Chin-Wo, S Reyes; Van Deynze, A E; Hausbeck, M K
2014-05-01
Phytophthora capsici is an important pepper (Capsicum annuum) pathogen causing fruit and root rot, and foliar blight in field and greenhouse production. Previously, an F6 recombinant inbred line population was evaluated for fruit rot susceptibility. Continuous variation among lines and partial and isolate-specific resistance were found. In this study, Phytophthora fruit rot resistance was mapped in the same F6 population between Criollo del Morelos 334 (CM334), a landrace from Mexico, and 'Early Jalapeno' using a high-density genetic map. Isolate-specific resistance was mapped independently in 63 of the lines evaluated and the two parents. Heritability of the resistance for each isolate at 3 and 5 days postinoculation (dpi) was high (h(2) = 0.63 to 0.68 and 0.74 to 0.83, respectively). Significant additive and epistatic quantitative trait loci (QTL) were identified for resistance to isolates OP97 and 13709 (3 and 5 dpi) and 12889 (3 dpi only). Mapping of fruit traits showed potential linkage with few disease resistance QTL. The partial fruit rot resistance from CM334 suggests that this may not be an ideal source for fruit rot resistance in pepper.
Goyal, Preeti; Chugh, L K
2017-09-01
Shelf life of pearl millet flour is very short because of rapid development of rancidity. This investigation was carried out in view of generating breeding material for development of low rancid pearl millet hybrids/varieties. Flour of twenty-one genotypes; seven hybrids, seven CMS lines, five inbreds and two composites stored in covered aluminium boxes at 37 °C for 30 days along with respective fresh flour was analysed for shelf life indicators/determinants. Crude fat content and fat acidity (FA) of fresh flour of the genotypes varied from 3.8 to 7.2% and 11 to 75 mg KOH/100 g d.m., respectively. FA in stored flour ranged between 180 and 330 mg KOH/100 g d.m. After storage, magnitude of decrease in pH of water extract of flour of the genotypes varied from 0.15 to 0.44. Activity of peroxidase (POX) varied from 378 to 588 units in control flour and irrespective of the genotypes decreased upon storage. Increase in FA (difference between FA of fresh and stored flour) rather total build up of FA was positively associated with crude fat content (r = 0.440*) indicated comparatively more prominent role of lipolytic enzymes. Chemical changes taking place in water soluble fraction of flour were independent of fat content as no correlation was discerned between fat content and decrease in pH. Among the hybrids, HHB 197 had lowest crude fat content (4.7%), lowest total build up FA (212 mg KOH/100 g d.m.), slowest increase in FA (191 mg KOH/100 g d.m.), least decrease in pH (0.31) of water soluble fraction flour during storage and lowest activity of POX in fresh flour (377 units/g d.m). Among all the tested CMS lines, inbreds and composites, HBL 11 showed pattern of quantitative changes in FA, pH and POX activity similar to the hybrid HHB 197 and was identified a promising inbred for developing low-rancid pearl millet variety or hybrid.
Directory of Open Access Journals (Sweden)
Riedelsheimer Christian
2012-09-01
Full Text Available Abstract Background There is increasing empirical evidence that whole-genome prediction (WGP is a powerful tool for predicting line and hybrid performance in maize. However, there is a lack of knowledge about the sensitivity of WGP models towards the genetic architecture of the trait. Whereas previous studies exclusively focused on highly polygenic traits, important agronomic traits such as disease resistances, nutrifunctional or climate adaptational traits have a genetic architecture which is either much less complex or unknown. For such cases, information about model robustness and guidelines for model selection are lacking. Here, we compared five WGP models with different assumptions about the distribution of the underlying genetic effects. As contrasting model traits, we chose three highly polygenic agronomic traits and three metabolites each with a major QTL explaining 22 to 30% of the genetic variance in a panel of 289 diverse maize inbred lines genotyped with 56,110 SNPs. Results We found the five WGP models to be remarkable robust towards trait architecture with the largest differences in prediction accuracies ranging between 0.05 and 0.14 for the same trait, most likely as the result of the high level of linkage disequilibrium prevailing in elite maize germplasm. Whereas RR-BLUP performed best for the agronomic traits, it was inferior to LASSO or elastic net for the three metabolites. We found the approach of genome partitioning of genetic variance, first applied in human genetics, as useful in guiding the breeder which model to choose, if prior knowledge of the trait architecture is lacking. Conclusions Our results suggest that in diverse germplasm of elite maize inbred lines with a high level of LD, WGP models differ only slightly in their accuracies, irrespective of the number and effects of QTL found in previous linkage or association mapping studies. However, small gains in prediction accuracies can be achieved if the WGP model is
Directory of Open Access Journals (Sweden)
Carlos Eduardo de Oliveira Camargo
1989-01-01
Full Text Available Compararam-se entre si vinte e quatro linhagens de triticale e o cultivar de trigo IAC-21, através de ensaios em diferentes localidades do Estado de São Paulo, nos anos de 1986 e 1987, analisando-se os seguintes parâmetros: rendimento de grãos, altura de plantas, ciclo em dias da emergência ao florescimento, porcentagem de plantas acamadas, peso de cem grãos e resistência à ferrugem-da-folha e às manchas-foliares em condições de campo. A linhagem de triticale Nutria 7272 foi a mais produtiva (3.098kg/ha, diferindo do 'IAC-21' (2.241 kg/ha e das demais linhagens de triticale, com exceção da Merino"S" - JLO"S" (T-20 e 21, Nutria 440 e Juanillo 159, com 2.891, 2.870, 2.805 e 2.645kg/ha respectivamente. As linhagens de triticale exibiram maior resistência à ferrugem-da-folha com relação ao 'IAC-21'. A Panche 7287 mostrou-se moderadamente resistente às manchas-foliares e, as demais, suscetíveis. As linhagens M2A-KLA"S" x MA (T-6, Faro"S" e Panche 7287 apresentaram ciclo da emergência ao florescimento significativamente maior que o 'IAC-21', e M2A-CML 360 x M2A (T-2, Turk DWF-V 127 x 6TA 204/IA 146, M2A-CML x IA, TCEP 77138, BGL "S"-IGA x PND"S" e BCM"S"-Addax"S" exibiram plantas significativamente mais baixas. A Juanillo 159 apresentou o maior peso de cem grãos, diferindo do 'IAC-21' e das demais linhagens, com exceção da Nutria 7272 e Merino"S" - JLO"S" (T-21.Twenty four triticale inbred lines and the wheat cultivar IAC-21 were evaluated in field experiments carried out at different locations of the State of São Paulo, Brazil, during the years of 1986 and 1987. Grain yield, plant height, number of days from emergence to flowering, percentage of layed plants, weight of 100 grains, resistance to leaf rust (Puccinia graminis sp. tritici and to leaf spots (Helminthosporium sp. and Septoria sp. were evaluated under field conditions. The triticale inbred line Nutria 7272 pre-sented the best grain yield (3,098 kg/ha, showing
Genetic analysis of recombinant inbred lines for Sorghum bicolor × Sorghum propinquum.
Kong, Wenqian; Jin, Huizhe; Franks, Cleve D; Kim, Changsoo; Bandopadhyay, Rajib; Rana, Mukesh K; Auckland, Susan A; Goff, Valorie H; Rainville, Lisa K; Burow, Gloria B; Woodfin, Charles; Burke, John J; Paterson, Andrew H
2013-01-01
We describe a recombinant inbred line (RIL) population of 161 F5 genotypes for the widest euploid cross that can be made to cultivated sorghum (Sorghum bicolor) using conventional techniques, S. bicolor × Sorghum propinquum, that segregates for many traits related to plant architecture, growth and development, reproduction, and life history. The genetic map of the S. bicolor × S. propinquum RILs contains 141 loci on 10 linkage groups collectively spanning 773.1 cM. Although the genetic map has DNA marker density well-suited to quantitative trait loci mapping and samples most of the genome, our previous observations that sorghum pericentromeric heterochromatin is recalcitrant to recombination is highlighted by the finding that the vast majority of recombination in sorghum is concentrated in small regions of euchromatin that are distal to most chromosomes. The advancement of the RIL population in an environment to which the S. bicolor parent was well adapted (indeed bred for) but the S. propinquum parent was not largely eliminated an allele for short-day flowering that confounded many other traits, for example, permitting us to map new quantitative trait loci for flowering that previously eluded detection. Additional recombination that has accrued in the development of this RIL population also may have improved resolution of apices of heterozygote excess, accounting for their greater abundance in the F5 than the F2 generation. The S. bicolor × S. propinquum RIL population offers advantages over early-generation populations that will shed new light on genetic, environmental, and physiological/biochemical factors that regulate plant growth and development.
Characterization of phenylpropanoid pathway genes within European maize (Zea mays L.) inbreds
DEFF Research Database (Denmark)
Andersen, Jeppe Reitan; Zein, Imad; Wenzel, Gerhard
2008-01-01
genomic fragments of six putative phenylpropanoid pathway genes in a panel of elite European inbred lines of maize (Zea mays L.) contrasting in forage quality traits. Six loci, encoding C4H, 4CL1, 4CL2, C3H, F5H, and CAD, displayed different levels of nucleotide diversity and linkage disequilibrium (LD...
Lubis, K.; Sutjahjo, S. H.; Syukur, M.; Trikoesoemaningtyas
2016-08-01
Technological developments and climate change have affected crop planting strategies. For example, maize production has expanded to sub-optimal lands, including acidic soil common in areas like Indonesia. Breeding programs have created inbred lines of maize introduced from CIMMYT; they were tested locally in acidic soils to determine their adaptability and tolerance mechanisms. Breeds CLA 46 and NEI 9008 were found to be excellent candidates for acidic soil due to their ASI, high number of grains per year, and suitable dry seed weight.
Holding, David R.
2010-11-13
Quality protein maize (QPM) is a high lysine-containing corn that is based on genetic modification of the opaque2 (o2) mutant. In QPM, modifier genes convert the starchy endosperm of o2 to the vitreous phenotype of wild type maize. There are multiple, unlinked o2 modifier loci (Opm) in QPM and their nature and mode of action are unknown. We previously identified seven Opm QTLs and characterized 16 genes that are differentially up-regulated at a significant level in K0326Y QPM, compared to the starchy endosperm mutant W64Ao2. In order to further characterize these Opm QTLs and the genes up-regulated in K0326Y QPM, we created a population of 314 recombinant inbred lines (RILs) from a cross between K0326Y QPM and W64Ao2. The RILs were characterized for three traits associated with endosperm texture: vitreousness, density and hardness. Genetic linkage analysis of the RIL population confirmed three of the previously identified QTLs associated with o2 endosperm modification in K0326Y QPM. Many of the genes up-regulated in K0326Y QPM showed substantially higher levels of expression in vitreous compared with opaque RILs. These included genes associated with the upstream regulation of the ethylene response pathway, and a gene encoding a regulatory subunit of pyrophosphate-dependent fructose-6-phosphate 1-phosphotransferase, an adaptive enzyme of the glycolytic pathway. © 2010 Springer-Verlag.
Excited levels of Pa-233; Niveles excitados del Pa-233
Energy Technology Data Exchange (ETDEWEB)
Vara Cuadrado, J M
1969-07-01
A study of Pa-233 excited levels from the alpha decay of Np-237 and from beta decay of Th-233 has been performed. The alpha decay spectrum was measured with a semiconductor spectrometer of 18 keV effective resolution (FWHM). Over 13 new lines were identified. The gamma ray spectra of Np-237 and Th-233 were obtained with a Ge-Li detector low and medium range energy lines, and with Si-Li detector for the low energy region. A continuous purification method of Np-237 from its comparatively short-lived daughter Pa-233 was applied. A high number of new lines were identified in both spectra. The gamma-gamma coincidence spectra were obtained with INa(T{sub 1}) detectors. (Author) 54 refs.
Uchio-Yamada, Kozue; Kasai, Fumio; Ozawa, Midori; Kohara, Arihiro
2017-03-01
Misidentification or cross-contamination of cell lines can cause serious issues. Human cell lines have been authenticated by short tandem repeat profiling; however, mouse cell lines have not been adequately assessed. In this study, mouse cell lines registered with the JCRB cell bank were examined by simple sequence length polymorphism (SSLP) analysis to identify their strains. Based on comparisons with 7 major inbred strains, our results revealed their strains in 80 of 90 cell lines. However, 12 of the 80 cell lines (15%) were found to differ from registered information. Of them, 4 cell lines originated from the same mouse, which had been generated through mating between two different inbred strains. The genotype of the mouse sample had not been examined after the backcross, leading to strain misidentification in those cell lines. Although 8 other cell lines had been established as sublines of a BALB/c cell line, their SSLP profiles are similar to a Swiss cell line. This affects differences in genotypes between inbred and outbred strains. Because the use of inbred samples and interbreeding between strains are not involved in human materials, our results suggest that the cause and influence of misidentification in mouse cell lines are different from those in human.
Directory of Open Access Journals (Sweden)
Tomasz L. Mróz
2018-03-01
Full Text Available Cucumber (Cucumis sativus L. has a large, paternally transmitted mitochondrial genome. Cucumber plants regenerated from cell cultures occasionally show paternally transmitted mosaic (MSC phenotypes, characterized by slower growth, chlorotic patterns on the leaves and fruit, lower fertility, and rearrangements in their mitochondrial DNAs (mtDNAs. MSC lines 3, 12, and 16 originated from different cell cultures all established using the highly inbred, wild-type line B. These MSC lines possess different rearrangements and under-represented regions in their mtDNAs. We completed RNA-seq on normalized and non-normalized cDNA libraries from MSC3, MSC12, and MSC16 to study their nuclear gene-expression profiles relative to inbred B. Results from both libraries indicated that gene expression in MSC12 and MSC16 were more similar to each other than MSC3. Forty-one differentially expressed genes (DEGs were upregulated and one downregulated in the MSC lines relative to B. Gene functional classifications revealed that more than half of these DEGs are associated with stress-response pathways. Consistent with this observation, we detected elevated levels of hydrogen peroxide throughout leaf tissue in all MSC lines compared to wild-type line B. These results demonstrate that independently produced MSC lines with different mitochondrial polymorphisms show unique and shared nuclear responses. This study revealed genes associated with stress response that could become selection targets to develop cucumber cultivars with increased stress tolerance, and further support of cucumber as a model plant to study nuclear-mitochondrial interactions.
Balint-Kurti, P J; Krakowsky, M D; Jines, M P; Robertson, L A; Molnár, T L; Goodman, M M; Holl, J B
2006-10-01
ABSTRACT A recombinant inbred line population derived from a cross between the maize lines NC300 (resistant) and B104 (susceptible) was evaluated for resistance to southern leaf blight (SLB) disease caused by Cochliobolus heterostrophus race O and for days to anthesis in four environments (Clayton, NC, and Tifton, GA, in both 2004 and 2005). Entry mean and average genetic correlations between disease ratings in different environments were high (0.78 to 0.89 and 0.9, respectively) and the overall entry mean heritability for SLB resistance was 0.89. When weighted mean disease ratings were fitted to a model using multiple interval mapping, seven potential quantitative trait loci (QTL) were identified, the two strongest being on chromosomes 3 (bin 3.04) and 9 (bin 9.03-9.04). These QTL explained a combined 80% of the phenotypic variation for SLB resistance. Some time-point-specific SLB resistance QTL were also identified. There was no significant correlation between disease resistance and days to anthesis. Six putative QTL for time to anthesis were identified, none of which coincided with any SLB resistance QTL.
Chen, Chi-Chien; Fu, Shih-Feng; Norikazu, Monma; Yang, Yau-Wen; Liu, Yu-Ju; Ikeo, Kazuho; Gojobori, Takashi; Huang, Hao-Jen
2015-12-01
MicroRNAs (miRNAs) play a vital role in growth, development, and stress response at the post-transcriptional level. Broccoli (Brassica oleracea L. var italic) is an important vegetable crop, and the yield and quality of broccoli are decreased by heat stress. The broccoli inbred lines that are capable of producing head at high temperature in summer are unique varieties in Taiwan. However, knowledge of miRNAomes during the broccoli head formation under heat stress is limited. In this study, molecular characterization of two nearly isogenic lines with contrasting head-forming capacity was investigated. Head-forming capacity was better for heat-tolerant (HT) than heat-sensitive (HS) broccoli under heat stress. By deep sequencing and computational analysis, 20 known miRNAs showed significant differential expression between HT and HS genotypes. According to the criteria for annotation of new miRNAs, 24 novel miRNA sequences with differential expression between the two genotypes were identified. To gain insight into functional significance, 213 unique potential targets of these 44 differentially expressed miRNAs were predicted. These targets were implicated in shoot apical development, phase change, response to temperature stimulus, hormone and energy metabolism. The head-forming capacity of the unique HT line was related to autonomous regulation of Bo-FT genes and less expression level of heat shock protein genes as compared to HS. For the genotypic comparison, a set of miRNAs and their targets had consistent expression patterns in various HT genotypes. This large-scale characterization of broccoli miRNAs and their potential targets is to unravel the regulatory roles of miRNAs underlying heat-tolerant head-forming capacity.
Anderson, J; Akond, M; Kassem, M A; Meksem, K; Kantartzi, S K
2015-04-01
The best way to protect yield loss of soybean [Glycine max (L.) Merr.] due to sudden death syndrome (SDS), caused by Fusarium virguliforme (Aoki, O'Donnel, Homma & Lattanzi), is the development and use of resistant lines. Mapping quantitative trait loci (QTL) linked to SDS help developing resistant soybean germplasm through molecular marker-assisted selection strategy. QTL for SDS presented herein are from a high-density SNP-based genetic linkage map of MD 96-5722 (a.k.a 'Monocacy') by 'Spencer' recombinant inbred line using SoySNP6K Illumina Infinium BeadChip genotyping array. Ninety-four F 5:7 lines were evaluated for 2 years (2010 and 2011) at two locations (Carbondale and Valmeyer) in southern Illinois, USA to identify QTL controlling SDS resistance using disease index (DX). Composite interval mapping identified 19 SDS controlling QTL which were mapped on 11 separate linkage group (LG) or chromosomes (Chr) out of 20 LG or Chr of soybean genome. Many of these significant QTL identified in one environment/year were confirmed in another year or environment, which suggests a common genetic effects and modes of the pathogen. These new QTL are useful sources for SDS resistance studies in soybean breeding, complementing previously reported loci.
Confidence Testing of Shell 405 and S-405 Catalysts in a Monopropellant Hydrazine Thruster
McRight, Patrick; Popp, Chris; Pierce, Charles; Turpin, Alicia; Urbanchock, Walter; Wilson, Mike
2005-01-01
As part of the transfer of catalyst manufacturing technology from Shell Chemical Company (Shell 405 catalyst manufactured in Houston, Texas) to Aerojet (S-405 manufactured in Redmond, Washington), Aerojet demonstrated the equivalence of S-405 and Shell 405 at beginning of life. Some US aerospace users expressed a desire to conduct a preliminary confidence test to assess end-of-life characteristics for S-405. NASA Marshall Space Flight Center (MSFC) and Aerojet entered a contractual agreement in 2004 to conduct a confidence test using a pair of 0.2-lbf MR-103G monopropellant hydrazine thrusters, comparing S-405 and Shell 405 side by side. This paper summarizes the formulation of this test program, explains the test matrix, describes the progress of the test, and analyzes the test results. This paper also includes a discussion of the limitations of this test and the ramifications of the test results for assessing the need for future qualification testing in particular hydrazine thruster applications.
Paschold, Anja; Jia, Yi; Marcon, Caroline; Lund, Steve; Larson, Nick B.; Yeh, Cheng-Ting; Ossowski, Stephan; Lanz, Christa; Nettleton, Dan; Schnable, Patrick S.; Hochholdinger, Frank
2012-01-01
Typically, F1-hybrids are more vigorous than their homozygous, genetically distinct parents, a phenomenon known as heterosis. In the present study, the transcriptomes of the reciprocal maize (Zea mays L.) hybrids B73×Mo17 and Mo17×B73 and their parental inbred lines B73 and Mo17 were surveyed in primary roots, early in the developmental manifestation of heterotic root traits. The application of statistical methods and a suitable experimental design established that 34,233 (i.e., 86%) of all high-confidence maize genes were expressed in at least one genotype. Nearly 70% of all expressed genes were differentially expressed between the two parents and 42%–55% of expressed genes were differentially expressed between one of the parents and one of the hybrids. In both hybrids, ∼10% of expressed genes exhibited nonadditive gene expression. Consistent with the dominance model (i.e., complementation) for heterosis, 1124 genes that were expressed in the hybrids were expressed in only one of the two parents. For 65 genes, it could be shown that this was a consequence of complementation of genomic presence/absence variation. For dozens of other genes, alleles from the inactive inbred were activated in the hybrid, presumably via interactions with regulatory factors from the active inbred. As a consequence of these types of complementation, both hybrids expressed more genes than did either parental inbred. Finally, in hybrids, ∼14% of expressed genes exhibited allele-specific expression (ASE) levels that differed significantly from the parental-inbred expression ratios, providing further evidence for interactions of regulatory factors from one parental genome with target genes from the other parental genome. PMID:23086286
Gradiz, Rui; Silva, Henriqueta C; Carvalho, Lina; Botelho, Maria Filomena; Mota-Pinto, Anabela
2016-02-17
Studies using cell lines should always characterize these cells to ensure that the results are not distorted by unexpected morphological or genetic changes possibly due to culture time or passage number. Thus, the aim of this study was to describe those MIA PaCa-2 and PANC-1 cell line phenotype and genotype characteristics that may play a crucial role in pancreatic cancer therapeutic assays, namely neuroendocrine chemotherapy and peptide receptor radionuclide therapy. Epithelial, mesenchymal, endocrine and stem cell marker characterization was performed by immunohistochemistry and flow cytometry, and genotyping by PCR, gene sequencing and capillary electrophoresis. MIA PaCa-2 (polymorphism) expresses CK5.6, AE1/AE3, E-cadherin, vimentin, chromogranin A, synaptophysin, SSTR2 and NTR1 but not CD56. PANC-1 (pleomorphism) expresses CK5.6, MNF-116, vimentin, chromogranin A, CD56 and SSTR2 but not E-cadherin, synaptophysin or NTR1. MIA PaCA-1 is CD24(-), CD44(+/++), CD326(-/+) and CD133/1(-), while PANC-1 is CD24(-/+), CD44(+), CD326(-/+) and CD133/1(-). Both cell lines have KRAS and TP53 mutations and homozygous deletions including the first 3 exons of CDKN2A/p16(INK4A), but no SMAD4/DPC4 mutations or microsatellite instability. Both have neuroendocrine differentiation and SSTR2 receptors, precisely the features making them suitable for the therapies we propose to assay in future studies.
recombinant inbred lines intercropped with oat
African Journals Online (AJOL)
ADMIN
The QTLs identified are stable for these characters and are located on ... number of seeds per ear, with better thousand kernel weight and grain yield ... to determine environmentally friendly way of barley lines to withstand oat .... The analysis of variance (ANOVA) was done .... yield components, multiple QTL mapping or.
2010-07-01
... 40 Protection of Environment 28 2010-07-01 2010-07-01 true [Reserved] 405.73 Section 405.73 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS DAIRY... § 405.73 [Reserved] ...
Effect of x-ray irradiation on maize inbred line B73 tissue cultures and regenerated plants
International Nuclear Information System (INIS)
Wang, A.S.; Cheng, D.S.K.; Milcic, J.B.; Yang, T.C.
1988-01-01
In order to enhance variation induced by the tissue culture process and to obtain agronomically desirable mutants, friable embryogenic tissue cultures of maize (Zea mays L.) inbred line B73 were x-ray irradiated with 11 doses [0-8.4 kilorads (kR)]. Reductions in callus growth rate and embryogenic callus formation occurred with increasing x-ray doses 20 d and 3 months after irradiation. Callus irradiated with 0.8 kR showed a significant increase in growth rate and a 20% increase in embryogenic callus 9 months after irradiation. A total of 230 R 0 plants were regenerated for evaluation. Pollen fertility and seed set of R 0 plants decreased with increasing x-ray dosage. Days to anthesis and plant height of R 0 plants varied among x-ray treatments but were generally reduced with higher dosages. The number of chromosomal aberrations increased with x-ray dosage. The R 1 seeds taken from R 0 plants were also grown and tested for mutant segregation. Plants regenerated from irradiated calli had a two- to 10-fold increase in mutations over plants regenerated from unirradiated control callus. Germination frequency of seeds from R 0 plants decreased with increasing x-ray dosage. Although chlorophyll mutants were most frequently observed, a number of vigorous plants with earlier anthesis date were also recovered
Prenyltransferase inhibitor radiosensitization of pancreatic ductal carcinoma (PaCa) cells
International Nuclear Information System (INIS)
Brunner, T.B.; Hahn, S.M.; Rustgi, A.K.
2003-01-01
Farnesyltransferase inhibitors (FTIs) radiosensitize tumor cell lines expressing activated H-Ras. K-Ras however remains active after FTI treatment due to prenylation by geranylgeranyltransferase. Up to 90% of pancreatic carcinomas (PaCa) are mutant in K-ras. We hypothesized that combined FTI and geranylgeranyltransferase inhibitor (GGTI) treatment could radiosensitize PaCa cells. Nine human PaCa lines (7 K-ras-mutant, 2 ras-wt) and transgenic mouse pancreatic ductal cells (PDC) expressing wt-ras or mutant K-ras were tested in clonogenic assays with combined FTI-A +/- GGTI-B (Merck and Co Inc.). Inhibition of PI3- kinase (with LY294002) or inhibition of MEK1/2 (with U0126) served to assess the significance of the PI3-kinase and MAPK to radiation survival in these cells. H- and K-Ras prenylation status and changes in phosphorylation of AKT and MAPK were monitored as were changes in cell cycle distribution. FTI+GGTI treatment achieved inhibition of K-Ras prenylation in all PaCa cell lines. This treatment radiosensitized the K-ras mutant cell lines AsPC-1, Capan-2, MiaPaCa-2 and PSN-1, PancM, but not Capan-1 or the ras-wt cell lines (BxPC-3, HS766T, PDC-wt). L-778,123, a dual action inhibitor, sensitized all K-ras mutant cells. Surprisingly, PancM, Panc-1, MiaPaCa-2 and PDC K-Ras cells were radiosensitized by FTI treatment alone. R11577, another FTI without GGTI activity, also sensitized Panc-1 and MiaPaCa-2 and additionally AsPC-1 cells. Radiosensitization was also achieved after treatment with LY294002 in all PaCa lines expressing mutant-K-ras and the ras-wt line BxPC-3 overexpressing Akt2. However these lines were not sensitized by U0126. FTI+GGTI sensitize K-ras mt PaCa cell lines to radiation. PI3-kinase signaling but not MAPK signaling appears to contribute to radiation survival in PaCa cells. Radiosensitization of certain PaCa cells by FTI alone indicates that alternate pathways or farnesylated targets other than K-Ras may also be involved in radiation survival
Guo, Su-Min; Kamphuis, Lars G.; Gao, Ling-Ling; Klingler, John P.; Lichtenzveig, Judith; Edwards, Owain; Singh, Karam B.
2012-01-01
and the more resistant line Jester. The results show that PA resistance in A17 involves both antibiosis and tolerance, and that resistance is phloem based. Quantitative trait locus (QTL) analysis using a recombinant inbred line (RIL) population (n=114) from a
2010-01-01
... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Dependency. 843.405 Section 843.405 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE REGULATIONS (CONTINUED) FEDERAL EMPLOYEES RETIREMENT SYSTEM-DEATH BENEFITS AND EMPLOYEE REFUNDS Child Annuities § 843.405 Dependency. To be...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT
Evaluation of the capacity for direct regeneration of maize inbreds of the Lancaster selection group
Directory of Open Access Journals (Sweden)
K. V. Derkach
2013-11-01
Full Text Available In connection with the necessity of bringing elite maize inbreds of the Lancaster germplasm group, which have potential for cultivation in Ukraine, into the system of genetic tranformation, the aim of this investigation is to identify the ability of maize inbreds of this group to regenerate by direct organogenesis and to determine the optimal mineral basis for their nutritional environment using segments of the node area of shoots. As explantats we used sterile 4-day old seedlings of 4 maize inbreds of Lancaster germplasm and model inbred Chi31 exotic germplasm. The seedlings were obtained by germination of sterile seeds in Petri dishes between two layers of moist sterile filter paper at a temperature of 27 ºC in dark conditions. A single 1 cmlong segment was cut from each from each seedling, running from 0.5 cmbefore the node to 0.5 cmafter the node. A cut was made in each segment of the node in order to create a wounded surface. Explantats were planted in a nutrient environment with mineral bases of MS or N6, modified by the addition of 10 mg/l silver nitrate, 100 mg/l casein hydrolyzate, 690 mg/l L-proline, 30 g/l sucrose, 1.0 mg/l 2,4-dychlorphenoksiacetic acid and 0,1 mg/l abscisic acid. Cultivation was carried out at 25–27 ºC in the light. Direct hemogenesis in this environment on the 14th day of cultivation in vitro reached 100% for each line. This meant that all researched lines of Lancaster germplasm and the model line showed a high capacity for direct regeneration through direct hemogenesis, which does not depend on the composition of the mineral content of their nutritional environment. Callus formation was observed in all genotypes on the 14th day of cultivation in vitro and the extent of its formation increased during the following month of cultivation. The callus formation was observed only at the site of the wounded surface. The calluses were transparent. Although green areas appeared in these calluses, they were
2010-01-01
... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Housing. 1253.405 Section 1253.405... in Education Programs or Activities Prohibited § 1253.405 Housing. (a) Generally. A recipient shall..., or offer different services or benefits related to housing, except as provided in this section...
42 CFR 405.810 - Review determination.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Review determination. 405.810 Section 405.810....810 Review determination. Subject to the provisions of §§ 405.807 through 405.809, the carrier shall... determination affirming or revising in whole or in part the findings and determination in question. [39 FR 12097...
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Housing. 28.405 Section 28.405 Money... in Education Programs or Activities Prohibited § 28.405 Housing. (a) Generally. A recipient shall not... offer different services or benefits related to housing, except as provided in this section (including...
2010-10-01
... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Housing. 41.405 Section 41.405 Public... in Education Programs or Activities Prohibited § 41.405 Housing. (a) Generally. A recipient shall not... offer different services or benefits related to housing, except as provided in this section (including...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Housing. 3.405 Section 3.405 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 3.405 Housing. (a) Generally...
2010-07-01
... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Housing. 5.405 Section 5.405 Protection... in Education Programs or Activities Prohibited § 5.405 Housing. (a) Generally. A recipient shall not... offer different services or benefits related to housing, except as provided in this section (including...
2010-10-01
... 45 Public Welfare 4 2010-10-01 2010-10-01 false Housing. 2555.405 Section 2555.405 Public Welfare... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 2555.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except as...
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Housing. 113.405 Section 113.405... Discrimination on the Basis of Sex in Education Programs Or Activities Prohibited § 113.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except as...
2010-01-01
... 6 Domestic Security 1 2010-01-01 2010-01-01 false Housing. 17.405 Section 17.405 Domestic Security... Education Programs or Activities Prohibited § 17.405 Housing. (a) General. A recipient shall not, on the... different services or benefits related to housing, except as provided in this section (including housing...
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false Housing. 25.405 Section 25.405 Transportation... Activities Prohibited § 25.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
2010-07-01
... 32 National Defense 2 2010-07-01 2010-07-01 false Housing. 196.405 Section 196.405 National... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except as...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 229.405 Section 229.405 Foreign... Programs or Activities Prohibited § 229.405 Housing. (a) Generally. A recipient shall not, on the basis of... services or benefits related to housing, except as provided in this section (including housing provided...
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Housing. 5.405 Section 5.405 Energy NUCLEAR REGULATORY....405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply different rules or regulations, impose different fees or requirements, or offer different services or benefits related to housing...
International Nuclear Information System (INIS)
Vara Cuadrado, J. M.
1969-01-01
A study of Pa-233 excited levels from the alpha decay of Np-237 and from beta decay of Th-233 has been performed. The alpha decay spectrum was measured with a semiconductor spectrometer of 18 keV effective resolution (FWHM). Over 13 new lines were identified. The gamma ray spectra of Np-237 and Th-233 were obtained with a Ge-Li detector low and medium range energy lines, and with Si-Li detector for the low energy region. A continuous purification method of Np-237 from its comparatively short-lived daughter Pa-233 was applied. A high number of new lines were identified in both spectra. The gamma-gamma coincidence spectra were obtained with INa(T 1 ) detectors. (Author) 54 refs
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Housing. 1042.405 Section 1042.405 Energy DEPARTMENT OF... Activities Prohibited § 1042.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Housing. 54.405 Section 54.405 Judicial... Activities Prohibited § 54.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Housing. 618.405 Section 618.405 Public Welfare... the Basis of Sex in Education Programs or Activities Prohibited § 618.405 Housing. (a) Generally. A... requirements, or offer different services or benefits related to housing, except as provided in this section...
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Housing. 36.405 Section 36.405 Labor Office of the Secretary....405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply different rules or regulations, impose different fees or requirements, or offer different services or benefits related to housing...
2010-04-01
... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Financing. 882.405 Section 882.405... § 882.405 Financing. (a) Types. Any type of public or private financing may be utilized with the... Contract as security for financing. An Owner may pledge, or offer as security for any loan or obligation...
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Discovery. 405.1037 Section 405.1037 Public Health... Appeals Under Original Medicare (Part A and Part B) Alj Hearings § 405.1037 Discovery. (a) General rules. (1) Discovery is permissible only when CMS or its contractor elects to participate in an ALJ hearing...
Guzmán-Rodríguez, Jaquelina Julia; López-Gómez, Rodolfo; Salgado-Garciglia, Rafael; Ochoa-Zarzosa, Alejandra; López-Meza, Joel E
2016-08-01
Antimicrobial peptides (AMPs) are cytotoxic to cancer cells; however, mainly the effects of AMPs from animals have been evaluated. In this work, we assessed the cytotoxicity of PaDef defensin from avocado (Persea americana var. drymifolia) on the MCF-7 cancer cell line (a breast cancer cell line) and evaluated its mechanism of action. PaDef inhibited the viability of MCF-7 cells in a concentration-dependent manner, with an IC50=141.62μg/ml. The viability of normal peripheral blood mononuclear cells was unaffected by this AMP. Additionally, PaDef induced apoptosis in MCF-7 cells in a time-dependent manner, but did not affect the membrane potential or calcium flow. In addition, PaDef IC50 induced the expression of cytochrome c, Apaf-1, and the caspase 7 and 9 genes. Likewise, this defensin induced the loss of mitochondrial Δψm and increased the phosphorylation of MAPK p38, which may lead to MCF-7 apoptosis by the intrinsic pathway. This is the first report of an avocado defensin inducing intrinsic apoptosis in cancer cells, which suggests that it could be a potential therapeutic molecule in the treatment of cancer. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zaidi, Pervez Haider; Rashid, Zerka; Vinayan, Madhumal Thayil; Almeida, Gustavo Dias; Phagna, Ramesh Kumar; Babu, Raman
2015-01-01
Waterlogging is an important abiotic stress constraint that causes significant yield losses in maize grown throughout south and south-east Asia due to erratic rainfall patterns. The most economic option to offset the damage caused by waterlogging is to genetically incorporate tolerance in cultivars that are grown widely in the target agro-ecologies. We assessed the genetic variation in a population of recombinant inbred lines (RILs) derived from crossing a waterlogging tolerant line (CAWL-46-3-1) to an elite but sensitive line (CML311-2-1-3) and observed significant range of variation for grain yield (GY) under waterlogging stress along with a number of other secondary traits such as brace roots (BR), chlorophyll content (SPAD), % stem and root lodging (S&RL) among the RILs. Significant positive correlation of GY with BR and SPAD and negative correlation with S&RL indicated the potential use of these secondary traits in selection indices under waterlogged conditions. RILs were genotyped with 331 polymorphic single nucleotide polymorphism (SNP) markers using KASP (Kompetitive Allele Specific PCR) Platform. QTL mapping revealed five QTL on chromosomes 1, 3, 5, 7 and 10, which together explained approximately 30% of phenotypic variance for GY based on evaluation of RIL families under waterlogged conditions, with effects ranging from 520 to 640 kg/ha for individual genomic regions. 13 QTL were identified for various secondary traits associated with waterlogging tolerance, each individually explaining from 3 to 14% of phenotypic variance. Of the 22 candidate genes with known functional domains identified within the physical intervals delimited by the flanking markers of the QTL influencing GY and other secondary traits, six have previously been demonstrated to be associated with anaerobic responses in either maize or other model species. A pair of flanking SNP markers has been identified for each of the QTL and high throughput marker assays were developed to facilitate
Dual Nuclear/Fluorescence Imaging Potantial of Zinc(II) Phthalocyanine in MIA PaCa-2 Cell Line.
Lambrecht, Fatma Yurt; Ince, Mine; Er, Ozge; Ocakoglu, Kasim; Sarı, Fatma Aslıhan; Kayabasi, Cagla; Gunduz, Cumhur
2016-01-01
Pancreatic cancer is very common and difficult to diagnose in early stage. Imaging systems for diagnosing cancer have many disadvantages. However, combining different imaging modalities offers synergistic advantages. Optical imaging is the most multidirectional and widely used imaging modality in both clinical practice and research. In present study, Zinc(II) phthalocyanine [Zn(II)Pc] was synthesized, labeled with iodine- 131 and in vitro study was carried out. The intracellular uptake studies of radiolabeled Zn(II)Pc were performed in WI-38 [ATCC CCL-75™, tissue: human fibroblast lung] and MIA PaCa-2 [ATCC CRL-1420™, tissue: human epithelial pancreas carcinoma] cell lines. The intracellular uptake efficiency of radiolabeled Zn(II)Pc in MIA PaCa-2 cells was determined two times higher than WI-38 cells. Also, fluorescence imaging (FI) efficiency of synthesized Zn(II)Pc was investigated in MIA PaCa-2 cells and significant uptake was observed. Zn(II)Pc might be used as a new agent for dual fluorescence/nuclear imaging for pancreatic cancer. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Park, S H; Sung, J H; Chung, N
2014-09-01
Cancer stem cells play an important role in metastasis and the relapse of drug resistant cancers. Side-population (SP) cells are capable of effluxing Hoechst 33342 dye and are referred to as cancer stem cells. We investigated the effect of berberine on pancreatic cancer stem cells of PANC-1 and MIA PaCa-2. For both cell lines, the proportions of SP cells in the presence of berberine were investigated and compared to the proportions in the presence of gemcitabine, a standard pancreatic anti-cancer drug. The proportions of SP cells in the PANC-1 and MIA PaCa-2 cell lines were about 9 and PANC-1 decreased to 5.7 ± 2.0 and 6.8 ± 0.8%, respectively, which compares to the control proportion of (9.7 ± 1.7). After berberine and gemcitabine treatment of PANC-1, of the four stem cell-associated genes (SOX2, POU5F1, NANOG, and NOTCH1), all but NOTCH1 were down-regulated. Unfortunately, the effect of berberine and gemcitabine treatments on MIA PaCa-2 SP cells could not be clearly observed because SP cells represented only a very small proportion of MIA PaCa-2 cells. However, SOX2, POU5F1, and NANOG genes were shown to be effectively down-regulated in the MIA PaCa-2 cell line as a whole. Taken together, these results indicate that berberine is as effective at targeting pancreatic cancer cell lines as gemcitabine. Therefore, we believe that POU5F1, SOX2, and NANOG can serve as potential markers, and berberine may be an effective anti-cancer agent when targeting human pancreatic cancer cells and/or their cancer stem cells.
Divergence and inheritance of neocortical heterotopia in inbred and genetically-engineered mice.
Toia, Alyssa R; Cuoco, Joshua A; Esposito, Anthony W; Ahsan, Jawad; Joshi, Alok; Herron, Bruce J; Torres, German; Bolivar, Valerie J; Ramos, Raddy L
2017-01-18
Cortical function emerges from the intrinsic properties of neocortical neurons and their synaptic connections within and across lamina. Neurodevelopmental disorders affecting migration and lamination of the neocortex result in cognitive delay/disability and epilepsy. Molecular layer heterotopia (MLH), a dysplasia characterized by over-migration of neurons into layer I, are associated with cognitive deficits and neuronal hyperexcitability in humans and mice. The breadth of different inbred mouse strains that exhibit MLH and inheritance patterns of heterotopia remain unknown. A neuroanatomical survey of numerous different inbred mouse strains, 2 first filial generation (F1) hybrids, and one consomic strain (C57BL/6J-Chr 1 A/J /NaJ) revealed MLH only in C57BL/6 mice and the consomic strain. Heterotopia were observed in numerous genetically-engineered mouse lines on a congenic C57BL/6 background. These data indicate that heterotopia formation is a weakly penetrant trait requiring homozygosity of one or more C57BL/6 alleles outside of chromosome 1. These data are relevant toward understanding neocortical development and disorders affecting neocortical lamination. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
20 CFR 405.30 - Discrimination complaints.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Discrimination complaints. 405.30 Section 405... INITIAL DISABILITY CLAIMS Introduction, General Description, and Definitions § 405.30 Discrimination... that an adjudicator has improperly discriminated against you, you may file a discrimination complaint...
42 CFR 405.715 - Reconsidered determination.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Reconsidered determination. 405.715 Section 405.715... Part A § 405.715 Reconsidered determination. (a) In reconsidering an initial determination, the CMS shall review such initial determination, the evidence and findings upon which such determination was...
20 CFR 405.501 - Judicial review.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Judicial review. 405.501 Section 405.501 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Judicial Review § 405.501 Judicial review. You may file an action in a Federal district...
20 CFR 654.405 - Water supply.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Water supply. 654.405 Section 654.405... THE EMPLOYMENT SERVICE SYSTEM Housing for Agricultural Workers Housing Standards § 654.405 Water supply. (a) An adequate and convenient supply of water that meets the standards of the State health...
Energy Technology Data Exchange (ETDEWEB)
Garcia, A.; Gomez, L. A.; Morales, A. [Instituto de Suelos, MINAG (Cuba); others, and
2013-11-15
Common bean (Phaseolus vulgaris L.) is the most important food legume for human consumption worldwide and especially in Latin America and Africa, but low soil phosphorus (P) availability limits grain production in these areas. For these reason eighty five recombinant inbred lines (RILs) of BAT 477 x DOR 364 and twenty commercial bean genotypes were sown in plots in an Acrisol soil with low P availability to evaluate nine root traits and grain yield. The study was carried out in Pinar del Rio province in Cuba between November 2006 and February 2009. The plots received basal fertilization (N and K) and P fertilization between 15 and 90 kg P{sub 2}O{sub 5} ha{sup -1}. Ten plants were sampled from each plot at R{sub 6} pod fill to evaluate root traits and shoot biomass, and at R{sub 9} physiological maturity to estimate grain yield. The 85 RILs showed great variability for root traits, grain yield and P stress tolerance calculated as relative grain yield. The commercial bean lines also showed large diversity in yield parameters. Principal Component Analysis showed that there were high and significant correlations between root traits (basal root number, primary root depth, adventitious root length and adventitious root number) and grain yield parameters (grain yield at 15 P level and relative grain yields). Adventitious root traits showed the greatest correlation with yield under low P. Promising RILs included 75.1.1, 60.1.1, 38.1.1, 14.1.1 and 38.1.1 and promising commercial bean lines included ICA Pijao, BAT 482, ICA 23, BAT 24 and BAT 832. (author)
12 CFR 411.405 - Penalty procedures.
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Penalty procedures. 411.405 Section 411.405 Banks and Banking EXPORT-IMPORT BANK OF THE UNITED STATES NEW RESTRICTIONS ON LOBBYING Penalties and Enforcement § 411.405 Penalty procedures. Agencies shall impose and collect civil penalties pursuant to the...
30 CFR 7.405 - Critical characteristics.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Critical characteristics. 7.405 Section 7.405... Cable Splice Kits § 7.405 Critical characteristics. (a) A sample from each production run, batch, or lot... tested, or (b) A sample of the materials that contribute to the flame-resistant characteristic of the...
Malkki, H.A.I.; Donga, L.A.B.; de Groot, S.E.; Brussaard, A.B.; Borst, J.G.G.; Elgersma, J.W.; Galjart, N.; van der Horst, G.T.; Levelt, C.N.; Pennartz, C.M.A.; Smit, A.B.; Spruijt, B.M.; Verhage, M.; de Zeeuw, C.I.; Battaglia, F.P.
2011-01-01
Extinction of instrumental responses is an essential skill for adaptive behavior such as foraging. So far, only few studies have focused on extinction following appetitive conditioning in mice. We studied extinction of appetitive operant lever-press behavior in six standard inbred mouse strains
Directory of Open Access Journals (Sweden)
Ghislain Kanfany
2018-01-01
Full Text Available Pearl millet is an important cereal crop for smallholder farmers’ food security in West and Central Africa. However, its production has stagnated due to several factors such as the continuous use of local populations. A set of 17 inbred lines was crossed with Sosat C 88 and Souna 3 following a line × tester mating design. The F1 hybrids, their parents, and a check were evaluated in Bambey and Nioro research stations during the rainy season of 2017. Data on downy mildew incidence, plant height, flowering time, panicle length and diameter, productive tillers, thousand-grain weight, panicle, and grain yield were recorded. GCA and SCA mean squares were significant for most of the traits indicating that both additive and nonadditive gene effects were involved in the control of the inheritance of these traits. However, the contribution of GCA to total mean squares was higher than that of SCA for all the traits, providing that additive gene action was more important in their inheritance. The top-cross hybrid IBL155-2-1 × Sosat C 88 exhibited negative and significant SCA effects for downy mildew incidence, flowering time, and plant height. Lines IBL003-B-1, IBL091-1-1, IBL095-4-1, IBL110-B-1, and IBL 206-1-1 had positive GCA effects for grain yield and negative GCA effects for downy mildew, flowering time, and plant height. These lines can be used as parents to create synthetic varieties or hybrids.
29 CFR 99.405 - Management decision.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Management decision. 99.405 Section 99.405 Labor Office of... Agencies and Pass-through Entities § 99.405 Management decision. (a) General. The management decision shall... process available to the auditee. (b) Federal agency. As provided in § 99.400(a)(7), the cognizant agency...
LIF-measurements on a low prassure RF-driven InBr lamp
Mulders, H.C.J.; Stoffels, W.W.
2007-01-01
A laser induced fluorescence (LIF) experiment has been carried out on a low pressure, capacitively coupled RF driven. Ar discharge with InBr as an additive. The intention is to find the density of the different states of InBr and the metastable states in particular. We measured the density profile
Selection of common bean lines with high grain yield and high grain calcium and iron concentrations
Directory of Open Access Journals (Sweden)
Nerinéia Dalfollo Ribeiro
2014-02-01
Full Text Available Genetic improvement of common bean nutritional quality has advantages in marketing and can contribute to society as a food source. The objective of this study was to evaluate the genetic variability for grain yield, calcium and iron concentrations in grains of inbred common bean lines obtained by different breeding methods. For this, 136 F7 inbred lines were obtained using the Pedigree method and 136 F7 inbred lines were obtained using the Single-Seed Descent (SSD method. The lines showed genetic variability for grain yield, and concentrations of calcium and iron independently of the method of advancing segregating populations. The Pedigree method allows obtaining a greater number of lines with high grain yield. Selection using the SSD method allows the identification of a larger number of lines with high concentrations of calcium and iron in grains. Weak negative correlations were found between grain yield and calcium concentration (r = -0.0994 and grain yield and iron concentration (r = -0.3926. Several lines show genetic superiority for grain yield and concentrations of calcium and iron in grains and their selection can result in new common bean cultivars with high nutritional quality.
48 CFR 9904.405-61 - Interpretation. [Reserved
2010-10-01
...] 9904.405-61 Section 9904.405-61 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-61 Interpretation. [Reserved] ...
Berberine induces apoptosis via ROS generation in PANC-1 and MIA-PaCa2 pancreatic cell lines.
Park, S H; Sung, J H; Kim, E J; Chung, N
2015-02-01
Pancreatic cancer is the fourth leading cause of cancer death. Gemcitabine is widely used as a chemotherapeutic agent for the treatment of pancreatic cancer, but the prognosis is still poor. Berberine, an isoquinoline alkaloid extracted from a variety of natural herbs, possesses a variety of pharmacological properties including anticancer effects. In this study, we investigated the anticancer effects of berberine and compared its use with that of gemcitabine in the pancreatic cancer cell lines PANC-1 and MIA-PaCa2. Berberine inhibited cell growth in a dose-dependent manner by inducing cell cycle arrest and apoptosis. After berberine treatment, the G1 phase of PANC-1 cells increased by 10% compared to control cells, and the G1 phase of MIA-PaCa2 cells was increased by 2%. Whereas gemcitabine exerts antiproliferation effects through S-phase arrest, our results showed that berberine inhibited proliferation by inducing G1-phase arrest. Berberine-induced apoptosis of PANC-1 and MIA-PaCa2 cells increased by 7 and 2% compared to control cells, respectively. Notably, berberine had a greater apoptotic effect in PANC-1 cells than gemcitabine. Upon treatment of PANC-1 and MIA-PaCa2 with berberine at a half-maximal inhibitory concentration (IC50), apoptosis was induced by a mechanism that involved the production of reactive oxygen species (ROS) rather than caspase 3/7 activation. Our findings showed that berberine had anti-cancer effects and may be an effective drug for pancreatic cancer chemotherapy.
Berberine induces apoptosis via ROS generation in PANC-1 and MIA-PaCa2 pancreatic cell lines
International Nuclear Information System (INIS)
Park, S.H.; Sung, J.H.; Kim, E.J.; Chung, N.
2014-01-01
Pancreatic cancer is the fourth leading cause of cancer death. Gemcitabine is widely used as a chemotherapeutic agent for the treatment of pancreatic cancer, but the prognosis is still poor. Berberine, an isoquinoline alkaloid extracted from a variety of natural herbs, possesses a variety of pharmacological properties including anticancer effects. In this study, we investigated the anticancer effects of berberine and compared its use with that of gemcitabine in the pancreatic cancer cell lines PANC-1 and MIA-PaCa2. Berberine inhibited cell growth in a dose-dependent manner by inducing cell cycle arrest and apoptosis. After berberine treatment, the G1 phase of PANC-1 cells increased by 10% compared to control cells, and the G1 phase of MIA-PaCa2 cells was increased by 2%. Whereas gemcitabine exerts antiproliferation effects through S-phase arrest, our results showed that berberine inhibited proliferation by inducing G1-phase arrest. Berberine-induced apoptosis of PANC-1 and MIA-PaCa2 cells increased by 7 and 2% compared to control cells, respectively. Notably, berberine had a greater apoptotic effect in PANC-1 cells than gemcitabine. Upon treatment of PANC-1 and MIA-PaCa2 with berberine at a half-maximal inhibitory concentration (IC 50 ), apoptosis was induced by a mechanism that involved the production of reactive oxygen species (ROS) rather than caspase 3/7 activation. Our findings showed that berberine had anti-cancer effects and may be an effective drug for pancreatic cancer chemotherapy
Variability induced by spaceflight environment on high oil and normal maize lines
International Nuclear Information System (INIS)
Xu Xiaowei; Xu Li; Dong Xin; Jin Weiwei; Chen Shaojiang
2011-01-01
High oil inbred line BY815 and two normal inbred lines 1145 and F349 treated with spaceflight were used for variability analysis. Results showed that the mutation rate of BY815 was 21.61% in SP 1 , while the mutation rates of 1145 and F349 were 2.57% and 3.13% respectively. Only six mutants were found from these three materials in SP 2 , of which two mutants, HT-3 from BY815 exhibiting albino leaf color and HT-5 from 1145 exhibiting stripe-like spots leaves, were worthy of further study. Genetic analysis of the two mutants showed that the segregation ratio of normal and mutant phenotypes was 3 : 1, which was in accordance with Mendel's single gene inheritance law. Cytological observation of all the six mutants showed no chromosome abnormalities. By using SSR (simple sequence repeat) method, 130 pairs of primers were employed and only one mutant originated from inbred line 1145 showed polymorphic and the mutated loci rate of the genome in this mutant was 8.46%. (authors)
47 CFR 25.405-25.406 - [Reserved
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false [Reserved] 25.405-25.406 Section 25.405-25.406 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Competitive Bidding Procedures for DARS §§ 25.405-25.406 [Reserved] ...
48 CFR 9904.405-40 - Fundamental requirement.
2010-10-01
.... 9904.405-40 Section 9904.405-40 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-40 Fundamental requirement. (a) Costs expressly...
Forward Genetics by Sequencing EMS Variation-Induced Inbred Lines
Directory of Open Access Journals (Sweden)
Charles Addo-Quaye
2017-02-01
Full Text Available In order to leverage novel sequencing techniques for cloning genes in eukaryotic organisms with complex genomes, the false positive rate of variant discovery must be controlled for by experimental design and informatics. We sequenced five lines from three pedigrees of ethyl methanesulfonate (EMS-mutagenized Sorghum bicolor, including a pedigree segregating a recessive dwarf mutant. Comparing the sequences of the lines, we were able to identify and eliminate error-prone positions. One genomic region contained EMS mutant alleles in dwarfs that were homozygous reference sequences in wild-type siblings and heterozygous in segregating families. This region contained a single nonsynonymous change that cosegregated with dwarfism in a validation population and caused a premature stop codon in the Sorghum ortholog encoding the gibberellic acid (GA biosynthetic enzyme ent-kaurene oxidase. Application of exogenous GA rescued the mutant phenotype. Our method for mapping did not require outcrossing and introduced no segregation variance. This enables work when line crossing is complicated by life history, permitting gene discovery outside of genetic models. This inverts the historical approach of first using recombination to define a locus and then sequencing genes. Our formally identical approach first sequences all the genes and then seeks cosegregation with the trait. Mutagenized lines lacking obvious phenotypic alterations are available for an extension of this approach: mapping with a known marker set in a line that is phenotypically identical to starting material for EMS mutant generation.
7 CFR 205.405 - Denial of certification.
2010-01-01
... PROVISIONS NATIONAL ORGANIC PROGRAM Certification § 205.405 Denial of certification. (a) When the certifying... organic program. (e) An applicant for certification who has received a written notification of... 7 Agriculture 3 2010-01-01 2010-01-01 false Denial of certification. 205.405 Section 205.405...
2010-07-01
... 40 Protection of Environment 28 2010-07-01 2010-07-01 true [Reserved] 405.83 Section 405.83 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS DAIRY PRODUCTS PROCESSING POINT SOURCE CATEGORY Ice Cream, Frozen Desserts, Novelties and Other Dairy Desserts...
42 CFR 405.2112 - ESRD network organizations.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false ESRD network organizations. 405.2112 Section 405... End-Stage Renal Disease (ESRD) Services § 405.2112 ESRD network organizations. CMS will designate an administrative governing body (network organization) for each network. The functions of a network organization...
42 CFR 405.1801 - Introduction.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Introduction. 405.1801 Section 405.1801 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM....1801 Introduction. (a) Definitions. As used in this subpart: Administrator means the Administrator or...
12 CFR 263.405 - Petition for reinstatement.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Petition for reinstatement. 263.405 Section 263.405 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE... Audit Services § 263.405 Petition for reinstatement. (a) Form of petition. Unless otherwise ordered by...
7 CFR 1280.405 - Books and records.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Books and records. 1280.405 Section 1280.405... INFORMATION ORDER Rules and Regulations § 1280.405 Books and records. (a) Each first handler, exporter of... by representatives of the Secretary, such books and records as are necessary to carry out the...
Directory of Open Access Journals (Sweden)
Wenzel Gerhard
2007-01-01
Full Text Available Abstract Background Cell-wall digestibility is the major target for improving the feeding value of forage maize. An understanding of the molecular basis for cell-wall digestibility is crucial towards breeding of highly digestible maize. Results 865 candidate ESTs for cell-wall digestibility were selected according to the analysis of expression profiles in 1 three sets of brown-midrib isogenic lines in the genetic background of inbreds 1332 (1332 and 1332 bm3, 5361 (5361 and 5361 bm3, and F2 (F2, F2 bm1, F2 bm2, and F2 bm3, 2 the contrasting extreme lines of FD (Flint × Dent, AS08 × AS 06, DD1 (Dent × Dent, AS11 × AS09, and DD2 (Dent × Dent, AS29 × AS30 mapping populations, and 3 two contrasting isogenic inbreds, AS20 and AS21. Out of those, 439 ESTs were assembled on our "Forage Quality Array", a small microarray specific for cell wall digestibility related experiments. Transcript profiles of 40 lines of a Flint × Flint population were monitored using the Forage Quality Array, which were contrasting for cell wall digestibility. Using t-tests (p Conclusion 102 candidate genes for cell-wall digestibility were validated by genetical genomics approach. Although the cDNA array highlights gene types (the tested gene and any close family members, trans-acting factors or metabolic bottlenecks seem to play the major role in controlling heritable variation of gene expression related to cell-wall digestibility, since no in silico mapped ESTs were in the same location as their own eQTL. Transcriptional variation was generally found to be oligogenic rather than monogenic inherited due to only 26% ESTs detected a single eQTL in the present study. One eQTL hotspot was co-localized with cell wall digestibility related QTL cluster on bins 3.05, implying that in this case the gene(s underlying QTL and eQTL are identical. As the field of genetical genomics develops, it is expected to significantly improve our knowledge about complex traits, such as cell
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Authority. 405.502 Section... PLANNING PUBLICIZING CONTRACT ACTIONS Paid Advertisements 405.502 Authority. (a) The authority vested in... delegated, with power of redelegation, to HCA's. HCA redelegation of this authority shall be in writing. (b...
7 CFR 28.405 - Low Middling Color.
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Low Middling Color. 28.405 Section 28.405 Agriculture..., TESTING, AND STANDARDS Standards Official Cotton Standards of the United States for the Color Grade of American Upland Cotton § 28.405 Low Middling Color. Low Middling Color is color which is within the range...
46 CFR 108.405 - Fire detection system.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Fire detection system. 108.405 Section 108.405 Shipping... EQUIPMENT Fire Extinguishing Systems § 108.405 Fire detection system. (a) Each fire detection system and each smoke detection system on a unit must— (1) Be approved by the Commandant; and (2) Have a visual...
2010-04-01
...-adversarial proceeding. In making a determination or decision on your claim, we conduct the administrative... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Introduction. 405.1 Section 405.1 Employees... before an administrative law judge. If you are dissatisfied with a decision made by the Federal reviewing...
2010-04-01
... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Housing. 1317.405... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 1317.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except as...
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Housing. 1211.405 Section... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 1211.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except as...
48 CFR 216.405 - Cost-reimbursement incentive contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Cost-reimbursement incentive contracts. 216.405 Section 216.405 Federal Acquisition Regulations System DEFENSE ACQUISITION... Contracts 216.405 Cost-reimbursement incentive contracts. ...
7 CFR 58.405 - Meaning of words.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Meaning of words. 58.405 Section 58.405 Agriculture... for Plants Manufacturing and Packaging Cheese § 58.405 Meaning of words. For the purpose of the regulations in this subpart, words in the singular form shall be deemed to impart the plural and vice versa as...
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Housing. 23.405 Section... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 23.405 Housing. (a) Generally... fees or requirements, or offer different services or benefits related to housing, except as provided in...
2010-10-01
... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Housing. 19.405 Section 19... Prohibited § 19.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply different rules... related to housing, except as provided in this section (including housing provided only to married...
48 CFR 9904.405-10 - [Reserved
2010-10-01
... Section 9904.405-10 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-10 [Reserved] ...
48 CFR 9904.405 - Accounting for unallowable costs.
2010-10-01
... costs. 9904.405 Section 9904.405 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405 Accounting for unallowable costs. ...
Mattey, S N; Strutt, L; Smiseth, P T
2013-04-01
Inbreeding depression is the reduction in fitness caused by mating between related individuals. Inbreeding is expected to cause a reduction in offspring fitness when the offspring themselves are inbred, but outbred individuals may also suffer a reduction in fitness when they depend on care from inbred parents. At present, little is known about the significance of such intergenerational effects of inbreeding. Here, we report two experiments on the burying beetle Nicrophorus vespilloides, an insect with elaborate parental care, in which we investigated inbreeding depression in offspring when either the offspring themselves or their parents were inbred. We found substantial inbreeding depression when offspring were inbred, including reductions in hatching success of inbred eggs and survival of inbred offspring. We also found substantial inbreeding depression when parents were inbred, including reductions in hatching success of eggs produced by inbred parents and survival of outbred offspring that received care from inbred parents. Our results suggest that intergenerational effects of inbreeding can have substantial fitness costs to offspring, and that future studies need to incorporate such costs to obtain accurate estimates of inbreeding depression. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.
48 CFR 25.405 - Caribbean Basin Trade Initiative.
2010-10-01
... Initiative. 25.405 Section 25.405 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS FOREIGN ACQUISITION Trade Agreements 25.405 Caribbean Basin Trade Initiative. Under the Caribbean Basin Trade Initiative, the United States Trade Representative has determined that, for...
Biochemical markers of embryogenesis in tissue cultures of the maize inbred B73
International Nuclear Information System (INIS)
Everett, N.P.; Wach, M.J.; Ashworth, D.J.
1985-01-01
Stable embryogenic, organogenic and undifferentiated cell lines of the maize (Zea mays L.) inbred B73 were used to assess the value of using isozyme analyses and the composition of secreted polysaccharides to identify embryogenic cells. Esterase, glutamate dehydrogenase, alcohol dehydrogenase and β-glucosidase all possessed developmentally regulated isozymes but only esterase and glutamate dehydrogenase could be used to distinguish between embryogenic and shoot-forming cultures. Embryogenic callus and suspension cultures secreted a mucilagenous polysaccharide whose production was stimulated by 2, 4-dichlorophenozyacetic acid (2, 4-D). The polysaccharide was different from root slime and corn hull gum and may be related to the 'cementing layer' in maize kernels (author)
20 CFR 405.701 - Expedited appeals process-general.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Expedited appeals process-general. 405.701 Section 405.701 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Expedited Appeals Process for Constitutional Issues § 405.701 Expedited...
48 CFR 1316.405 - Cost-reimbursement incentive contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Cost-reimbursement incentive contracts. 1316.405 Section 1316.405 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 1316.405 Cost-reimbursement...
48 CFR 916.405 - Cost-reimbursement incentive contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Cost-reimbursement incentive contracts. 916.405 Section 916.405 Federal Acquisition Regulations System DEPARTMENT OF ENERGY CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 916.405 Cost-reimbursement...
Zhou, Zhiqiang; Zhang, Chaoshu; Zhou, Yu; Hao, Zhuanfang; Wang, Zhenhua; Zeng, Xing; Di, Hong; Li, Mingshun; Zhang, Degui; Yong, Hongjun; Zhang, Shihuang; Weng, Jianfeng; Li, Xinhai
2016-03-03
Plant architecture attributes, such as plant height, ear height, and internode number, have played an important role in the historical increases in grain yield, lodging resistance, and biomass in maize (Zea mays L.). Analyzing the genetic basis of variation in plant architecture using high density QTL mapping will be of benefit for the breeding of maize for many traits. However, the low density of molecular markers in existing genetic maps has limited the efficiency and accuracy of QTL mapping. Genotyping by sequencing (GBS) is an improved strategy for addressing a complex genome via next-generation sequencing technology. GBS has been a powerful tool for SNP discovery and high-density genetic map construction. The creation of ultra-high density genetic maps using large populations of advanced recombinant inbred lines (RILs) is an efficient way to identify QTL for complex agronomic traits. A set of 314 RILs derived from inbreds Ye478 and Qi319 were generated and subjected to GBS. A total of 137,699,000 reads with an average of 357,376 reads per individual RIL were generated, which is equivalent to approximately 0.07-fold coverage of the maize B73 RefGen_V3 genome for each individual RIL. A high-density genetic map was constructed using 4183 bin markers (100-Kb intervals with no recombination events). The total genetic distance covered by the linkage map was 1545.65 cM and the average distance between adjacent markers was 0.37 cM with a physical distance of about 0.51 Mb. Our results demonstrated a relatively high degree of collinearity between the genetic map and the B73 reference genome. The quality and accuracy of the bin map for QTL detection was verified by the mapping of a known gene, pericarp color 1 (P1), which controls the color of the cob, with a high LOD value of 80.78 on chromosome 1. Using this high-density bin map, 35 QTL affecting plant architecture, including 14 for plant height, 14 for ear height, and seven for internode number were detected
48 CFR 9904.405-62 - Exemption.
2010-10-01
... Section 9904.405-62 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-62 Exemption. None for this Standard. ...
48 CFR 1816.405 - Cost-reimbursement incentive contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Cost-reimbursement incentive contracts. 1816.405 Section 1816.405 Federal Acquisition Regulations System NATIONAL AERONAUTICS... 1816.405 Cost-reimbursement incentive contracts. [62 FR 3478, Jan. 23, 1997. Redesignated at 62 FR...
48 CFR 9904.405-50 - Techniques for application.
2010-10-01
.... 9904.405-50 Section 9904.405-50 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-50 Techniques for application. (a) The detail and...
48 CFR 9904.405-60 - Illustrations.
2010-10-01
... Section 9904.405-60 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-60 Illustrations. (a) An auditor recommends disallowance of...
Wu, Liancheng; Li, Mingna; Tian, Lei; Wang, Shunxi; Wu, Liuji; Ku, Lixia; Zhang, Jun; Song, Xiaoheng; Liu, Haiping; Chen, Yanhui
2017-01-01
In maize (Zea mays), leaf senescence acts as a nutrient recycling process involved in proteins, lipids, and nucleic acids degradation and transport to the developing sink. However, the molecular mechanisms of pre-maturation associated with pollination-prevention remain unclear in maize. To explore global gene expression changes during the onset and progression of senescence in maize, the inbred line 08LF, with severe early senescence caused by pollination prevention, was selected. Phenotypic observation showed that the onset of leaf senescence of 08LF plants occurred approximately 14 days after silking (DAS) by pollination prevention. Transcriptional profiling analysis of the leaf at six developmental stages during induced senescence revealed that a total of 5,432 differentially expressed genes (DEGs) were identified, including 2314 up-regulated genes and 1925 down-regulated genes. Functional annotation showed that the up-regulated genes were mainly enriched in multi-organism process and nitrogen compound transport, whereas down-regulated genes were involved in photosynthesis. Expression patterns and pathway enrichment analyses of early-senescence related genes indicated that these DEGs are involved in complex regulatory networks, especially in the jasmonic acid pathway. In addition, transcription factors from several families were detected, particularly the CO-like, NAC, ERF, GRAS, WRKY and ZF-HD families, suggesting that these transcription factors might play important roles in driving leaf senescence in maize as a result of pollination-prevention.
48 CFR 9904.405-30 - Definitions.
2010-10-01
... Section 9904.405-30 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-30 Definitions. (a) The following are definitions of terms...
33 CFR 135.405 - Appeal provisions.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Appeal provisions. 135.405 Section 135.405 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION FINANCIAL RESPONSIBILITY AND COMPENSATION OFFSHORE OIL POLLUTION COMPENSATION FUND...
42 CFR 405.803 - Initial determination.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Initial determination. 405.803 Section 405.803....803 Initial determination. (a) Carriers make initial determinations regarding claims for benefits under Medicare Part B. (b) An initial determination for purposes of this subpart includes determinations...
20 CFR 405.360 - Official record.
2010-04-01
... in making the decision under review and any additional evidence or written statements that the... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Official record. 405.360 Section 405.360 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL...
2010-10-01
... Section 9904.405-20 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-20 Purpose. (a) The purpose of this Cost Accounting Standard is...
Brusamarello-Santos, Liziane Cristina; Gilard, Françoise; Brulé, Lenaïg; Quilleré, Isabelle; Gourion, Benjamin; Ratet, Pascal; Maltempi de Souza, Emanuel; Lea, Peter J.; Hirel, Bertrand
2017-01-01
Maize roots can be colonized by free-living atmospheric nitrogen (N2)-fixing bacteria (diazotrophs). However, the agronomic potential of non-symbiotic N2-fixation in such an economically important species as maize, has still not been fully exploited. A preliminary approach to improve our understanding of the mechanisms controlling the establishment of such N2-fixing associations has been developed, using two maize inbred lines exhibiting different physiological characteristics. The bacterial-plant interaction has been characterized by means of a metabolomic approach. Two established model strains of Nif+ diazotrophic bacteria, Herbaspirillum seropedicae and Azospirillum brasilense and their Nif- couterparts defficient in nitrogenase activity, were used to evaluate the impact of the bacterial inoculation and of N2 fixation on the root and leaf metabolic profiles. The two N2-fixing bacteria have been used to inoculate two genetically distant maize lines (FV252 and FV2), already characterized for their contrasting physiological properties. Using a well-controlled gnotobiotic experimental system that allows inoculation of maize plants with the two diazotrophs in a N-free medium, we demonstrated that both maize lines were efficiently colonized by the two bacterial species. We also showed that in the early stages of plant development, both bacterial strains were able to reduce acetylene, suggesting that they contain functional nitrogenase activity and are able to efficiently fix atmospheric N2 (Fix+). The metabolomic approach allowed the identification of metabolites in the two maize lines that were representative of the N2 fixing plant-bacterial interaction, these included mannitol and to a lesser extend trehalose and isocitrate. Whilst other metabolites such as asparagine, although only exhibiting a small increase in maize roots following bacterial infection, were specific for the two Fix+ bacterial strains, in comparison to their Fix- counterparts. Moreover, a number
Directory of Open Access Journals (Sweden)
Liziane Cristina Brusamarello-Santos
Full Text Available Maize roots can be colonized by free-living atmospheric nitrogen (N2-fixing bacteria (diazotrophs. However, the agronomic potential of non-symbiotic N2-fixation in such an economically important species as maize, has still not been fully exploited. A preliminary approach to improve our understanding of the mechanisms controlling the establishment of such N2-fixing associations has been developed, using two maize inbred lines exhibiting different physiological characteristics. The bacterial-plant interaction has been characterized by means of a metabolomic approach. Two established model strains of Nif+ diazotrophic bacteria, Herbaspirillum seropedicae and Azospirillum brasilense and their Nif- couterparts defficient in nitrogenase activity, were used to evaluate the impact of the bacterial inoculation and of N2 fixation on the root and leaf metabolic profiles. The two N2-fixing bacteria have been used to inoculate two genetically distant maize lines (FV252 and FV2, already characterized for their contrasting physiological properties. Using a well-controlled gnotobiotic experimental system that allows inoculation of maize plants with the two diazotrophs in a N-free medium, we demonstrated that both maize lines were efficiently colonized by the two bacterial species. We also showed that in the early stages of plant development, both bacterial strains were able to reduce acetylene, suggesting that they contain functional nitrogenase activity and are able to efficiently fix atmospheric N2 (Fix+. The metabolomic approach allowed the identification of metabolites in the two maize lines that were representative of the N2 fixing plant-bacterial interaction, these included mannitol and to a lesser extend trehalose and isocitrate. Whilst other metabolites such as asparagine, although only exhibiting a small increase in maize roots following bacterial infection, were specific for the two Fix+ bacterial strains, in comparison to their Fix- counterparts
Brusamarello-Santos, Liziane Cristina; Gilard, Françoise; Brulé, Lenaïg; Quilleré, Isabelle; Gourion, Benjamin; Ratet, Pascal; Maltempi de Souza, Emanuel; Lea, Peter J; Hirel, Bertrand
2017-01-01
Maize roots can be colonized by free-living atmospheric nitrogen (N2)-fixing bacteria (diazotrophs). However, the agronomic potential of non-symbiotic N2-fixation in such an economically important species as maize, has still not been fully exploited. A preliminary approach to improve our understanding of the mechanisms controlling the establishment of such N2-fixing associations has been developed, using two maize inbred lines exhibiting different physiological characteristics. The bacterial-plant interaction has been characterized by means of a metabolomic approach. Two established model strains of Nif+ diazotrophic bacteria, Herbaspirillum seropedicae and Azospirillum brasilense and their Nif- couterparts defficient in nitrogenase activity, were used to evaluate the impact of the bacterial inoculation and of N2 fixation on the root and leaf metabolic profiles. The two N2-fixing bacteria have been used to inoculate two genetically distant maize lines (FV252 and FV2), already characterized for their contrasting physiological properties. Using a well-controlled gnotobiotic experimental system that allows inoculation of maize plants with the two diazotrophs in a N-free medium, we demonstrated that both maize lines were efficiently colonized by the two bacterial species. We also showed that in the early stages of plant development, both bacterial strains were able to reduce acetylene, suggesting that they contain functional nitrogenase activity and are able to efficiently fix atmospheric N2 (Fix+). The metabolomic approach allowed the identification of metabolites in the two maize lines that were representative of the N2 fixing plant-bacterial interaction, these included mannitol and to a lesser extend trehalose and isocitrate. Whilst other metabolites such as asparagine, although only exhibiting a small increase in maize roots following bacterial infection, were specific for the two Fix+ bacterial strains, in comparison to their Fix- counterparts. Moreover, a number
24 CFR 891.405 - Replacement reserve.
2010-04-01
... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Replacement reserve. 891.405....405 Replacement reserve. (a) Establishment of reserve. The Owner shall establish and maintain a replacement reserve to aid in funding extraordinary maintenance and repair and replacement of capital items...
48 CFR 15.405 - Price negotiation.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Price negotiation. 15.405... AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 15.405 Price negotiation. (a) The purpose of performing cost or price analysis is to develop a negotiation position that permits the...
40 CFR 721.405 - Polyether acrylate.
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Polyether acrylate. 721.405 Section... § 721.405 Polyether acrylate. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as a polyether acrylate (PMN P-95-666) is subject to...
Genome characterization of the selected long- and short-sleep mouse lines.
Dowell, Robin; Odell, Aaron; Richmond, Phillip; Malmer, Daniel; Halper-Stromberg, Eitan; Bennett, Beth; Larson, Colin; Leach, Sonia; Radcliffe, Richard A
2016-12-01
The Inbred Long- and Short-Sleep (ILS, ISS) mouse lines were selected for differences in acute ethanol sensitivity using the loss of righting response (LORR) as the selection trait. The lines show an over tenfold difference in LORR and, along with a recombinant inbred panel derived from them (the LXS), have been widely used to dissect the genetic underpinnings of acute ethanol sensitivity. Here we have sequenced the genomes of the ILS and ISS to investigate the DNA variants that contribute to their sensitivity difference. We identified ~2.7 million high-confidence SNPs and small indels and ~7000 structural variants between the lines; variants were found to occur in 6382 annotated genes. Using a hidden Markov model, we were able to reconstruct the genome-wide ancestry patterns of the eight inbred progenitor strains from which the ILS and ISS were derived, and found that quantitative trait loci that have been mapped for LORR were slightly enriched for DNA variants. Finally, by mapping and quantifying RNA-seq reads from the ILS and ISS to their strain-specific genomes rather than to the reference genome, we found a substantial improvement in a differential expression analysis between the lines. This work will help in identifying and characterizing the DNA sequence variants that contribute to the difference in ethanol sensitivity between the ILS and ISS and will also aid in accurate quantification of RNA-seq data generated from the LXS RIs.
42 CFR 405.809 - Opportunity to submit evidence.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Opportunity to submit evidence. 405.809 Section 405.809 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM FEDERAL HEALTH INSURANCE FOR THE AGED AND DISABLED Appeals Under the Medicare Part B Program § 405.809 Opportunity to submit...
24 CFR 598.405 - Environmental review.
2010-04-01
... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Environmental review. 598.405...-Designation Requirements § 598.405 Environmental review. Where any EZ's strategic plan or any revision thereof proposes the use of HUD EZ Grant Funds for activities that are not excluded from environmental review under...
2010-07-01
... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Housing. 101-4.405... Education Programs or Activities Prohibited § 101-4.405 Housing. (a) Generally. A recipient shall not, on... offer different services or benefits related to housing, except as provided in this section (including...
Characterization and performance of 16 new inbred lines of lettuce
The Agricultural Research Service, U.S. Department of Agriculture announces the release of sixteen breeding lines of lettuce (Lactuca sativa L.). Five (SM13-I1, SM13-I2, SM13-I3, SM13-I4, and SM13-I5) of the six iceberg breeding lines can be used for whole head or salad blend production; the sixth i...
Inhibition of autophagy enhances the cytotoxic effect of PA-MSHA in breast cancer
International Nuclear Information System (INIS)
Xu, Wen-Huan; Liu, Zhe-Bin; Hou, Yi-Feng; Hong, Qi; Hu, Da-Li; Shao, Zhi-Ming
2014-01-01
PA-MSHA, a genetically engineered Pseudomonas aeruginosa (PA) strain, is currently under investigation as a new anti-cancer drug. It can induce cell cycle arrest and apoptosis in different human cancer cells, including hormone receptor negative breast cancer cells. However, the underlying mechanism of tumor lethality mediated by PA-MSHA remains to be fully investigated. The effect of PA-MSHA on human hormone receptor negative breast cancer cells was analyzed by morphological measurement, western blot, cell proliferation assay and mouse xenograft model. PA-MSHA was found to induce endoplasmic reticulum (ER) stress in breast cancer cell lines through the IRE1 signaling pathway. Inhibiting autophagy potentiated the cytotoxic effect of PA-MSHA while treating breast cancer cell lines. In mouse xenograft model, PA-MSHA produced more pronounced tumor suppression in mice inoculated with IRE1 gene knockdown. MDA-MB-231HM cells. These findings demonstrated inhibiting autophagy together with PA-MSHA might be a promising therapeutic strategy in treating hormone receptor negative breast cancer cells
Huang, De-Run; Fan, Ye-Yang; Hu, Biao-Lin; Xiao, Ye-Qing; Chen, Da-Zhou; Zhuang, Jie-Yun
2018-03-01
Heavy metal accumulation in rice is a growing concern for public health. Backcross inbred lines derived from an interspecific cross of Oryza sativa × O. rufipogon were grown in two distinct ecological locations (Hangzhou and Lingshui, China). The objective of this study was to characterise the contents of heavy metal in rice grains, and to identify quantitative trait loci (QTLs) for heavy metal contents. The contents of Ni, As, Pb, Cr and Hg in milled rice showed a significant decline as compared with those in brown rice, whereas the content of Cd showed little change. The concentration of heavy metal in rice grain varied greatly between the two environments. A total of 24 QTLs responsible for heavy metal contents were detected, including two for both the brown and milled rice, 13 for brown rice only, and nine for milled rice only. All the QTLs except two had the enhancing alleles derived from O. rufipogon. Sixteen QTLs were clustered in six chromosomal regions. Environmental variation plays an important role in the heavy metal contents in rice grain. QTLs detected in this study might be useful for breeding rice varieties with low heavy metal content. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
2010-01-01
... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Housing. 8a.405 Section 8a.405 Commerce and Foreign Trade Office of the Secretary of Commerce NONDISCRIMINATION ON THE BASIS OF SEX IN... offer different services or benefits related to housing, except as provided in this section (including...
20 CFR 405.715 - Agreement in expedited appeals process.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Agreement in expedited appeals process. 405.715 Section 405.715 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Expedited Appeals Process for Constitutional Issues § 405...
Initial locomotor sensitivity to cocaine varies widely among inbred mouse strains.
Wiltshire, T; Ervin, R B; Duan, H; Bogue, M A; Zamboni, W C; Cook, S; Chung, W; Zou, F; Tarantino, L M
2015-03-01
Initial sensitivity to psychostimulants can predict subsequent use and abuse in humans. Acute locomotor activation in response to psychostimulants is commonly used as an animal model of initial drug sensitivity and has been shown to have a substantial genetic component. Identifying the specific genetic differences that lead to phenotypic differences in initial drug sensitivity can advance our understanding of the processes that lead to addiction. Phenotyping inbred mouse strain panels are frequently used as a first step for studying the genetic architecture of complex traits. We assessed locomotor activation following a single, acute 20 mg/kg dose of cocaine (COC) in males from 45 inbred mouse strains and observed significant phenotypic variation across strains indicating a substantial genetic component. We also measured levels of COC, the active metabolite, norcocaine and the major inactive metabolite, benzoylecgonine, in plasma and brain in the same set of inbred strains. Pharmacokinetic (PK) and behavioral data were significantly correlated, but at a level that indicates that PK alone does not account for the behavioral differences observed across strains. Phenotypic data from this reference population of inbred strains can be utilized in studies aimed at examining the role of psychostimulant-induced locomotor activation on drug reward and reinforcement and to test theories about addiction processes. Moreover, these data serve as a starting point for identifying genes that alter sensitivity to the locomotor stimulatory effects of COC. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
5 CFR 300.405 - Requirement for contract.
2010-01-01
... principles and equal opportunity laws. ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Requirement for contract. 300.405 Section... (GENERAL) Use of Commercial Recruiting Firms and Nonprofit Employment Services § 300.405 Requirement for...
Directory of Open Access Journals (Sweden)
Schwegler Herbert
2005-04-01
Full Text Available Abstract In the present paper we review a series of experiments showing that heritable variations in the size of the hippocampal intra- and infrapyramidal mossy fiber (IIPMF terminal fields correlate with performance in spatial, but not non-spatial radial-maze tasks. Experimental manipulation of the size of this projection by means of early postnatal hyperthyroidism produces the effects predicted from the correlations obtained with inbred mouse strains. Although the physiological mechanisms behind these correlations are unknown as yet, several lines of evidence indicate that these correlations are causal.
Screening of inbred popcorn lines for tolerance to low phosphorus.
Santos, O J A P; Gonçalves, L S A; Scapim, C A; S M de Sousa, de; Castro, C R; Y Baba, V; de Oliveira, A L M
2016-05-06
Increasing phosphorus use efficiency in agriculture is essential for sustainable food production. Thus, the aims of this study were: i) to identify phosphorus use efficiency (PUE) in popcorn lines during the early plant stages, ii) to study the relationship between traits correlated with PUE, and iii) to analyze genetic diversity among lines. To accomplish this, 35 popcorn lines from Universidade Estadual de Maringá breeding program were studied. The experiment was conducted in a growth chamber using a nutrient solution containing two concentrations of phosphorus (P): 2.5 μM or low P (LP) and 250 μM or high P (HP). After 13 days in the nutrient solution, root morphology traits, shoot and root dry weight, and P content of the maize seedlings were measured. A deviance analysis showed there was a high level of genetic variability. An unweighted pair group method with arithmetic mean (UPGMA) clustering analysis identified three groups for the LP treatment (efficient, intermediate, and inefficient) and three groups for the HP treatment (responsive, moderately responsive, and unresponsive). The results of a principal component analysis and selection index were consistent with the UPGMA analysis, and lines 1, 2, 13, 17, 26, and 31 were classified as PUE.
20 CFR 405.515 - Application of circuit court law.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Application of circuit court law. 405.515 Section 405.515 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Judicial Review § 405.515 Application of circuit court law. We will...
Study of improvement of indices maize line to establish their position in hybrids
Directory of Open Access Journals (Sweden)
Oxana DIRZU-COCOS
2015-12-01
Full Text Available Corn (Zea mays L. crop that is grown on large areas - over 140 million hectares worldwide, and 400-500 thousand ha in Moldova due to production potential broad diversity of use as food for humans, animals, birds raw material for industrial processing. The upward trend in average yields achieved is largely attributed to the improvement of scientific programs. Select the line with the characters and traits that are transmitted hereditary hybrids and contribute to their performance, ensure progress in improvement. Therefore, the process of creating inbred lines associated with combining ability testing as a measure of productivity conferred hybrids, is significant research programs. Orientation purpose of improved maize hybrids to formulas and simple change to a superior capitalization heterosis effect and perfect uniformity of plant requires changes in methodology for the creation, evaluation and classification of inbred lines.
26 CFR 1.405-3 - Taxation of retirement bonds.
2010-04-01
... 26 Internal Revenue 5 2010-04-01 2010-04-01 false Taxation of retirement bonds. 1.405-3 Section 1.405-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.405-3 Taxation of retirement...
48 CFR 9904.405-63 - Effective date.
2010-10-01
...-63 Section 9904.405-63 Federal Acquisition Regulations System COST ACCOUNTING STANDARDS BOARD, OFFICE OF FEDERAL PROCUREMENT POLICY, OFFICE OF MANAGEMENT AND BUDGET PROCUREMENT PRACTICES AND COST ACCOUNTING STANDARDS COST ACCOUNTING STANDARDS 9904.405-63 Effective date. This Standard is effective as of...
23 CFR 710.405 - Air rights on the Interstate.
2010-04-01
... 23 Highways 1 2010-04-01 2010-04-01 false Air rights on the Interstate. 710.405 Section 710.405 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RIGHT-OF-WAY AND ENVIRONMENT RIGHT-OF-WAY AND REAL ESTATE Real Property Management § 710.405 Air rights on the Interstate. (a) The FHWA...
31 CFR 544.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 544.405 Section 544.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE..., provide legal, accounting, financial, brokering, freight forwarding, transportation, public relations, or...
BXSB/long-lived is a recombinant inbred strain containing powerful disease suppressor loci.
Haywood, Michelle E K; Gabriel, Luisa; Rose, S Jane; Rogers, Nicola J; Izui, Shozo; Morley, Bernard J
2007-08-15
The BXSB strain of recombinant inbred mice develops a spontaneous pathology that closely resembles the human disease systemic lupus erythematosus. Six non-MHC loci, Yaa, Bxs1-4, and Bxs6, have been linked to the development of aspects of the disease while a further locus, Bxs5, may be a BXSB-derived disease suppressor. Disease development is delayed in a substrain of BXSB, BXSB/MpJScr-long-lived (BXSB/ll). We compared the genetic derivation of BXSB/ll mice to the original strain, BXSB/MpJ, using microsatellite markers and single nucleotide polymorphisms across the genome. These differences were clustered and included two regions known to be important in the disease-susceptibility of these mice, Bxs5 and 6, as well as regions on chromosomes 5, 6, 9, 11, 12, and 13. We compared BXSB/ll to >20 strains including the BXSB parental SB/Le and C57BL/6 strains. This revealed that BXSB/ll is a separate recombinant inbred line derived from SB/Le and C57BL/6, but distinctly different from BXSB, that most likely arose due to residual heterozygosity in the BXSB stock. Despite the continued presence of the powerful disease-susceptibility locus Bxs3, BXSB/ll mice do not develop disease. We propose that the disappearance of the disease phenotype in the BXSB/ll mice is due to the inheritance of one or more suppressor loci in the differentially inherited intervals between the BXSB/ll and BXSB strains.
GGE Biplot projection in discriminating the efficiency of popcorn lines to use nitrogen
Directory of Open Access Journals (Sweden)
Adriano dos Santos
Full Text Available ABSTRACT Nitrogen is essential for sustaining life on the planet, and it is the most important nutrient for obtaining high agricultural production. However, their use leads to the release of nitrous oxide with a global warming potential 296 times higher than the CO2 molecule, making it a challenge to reduce their use in agriculture. The objective of this research was to identify efficient popcorn inbred lines and responsive nitrogen use and exhibit a good expansion volume. For this, 29 inbred lines from the Germplasm Collection of Darcy Ribeiro North Fluminense State University (UENF were evaluated at two contrasting levels of nitrogen availability (low and ideal at two representative locations in the north and northwest of the state of Rio de Janeiro, Brazil, arranged in a randomized block design with three replicates. These inbred lines were discriminated against efficient use of nitrogen by multivariate GGE Biplot. Selective accuracy was close to 1, showing that the genotypes were enough to provide contrasting success in selection procedures. The first two main components (PC retained 93.82% of the total variation, and PC1 furnished an information ratio (IR that was unaffected by noise. L77 was the most unstable line, while P7, P2, P6, P3, P5, P4, P9, P10, P8, P9, L70, L74, and L55 were efficient and responsive. The GGE biplot method is recommended for the reliable identification of popcorn lines that are efficient and responsive to the use of nitrogen.
48 CFR 1845.405-70 - NASA procedures.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NASA procedures. 1845.405... ADMINISTRATION CONTRACT MANAGEMENT GOVERNMENT PROPERTY Contractor Use and Rental of Government Property 1845.405... and research property if such property is used in performing services or manufacturing articles for...
48 CFR 416.405 - Cost-reimbursement incentive contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Cost-reimbursement incentive contracts. 416.405 Section 416.405 Federal Acquisition Regulations System DEPARTMENT OF...-reimbursement incentive contracts. ...
31 CFR 541.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 541.405 Section 541.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE.... persons may not, except as authorized by or pursuant to this part, provide legal, accounting, financial...
31 CFR 537.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 537.405 Section 537.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE.... persons may not, except as authorized by or pursuant to this part, provide legal, accounting, financial...
31 CFR 593.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 593.405 Section 593.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE.... persons may not, except as authorized by or pursuant to this part, provide legal, accounting, financial...
31 CFR 542.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 542.405 Section 542.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE.... persons may not, except as authorized by or pursuant to this part, provide legal, accounting, financial...
31 CFR 548.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 548.405 Section 548.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE.... persons may not, except as authorized by or pursuant to this part, provide legal, accounting, financial...
31 CFR 547.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 547.405 Section 547.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE.... persons may not, except as authorized by or pursuant to this part, provide legal, accounting, financial...
40 CFR 59.405 - Container labeling requirements.
2010-07-01
... 40 Protection of Environment 5 2010-07-01 2010-07-01 false Container labeling requirements. 59.405... National Volatile Organic Compound Emission Standards for Architectural Coatings § 59.405 Container... section on the coating container in which the coating is sold or distributed. (1) The date the coating was...
Directory of Open Access Journals (Sweden)
Maria Elisa Ayres Guidetti Zagatto Paterniani
2002-04-01
Full Text Available Avaliaram-se dez linhagens de milho do programa de melhoramento do Instituto Agronômico (IAC, em cruzamentos dialélicos e os 45 híbridos resultantes quanto à tolerância à toxicidade de alumínio em laboratório. Estimou-se a tolerância pelo comprimento líquido da radícula (CLR de plântulas em solução nutritiva contendo 4,5 mg.L-1 de alumínio, em ensaio sob delineamento experimental de blocos casualizados com quatro repetições, utilizando-se como padrões linhagens sensível e tolerante de IAC Taiúba. Apresentam-se, ainda, resultados da produtividade desses cruzamentos em ensaios de campo. Identificaram-se linhagens que constituem fontes de tolerância (L 06 e L 09 e híbridos tolerantes à toxicidade de alumínio com elevada produtividade em solos corrigidos. Na análise dialélica, o desdobramento dos efeitos de tratamentos, em capacidade geral (CGC e específica (CEC de combinação, indicou a predominância de efeitos aditivos na manifestação da tolerância ao alumínio tóxico. Obtiveram-se elevados valores de heterose, indicando a existência de interações não alélicas na manifestação do CLR. O híbrido HS 10X11 (denominado IAC 21 aliou alta produtividade e tolerância ao alumínio, apresentando a maior estimativa da CEC para CLR.Ten inbred lines and the resulting forty-five hybrids from the maize IAC breeding program were evaluated for Al tolerance by the nutrient solution technique. Net radicle lengths (CLR of plants grown with 4.5 mg.L-1 were used to estimate Al tolerance. The experimental design was randomized complete block with four replications, and it was used two divergent inbred lines IAC Taiuba as control for Al tolerance and sensitivity, respectively. In addition to these data, it is shown also the grain yield of the same materials from field plots. It was identified two inbred lines (L 06 and L 09 as Al tolerance sources and hybrids potentially adapted to acid soil conditions (tolerant to Al toxicity
48 CFR 8.405-5 - Small business.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Small business. 8.405-5... REQUIRED SOURCES OF SUPPLIES AND SERVICES Federal Supply Schedules 8.405-5 Small business. (a) Although the... credited toward the ordering activity's small business goals. For purposes of reporting an order placed...
42 CFR 405.2446 - Scope of services.
2010-10-01
... nursing facility or a nursing facility or other institution used as a patient's home. (d) Federally... 42 Public Health 2 2010-10-01 2010-10-01 false Scope of services. 405.2446 Section 405.2446 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM...
31 CFR 587.405 - Provision of services.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Provision of services. 587.405 Section 587.405 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE...) Example: U.S. persons may not, except as authorized by or pursuant to this part, provide legal, accounting...
20 CFR 628.405 - Service delivery areas.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Service delivery areas. 628.405 Section 628... TITLE II OF THE JOB TRAINING PARTNERSHIP ACT Local Service Delivery System § 628.405 Service delivery... evaluate the degree to which a proposed service delivery area meets criteria established by the Governor...
28 CFR 42.405 - Public dissemination of title VI information.
2010-07-01
... Federally Assisted Programs § 42.405 Public dissemination of title VI information. (a) Federal agencies... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Public dissemination of title VI information. 42.405 Section 42.405 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION; EQUAL...
42 CFR 405.374 - Opportunity for rebuttal.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Opportunity for rebuttal. 405.374 Section 405.374 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM FEDERAL HEALTH INSURANCE FOR THE AGED AND DISABLED Suspension of Payment, Recovery of Overpayments, and Repayment of Scholarships and...
48 CFR 1816.405-271 - Base fee.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Base fee. 1816.405-271... CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 1816.405-271 Base fee. (a) A base fee shall not be used on CPAF contracts for which the periodic award fee evaluations are final...
Directory of Open Access Journals (Sweden)
Pascal Schopp
2017-11-01
Full Text Available A major application of genomic prediction (GP in plant breeding is the identification of superior inbred lines within families derived from biparental crosses. When models for various traits were trained within related or unrelated biparental families (BPFs, experimental studies found substantial variation in prediction accuracy (PA, but little is known about the underlying factors. We used SNP marker genotypes of inbred lines from either elite germplasm or landraces of maize (Zea mays L. as parents to generate in silico 300 BPFs of doubled-haploid lines. We analyzed PA within each BPF for 50 simulated polygenic traits, using genomic best linear unbiased prediction (GBLUP models trained with individuals from either full-sib (FSF, half-sib (HSF, or unrelated families (URF for various sizes (Ntrain of the training set and different heritabilities (h2 . In addition, we modified two deterministic equations for forecasting PA to account for inbreeding and genetic variance unexplained by the training set. Averaged across traits, PA was high within FSF (0.41–0.97 with large variation only for Ntrain < 50 and h2 < 0.6. For HSF and URF, PA was on average ∼40–60% lower and varied substantially among different combinations of BPFs used for model training and prediction as well as different traits. As exemplified by HSF results, PA of across-family GP can be very low if causal variants not segregating in the training set account for a sizeable proportion of the genetic variance among predicted individuals. Deterministic equations accurately forecast the PA expected over many traits, yet cannot capture trait-specific deviations. We conclude that model training within BPFs generally yields stable PA, whereas a high level of uncertainty is encountered in across-family GP. Our study shows the extent of variation in PA that must be at least reckoned with in practice and offers a starting point for the design of training sets composed of multiple BPFs.
20 CFR 405.510 - Claims remanded by a Federal court.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Claims remanded by a Federal court. 405.510 Section 405.510 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Judicial Review § 405.510 Claims remanded by a Federal court. When a...
40 CFR 405.110 - Applicability; description of the condensed whey subcategory.
2010-07-01
... condensed whey subcategory. 405.110 Section 405.110 Protection of Environment ENVIRONMENTAL PROTECTION... Condensed Whey Subcategory § 405.110 Applicability; description of the condensed whey subcategory. The... whey and condensed acid whey. ...
International Nuclear Information System (INIS)
Singh, B.D.; Singh, R.B.; Singh, R.M.; Vijay Laxmi
1977-01-01
Chiasma frequency was recorded in normal and treated [10, 20, 30 Kr γ-rays, 0.2% ethyl methane-sulphonate (EMS) and 10 Kr γ-rays + 0.2% EMS] populations of 7 inbreds and 3 hybrids of pearl millet. Inbreds in general showed lower chiasma frequency than hybrids. However, inbred Bi13B showed the highest chiasma frequency. The male sterile cytoplasm reduced the chaisma frequency and increased the among-plant-variability in the inbreds and, therefore, possibly in the hybrids which had male sterile cytoplasm. γ-rays were more effective than EMS in reducing chiasma frequency. In most of the genotypes 10Kr γ-rays and 0.2% EMS promoted chiasma frequency. The combination treatments showed greater effect than γ-rays and EMS applied individually. Hybrids as a group, showed lower variation for chiasma number than inbreds in response to the mutagenic treatments. (author)
Uchio-Yamada, Kozue; Kasai, Fumio; Ozawa, Midori; Kohara, Arihiro
2016-01-01
Misidentification or cross-contamination of cell lines can cause serious issues. Human cell lines have been authenticated by short tandem repeat profiling; however, mouse cell lines have not been adequately assessed. In this study, mouse cell lines registered with the JCRB cell bank were examined by simple sequence length polymorphism (SSLP) analysis to identify their strains. Based on comparisons with 7 major inbred strains, our results revealed their strains in 80 of 90 cell lines. However,...
Diversity analysis of Ethiopian mustard breeding lines using RAPD ...
African Journals Online (AJOL)
Using cluster analysis based on unweighted pair-group method with arithmetic average (UPGMA) and principal coordinate analysis (PCoA), the 21 Ethiopian inbred lines were grouped into three subgroups and the single genotype introduced from Sweden formed a separate group. The clustering pattern failed to show a ...
48 CFR 16.405 - Cost-reimbursement incentive contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Cost-reimbursement incentive contracts. 16.405 Section 16.405 Federal Acquisition Regulations System FEDERAL ACQUISITION...-reimbursement incentive contracts. See 16.301 for requirements applicable to all cost-reimbursement contracts...
48 CFR 27.405-3 - Commercial computer software.
2010-10-01
... software. 27.405-3 Section 27.405-3 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Commercial computer software. (a) When contracting other than from GSA's Multiple Award Schedule contracts for the acquisition of commercial computer software, no specific contract clause prescribed in this...
Enzyme markers in inbred rat strains: genetics of new markers and strain profiles.
Adams, M; Baverstock, P R; Watts, C H; Gutman, G A
1984-08-01
Twenty-six inbred strains of the laboratory rat (Rattus norvegicus) were examined for electrophoretic variation at an estimated 97 genetic loci. In addition to previously documented markers, variation was observed for the enzymes aconitase, aldehyde dehydrogenase, and alkaline phosphatase. The genetic basis of these markers (Acon-1, Ahd-2, and Akp-1) was confirmed. Linkage analysis between 35 pairwise comparisons revealed that the markers Fh-1 and Pep-3 are linked. The strain profiles of the 25 inbred strains at 11 electrophoretic markers are given.
46 CFR 15.405 - Familiarity with vessel characteristics.
2010-10-01
... 46 Shipping 1 2010-10-01 2010-10-01 false Familiarity with vessel characteristics. 15.405 Section... MANNING REQUIREMENTS Manning Requirements; All Vessels § 15.405 Familiarity with vessel characteristics. Each credentialed individual must become familiar with the relevant characteristics of the vessel on...
48 CFR 49.405 - Completion by another contractor.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Completion by another contractor. 49.405 Section 49.405 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... contractor. If the surety does not arrange for completion of the contract, the contracting officer normally...
40 CFR 405.120 - Applicability; description of the dry whey subcategory.
2010-07-01
... whey subcategory. 405.120 Section 405.120 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS DAIRY PRODUCTS PROCESSING POINT SOURCE CATEGORY Dry Whey Subcategory § 405.120 Applicability; description of the dry whey subcategory. The provisions of this subpart...
After examining ear-colonizing pest resistance, 20 maize lines from the USDA-ARS germplasm enhancement of Maize (GEM) Program were evaluated for whorl-feeding fall armyworm (FAW) (Spodoptera frugiperda) resistance using four maize inbred lines as the resistant and susceptible controls. Both FAW inju...
BaO-Nd2O3-CuOx subsolidus equilibria under carbonate-free conditions at pO2=100 Pa and at pO2=21 kPa
International Nuclear Information System (INIS)
Wong-Ng, W.; Cook, L.P.; Suh, J.; Coutts, R.; Stalick, J.K.; Levin, I.; Huang, Q.
2003-01-01
Subsolidus phase equilibria of the BaO-Nd 2 O 3 -CuO x system at pO 2 =100 Pa (0.1% O 2 volume fraction, 810 deg. C) and at pO 2 =21 kPa (21% O 2 volume fraction, 930 deg. C) have been investigated by applying controlled-atmosphere methods to minimize the presence of carbonate and CO 2 and H 2 O contamination. Under carbonate-free conditions, the BaO-Nd 2 O 3 -CuO x phase diagrams at pO 2 =100 Pa and at pO 2 =21 kPa are similar to one another except for differences in the extent of the solid solutions. Apart from the limiting binary phases, the ternary system consists of three solid solutions and one stoichiometric ternary compound. The first solid solution is the high T c series, Ba 2-x Nd 1+x Cu 3 O 6+z (0.3≥x≥0 at pO 2 =100 Pa; 0.95≥x≥ 0 at pO 2 =21 kPa). At pO 2 =21 kPa, a compositionally dependent phase change was detected, from tetragonal (0.7>x≥0) to orthorhombic (0.95≥x≥0.7). The second solid solution series, the 'brown-phase' Ba 1+x Nd 2-x CuO z , has a narrow homogeneity region (0.10>x≥0 at pO 2 =100 Pa; 0.15>x≥0 at pO 2 =21 kPa). In the high BaO part of the phase diagram, a third solid solution (Ba 2-x Nd x )CuO 3+z (x=0 to ∼ 0.3 at pO 2 =100 Pa; x=0-0.45 at pO 2 =21 kPa) was confirmed, as well as a nominally stoichiometric phase, Ba 4 Nd 2 Cu 2 O z . The latter phase is an insulator, with a structure comprised of unusual CuO 5 linear chains. A significant difference in tie line distribution involving the Ba 2-x Nd 1+x Cu 3 O 6+z superconductor was found under carbonate-free conditions relative to literature studies completed in air. Instead of the BaCuO 2+x -Ba 2+x Nd 4-x Cu 2 O z tie line normally encountered in air, a Ba 2-x Nd 1+x Cu 3 O 6+z -(Ba,Nd) 2 CuO 3+x tie line was established. This tie line substantially expands the field of stability of the Ba 2-x Nd 1+x Cu 3 O 6+z superconductor phase into the BaO-rich region of the phase diagram. Implications for the processing of materials based on the Ba 2-x Nd 1+x Cu 3 O 6+z
20 CFR 405.365 - Consolidated hearing before an administrative law judge.
2010-04-01
... before us. (2) If the administrative law judge consolidates the claims, he or she will decide both claims... law judge. 405.365 Section 405.365 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Administrative Law Judge Hearing § 405.365...
Directory of Open Access Journals (Sweden)
Glauce Cristina Ricardo Rumin
2001-06-01
Full Text Available Marcadores moleculares têm sido sugeridos como ferramentas úteis em programas de melhoramento de plantas. Assim, este trabalho teve como objetivo propor um índice de seleção de linhagens visando a geração de populações sintéticas de milho, baseado em marcadores moleculares e dados de campo. Para tanto foram utilizados valores fenotípicos e genotípicos, oriundos de experimentos convencionais de campo e através da genotipagem das plantas-mãe das linhagens por marcadores RFLP, respectivamente. O índice foi examinado quanto à sua capacidade de originar sintéticos com alta freqüência de alelos favoráveis, em comparação com os obtidos baseando-se na seleção convencional. Utilizaram-se inicialmente 157 locos marcadores com distância média de 15,30 cM entre eles. Sessenta e oito linhagens S2, provenientes da geração F2 do cruzamento entre duas linhagens homozigóticas foram cruzadas em topcross e avaliadas em quatro locais de Iowa, EUA, em 1996. Dos 157 locos foram selecionados 18 que explicaram 74,70% da variância genética entre progênies, na média dos locais. O índice proposto leva em conta o comportamento próprio (per se das linhagens e a complementaridade genotípica entre elas, o que não é conseguido utilizando-se apenas dados dos topcrosses. O uso do índice proposto permite obter homólogo de tabela dialélica tendo-se apenas dados de médias de topcrosses. O índice levou à seleção de sintéticos com propriedades superiores às esperadas pela seleção baseada apenas nas médias das progênies topcross. Essa conclusão, no entanto, só é válida para os QTL's abrangidos pelas marcas. A metodologia proposta permite monitoramento muito adequado e útil das propriedades genéticas dos sintéticos a serem obtidos.Molecular markers have been suggested as useful tools in breeding programmes. The purpose of this work was to propose and apply an index for inbred line selection to be used for generating synthetic
42 CFR 405.2440 - Conditions for reinstatement after termination by CMS.
2010-10-01
... CMS. 405.2440 Section 405.2440 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... § 405.2440 Conditions for reinstatement after termination by CMS. When CMS has terminated an agreement with a Federally qualified health center, CMS will not enter into another agreement with the Federally...
41 CFR 105-60.405 - Processing requests for confidential commercial information.
2010-07-01
... MATERIALS 60.4-Described Records § 105-60.405 Processing requests for confidential commercial information... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Processing requests for confidential commercial information. 105-60.405 Section 105-60.405 Public Contracts and Property Management...
5 CFR 359.405 - Removal: Reduction in force.
2010-01-01
... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Removal: Reduction in force. 359.405... Appointees During Probation § 359.405 Removal: Reduction in force. (a) Coverage. This section covers the removal of a career appointee from the SES during the probationary period under a reduction in force. (b...
42 CFR 405.1834 - CMS reviewing official procedure.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false CMS reviewing official procedure. 405.1834 Section... Determinations and Appeals § 405.1834 CMS reviewing official procedure. (a) Scope. A provider that is a party to... Administrator by a designated CMS reviewing official who considers whether the decision of the intermediary...
42 CFR 50.405 - What is the structure of review committees?
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false What is the structure of review committees? 50.405 Section 50.405 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS POLICIES OF GENERAL APPLICABILITY Public Health Service Grant Appeals Procedure § 50.405 What is the...
76 FR 51469 - CSX Transportation, Inc.-Abandonment Exemption-in Beaver County, PA
2011-08-18
... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 55 (Sub-No. 708X)] CSX Transportation, Inc.--Abandonment Exemption--in Beaver County, PA CSX Transportation, Inc. (CSXT) has filed a... milepost PLK 2.39, in Koppel, Beaver County, Pa. The line traverses United States Postal Service Zip Code...
Energy Technology Data Exchange (ETDEWEB)
Lee, Yong Su; Song, Hi Sup; Kim, Jin Kyu; Shin, In Chul [Nongwoo Seed Co., Suwon (Korea)
2000-04-01
To obtain disease resistant mutant lines, 6 inbred lines were hotppepers were irradiated with 250Gy of gamma ray and crossed between cultivar and wild species. 1) 4500 M{sub 1} plants were cultivated for obtaining M{sub 2} seed in 6 inbred lines of hotpeppers irradiated with 250 Gy of gamma ray. 2) Crossability was not generally existed among interspecific crosses, crossability between C. annum and C. chacoense was successful except crosses between C. annum, C. pubescens and C. eximium. 3) The embryo disected 45 days after pollination was suitable for embryo culture. 4) Hybrid plants were obtained from the embryo culture of the combination between C. annum and C. chacoense, while abnormal hybrid plants occurred from the combination between C. annum and C. baccatum. 15 refs., 4 figs., 4 tabs. (Author)
Evaluation on reaction of late maturing maize hybrids and lines to Fusarium ear rot.
Directory of Open Access Journals (Sweden)
M. Haddadi
2015-03-01
Full Text Available Abstract. In order to evaluate and determine resistance rates of different corn genotypes to Fusarium ear rot, 22 inbred lines and 19 late and medium maturity hybrids in 2009 and 17 inbred lines and 14 late and medium maturity hybrids were planted in Qarakheil Agricultural Research Station in 2010. Each line and hybrid were planted separately. For each experiment a randomized complete block design with three replications was used. Plant ears were inoculated by Nail th Punch method at the 10 day after anthesis. When the disease symptoms were observed, evaluation of each line and genotype was done based on percentage and severity of the disease symptom. The result in 2009 showed that 14 hybrids were tolerant. Hybrids of K3640/3 X MO17, K166B X K18, K166B X K19/1 and K3547/4 X MO17 were resistant. One hybrid was susceptible. Pure lines of K18 and K LM77007/7-2-6-3-1-2-1 were resistant. 14 tolerance lines and 6 susceptible lines were shown. In 2010 hybrids of K166B X K18 and K3653/2 X K18 were resistant. The other hybrids were tolerant. Pure lines of K3547/3 and K18 were resistant. Five tolerance lines were also shown.
Hauck, Andrew L; Novais, Joana; Grift, Tony E; Bohn, Martin O
2015-01-01
The mature root system is a vital plant organ, which is critical to plant performance. Commercial maize (Zea mays L.) breeding has resulted in a steady increase in plant performance over time, along with noticeable changes in above ground vegetative traits, but the corresponding changes in the root system are not presently known. In this study, roughly 2500 core root systems from field trials of a set of 10 diverse elite inbreds formerly protected by Plant Variety Protection plus B73 and Mo17 and the 66 diallel intercrosses among them were evaluated for root traits using high throughput image-based phenotyping. Overall root architecture was modeled by root angle (RA) and stem diameter (SD), while root complexity, the amount of root branching, was quantified using fractal analysis to obtain values for fractal dimension (FD) and fractal abundance (FA). For each trait, per se line effects were highly significant and the most important contributor to trait performance. Mid-parent heterosis and specific combining ability was also highly significant for FD, FA, and RA, while none of the traits showed significant general combining ability. The interaction between the environment and the additive line effect was also significant for all traits. Within the inbred and hybrid generations, FD and FA were highly correlated (rp ≥ 0.74), SD was moderately correlated to FD and FA (0.69 ≥ rp ≥ 0.48), while the correlation between RA and other traits was low (0.13 ≥ rp ≥ -0.40). Inbreds with contrasting effects on complexity and architecture traits were observed, suggesting that root complexity and architecture traits are inherited independently. A more comprehensive understanding of the maize root system and the way it interacts with the environment will be useful for defining adaptation to nutrient acquisition and tolerance to stress from drought and high plant densities, critical factors in the yield gains of modern hybrids.
42 CFR 405.1024 - Objections to the issues.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Objections to the issues. 405.1024 Section 405.1024 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE... issues. (a) If a party objects to the issues described in the notice of hearing, he or she must notify...
48 CFR 1816.405-2 - Cost-plus-award-fee (CPAF) contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Cost-plus-award-fee (CPAF) contracts. 1816.405-2 Section 1816.405-2 Federal Acquisition Regulations System NATIONAL AERONAUTICS AND....405-2 Cost-plus-award-fee (CPAF) contracts. [62 FR 3478, Jan. 23, 1997. Redesignated at 62 FR 36706...
Lifescience Database Archive (English)
Full Text Available CH (Link to library) CHD405 (Link to dictyBase) - - - Contig-U15984-1 CHD405E (Link... Clone ID CHD405 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15984-1 Original site URL http://dict...ts) Value N AC115599 |AC115599.2 Dictyostelium discoideum chromosome 2 map 422909...8-4354721 strain AX4, complete sequence. 42 3e-11 9 AC115598 |AC115598.2 Dictyostelium discoideum chromosome... 2 map 581427-735498 strain AX4, complete sequence. 50 4e-11 11 CK417372 |CK417372.1 AUF_IpInt_56_d19 Intestine cDNA library Ict
42 CFR 405.753 - Appeal of a categorization of a device.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Appeal of a categorization of a device. 405.753... Under Medicare Part A § 405.753 Appeal of a categorization of a device. (a) CMS's acceptance of the FDA categorization of a device as an experimental/investigational (Category A) device under § 405.203 is a national...
42 CFR 405.877 - Appeal of a categorization of a device.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Appeal of a categorization of a device. 405.877... Part B Program § 405.877 Appeal of a categorization of a device. (a) CMS's acceptance of the FDA categorization of a device as an experimental/investigational (Category A) device under § 405.203 is a national...
40 CFR 1048.405 - How does this program work?
2010-07-01
... Section 1048.405 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR POLLUTION CONTROLS CONTROL OF EMISSIONS FROM NEW, LARGE NONROAD SPARK-IGNITION ENGINES Testing In-use Engines § 1048.405 How does this program work? (a) You must test in-use engines, for exhaust emissions, from the...
48 CFR 405.403 - Requests from Members of Congress.
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Requests from Members of Congress. 405.403 Section 405.403 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE... Members of Congress. The head of the contracting activity (HCA) is the agency head designee pursuant to...
42 CFR 405.203 - FDA categorization of investigational devices.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false FDA categorization of investigational devices. 405... Coverage Decisions That Relate to Health Care Technology § 405.203 FDA categorization of investigational.../investigational (Category A) or non-experimental/investigational (Category B). (c) CMS uses the categorization of...
International Nuclear Information System (INIS)
Americo, Jeffrey L.; Sood, Cindy L.; Cotter, Catherine A.; Vogel, Jodi L.; Kristie, Thomas M.; Moss, Bernard; Earl, Patricia L.
2014-01-01
Classical inbred mice are extensively used for virus research. However, we recently found that some wild-derived inbred mouse strains are more susceptible than classical strains to monkeypox virus. Experiments described here indicated that the 50% lethal dose of vaccinia virus (VACV) and cowpox virus (CPXV) were two logs lower in wild-derived inbred CAST/Ei mice than classical inbred BALB/c mice, whereas there was little difference in the susceptibility of the mouse strains to herpes simplex virus. Live bioluminescence imaging was used to follow spread of pathogenic and attenuated VACV strains and CPXV virus from nasal passages to organs in the chest and abdomen of CAST/Ei mice. Luminescence increased first in the head and then simultaneously in the chest and abdomen in a dose-dependent manner. The spreading kinetics was more rapid with VACV than CPXV although the peak photon flux was similar. These data suggest advantages of CAST/Ei mice for orthopoxvirus studies. - Highlights: • Wild-derived inbred CAST/Ei mice are susceptible to vaccinia virus and cowpox virus. • Morbidity and mortality from orthopoxviruses are greater in CAST/Ei than BALB/c mice. • Morbidity and mortality from herpes simplex virus type 1 are similar in both mice. • Imaging shows virus spread from nose to lungs, abdominal organs and brain. • Vaccinia virus spreads more rapidly than cowpox virus
Energy Technology Data Exchange (ETDEWEB)
Americo, Jeffrey L.; Sood, Cindy L.; Cotter, Catherine A.; Vogel, Jodi L.; Kristie, Thomas M.; Moss, Bernard, E-mail: bmoss@nih.gov; Earl, Patricia L., E-mail: pearl@nih.gov
2014-01-20
Classical inbred mice are extensively used for virus research. However, we recently found that some wild-derived inbred mouse strains are more susceptible than classical strains to monkeypox virus. Experiments described here indicated that the 50% lethal dose of vaccinia virus (VACV) and cowpox virus (CPXV) were two logs lower in wild-derived inbred CAST/Ei mice than classical inbred BALB/c mice, whereas there was little difference in the susceptibility of the mouse strains to herpes simplex virus. Live bioluminescence imaging was used to follow spread of pathogenic and attenuated VACV strains and CPXV virus from nasal passages to organs in the chest and abdomen of CAST/Ei mice. Luminescence increased first in the head and then simultaneously in the chest and abdomen in a dose-dependent manner. The spreading kinetics was more rapid with VACV than CPXV although the peak photon flux was similar. These data suggest advantages of CAST/Ei mice for orthopoxvirus studies. - Highlights: • Wild-derived inbred CAST/Ei mice are susceptible to vaccinia virus and cowpox virus. • Morbidity and mortality from orthopoxviruses are greater in CAST/Ei than BALB/c mice. • Morbidity and mortality from herpes simplex virus type 1 are similar in both mice. • Imaging shows virus spread from nose to lungs, abdominal organs and brain. • Vaccinia virus spreads more rapidly than cowpox virus.
Directory of Open Access Journals (Sweden)
Leonardo de B. Giordano
2005-03-01
Full Text Available As altas temperaturas nas regiões tropicais e equatoriais induzem uma série de distúrbios morfológicos e/ou fisiológicos em estruturas florais do tomateiro, resultando em menor produtividade devido a maiores taxas de abortamento e má formação de frutos. Neste trabalho foram avaliadas linhagens de tomateiro oriundas de duas populações que vêm sendo cultivadas em Roraima, região Norte do Brasil. Doze linhagens foram obtidas após um ciclo prévio de seleção (em Brasília-DF em condições de temperatura elevada. A avaliação destas doze linhagens e duas cultivares testemunhas ('Viradoro' e 'Santa Clara' foi conduzida em casa de vegetação com temperaturas média das mínimas de 15ºC e média das máximas de 46,2ºC. Foram observadas diferenças significativas para número de frutos abortados, número de frutos maduros, peso de frutos maduros, teores de sólidos solúveis, firmeza e coloração de frutos. As linhagens (como um grupo apresentaram melhor desempenho do que as testemunhas 'Viradoro' e 'Santa Clara' para os parâmetros número de frutos abortados, peso, número e coloração de frutos maduros. A metodologia adotada no presente trabalho, permite a identificação de genótipos superiores adaptados ao cultivo em regiões tropicais e equatoriais com elevadas temperaturas.Heat tolerance is a major trait for tomato breeding programs targeted for lowland wet climates in equatorial and tropical areas of the world. High temperatures might cause several disturbances to morphological and physiological characteristics of the tomato flowers leading to yield constraints due to reduction in fruit setting. In the present work, an experiment was conducted to evaluate tomato breeding lines, derived from two tomato landrace populations cultivated by farmers in Roraima State (North Region of Brazil. Twelve inbred lines were obtained from these populations after one cycle of selection in a plastic house with high temperatures. These 12
Hemodynamic Characterization of Recombinant Inbred Strains: Twenty Years Later
Czech Academy of Sciences Publication Activity Database
Kuneš, Jaroslav; Dobešová, Zdenka; Musilová, Alena; Zídek, Václav; Vorlíček, Jaroslav; Pravenec, Michal; Křen, Vladimír; Zicha, Josef
2008-01-01
Roč. 31, č. 8 (2008), s. 1659-1668 ISSN 0916-9636 R&D Projects: GA MŠk(CZ) 1M0510; GA ČR(CZ) GA305/08/0139; GA AV ČR(CZ) IAA500110604 Institutional research plan: CEZ:AV0Z50110509 Keywords : recombinant inbred strains * blood pressure * telemetry Subject RIV: ED - Physiology Impact factor: 3.146, year: 2008
International Nuclear Information System (INIS)
Saleh, O.M.
1998-01-01
From eighteen zea mays inbred lines, two were chosen as drought tolerant and drought sensitive genotypes (G621W and G603W, respectively). They were evaluated along with their F1 and F2 for their relative drought tolerance for some yield traits. The physiological markers cations (Na, K, Ca and Mg) and their ratios (K/Na, Ca/K and Ca/Mg) showed differential association with drought tolerance was observed.SDS-protein profiles indicated the presence of two bands in the tolerant group associated with drought tolerance. Western blotting analysis didn't give polymorphism patterns such as esterase, peroxidase and acid phosphatase showed differential responses with respect to drought tolerance
Request for Observations of V405 Peg
Templeton, Matthew R.
2009-12-01
Dr. Axel Schwope (Astrophysikalisches Institut Potsdam) requests time-series monitoring of the magnetic cataclysmic variable V405 Pegasi from 2009 December 28 through 2009 December 30. These observations are requested in support of a planned XMM-Newton observation of V405 Peg on 2009 December 29 beginning at 18:51 UT (JD 2455195.2854) and continuing for 12.5 hours. Observers are asked to provide intensive coverage during the three day window centered on the XMM-Newton observation to provide information on the activity state of V405 Peg, to improve the orbital ephemeris, and to provide optical data that will help constrain the spectral energy distribution of this poorly understood cataclysmic variable. The primary filters for this observation are Johnson B and Cousins I, but all observations will be useful for determining the orbital ephemeris. V405 Peg may show both orbital modulation as well as changes in its activity level. The orbital period is approximately four hours, and observers are asked to obtain at least ten and preferably more data points per cycle in each filter. Please use exposure times that provide S/N of at least 20 in both the comparison and target stars but short exposure times are preferred to detect flickering and other short-timescale variations. Finder charts with sequence may be created using the AAVSO Variable Star Plotter (http://www.aavso.org/vsp). Observations should be submitted to the AAVSO International Database. See full Alert Notice for more details.
45 CFR 170.405 - Correspondence.
2010-10-01
... Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Temporary Certification Program for HIT § 170.405 Correspondence. (a...
42 CFR 405.1803 - Intermediary determination and notice of amount of program reimbursement.
2010-10-01
... program reimbursement. 405.1803 Section 405.1803 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES... Provider Reimbursement Determinations and Appeals § 405.1803 Intermediary determination and notice of amount of program reimbursement. (a) General requirement. Upon receipt of a provider's cost report, or...
Meyer, J D F; Snook, M E; Houchins, K E; Rector, B G; Widstrom, N W; McMullen, M D
2007-06-01
Maysin is a naturally occurring C-glycosyl flavone found in maize (Zea mays L.) silk tissue that confers resistance to corn earworm (Helicoverpa zea, Boddie). Recently, two new maize populations were derived for high silk maysin. The two populations were named the exotic populations of maize (EPM) and the southern inbreds of maize (SIM). Quantitative trait locus (QTL) analysis was employed to determine which loci were responsible for elevated maysin levels in inbred lines derived from the EPM and SIM populations. The candidate genes consistent with QTL position included the p (pericarp color), c2 (colorless2), whp1 (white pollen1) and in1 (intensifier1) loci. The role of these loci in controlling high maysin levels in silks was tested by expression analysis and use of the loci as genetic markers onto the QTL populations. These studies support p, c2 and whp1, but not in1, as loci controlling maysin. Through this study, we determined that the p locus regulates whp1 transcription and that increased maysin in these inbred lines was primarily due to alleles at both structural and regulatory loci promoting increased flux through the flavone pathway by increasing chalcone synthase activity.
Directory of Open Access Journals (Sweden)
Deyana Gencheva Hristova
2018-03-01
Full Text Available Taking into consideration that the growth hormone (GH gene in rabbits is a candidate for meat production, understanding the genetic diversity and variation in this locus is of particular relevance. The present study comprised 86 rabbits (Oryctolagus cuniculus divided into 3 groups: New Zealand White (NZW outbred rabbits; first-generation inbred rabbits (F1 and second-generation inbred rabbits (F2. They were analysed by polymerase chain reaction-based restriction fragment length polymorphism method. A 231 bp fragment of the polymorphic site of the GH gene was digested with Bsh1236 restriction enzyme. Single nucleotide polymorphisms for the studied GH locus corresponding to 3 genotypes were detected in the studied rabbit populations: CC, CT and TT. In the synthetic inbred F1 and F2 populations, the frequency of the heterozygous genotype CT was 0.696 and 0.609, respectively, while for the homozygous CC genotype the frequency was lower (0.043 and 0.000, and respective values for the homozygous TT genotype were 0.261 and 0.391. This presumed a preponderance of the T allele (0.609 and 0.696 over the C allele (0.391 and 0.304 in these groups. In outbred rabbits, the allele frequencies were 0.613 (allele C and 0.387 (allele Т; consequently, the frequency of the homozygous CC genotype was higher than that of the homozygous TT genotype (0.300 vs. 0.075. Observed heterozygosity for the GH gene was higher than expected, and the result was therefore a negative inbreeding coefficient (Fis=–0.317 for outbred NZW rabbits; –0.460 for inbred F1 and –0.438 for inbred F2, indicating a sufficient number of heterozygous forms in all studied groups of rabbits. The application of narrow inbreeding by breeding full sibs in the synthetic population did not cause a rapid increase in homozygosity.
20 CFR 405.720 - Notice of agreement to expedite appeal.
2010-04-01
....720 Section 405.720 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Expedited Appeals Process for Constitutional Issues § 405.720 Notice of agreement to expedite appeal. If we agree that you can use the expedited appeals process...
48 CFR 403.405 - Misrepresentations or violations of the Covenant Against Contingent Fees.
2010-10-01
... violations of the Covenant Against Contingent Fees. 403.405 Section 403.405 Federal Acquisition Regulations... Contingent Fees 403.405 Misrepresentations or violations of the Covenant Against Contingent Fees. (a) A suspected misrepresentation or violation of the Covenant Against Contingent Fees shall be documented in...
48 CFR 603.405 - Misrepresentations or violations of the Covenant Against Contingent Fees.
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Misrepresentations or violations of the Covenant Against Contingent Fees. 603.405 Section 603.405 Federal Acquisition Regulations... Contingent Fees 603.405 Misrepresentations or violations of the Covenant Against Contingent Fees. (a) The...
20 CFR 405.220 - Decision by the Federal reviewing official.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Decision by the Federal reviewing official. 405.220 Section 405.220 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW... Medical and Vocational Expert System before making a decision. At all times, the Federal reviewing...
76 FR 29176 - Airworthiness Directives; Piper Aircraft, Inc. PA-23, PA-31, and PA-42 Airplanes
2011-05-20
...-0218; Directorate Identifier 2009-CE-006-AD] RIN 2120-AA64 Airworthiness Directives; Piper Aircraft... (AD) that applies to Piper Aircraft, Inc. PA-23, PA-31, and PA-42 airplanes. The existing AD currently... Federal holidays. For service information identified in this AD, contact Piper Aircraft, Inc., 2926 Piper...
20 CFR 405.710 - How to request an expedited appeal.
2010-04-01
... Section 405.710 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Expedited Appeals Process for Constitutional Issues § 405.710 How to... process, you must request it— (1) No later than 60 days after the date you receive notice of the Federal...
42 CFR 405.215 - Confidential commercial and trade secret information.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Confidential commercial and trade secret information. 405.215 Section 405.215 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... trade secret information. To the extent that CMS relies on confidential commercial or trade secret...
20 CFR 416.405 - Cost-of-living adjustments in benefits.
2010-04-01
... which the title II benefits are being increased based on the Consumer Price Index, or, if greater, the... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Cost-of-living adjustments in benefits. 416.405 Section 416.405 Employees' Benefits SOCIAL SECURITY ADMINISTRATION SUPPLEMENTAL SECURITY INCOME...
48 CFR 216.405-1 - Cost-plus-incentive-fee contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Cost-plus-incentive-fee... Contracts 216.405-1 Cost-plus-incentive-fee contracts. See PGI 216.405-1 for guidance on the use of cost-plus-incentive-fee contracts. [71 FR 39007, July 11, 2006] ...
40 CFR 405.81 - Specialized definitions.
2010-07-01
... STANDARDS DAIRY PRODUCTS PROCESSING POINT SOURCE CATEGORY Ice Cream, Frozen Desserts, Novelties and Other Dairy Desserts Subcategory § 405.81 Specialized definitions. For the purpose of this subpart: (a) Except...
33 CFR 167.405 - Off San Francisco: Main ship channel.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Off San Francisco: Main ship channel. 167.405 Section 167.405 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY OFFSHORE TRAFFIC SEPARATION SCHEMES Description of Traffic Separation Schemes and Precautionary Areas...
42 CFR 405.213 - Re-evaluation of a device categorization.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Re-evaluation of a device categorization. 405.213... Decisions That Relate to Health Care Technology § 405.213 Re-evaluation of a device categorization. (a... experimental/investigational (Category A) may request re-evaluation of the categorization decision. (2) A...
Rodrigues, C S; Pacheco, C A P; Guedes, M L; Pinho, R G V; Castro, C R
2016-09-23
The aim of this study was to identify inbred progenies of S 0:1 maize (Zea mays L.) plants that were efficient at a low level of technology and responsive at a high level of technology through the use of topcrosses. Two contrasting environments were created using two levels of base fertilization and topdressing, so that the levels of nitrogen, phosphorus, and potassium were applied four times higher in one environment than in the other. We used S 0:1 progenies derived from commercial hybrids in topcrosses with two testers (an elite line from the flint heterotic group and an elite line from the dent heterotic group). The progenies and three controls were evaluated in an augmented block design in Nossa Senhora das Dores, SE, Brazil in the 2010 crop season. The average grain yield in the high-technological level was 21.44% greater than that in the low-technological level. There were no changes in progeny behavior in the two technological levels for grain yield. The testers did not differ in the average grain yield of the progenies at the two technological levels. Therefore, it is possible to select progenies derived from commercial hybrids that have an efficient response to fertilization.
Directory of Open Access Journals (Sweden)
Aušra Liubavičiūtė
2015-11-01
Conclusions: Our data demonstrate that low-doses proton beam irradiation had an effect on MIA PaCa-2 pancreatic carcinoma cell line. Full extent of irradiation had an impact only 24 h postirradiation, triggering DNA arrested cell cycle in G1/0 phase. Formed DNA DSBs were found to be repaired via the NHEJ pathway mechanism within 72 h. Unsuccessful repaired DSBs induced apoptotic cell death. After 72 h reparation processes were completed, and cell cycle was released from arrest in G1/0 phase.
2010-04-01
... certain registered government securities brokers and dealers. 405.3 Section 405.3 Commodity and Securities... REPORTS AND AUDIT § 405.3 Notification provisions for certain registered government securities brokers and dealers. (a) Every registered government securities broker or dealer, other than a government securities...
2010-07-01
... Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY BOATS AND ASSOCIATED EQUIPMENT Electrical Systems General § 183.405 General. Each electrical component on a boat to which this subpart applies must meet the requirements of this subpart unless the component is...
Directory of Open Access Journals (Sweden)
Zhi Zhang
Full Text Available Natural populations of the fruit fly, Drosophila melanogaster, segregate genetic variation that leads to cardiac disease phenotypes. One nearly isogenic line from a North Carolina peach orchard, WE70, is shown to harbor two genetically distinct heart phenotypes: elevated incidence of arrhythmias, and a dramatically constricted heart diameter in both diastole and systole, with resemblance to restrictive cardiomyopathy in humans. Assuming the source to be rare variants of large effect, we performed Bulked Segregant Analysis using genomic DNA hybridization to Affymetrix chips to detect single feature polymorphisms, but found that the mutant phenotypes are more likely to have a polygenic basis. Further mapping efforts revealed a complex architecture wherein the constricted cardiomyopathy phenotype was observed in individual whole chromosome substitution lines, implying that variants on both major autosomes are sufficient to produce the phenotype. A panel of 170 Recombinant Inbred Lines (RIL was generated, and a small subset of mutant lines selected, but these each complemented both whole chromosome substitutions, implying a non-additive (epistatic contribution to the "disease" phenotype. Low coverage whole genome sequencing was also used to attempt to map chromosomal regions contributing to both the cardiomyopathy and arrhythmia, but a polygenic architecture had to be again inferred to be most likely. These results show that an apparently simple rare phenotype can have a complex genetic basis that would be refractory to mapping by deep sequencing in pedigrees. We present this as a cautionary tale regarding assumptions related to attempts to map new disease mutations on the assumption that probands carry a single causal mutation.
40 CFR 265.405 - Special requirements for ignitable or reactive waste.
2010-07-01
... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for ignitable or reactive waste. 265.405 Section 265.405 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) INTERIM STATUS STANDARDS FOR OWNERS AND OPERATORS OF HAZARDOUS WASTE...
47 CFR 101.405 - Adherence to program of research and development.
2010-10-01
... to program of research and development. The program of research and development, as stated by an... 47 Telecommunication 5 2010-10-01 2010-10-01 false Adherence to program of research and development. 101.405 Section 101.405 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY...
Wang, Xianzhi; Jiang, Guo-Liang; Green, Marci; Scott, Roy A; Song, Qijian; Hyten, David L; Cregan, Perry B
2014-10-01
Soybean seeds contain high levels of oil and protein, and are the important sources of vegetable oil and plant protein for human consumption and livestock feed. Increased seed yield, oil and protein contents are the main objectives of soybean breeding. The objectives of this study were to identify and validate quantitative trait loci (QTLs) associated with seed yield, oil and protein contents in two recombinant inbred line populations, and to evaluate the consistency of QTLs across different environments, studies and genetic backgrounds. Both the mapping population (SD02-4-59 × A02-381100) and validation population (SD02-911 × SD00-1501) were phenotyped for the three traits in multiple environments. Genetic analysis indicated that oil and protein contents showed high heritabilities while yield exhibited a lower heritability in both populations. Based on a linkage map constructed previously with the mapping population and using composite interval mapping and/or interval mapping analysis, 12 QTLs for seed yield, 16 QTLs for oil content and 11 QTLs for protein content were consistently detected in multiple environments and/or the average data over all environments. Of the QTLs detected in the mapping population, five QTLs for seed yield, eight QTLs for oil content and five QTLs for protein content were confirmed in the validation population by single marker analysis in at least one environment and the average data and by ANOVA over all environments. Eight of these validated QTLs were newly identified. Compared with the other studies, seven QTLs for seed yield, eight QTLs for oil content and nine QTLs for protein content further verified the previously reported QTLs. These QTLs will be useful for breeding higher yield and better quality cultivars, and help effectively and efficiently improve yield potential and nutritional quality in soybean.
Fusarium ear rot, caused by Fusarium verticillioides and other Fusarium spp. is found in all U.S. maize growing regions. Affected grain often contains carcinogenic mycotoxins called fumonisins. We tested the hypothesis that inbred lines with greater resistance to fumonisin contamination would pro...
Surgical performance of a 405-nm diode laser in treatment of soft tissue
International Nuclear Information System (INIS)
Kato, J; Akashi, G; Moriya, K; Hirai, Y; Hatayama, H; Inoue, A; Miyazaki, H
2008-01-01
The study was conducted to evaluate the surgical performance of a 405-nm diode laser ex vivo. The experiments were carried out using tuna tissue, which was irradiated with a 405-nm diode laser at output powers of 400 mW (694 W/cm 2 ) to 1 W (1735 W/cm 2 ) on a motorized stage moving at a rate of 1 mm/sec. As a control, a 920-nm diode laser was used with the same irradiation conditions. After irradiation, the thickness of ablation and coagulation was measured by stereoscopic microscopy and evaluated statistically. Ablation and coagulation zones were obtained with 405-nm laser irradiation, but not with irradiation at 920 nm. Ablation depth increased significantly with output power and a thick coagulation zone was observed with 405-nm irradiation. The 405-nm diode laser performed well for incising and coagulating soft tissue at a low power density
Lifescience Database Archive (English)
Full Text Available ACAAAAACTAGTAATTTAAAAAAA AAAAANCCAAAAAAAAAAXXXXXXXXXXCCAGATTTCCATANATGTGTTNAAANAC...FC405Z.Seq ----------CCAGATTTCCATANATGTGTTNAAANACGTGGTGGTATCTTAAGNTGNGA ATTTGANCC...TCAATACAATTAA AAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAAAA AAAAANCCAAAAAAAAAA----------CCAGATTTCCATANA
Removal of 230Th and 231Pa at ocean margins
International Nuclear Information System (INIS)
Anderson, R.F.; Bacon, M.P.; Brewer, P.G.
1983-01-01
Uranium, thorium and protactinium isotopes were measured in particulate matter collected by sediment traps deployed in the Panama Basin and by in-situ filtration of large volumes of seawater in the Panama and Guatemala Basins. Concentrations of dissolved Th and Pa isotopes were determined by extraction onto MnO 2 adsorbers placed in line behind the filters in the in-situ pumping systems. Concentrations of dissolved 230 Th and 231 Pa in the Panama and Guatemala Basins are lower than in the open ocean, whereas dissolved 230 Th/ 231 Pa ratios are equal to, or slightly greater than, ratios in the open ocean. Particulate 230 Th/ 231 Pa ratios in the sediment trap samples ranged from 4 to 8, in contrast to ratios of 30 or more at the open ocean sites previously studied. Particles collected by filtration in the Panama Basin and nearest to the continental margin in the Guatemala Basin contained 230 Th/ 231 Pa ratios similar to the ratios in the sediment trap samples. The ratios increased with distance away from the continent. Suspended particles near the margin show no preference for adsorption of Th or Pa and therefore must be chemically different from particles in the open ocean, which show a strong preference for adsorption of Th. Ocean margins, as typified by the Panama and Guatemala Basins, are preferential sinks for 231 Pa relative to 230 Th. Furthermore, the margins are sinks for 230 Th and, to a greater extent, 231 Pa transported by horizontal mixing from the open ocean. (orig.)
20 CFR 405.301 - Hearing before an administrative law judge-general.
2010-04-01
... law judge. (c) You may examine the evidence used in making the decision or determination under review... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Hearing before an administrative law judge-general. 405.301 Section 405.301 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW...
2010-10-01
... under the inpatient psychiatric facility prospective payment system. 412.405 Section 412.405 Public... Services of Inpatient Psychiatric Facilities § 412.405 Preadmission services as inpatient operating costs under the inpatient psychiatric facility prospective payment system. The prospective payment system...
TEMPORAL STRUCTURE OF OPEN-FIELD BEHAVIOR IN INBRED STRAINS OF MICE
MAKINO, J; KATO, K; MAES, FW
1991-01-01
Behavior of the inbred mouse strains BALB, C3H, DBA and C57BL in an open field was directly observed for 10 min by a multi-event time sampling method. It was coded into nine behavioral items, the occurrence or absence of which in consecutive 5-s time bins was called a behavioral state. Fourteen
20 CFR 405.315 - Time and place for a hearing before an administrative law judge.
2010-04-01
... administrative law judge will decide whether to have that person appear in person or by video teleconference... administrative law judge. 405.315 Section 405.315 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Administrative Law Judge Hearing § 405...
23 CFR 650.405 - Eligible projects.
2010-04-01
... FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS BRIDGES, STRUCTURES, AND HYDRAULICS Highway Bridge Replacement and Rehabilitation Program § 650.405 Eligible projects... rehabilitation. (b) Types of projects which are eligible. The following types of work are eligible for...
International Nuclear Information System (INIS)
Milanović, Dušan; Firat, Elke; Grosu, Anca Ligia; Niedermann, Gabriele
2013-01-01
Heat shock Protein 90 (Hsp90) is a molecular chaperone that folds, stabilizes, and functionally regulates many cellular proteins involved in oncogenic signaling and in the regulation of radiosensitivity. It is upregulated in response to stress such a heat. Hyperthermia is a potent radiosensitizer, but induction of Hsp90 may potentially limit its efficacy. Our aim was to investigate whether the new Hsp90 inhibitor NVP-HSP990 increases radiosensitivity, thermosensitivity and radiothermosensitivity of human tumor cell lines. U251 glioblastoma and MIA PaCa-2 pancreatic carcinoma cells were used. To determine clonogenic survival, colony forming assays were performed. Cell viability and proliferation were assesed by Trypan blue staining. Cell cycle and apoptosis analyses were performed by flow cytometry. DAPI staining was used to detect mitotic catastrophe. NVP-HSP990 increased the thermosensitivity, radiosensitivity and radio-thermosensitivity of both cell lines in clonogenic assays. 72 hours after irradiation with 4 Gy, a significant reduction in cell number associated with considerable G2/M acumulation and mitotic catastrophe as well as cell death by apoptosis/necrosis was observed. Treatment with NVP-HSP990 strongly sensitized U251 and MIA PaCa-2 cells to hyperthermia and ionizing radiation or combination thereof through augmentation of G2/M arrest, mitotic catastrophe and associated apoptosis
Festing, Michael F W
2014-01-01
Inbred strains of mice such as C57BL and BALB/c are more widely used in published work than outbred stocks of mice such as ICR and CD-1. In contrast, outbred stocks of rats such as Wistar and Sprague-Dawley are more widely used than inbred strains such as F344 and LEW. The properties of inbred and outbred mice and rats are briefly reviewed, and it is concluded that, with some exceptions, there is a strong case for using inbred strains in most controlled experiments. This is because they are usually more uniform, so that fewer animals are usually needed to detect a specified response and they are more repeatable, because they are genetically defined (i.e., the strain can be identified using genetic markers) and less liable to genetic change. Yet many scientists continue to use outbred animals. In Daniel Kahneman's book "Thinking Fast and Slow" he explains that we can answer questions in 2 ways: "fast" by intuition or "slow" by analytical reasoning. The former method is instantaneous, requires no thought but is not evidence based. Analytical reasoning is evidence based but requires hard work, which we all avoid. He has found that "… when faced with a difficult question, we often answer an easier one instead, usually without noticing the substitution." The target question of whether to choose outbred or inbred strains in controlled experiments is a difficult one requiring knowledge of the characteristics of these strains and the principles of experimental design. A substitute question, "are humans and outbred stocks both genetically heterogeneous," is easily answered in the affirmative. It is likely that many scientists are intuitively answering the substitute question and are assuming that they have answered the target question. If so they may be using the wrong animals in their research. Nor is the fact that humans and outbred stocks are alike in being genetically heterogeneous a reason for using them. The whole concept of a "model" is that it is similar to the
Agrobacterium- and Biolistic-Mediated Transformation of Maize B104 Inbred.
Raji, Jennifer A; Frame, Bronwyn; Little, Daniel; Santoso, Tri Joko; Wang, Kan
2018-01-01
Genetic transformation of maize inbred genotypes remains non-routine for many laboratories due to variations in cell competency to induce embryogenic callus, as well as the cell's ability to receive and incorporate transgenes into the genome. This chapter describes two transformation protocols using Agrobacterium- and biolistic-mediated methods for gene delivery. Immature zygotic embryos of maize inbred B104, excised from ears harvested 10-14 days post pollination, are used as starting explant material. Disarmed Agrobacterium strains harboring standard binary vectors and the biolistic gun system Bio-Rad PDS-1000/He are used as gene delivery systems. The herbicide resistant bar gene and selection agent bialaphos are used for identifying putative transgenic type I callus events. Using the step-by-step protocols described here, average transformation frequencies (number of bialaphos resistant T 0 callus events per 100 explants infected or bombarded) of 4% and 8% can be achieved using the Agrobacterium- and biolistic-mediated methods, respectively. An estimated duration of 16-21 weeks is needed using either protocol from the start of transformation experiments to obtaining putative transgenic plantlets with established roots. In addition to laboratory in vitro procedures, detailed greenhouse protocols for producing immature ears as transformation starting material and caring for transgenic plants for seed production are also described.
DEFF Research Database (Denmark)
Abou-Zleikha, Mohamed; Shaker, Noor
2014-01-01
We present a demonstration of PaTux, an authoring tool for designing levels in SuperTux game through combining patterns. PaTux allows game designers to specify the design of their levels using patterns extracted from training level samples. The Non-negative Matrix Factorisation (NMF) method...
Efficacy of antimicrobial 405 nm blue-light for inactivation of airborne bacteria
Dougall, Laura R.; Anderson, John G.; Timoshkin, Igor V.; MacGregor, Scott J.; Maclean, Michelle
2018-02-01
Airborne transmission of infectious organisms is a considerable concern within the healthcare environment. A number of novel methods for `whole room' decontamination, including antimicrobial 405 nm blue light, are being developed. To date, research has focused on its effects against surface-deposited contamination; however, it is important to also establish its efficacy against airborne bacteria. This study demonstrates evidence of the dose-response kinetics of airborne bacterial contamination when exposed to 405 nm light and compares bacterial susceptibility when exposed in three different media: air, liquid and surfaces. Bacterial aerosols of Staphylococcus epidermidis, generated using a 6-Jet Collison nebulizer, were introduced into an aerosol suspension chamber. Aerosolized bacteria were exposed to increasing doses of 405 nm light, and air samples were extracted from the chamber using a BioSampler liquid impinger, with viability analysed using pour-plate culture. Results have demonstrated successful aerosol inactivation, with a 99.1% reduction achieved with a 30 minute exposure to high irradiance (22 mWcm-2) 405 nm light (P=0.001). Comparison to liquid and surface exposures proved bacteria to be 3-4 times more susceptible to 405 nm light inactivation when in aerosol form. Overall, results have provided fundamental evidence of the susceptibility of bacterial aerosols to antimicrobial 405 nm light treatment, which offers benefits in terms of increased safety for human exposure, and eradication of microbes regardless of antibiotic resistance. Such benefits provide advantages for a number of applications including `whole room' environmental decontamination, in which reducing levels of airborne bacteria should reduce the number of infections arising from airborne contamination.
Directory of Open Access Journals (Sweden)
Omar Idrissi
2016-08-01
Full Text Available Drought is one of the major abiotic stresses limiting lentil productivity in rainfed production systems. Specific rooting patterns can be associated with drought avoidance mechanisms that can be used in lentil breeding programs. In all, 252 co-dominant and dominant markers were used for Quantitative Trait Loci (QTL analysis on 132 lentil recombinant inbred lines based on greenhouse experiments for root and shoot traits during two seasons under progressive drought-stressed conditions. Eighteen QTLs controlling a total of 14 root and shoot traits were identified. A QTL-hotspot genomic region related to a number of root and shoot characteristics associated with drought tolerance such as dry root biomass, root surface area, lateral root number, dry shoot biomass and shoot length was identified. Interestingly, a QTL related to root-shoot ratio, an important trait for drought avoidance, explaining the highest phenotypic variance of 27.6 % and 28.9 % for the two consecutive seasons, respectively, was detected. This QTL was closed to the co-dominant SNP marker TP6337 and also flanked by the two SNP TP518 and TP1280. An important QTL related to lateral root number was found close to TP3371 and flanked by TP5093 and TP6072 SNP markers. Also, a QTL associated with specific root length was identified close to TP1873 and flanked by F7XEM6b SRAP marker and TP1035 SNP marker. These two QTLs were detected in both seasons. Our results could be used for marker-assisted selection in lentil breeding programs targeting root and shoot characteristics conferring drought avoidance as an efficient alternative to slow and labour-intensive conventional breeding methods.
42 CFR 405.874 - Appeals of CMS or a CMS contractor.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Appeals of CMS or a CMS contractor. 405.874 Section... Part B Program § 405.874 Appeals of CMS or a CMS contractor. A CMS contractor's (that is, a carrier... supplier enrollment application. If CMS or a CMS contractor denies a provider's or supplier's enrollment...
20 CFR 405.410 - Selecting claims for Decision Review Board review.
2010-04-01
... will not review claims based on the identity of the administrative law judge who decided the claim. (b... Decision Review Board review. (a)(1) The Board may review your claim if the administrative law judge made a decision under §§ 405.340 or 405.370 of this part, regardless of whether the administrative law judge's...
Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...
42 CFR 405.1202 - Expedited determination procedures.
2010-10-01
... Reconsiderations of Provider Service Terminations, and Procedures for Inpatient Hospital Discharges § 405.1202... exercise the right to an expedited determination must submit a request for a determination to the QIO in...
Guo, Su-Min
2012-03-21
Aphids are a major family of plant insect pests. Medicago truncatula and Acyrthosiphon pisum (pea aphid, PA) are model species with a suite of resources available to help dissect the mechanism underlying plant-aphid interactions. A previous study focused on monogenic and relatively strong resistance in M. truncatula to PA and other aphid species. In this study a moderate resistance to PA was characterized in detail in the M. truncatula line A17 and compared with the highly susceptible line A20 and the more resistant line Jester. The results show that PA resistance in A17 involves both antibiosis and tolerance, and that resistance is phloem based. Quantitative trait locus (QTL) analysis using a recombinant inbred line (RIL) population (n=114) from a cross between A17 and A20 revealed that one locus, which co-segregated with AIN (Acyrthosiphon-induced necrosis) on chromosome 3, is responsible for the reduction of aphid biomass (indicator of antibiosis) for both PA and bluegreen aphid (BGA, A. kondoi), albeit to a lesser degree for PA than BGA. Interestingly, two independent loci on chromosomes 5 and 3 were identified for the plant biomass reduction (indicator of plant tolerance) by PA and BGA, respectively, demonstrating that the plant\\'s tolerance response to these two closely related aphid species is distinct. Together with previously identified major resistant (R) genes, the QTLs identified in this study are powerful tools to understand fully the spectrum of plant defence against sap-sucking insects and provide opportunities for breeders to generate effective and sustainable strategies for aphid control. 2012 The Author.
18 CFR 706.405 - Supplementary statements.
2010-04-01
... employee shall at all times avoid acquiring a financial interest that could result, or taking an action... EMPLOYEE RESPONSIBILITIES AND CONDUCT Statements of Employment and Financial Interests § 706.405... employment and financial interests shall be reported in a supplementary statement, in the format prescribed...
Osthushenrich, Tanja; Frisch, Matthias; Herzog, Eva
2017-01-01
In a line or a hybrid breeding program superior lines are selected from a breeding pool as parental lines for the next breeding cycle. From a cross of two parental lines, new lines are derived by single-seed descent (SSD) or doubled haploid (DH) technology. However, not all possible crosses between the parental lines can be carried out due to limited resources. Our objectives were to present formulas to characterize a cross by the mean and variance of the genotypic values of the lines derived from the cross, and to apply the formulas to predict means and variances of flowering time traits in recombinant inbred line families of a publicly available data set in maize. We derived formulas which are based on the expected linkage disequilibrium (LD) between two loci and which can be used for arbitrary mating systems. Results were worked out for SSD and DH lines derived from a cross after an arbitrary number of intermating generations. The means and variances were highly correlated with results obtained by the simulation software PopVar. Compared with these simulations, computation time for our closed formulas was about ten times faster. The means and variances for flowering time traits observed in the recombinant inbred line families of the investigated data set showed correlations of around 0.9 for the means and of 0.46 and 0.65 for the standard deviations with the estimated values. We conclude that our results provide a framework that can be exploited to increase the efficiency of hybrid and line breeding programs by extending genomic selection approaches to the selection of crossing partners.
Osthushenrich, Tanja; Frisch, Matthias
2017-01-01
In a line or a hybrid breeding program superior lines are selected from a breeding pool as parental lines for the next breeding cycle. From a cross of two parental lines, new lines are derived by single-seed descent (SSD) or doubled haploid (DH) technology. However, not all possible crosses between the parental lines can be carried out due to limited resources. Our objectives were to present formulas to characterize a cross by the mean and variance of the genotypic values of the lines derived from the cross, and to apply the formulas to predict means and variances of flowering time traits in recombinant inbred line families of a publicly available data set in maize. We derived formulas which are based on the expected linkage disequilibrium (LD) between two loci and which can be used for arbitrary mating systems. Results were worked out for SSD and DH lines derived from a cross after an arbitrary number of intermating generations. The means and variances were highly correlated with results obtained by the simulation software PopVar. Compared with these simulations, computation time for our closed formulas was about ten times faster. The means and variances for flowering time traits observed in the recombinant inbred line families of the investigated data set showed correlations of around 0.9 for the means and of 0.46 and 0.65 for the standard deviations with the estimated values. We conclude that our results provide a framework that can be exploited to increase the efficiency of hybrid and line breeding programs by extending genomic selection approaches to the selection of crossing partners. PMID:29200436
19 CFR 351.405 - Calculation of normal value based on constructed value.
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Calculation of normal value based on constructed value. 351.405 Section 351.405 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE ANTIDUMPING AND COUNTERVAILING DUTIES Calculation of Export Price, Constructed Export Price, Fair Value, and...
42 CFR 405.1875 - Administrator review.
2010-10-01
... Appeals § 405.1875 Administrator review. (a) Basic rule: Time limit for rendering Administrator decisions... after the date the party making the request received the Board's decision or other reviewable action... decision or other reviewable matter. (ii) Any submission must be limited to the issues accepted for...
20 CFR 405.505 - Extension of time to file a civil action.
2010-04-01
....505 Section 405.505 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Judicial Review § 405.505 Extension of time to file a civil... judicial review in a Federal district court. Your request must be in writing and explain why the action was...
International Nuclear Information System (INIS)
Ganesan, S.; McLaughlin, P.K.
1992-02-01
Since 1990, one of the most interesting developments in the field of nuclear data for nuclear technology applications is that several new evaluated data files have been finalized and made available to the International Atomic Energy Agency (IAEA) for distribution to its Member States. Improved evaluated nuclear data libraries such as ENDF/B-VI from the United States and JENDL-3 from Japan were developed over a period of 10-15 years. This report is not an evaluation of the evaluations. The report as presented here gives a first look at the cross section line shapes of the isotopes that are important to the thorium fuel cycle derived from the two recently evaluated data files: JENDL-3 and ENDF/B-VI. The basic evaluated data files JENDL-3 and ENDF/B-VI were point-processed successfully using the codes LINEAR and RECENT. The point data were multigrouped in three different group structures using the GROUPIE code. Graphs of intercomparisons of cross section line shapes of JENDL-3 and ENDF/B-VI are presented in this paper for the following isotopes of major interest to studies of the thorium fuel cycle: 230 Th, 232 Th, 231 Pa, 233 Pa, 232 U, 233 U and 234 U. Comparisons between JENDL-3 and ENDF/B-VI which were performed at the point and group levels show large discrepancies in various cross sections. We conclude this report with a general remark that it is necessary to perform sensitivity studies to assess the impacts of the discrepancies between the two different sets of data on calculated reactor design and safety parameters of specific reactor systems and, based on the results of such sensitivity studies, to undertake new tasks of evaluations. (author). 2 refs, 245 figs, 8 tabs
Evaluation of Grain Quality in Bread Wheat Recombinant Inbred Lines Under Drought Stress Conditions
Directory of Open Access Journals (Sweden)
H. Shahbazi
2014-04-01
Full Text Available To study drought stress effect on grain quality properties of wheat, an experiment was conductedusing 169 recombinant inbreed lines (RILS under water stress and non-stress condition and with two separated lattice designs. Grain yield, protein yield, protein content, volume of Zeleny sediment, grain hardness, water absorption, grain moisture content and grain dry matter were evaluated. Analysis of variance showed that there were significant differences among the lines for all traits. Moreover, comparison between two lines in two environmental conditions showed, the quality in bread wheat under drought stress conditions due to increment of protein yield is improved. Protein yield in both irrigation regimes has a significant and negative correlation with grain moisture and in the other hand, significant and positive correlation with the grain hardiness dry matter, Zeleny sedimentation and water intake in both conditions. The results showed that the identification of favorable quality characteristics in optimum and stressed conditions were possible and the lines with high grain quality can be used in breeding programs for improving of baking quality. Although some drought sensitive genotypes possessed a favorable baking quality but their grain yield was low.
Krause, W; Viana, A P; Cavalcante, N R; Ambrósio, M; Santos, E A; Vieira, H D
2017-03-22
Digital image analysis of seeds has been used for the identification of cultivars, determination of seed color and mechanical damage, and classification of different seed sizes. The aim of the present study was to evaluate the efficiency of digital image analysis of seeds for the quantification of genetic diversity among genotypes of inbred guava (Psidium guajava L.) families. The SAS Mini equipment, which consists of a capture module and a software program for analysis, was employed for the capture and analysis of the seed images. Different genetic diversity quantification strategies were tested using the Ward-Modified Location Model method. The set of variables related to geometry of the seeds was the largest contributor to divergence among the guava genotypes. The use of seed descriptors obtained by digital image analysis via the SAS system was efficient at quantifying the genetic diversity among genotypes of inbred guava families associated with the use of the Ward-Modified Location Model method.
Bactericidal effect of a 405-nm diode laser on Porphyromonas gingivalis
Energy Technology Data Exchange (ETDEWEB)
Kotoku, Y; Kato, J; Akashi, G; Hirai, Y [Department of Operative Dentistry, Tokyo Dental College, 1-2-2, Masago, Mihama-ku, Chiba, 261-8502 (Japan); Ishihara, K [Department of Microbiology, Tokyo Dental College, 1-2-2, Masago, Mihama-ku, Chiba, 261-8502 (Japan)
2009-05-15
The study was conducted to determine the effect of 405-nm diode laser irradiation on periodontopathic bacteria such as Porphyromonas gingivalis in vitro. A diluted suspension of P. gingivalis was irradiated directly with a 405-nm diode laser under conditions of 100 mW-10 sec, 100 mW-20 sec, 200 mW-5 sec, 200 mW-10 sec, 200 mW-20 sec, 400 mW-5 sec, 400 mW-10 sec, and 400 mW-20 sec. The energy density ranged from 2.0 to 16.0 J/cm{sup 2}. The irradiated bacterial suspension was spread on a blood agar plate and growth of the colonies was examined after an anaerobic culture for 7 days. Bacterial growth was inhibited under all irradiation conditions, but the bactericidal effect of the 405-nm diode laser depended on the energy density. More than 97% of bacterial growth was inhibited with irradiation at an energy density > 4.0 J/cm{sup 2}. The mechanism of the bactericidal effect is photochemical, rather than photothermal. These findings suggest that a 405-nm diode laser has a high bactericidal effect on P. gingivalis.
Bactericidal effect of a 405-nm diode laser on Porphyromonas gingivalis
International Nuclear Information System (INIS)
Kotoku, Y; Kato, J; Akashi, G; Hirai, Y; Ishihara, K
2009-01-01
The study was conducted to determine the effect of 405-nm diode laser irradiation on periodontopathic bacteria such as Porphyromonas gingivalis in vitro. A diluted suspension of P. gingivalis was irradiated directly with a 405-nm diode laser under conditions of 100 mW-10 sec, 100 mW-20 sec, 200 mW-5 sec, 200 mW-10 sec, 200 mW-20 sec, 400 mW-5 sec, 400 mW-10 sec, and 400 mW-20 sec. The energy density ranged from 2.0 to 16.0 J/cm 2 . The irradiated bacterial suspension was spread on a blood agar plate and growth of the colonies was examined after an anaerobic culture for 7 days. Bacterial growth was inhibited under all irradiation conditions, but the bactericidal effect of the 405-nm diode laser depended on the energy density. More than 97% of bacterial growth was inhibited with irradiation at an energy density > 4.0 J/cm 2 . The mechanism of the bactericidal effect is photochemical, rather than photothermal. These findings suggest that a 405-nm diode laser has a high bactericidal effect on P. gingivalis
Bactericidal effect of a 405-nm diode laser on Porphyromonas gingivalis
Kotoku, Y.; Kato, J.; Akashi, G.; Hirai, Y.; Ishihara, K.
2009-05-01
The study was conducted to determine the effect of 405-nm diode laser irradiation on periodontopathic bacteria such as Porphyromonas gingivalis in vitro. A diluted suspension of P. gingivalis was irradiated directly with a 405-nm diode laser under conditions of 100 mW-10 sec, 100 mW-20 sec, 200 mW-5 sec, 200 mW-10 sec, 200 mW-20 sec, 400 mW-5 sec, 400 mW-10 sec, and 400 mW-20 sec. The energy density ranged from 2.0 to 16.0 J/cm2. The irradiated bacterial suspension was spread on a blood agar plate and growth of the colonies was examined after an anaerobic culture for 7 days. Bacterial growth was inhibited under all irradiation conditions, but the bactericidal effect of the 405-nm diode laser depended on the energy density. More than 97% of bacterial growth was inhibited with irradiation at an energy density > 4.0 J/cm2. The mechanism of the bactericidal effect is photochemical, rather than photothermal. These findings suggest that a 405-nm diode laser has a high bactericidal effect on P. gingivalis.
20 CFR 405.330 - Prehearing conferences.
2010-04-01
... INITIAL DISABILITY CLAIMS Administrative Law Judge Hearing § 405.330 Prehearing conferences. (a)(1) The administrative law judge, on his or her own initiative or at your request, may decide to conduct a prehearing... claim. A prehearing conference normally will be held by telephone, unless the administrative law judge...
20 CFR 405.366 - Posthearing conferences.
2010-04-01
... INITIAL DISABILITY CLAIMS Administrative Law Judge Hearing § 405.366 Posthearing conferences. (a) The administrative law judge may decide, on his or her own initiative or at your request, to hold a posthearing... unless the administrative law judge decides that conducting it in another manner would be more efficient...
40 CFR 405.101 - Specialized definitions.
2010-07-01
... AND STANDARDS DAIRY PRODUCTS PROCESSING POINT SOURCE CATEGORY Dry Milk Subcategory § 405.101... definitions, abbreviations and methods of analysis set forth in part 401 of this chapter shall apply to this.... Composition of input materials may be based on either direct analysis or generally accepted published values. ...
3-Bromopyruvate induces necrotic cell death in sensitive melanoma cell lines
Energy Technology Data Exchange (ETDEWEB)
Qin, J.-Z.; Xin, H. [Oncology Institute, Cardinal Bernardin Cancer Center, Loyola University of Chicago Medical Center (United States); Nickoloff, B.J., E-mail: bnickol@lumc.edu [Oncology Institute, Cardinal Bernardin Cancer Center, Loyola University of Chicago Medical Center (United States)
2010-05-28
Clinicians successfully utilize high uptake of radiolabeled glucose via PET scanning to localize metastases in melanoma patients. To take advantage of this altered metabolome, 3-bromopyruvate (BrPA) was used to overcome the notorious resistance of melanoma to cell death. Using four melanoma cell lines, BrPA triggered caspase independent necrosis in two lines, whilst the other two lines were resistant to killing. Mechanistically, sensitive cells differed from resistant cells by; constitutively lower levels of glutathione, reduction of glutathione by BrPA only in sensitive cells; increased superoxide anion reactive oxygen species, loss of outer mitochondrial membrane permeability, and rapid ATP depletion. Sensitive cell killing was blocked by N-acetylcysteine or glutathione. When glutathione levels were reduced in resistant cell lines, they became sensitive to killing by BrPA. Taken together, these results identify a metabolic-based Achilles' heel in melanoma cells to be exploited by use of BrPA. Future pre-clinical and clinical trials are warranted to translate these results into improved patient care for individuals suffering from metastatic melanoma.
3-Bromopyruvate induces necrotic cell death in sensitive melanoma cell lines.
Qin, J-Z; Xin, H; Nickoloff, B J
2010-05-28
Clinicians successfully utilize high uptake of radiolabeled glucose via PET scanning to localize metastases in melanoma patients. To take advantage of this altered metabolome, 3-bromopyruvate (BrPA) was used to overcome the notorious resistance of melanoma to cell death. Using four melanoma cell lines, BrPA triggered caspase independent necrosis in two lines, whilst the other two lines were resistant to killing. Mechanistically, sensitive cells differed from resistant cells by; constitutively lower levels of glutathione, reduction of glutathione by BrPA only in sensitive cells; increased superoxide anion reactive oxygen species, loss of outer mitochondrial membrane permeability, and rapid ATP depletion. Sensitive cell killing was blocked by N-acetylcysteine or glutathione. When glutathione levels were reduced in resistant cell lines, they became sensitive to killing by BrPA. Taken together, these results identify a metabolic-based Achilles' heel in melanoma cells to be exploited by use of BrPA. Future pre-clinical and clinical trials are warranted to translate these results into improved patient care for individuals suffering from metastatic melanoma. Copyright (c) 2010 Elsevier Inc. All rights reserved.
3-Bromopyruvate induces necrotic cell death in sensitive melanoma cell lines
International Nuclear Information System (INIS)
Qin, J.-Z.; Xin, H.; Nickoloff, B.J.
2010-01-01
Clinicians successfully utilize high uptake of radiolabeled glucose via PET scanning to localize metastases in melanoma patients. To take advantage of this altered metabolome, 3-bromopyruvate (BrPA) was used to overcome the notorious resistance of melanoma to cell death. Using four melanoma cell lines, BrPA triggered caspase independent necrosis in two lines, whilst the other two lines were resistant to killing. Mechanistically, sensitive cells differed from resistant cells by; constitutively lower levels of glutathione, reduction of glutathione by BrPA only in sensitive cells; increased superoxide anion reactive oxygen species, loss of outer mitochondrial membrane permeability, and rapid ATP depletion. Sensitive cell killing was blocked by N-acetylcysteine or glutathione. When glutathione levels were reduced in resistant cell lines, they became sensitive to killing by BrPA. Taken together, these results identify a metabolic-based Achilles' heel in melanoma cells to be exploited by use of BrPA. Future pre-clinical and clinical trials are warranted to translate these results into improved patient care for individuals suffering from metastatic melanoma.
Energy Technology Data Exchange (ETDEWEB)
Philip, Vivek M [ORNL; Ansah, T [University of Tennessee Health Science Center, Memphis; Blaha, C, [University of Tennessee Health Science Center, Memphis; Cook, Melloni N. [University of Memphis; Hamre, Kristin M. [University of Tennessee Health Science Center, Memphis; Lariviere, William R [University of Pittsburgh; Matthews, Douglas B [Baylor University; Goldowitz, Daniel [University of British Columbia, Vancouver; Chesler, Elissa J [ORNL
2010-01-01
Genetic reference populations, particularly the BXD recombinant inbred strains, are a valuable resource for the discovery of the bio-molecular substrates and genetic drivers responsible for trait variation and co- ariation. This approach can be profitably applied in the analysis of susceptibility and mechanisms of drug and alcohol use disorders for which many predisposing behaviors may predict occurrence and manifestation of increased preference for these substances. Many of these traits are modeled by common mouse behavioral assays, facilitating the detection of patterns and sources of genetic co-regulation of predisposing phenotypes and substance consumption. Members of the Tennessee Mouse Genome Consortium have obtained behavioral phenotype data from 260 measures related to multiple behavioral assays across several domains: self-administration, response to, and withdrawal from cocaine, MDMA, morphine and alcohol; novelty seeking; behavioral despair and related neurological phenomena; pain sensitivity; stress sensitivity; anxiety; hyperactivity; and sleep/wake cycles. All traits have been measured in both sexes and the recently expanded panel of 69 additional BXD recombinant inbred strains (N=69). Sex differences and heritability estimates were obtained for each trait, and a comparison of early (N = 32) and recent BXD RI lines was performed. Primary data is publicly available for heritability, sex difference and genetic analyses using www.GeneNetwork.org. These analyses include QTL detection and genetic analysis of gene expression. Stored results from these analyses are available at http://ontologicaldiscovery.org for comparison to other genomic analysis results. Together with the results of related studies, these data form a public resource for integrative systems genetic analysis of neurobehavioral traits.
48 CFR 32.405 - Applying Pub. L. 85-804 to advance payments under sealed bid contracts.
2010-10-01
... advance payments under sealed bid contracts. 32.405 Section 32.405 Federal Acquisition Regulations System... Non-Commercial Items 32.405 Applying Pub. L. 85-804 to advance payments under sealed bid contracts. (a... provisions of law relating to contracts, as explained in 50.101-1(a), also include making advance payments...
Clones of common carp, Cyprinus carpio = New perspectives in fish research
Komen, J.
1990-01-01
The absence of well defined inbred lines is an important problem associated with scientific research on fish. Inbred lines can be produced by conventional full-sib mating, but at least 10-15 generations are needed to produce homozygous inbred lines. Using common carp, which reach maturity
Directory of Open Access Journals (Sweden)
Fabricio Rodrigues
2009-01-01
specific combining ability (SCA in vegetable corn production. Eight inbred lines and 28 hybrids derived from them were evaluated in 2004/2005 season in two environments, in Lavras and Ijaci, State of Minas Gerais. A randomized complete block design with two replications per environment were used, and seven traits of agronomic and commercial interest for vegetable corn production were studied. The quadratic component of specific of combining ability (SCA was greater than the general combining ability (GCA for all the traits assessed. Non-additive genetic effects were more important than additive effects for genotypes variation, indicating that heterosis is important for hybrid selection for vegetable corn production. The inbred line L55 showed higher concentration of favorable alleles to the increase of traits PEC, PEE, MASSA, COR e COMP, being more suitable for the formation of new hybrid and the hybrids HS27, HS48 and HS24 accumulated a larger number of traits with SCA positive effect, significant and of high magnitude, indicating that those combinations presented better performance for all the traits, simultaneously, and can be recommended to the market for vegetable corn.
Expression of uPA, tPA, and PAI-1 in Calcified Aortic Valves
Directory of Open Access Journals (Sweden)
Najlah Kochtebane
2014-01-01
Full Text Available Purpose. Our physiopathological assumption is that u-PA, t-PA, and PAI-1 are released by calcified aortic valves and play a role in the calcification of these valves. Methods. Sixty-five calcified aortic valves were collected from patients suffering from aortic stenosis. Each valve was incubated for 24 hours in culture medium. The supernatants were used to measure u-PA, t-PA, and PAI-1 concentrations; the valve calcification was evaluated using biphotonic absorptiometry. Results. Aortic stenosis valves expressed normal plasminogen activators concentrations and overexpressed PAI-1 (u-PA, t-PA, and PAI-1 mean concentrations were, resp., 1.69 ng/mL ± 0.80, 2.76 ng/mL ± 1.33, and 53.27 ng/mL ± 36.39. There was no correlation between u-PA and PAI-1 (r=0.3 but t-PA and PAI-1 were strongly correlated with each other (r=0.6. Overexpression of PAI-1 was proportional to the calcium content of the AS valves. Conclusions. Our results demonstrate a consistent increase of PAI-1 proportional to the calcification. The overexpression of PAI-1 may be useful as a predictive indicator in patients with aortic stenosis.
Generation of Novel Chimeric Mice with Humanized Livers by Using Hemizygous cDNA-uPA/SCID Mice.
Directory of Open Access Journals (Sweden)
Chise Tateno
Full Text Available We have used homozygous albumin enhancer/promoter-driven urokinase-type plasminogen activator/severe combined immunodeficient (uPA/SCID mice as hosts for chimeric mice with humanized livers. However, uPA/SCID mice show four disadvantages: the human hepatocytes (h-heps replacement index in mouse liver is decreased due to deletion of uPA transgene by homologous recombination, kidney disorders are likely to develop, body size is small, and hemizygotes cannot be used as hosts as more frequent homologous recombination than homozygotes. To solve these disadvantages, we have established a novel host strain that has a transgene containing albumin promoter/enhancer and urokinase-type plasminogen activator cDNA and has a SCID background (cDNA-uPA/SCID. We applied the embryonic stem cell technique to simultaneously generate a number of transgenic lines, and found the line with the most appropriate levels of uPA expression-not detrimental but with a sufficiently damaged liver. We transplanted h-heps into homozygous and hemizygous cDNA-uPA/SCID mice via the spleen, and monitored their human albumin (h-alb levels and body weight. Blood h-alb levels and body weight gradually increased in the hemizygous cDNA-uPA/SCID mice and were maintained until they were approximately 30 weeks old. By contrast, blood h-alb levels and body weight in uPA/SCID chimeric mice decreased from 16 weeks of age onwards. A similar decrease in body weight was observed in the homozygous cDNA-uPA/SCID genotype, but h-alb levels were maintained until they were approximately 30 weeks old. Microarray analyses revealed identical h-heps gene expression profiles in homozygous and hemizygous cDNA-uPA/SCID mice were identical to that observed in the uPA/SCID mice. Furthermore, like uPA/SCID chimeric mice, homozygous and hemizygous cDNA-uPA/SCID chimeric mice were successfully infected with hepatitis B virus and C virus. These results indicate that hemizygous cDNA-uPA/SCID mice may be novel and
Generation of Novel Chimeric Mice with Humanized Livers by Using Hemizygous cDNA-uPA/SCID Mice.
Tateno, Chise; Kawase, Yosuke; Tobita, Yoshimi; Hamamura, Satoko; Ohshita, Hiroki; Yokomichi, Hiroshi; Sanada, Harumi; Kakuni, Masakazu; Shiota, Akira; Kojima, Yuha; Ishida, Yuji; Shitara, Hiroshi; Wada, Naoko A; Tateishi, Hiromi; Sudoh, Masayuki; Nagatsuka, Shin-Ichiro; Jishage, Kou-Ichi; Kohara, Michinori
2015-01-01
We have used homozygous albumin enhancer/promoter-driven urokinase-type plasminogen activator/severe combined immunodeficient (uPA/SCID) mice as hosts for chimeric mice with humanized livers. However, uPA/SCID mice show four disadvantages: the human hepatocytes (h-heps) replacement index in mouse liver is decreased due to deletion of uPA transgene by homologous recombination, kidney disorders are likely to develop, body size is small, and hemizygotes cannot be used as hosts as more frequent homologous recombination than homozygotes. To solve these disadvantages, we have established a novel host strain that has a transgene containing albumin promoter/enhancer and urokinase-type plasminogen activator cDNA and has a SCID background (cDNA-uPA/SCID). We applied the embryonic stem cell technique to simultaneously generate a number of transgenic lines, and found the line with the most appropriate levels of uPA expression-not detrimental but with a sufficiently damaged liver. We transplanted h-heps into homozygous and hemizygous cDNA-uPA/SCID mice via the spleen, and monitored their human albumin (h-alb) levels and body weight. Blood h-alb levels and body weight gradually increased in the hemizygous cDNA-uPA/SCID mice and were maintained until they were approximately 30 weeks old. By contrast, blood h-alb levels and body weight in uPA/SCID chimeric mice decreased from 16 weeks of age onwards. A similar decrease in body weight was observed in the homozygous cDNA-uPA/SCID genotype, but h-alb levels were maintained until they were approximately 30 weeks old. Microarray analyses revealed identical h-heps gene expression profiles in homozygous and hemizygous cDNA-uPA/SCID mice were identical to that observed in the uPA/SCID mice. Furthermore, like uPA/SCID chimeric mice, homozygous and hemizygous cDNA-uPA/SCID chimeric mice were successfully infected with hepatitis B virus and C virus. These results indicate that hemizygous cDNA-uPA/SCID mice may be novel and useful hosts for
2010-07-01
... cream, frozen desserts, novelties and other dairy desserts subcategory. 405.80 Section 405.80 Protection... PRODUCTS PROCESSING POINT SOURCE CATEGORY Ice Cream, Frozen Desserts, Novelties and Other Dairy Desserts Subcategory § 405.80 Applicability; description of the ice cream, frozen desserts, novelties and other dairy...
Kinetic characterization of tissue-type plasminogen activator (t-PA) and t-PA deletion mutants
de Vries, C. [=Carlie J. M.; Veerman, H.; Nesheim, M. E.; Pannekoek, H.
1991-01-01
The binding of t-PA to fibrin is mediated both by its "finger" (F) and its "kringle 2" (K2) domain. In addition, these domains are involved in the stimulation of t-PA activity by fibrin. We analyzed the kinetic characteristics of Glu-plasminogen activation by t-PA and a set of t-PA deletion mutants
A Maize Inbred Exhibits Resistance Against Western Corn Rootwoorm, Diabrotica virgifera virgifera.
Castano-Duque, Lina; Loades, Kenneth W; Tooker, John F; Brown, Kathleen M; Paul Williams, W; Luthe, Dawn S
2017-12-01
Insect resistance against root herbivores like the western corn rootworm (WCR, Diabrotica virgifera virgifera) is not well understood in non-transgenic maize. We studied the responses of two American maize inbreds, Mp708 and Tx601, to WCR infestation using biomechanical, molecular, biochemical analyses, and laser ablation tomography. Previous studies performed on several inbreds indicated that these two maize genotypes differed in resistance to pests including fall armyworm (Spodoptera frugiperda) and WCR. Our data confirmed that Mp708 shows resistance against WCR, and demonstrates that the resistance mechanism is based in a multi-trait phenotype that includes increased resistance to cutting in nodal roots, stable root growth during insect infestation, constitutive and induced expression of known herbivore-defense genes, including ribosomal inhibitor protein 2 (rip2), terpene synthase 23 (tps23) and maize insect resistance cysteine protease-1 (mir1), as well high constitutive levels of jasmonic acid and production of (E)-β-caryophyllene. In contrast, Tx601 is susceptible to WCR. These findings will facilitate the use of Mp708 as a model to explore the wide variety of mechanisms and traits involved in plant defense responses and resistance to herbivory by insects with several different feeding habits.
Directory of Open Access Journals (Sweden)
David Harrison
2011-06-01
Full Text Available Inbred mice provide a unique tool to study aging populations because of the genetic homogeneity within an inbred strain, their short life span, and the tools for analysis which are available. A large-scale longitudinal and cross-sectional aging study was conducted on 30 inbred strains to determine, using histopathology, the type and diversity of diseases mice develop as they age. These data provide tools that when linked with modern in silico genetic mapping tools, can begin to unravel the complex genetics of many of the common chronic diseases associated with aging in humans and other mammals. In addition, novel disease models were discovered in some strains, such as rhabdomyosarcoma in old A/J mice, to diseases affecting many but not all strains including pseudoxanthoma elasticum, pulmonary adenoma, alopecia areata, and many others. This extensive data set is now available online and provides a useful tool to help better understand strain-specific background diseases that can complicate interpretation of genetically engineered mice and other manipulatable mouse studies that utilize these strains.
5 CFR 2634.405 - Certification of trusts.
2010-01-01
... FINANCIAL DISCLOSURE, QUALIFIED TRUSTS, AND CERTIFICATES OF DIVESTITURE Qualified Trusts § 2634.405... documents and responses to requests for information, including a statement that any interested party who will be a party to a certified trust instrument has read and understands the overview of executive...
Hoyerová, Klára; Perry, Lucie; Hand, Paul; Laňková, Martina; Kocábek, Tomáš; May, Sean; Kottová, Jana; Pačes, Jan; Napier, Richard; Zažímalová, Eva
2008-01-01
We have isolated the cDNA of the gene PaLAX1 from a wild cherry tree (Prunus avium). The gene and its product are highly similar in sequences to both the cDNAs and the corresponding protein products of AUX/LAX-type genes, coding for putative auxin influx carriers. We have prepared and characterized transformed Nicotiana tabacum and Arabidopsis thaliana plants carrying the gene PaLAX1. We have proved that constitutive overexpression of PaLAX1 is accompanied by changes in the content and distribution of free indole-3-acetic acid, the major endogenous auxin. The increase in free indole-3-acetic acid content in transgenic plants resulted in various phenotype changes, typical for the auxin-overproducing plants. The uptake of synthetic auxin, 2,4-dichlorophenoxyacetic acid, was 3 times higher in transgenic lines compared to the wild-type lines and the treatment with the auxin uptake inhibitor 1-naphthoxyacetic acid reverted the changes caused by the expression of PaLAX1. Moreover, the agravitropic response could be restored by expression of PaLAX1 in the mutant aux1 plants, which are deficient in auxin influx carrier activity. Based on our data, we have concluded that the product of the gene PaLAX1 promotes the uptake of auxin into cells, and, as a putative auxin influx carrier, it affects the content and distribution of free endogenous auxin in transgenic plants. PMID:18184737
20 CFR 655.405 - Complaints and investigative procedures.
2010-04-01
... TEMPORARY EMPLOYMENT OF FOREIGN WORKERS IN THE UNITED STATES Enforcement of H-1A Attestations § 655.405... such determination to the interested parties and shall inform them of the opportunity for a hearing...
20 CFR 10.405 - Who is considered a dependent in a claim based on disability or impairment?
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Who is considered a dependent in a claim based on disability or impairment? 10.405 Section 10.405 Employees' Benefits OFFICE OF WORKERS... Disability and Impairment § 10.405 Who is considered a dependent in a claim based on disability or impairment...
Structure and activity of the Pseudomonas aeruginosa hotdog-fold thioesterases PA5202 and PA2801.
Gonzalez, Claudio F; Tchigvintsev, Anatoli; Brown, Greg; Flick, Robert; Evdokimova, Elena; Xu, Xiaohui; Osipiuk, Jerzy; Cuff, Marianne E; Lynch, Susan; Joachimiak, Andrzej; Savchenko, Alexei; Yakunin, Alexander F
2012-06-15
The hotdog fold is one of the basic protein folds widely present in bacteria, archaea and eukaryotes. Many of these proteins exhibit thioesterase activity against fatty acyl-CoAs and play important roles in lipid metabolism, cellular signalling and degradation of xenobiotics. The genome of the opportunistic pathogen Pseudomonas aeruginosa contains over 20 genes encoding predicted hotdog-fold proteins, none of which have been experimentally characterized. We have found that two P. aeruginosa hotdog proteins display high thioesterase activity against 3-hydroxy-3-methylglutaryl-CoA and glutaryl-CoA (PA5202), and octanoyl-CoA (PA2801). Crystal structures of these proteins were solved (at 1.70 and 1.75 Å for PA5202 and PA2801 respectively) and revealed a hotdog fold with a potential catalytic carboxylate residue located on the long α-helix (Asp(57) in PA5202 and Glu(35) in PA2801). Alanine residue replacement mutagenesis of PA5202 identified four residues (Asn(42), Arg(43), Asp(57) and Thr(76)) that are critical for its activity and are located in the active site. A P. aeruginosa PA5202 deletion strain showed an increased secretion of the antimicrobial pigment pyocyanine and an increased expression of genes involved in pyocyanin biosynthesis, suggesting a functional link between PA5202 activity and pyocyanin production. Thus the P. aeruginosa hotdog thioesterases PA5202 and PA2801 have similar structures, but exhibit different substrate preferences and functions.
Tenno, Ann, 1952-
2003-01-01
Pa-kua sümbol, kolmikmärkide Varane Taevane Järjestus - yin pa-kua ja Hilisem Taevane Järjestus - yang pa-kua. Inimeste kodude - majade ja aedade kujundamiseks kasutatakse Hilisema Taevase Järjestuse pa-kua'd. Pa-kua kolmikmärgid yang pa-kua järjestuses, soovitusi aia kujundamiseks. 8 ill
29 CFR 780.405 - Exemption is direct and does not mean activities are agriculture.
2010-07-01
... agriculture. 780.405 Section 780.405 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION... EXEMPTIONS APPLICABLE TO AGRICULTURE, PROCESSING OF AGRICULTURAL COMMODITIES, AND RELATED SUBJECTS UNDER THE FAIR LABOR STANDARDS ACT Employment in Agriculture or Irrigation That Is Exempted From the Overtime Pay...
22 CFR 1203.735-405 - Information required.
2010-04-01
... RESPONSIBILITIES AND CONDUCT Statements of Employment and Financial Interests § 1203.735-405 Information required... defined in § 1203.735-102(f). (d) Information not known by employees. If any information required to be... connection with, or interest in, a professional society or a charitable, religious, social, fraternal...
2010-07-01
... mix for ice cream and other frozen desserts subcategory. 405.70 Section 405.70 Protection of... PROCESSING POINT SOURCE CATEGORY Fluid Mix for Ice Cream and Other Frozen Desserts Subcategory § 405.70 Applicability; description of the fluid mix for ice cream and other frozen desserts subcategory. The provisions...
2011-06-22
...-0639; Directorate Identifier 2011-CE-016-AD] RIN 2120-AA64 Airworthiness Directives; Piper Aircraft... identified in this proposed AD, contact Piper Aircraft, Inc., 2926 Piper Drive, Vero Beach, Florida 32960... September 15, 2004. This SAIB alerted owners and operators of Piper Aircraft, Inc. (Piper) Models PA-23, PA...
Directory of Open Access Journals (Sweden)
Angela Maria Cangiani Furlani
1986-01-01
Full Text Available Dois ensaios foram conduzidos no Centro Experimental de Campinas, no período agosto-outubro de 1983, em condições de casa de vegetação, para avaliar e selecionar linhagens de milho (Zea mays L. quanto à eficiência na absorção e utilização de potássio em solução nutritiva. No primeiro ensaio, seis linhagens foram cultivadas com 20, 40, 60, 80 e 100 mg/litro de K até aos 34 dias de idade, com o objetivo de determinar o nível adequado para diferenciação das plantas. No segundo, 37 linhagens de milho foram selecionadas com 20 mg/litro de K até aos 25 dias de idade. As soluções nutritivas foram continuamente arejadas e não renovadas e as plantas, deixadas crescer até aparecerem sintomas de deficiência de potássio nas folhas inferiores. As variações observadas nos pesos de matéria seca das raízes (CV das médias = 38,9% foram maiores que aquelas da parte aérea (CV das médias = 28,5%. As linhagens foram classificadas de acordo com a produção de matéria seca total, em grupos eficientes, ineficientes e medianamente eficientes, utilizando-se de um intervalo de confiança para a média geral. A absorção de K pelas linhagens, avaliada pelo seu conteúdo total, variou (CV das médias = 9% acompanhando a variação observada nos pesos de matéria seca total (r = 0,92. Entretanto, a relação de eficiência das linhagens apresentou variação maior (CV das médias = 23% e também acompanhou a variação no crescimento das plantas (r = 0,99. Isso é uma indicação de que o mecanismo de utilização de K pelas plantas foi o fator que mais contribuiu para a diferenciação entre os genótipos.Two experiments were conducted in the Experimental Station of Campinas, Instituto Agronômico, State of São Paulo, Brazil, in 1983, under greenhouse conditions, in order to evaluate and select efficient corn (Zea mays L. inbred lines in the uptake and use of potassium in nutrient solution. In a first trial, six lines were grow n with 20
40 CFR 405.86 - Pretreatment standards for new sources.
2010-07-01
... GUIDELINES AND STANDARDS DAIRY PRODUCTS PROCESSING POINT SOURCE CATEGORY Ice Cream, Frozen Desserts, Novelties and Other Dairy Desserts Subcategory § 405.86 Pretreatment standards for new sources. Any new...
Substrains of Inbred Mice Differ in Their Physical Activity as a Behavior
Directory of Open Access Journals (Sweden)
Dario Coletti
2013-01-01
Full Text Available Recent studies strengthen the belief that physical activity as a behavior has a genetic basis. Screening wheel-running behavior in inbred mouse strains highlighted differences among strains, showing that even very limited genetic differences deeply affect mouse behavior. We extended this observation to substrains of the same inbred mouse strain, that is, BALB/c mice. We found that only a minority of the population of one of these substrains, the BALB/c J, performs spontaneous physical activity. In addition, the runners of this substrain cover a significantly smaller distance than the average runners of two other substrains, namely, the BALB/c ByJ and the BALB/c AnNCrl. The latter shows a striking level of voluntary activity, with the average distance run/day reaching up to about 12 kilometers. These runners are not outstanders, but they represent the majority of the population, with important scientific and economic fallouts to be taken into account during experimental planning. Spontaneous activity persists in pathological conditions, such as cancer-associated cachexia. This important amount of physical activity results in a minor muscle adaptation to endurance exercise over a three-week period; indeed, only a nonsignificant increase in NADH transferase+ fibers occurs in this time frame.
5 CFR 9701.405 - Performance management system requirements.
2010-01-01
... feedback, and developing, rating, and rewarding performance; and (6) Specify the criteria and procedures to... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Performance management system... HOMELAND SECURITY HUMAN RESOURCES MANAGEMENT SYSTEM Performance Management § 9701.405 Performance...
25 CFR 115.405 - How frequently will a minor's statement of performance be mailed?
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false How frequently will a minor's statement of performance be mailed? 115.405 Section 115.405 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FINANCIAL... minor's statement of performance be mailed? We will mail a minor's statement of performance to the...
24 CFR 203.405 - Debenture interest rate.
2010-04-01
... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Debenture interest rate. 203.405... Debenture interest rate. (a) Debentures shall bear interest from the date of issue, payable semiannually on... claim is paid in cash, the debenture interest rate for purposes of calculating such a claim shall be the...
31 CFR 25.405 - Form of guaranty.
2010-07-01
... SALES LOANS MADE BY THE DEFENSE SECURITY ASSISTANCE AGENCY AND FOREIGN MILITARY SALES LOANS MADE BY THE FEDERAL FINANCING BANK AND GUARANTEED BY THE DEFENSE SECURITY ASSISTANCE AGENCY Form of Private Loan § 25.405 Form of guaranty. (a) The Guaranty that will be attached to the Private Loan Note on the Closing...
Hidden Markov model analysis of maternal behavior patterns in inbred and reciprocal hybrid mice.
Directory of Open Access Journals (Sweden)
Valeria Carola
Full Text Available Individual variation in maternal care in mammals shows a significant heritable component, with the maternal behavior of daughters resembling that of their mothers. In laboratory mice, genetically distinct inbred strains show stable differences in maternal care during the first postnatal week. Moreover, cross fostering and reciprocal breeding studies demonstrate that differences in maternal care between inbred strains persist in the absence of genetic differences, demonstrating a non-genetic or epigenetic contribution to maternal behavior. In this study we applied a mathematical tool, called hidden Markov model (HMM, to analyze the behavior of female mice in the presence of their young. The frequency of several maternal behaviors in mice has been previously described, including nursing/grooming pups and tending to the nest. However, the ordering, clustering, and transitions between these behaviors have not been systematically described and thus a global description of maternal behavior is lacking. Here we used HMM to describe maternal behavior patterns in two genetically distinct mouse strains, C57BL/6 and BALB/c, and their genetically identical reciprocal hybrid female offspring. HMM analysis is a powerful tool to identify patterns of events that cluster in time and to determine transitions between these clusters, or hidden states. For the HMM analysis we defined seven states: arched-backed nursing, blanket nursing, licking/grooming pups, grooming, activity, eating, and sleeping. By quantifying the frequency, duration, composition, and transition probabilities of these states we were able to describe the pattern of maternal behavior in mouse and identify aspects of these patterns that are under genetic and nongenetic inheritance. Differences in these patterns observed in the experimental groups (inbred and hybrid females were detected only after the application of HMM analysis whereas classical statistical methods and analyses were not able to
Plasminogen activation independent of uPA and tPA maintains wound healing in gene-deficient mice
DEFF Research Database (Denmark)
Lund, Leif R; Green, Kirsty A; Stoop, Allart A
2006-01-01
Simultaneous ablation of the two known activators of plasminogen (Plg), urokinase-type (uPA) and the tissue-type (tPA), results in a substantial delay in skin wound healing. However, wound closure and epidermal re-epithelialization are significantly less impaired in uPA;tPA double-deficient mice ...
DEFF Research Database (Denmark)
Jensen, Palle; Overgaard, Johannes; Loeschcke, Volker
2014-01-01
in replicated lines of inbred and outbred Drosophila melanogaster at stressful low, benign and stressful high temperatures. The lowest measurements of metabolic rate in our study are always associated with the low activity period of the diurnal cycle and these measurements therefore serve as good estimates...... of standard metabolic rate. Due to the potentially added costs of genetic stress in inbred lines we hypothesized that inbred individuals have increased metabolic rate compared to outbred controls and that this is more pronounced at stressful temperatures due to synergistic inbreeding by environment...... interactions. Contrary to our hypothesis we found no significant difference in metabolic rate between inbred and outbred lines and no interaction between inbreeding and temperature. Inbreeding however effected the variance; the variance in metabolic rate was higher between the inbred lines compared...
42 CFR 405.718 - Expedited appeals process.
2010-10-01
... Part A § 405.718 Expedited appeals process. (a) Conditions for use of expedited appeals process (EAP). A party may use the EAP to request court review in place of an administrative law judge (ALJ..., with the request for the EAP. (b) Content of the request for EAP. The request for the EAP: (1) Alleges...
2010-01-01
... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Air traffic controllers, firefighters, law enforcement officers, and nuclear materials couriers. 842.405 Section 842.405 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE REGULATIONS (CONTINUED) FEDERAL EMPLOYEES RETIREMENT SYSTEM-BASIC ANNUITY Computations ...
42 CFR 405.853 - Expedited appeals process.
2010-10-01
....853 Expedited appeals process. (a) Conditions for use of expedited appeals process (EAP). A party may use the EAP set forth in § 405.718 of this chapter to request court review in place of the ALJ hearing... the request for an EAP. (b) Content of the request for EAP. The request for an EAP: (1) Alleges that...
DEFF Research Database (Denmark)
Kobæk Larsen, Morten; Fenger, Claus; Hansen, Ket
2002-01-01
To obtain controlled genetic variation, colon cancer was chemically induced by use of four subcutaneous injections of azoxymethane (15 mg/kg of body weight/wk) to rats of 3 inbred strains (BDIX/OrlIco, F344/NHsd, WAG/Rij). The selection was based on the availability of established colon cancer cell...
Evaluation of 405 nm monochromatic light for inactivation of tulane virus on blueberry surfaces
The aim of this study was to evaluate the potential of 405 nm light as an intervention for virus contaminated blueberries. Tulane virus-contaminated-blueberries were treated with 4.2 mW/sq cm of 405 nm light for 5 to 30 min. To mitigate thermal heating due to the intense light, a dry ice-chilled ni...
Energy Technology Data Exchange (ETDEWEB)
Levon, A.I. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); De Boer, J. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Graw, G. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Hertenberger, R. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Hofer, D. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Kvasil, J. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Loesch, A. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Mueller-Zanotti, E. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Wuerkner, M. (Sektion Physik, University of Munich, D-85748 Garching (Germany)); Baltzer, H. (Institut fuer Strahlen- und Kernphysik, University of Bonn, D-53115 Bonn (Germany)); Grafen, V. (Institut fuer Strahlen- und Kernphysik, University of Bonn, D-53115 Bonn (Germany)); Guenther, C. (Institut fuer Strahlen- und Kernphysik, University of
1994-08-29
The level structure of the [sup 229]Pa nucleus has been investigated by means of the [sup 231]Pa(p,t)[sup 229]Pa and [sup 230]Th(p,2n[gamma])[sup 229]Pa reactions. Triton angular-distribution measurements were subjected to a CCBA analysis and combined with the results of in-beam conversion electron and [gamma]-ray spectroscopy to establish a level scheme. Two low-lying bands of opposite parity were observed up to spins (23/2)[sup -] and (17/2)[sup +], respectively. Rotational bands built on some 0[sup +] excitations of the even-even core can be assigned. The lowest states of three further low-lying bands are observed. The level scheme is interpreted in terms of an octupole-deformed core with an unpaired proton. From the E1/E2 branching ratio the electric dipole moment can be deduced vertical stroke D[sub 0]vertical stroke =(0.09 [+-]0.04) e .fm. ((orig.))
42 CFR 405.2462 - Payment for rural health clinic and Federally qualified health center services.
2010-10-01
... integral and subordinate part of a hospital, skilled nursing facility or home health agency participating... 42 Public Health 2 2010-10-01 2010-10-01 false Payment for rural health clinic and Federally qualified health center services. 405.2462 Section 405.2462 Public Health CENTERS FOR MEDICARE & MEDICAID...
Variation in DNA Methylation Patterns is More Common among Maize Inbreds than among Tissues
Directory of Open Access Journals (Sweden)
Steven R. Eichten
2013-07-01
Full Text Available Chromatin modifications, such as DNA methylation, can provide heritable, epigenetic regulation of gene expression in the absence of genetic changes. A role for DNA methylation in meiotically stable marking of repetitive elements and other sequences has been demonstrated in plants. Methylation of DNA is also proposed to play a role in development through providing a mitotic memory of gene expression states established during cellular differentiation. We sought to clarify the relative levels of DNA methylation variation among different genotypes and tissues in maize ( L.. We have assessed genomewide DNA methylation patterns in leaf, immature tassel, embryo, and endosperm tissues of two inbred maize lines: B73 and Mo17. There are hundreds of regions of differential methylation present between the two genotypes. In general, the same regions exhibit differential methylation between B73 and Mo17 in each of the tissues that were surveyed. In contrast, there are few examples of tissue-specific DNA methylation variation. Only a subset of regions with tissue-specific variation in DNA methylation show similar patterns in both genotypes of maize and even fewer are associated with altered gene expression levels among the tissues. Our data indicates a limited impact of DNA methylation on developmental gene regulation within maize.
Kaushik, A; Papachristou, E; Dima, D; Fewings, S; Kostaki, E; Ploubidis, G B; Kyriakopoulos, M
2017-06-01
Research on the impact of stigma associated with mental illness in children is scarce. Considering the known negative effects of stigma associated with mental illness in adults, it is crucial to explore the stigma experienced by children who access mental health treatment. However, no scale measuring self-stigmatization in younger children is available to date. This study aimed to develop and validate such a scale, the Paediatric Self-Stigmatization Scale (PaedS). A total of 156 children (119 receiving outpatient and 37 receiving inpatient treatment), aged 8-12 years, completed the PaedS, the Self-Perception Profile for Children and the Pediatric Quality of Life Inventory (PedsQL - Child Report, ages 8-12). In addition, parents completed the PedsQL (Parent Report for Children, ages 8-12), the Strengths and Difficulties Questionnaire (SDQ) and a modified subscale of the PaedS measuring the children's rejection by others due to their mental health difficulties. A confirmatory factor analysis showed that a four-factor structure, comprising Societal Devaluation, Personal Rejection, Self-Stigma and Secrecy scales, had excellent fit to the data (CFI=0.95; TLI=0.95; RMSEA=0.05). Child-reported PaedS scores were positively correlated with parental-reported PaedS scores and negatively with PedsQL, the SDQ, and 5 out of 6 subscales of the Self-Perception Profile for Children, suggesting adequate convergent validity (all P-values<0.05). The PaedS is a valid instrument, which is hoped to advance the understanding of self-stigmatization in children with mental health difficulties and contribute to its prevention. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
24 CFR 791.405 - Reallocations of budget authority.
2010-04-01
... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Reallocations of budget authority... Allocation of Budget Authority for Housing Assistance § 791.405 Reallocations of budget authority. (a) The field office shall make every reasonable effort to use the budget authority made available for each...
33 CFR 101.405 - Maritime Security (MARSEC) Directives.
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Maritime Security (MARSEC... SECURITY MARITIME SECURITY MARITIME SECURITY: GENERAL Control Measures for Security § 101.405 Maritime... necessary to respond to a threat assessment or to a specific threat against the maritime elements of the...
Una mirada al 23 F. Los editoriales de El País y ABC
Directory of Open Access Journals (Sweden)
Aitor Pérez Blázquez
2013-10-01
Full Text Available En el presente artículo pretendemos realizar un acercamiento a uno de los hechos más graves de la democracía española. Nos referimos al fallido intento de golpe de estado del 23 de Febrero. Nos hemos fijado en las líneas editoriales de dos periodicos, ABC y EL Pais, para observar como percibieron y se posicionaron durante los días claves tras el golpe militar.Palabras clave: 23F; Editoriales; El País; ABC 23F, editorials, El País, ABC_________________A look to 23 F. The editorials of El País and ABCAbstract:In the present paper we try to realize an approximation to one of the most serious facts of the Spanish democracy. We refer to 23 F. We have concentrated on the publishing lines of two newspapers, ABC and El País, to observe since they perceived and were positioned during the key days after the militar strike.Keywords:
M6: A diploid potato inbred line for use in breeding and genetics research
M6 is a vigorous, homozygous breeding line derived by self-pollinating the diploid wild potato relative Solanum chacoense for seven generations. While most wild Solanum species are self-incompatible, this clone is homozygous for the dominant self-incompatibility inhibitor gene Sli. It is homozygous ...
Simplified PCR protocols for INNO-LiPA HBV Genotyping and INNO-LiPA HBV PreCore assays
Qutub, Mohammed O.; Germer, Jeffrey J.; Rebers, Sjoerd P. H.; Mandrekar, Jayawant N.; Beld, Marcel G. H. M.; Yao, Joseph D. C.
2006-01-01
INNO-LiPA HBV Genotyping (LiPA HBV GT) and INNO-LiPA HBV PreCore (LiPA HBV PC) are commercially available assays for hepatitis B virus (HBV) characterization. These assays are labor-intensive and may be prone to exogenous DNA contamination due to their use of nested PCR amplification procedures and
Cocaine locomotor activation, sensitization and place preference in six inbred strains of mice
2011-01-01
Background The expanding set of genomics tools available for inbred mouse strains has renewed interest in phenotyping larger sets of strains. The present study aims to explore phenotypic variability among six commonly-used inbred mouse strains to both the rewarding and locomotor stimulating effects of cocaine in a place conditioning task, including several strains or substrains that have not yet been characterized for some or all of these behaviors. Methods C57BL/6J (B6), BALB/cJ (BALB), C3H/HeJ (C3H), DBA/2J (D2), FVB/NJ (FVB) and 129S1/SvImJ (129) mice were tested for conditioned place preference to 20 mg/kg cocaine. Results Place preference was observed in most strains with the exception of D2 and 129. All strains showed a marked increase in locomotor activity in response to cocaine. In BALB mice, however, locomotor activation was context-dependent. Locomotor sensitization to repeated exposure to cocaine was most significant in 129 and D2 mice but was absent in FVB mice. Conclusions Genetic correlations suggest that no significant correlation between conditioned place preference, acute locomotor activation, and locomotor sensitization exists among these strains indicating that separate mechanisms underlie the psychomotor and rewarding effects of cocaine. PMID:21806802
Lee, M.Y.; Yan, L.J.; Gorter, F.A.; Kim, B.Y.T.; Cui, Y.; Hu, Y.; Yuan, C.; Grindheim, J.; Ganesan, U.; Liu, Z.Y.; Han, C.G.; Yu, J.L.; Li, D.W.; Jackson, A.O.
2012-01-01
Barley stripe mosaic virus North Dakota 18 (ND18), Beijing (BJ), Xinjiang (Xi), Type (TY) and CV21 strains are unable to infect the Brachypodium distachyon Bd3-1 inbred line, which harbours a resistance gene designated Bsr1, but the Norwich (NW) strain is virulent on Bd3-1. Analysis of ND18 and NW
Hamidi, Sepehr; Aliesky, Holly; Chen, Chun-Rong; Rapoport, Basil
2010-01-01
Background Recombinant-inbred mouse strains differ in their susceptibility to Graves'-like hyperthyroidism induced by immunization with adenovirus expressing the human thyrotropin (TSH) receptor. Because one genetic component contributing to this susceptibility is altered thyroid sensitivity to TSH receptor agonist stimulation, we wished to quantify thyroid responsiveness to TSH. For such studies, it is necessary to suppress endogenous TSH by administering L-3,5,3′-triiodothyronine (L-T3), with the subsequent decrease in serum thyroxine (T4) reflecting endogenous TSH suppression. Our two objectives were to assess in different inbred strains of mice (i) the extent of serum T4 suppression after L-T3 administration and (ii) the magnitude of serum T4 increase induced by TSH. Methods Mice were tail-bled to establish baseline-serum T4 before L-T3 administration. We initially employed a protocol of L-T3-supplemented drinking water for 7 days. In subsequent experiments, we injected L-T3 intraperitoneally (i.p.) daily for 3 days. Mice were then injected i.p. with bovine TSH (10 mU) and euthanized 5 hours later. Serum T4 was assayed before L-T3 administration, and before and after TSH injection. In some experiments, serum T3 and estradiol were measured in pooled sera. Results Oral L-T3 (3 or 5 μg/mL) suppressed serum T4 levels by 26%–64% in female BALB/c mice but >95% in males. T4 suppression in female B6 mice ranged from 0% to 90%. In C3H mice, L-T3 at 3 μg/mL was ineffective but 5 μg/mL achieved >80% serum T4 reduction. Unlike inbred mice, in outbred CF1 mice the same protocol was more effective: 83% in females and 100% suppression in males. The degree of T4 suppression was unrelated to baseline T4, T3, or estradiol, but was related to mouse weight and postmortem T3, with greater suppression in larger mice (outbred CF1 animals and inbred males). Among females with serum T4 suppression >80%, the increase in serum T4 after TSH injection was greater for BALB
21 CFR 1.405 - When does FDA have to issue a decision on an appeal?
2010-04-01
... 21 Food and Drugs 1 2010-04-01 2010-04-01 false When does FDA have to issue a decision on an appeal? 1.405 Section 1.405 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL GENERAL ENFORCEMENT REGULATIONS Administrative Detention of Food for Human or Animal...
1995-04-13
vaccinia virus-T7 RNA polymerase s y stem for e xpression of target genes . Mol . Cell . BioI . 7 : 2538-2544 . Gagneten , S ., Gout , 0 ., Dubois-Dalcq...glycoprotein. These results showed f or the first time that two murine CEA- related genes can be co-expressed in some cell lines from inbred mice...49 Southern Hybridization ................ . ............ 50 Subcloning of PCR Products and Gene Cloning ........ 51 Growth
Directory of Open Access Journals (Sweden)
Ratnayake Walisundera MN
2010-02-01
Full Text Available Abstract Background There are safety concerns regarding widespread consumption of phytosterol and phytostanol supplemented food products. The aim of this study was to determine, in the absence of excess dietary salt, the individual effects of excess accumulation of dietary phytosterols and phytostanols on blood pressure in Wistar Kyoto (WKY inbred rats that have a mutation in the Abcg5 gene and thus over absorb phytosterols and phytostanols. Methods Thirty 35-day old male WKY inbred rats (10/group were fed a control diet or a diet containing phytosterols or phytostanols (2.0 g/kg diet for 5 weeks. The sterol composition of the diets, plasma and tissues were analysed by gas chromatography. Blood pressure was measured by the tail cuff method. mRNA levels of several renal blood pressure regulatory genes were measured by real-time quantitative PCR. Results Compared to the control diet, the phytosterol diet resulted in 3- to 4-fold increases in the levels of phytosterols in plasma, red blood cells, liver, aorta and kidney of WKY inbred rats (P 9-fold the levels of phytostanols in plasma, red blood cells, liver, aorta and kidney of these rats (P P P P P angiotensinogen mRNA levels of these rats. Conclusion These data suggest that excessive accumulation of dietary phytosterols and phytostanols in plasma and tissues may contribute to the increased blood pressure in WKY inbred rats in the absence of excess dietary salt. Therefore, even though phytosterols and phytostanols lower cholesterol levels, prospective clinical studies testing the net beneficial effects of dietary phytosterols and phytostanols on cardiovascular events for subgroups of individuals that have an increased incorporation of these substances are needed.
Inhibition of enteric pathogens using integrated high intensity 405 nm LED on the surface of almonds
The disinfecting properties of 405 nm light were investigated against Escherichia coli O157:H7, Salmonella, and their non-pathogenic surrogates inoculated onto the surface of almonds. High intensity monochromatic light was generated from an array of narrow-band 405 nm light emitting diodes (LED). Al...
Iron and zinc availability in maize lines
Directory of Open Access Journals (Sweden)
Valéria Aparecida Vieira Queiroz
2011-09-01
Full Text Available The aim of this study was to characterize the Zn and Fe availability by phytic acid/Zn and phytic acid/Fe molar ratios, in 22 tropical maize inbred lines with different genetic backgrounds. The Zn and Fe levels were determined by atomic absorption spectrophotometry and the P through colorimetry method. Three screening methods for phytic acid (Phy analysis were tested and one, based on the 2,2'-bipyridine reaction, was select. There was significant variability in the contents of zinc (17.5 to 42 mg.kg-1, iron (12.2 to 36.7 mg.kg-1, phosphorus (230 to 400 mg.100 g-1, phytic acid (484 to 1056 mg.100 g-1, phytic acid P (140 to 293 mg.100 g-1 and available-P (43.5 to 199.5 mg.100 g-1, and in the available-P/total-P ratio (0.14 to 0.50, Phy/Zn (18.0 to 43.5 and Phy/Fe (16.3 to 45.5 molar ratios. Lines 560977, 560978 and 560982 had greater availability of Zn and lines 560975, 560977, 561010 and 5610111 showed better Fe availability. Lines 560975, 560977 and 560978 also showed better available-P/total-P ratio. Thus, the lines 560975, 560977 and 560978 were considered to have the potential for the development of cultivars of maize with high availability of Fe and/or Zn.
Fluorescence-based calculus detection using a 405-nm excitation wavelength
Brede, O.; Schelle, F.; Krueger, S.; Oehme, B.; Dehn, C.; Frentzen, M.; Braun, A.
2011-03-01
The aim of this study was to assess the difference of fluorescence signals of cement and calculus using a 405 nm excitation wavelength. A total number of 20 freshly extracted teeth was used. The light source used for this study was a blue LED with a wavelength of 405nm. For each tooth the spectra of calculus and cementum were measured separately. Fluorescence light was collimated into an optical fibre and spectrally analyzed using an echelle spectrometer (aryelle 200, Lasertechnik Berlin, Germany) with an additionally bandpass (fgb 67, Edmund Industrial Optics, Karlsruhe, Germany). From these 40 measurements the median values were calculated over the whole spectrum, leading to two different median spectra, one for calculus and one for cementum. For further statistical analysis we defined 8 areas of interest (AOI) in wavelength regions, showing remarkable differences in signal strength. In 7 AOIs the intensity of the calculus spectrum differed statistically significant from the intensity of the cementum spectrum (p calculus and cement between 600nm and 700nm. Thus, we can conclude that fluorescence of calculus shows a significant difference to the fluorescence of cement. A differentiation over the intensity is possible as well as over the spectrum. Using a wavelength of 405nm, it is possible to distinguish between calculus and cement. These results could be used for further devices to develop a method for feedback controlled calculus removal.
2010-10-01
... psychologist and clinical social worker services. 405.2452 Section 405.2452 Public Health CENTERS FOR MEDICARE... clinical social worker services. (a) Services and supplies incident to a clinical psychologist's or clinical social worker's services are reimbursable under this subpart if the service or supply is— (1) Of a...
40 CFR 1068.405 - What is in a test order?
2010-07-01
... CONTROLS GENERAL COMPLIANCE PROVISIONS FOR ENGINE PROGRAMS Selective Enforcement Auditing § 1068.405 What.../equipment for testing. The information would apply only for a single model year so it would be best to...
Yasui, Yasuo; Hirakawa, Hideki; Oikawa, Tetsuo; Toyoshima, Masami; Matsuzaki, Chiaki; Ueno, Mariko; Mizuno, Nobuyuki; Nagatoshi, Yukari; Imamura, Tomohiro; Miyago, Manami; Tanaka, Kojiro; Mise, Kazuyuki; Tanaka, Tsutomu; Mizukoshi, Hiroharu; Mori, Masashi; Fujita, Yasunari
2016-12-01
Chenopodium quinoa Willd. (quinoa) originated from the Andean region of South America, and is a pseudocereal crop of the Amaranthaceae family. Quinoa is emerging as an important crop with the potential to contribute to food security worldwide and is considered to be an optimal food source for astronauts, due to its outstanding nutritional profile and ability to tolerate stressful environments. Furthermore, plant pathologists use quinoa as a representative diagnostic host to identify virus species. However, molecular analysis of quinoa is limited by its genetic heterogeneity due to outcrossing and its genome complexity derived from allotetraploidy. To overcome these obstacles, we established the inbred and standard quinoa accession Kd that enables rigorous molecular analysis, and presented the draft genome sequence of Kd, using an optimized combination of high-throughput next generation sequencing on the Illumina Hiseq 2500 and PacBio RS II sequencers. The de novo genome assembly contained 25 k scaffolds consisting of 1 Gbp with N50 length of 86 kbp. Based on these data, we constructed the free-access Quinoa Genome DataBase (QGDB). Thus, these findings provide insights into the mechanisms underlying agronomically important traits of quinoa and the effect of allotetraploidy on genome evolution. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang
2013-12-10
The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant "C. moschata", thermolabile "C. maxima" and moderately heat-tolerant interspecific inbred line "Maxchata" genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. "C. moschata" exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2(-)) and malondialdehyde (MDA) contents in the roots compared to stems, followed by "Maxchata". The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among "C. maxima" and "Maxchata", most of these genes were highly induced under heat stress in "Maxchata", which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.
Renal blood flow dynamics in inbred rat strains provides insight into autoregulation.
A Mitrou, Nicholas G; Cupples, William A
2014-01-01
Renal autoregulation maintains stable renal blood flow in the face of constantly fluctuating blood pressure. Autoregulation is also the only mechanism that protects the delicate glomerular capillaries when blood pressure increases. In order to understand autoregulation, the renal blood flow response to changing blood pressure is studied. The steadystate response of blood flow is informative, but limits investigation of the individual mechanisms of autoregulation. The dynamics of autoregulation can be probed with transfer function analysis. The frequency-domain analysis of autoregulation allows investigators to probe the relative activity of each mechanism of autoregulation. We discuss the methodology and interpretation of transfer function analysis. Autoregulation is routinely studied in the rat, of which there are many inbred strains. There are multiple strains of rat that are either selected or inbred as models of human pathology. We discuss relevant characteristics of Brown Norway, Spontaneously hypertensive, Dahl, and Fawn-Hooded hypertensive rats and explore differences among these strains in blood pressure, dynamic autoregulation, and susceptibility to hypertensive renal injury. Finally we show that the use of transfer function analysis in these rat strains has contributed to our understanding of the physiology and pathophysiology of autoregulation and hypertensive renal disease.Interestingly all these strains demonstrate effective tubuloglomerular feedback suggesting that this mechanism is not sufficient for effective autoregulation. In contrast, obligatory or conditional failure of the myogenic mechanism suggests that this component is both necessary and sufficient for autoregulation.
10 CFR 26.405 - Drug and alcohol testing.
2010-01-01
... NUCLEAR REGULATORY COMMISSION FITNESS FOR DUTY PROGRAMS FFD Program for Construction § 26.405 Drug and..., as defined in § 26.5; (3) Post-accident. As soon as practical after an event involving a human error... contributed to the accident. The licensee or other entity shall test the individual(s) who committed the error...
Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe
2012-08-01
Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development. Copyright © 2012 Elsevier Inc. All rights reserved.
2010-07-26
... Airworthiness Directives; Piper Aircraft, Inc. Models PA-32R-301T and PA-46-350P Airplanes AGENCY: Federal... applies to certain Piper Aircraft, Inc. Models PA-32R-301T and PA-46- 350P airplanes. AD 2010-13-07... 23, 2010), which applies to certain Piper Aircraft, Inc. Models PA-32R-301T and PA-46-350P airplanes...
Directory of Open Access Journals (Sweden)
Carlos Eduardo de Oliveira Camargo
1995-01-01
Full Text Available Compararam-se 23 linhagens tolerantes, ao mesmo tempo, à toxicidade de Al3+ Mn2+ e Fe2+, provindas do cruzamento entre 'BH-1146' (tolerante à toxicidade de A1(3+ e sensível à de Mn2+ e Fe2+ e 'Siete Cerros' (sensível à toxicidade de A1(3+ e tolerante à de Mn2+ e Fe2+ e os dois cultivares utilizados como pais em quatro ensaios instalados nas Estações Experimentais de Itararé (1990-92 e de Capão Bonito (1992, em solos ácidos, e em cinco ensaios realizados no Centro Experimental de Campinas (1990-92 e na Fazenda Santa Lúcia (1990-91, município de Cruzália, em solos corrigidos, analisando os seguintes parâmetros: rendimento de grãos, características agronômicas e resistência às doenças. Em solos ácidos, vinte linhagens e o 'BH-1146' mostraram maior rendimento de grãos em relação ao 'Siete Cerros' indicando que a toxicidade de alumínio foi um dos principais fatores limitantes à produção. Em solos corrigidos, não se verificaram diferenças significativas entre os genótipos estudados quanto ao rendimento de grãos, mostrando não haver urna associação entre baixa produtividade e tolerância ao A1(3+ nessas condições. A linhagem 21 foi moderadamente resistente ao agente causal de oídio em condições naturais de infecção. Todos os genótipos avaliados revelaram suscetibilidade aos agentes causais das manchas foliares. O 'Siete Cerros' e as linhagens 3 a 12 apresentaram porte baixo associado à menor porcentagem de acamamento; as 13, 14 e 23 mostraram espigas compridas; a 12, maior número de espiguetas e grãos por espiga, e a 17, grãos mais pesados, representando fontes genéticas de valor para essas características.Twenty three inbred lines showing at the same time tolerance to A1(3+, Mn2+ and Fe2+ toxicities, originated from the cross between 'BH-1146' (tolerant to Al3+ toxicity and sensitive to Mn2+ and Fe2+ toxicities and 'Siete Cerros' (sensitive to Al3+ and tolerant to Mn2+ and Fe2+ toxicities, and the two
48 CFR 1516.405-2 - Cost-plus-award-fee contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Cost-plus-award-fee... AGENCY CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 1516.405-2 Cost-plus-award-fee contracts. ...
A new isotope of protactinium: 239Pa
International Nuclear Information System (INIS)
Yuan, S.; Yang, W.; Mou, W.; Zhang, X.; Li, Z.; Yu, X.; Gu, J.; Guo, Y.; Gan, Z.; Liu, H.; Guo, J.
1995-01-01
A new nuclide 239 Pa was produced by 50MeV/u 18 O bombardment of uranium. A radiochemical separation method was employed for preparing sources of 239 Pa. The protactinium isotope 239 Pa has been identified for the first time by the results observed from the decay of the 239 Pa and its daughter 239 U. The half-life of 239 Pa has been determined to be 106±30min. (orig.)
42 CFR 483.405 - Relationship to other HHS regulations.
2010-10-01
... SERVICES (CONTINUED) STANDARDS AND CERTIFICATION REQUIREMENTS FOR STATES AND LONG TERM CARE FACILITIES Conditions of Participation for Intermediate Care Facilities for the Mentally Retarded § 483.405 Relationship... participation under this Part, their violation may result in the termination or suspension of, or the refusal to...
42 CFR 405.924 - Actions that are initial determinations.
2010-10-01
... that Medicare has a recovery claim against a provider, supplier, or beneficiary for services or items... terminate services provided to an individual when a physician certified that failure to continue the... Section 405.924 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN...
Comparison of inbred mouse substrains reveals segregation of maladaptive fear phenotypes
Directory of Open Access Journals (Sweden)
Stephanie J Temme
2014-08-01
Full Text Available Maladaptive fear, such as fear that is persistent or easily generalized to a nonthreatening stimuli, is associated with anxiety-related disorders in humans. In the laboratory, maladaptive fear can be modeled in rodents using Pavlovian fear conditioning. Recently, an inbred mouse strain known as 129S1/SvImJ, or 129S1 have been reported as exhibiting impairments in fear extinction and enhanced fear generalization. With a long-term goal of identifying segregating genetic markers of maladaptive fear, we used Pavlovian fear conditioning to characterize a closely related substrain designated as 129S6/SvEvTac, or 129S6. Here we report that, like 129S1 animals, 129S6 mice exhibit appropriate levels of fear upon conditioning, but are unable to extinguish fear memories once they are consolidated. Importantly, the maladaptive fear phenotype in this inbred stain can be segregated by sub-strain when probed using conditioning protocols designed to assess generalized fear. We find that unlike the 129S1 substrain, mice from the 129S6 sub-strain do not generalize conditioned fear to previously novel contexts and can learn to discriminate between two similar contexts when trained using a discrimination protocol. These results suggest that at least two forms of maladaptive fear (deficits in fear extinction and fear generalization can be can be functionally segregated, further suggesting that the underlying neurobiology is heritable. Given the observation that two closely related sub-strains can exhibit different constellations of maladaptive fear suggests that these findings could be exploited to facilitate the identification of candidate genes for anxiety-related disorders.
DEFF Research Database (Denmark)
Bekes, Erin; Deryugina, Elena; Kuprianova, Tatyana
2011-01-01
disseminating variant of the human PC-3 prostate carcinoma cell line, PC-hi/diss, as a prototype of aggressive carcinomas to investigate the mechanisms whereby pro-uPA activation and uPA-generated plasmin functionally contribute to specific stages of metastasis. The PC-hi/diss cells secrete and activate...... significant amounts of pro-uPA, leading to efficient generation of plasmin in solution and at the cell surface. In a mouse orthotopic xenograft model, treatment with the specific pro-uPA activation-blocking antibody mAb-112 significantly inhibited local invasion and distant metastasis of the PC-hi/diss cells....... To mechanistically examine the uPA/plasmin-mediated aspects of tumor cell dissemination, the anti pro-uPA mAb-112 and the potent serine protease inhibitor, aprotinin, were utilized in parallel in a number of in vivo assays modeling various rate-limiting steps in early metastatic spread. Our findings demonstrate...
Czech Academy of Sciences Publication Activity Database
Mucksová, J.; Plachý, Jiří; Staněk, Ondřej; Hejnar, Jiří; Kalina, J.; Benešová, B.; Trefil, P.
2017-01-01
Roč. 48, č. 18 (2017), č. článku 18. ISSN 0928-4249 R&D Projects: GA MZe QJ1210041 Institutional support: RVO:61388971 ; RVO:68378050 Keywords : major histocompatibility complex * natural-killer-cells * rous-sarcoma-virus * class-i molecule * c-type lectin * induced tumors * inbred lines * b-nk * mycobacterium-tuberculosis * receptor dec-205 Subject RIV: EB - Genetics ; Molecular Biology; EE - Microbiology, Virology (MBU-M) OBOR OECD: Microbiology; Microbiology (MBU-M) Impact factor: 2.798, year: 2016
International Nuclear Information System (INIS)
D'Hoostelaere, L.; Potter, M.
1982-01-01
Antibodies to dextran B512 were raised in various strains of mice and were assayed by a radioimunoassay procedure. Idiotypic antibodies to the IgA(k) dextran B512 binding myeloma proteins QUOC52 and W3129 of BALB/c origin were prepred in rabbits. After adsorption, each antiserum was specific for the immunizing myeloma protein and did not react with hundreds of other myeloma proteins; nonetheless, antibodies to dextran B512 from various strains of mice cross-reacted in these test systems. Of the 2 idiotypes tested, the W3129 idiotype was more universally expressed in different strains of mice. The QUPC52 idiotype was the predominant idiotype in BALB/c anti-dextran B512 antibodies and was found in only a few other inbred strains. Using a battery of congenic and inbred strains, it was shown that the QUPC52 idiotype was controlled by genes linked to the Igh complex locus (chromosome 12) and to the Ig k complex locus (chromosome 6). The W3129 idiotype was found in a number of stocks of mice in the genus Mus recently isolated from the wild. The QUPC52 idiotype thus far was found only in inbred mice
Directory of Open Access Journals (Sweden)
Carlos Eduardo de Oliveira Camargo
1988-01-01
Full Text Available Avaliaram-se vinte e duas linhagens e três cultivares de trigo em ensaios instalados em cinco regiões paulistas, em 1984-86, analisando-se os seguintes parâmetros: rendimento de grãos, altura de plantas, ciclo, em dias, da emergência ao florescimento e da emergência à maturação, porcentagem de plantas acamadas, comprimento da espiga, número de grãos por espiga e por espigueta, número de espiguetas por espiga, peso de cem grãos, resistência à ferrugem-do-colmo e da-folha em condições de campo e de casa de vegetação, resistência à helmintosporiose e ao oídio em condições de campo. Em laboratório, foram realizados estudos da tolerância ao alumínio, em soluções nutritivas. Em sequeiro, nos ensaios conduzidos em Capão Bonito e no Vale do Paranapanema (Maracaí e Cruzália, destacaram-se, quanto à produção de grãos, respectivamente, o cultivar BH-1146 e a linhagem 12. As linhagens 4, 9 e 13, em Campinas, e a 8, em Tatuí, evidenciaram alta produção de grãos em condição de irrigação por aspersão. Na média de nove experimentos, destacaram-se em produção de grãos, por ordem decrescente, o cultivar BH-1146 e as linhagens 13, 20 e 14. As linhagens 2, 7, 8, 17 e 18 e o 'Alondra-S-46' mostraram plantas significativamente mais baixas que o 'BH-1146' e 'IAC-5'. As linhagens 7 e 8 e o cultivar Alondra-S-46 mostraram resistência às seis raças e as linhagens 17 e 18 a cinco raças testadas do agente causal de ferrugem-do-colmo em estádio de plântula, em casa de vegetação. Em campo, no estádio de planta adulta, apresentaram menor área infectada por essa doença as linhagens 1, 2, 7, 8, 12 e 17 e o cultivar Alondra-S-46. Nas mesmas condições, as linhagens 1, 5, 8 e 18 exibiram menor área infectada por ferrugem-da-folha. As linhagens 11, 12, 13, 19, 20 e 21 e o cultivar BH-1146 mostraram tolerância à presença de 10mg/litro de Al3+ na solução nutritiva.Twenty two inbred lines from the wheat breeding
DEFF Research Database (Denmark)
Kobæk Larsen, Morten; Diederichsen, Axel Cosmus Pyndt; Agger, Ralf
2004-01-01
by four weekly subcutaneous azoxymethane injections in inbred rats of the BDIX/OrlIco strain in two separate studies. Azoxymethane-induced tumours show many similarities to spontaneously occurring human colon carcinomas with respect to histopathological appearance. In our studies, the overall inflammatory...
Haughey, Heather M; Kaiser, Alan L; Johnson, Thomas E; Bennett, Beth; Sikela, James M; Zahniser, Nancy R
2005-10-01
Altered noradrenergic neurotransmission is associated with depression and may contribute to drug abuse and alcoholism. Differential initial sensitivity to ethanol is an important predictor of risk for future alcoholism, making the inbred long-sleep (ILS) and inbred short-sleep (ISS) mice a useful model for identifying genes that may contribute to alcoholism. In this study, molecular biological, neurochemical, and behavioral approaches were used to test the hypothesis that the norepinephrine transporter (NET) contributes to the differences in ethanol-induced loss of righting reflex (LORR) in ILS and ISS mice. We used these mice to investigate the NET as a candidate gene contributing to this phenotype. The ILS and ISS mice carry different DNA haplotypes for NET, showing eight silent differences between allelic coding regions. Only the ILS haplotype is found in other mouse strains thus far sequenced. Brain regional analyses revealed that ILS mice have 30 to 50% lower [3H]NE uptake, NET binding, and NET mRNA levels than ISS mice. Maximal [3H]NE uptake and NET number were reduced, with no change in affinity, in the ILS mice. These neurobiological changes were associated with significant influences on the behavioral phenotype of these mice, as demonstrated by (1) a differential response in the duration of ethanol-induced LORR in ILS and ISS mice pretreated with a NET inhibitor and (2) increased ethanol-induced LORR in LXS recombinant inbred (RI) strains, homozygous for ILS in the NET chromosomal region (44-47 cM), compared with ISS homozygous strains. This is the first report to suggest that the NET gene is one of many possible genetic factors influencing ethanol sensitivity in ILS, ISS, and LXS RI mouse strains.
42 CFR 405.801 - Part B appeals-general description.
2010-10-01
... 405.801 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... rights of a beneficiary under paragraph (a) of this section to appeal the carrier's initial determination... whether an individual has met basic Part B entitlement requirements are covered in subpart G of this part...
40 CFR 98.405 - Procedures for estimating missing data.
2010-07-01
... meter malfunctions), a substitute data value for the missing quantity measurement must be used in the... period for any reason, the reporter shall use either its delivering pipeline measurements or the default... § 98.405 Procedures for estimating missing data. (a) Whenever a quality-assured value of the quantity...
41 CFR 101-39.405 - Claims against the Government.
2010-07-01
... VEHICLES 39-INTERAGENCY FLEET MANAGEMENT SYSTEMS 39.4-Accidents and Claims § 101-39.405 Claims against the Government. (a) Whenever a GSA Interagency Fleet Management System (IFMS) vehicle is involved in an accident... against the agency using a GSA Interagency Fleet Management System (IFMS) vehicle, the agency shall...
McLachlan, Stela; Page, Kathryn E; Lee, Seung-Min; Loguinov, Alex; Valore, Erika; Hui, Simon T; Jung, Grace; Zhou, Jie; Lusis, Aldons J; Fuqua, Brie; Ganz, Tomas; Nemeth, Elizabeta; Vulpe, Chris D
2017-11-01
Iron homeostasis is tightly regulated, and the peptide hormone hepcidin is considered to be a principal regulator of iron metabolism. Previous studies in a limited number of mouse strains found equivocal sex- and strain-dependent differences in mRNA and serum levels of hepcidin and reported conflicting data on the relationship between hepcidin ( Hamp1 ) mRNA levels and iron status. Our aim was to clarify the relationships between strain, sex, and hepcidin expression by examining multiple tissues and the effects of different dietary conditions in multiple inbred strains. Two studies were done: first, Hamp1 mRNA, liver iron, and plasma diferric transferrin levels were measured in 14 inbred strains on a control diet; and second, Hamp1 mRNA and plasma hepcidin levels in both sexes and iron levels in the heart, kidneys, liver, pancreas, and spleen in males were measured in nine inbred/recombinant inbred strains raised on an iron-sufficient or high-iron diet. Both sex and strain have a significant effect on both hepcidin mRNA (primarily a sex effect) and plasma hepcidin levels (primarily a strain effect). However, liver iron and diferric transferrin levels are not predictors of Hamp1 mRNA levels in mice fed iron-sufficient or high-iron diets, nor are the Hamp1 mRNA and plasma hepcidin levels good predictors of tissue iron levels, at least in males. We also measured plasma erythroferrone, performed RNA-sequencing analysis of liver samples from six inbred strains fed the iron-sufficient, low-iron, or high-iron diets, and explored differences in gene expression between the strains with the highest and lowest hepcidin levels. NEW & NOTEWORTHY Both sex and strain have a significant effect on both hepcidin mRNA (primarily a sex effect) and plasma hepcidin levels (primarily a strain effect). Liver iron and diferric transferrin levels are not predictors of Hamp1 mRNA levels in mice, nor are the Hamp1 mRNA and plasma hepcidin levels good predictors of tissue iron levels, at least
2010-07-01
... 32 National Defense 5 2010-07-01 2010-07-01 false PA fees. 701.123 Section 701.123 National... OFFICIAL RECORDS AVAILABILITY OF DEPARTMENT OF THE NAVY RECORDS AND PUBLICATION OF DEPARTMENT OF THE NAVY DOCUMENTS AFFECTING THE PUBLIC DON Privacy Program § 701.123 PA fees. The PA fee schedule is only applicable...
Krzanowska, H; Styrna, J; Wabik-Sliz, B
1995-07-01
Recombinant inbred strains were developed from reciprocal crosses between two inbred strains of mice (CBA and KE) differing in sperm head shape, proportion of normal sperm heads (CBA, 95%; KE, 78%) and fertilization efficiency (CBA, 100% of fertilized ova; KE, 72%), to determine whether the indices of sperm morphology and function were correlated. The following parameters were analysed in recombinant inbred and progenitor strains: index of sperm head shape (head width in the middle of its length/head length), percentage of abnormal sperm heads, percentage of spermatozoa with progressive movements, efficiency of penetration of hyaluronic acid polymer (Sperm Select) and percentage of fertilized ova after mating males from the tested strains with females from an outbred stock. For each investigated character, recombinant inbred strains, recombinant inbred EXCB and CBXE, could be divided into at least three categories: KE-like, CBA-like and intermediate, suggesting that in each case a minimum of two genes was involved. Recombinant strains derived from the reciprocal crosses of progenitor strains differed only with respect to the proportion of abnormal sperm heads, showing the involvement of the Y chromosome in determining this character. Penetration into Sperm Select was significantly correlated both with fertilization efficiency and sperm motility, while correlation with the proportion of normal spermatozoa did not reach the level of significance. However, there was a significant negative correlation of both sperm abnormalities and the incidence of supplementary spermatozoa in the perivitelline space with the index of sperm head shape.(ABSTRACT TRUNCATED AT 250 WORDS)
SRAP analysis for space induced mutant line of maize (Zea mays L.)
International Nuclear Information System (INIS)
Du Wenping; Yu Guirong; Song Jun; Xu Liyuan
2011-01-01
In order to detect the effects of space mutation on maize, 16 SRAP primers were applied for the discrimination of the maize inbred line '968' and its 93 mutant materials, 154 polymorphic fragments were amplified. The average of polymorphic bands detected by per SRAP primer combination was 9.6 with a range from 5 to 18. Genetic similarities among the 94 materials ranged from 0.481 to 1.000 with an average of 0.903, and the largest genetic distance was found between mutant line 37 and control. The 94 materials were divided into six groups with the similarity coefficient of 0.732. The phylogenetic analysis showed distinct variation among the mutants. The results indicated that SRAP markers could be used for analyzing genetic variation of mutants. (authors)
5 CFR 430.405 - Procedures for certifying agency appraisal systems.
2010-01-01
... SERVICE REGULATIONS PERFORMANCE MANAGEMENT Performance Appraisal Certification for Pay Purposes § 430.405... appraisals of their relative performance against performance expectations in any given appraisal period..., requirements, or expectations for the employees they supervise to ensure that they clearly link to...
33 CFR 153.405 - Liability to the pollution fund.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Liability to the pollution fund... (CONTINUED) POLLUTION CONTROL OF POLLUTION BY OIL AND HAZARDOUS SUBSTANCES, DISCHARGE REMOVAL Administration of the Pollution Fund § 153.405 Liability to the pollution fund. The owner or operator of the vessel...
20 CFR 405.10 - Medical and Vocational Expert System.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Medical and Vocational Expert System. 405.10... Vocational Expert System. (a) General. The Medical and Vocational Expert System is comprised of the Medical... Vocational Expert System. (3) Experts who provide evidence at your request. Experts whom you ask to provide...
20 CFR 405.373 - Requesting consideration of new evidence.
2010-04-01
... consideration of new evidence. (a) If the administrative law judge's decision is our final decision, the... consideration by the administrative law judge at the earliest possible opportunity, but no later than 30 days... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Requesting consideration of new evidence. 405...
2010-01-01
... flight instructor certificate with a sport pilot rating? 61.405 Section 61.405 Aeronautics and Space..., FLIGHT INSTRUCTORS, AND GROUND INSTRUCTORS Flight Instructors With a Sport Pilot Rating § 61.405 What tests do I have to take to obtain a flight instructor certificate with a sport pilot rating? To obtain a...
Accelerated Generation of Selfed Pure Line Plants for Gene Identification and Crop Breeding
Directory of Open Access Journals (Sweden)
Guijun Yan
2017-10-01
Full Text Available Production of pure lines is an important step in biological studies and breeding of many crop plants. The major types of pure lines for biological studies and breeding include doubled haploid (DH lines, recombinant inbred lines (RILs, and near isogenic lines (NILs. DH lines can be produced through microspore and megaspore culture followed by chromosome doubling while RILs and NILs can be produced through introgressions or repeated selfing of hybrids. DH approach was developed as a quicker method than conventional method to produce pure lines. However, its drawbacks of genotype-dependency and only a single chance of recombination limited its wider application. A recently developed fast generation cycling system (FGCS achieved similar times to those of DH for the production of selfed pure lines but is more versatile as it is much less genotype-dependent than DH technology and does not restrict recombination to a single event. The advantages and disadvantages of the technologies and their produced pure line populations for different purposes of biological research and breeding are discussed. The development of a concept of complete in vitro meiosis and mitosis system is also proposed. This could integrate with the recently developed technologies of single cell genomic sequencing and genome wide selection, leading to a complete laboratory based pre-breeding scheme.
49 CFR 1572.405 - Procedures for collection by TSA.
2010-10-01
... 49 Transportation 9 2010-10-01 2010-10-01 false Procedures for collection by TSA. 1572.405 Section... Procedures for collection by TSA. This section describes the procedures that an individual, who applies to obtain or renew an HME for a CDL, must follow if a TSA agent collects and transmits the Information...
47 CFR 69.405 - Published directory expenses in Account 6620.
2010-10-01
... 47 Telecommunication 3 2010-10-01 2010-10-01 false Published directory expenses in Account 6620... SERVICES (CONTINUED) ACCESS CHARGES Apportionment of Expenses § 69.405 Published directory expenses in Account 6620. Published Directory expenses shall be assigned to the Information element. ...
5 CFR 1330.405 - Procedures for certifying agency appraisal systems.
2010-01-01
... Certification for Pay Purposes § 1330.405 Procedures for certifying agency appraisal systems. (a) General. To... senior employees based on appraisals of their relative performance against performance expectations in... responsibilities— (A) The performance standards, requirements, or expectations for the employees they supervise to...
Park, Suhyoung; Valan Arasu, Mariadhas; Lee, Min-Ki; Chun, Jin-Hyuk; Seo, Jeong Min; Lee, Sang-Won; Al-Dhabi, Naif Abdullah; Kim, Sun-Ju
2014-02-15
We profiled and quantified glucosinolates (GSLs), anthocyanins, free amino acids, and vitamin C metabolites in forty-five lines of green and red cabbages. Analysis of these distinct cabbages revealed the presence of 11 GSLs, 13 anthocyanins, 22 free amino acids, and vitamin C. GSL contents were varied amongst the different lines of cabbage. The total GSL content was mean 10.6 μmol/g DW, and sinigrin was the predominant GSL accounted mean 4.0 μmol/g DW (37.7% of the total) followed by glucoraphanin (1.9) and glucobrassicin (2.4). Amongst the 13 anthocyanins, cyanidin 3-(sinapoyl) diglucoside-5-glucoside levels were the highest. The amounts of total free amino acids in green cabbage lines ranged 365.9 mg/100g fresh weight (FW) to 1089.1mg/100g FW. Vitamin C levels were much higher in red cabbage line (129.9 mg/100g FW). Thus, the amounts of GSLs, anthocyanins, free amino acids, and vitamin C varied widely, and the variations in these compounds between the lines of cabbage were significant. Copyright © 2013 Elsevier Ltd. All rights reserved.
Measuring Maize Seedling Drought Response in Search of Tolerant Germplasm
Directory of Open Access Journals (Sweden)
Dirk Hays
2013-02-01
Full Text Available To identify and develop drought tolerant maize (Zea mays L., high-throughput and cost-effective screening methods are needed. In dicot crops, measuring survival and recovery of seedlings has been successful in predicting drought tolerance but has not been reported in C4 grasses such as maize. Seedlings of sixty-two diverse maize inbred lines and their hybrid testcross progeny were evaluated for germination, survival and recovery after a series of drought cycles. Genotypic differences among inbred lines and hybrid testcrosses were best explained approximately 13 and 18 days after planting, respectively. Genotypic effects were significant and explained over 6% of experimental variance. Specifically three inbred lines had significant survival, and 14 hybrids had significant recovery. However, no significant correlation was observed between hybrids and inbreds (R2 = 0.03, indicating seedling stress response is more useful as a secondary screening parameter in hybrids than in inbred lines per se. Field yield data under full and limited irrigation indicated that seedling drought mechanisms were independent of drought responses at flowering in this study.
Directory of Open Access Journals (Sweden)
Saeed Yadranji Aghdam
2016-01-01
Full Text Available Diabetic nephropathy (DN and diabetic retinopathy (DR are major complications of type 1 and type 2 diabetes. DN and DR are mainly caused by injury to the perivascular supporting cells, the mesangial cells within the glomerulus, and the pericytes in the retina. The genes and molecular mechanisms predisposing retinal and glomerular pericytes to diabetic injury are poorly characterized. In this study, the genetic deletion of proteasome activator genes, PA28α and PA28β genes, protected the diabetic mice in the experimental STZ-induced diabetes model against renal injury and retinal microvascular injury and prolonged their survival compared with wild type STZ diabetic mice. The improved wellbeing and reduced renal damage was associated with diminished expression of Osteopontin (OPN and Monocyte Chemoattractant Protein-1 (MCP-1 in the glomeruli of STZ-injected PA28α/PA28β double knockout (Pa28αβDKO mice and also in cultured mesangial cells and retinal pericytes isolated from Pa28αβDKO mice that were grown in high glucose. The mesangial PA28-mediated expression of OPN under high glucose conditions was suppressed by peptides capable of inhibiting the binding of PA28 to the 20S proteasome. Collectively, our findings demonstrate that diabetic hyperglycemia promotes PA28-mediated alteration of proteasome activity in vulnerable perivascular cells resulting in microvascular injury and development of DN and DR.
20 CFR 405.725 - Effect of expedited appeals process agreement.
2010-04-01
... PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Expedited Appeals Process for Constitutional Issues § 405.725 Effect of expedited appeals process agreement. After an expedited appeals process agreement is... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Effect of expedited appeals process agreement...
48 CFR 916.405-2 - Cost-plus-award-fee contracts.
2010-10-01
..., output, be it hardware, research and development, demonstration or services, together with business... CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 916.405-2 Cost-plus-award-fee... appropriate) and business management considerations tailored to the needs of the particular situation. In...
2010-07-01
... Privacy Program § 701.120 Processing requests that cite or imply PA, Freedom of Information (FOIA), or PA... maximum release of information allowed under the Acts. (d) Processing time limits. DON activities shall... 32 National Defense 5 2010-07-01 2010-07-01 false Processing requests that cite or imply PA...
VizieR Online Data Catalog: QSOs narrow absorption line variability (Hacker+, 2013)
Hacker, T. L.; Brunner, R. J.; Lundgren, B. F.; York, D. G.
2013-06-01
Catalogues of 2,522 QAL systems and 33 variable NAL systems detected in SDSS DR7 quasars with repeat observations. The object identifiers, position coordinates, and plate-MJD-fibre designations are taken from the SpecObjAll table in the SDSS Catalogue Archive Server (CAS) while the quasar redshifts (zqso) are from Hewett & Wild (2010, Cat. J/MNRAS/405/2302). The absorption system redshift (zabs), system grade, and detected lines are outputs of the York et al. (2013, in. prep.) QAL detection pipeline. Some absorption lines are flagged based on alternate identifications (a), proximity of masked pixels (b), or questionable continuum fits (c). (3 data files).
Malagnac, Fabienne; Klapholz, Benjamin; Silar, Philippe
2007-12-01
In various organisms, thioredoxins are known to be involved in the reduction of protein disulfide bonds and in protecting the cell from oxidative stress. Genes encoding thioredoxins were found by searching the complete genome sequence of the filamentous ascomycete Podospora anserina. Among them, PaTrx1, PaTrx2, and PaTrx3 are predicted to be canonical cytosolic proteins without additional domains. Targeted disruption of PaTrx1, PaTrx2, and PaTrx3 shows that PaTrx1 is the major thioredoxin involved in sulfur metabolism. Deletions have no effect on peroxide resistance; however, data show that either PaTrx1 or PaTrx3 is necessary for sexual reproduction and for the development of the crippled growth cell degeneration (CG), processes that also required the PaMpk1 mitogen-activated protein kinase (MAPK) pathway. Since PaTrx1 PaTrx3 mutants show not an enhancement but rather an impairment in CG, it seems unlikely that PaTrx1 and PaTrx3 thioredoxins participate in the inhibition of this MAPK pathway. Altogether, these results underscore a role for thioredoxins in fungal development.
42 CFR 405.512 - Carriers' procedural terminology and coding systems.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Carriers' procedural terminology and coding systems... Determining Reasonable Charges § 405.512 Carriers' procedural terminology and coding systems. (a) General. Procedural terminology and coding systems are designed to provide physicians and third party payers with a...
20 CFR 405.320 - Administrative law judge hearing procedures-general.
2010-04-01
...) Conduct of the hearing. The administrative law judge will decide the order in which the evidence will be... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Administrative law judge hearing procedures... PROCESS FOR ADJUDICATING INITIAL DISABILITY CLAIMS Administrative Law Judge Hearing § 405.320...
Malsy, Manuela; Graf, Bernhard; Bundscherer, Anika
2017-12-06
Adenocarcinoma of the pancreas is one of the most aggressive cancer diseases affecting the human body. Recent research has shown the importance of the perioperative phase in disease progression. Particularly during this vulnerable phase, substances such as metamizole and paracetamol are given as general anesthetics and postoperative analgesics. Therefore, the effects of metamizole and paracetamol on tumor progression should be investigated in more detail because the extent to which these substances influence the carcinogenesis of pancreatic carcinoma is still unclear. This study analyzed the influence of metamizole and its active metabolites MAA (4-N-methyl-aminoantipyrine) and paracetamol on the proliferation, apoptosis, and necrosis of the pancreatic cancer cell lines PaTu 8988t and Panc-1 in vitro. Cell proliferation was measured by means of the ELISA BrdU assay and the rate of apoptosis by flow cytometry using the Annexin V assay. Metamizole and paracetamol significantly inhibited cell proliferation in pancreatic cancer cells. After the addition of metamizole to PaTu 8988t cells, the rate of apoptosis was reduced after 3 h of incubation but significantly increased after 9 h of incubation. The oncogenic potential of pancreatic adenocarcinoma is mainly characterized by its extreme growth rate. Non-opioid analgesics such as metamizole and paracetamol are given as general anesthetics and postoperative analgesics. The combination of metamizole or paracetamol with cytotoxic therapeutic approaches may achieve synergistic effects. Further studies are necessary to identify the underlying mechanisms so that new therapeutic options may be developed for the treatment of this aggressive tumor.
Microsatellite analysis of the correlation between molecular and ...
African Journals Online (AJOL)
The Co-ancestry distance showed six tied groups with the Kenya cluster showing some differentiation with Exact Tests for population differentiation with a p = 0.0513. The American inbred line (OSU 23i) segregated alone, while the Kenya lines (EM11-133 and. EM12-210) had close homology with the CIMMYT inbred lines ...
48 CFR 16.405-1 - Cost-plus-incentive-fee contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Cost-plus-incentive-fee... CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 16.405-1 Cost-plus-incentive-fee contracts. (a) Description. The cost-plus-incentive-fee contract is a cost-reimbursement contract that...
42 CFR 405.817 - Principles for determining amount in controversy.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Principles for determining amount in controversy... the Medicare Part B Program § 405.817 Principles for determining amount in controversy. (a) Individual... may assert that the aggregation principles contained in this subpart may be applied to determine the...
2010-10-01
... prostitution; crimes against persons; or offenses committed against children, are placed in positions involving... children? 136.405 Section 136.405 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Indian Child...
Expression pattern of matrix metalloproteinases in human gynecological cancer cell lines
International Nuclear Information System (INIS)
Schröpfer, Andrea; Kammerer, Ulrike; Kapp, Michaela; Dietl, Johannes; Feix, Sonja; Anacker, Jelena
2010-01-01
Matrix metalloproteinases (MMPs) are involved in the degradation of protein components of the extracellular matrix and thus play an important role in tumor invasion and metastasis. Their expression is related to the progression of gynecological cancers (e.g. endometrial, cervical or ovarian carcinoma). In this study we investigated the expression pattern of the 23 MMPs, currently known in humans, in different gynecological cancer cell lines. In total, cell lines from three endometrium carcinomas (Ishikawa, HEC-1-A, AN3 CA), three cervical carcinomas (HeLa, Caski, SiHa), three chorioncarcinomas (JEG, JAR, BeWo), two ovarian cancers (BG-1, OAW-42) and one teratocarcinoma (PA-1) were examined. The expression of MMPs was analyzed by RT-PCR, Western blot and gelatin zymography. We demonstrated that the cell lines examined can constitutively express a wide variety of MMPs on mRNA and protein level. While MMP-2, -11, -14 and -24 were widely expressed, no expression was seen for MMP-12, -16, -20, -25, -26, -27 in any of the cell lines. A broad range of 16 MMPs could be found in the PA1 cells and thus this cell line could be used as a positive control for general MMP experiments. While the three cervical cancer cell lines expressed 10-14 different MMPs, the median expression in endometrial and choriocarcinoma cells was 7 different enzymes. The two investigated ovarian cancer cell lines showed a distinctive difference in the number of expressed MMPs (2 vs. 10). Ishikawa, Caski, OAW-42 and BeWo cell lines could be the best choice for all future experiments on MMP regulation and their role in endometrial, cervical, ovarian or choriocarcinoma development, whereas the teratocarcinoma cell line PA1 could be used as a positive control for general MMP experiments
Causes and consequences of chromatin variation between inbred mice.
Directory of Open Access Journals (Sweden)
Mona Hosseini
2013-06-01
Full Text Available Variation at regulatory elements, identified through hypersensitivity to digestion by DNase I, is believed to contribute to variation in complex traits, but the extent and consequences of this variation are poorly characterized. Analysis of terminally differentiated erythroblasts in eight inbred strains of mice identified reproducible variation at approximately 6% of DNase I hypersensitive sites (DHS. Only 30% of such variable DHS contain a sequence variant predictive of site variation. Nevertheless, sequence variants within variable DHS are more likely to be associated with complex traits than those in non-variant DHS, and variants associated with complex traits preferentially occur in variable DHS. Changes at a small proportion (less than 10% of variable DHS are associated with changes in nearby transcriptional activity. Our results show that whilst DNA sequence variation is not the major determinant of variation in open chromatin, where such variants exist they are likely to be causal for complex traits.
Evaluation of ID-PaGIA syphilis antibody test.
Naaber, Paul; Makoid, Ene; Aus, Anneli; Loivukene, Krista; Poder, Airi
2009-01-01
Laboratory diagnosis of syphilis is usually accomplished by serology. There are currently a large number of different commercial treponemal tests available that vary in format, sensitivity and specificity. To evaluate the ID-PaGIA Syphilis Antibody Test as an alternative to other specific treponemal tests for primary screening or confirmation of diagnosis. Serum samples from healthy adults (n = 100) were used for detection of specificity of ID-PaGIA. To evaluate sensitivity of ID-PaGIA serum samples (n = 101) from patients with confirmed or suspected syphilis were tested for syphilis antibodies with FTA-Abs IgM, ID-PaGIA, ELISA IgM and TPHA tests. No false-positive results were found with ID-PaGIA. Sensitivity of various treponemal tests was the following: FTA-Abs IgM: 95.5%, ID-PaGIA and ELISA IgM: 94%, and TPHA 75%. The positive and negative predictive values of ID-PaGIA were 100 and 89.5%, respectively. Compared with other treponemal tests ID-PaGIA has excellent sensitivity and specificity.
International Nuclear Information System (INIS)
Han, A.; Peak, M.J.; Peak, J.G.
1984-01-01
The survival, the induction of DNA-protein cross-linking, and the number of T4-endonuclease sensitive sites were measured in Chinese hamster cells that had been irradiated with 365 and 405 nm monochromatic light. The survival measurements show that cells are somewhat less sensitive to 405 nm light than to 365 nm light. The difference is expressed predominantly in the shoulder widths of the survival curves, whereas the slopes of the two curves are about the same. Induction of pyrimidine dimers, as indicated by the number of endonuclease-sensitive sites, after exposures that produce about 10% survival is very low at 365 nm (approx. 4 endonuclease sites per 2 x 10 8 daltons), while no dimers are detected at 405 nm. In contrast, DNA-protein cross-links are induced rather effectively at either wavelength even after exposures that result in a relatively high survival (60-20%). These measurements support the conclusion that lethality in mammalian cells after irradiations with 365 or 405 nm light is caused by a nondimer damage, possibly DNA-protein cross-links. (author)
48 CFR 3003.405 - Misrepresentations or violations of the Covenant Against Contingent Fees.
2010-10-01
... System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY ACQUISITION REGULATION (HSAR) GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Contingent Fees 3003.405 Misrepresentations or...
Conductive ink print on PA66 gear for manufacturing condition monitoring sensors
Futagawa, Shintaro; Iba, Daisuke; Kamimoto, Takahiro; Nakamura, Morimasa; Miura, Nanako; Iizuka, Takashi; Masuda, Arata; Sone, Akira; Moriwaki, Ichiro
2018-03-01
Failures detection of rotating machine elements, such as gears, is an important issue. The purpose of this study was to try to solve this issue by printing conductive ink on gears to manufacture condition-monitoring sensors. In this work, three types of crack detection sensor were designed and the sprayed conductive ink was directly sintered on polyimide (PI) - coated polyamide (PA) 66 gears by laser. The result showed that it was possible to produce narrow circuit lines of the conductive ink including Ag by laser sintering technique and the complex shape sensors on the lateral side of the PA66 gears, module 1.0 mm and tooth number 48. A preliminary operation test was carried out for investigation of the function of the sensors. As a result of the test, the sensors printed in this work should be effective for detecting cracks at tooth root of the gears and will allow for the development of better equipment and detection techniques for health monitoring of gears.
48 CFR 416.405-2 - Cost-plus-award-fee contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Cost-plus-award-fee... CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 416.405-2 Cost-plus-award-fee contracts. The HCA may designate an acquisition official other than the contracting officer as the fee...
48 CFR 1316.405-2 - Cost-plus-award-fee contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Cost-plus-award-fee... CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 1316.405-2 Cost-plus-award-fee contracts. Insert clause 1352.216-72, Determination of Award Fee, in all cost-plus-award-fee contracts. ...
48 CFR 216.405-2 - Cost-plus-award-fee contracts.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Cost-plus-award-fee... Contracts 216.405-2 Cost-plus-award-fee contracts. (b) Application. The cost-plus-award-fee (CPAF) contract... avoid— (1) Establishing cost-plus-fixed-fee contracts when the criteria for cost-plus-fixed-fee...
Prospection for natural 231Pa in India
International Nuclear Information System (INIS)
Anupama, P.; Gantayet, L.M.; Verma, R.; Parthasarathy, R.; Anil Kumar, S.; Dingankar, M.V.; Ghosh, S.K.; Patra, R.N.
2001-08-01
Protactinium-231 ( 231 Pa) occurs in nature as a member of the decay chain of naturally occuring 235 U of the 4n+ 3 radioactive series. The expected protactinium concentration in the Jaduguda ore body (with uranium concentration of 0.03-0.06 %) is around 0.2 parts per billion (ppb) and that in monazite ore (uranium concentration 0.3%) is 0.9 ppb. The process at uranium ore processing plant at Jaduguda was studied. 231 Pa content in samples from the process streams of the plant was determined. The gamma ray spectrometry method was chosen and standardised in our laboratory to detect and measure 231 Pa in parts per billion levels in these samples. A concentrated source of protactinium could not be found among the assessed streams of Jaduguda uranium plant. The Monazite processing plant at IRE, Aluva was then studied. From the known chemistry of protactinium, the possible distribution of the 231 Pa was guessed at. Accordingly, the process streams of IRE process plant were selected to prospect for 231 Pa and determine the fractionation of protactinium. For analysis of 231 Pa, the thorium bearing samples were chemically treated to remove the thorium daughter products, which interfere in gamma spectrometry. This report describes the planning for prospecting, sample selection, the standardisation of the analysis procedure for determination of 231 Pa content, and the analysis results. The 231 Pa content in various streams of Indian Rare Earths plant was found in the range 0.2 -6.5 ppb. Some of the streams did not carry any protactinium. The fractionation of 231 Pa in the various streams of the plant and the selection of source for recovery of protactinium are discussed in detail. (author)
Malagnac, Fabienne; Klapholz, Benjamin; Silar, Philippe
2007-01-01
In various organisms, thioredoxins are known to be involved in the reduction of protein disulfide bonds and in protecting the cell from oxidative stress. Genes encoding thioredoxins were found by searching the complete genome sequence of the filamentous ascomycete Podospora anserina. Among them, PaTrx1, PaTrx2, and PaTrx3 are predicted to be canonical cytosolic proteins without additional domains. Targeted disruption of PaTrx1, PaTrx2, and PaTrx3 shows that PaTrx1 is the major thioredoxin involved in sulfur metabolism. Deletions have no effect on peroxide resistance; however, data show that either PaTrx1 or PaTrx3 is necessary for sexual reproduction and for the development of the crippled growth cell degeneration (CG), processes that also required the PaMpk1 mitogen-activated protein kinase (MAPK) pathway. Since PaTrx1 PaTrx3 mutants show not an enhancement but rather an impairment in CG, it seems unlikely that PaTrx1 and PaTrx3 thioredoxins participate in the inhibition of this MAPK pathway. Altogether, these results underscore a role for thioredoxins in fungal development. PMID:17933907
Influencia del eslogan y el logotipo de la marca país en el posicionamiento de los países
Directory of Open Access Journals (Sweden)
Gina Pipoli de Azambuja
2010-10-01
Full Text Available Para construir la imagen de un país en la mente de los consumidores, los países aplican estrategias demárketing que parten del desarrollo de su marca país, de la misma forma en que las empresas aplican elmárketing a sus productos y servicios. El desarrollo del logotipo y el eslogan que se utilizará en la estrategiade comunicación, constituyen dos elementos fundamentales de su éxito en el proceso de construcción de lamarca país (Keller 2008. Es así que el objetivo de la presente investigación es el de conocer la importanciade la utilización del logotipo y el eslogan en las estrategias de márketing internacional de los países. Paraello, esta investigación analiza el uso de estos dos elementos, logotipo y eslogan, en las estrategias demarca país de aquellos países que han ocupado los primeros lugares en el Country Brand Index (2009 de Future Brand.
Production and identification of an isomeric state in 217Pa and the new isotope 218Pa
International Nuclear Information System (INIS)
Schmidt, K.H.; Faust, W.; Muenzenberg, G.; Ewald, H.; Guettner, K.; Clerc, H.G.; Lang, W.; Wohlfarth, H.; Pielenz, K.
1977-02-01
Evaporation residues produced in the reaction 40Ar(176 MeV) + 181Ta were separated from the primary beam by the velocity filter SHIP and detected by a ΔE-E counter telescope. The technique of delayed coincidences was applied to individually identify the reaction products implanted into a Si-surface barrier detector by their subsequent alpha decays. The previously unknown nucleus 218Pa was identified by its known daughter decays. 218Pa was found to decay with Esub(α) = (9.614 +- 0.015) MeV, T(1/2) = (140 +- 50) μs and probably also with Esub(α) = (9.535 +- 0.020) MeV, T(1/2) = (150 + 100 - 50) μs. The half-life of the 8.33 MeV alpha decay of 217Pa was determined to be (o.2 +- 0.4) ms. Anew isomer in 217 Pa was found which decays with Esub(α) = (10.16 +- 0.02) MeV and T(1/2) = (1.8 +- 0.5) ms. (orig./BJ) [de
Takeuchi, Kana; Nakamura, Kazuyuki; Fujimoto, Masanori; Kaino, Seiji; Kondoh, Satoshi; Okita, Kiwamu
2002-02-01
Alterations of intracellular proteins during the process of heat stress-induced cell death of a human pancreatic cancer cell line, MIA PaCa-2, were investigated using two-dimensional gel electrophoresis (2-DE), agarose gel electrophoresis, and cell biology techniques. Incubation of MIA PaCa-2 at 45 degrees C for 30 min decreased the cell growth rate and cell viability without causing chromosomal DNA fragmentation. Incubation at 51 degrees C for 30 min suppressed cell growth and again led to death without DNA fragmentation. The cell death was associated with the loss of an intracellular protein of M(r) 17,500 and pI 5.2 on 2-DE gel. This protein was determined to be eukaryotic initiation factor SA (eIF-5A) by microsequencing of the N-terminal region of peptide fragments obtained by cyanogen bromide treatment of the protein blotted onto a polyvinylidene difluoride (PVDF) membrane. The sequences detected were QXSALRKNGFVVLKGRP and STSKTGXHGHAKVHLVGID, which were homologous with the sequence of eIF-5A from Gln 20 to Pro 36 and from Ser 43 to Asp 61, respectively. Furthermore, the result of sequencing suggested that the protein was an active form of hypusinated eIF-5A, because Lys 46 could be detected but not Lys 49, which is the site for hypusination. These results suggest that loss of the active form of eIF-5A is an important factor in the irreversible process of heat stress-induced death of MIA PaCa-2 cells.
The disinfecting properties of 405 nm light were investigated against Escherichia coli O157:H7, Salmonella, and their non-pathogenic surrogate bacteria on the surface of almonds. High intensity monochromatic blue light (MBL) was generated from an array of narrow-band 405 nm light-emitting diodes (LE...
Recurrent selection in inbred popcorn families
Directory of Open Access Journals (Sweden)
Daros Máskio
2004-01-01
Full Text Available Although much appreciated in Brazil, commercial popcorn is currently cropped on a fairly small scale. A number of problems need to be solved to increase production, notably the obtaintion of seeds with good agronomic traits and good culinary characteristics. With the objective of developing superior genotypes in popcorn, a second cycle of intrapopulation recurrent selection based on inbred S1 families was carried out. From the first cycle of selection over the UNB-2U population, 222 S1 families were obtained, which were then divided into six sets and evaluated in a randomized complete block design with two replications within the sets. Experiments were carried out in two Brazilian localities. The analysis of variance revealed environmental effects for all evaluated traits, except popping and stand, showing that, for most traits, these environments affected genotype behavior in different ways. In addition, the set as source of variation was significant for most of the evaluated traits, indicating that dividing the families into sets was an efficient strategy. Genotype-by-environment interaction was detected for most traits, except popping expansion and stand. Differences among genotypes were also detected (1% F-test, making viable the proposition of using the genetic variability in the popcorn population as a basis for future recurrent selection cycles. Superior families were selected using the Smith and Hazel classic index, with predicted genetic gains of 17.8% for popping expansion and 26.95% for yield.
7 CFR 765.405 - Payment of costs associated with transfers.
2010-01-01
... transferee, with Agency approval, may pay these costs provided: (a) Any cash equity due the transferor is applied first to payment of costs and the transferor does not receive any cash payment above these costs... 7 Agriculture 7 2010-01-01 2010-01-01 false Payment of costs associated with transfers. 765.405...
48 CFR 16.405-2 - Cost-plus-award-fee contracts.
2010-10-01
... CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 16.405-2 Cost-plus-award-fee... during performance and that is sufficient to provide motivation for excellence in the areas of cost... consisting of (1) a base amount fixed at inception of the contract, if applicable and at the discretion of...
Plant PA signaling via diacylglycerol kinase
Arisz, S.A.; Testerink, C.; Munnik, T.
2009-01-01
Accumulating evidence suggests that phosphatidic acid (PA) plays a pivotal role in the plant's response to environmental signals. Besides phospholipase D (PLD) activity, PA can also be generated by diacylglycerol kinase (DGK). To establish which metabolic route is activated, a differential
Effect of. gamma. -radiation on chiasma frequency in four inbred strains of Trigonella L
Energy Technology Data Exchange (ETDEWEB)
Venkateswara Rao, T; Lakshmi, N
1983-12-01
The effect of ..gamma..-rays on chiasma frequency was studied in M/sub 1/ plants of three inbred strains of T. foenum-graecum and T. corniculata. The response of the varieties to different doses of radiation with respect to chaiasma frequency was found to be different on the basis of students 't' test. In all the treated strains a decrease in chiasma frequency was observed compared to controls and the decrease was found to be inversely proportional to the dose. The possible causes for reduction in chiasma frequency are discussed. 16 refs., 3 tables.
2010-10-01
... presenting the prospect of direct benefit to the individual subjects. 46.405 Section 46.405 Public Welfare... risk but presenting the prospect of direct benefit to the individual subjects. HHS will conduct or fund... procedure that holds out the prospect of direct benefit for the individual subject, or by a monitoring...
2010-07-01
... presenting the prospect of direct benefit to the individual subjects. 97.405 Section 97.405 Education Office... the prospect of direct benefit to the individual subjects. ED conducts or funds research in which the... holds out the prospect of direct benefit for the individual subject, or by a monitoring procedure that...
Ganapathy-Kanniappan, Shanmugasundaram; Geschwind, Jean-Francois H; Kunjithapatham, Rani; Buijs, Manon; Syed, Labiq H; Rao, Pramod P; Ota, Shinichi; Kwak, Byung Kook; Loffroy, Romaric; Vali, Mustafa
2010-03-01
Autophagy, a cellular response to stress, plays a role in resistance to chemotherapy in cancer cells. Resistance renders systemic chemotherapy generally ineffective against human hepatocellular carcinoma (HCC). Recently, we reported that the pyruvate analog 3-bromopyruvate (3-BrPA) promoted tumor cell death by targeting GAPDH. In continuance, we investigated the intracellular response of two human HCC cell lines (Hep3B and SK-Hep1) that differ in their status of key apoptotic regulators, p53 and Fas. 3-BrPA treatment induced endoplasmic reticulum (ER) stress, translation inhibition and apoptosis based on Western blot and qPCR, pulse labeling, Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay and active caspase-3 in both the cell lines. However, electron microscopy revealed that 3-BrPA treated SK-Hep1 cells underwent classical apoptotic cell death while Hep3B cells initially responded with the protective autophagy that failed to prevent eventual apoptosis. 3-BrPA treatment promotes apoptosis in human HCC cell lines, irrespective of the intracellular response.
Eskandari-Sedighi, Ghazaleh; Daude, Nathalie; Gapeshina, Hristina; Sanders, David W; Kamali-Jamil, Razieh; Yang, Jing; Shi, Beipei; Wille, Holger; Ghetti, Bernardino; Diamond, Marc I; Janus, Christopher; Westaway, David
2017-10-04
MAPT mutations cause neurodegenerative diseases such as frontotemporal dementia but, strikingly, patients with the same mutation may have different clinical phenotypes. Given heterogeneities observed in a transgenic (Tg) mouse line expressing low levels of human (2 N, 4R) P301L Tau, we backcrossed founder stocks of mice to C57BL/6Tac, 129/SvEvTac and FVB/NJ inbred backgrounds to discern the role of genetic versus environmental effects on disease-related phenotypes. Three inbred derivatives of a TgTau P301L founder line had similar quality and steady-state quantity of Tau production, accumulation of abnormally phosphorylated 64-68 kDa Tau species from 90 days of age onwards and neuronal loss in aged Tg mice. Variegation was not seen in the pattern of transgene expression and seeding properties in a fluorescence-based cellular assay indicated a single "strain" of misfolded Tau. However, in other regards, the aged Tg mice were heterogeneous; there was incomplete penetrance for Tau deposition despite maintained transgene expression in aged animals and, for animals with Tau deposits, distinctions were noted even within each subline. Three classes of rostral deposition in the cortex, hippocampus and striatum accounted for 75% of pathology-positive mice yet the mean ages of mice scored as class I, II or III were not significantly different and, hence, did not fit with a predictable progression from one class to another defined by chronological age. Two other patterns of Tau deposition designated as classes IV and V, occurred in caudal structures. Other pathology-positive Tg mice of similar age not falling within classes I-V presented with focal accumulations in additional caudal neuroanatomical areas including the locus coeruleus. Electron microscopy revealed that brains of Classes I, II and IV animals all exhibit straight filaments, but with coiled filaments and occasional twisted filaments apparent in Class I. Most strikingly, Class I, II and IV animals presented
Hinnov, L.; Ogg, J. G.
2009-12-01
Mesozoic cyclostratigraphy from around the world is being assessed to construct a continuous Astronomical Time Scale (ATS) based on Earth’s cyclic orbital parameters. The recognition of a prevalent sedimentary cycling with a ~400-kyr period associated with forcing by the stable 405-kyr orbital eccentricity variation is an important development. Numerous formations spanning 10 to 20 myr (and longer) intervals in the Cretaceous, Jurassic and Triassic clearly express this dominant cycle and provide a robust basis for 405-kyr-scale calibration of the ATS. This 405-kyr metronome will enable extension of the well-defined Cenozoic ATS for scaling of the past quarter-billion years of Earth history. This astronomical calibration has a resolution comparable to the 1% to 0.1% precision for radioisotope dating of Mesozoic ash beds, with the added benefit of providing continuous stratigraphic coverage between dated beds. Extended portions of the Mesozoic ATS have already provided new insights into long-standing geologic problems of seafloor spreading, tectonics, eustasy, and paleoclimate change. Ongoing work is focused on closing gaps in coverage and on collecting duplicate cyclostratigraphic records for the entire Mesozoic Era.
PaCYP78A9, a Cytochrome P450, Regulates Fruit Size in Sweet Cherry (Prunus avium L.
Directory of Open Access Journals (Sweden)
Xiliang Qi
2017-12-01
Full Text Available Sweet cherry (Prunus avium L. is an important fruit crop in which fruit size is strongly associated with commercial value; few genes associated with fruit size have, however, been identified in sweet cherry. Members of the CYP78A subfamily, a group of important cytochrome P450s, have been found to be involved in controlling seed size and development in Arabidopsis thaliana, rice, soybean, and tomato. However, the influence of CYP78A members in controlling organ size and the underlying molecular mechanisms in sweet cherry and other fruit trees remains unclear. Here, we characterized a P. avium CYP78A gene PaCYP78A9 that is thought to be involved in the regulation of fruit size and organ development using overexpression and silencing approaches. PaCYP78A9 was significantly expressed in the flowers and fruit of sweet cherry. RNAi silencing of PaCYP78A9 produced small cherry fruits and PaCYP78A9 was found to affect fruit size by mediating mesocarp cell proliferation and expansion during fruit growth and development. Overexpression of PaCYP78A9 in Arabidopsis resulted in increased silique and seed size and PaCYP78A9 was found to be highly expressed in the inflorescences and siliques of transgenic plants. Genes related to cell cycling and proliferation were downregulated in fruit from sweet cherry TRV::PaCYP78A9-silencing lines, suggesting that PaCYP78A9 is likely to be an important upstream regulator of cell cycle processes. Together, our findings indicate that PaCYP78A9 plays an essential role in the regulation of cherry fruit size and provide insights into the molecular basis of the mechanisms regulating traits such as fruit size in P. avium.
Malagnac, Fabienne; Klapholz, Benjamin; Silar, Philippe
2007-01-01
In various organisms, thioredoxins are known to be involved in the reduction of protein disulfide bonds and in protecting the cell from oxidative stress. Genes encoding thioredoxins were found by searching the complete genome sequence of the filamentous ascomycete Podospora anserina. Among them, PaTrx1, PaTrx2, and PaTrx3 are predicted to be canonical cytosolic proteins without additional domains. Targeted disruption of PaTrx1, PaTrx2, and PaTrx3 shows that PaTrx1 is the major thioredoxin inv...
Loss of photoreversibility for UV mutation in E. coli using 405 nm or near-UV challenge
International Nuclear Information System (INIS)
Kristoff, S.; Bockrath, R.
1983-01-01
E. coli mutagenized with germicidal ultraviolet light (UV) were incubated to allow for development of mutation-fixation processes. Fixation was estimated from the effects on mutation frequency of photoreactivation challenge during the first 60 min post-UV. Two different light sources were used for photoreactivation, one providing effective light primarily at 405 nm and another providing a broad range of near-UV around 365 nm. Kinetics for the loss of photoreversibility (LOP) were determined. The times for completion of LOP in wild-type cells indicated one fixation process for back mutation and another for de novo or converted suppressor mutation regardless of the light source. Using 405-nm light for photoreactivation, the LOP kinetics for back mutation and de novo suppressor mutation in uvrA cells were similar. Hence, classical observations were confirmed here. Immediately post-UV all mutation frequencies were more sensitive to near-UV than 405-nm light. (orig./AJ)
AVALIAÇÃO DE LINHAGENS S3 DE MILHO POR MEIO DE TESTADORES ADAPTADOS À SAFRINHA
Directory of Open Access Journals (Sweden)
LUIZ RAFAEL CLOVIS
2015-01-01
Full Text Available Several breeding programs aim to develop superior maize genotypes able to be explored in off-season cropping, mainly due to the increased area under maize produced in alternative season. Few hybrids on the market are adapted to the environmental conditions of autumn-winter. The objective of this study was to identify the inbred lines adapted to off-season condition, by the analysis of combining ability of 50 S3 maize inbred lines, developed by the Maringá State University. These inbred lines were crossed with two adapted hybrids (AG9040 and P30K75, used as testers. The male and female flowering time and also the grain yield (kg ha-1 adjusted for moisture (14,5% and stand (65.000 plants were evaluated in 3 locations of the western region of Paraná. The tester AG9040 presents itself as the best to contribute to high grain yields in their topcrosses. The line 30 had high general combining ability for yield in the three environments. The crossing line AG9040 x 49 obtained significant estimates of specific combining ability (SCA for grain yield in Toledo and Palotina. Also, there is the crossing line AG9040 x 38 to obtain relevant SCA for yield and flowering Tupãssi in male and female. With the tester 30K75 mainly determined by the intersection with the line 27, so it is recommended that this inbred line can be used as tester lines from the commercial hybrid 30K75. With the tester AG9040 mainly determined by the intersection with the line 48, therefore, thes lines can be used as a new tester inbred lines derived from commercial hybrid AG9040.
Jimenez-Pavon, D.; Fernandez-Alvira, J.M.; te Velde, S.J.; Brug, J.; Bere, E.; Jan, N.; Kovacs, E.; Androutsos, O.; Manios, Y.; de Bourdeaudhuij, I.; Moreno, L.A.
2012-01-01
Objective: The present study sought to examine the independent associations of parental education and physical activity (PA) with children's PA across Europe. Methods: A total of 7214 children (10-12. years) were recruited from a school-based cross-sectional survey during 2010 in seven European
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Towards the end, 197 recombinant inbred lines from a cross were grown over two seasons to characterize variability for seven biomass and 23 terpenoid indole alkaloids content-traits and yield-traits. The recombinant inbred lines were genotyped for 178 DNA markers which formed a framework genetic map of eight linkage ...
Evaluation of drought tolerance in different growth stages of maize ...
African Journals Online (AJOL)
In order to find the best drought tolerant inbred lines, experiment was performed at the Agricultural College of Islamic Azad University, Shoushtar Branch, Iran during ... Data analysis revealed that the MP, GMP and STI indices were the more accurate criteria for selection of drought tolerant and high yielding inbred lines.
DEFF Research Database (Denmark)
Jögi, Annika; Rønø, Birgitte; Lund, Ida K
2010-01-01
Proteolytic degradation by plasmin and metalloproteinases is essential for epidermal regeneration in skin wound healing. Plasminogen deficient mice have severely delayed wound closure as have mice simultaneously lacking the two plasminogen activators, urokinase-type plasminogen activator (u......PA) and tissue-type plasminogen activator (tPA). In contrast, individual genetic deficiencies in either uPA or tPA lead to wound healing kinetics with no or only slightly delayed closure of skin wounds....
Carrasco, Javier; Márquez, Cristina; Nadal, Roser; Tobeña, Adolfo; Fernández-Teruel, Albert; Armario, Antonio
2008-05-01
Several studies performed in outbred Roman high- and low-avoidance lines (RHA and RLA, respectively) have demonstrated that the more anxious line (RLA) is characterized by a higher hypothalamic-pituitary-adrenal (HPA) response to certain stressors than the less anxious one (RHA). However, inconsistent results have also been reported. Taking advantage of the generation of an inbred colony of RLA and RHA rats (RHA-I and RLA-I, respectively), we have characterized in the two strains not only resting and stress levels of peripheral HPA hormones but also central components of the HPA axis, including CRF gene expression in extra-hypothalamic areas. Whereas resting levels of ACTH and corticosterone did not differ between the strains, a greater response to a novel environment was found in RLA-I as compared to RHA-I rats. RLA-I rats showed enhanced CRF gene expression in the paraventricular nucleus (PVN) of the hypothalamus, with normal arginin-vasopressin gene expression in both parvocellular and magnocellular regions of the PVN. This enhanced CRF gene expression is not apparently related to altered negative corticosteroid feedback as similar levels of expression of brain glucorticoid and mineralocorticoid receptors were found in the two rat strains. CRF gene expression tended to be higher in the central amygdala and it was significantly higher in the dorsal region of the bed nucleus of stria terminalis (BNST) of RLA-I rats, while no differences appeared in the ventral region of BNST. Considering the involvement of CRF and the BNST in anxiety and stress-related behavioral alterations, the present data suggest that the CRF system may be a critical neurobiological substrate underlying differences between the two rat strains.
Outbred CD1 mice are as suitable as inbred C57BL/6J mice in performing social tasks.
Hsieh, Lawrence S; Wen, John H; Miyares, Laura; Lombroso, Paul J; Bordey, Angélique
2017-01-10
Inbred mouse strains have been used preferentially for behavioral testing over outbred counterparts, even though outbred mice reflect the genetic diversity in the human population better. Here, we compare the sociability of widely available outbred CD1 mice with the commonly used inbred C57BL/6J (C57) mice in the one-chamber social interaction test and the three-chamber sociability test. In the one-chamber task, intra-strain pairs of juvenile, non-littermate, male CD1 or C57 mice display a series of social and aggressive behaviors. While CD1 and C57 pairs spend equal amount of time socializing, CD1 pairs spend significantly more time engaged in aggressive behaviors than C57 mice. In the three-chamber task, sociability of C57 mice was less dependent on acclimation paradigms than CD1 mice. Following acclimation to all three chambers, both groups of age-matched male mice spent more time in the chamber containing a stranger mouse than in the empty chamber, suggesting that CD1 mice are sociable like C57 mice. However, the observed power suggests that it is easier to achieve statistical significance with C57 than CD1 mice. Because the stranger mouse could be considered as a novel object, we assessed for a novelty effect by adding an object. CD1 mice spend more time in the chamber with a stranger mouse than that a novel object, suggesting that their preference is social in nature. Thus, outbred CD1 mice are as appropriate as inbred C57 mice for studying social behavior using either the single or the three-chamber test using a specific acclimation paradigm. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
42 CFR 405.740 - Principles for determining the amount in controversy.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Principles for determining the amount in... Reconsiderations and Appeals Under Medicare Part A § 405.740 Principles for determining the amount in controversy... more appellants, the Secretary may assert that the aggregation principles contained in this subpart may...
7 CFR 3560.405 - Borrower organizational structure or ownership interest changes.
2010-01-01
... Servicing § 3560.405 Borrower organizational structure or ownership interest changes. (a) General. The requirements of this section apply to changes in a borrower entity's organizational structure or to a change in... organizational change. The request must document that the proposed changes will not adversely affect the program...
42 CFR 405.2450 - Clinical psychologist and clinical social worker services.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Clinical psychologist and clinical social worker... § 405.2450 Clinical psychologist and clinical social worker services. (a) For clinical psychologist or clinical social worker professional services to be payable under this subpart, the services must be— (1...
Mills, D R; Goldsmith, M R
2000-04-01
Recent work towards the completion of a saturated molecular genetic linkage map for the lepidopteran silkworm, Bombyx mori (n = 28), has provided evidence for existing polymorphisms in the inbred strain C108. Two inbred parental strains, p50 and C108, were crossed to produce the F1 (P/C) hybrid offspring. The populations used in this project were comprised of a combination of 29 F2 (F1 x F1) and 31 reciprocal backcross (P/C x C/C, P/C x P/P) progeny. All restriction fragment length polymorphisms (RFLPs) for the initial analysis were hybridized with anonymous probes derived from a random early follicular cDNA (Rcf) library from Bombyx. A total of 19 Rcf probes were selected as showing scorable codominant polymorphic patterns when screened against F2 and backcross DNAs digested with the restriction enzymes EcoRI, HindIII, or PstI, and Southern blotted to nylon membranes for hybridization. Of the newly reported Rcf probes, 7 (37%) were characterized as producing 'simple' polymorphic patterns, while 12 (63%) were characterized as producing 'complex' polymorphic patterns. Further characterization of the complex patterns subdivided this group into two general classes: polymorphisms that contained an additional allele, and multiple bands that contained an easily scored two banded polymorphism. Because the extra allele class was limited to the (P/C x C/C) backcross progeny, it is suggested that the inbred parental strain C108 harbors polymorphic loci that are inherited in a simple Mendelian fashion. A genetic analysis discussing plausible origins and maintenance of these polymorphisms is presented.
Hyperthermic Fibrinolysis with rt-PA: In Vitro Results
International Nuclear Information System (INIS)
Schwarzenberg, Helmut; Mueller-Huelsbeck, Stefan; Brossman, Joachim; Christian Glueer, Claus; Bruhn, Hans Dieter; Heller, Martin
1998-01-01
Purpose: To investigate the influence of hyperthermia up to 45 deg. C on fibrinolysis with recombinant tissue-type plasminogen activator (rt-PA). Methods: Standardized fibrin clots were incubated in a water bath for 5 hr with either rt-PA (test group) or 0.9% sodium chloride (control group) and blood plasma at temperatures of 30-45 deg. C. Concentrations of D-dimer and time to complete clot lysis were measured.Results: The activity of fibrinolysis with rt-PA rose with increasing temperature: time to lysis approximately halved from 30 deg. C to 40 deg. C and the concentration of D-dimer tripled. In the control group clot size did not change.Conclusions: Activity of rt-PA-induced fibrinolysis rises distinctly with higher temperatures. Since even healthy subjects show a physiologic decline in body temperature in the extremities, in patients with occlusive arterial disease decreased activity of fibrinolysis with rt-PA can be expected. Controlled hyperthermia may improve fibrinolysis with rt-PA and should be investigated in vivo
Wai, T; Grumet, R
1995-09-01
The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.
42 CFR 405.1063 - Applicability of laws, regulations and CMS Rulings.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Applicability of laws, regulations and CMS Rulings... Medicare Coverage Policies § 405.1063 Applicability of laws, regulations and CMS Rulings. (a) All laws and... the MAC. (b) CMS Rulings are published under the authority of the Administrator, CMS. Consistent with...
Directory of Open Access Journals (Sweden)
Neelam Ara
2013-12-01
Full Text Available The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C and severe (42 °C heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2, superoxide (O2− and malondialdehyde (MDA contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD, ascorbate peroxidase (APX, catalase (CAT and peroxidase (POD were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration.
Ara, Neelam; Nakkanong, Korakot; Lv, Wenhui; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang
2013-01-01
The elucidation of heat tolerance mechanisms is required to combat the challenges of global warming. This study aimed to determine the antioxidant enzyme responses to heat stress, at the enzymatic activity and gene expression levels, and to investigate the antioxidative alterations associated with heat tolerance in the stems and roots of squashes using three genotypes differing in heat tolerance. Plants of heat-tolerant “C. moschata”, thermolabile “C. maxima” and moderately heat-tolerant interspecific inbred line “Maxchata” genotypes were exposed to moderate (37 °C) and severe (42 °C) heat shocks. “C. moschata” exhibited comparatively little oxidative damage, with the lowest hydrogen peroxide (H2O2), superoxide (O2−) and malondialdehyde (MDA) contents in the roots compared to stems, followed by “Maxchata”. The enzyme activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT) and peroxidase (POD) were found to be increased with heat stress in tolerant genotypes. The significant inductions of FeSOD, MnSOD, APX2, CAT1 and CAT3 isoforms in tolerant genotypes suggested their participation in heat tolerance. The differential isoform patterns of SOD, APX and CAT between stems and roots also indicated their tissue specificity. Furthermore, despite the sequence similarity of the studied antioxidant genes among “C. maxima” and “Maxchata”, most of these genes were highly induced under heat stress in “Maxchata”, which contributed to its heat tolerance. This phenomenon also indicated the involvement of other unknown genetic and/or epigenetic factors in controlling the expression of these antioxidant genes in squashes, which demands further exploration. PMID:24336062
On-site comprehensive analysis of explosives using HPLC-UV-PAED
Marple, Ronita L.; LaCourse, William R.
2004-03-01
High-performance liquid chromatography with ultra violet and photo-assisted electrochemical detection (HPLC-UV-PAED) has been developed for the sensitive and selective detection of explosives in ground water and soil extracts. Fractionation and preconcentration of explosives is accomplished with on-line solid phase extraction (SPE), which minimizes sample pretreatment and enables faster and more accurate on-site assessment of a contaminated site. Detection limits are equivalent or superior (i.e., applicable, as it is capable of determining a wider range of organic nitro compounds. Soil samples are extracted using pressurized fluid extraction (PFE), and this technique is automatable, field-compatible, and environmentally friendly, adding to the overall efficiency of the methodology.
Chang, Peter L; Kopania, Emily; Keeble, Sara; Sarver, Brice A J; Larson, Erica; Orth, Annie; Belkhir, Khalid; Boursot, Pierre; Bonhomme, François; Good, Jeffrey M; Dean, Matthew D
2017-10-01
The house mouse is a powerful model to dissect the genetic basis of phenotypic variation, and serves as a model to study human diseases. Despite a wealth of discoveries, most classical laboratory strains have captured only a small fraction of genetic variation known to segregate in their wild progenitors, and existing strains are often related to each other in complex ways. Inbred strains of mice independently derived from natural populations have the potential to increase power in genetic studies with the addition of novel genetic variation. Here, we perform exome-enrichment and high-throughput sequencing (~8× coverage) of 26 wild-derived strains known in the mouse research community as the "Montpellier strains." We identified 1.46 million SNPs in our dataset, approximately 19% of which have not been detected from other inbred strains. This novel genetic variation is expected to contribute to phenotypic variation, as they include 18,496 nonsynonymous variants and 262 early stop codons. Simulations demonstrate that the higher density of genetic variation in the Montpellier strains provides increased power for quantitative genetic studies. Inasmuch as the power to connect genotype to phenotype depends on genetic variation, it is important to incorporate these additional genetic strains into future research programs.
van Boxelaere, Michiel; Clements, Jason; Callaerts, Patrick; D'Hooge, Rudi; Callaerts-Vegh, Zsuzsanna
2017-01-01
Alterations in the social and cognitive domain are considered important indicators for increased disability in many stress-related disorders. Similar impairments have been observed in rodents chronically exposed to stress, mimicking potential endophenotypes of stress-related psychopathologies such as major depression disorder (MDD), anxiety, conduct disorder, and posttraumatic stress disorder (PTSD). Data from numerous studies suggest that deficient plasticity mechanisms in hippocampus (HC) and prefrontal cortex (PFC) might underlie these social and cognitive deficits. Specifically, stress-induced deficiencies in neural plasticity have been associated with a hypodopaminergic state and reduced neural plasticity persistence. Here we assessed the effects of unpredictable chronic mild stress (UCMS) on exploratory, social and cognitive behavior of females of two inbred mouse strains (C57BL/6J and DBA/2J) that differ in their dopaminergic profile. Exposure to chronic stress resulted in impaired circadian rhythmicity, sociability and social cognition in both inbred strains, but differentially affected activity patterns and contextual discrimination performance. These stress-induced behavioral impairments were accompanied by reduced expression levels of brain derived neurotrophic factor (BDNF) in the prefrontal cortex. The strain-specific cognitive impairment was coexistent with enhanced plasma corticosterone levels and reduced expression of genes related to dopamine signaling in hippocampus. These results underline the importance of assessing different strains with multiple test batteries to elucidate the neural and genetic basis of social and cognitive impairments related to chronic stress.
Experimental investigation on tribological behaviours of PA6, PA6 ...
Indian Academy of Sciences (India)
... wear resistance. Further, the thermal stability of Al2O3 and graphite particles was studied ... no significant improvement in wear resistance, the co-efficient of friction and heat generation. Keywords. ... wear tests for aramid, carbon and glass fibre composites run- ...... PA6/30wt% Al2O3 composites were determined from the.
Kandianis, Catherine B.; Michenfelder, Abigail S.; Simmons, Susan J.; Grusak, Michael A.; Stapleton, Ann E.
2013-01-01
The improvement of grain nutrient profiles for essential minerals and vitamins through breeding strategies is a target important for agricultural regions where nutrient poor crops like maize contribute a large proportion of the daily caloric intake. Kernel iron concentration in maize exhibits a broad range. However, the magnitude of genotype by environment (GxE) effects on this trait reduces the efficacy and predictability of selection programs, particularly when challenged with abiotic stress such as water and nitrogen limitations. Selection has also been limited by an inverse correlation between kernel iron concentration and the yield component of kernel size in target environments. Using 25 maize inbred lines for which extensive genome sequence data is publicly available, we evaluated the response of kernel iron density and kernel mass to water and nitrogen limitation in a managed field stress experiment using a factorial design. To further understand GxE interactions we used partition analysis to characterize response of kernel iron and weight to abiotic stressors among all genotypes, and observed two patterns: one characterized by higher kernel iron concentrations in control over stress conditions, and another with higher kernel iron concentration under drought and combined stress conditions. Breeding efforts for this nutritional trait could exploit these complementary responses through combinations of favorable allelic variation from these already well-characterized genetic stocks. PMID:24363659
DEFF Research Database (Denmark)
Kjærup, Rikke Munkholm; Dalgaard, Tina Sørensen; Norup, Liselotte Rothmann
2014-01-01
Chickens from two inbred lines selected for high (L10H) or low (L10L) mannose-binding lectin (MBL) serum concentrations were infected with infectious bronchitis virus (IBV), and innate as well as adaptive immunological parameters were measured throughout the experimental period. Chickens with high...... MBL serum concentrations were found to have less viral load in the trachea than chickens with low MBL serum concentrations indicating that these chickens were less severely affected by the infection. This study is the first to show that MBL expression is present in the lungs of healthy chickens...
The effects of inbreeding and heat stress on male sterility in Drosophila melanogaster
DEFF Research Database (Denmark)
Pedersen, Louise Dybdahl; Pedersen, Asger Roer; Bijlsma, Kuke
2011-01-01
in benign and stressful environments using Drosophila melanogaster as a model organism. Male sterility was compared in 21 inbred lines and five non-inbred control lines at 25.0 and 29.0 °C. The effect of inbreeding on sterility was significant only at 29.0 °C. This stress-induced increase in sterility...
Genetic basis of resistance to trauma in inbred strains of mice
International Nuclear Information System (INIS)
Radojicic, C.; Andric, B.; Simovic, M.; Dujic, A.; Marinkovic, D.
1990-01-01
In this study the resistance to mechanical, thermal, and radiation trauma in four inbred strains of mice (AKR, BALB/c, CBA, and C57Bl/6) was compared with the degree of genetic resemblance, by analyzing the allozyme variabilities of these strains. It was shown that the highest degree of genetic resemblance was among CBA and AKR strains, which correlated with a similar degree of resistance to trauma. On the other hand, BALB/c and C57Bl/6 strains expressed significant differences, both genetically and with respect to the responses to trauma. The hypothesis is introduced that the genetic determination of the resistance to trauma is based on: (a) a polygenic control of general physiological homeostasis, with the possibility that (b) some specific genes or single loci may contribute more than others to such adaptations of the strains tested
Blood brain barrier permeability and tPA-mediated neurotoxicity
Nassar, Taher; Yarovoi, Sergey; Rayan, Anwar; Lamensdorf, Itschak; Karakoveski, Michael; Vadim, Polianski; Fanne, Rami Abu; Jamal, Mahmud; Cines, Douglas B.; Higazi, Abd Al-Roof
2015-01-01
Tissue type plasminogen activator (tPA) induces neuronal apoptosis, disrupt the blood-brain-barrier (BBB), and promotes dilation of the cerebral vasculature. The timing, sequence and contributions of these and other deleterious effects of tPA and their contribution to post-ischemic brain damage after stroke, have not been fully elucidated. To dissociate the effects of tPA on BBB permeability, cerebral vasodilation and protease-dependent pathways, we developed several tPA mutants and PAI-1 derived peptides constructed by computerized homology modeling of tPA. Our data show that intravenous administration of human tPA to rats increases BBB permeability through a non-catalytic process, which is associated with reversible neurotoxicity, brain damage, edema, mortality and contributes significantly to its brief therapeutic window. Furthermore, our data show that inhibiting the effect of tPA on BBB function without affecting its catalytic activity, improves outcome and significantly extends its therapeutic window in mechanical as well as thromboembolic models of stroke. PMID:20060006
42 CFR 405.515 - Reimbursement for clinical laboratory services billed by physicians.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Reimbursement for clinical laboratory services... Criteria for Determining Reasonable Charges § 405.515 Reimbursement for clinical laboratory services billed... limitation on reimbursement for markups on clinical laboratory services billed by physicians. If a physician...
The Mirror: Advice on Presence and Awareness (dran pa dang shes bzhin gyi gdams pa me long ma
Directory of Open Access Journals (Sweden)
Chögyal Namkhai Norbu
2013-09-01
Full Text Available “The Mirror: Advice on the Presence of Awareness” (dran pa dang shes bzhin gyi gdams pa me long ma is a short text that describes the essence of the Dzogchen teaching (rdzogs chen, total perfection. Concerning the way to establish this point of view (lta ba, the main point is to have a direct understanding through the experience of our primordial state of pure presence, beyond any mental or intellectual construction. With regard to meditation (sgom pa, this involves practicing in order to be sure to understand our own true nature, the non-dual condition of the calm state (the essence of the mind and movement (its natural energy. Behavior (spyod pa is the integration of meditation in all our daily activities, continuing in the state of pure presence in every circumstance of life. This is the total realization.
Electrophoretic variation in low molecular weight lens crystallins from inbred strains of rats.
Donner, M E; Skow, L C; Kunz, H W; Gill, T J
1985-10-01
Analysis of rat lens soluble proteins by analytical isoelectric focusing detected two inherited electrophoretic differences in low molecular weight (LM) crystallins from inbred strains of rats (Rattus norvegicus). The polymorphic lens crystallins were shown to be similar to a genetically variant LM crystallin, LEN-1, previously described in mice (Mus musculus) and encoded on chromosome 1, at a locus linked to Pep-3 (dipeptidase). Linkage analysis demonstrated that the rat crystallin locus was loosely linked to Pep-3 at a recombination distance of 38 +/- 4.5 U. These data suggest the conservation of a large chromosomal region during the evolution of Rodentia and support the hypothesis that the gamma-crystallins are evolving more rapidly than alpha- or beta-crystallins.
Evaluation of drought tolerance in different growth stages of maize ...
African Journals Online (AJOL)
Jane
2011-10-12
Oct 12, 2011 ... index; STI: stress tolerance index. condition. MO17 was a tolerant inbred line based on TOL and its low quantity indicates tolerant inbred lines (Table 4). MO17 was low yielding under all conditions. It seems that. TOL had succeeded in selecting genotypes with high yield under stress, but had failed to select ...
Warris, Sven; Timal, N.R.N.; Kempenaar, Marcel; Poortinga, Arne M.; Geest, van de Henri; Varbanescu, Ana L.; Nap, Jan Peter
2018-01-01
Background Our previously published CUDA-only application PaSWAS for Smith-Waterman (SW) sequence alignment of any type of sequence on NVIDIA-based GPUs is platform-specific and therefore adopted less than could be. The OpenCL language is supported more widely and allows use on a variety of hardware
Sample Scripts for Generating PaGE-OM XML [
Lifescience Database Archive (English)
Full Text Available Sample Scripts for Generating PaGE-OM XML This page is offering some sample scripts...on MySQL. Outline chart of procedure 6. Creating RDB tables for Generating PaGE-OM XML These scripts help yo...wnload: create_tables_sql2.zip 7. Generating PaGE-OM XML from phenotype data This sample Perl script helps y
Alves, Ana Cristina de Jesus; Matsukura, Thelma Simões; Scherer, Marcia J
2017-02-01
The purpose of this study is to conduct a cross-cultural adaptation of the Assistive Technology Device Predisposition Assessment (ATD PA) for use in Brazil. The selection of the Assistive Technology Device Predisposition Assessment (ATD PA) was determined by previous literature reviews of articles published in 2014 and 2016 in six databases with the terms "assistive device" or "assistive technology" or "self-help device" combined with "evidence-based practice" or "framework" or "measurement scale" or "model and outcome assessment". This review indicated that the conceptual model of Assistive Technology (AT) most discussed in the literature was the Matching Person and Technology (MPT) model, and this finding determined the selection of ATD PA as an assessment within the MPT portfolio of measures. The procedures for cross-cultural adaptation were as follows: Equivalence of Concept, Semantic and Operational. Five experts were asked to translate 725 items and these translations were evaluated and a high level of agreement was demonstrated. The Portuguese version, Avaliação de Tecnologia Assistiva - Predisposição ao Uso - ATD PA Br, was derived from the original version in English (ATD PA). The ATD PA Br will support professionals and people with disabilities in Brazil to better select AT devices according to the clients' needs. Implications for rehabilitation Provides a systematic way of selecting assistive technology devices for the use of individuals with disabilities according to the Brazilian reality. A systematic way of selecting the assistive technology that can help decrease the abandonment of the assistive technology use. The use of the Matching Person and Technology theorical model and of the assessment ATD PA Br is essential to guide the researches and clinical practice in Brazil.