WorldWideScience

Sample records for in-111 wbc scintigrams

  1. Pediatric uses of In-111 WBC imaging

    Energy Technology Data Exchange (ETDEWEB)

    Samuels, L.D.; Goodgold, H.M.; Hendershott, L.

    1985-05-01

    To evaluate the diagnostic efficacy of In-111 WBC imaging in pediatrics the authors have examined the records of children seen in the laboratory. During the past 4 years they have performed 45 pediatric In-111 WBC studies, half within 1984 alone, in 40 children aged one month to 20 years. In children under one year old they have labelled WBC from 5-10 cc. of the child's blood. They have preferred to transfuse infants after withdrawal of the blood for labelling rather than label donor blood. In twelve children (30%) there was diagnostic localization of labelled WBCs. Five children had equivocal results while three had distinct but false positive localization. The confusing effect of skin lesions of chicken pox and of lymphadenopathy was apparent in six patients. Thirteen children had normal studies. Overall this study of utilization of In-111 WBC in pediatrics suggests best utilization in colitis and abdominal and pelvic infections and in osteomyelitis, especially in distinguishing osteomyelitis from bone infarcts in sickle cell disease. There appears to be lesser utility in patients with palpable adenopathy or superficial infection. Although In-111 WBC imaging may provide clear evidence for active pneumonitis in cases where a chest x-ray is equivocal, such as cytomegalovirus infection, vague localization in bases of lungs, mediastimum or heart is a relatively common finding without known clinical significance.

  2. Pediatric uses of In-111 WBC imaging

    International Nuclear Information System (INIS)

    Samuels, L.D.; Goodgold, H.M.; Hendershott, L.

    1985-01-01

    To evaluate the diagnostic efficacy of In-111 WBC imaging in pediatrics the authors have examined the records of children seen in the laboratory. During the past 4 years they have performed 45 pediatric In-111 WBC studies, half within 1984 alone, in 40 children aged one month to 20 years. In children under one year old they have labelled WBC from 5-10 cc. of the child's blood. They have preferred to transfuse infants after withdrawal of the blood for labelling rather than label donor blood. In twelve children (30%) there was diagnostic localization of labelled WBCs. Five children had equivocal results while three had distinct but false positive localization. The confusing effect of skin lesions of chicken pox and of lymphadenopathy was apparent in six patients. Thirteen children had normal studies. Overall this study of utilization of In-111 WBC in pediatrics suggests best utilization in colitis and abdominal and pelvic infections and in osteomyelitis, especially in distinguishing osteomyelitis from bone infarcts in sickle cell disease. There appears to be lesser utility in patients with palpable adenopathy or superficial infection. Although In-111 WBC imaging may provide clear evidence for active pneumonitis in cases where a chest x-ray is equivocal, such as cytomegalovirus infection, vague localization in bases of lungs, mediastimum or heart is a relatively common finding without known clinical significance

  3. In-111 WBC imaging in musculoskeletal sepsis

    International Nuclear Information System (INIS)

    Thompson, L.; Ouzounian, T.J.; Webber, M.M.; Amstutz, H.C.

    1984-01-01

    This study evaluated the accuracy and utility of the In-111 labeled WBC imaging in a series of patients who were suspected of having musculoskeletal sepsis. The labeling of the WBCs was patterned after a method previously described, in which the WBCs are labeled with In-111 oxine in plasma. The WBCs from 100 ml of blood are separated and incubated with In-111 oxine complex, and then 500 μCi. of the labeled cells were reinjected into the patient. Images of the areas in question were obtained at 24 hrs. In some instances, 48 hour images were also obtained. Images were interpreted using consistent criteria. Forty imaging procedures were done on 39 patients. These included 39 total joint protheses, and 17 other images to evaluate possible osteomyelitis, septic arthritis or deep abscesses. Of these studies, 15 were positive, and 42 negative. The findings were then correlated with operative culture and pathology in 21, aspiration cultures and gram stains in 14, and with clinical findings in the remaining 21. This correlation showed 41 true negatives, 12 true positives, 1 false negative, and 2 false positives. The sensitivity was 92.9% and the specificity was 95.2%l. The false negative occurred in a patient on chronic suppressive antibiotic therapy for an infected total hip replacement. The false positive images occurred in a patient with active rheumatoid arthritis and in a patient imaged one month post operative placement of the prosthesis. These images were very useful in several septic patients who had many possible sites of infection. The authors conclude that In-III imaging is an accurate and useful non-invasive method of evaluating musculoskeletal sepsis

  4. Different cell moieties and white blood cell (WBC) integrity in In-111 labeled WBC preparations

    International Nuclear Information System (INIS)

    Saha, G.B.; Feiglin, D.H.I.; McMahon, J.T.; Go, R.T.; O'Donnell, J.K.; MacIntyre, W.J.

    1985-01-01

    Indium-111 labeled white blood cells (WBC) have become very popular in detecting inflammatory diseases. The purpose of this paper is to determine the distribution of different types of cells in WBC preparation for In-111 oxine labeling, and also to assess the histological integrity of WBC's after labeling with In-111 oxine. Forty to fifty cc of blood was collected from each patient and WBC's were separated by sedimentation and centrifugation. After labeling with In-111 oxine, an aliquot of the WBC sample was used for cell counting and a second aliquot was used for electron microscopic (EM) examination. The different cell moieties were counted, and the mean and standard deviation of twelve determinations calculated. Cells were prepared by the standard technique for electron microscopic examination and images of the cells were obtained at different magnifications (X8,000-25,000). The EM images revealed that although minimal cytoplasmic vacuolization occurred in the WBC's due to the labeling process, the overall histological integrity of the cells remained intact. The relative labeling efficiency of WBC's is greater than those of RBC's and platelets (J Nuc) Med 25:p98, 1984) and, therefore, even a comparatively low population of WBC's gives optimal imaging due to their increased tracer uptake

  5. Distinction of infected and non-infected post-surgical incisions with In-111-WBC scintigraphy

    International Nuclear Information System (INIS)

    Abdel-Nabi, H.; Hinkle, G.H.; Olsen, J.O.

    1985-01-01

    To determine if In-111-WBCs scintigraphy can distinguish between healing and infection in post-surgical wounds, a prospective study was performed in patients with 3-14 day old surgical incisions. Eighteen patients (11 males and 7 females) were scanned 24 hrs after injection of 0.5 mCi of In-111 labeled autologous leukocytes. The scan findings were correlated with blood and/wound cultures results and diagnosis at time of discharge. Incisional uptake of In-111-WBCs was noted in 9 patients with infected surgical wounds and was absent in those 9 patients with non-infected surgical wounds. The results of the authors' study show that In-111-WBCs do not accumulate in non-infected surgical incisions. This confirms their previous findings in rats. The high specificity of In-111 leukocytes imaging makes it a valuable study in the evaluation of post-operative patients with suspected surgical wound infections. In-111 WBCs scintigraphy can distinguish between normal healing and infection at the site of recent (3-14 days) surgical incisions

  6. Symbolic reasoning about myocardial scintigrams in PROLOG

    Energy Technology Data Exchange (ETDEWEB)

    Rosenberg, S.; Itti, R.; Benjelloun, L.

    1986-06-01

    PROLOG (PROgramming in LOGic) is the declarative programming language at the heart of the Japanese fifth-generation computer project. It is proposed that PROLOG is a suitable tool for symbolic image processing, once standard preprocessing has been done. In the present application, the problem of prediction of coronary anatomy from myocardial scintigrams is addressed. Uncertainty is dealt with by a combination of fuzzy-set theoretic and probabilistic reasoning. Heuristic classification rules are based on clinical experience and on a set of 247 myocardial scintigrams with their corresponding coronary angiograms.

  7. Classification of bone scintigrams in hemodialysis patients

    International Nuclear Information System (INIS)

    Ishibashi, Kazunari; Miyamae, Tatsuya

    1985-01-01

    Bone scintigrams from a total of 75 hemodialysis patients using sup(99m)Tc-methylene-diphosphonate (MDP) were classified into two groups; Group I (56 patients) in which the uptake of the radioactivity appeared to be relatively high in the soft tissue and low in the bone, and Group II (19 patients) in which high uptake in the bone and low uptake in the soft tissue were observed. Patients in Group I were further classified into two subgroups; Group I sub(A) (articular type, 21 patients) which was characterized by relatively high uptake into the joint, and Group I sub(B) (reduction type, 35 patients) where uptake was faint in the whole region of the bone. The classification of patients in Group II was also performed; Group II sub(A) (spinal type, 14 patients) where high spinal uptake was observed, and Group II sub(B) (cranio-facial type, 5 patients) where high uptake into the cranio-facial region was observed. The results were compared with 146 subjects with normal bone scintigram in terms of the ratio of bone to soft tissue uptake (B/S ratio) for the cranial bone, jaw bone, lumbar vertebra and femoral bone, and the ratio of epiphysis to diaphysis uptake (E/D ratio) for the femoral bone. The B/S ratio was low in Group I and high in Group II for the bone studied, and the E/D ratio was markedly high in Group I sub(A). Histobiochemical examination indicated that patients in Group I sub(A) and Group II may have osteomalacia and secondary hyperparathyroidism, respectively. It was considered that the visual classification and semiquantitative study as described here were useful for evaluating the pathological condition of renal osteodystrophy. (author)

  8. The pyrophosphate heart scintigram in children with progressive muscular dystrophy

    International Nuclear Information System (INIS)

    Duska, F.; Nesvadba, Z.; Zdansky, P.; Novak, J.; Kubicek, J.; Kafka, P.; Vizda, J.; Mazurova, Y.; Karlova Univ., Hradec Kralove; Karlova Univ., Hradec Kralove

    1984-01-01

    A pyrophosphate heart scintigram was obtained in 16 boys with progressive muscular dystrophy Duchenne. All of them showed pathological ECG findings and high plasma levels of CK, AST, ALT and LD. In 4 patients the scintigram was distinctly positive and in further 3 it reached borderline values. The remaining 9 boys had normal scintigraphic findings. Those with a positive heart scintigram had very high plasma levels of the enzymes under study which was suggestive of current progression of the disease. There was, however, no relation between heart scintigraphy and the affliction of the skeletal muscles expressed by means of an index. (orig.) [de

  9. Evaluation of pancreatic scintigram in the diagnosis of pancreatic diseases

    International Nuclear Information System (INIS)

    Takai, Yukihiro; Ueda, Noriyuki; Takasago, Noritsugu; Minemoto, Hiromasa; Namiki, Masayoshi

    1981-01-01

    The classification of accumulative patterns with the pancreatic scintigram findings of chronic pancreatitis and carcinoma of the pancreas were compared with endoscopic retrograde pancreatography (ERP) findings and Pancreozymin-Secretin test (P-S test). I) The frequency of pancreatic cancer was 93%, whilst, the chronic pancreatitis was 88% in the abnormal pancreatic scintigram. II) In the scintigram the type II (localyzed defect shadows) of pancreatic cancer was comparatively high and it is proportional to evidence. derived from ERP. Localized diagnostic certainty is helpful, although the two tests are related. The P-S test is only restricted to the carcinoma of head, whilst, scintigram is more useful to detect the carcinoma of the body and tail of the pancreas. III) As for the chronic pancreatitis, there are various accumulative patterns. This is resemblance to that of ERP findings, but in the P-S normal test, it showed discrepancy in part of the result. Particularly, in the type I (slightly generalized low uptake with density silhouette) and type II. Therefore in order to obtain an accurate diagnosis, it is essential to have both the P-S test and scintigram. (author)

  10. Prototype production of the scintigram viewer (SVO-1)

    International Nuclear Information System (INIS)

    Oyamada, Hiyoshimaru

    1975-01-01

    ''Scintigram Viewer'', SVO-1, is designed for reading the scintigram films by enhancing contrast of the pictures. This is composed of a light source, AKAI CVC-150 TV camera (with a zoom lens, Fujinon TV.Z, f:2), AKAI VCS-150 camera control unit and color TV(Sony, Trinitron CVM-1840). The light source is set in a box which has a side-window where the scintigram film is set. The light coming through the film is caught by TV camera where red and blue light are separated, leaving green light not affected. These lights are then sent to AKAI VCS-150 where the gains for red and blue can be adjusted to desirable color as the operator likes for display. After these manual processings, the scintigram film is shown on the color TV. The contrast enhancement can be done by adjusting either picture control on the TV panel or diaphragm of TV camera/or both, and the defocusing can be easily done by changing the focus of the lens. Because the TV camera has a zoom lens as mentioned above, either whole picture or enlarged picture of one area on the film can be displayed. Initially, the author designed this machine to find out cold areas which were easily overlooked by the ordinary manner on the original films. However, after examining many scintigram films by this technique it was found that the search for the hot areas was more suitable with this machine and the whole body bone scintigram was the best so far. For example, the metastatic bone lesion which is not definite on the original sicntigram by nacked eyes can be easily pointed out on the color TV after the abovementioned processings. Now, this machine is working very well and is an important accessory for our daily work. (auth.)

  11. Evaluation of latent cardiac disease in diabetic patients with Tl-201 exercise myocardial scintigram and blood pool scintigram

    International Nuclear Information System (INIS)

    Miyashita, Takeo; Kasai, Ryutaro; Ikebe, Nobuhiko; Nagai, Yoshikazu; Yamasawa, Ikuhiro; Ibukiyama, Chiharu; Notoya, Yoko

    1990-01-01

    To find latent heart disease in diabetic patients, 142 diabetic patients were divided into 4 groups: (1) no hypertension and normal ECG (DM group); (2) hypertension recognized clinically (HT group); (3) myocardial damage on ECG (MD group); (4) group associated with the previous 2 (HT+MD group). In all groups Tl-201 exercise myocardial scintigrams and blood pool scintigrams were taken for comparative analysis. Positive rates of SPECT were 27.7% (23/83) in the DM group, 30.0% (9/30) in the HT group, 50.0% (6/12) in the MD group, and 70.6% (12/17) in the HT+MD group. The rate in the HT+MD group was significantly higher than in that of the DM and HT groups (p<0.001, p<0.01). Blood pool scintigrams revealed that in the HT+MD group, as compared with the normal control group, both 1/3 FF and PFR were significantly depressed, in addition to significant TPF prolongation in the former (p<0.001, p<0.05, p<0.05). These findings suggest that in diabetic patients hypertension and myocardial damage would lead to a high incidence of abnormality in SPECT and left ventricular rapid filling dysfunction. This indicate a high incidence of latent cardiac disease which can be recognized in diabetic patients by stress myocardial and blood pool scintigrams. (author)

  12. Analysis of scintigrams by singular value decomposition (SVD) technique

    Energy Technology Data Exchange (ETDEWEB)

    Savolainen, S.E.; Liewendahl, B.K. (Helsinki Univ. (Finland). Dept. of Physics)

    1994-05-01

    The singular value decomposition (SVD) method is presented as a potential tool for analyzing gamma camera images. Mathematically image analysis is a study of matrixes as the standard scintigram is a digitized matrix presentation of the recorded photon fluence from radioactivity of the object. Each matrix element (pixel) consists of a number, which equals the detected counts of the object position. The analysis of images can be reduced to the analysis of the singular values of the matrix decomposition. In the present study the clinical usefulness of SVD was tested by analyzing two different kinds of scintigrams: brain images by single photon emission tomography (SPET), and liver and spleen planar images. It is concluded that SVD can be applied to the analysis of gamma camera images, and that it provides an objective method for interpretation of clinically relevant information contained in the images. In image filtering, SVD provides results comparable to conventional filtering. In addition, the study of singular values can be used for semiquantitation of radionuclide images as exemplified by brain SPET studies and liver-spleen planar studies. (author).

  13. Two-stage nonlinear filter for processing of scintigrams

    International Nuclear Information System (INIS)

    Pistor, P.; Hoener, J.; Walch, G.

    1973-01-01

    Linear filters which have been successfully used to process scintigrams can be modified in a meaningful manner by a preceding non-linear point operator, the Anscombe-transform. The advantages are: The scintigraphic noise becomes quasi-stationary and thus independent of the image. By these means the noise can be readily allowed for in the design of the convolutional operators. Transformed images with a stationary signal-to-noise ratio and a non-constant background t correspond to untransformed images with a signal-to-noise ratio that varies in certain limits. The filter chain automatically adapts to these changes. Our filter has the advantage over the majority of space-varying filters of being realizable by Fast Fourier Transform techniques. These advantages have to be paid for by reduced signal amplitude to background ratios. If the background is known, this shortcoming can be easily by-passed by processing trendfree scintigrams. If not, the filter chain should be completed by a third operator which reverses the Anscombe-transform. The Anscombe-transform influences the signal-to-noise ratio of cold spots and of hot spots in a different way. It remains an open question if this fact can be utilized to directly influence the detectability of the different kinds of spots

  14. Technetium stannous pyrophosphate myocardial scintigrams in patients with chest pain of varying etiology

    International Nuclear Information System (INIS)

    Willerson, J.T.; Parkey, R.W.; Bonte, F.J.; Meyer, S.L.; Atkins, J.M.; Stokely, E.M.

    1975-01-01

    Technetium-99m stannous pyrophosphate was utilized for myocardial imaging in 202 patients admitted to the hospital with chest pain of uncertain etiology. One hundred and one patients had clinical and evolved electrocardiographic and enzymatic evidence of acute myocardial infarction. Ninety-six of these 101 patients had increased myocardial uptake of the technetium stannous pyrophosphate and positive myocardial scintigrams; there was nearly precise correlation between the ECG and myocardial imaging localization of the area of infarction for acute transmural myocardial infarctions. In the five patients with negative myocardial images the scintigrams were obtained after seven or more days had elapsed following the myocardial infarction. In the remaining 101 patients no clinical, ECG, or enzymatic evidence of infarction developed; 92 of these patients had negative myocardial scintigrams. Seven of the remaining nine patients were admitted with ''unstable angina pectoris'' and despite the absence of diagnostic ECG and enzyme evolution each of these patients had faintly and diffusely positive myocardial scintigrams. The remaining two patients had positive myocardial scintigrams but no definite ECG or enzymatic evidence of acute myocardial infarction. Thus the technetium pyrophosphate imaging technique appears safe, inexpensive and to correlate well with ECG and enzyme identification of the presence of infarction and with ECG localization of myocardial infarction. In addition the positive myocardial scintigrams in some patients with unstable angina suggest that there may be limited myocardial necrosis that is ordinarily undetected by ECG and enzymes in these patients. The incidence of false positive and false negative scintigrams appears to be small

  15. Acquisition, processing and display of gated cardiac scintigrams

    International Nuclear Information System (INIS)

    Alpert, N.M.; Chesler, D.A.; McKusick, K.A.; Potsaid, M.S.; Pohost, G.M.; Dinsmore, R.A.

    1974-01-01

    An improved method for non-traumatic and essentially noninvasive evaluation of left ventricular (LV) function with /sup 99m/Tc as the tracer was developed. This method combines previously used EKG gating techniques for cardiac blood pool visualization with new computerized acquisition, processing and display techniques. An Anger camera, a small computer, and a physiological synchronizer are used to acquire a sequence of eight scintigrams which span the entire cardiac cycle. Under our present protocol two twenty-minute sequences are obtained, one an LAO (50 0 ) projection, the other an RAO (30 0 ) projection. Subsequently these images are processed on-line with a digital filter to increase definition of the cardiac borders. The eight images are then displayed sequentially on a specially designed electronic monitor to give an impression of the beating heart somewhat analogous to that obtained with invasive contrast angiography

  16. Gastroesophageal reflux after esophageal surgery. Evaluation by means of esophageal transit scintigram

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, Osamu; Yokoi, Hideki; Maebeya, Shinji and others

    1989-04-01

    By means of esophageal transit scintigram using /sup 99m/Tc-DTPA, 15 patients (13 esophageal carcinomas and 2 cardia carcinomas) were studied, in whom esophagogastric anastomosis was done according to the posterior invagination anastomosis technique we had devised. In all 8 patients with anastomosis at cervical region, gastroesophageal reflux was not seen on both scintigrams before and after meals, and the average pressure gradient of high pressure zone at anastomosis was 39.8 cmH/sub 2/O. In 2 of 7 patients with intrathoracic anastomosis, the scintigram before meals showed severe reflux. and the endoscopic findings showed diffuse and moderate erosion in the esophageal mucosa. The average pressure gradient across the anastomosis was 6.5 cmH/sub 2/O. In these 2 patients, the new fornix with a sharp angle of His was not formed. In the remaining 5 patients with intrathoracic anastomosis, reflux was not seen on the scintigram before meals. However, in 2 of them, the scintigram after meal and endoscopic examination revealed mild reflux and mild esophagitis respectively. Furthermore in one patient very mild reflux was observed only on the scintigram after meals but the endoscopic findings showed the normal esophageal mucosa. In these 5 patients, the average pressure gradient across the anastomosis was 17.0 cmH/sub 2/O, which was significantly higher (p<0.01) than that in 2 patients with severe reflux and was significantly lower (p<0.01) than the mean value of high pressure zone in 8 patients with cervical anastomosis. In conclusion, it is presumed that the formation of a large fornix enough to store food and a sharp angle of His are important factors in maintaining an anti-reflux mechanism. The esophageal transit scintigram was proved to be an excellent technique in detecting and evaluating quantitatively gastroesophageal reflux. (author).

  17. Imaging technique of whole-body scintigram in the event of breakdown of the photomultiplier tube

    International Nuclear Information System (INIS)

    Inagaki, Syoichi; Tonami, Syuichi; Yasui, Masakazu; Sugishita, Kouki; Nakamura, Mamoru; Kuranishi, Makoto

    1997-01-01

    When the PMT and preamplifier are out of order, it is impossible to make a correct diagnosis because of defects on the scintigram. However, repair of the equipment may take a long time. In order to perform emergent whole-body scintigrams in the event of such breakdowns, we have developed a new approach named the lead-shield method. The major principles of this method involve placing a lead shield on the gamma camera such that it corresponds to the area of the abnormal PMT and making use of the normal area of the detector. The lead shield, 2 mm thick and 1.5 times as wide as the defect on a planar image, was situated perpendicular to the scan plane of the whole-body scintigram. The results showed that whole-body scintigrams obtained by the lead-shield method had the same quality as those obtained by the conventional method, and the spatial resolution and uniformity showed nearly no change despite some disadvantages such as lower sensitivity and shorter scan length. The lead-shield method can be a useful tool for the performance of whole-body scintigrams in cases of emergency when the PMT and preamplifier are out of order. (author)

  18. Imaging technique of whole-body scintigram in the event of breakdown of the photomultiplier tube

    Energy Technology Data Exchange (ETDEWEB)

    Inagaki, Syoichi; Tonami, Syuichi; Yasui, Masakazu; Sugishita, Kouki; Nakamura, Mamoru; Kuranishi, Makoto [Toyama Medical and Pharmaceutical Univ. (Japan). Hospital

    1997-10-01

    When the PMT and preamplifier are out of order, it is impossible to make a correct diagnosis because of defects on the scintigram. However, repair of the equipment may take a long time. In order to perform emergent whole-body scintigrams in the event of such breakdowns, we have developed a new approach named the lead-shield method. The major principles of this method involve placing a lead shield on the gamma camera such that it corresponds to the area of the abnormal PMT and making use of the normal area of the detector. The lead shield, 2 mm thick and 1.5 times as wide as the defect on a planar image, was situated perpendicular to the scan plane of the whole-body scintigram. The results showed that whole-body scintigrams obtained by the lead-shield method had the same quality as those obtained by the conventional method, and the spatial resolution and uniformity showed nearly no change despite some disadvantages such as lower sensitivity and shorter scan length. The lead-shield method can be a useful tool for the performance of whole-body scintigrams in cases of emergency when the PMT and preamplifier are out of order. (author)

  19. Value of the 201-Thallium scintigram in the diagnosis of coronary artery disease in patients with and without myocardial infraction

    International Nuclear Information System (INIS)

    Silber, S.; Klein, U.; Rudolph, W.

    1980-01-01

    The usefulness and limitations of the 201-thallium scintigram in the detection of myocardial hypoperfusions is dependent on the sensitivity, specificity and predictive value of the method. The presence of myocardial hypoperfusion can be diagnosed with certainly from a pathologic scintigram only in the absence of false positive scintigrams. Such a high specificity can be achieved only by desginating markedly positive scintigrams as pathologic findings. This, however, necessarily incurs a reduction in sensitivity. In coronary artery disease with previous myocardial infarction, the sensitivity is primarily dependent on the extent of infarction. In coronary arterx desease with no previous myocardial infarction, the sensitivity of the thallium scintigram in patients with 2-vessel disease was found to be less than that of those with 1-vessel disease and 3-vessel disease. As compared with the exercise ECG, the scintigram was more sensitive only in patients with 1-vessel but less sensitive in those patients with 2-vessel and 3-vessel disease. The thallium scintigram is indicated for patients with atypical chest pain, when angina pectoris cannot be ruled out and when the exercise ECG is borderline or non-interpretable. The thallium scintigram is also indicated for asymptomatic patients with a markedly positive exercise ECG. The thallium scintigram yields no additional information relative to the question of presence or absence of myocardial hypoperfusion in patients with typical angina pectoris. In patients with a history of, but with no electrocardiographic criteria for myocardial infarction, the scintigram seems to be of only limited valued. The thallium scintigram is a valuable adjunct in the assessment of the results of coronary artery bypass surgery provided that a pre-operative study is available for comparison. (orig./MG) [de

  20. Effect of different doses of aerobic exercise on total white blood cell (WBC and WBC subfraction number in postmenopausal women: results from DREW.

    Directory of Open Access Journals (Sweden)

    Neil M Johannsen

    Full Text Available BACKGROUND: Elevated total white blood cell (WBC count is associated with an increased risk of coronary heart disease and death. Aerobic exercise is associated with lower total WBC, neutrophil, and monocyte counts. However, no studies have evaluated the effect of the amount of aerobic exercise (dose on total WBC and WBC subfraction counts. PURPOSE: To examine the effects of 3 different doses of aerobic exercise on changes in total WBC and WBC subfraction counts and independent effects of changes in fitness, adiposity, markers of inflammation (IL-6, TNF-α, C-reactive protein, fasting glucose metabolism, and adiponectin. METHODS: Data from 390 sedentary, overweight/obese postmenopausal women from the DREW study were used in these analyses. Women were randomized to a non-exercise control group or one of 3 exercise groups: energy expenditure of 4, 8, or 12 kcal kg(-1⋅week(-1 (KKW for 6 months at an intensity of 50% VO2peak. RESULTS: A dose-dependent decrease in total WBC counts (trend P = 0.002 was observed with a significant decrease in the 12KKW group (-163.1±140.0 cells/µL; mean±95%CI compared with the control (138.6±144.7 cells/µL. A similar response was seen in the neutrophil subfraction (trend P = 0.001 with a significant decrease in the 12KKW group (-152.6±115.1 cells/µL compared with both the control and 4KKW groups (96.4±119.0 and 21.9±95.3 cells/µL, respectively and in the 8KKW group (-102.4±125.0 cells/µL compared with the control. When divided into high/low baseline WBC categories (median split, a dose-dependent decrease in both total WBCs (P = 0.003 and neutrophils (P<0.001 was observed in women with high baseline WBC counts. The effects of exercise dose on total WBC and neutrophil counts persisted after accounting for significant independent effects of change in waist circumference and IL-6. CONCLUSION: Aerobic exercise training reduces total WBC and neutrophil counts, in a dose-dependent manner, in

  1. Whole body bone scintigram with sup(99m)Tc-phosphate compounds

    International Nuclear Information System (INIS)

    Oyamada, Hiyoshimaru; Orii, Hirotake; Tabei, Toshio; Ishibashi, Hiroyoshi.

    1975-01-01

    Among the compounds of four different types, which are sup(99m)Tc-polyphosphate suppled by A Company, sup(99m)Tc-pyrophosphate by B Company, and sup(99m)Tc-pyrophosphate of electrolysis method and sup(99m)Tc-diphosphonate by C Company, sup(99m)Tc-diphosphonate showed the most favorable result with a constantly good scintigram quality. The remaining three compounds were found also favorable for clinical application. Besides these are undesirable accumulations, rather low energy of sup(99m)Tc-causes different pictures upon the anterior and the posterior views, and previously irradiated area shows a decreased uptake of these compounds. The usefulness of whole body scintigrams in the detection of metastatic bone tumors was also discussed. There was a definite superiority with this technique over the conventional X-ray study. Especially, in thoracic vertebrae, pelvic bone, and ribs, far many diseased areas were detected on the scintigrams than the areas which the physicians noticed or suspected the metastases. As a conclusion, although there are some problems on the scintigrams, it can be said that sup(99m)Tc-phosphate compounds are very useful in detection of metastatic bone tumors, especially with the help of whole body scanner. (JPN)

  2. Bico 2: second national intercomparison campaign of WBC centres working in Italy; Bico 2: la seconda campagna MIDIA di interconfronto dei WBC operanti in Italia

    Energy Technology Data Exchange (ETDEWEB)

    Castellani, C.M.; Battisti, P.; Tarroni, G. [ENEA, Centro Ricerche `Ezio Clementel`, Bologna (Italy). Dip. Ambiente

    1998-12-31

    During the period November 1994 - May 1995 the coordinating group of WBC centres working in Italy organised the 2. national intercalibration and intercomparison campaign. A BOMAB phantom was used filled with four radionuclides gel solution with gamma energy emissions ranging between 100 keV and 2 MeV. 17 out of 21 Italian WBC centres took part in the campaign. Through the intercalibration, organised according to internationally accepted methodologies, each WBC centre could check its own calibration procedures. many intermediate data, collected for the methodologies and measurement procedures intercomparison, permitted analyses and comparison of uncertainly causes in a WBC measurement of the internal contamination. A proposal of MDA definition and assessment procedure resulted from the intercomparison campaign. [Italiano] Il Coordinamento dei Centri WBC operanti in Italia ha organizzato la seconda campagna di intercalibrazione ed interconfronto nazionale basata sulle misure di un fantoccio BOMAB riempito con una soluzione radioattiva gelificata contenente 4 radionuclidi con emissioni gamma nell`intervallo energetico compreso fra 100 keV e 2 MeV. Alla campagna, che si e` svolta fra novembre 1994 e maggio 1995, hanno partecipato 17 dei 21 Centri WBC censiti in Italia. L`intercalibrazione e` stata organizzata secondo criteri ormai consolidati in campo internazionale ed ha permesso ad ognuno dei partecipanti di verificare le proprie procedure di calibrazione. Per l`interconfronto delle procedure e dei metodi di misura impiegati e` stata raccolta una serie di dati intermedi che hanno consentito di analizzare e confrontare le fonti di incertezza insite nella misura di contaminazione interna nell`uomo tramite WBC. Cio` ha infine reso possibile una proposta di definizione e di procedura di determinazione del valore della minima attivita` rivelabile (MDA) in accordo con le piu` recenti tendenze in campo internazionale.

  3. Noninvasive detection of coronary thrombi with In-111 platelets: concise communication

    International Nuclear Information System (INIS)

    Bergmann, S.R.; Lerch, R.A.; Mathias, C.J.; Sobel, B.E.; Welch, M.J.

    1983-01-01

    The need for rapid, definitive identification of coronary thrombosis has been intensified by the advent of thrombolytic therapy and by interest in the role of thrombosis in the etiology of coronary artery disease. To determine whether platelet thrombi can be detected noninvasively with In-111 platelets, a method was developed in which Tc-99m-tagged red blood cells were used to correct for activity within the blood attributable to platelets circulating but not associated with thrombus. In 18 dogs coronary thrombi were induced closed-chest with a copper coil introduced into the coronary artery. Indium-111 platelets and Tc-99m RBCs were administered either before or 1 hr after induction of thrombus, and serial scintigrams obtained. Coronary thrombus was identified readily in the processed scintigrams. In six dogs, thrombolysis was achieved with intracoronary streptokinase. In each case serial scintigraphy demonstrated resolution of the clot. The dual radiotracer technique should permit serial noninvasive delineation of the temporal relationship between platelet deposition and coronary heart disease in patients, and should facilitate the evaluation of interventions designed to prevent platelet aggregation or to lyse existing thrombi

  4. 99Tcm stannous WBC study in childhood inflammatory bowel disease- what benefit?

    International Nuclear Information System (INIS)

    Howman-Giles, R.; Porn, U.; Peacock, K.; O'Loughlin, E.; Uren, R.

    2000-01-01

    Full text: Inflammatory bowel disease (IBD) is increasingly recognised in the paediatric population. Management requires early diagnosis with determination of disease localisation and intensity. The 99 Tc m labelled white blood cell (WBC) study has been used for IBD in adults but little data is available in children. The most common agent used is 99 Tc m HMPAO however, this is time consuming and expensive. The use of 99 Tc m sulphur colloid labelled WBC is an easy, reliable technique. 70 patients aged 2-19 years (mean 12.7) were studied. Planar and SPECT imaging was performed at one and three hours. 38 patients with proven IBD had positive WBC. Of 32 with negative WBC, five had IBD, however, three were on treatment with steroids. 18 patients had barium radiography (BR): nine (50%) were positive for IBD whereas 18 (100%) were positive on WBC. Comparison with endoscopy showed good correlation of areas involved in 45%, 18% had different areas and 36% had more areas defined on endoscopy. In the latter group 14% had positive endoscopy in the stomach and duodenum, which are area not visualised on WBC studies. The WBC has a sensitivity of 95%, specificity of 100% and accuracy of 93%. For BR the sensitivity was 53%, specificity 100% and accuracy 63%. Conclusion: WBC is a good screening investigation for IBD prior to having other invasive investigations. This study would suggest that the barium radiographic study does not offer additional benefits over the WBC and endoscopy in determining the initial diagnosis and extent of the disease. Copyright (2000) The Australian and New Zealand Society of Nuclear Medicine Inc

  5. Bico 2: second national intercomparison campaign of WBC centres working in Italy

    International Nuclear Information System (INIS)

    Castellani, C.M.; Battisti, P.; Tarroni, G.

    1998-01-01

    During the period November 1994 - May 1995 the coordinating group of WBC centres working in Italy organised the 2. national intercalibration and intercomparison campaign. A BOMAB phantom was used filled with four radionuclides gel solution with gamma energy emissions ranging between 100 keV and 2 MeV. 17 out of 21 Italian WBC centres took part in the campaign. Through the intercalibration, organised according to internationally accepted methodologies, each WBC centre could check its own calibration procedures. many intermediate data, collected for the methodologies and measurement procedures intercomparison, permitted analyses and comparison of uncertainly causes in a WBC measurement of the internal contamination. A proposal of MDA definition and assessment procedure resulted from the intercomparison campaign [it

  6. Value of counting white blood cells (WBC) in semen samples to predict the presence of bacteria.

    Science.gov (United States)

    Lackner, Jakob; Schatzl, Georg; Horvath, Sabine; Kratzik, Christian; Marberger, Michael

    2006-01-01

    To investigate the correlation between the presence of white blood cells (WBC) without the use of specific stain to differentiate leukocytes and the presence of bacteria in semen samples of infertile men. A total of 143 semen samples of men who attended an andrologic clinic for the evaluation of fertility were investigated using routine semen analysis (according to WHO laboratory guidelines) and bacterial culture. WBC were found in 43.4% (62/143). There were no WBC in 56.6% (81/143) of the samples (group I) while WBC were found in 43.4% (62/143) of the samples (group II). Pathogenic bacteria were detected in 48.2% (39/81) in group I and in 54.9% (34/62) in group II, all in all Bacteriospermia was present in 51.1% (73/143). The most common bacteria were Ureaplasma urealyticum, Enterococcus faecalis and Escherichia coli (23.8%, 16.8%, and 7.0% of samples, respectively). The sensitivity/specificity for detecting bacteria was 0.47/0.60 at a cut-off level of 0.25 Mio/mL WBC and 0.16/0.84 at a cut-off level of WBC 1 Mio/mL, representing likelihood ratios of 1.16 and 1.04, respectively. The greatest ratio between sensitivity and specificity (0.37/0.72) was found at a cut-off level of 0.5 Mio/mL WBC, with a likelihood ratio of 1.29. Counting WBC instead of a specific stain for the detection of leukocytes has only a poor sensitivity/specificity for the detection of bacteria.

  7. Effect of latrogenic trauma on the bone scintigram: an animal study. Concise communication

    International Nuclear Information System (INIS)

    Alazraki, N.; Moitoza, J.; Heaphy, J.; Taylor, A. Jr.

    1984-01-01

    An animal study was performed to assess the effect on the Tc-99m phosphate bone scintigram of injury by needle aspiration or drill hole to metaphyseal and diaphyseal areas in immature and mature bones. Results showed that in 12 immature rabbits such trauma to metaphyseal regions had no effect on the bone image. Similar metaphyseal trauma in two mature dogs showed definite abnormalities on the bone image, but in one mature rabbit, no abnormality could be identified by scintigram. Diaphyseal trauma always gave a definitely abnormal bone image. Extrapolation of these results to humans should be cautious, but it suggests that needling or drilling in metaphyseal regions in neonates or young children probably does not affect later bone images

  8. Automated interpretation of ventilation-perfusion lung scintigrams for the diagnosis of pulmonary embolism using artificial neural networks

    International Nuclear Information System (INIS)

    Holst, H.; Jaerund, A.; Traegil, K.; Evander, E.; Edenbrandt, L.; Aastroem, K.; Heyden, A.; Kahl, F.; Sparr, G.; Palmer, J.

    2000-01-01

    The purpose of this study was to develop a completely automated method for the interpretation of ventilation-perfusion (V-P) lung scintigrams used in the diagnosis of pulmonary embolism. An artificial neural network was trained for the diagnosis of pulmonary embolism using 18 automatically obtained features from each set of V-P scintigrams. The techniques used to process the images included their alignment to templates, the construction of quotient images based on the ventilation and perfusion images, and the calculation of measures describing V-P mismatches in the quotient images. The templates represented lungs of normal size and shape without any pathological changes. Images that could not be properly aligned to the templates were detected and excluded automatically. After exclusion of those V-P scintigrams not properly aligned to the templates, 478 V-P scintigrams remained in a training group of consecutive patients with suspected pulmonary embolism, and a further 87 V-P scintigrams formed a separate test group comprising patients who had undergone pulmonary angiography. The performance of the neural network, measured as the area under the receiver operating characteristic curve, was 0.87 (95% confidence limits 0.82-0.92) in the training group and 0.79 (0.69-0.88) in the test group. It is concluded that a completely automated method can be used for the interpretation of V-P scintigrams. The performance of this method is similar to others previously presented, whereby features were extracted manually. (orig.)

  9. Effects of bacteria and yeast on WBC counting in three automated hematology counters.

    Science.gov (United States)

    Kim, Hye Ryoun; Park, Bo Rae G; Lee, Mi Kyung

    2008-07-01

    Bacteria or yeast may be observed on peripheral blood smears and may lead to spuriously elevated platelet counts. They have been reported to disturb the white blood cell (WBC) differential count if they clumped together, and a large number of such microorganisms have been shown to increase WBC counts. The purpose of this study was to evaluate the spurious rise in WBC counts according to species of microorganisms and automated hematology analyzers. The species we selected were Staphylococcus aureus, Escherichia coli, Candida albicans, C. tropicalis, C. krusei, C. dubliniensis, C. glabrata, and C. parapsilosis. We investigated the effects of bacteria and yeast on peripheral blood samples by the ADVIA 120/2120 Hematology System, Sysmex XE-2100 (TOA Medical Electronics, Kobe, Japan) and Coulter LH 750 (Beckman Coulter, Miami, FL, USA). C. albicans, C. tropicalis, C. krusei, and C. dubliniensis had an overt effect on the WBC count at concentrations of up to 1-5 x 10(7) colony-forming units (CFU)/mL in three automated cell counters, and C. glabrata and C. parapsilosis, when present at concentrations of 1-5 x 10(8) CFU/mL, caused a significant increase in the WBC count obtained by the Sysmex XE-2100 but not by the ADVIA 120/2120 system and Coulter LH 750 (p bacteria and yeast may give erroneously high WBC counts and differential leukocyte counts and should review the peripheral blood smear by microscopy.

  10. Notes on the liver correction applied systematically to all renal scintigrams

    International Nuclear Information System (INIS)

    Artus, J.C.; Miro, L.; Durand, J.

    1976-01-01

    A problem still outstanding in renal scintigraphy is analyzed: how to deal with the parasitic tracer uptake by the liver. Some investigators correct systematically for the liver shadow by injecting technetium labelled colloids, for others the data supplied by 197 HgCl 2 scintigraphy alone allow to estimate the kidney uptake. Objective criteria are given as a mean to decide whether a liver scintigram is necessary in order to obtain the kidney uptake rate [fr

  11. Measurement of acute myocardial infarcts in dogs with /sup 99m/Tc-stannous pyrophosphate scintigrams

    International Nuclear Information System (INIS)

    Stokely, E.M.; Buja, L.M.; Lewis, S.E.; Parkey, R.W.; Bonte, F.J.; Harris, R.A. Jr.; Willerson, J.T.

    1976-01-01

    Myocardial scintigrams using /sup 99m/Tc-stannous pyrophosphate (/sup 99m/Tc-PYP) can be used to measure myocardial infarcts produced in dogs by proximal ligation of the left anterior descending coronary artery. Seven dogs had /sup 99m/Tc-PYP myocardial scintigraphy performed 24 to 32 hr after ligation of the proximal left anterior artery. In each dog the scintigrams showed increased /sup 99m/Tc-PYP uptake in the distribution of the artery. The scintigraphically visible areas of infarction, measured using interactive computer-aided techniques, were compared subsequently with independent histologic measurements of myocardial infarct size. Several methods for using the area measurements to estimate infarct size were treated. The most successful method (r = 0.92, p less than 0.01) assumed a linear relationship between the largest scintigraphic infarct area and the histologically determined infarct weight. The results suggest that /sup 99m/Tc-PYP myocardial scintigrams provide a useful noninvasive method for measuring infarct size in dogs with proximal ligation of the left anterior descending coronary artery

  12. Pathology of the idiopathic renal tubular proteinuria evaluated by the renal scintigram

    International Nuclear Information System (INIS)

    Matsuyama, Takeshi; Saotome, Yumiko; Fuse, Tomoko

    1998-01-01

    In 10 patients matching to the temporal standards of the idiopathic renal tubular proteinuria disease, renal scintigrams using 99m Tc-dimercaptosuccinic acid (DMSA) and 99m Tc-mercaptoacetyl-glycylglycylglycine (MAG3) were performed. All patients were boys with age of 11.9 years and the median concentration of β 2 -macroglobulin in urea was 69,150 μg/l. In the DMSA scintigram, there was no abnormalities of accumulation in the morphology, but %uptake of DMSA in all patients decreased, and that ranges from 2.8 to 10.9% per kidney, equivalent to 1/3 to 1/5 of the normal healthy controls. On the other hand, in the MAG3 scintigram, the vessel and the functional phases seemed to be normal except one case, but the excretion phase was delayed except one case. This disease had the impairment in the active transport on the vessel cavity side of the distal renal tubular cells, and will show in future symptoms other than the low molecular weight proteinuria. It is important to observe carefully the development of symptoms. (K.H.)

  13. Segmental quantitative analysis of digital thallium-201 myocardial scintigrams in diagnosis of coronary artery disease

    International Nuclear Information System (INIS)

    Wainwright, R.J.; Maisey, M.N.; Sowton, E.

    1981-01-01

    One hundred and forty-nine patients with suspected ischaemic heart disease were evaluated by exercise thallium-201 myocardial scintigraphy ( 201 Tl SMS), single lead exercise electrocardiography, and coronary arteriography. Myocardial distribution of tracer was assessed semi-quantitatively from digital 201 Tl scintigrams and compared with tracer distribution in subjects with normal hearts. Fifty-two of 54 (96%) patients with normal coronary arteries had normal myocardial scintigrams whereas three patients had a positive ischaemic exercise electrocardiogram and were scan normal. Conversely, 36 of 95 (38%) patients with coronary artery disease had a positive ischaemic electrocardiogram compared with 94 of 95 (99%) patients who had a positive myocardial scintigram. Disease was predicted correctly in 76 out of 80 (95%) of left anterior descending coronary stenoses, in 48 out of 64 (75%) of right coronary artery stenoses, and in 55 out of 64 (85%) of left circumflex coronary artery stenoses, despite the presence of infarcted myocardium in other territories. 201 Tl SMS with segmental quantitative analysis is a highly sensitive and specific technique in the diagnosis of coronary artery disease and may be a useful screening procedure to select patients for further investigation, particularly those with evidence of life-threatening severe left coronary artery disease. (author)

  14. WBC reduction filtration efficacy performed at varying time intervals post-collection.

    Science.gov (United States)

    Hinojosa, Ricardo; Bryant, Barbara J

    2011-12-01

    A multisite blood center experienced unacceptable post-leukoreduction filtration white blood cell (WBC) counts at a few centers. Since prefiltration storage time and temperature were suspect, whole blood (WB) units were stored in transport shippers for at least 2 hours, cooling toward 1-6 ° C, before filtration. This study compared the effect of storage times in transport shippers on the residual WBC counts of leukoreduced units. Collection and filtration of WB units were accomplished with the use of the Fenwal Express System with Integral Sepacell RZ-2000 WB Leukocyte Reduction Filter. Units were collected and placed in transport shippers containing ice. Leukoreduction filtration was performed at designated intervals post-collection. Acceptable leukoreduction was defined as < 5 × 10(6) residual WBC. Fifty donor units were selected randomly over 3 months. Units were held in transport shippers, and WBC reduction was performed at designated post-collection intervals. Storage times ranged from 28 to 458 minutes. All residual WBC counts were acceptable. Storage time of WB units in transport shippers did not play a role in the efficacy of the leukoreduction. This study demonstrated the 2-hour storage time before leukoreduction filtration could be eliminated resulting in time savings and increased efficacy in the component production laboratory. © 2011 American Association of Blood Banks.

  15. Additive value of three-phase of Tc-99m HMPAO WBC scintigraphy in patients with suspected knee prosthesis infection

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Suk; Lim, Seok Tae; Jeong, Hwan Jeong; Sohn, Myung Hee [Chonbuk National University Hospital, Jeonju (Korea, Republic of)

    2007-07-01

    We investigated if three-phase Tc-99m HMPAO WBC scintigraphy (TP-WBC) to detect infection in patients with knee protheses has more additive values than conventional Tc-99m HMPAO WBC scintigraphy (C-WBC). Thirty patients (M: F=8: 22, Age; 69.26.2 yrs) with suspected knee prothesis infection were enrolled in our study. We performed Tc-99m HMPAO WBC scintigraphies at 4 different time points after the injection of the labeled leukocytes; Immediately after the bolus injection (perfusion phase image), 1 min (blood-pool phase image), and 1 and 3 hours (delayed static images, C-WBC). The final diagnosis of infection was based on surgical, histologic, and bacteriologic data and other follow-up studies. We compared with diagnostic performance between TP-WBC and C-WBC. Twenty patients (66.7%) finally had infected prothesis, the other ten (33.3%) didn't have it. C-WBC showed 85.0% of sensitivity, 30.0% of specificity, 70.8% of PPV, 50.0% of PNV, and 66.7% of accuracy. TP-WBC also showed 95.0% of sensitivity, 30.0% of specificity, 73.1 % of PPV, 75.0% of PNV, and 73.3% of accuracy. TP-WBC demonstrated higher sensitivity and accuracy than C-WBC. Three-phase images of Tc-99m HMPAO WBC scintigraphy may have more additive value to detect infection in patients with suspected knee prosthesis infection.

  16. Comparison of cryopreservation bags for hematopoietic progenitor cells using a WBC-enriched product.

    Science.gov (United States)

    Dijkstra-Tiekstra, Margriet J; Hazelaar, Sandra; Gkoumassi, Effimia; Weggemans, Margienus; de Wildt-Eggen, Janny

    2015-04-01

    Hematopoietic progenitor cells (HPC) are stored in cryopreservation bags that are resistant to liquid nitrogen. Since Cryocyte bags of Baxter (B-bags) are no longer available, an alternative bag was sought. Also, the influence of freezing volume was studied. Miltenyi Biotec (MB)- and MacoPharma (MP)-bags passed the integrity tests without failure. Comparing MB- and MP-bags with B-bags, no difference in WBC recovery or viability was found when using a WBC-enriched product as a "dummy" HPC product. Further, a freezing volume of 30 mL resulted in better WBC recovery and viability than 60 mL. Additonal studies using real HPC might be necessary. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Penetration effects in 111Cd

    International Nuclear Information System (INIS)

    Giannatiempo, A.; Perego, A.; Passeri, A.

    1984-01-01

    Penetration effects in the conversion process of the 7/2 + ->5/2 + , 171 keV and 5/2 + ->1/2 + , 245 keV transitions in 111 Cd have been investigated. The decay of 111 In has been studied to deduce the relative intensity of the K-conversion lines Isub(K)(171)/Isub(K)(245) and the ratio Isub(K)(245)/Isub(L+M...)(245). The values obtained for the penetration parameters of the two transitions are 0 1 (245)<=1.9. (orig.)

  18. An independent evaluation of a new method for automated interpretation of lung scintigrams using artificial neural networks

    International Nuclear Information System (INIS)

    Holst, H.; Jaerund, A.; Evander, E.; Taegil, K.; Edenbrandt, L.; Maare, K.; Aastroem, K.; Ohlsson, M.

    2001-01-01

    The purpose of this study was to evaluate a new automated method for the interpretation of lung perfusion scintigrams using patients from a hospital other than that where the method was developed, and then to compare the performance of the technique against that of experienced physicians. A total of 1,087 scintigrams from patients with suspected pulmonary embolism comprised the training group. The test group consisted of scintigrams from 140 patients collected in a hospital different to that from which the training group had been drawn. An artificial neural network was trained using 18 automatically obtained features from each set of perfusion scintigrams. The image processing techniques included alignment to templates, construction of quotient images based on the perfusion/template images, and finally calculation of features describing segmental perfusion defects in the quotient images. The templates represented lungs of normal size and shape without any pathological changes. The performance of the neural network was compared with that of three experienced physicians who read the same test scintigrams according to the modified PIOPED criteria using, in addition to perfusion images, ventilation images when available and chest radiographs for all patients. Performances were measured as area under the receiver operating characteristic curve. The performance of the neural network evaluated in the test group was 0.88 (95% confidence limits 0.81-0.94). The performance of the three experienced experts was in the range 0.87-0.93 when using the perfusion images, chest radiographs and ventilation images when available. Perfusion scintigrams can be interpreted regarding the diagnosis of pulmonary embolism by the use of an automated method also in a hospital other than that where it was developed. The performance of this method is similar to that of experienced physicians even though the physicians, in addition to perfusion images, also had access to ventilation images for

  19. A new method for evaluating worst- and best-case (WBC) economic consequences of technological development

    DEFF Research Database (Denmark)

    Schjær-Jacobsen, Hans

    1996-01-01

    This paper is addressing the problem of evaluating economic worst- and best-care (WBC) consequences of technological development in industrial companies faking into account uncertainties and lack of exact cost and market information. In the theoretical part of the paper, the mathematical concepts...

  20. Efficacy of lung ventilation scintigram and exercise pulmonary hemodynamic measurement to evaluate operability for pulmonary resection

    International Nuclear Information System (INIS)

    Kaneda, Masanori; Hayashi, Takashi; Hiraiwa, Takane; Sakai, Takashi; Namikawa, Shoji; Kusakawa, Minoru.

    1989-01-01

    Preoperative evaluation of patients with lung cancer should include data concerning both resectability and operability. Operability addresses the question how much pulmonary tissue can be safely removed. The purpose of this study is to demonstrate an efficacy of the lung ventilation scintigram and measurement of exercise change in pulmonary hemodynamic parameters by detecting respiratory and circulatory reserve of pulmonary function. Predicted postoperative forced vital capacity (FVC) were calculated from the data of lung scintigram and preoperative spirometry by means of subsegmental formula. Accuracy of prediction was confirmed by spirometry 6 months after the operation. Correlation coefficient between predicted value and actually measured one was R=0.95, and simple regression formula was y=0.98x-10.4. It was recommended that the lower limit should be setted at 40% by the calculated postoperative %FVC. Exercise test were performed by means of bicycle ergometer with the measurement of pulmonary arterial pressure and cardiac output. Pulmonary arterial resistance index (PARI) were also calculated. In younger group rise of pulmonary arterial pressure during exercise was gentle, and PARI was settled between 150 to 200 in high output state. But in older group rise of pulmonary aerial pressure was steep and PARI was over 200 in some cases, just like the case of COLD. It should be recommended to set the upper limit of PARI at 400 in maximum exercise. (author)

  1. Computer-enhanced thallium scintigrams in asymptomatic men with abnormal exercise tests

    International Nuclear Information System (INIS)

    Uhl, G.S.; Kay, T.N.; Hickman, J.R. Jr.

    1981-01-01

    The use of treadmill testing in asymptomatic patients and those with an atypical chest pain syndrome is increasing, yet the proportion of false positive stress electrocardiograms increases as the prevalence of disease decreases. To determine the diagnostic accuracy of computer-enhanced thallium perfusion scintigraphy in this subgroup of patients, multigated thallium scans were obtained after peak exercise and 3 or 4 hours after exercise and the raw images enhanced by a computer before interpretations were made. The patient group consisted of 191 asymptomatic U.S. Air force aircrewmen who had an abnormal exercise electrocardiogram. Of these, 135 had normal coronary angiographic findings, 15 had subcritical coronary stenosis (less than 50 percent diameter narrowing) and 41 had significant coronary artery disease. Use of computer enhancement resulted in only four false positive and two false negative scintigrams. The small subgroup with subcritical coronary disease had equivocal results on thallium scintigraphy, 10 men having abnormal scans and 5 showing no defects. The clinical significance of such subcritical disease in unclear, but it can be detected with thallium scintigraphy. Thallium scintigrams that have been enhanced by readily available computer techniques are an accurate diagnostic tool even in asymptomatic patients with an easily interpretable abnormal maximal stress electrocardiogram. Thallium scans can be effectively used in counseling asymptomatic patients on the likelihood of their having coronary artery disease

  2. A methodology to develop computational phantoms with adjustable posture for WBC calibration

    Science.gov (United States)

    Ferreira Fonseca, T. C.; Bogaerts, R.; Hunt, John; Vanhavere, F.

    2014-11-01

    A Whole Body Counter (WBC) is a facility to routinely assess the internal contamination of exposed workers, especially in the case of radiation release accidents. The calibration of the counting device is usually done by using anthropomorphic physical phantoms representing the human body. Due to such a challenge of constructing representative physical phantoms a virtual calibration has been introduced. The use of computational phantoms and the Monte Carlo method to simulate radiation transport have been demonstrated to be a worthy alternative. In this study we introduce a methodology developed for the creation of realistic computational voxel phantoms with adjustable posture for WBC calibration. The methodology makes use of different software packages to enable the creation and modification of computational voxel phantoms. This allows voxel phantoms to be developed on demand for the calibration of different WBC configurations. This in turn helps to study the major source of uncertainty associated with the in vivo measurement routine which is the difference between the calibration phantoms and the real persons being counted. The use of realistic computational phantoms also helps the optimization of the counting measurement. Open source codes such as MakeHuman and Blender software packages have been used for the creation and modelling of 3D humanoid characters based on polygonal mesh surfaces. Also, a home-made software was developed whose goal is to convert the binary 3D voxel grid into a MCNPX input file. This paper summarizes the development of a library of phantoms of the human body that uses two basic phantoms called MaMP and FeMP (Male and Female Mesh Phantoms) to create a set of male and female phantoms that vary both in height and in weight. Two sets of MaMP and FeMP phantoms were developed and used for efficiency calibration of two different WBC set-ups: the Doel NPP WBC laboratory and AGM laboratory of SCK-CEN in Mol, Belgium.

  3. A methodology to develop computational phantoms with adjustable posture for WBC calibration.

    Science.gov (United States)

    Fonseca, T C Ferreira; Bogaerts, R; Hunt, John; Vanhavere, F

    2014-11-21

    A Whole Body Counter (WBC) is a facility to routinely assess the internal contamination of exposed workers, especially in the case of radiation release accidents. The calibration of the counting device is usually done by using anthropomorphic physical phantoms representing the human body. Due to such a challenge of constructing representative physical phantoms a virtual calibration has been introduced. The use of computational phantoms and the Monte Carlo method to simulate radiation transport have been demonstrated to be a worthy alternative. In this study we introduce a methodology developed for the creation of realistic computational voxel phantoms with adjustable posture for WBC calibration. The methodology makes use of different software packages to enable the creation and modification of computational voxel phantoms. This allows voxel phantoms to be developed on demand for the calibration of different WBC configurations. This in turn helps to study the major source of uncertainty associated with the in vivo measurement routine which is the difference between the calibration phantoms and the real persons being counted. The use of realistic computational phantoms also helps the optimization of the counting measurement. Open source codes such as MakeHuman and Blender software packages have been used for the creation and modelling of 3D humanoid characters based on polygonal mesh surfaces. Also, a home-made software was developed whose goal is to convert the binary 3D voxel grid into a MCNPX input file. This paper summarizes the development of a library of phantoms of the human body that uses two basic phantoms called MaMP and FeMP (Male and Female Mesh Phantoms) to create a set of male and female phantoms that vary both in height and in weight. Two sets of MaMP and FeMP phantoms were developed and used for efficiency calibration of two different WBC set-ups: the Doel NPP WBC laboratory and AGM laboratory of SCK-CEN in Mol, Belgium.

  4. A methodology to develop computational phantoms with adjustable posture for WBC calibration

    International Nuclear Information System (INIS)

    Fonseca, T C Ferreira; Vanhavere, F; Bogaerts, R; Hunt, John

    2014-01-01

    A Whole Body Counter (WBC) is a facility to routinely assess the internal contamination of exposed workers, especially in the case of radiation release accidents. The calibration of the counting device is usually done by using anthropomorphic physical phantoms representing the human body. Due to such a challenge of constructing representative physical phantoms a virtual calibration has been introduced. The use of computational phantoms and the Monte Carlo method to simulate radiation transport have been demonstrated to be a worthy alternative. In this study we introduce a methodology developed for the creation of realistic computational voxel phantoms with adjustable posture for WBC calibration. The methodology makes use of different software packages to enable the creation and modification of computational voxel phantoms. This allows voxel phantoms to be developed on demand for the calibration of different WBC configurations. This in turn helps to study the major source of uncertainty associated with the in vivo measurement routine which is the difference between the calibration phantoms and the real persons being counted. The use of realistic computational phantoms also helps the optimization of the counting measurement. Open source codes such as MakeHuman and Blender software packages have been used for the creation and modelling of 3D humanoid characters based on polygonal mesh surfaces. Also, a home-made software was developed whose goal is to convert the binary 3D voxel grid into a MCNPX input file. This paper summarizes the development of a library of phantoms of the human body that uses two basic phantoms called MaMP and FeMP (Male and Female Mesh Phantoms) to create a set of male and female phantoms that vary both in height and in weight. Two sets of MaMP and FeMP phantoms were developed and used for efficiency calibration of two different WBC set-ups: the Doel NPP WBC laboratory and AGM laboratory of SCK-CEN in Mol, Belgium. (paper)

  5. Computer-aided diagnosis system for bone scintigrams from Japanese patients: importance of training database

    DEFF Research Database (Denmark)

    Horikoshi, Hiroyuki; Kikuchi, Akihiro; Onoguchi, Masahisa

    2012-01-01

    Computer-aided diagnosis (CAD) software for bone scintigrams have recently been introduced as a clinical quality assurance tool. The purpose of this study was to compare the diagnostic accuracy of two CAD systems, one based on a European and one on a Japanese training database, in a group of bone...... scans from Japanese patients.The two CAD software are trained to interpret bone scans using training databases consisting of bone scans with the desired interpretation, metastatic disease or not. One software was trained using 795 bone scans from European patients and the other with 904 bone scans from...... Japanese patients. The two CAD softwares were evaluated using the same group of 257 Japanese patients, who underwent bone scintigraphy because of suspected metastases of malignant tumors in 2009. The final diagnostic results made by clinicians were used as gold standard.The Japanese CAD software showed...

  6. Persistent renal cortical scintigram defects in children 2 years after urinary tract infection

    Energy Technology Data Exchange (ETDEWEB)

    Ditchfield, Michael R.; Cook, David J.; Campo, John F. de [Department of Radiology, Royal Children' s Hospital, 3052, Parkville, Victoria (Australia); Grimwood, Keith [Department of General Paediatrics, Royal Children' s Hospital, 3052, Parkville, Victoria (Australia); Department of Paediatrics, University of Melbourne, Melbourne (Australia); Powell, Harley R.; Gulati, Sanjeev [Department of Nephrology, Royal Children' s Hospital, 3052, Parkville, Victoria (Australia); Sloane, Robert [Department of General Paediatrics, Royal Children' s Hospital, 3052, Parkville, Victoria (Australia)

    2004-06-01

    Background: Renal cortical scintigraphic studies challenge the role of vesicoureteric reflux in renal scar development, emphasizing instead the part played by acute pyelonephritis. Objective: To determine the prevalence of renal cortical defects in a child cohort 2 years after the child's first diagnosed urinary tract infection and to analyze the relationship of these defects with acute illness variables, primary vesicoureteric reflux and recurrent infections. Materials and methods: In a prospective cohort study, 193 children younger than 5 years with their first proven urinary tract infection underwent renal sonography, voiding cystourethrogram, and renal cortical scintigraphy within 15 days of diagnosis. Two years later, 150 of the 193 children, or 77.7%, had a further renal cortical scintigram, including 75, or 86.2%, of the 87 children who had acute scintigraphic defects. The relationship of cortical defects to age, gender, pre-treatment symptom duration, hospitalization, presence and grade of vesicoureteric reflux, and recurrent urinary tract infections was evaluated. Results: Overall, 20 of the 150 (13.3%; 95% confidence interval (CI) 8.3, 19.8) children had persistent defects 2 years after infection. This included 20 of 75 (26.7%; 95% CI 17.1, 38.1) with initially abnormal scintigrams. No new defects were detected. Although acute defects were more common in the young, those with persistent defects were older (median ages 16.4 vs. 6.8 months, P=0.004) than those with transient abnormalities. After adjustment for age, persistent defects were no longer associated with gender and were not predicted by acute illness variables, primary vesicoureteric reflux or recurrent infections. (orig.)

  7. Persistent renal cortical scintigram defects in children 2 years after urinary tract infection

    International Nuclear Information System (INIS)

    Ditchfield, Michael R.; Cook, David J.; Campo, John F. de; Grimwood, Keith; Powell, Harley R.; Gulati, Sanjeev; Sloane, Robert

    2004-01-01

    Background: Renal cortical scintigraphic studies challenge the role of vesicoureteric reflux in renal scar development, emphasizing instead the part played by acute pyelonephritis. Objective: To determine the prevalence of renal cortical defects in a child cohort 2 years after the child's first diagnosed urinary tract infection and to analyze the relationship of these defects with acute illness variables, primary vesicoureteric reflux and recurrent infections. Materials and methods: In a prospective cohort study, 193 children younger than 5 years with their first proven urinary tract infection underwent renal sonography, voiding cystourethrogram, and renal cortical scintigraphy within 15 days of diagnosis. Two years later, 150 of the 193 children, or 77.7%, had a further renal cortical scintigram, including 75, or 86.2%, of the 87 children who had acute scintigraphic defects. The relationship of cortical defects to age, gender, pre-treatment symptom duration, hospitalization, presence and grade of vesicoureteric reflux, and recurrent urinary tract infections was evaluated. Results: Overall, 20 of the 150 (13.3%; 95% confidence interval (CI) 8.3, 19.8) children had persistent defects 2 years after infection. This included 20 of 75 (26.7%; 95% CI 17.1, 38.1) with initially abnormal scintigrams. No new defects were detected. Although acute defects were more common in the young, those with persistent defects were older (median ages 16.4 vs. 6.8 months, P=0.004) than those with transient abnormalities. After adjustment for age, persistent defects were no longer associated with gender and were not predicted by acute illness variables, primary vesicoureteric reflux or recurrent infections. (orig.)

  8. Thyroid Dose Estimation Using WBC and I-131 Concentration in Working Area of Radioisotope Production at Normal Operation

    International Nuclear Information System (INIS)

    Tedjasari, R S; Lubis, E

    1996-01-01

    Thyroid dose estimation at Radioisotope Production Centre workers using WBC and calculation based on I-131 concentration in working area has been done. The aim of this research is to get the relation between WBC result and calculation using I-131 concentration in working area. The result indicates differences in a range of 3,2% to 53,2%. These differences caused of parameters which influence the calculation are not accurate. These results also indicate that dose estimation using WBC is relatively batter and more accurate but need to have certain information about time of intake

  9. A study on relationship between liver scintigram and various kinds of liver function tests

    International Nuclear Information System (INIS)

    Watanabe, Kazuo

    1975-01-01

    The relationship between GOT, γ-globulin, alkaline phosphatase, ICG-R 15 and liver scintigram (anterior view) was studied in 37 patients with miscellaneous liver diseases. The length of the splenic image and the difference between right side and left side widths of the liver were indicated as liver scintigraphic findings. 1. γ-globulin and alkaline phosphatase tended to be slightly higher with remarkable splenic image. 2. All three patients with over 35% of ICG-R 15 had atrophic type of the right lobe showing more than 13 cm of the spleen. At first sight, they were diagnosed as having liver cirrhosis. On the other hand, some of the patients who had normal or slightly abnormal ICG-R 15 were suspected of having liver cirrhosis because of the long splenic image, but all had remarkable swelling of the right lobe. 3. The patients whom the difference between the right side and the left side widths was below 3 cm contained many patients with liver cirrhosis acompanied by atrophic type of the right lobe and remarkably abnormal ICG-R 15 . (Namekawa, K.)

  10. Quantitative Analysis of Bone Scintigrams at the Korle-Bu Teaching Hospital

    International Nuclear Information System (INIS)

    Huguette, E.Y.Y.

    2012-01-01

    Qualitative method of diagnosis has been the traditional means of diagnosing bone tumours at the Nuclear Medicine Department of the Korle-Bu Teaching Hospital over the years. Although this method is commendable, a more accurate diagnostic means is the quantitative approach. Study on ninety-five patients undergoing bone scans has been performed quantitatively using image J. The patients were administered with activity ranging from 15 to 30 mCi depending on their weights, and were then scanned with an installed e.Cam SPECT system. A 256 x 1024 matrix size was used in acquiring the bone scans. Quantitative analyses performed with the image J, revealed that uptake levels in all selected body parts were higher for metastatic tumours compared to non-metastatic tumours. The average normalised uptake in the recorded metastatic cases was 1.37332 cts/mm 2 /mCi and the corresponding uptake in the non-metastatic cases was 0.85230 cts/mm 2 /mCi. The relative higher uptake in metastatic tumours is attributed to high osteoblastic activity and blood flow in metastatic cases compared to non-metastatic cases. Quantitative assessment of bone scintigrams is recommended for its high accuracy and quicker means of diagnosing.(author)

  11. Whole-Body Counter(WBC and food radiocesium contamination surveys in Namie, Fukushima Prefecture.

    Directory of Open Access Journals (Sweden)

    Yoichiro Hosokawa

    Full Text Available This study examined the internal Cs exposure of residents and the Cs present in food products produced in Namie. Whole-body counter (WBC was used for the measurement of internal exposure per each whole body of examinees.The food products which appeared to be used for consumption, were brought by residents and commercially available food items were excluded. Most of them were wild plants or food items produced by residents. Four years of data from April 2012 to March 2013 (fiscal 2012 and April 2015 to March 2016 (Fiscal 2015 were analyzed and studied.The average radioactivity measured by WBC was approximately 5 Bq for Cs-134, and 20 Bq for Cs-137 and the average committed effective dose was approximately 1 μSv. The average for the residents with detectable radioactivity was 25 μSv, and the human health effects are considered to be extremely low risk. However, the radioactivity of the affected individuals showed a higher value than the theoretical attenuation rate. The majority (83.2% of individuals exhibiting radioactivity were over 50 years old. The number of food products brought in for detection decreased as the study period progressed, but the number of food products with radioactivity had increased. While the items with a higher detection rate of radioactivity included fruits such as citron and persimmon, shiitake mushrooms exhibited the highest radioactivity. Moreover, the radioactivity of seven items in these 10 items decreased from fiscal 2012 to fiscal 2015. Mushrooms had high radioactivity and were produced over a wide area.We suggest that the elderly try to enjoy life and eat wild plants in moderation while inspecting food products. Therefore, we will continue to work in raising awareness of radiation and its potential presence in food products and thus the continuing necessity of monitoring radioactivity in food in the future.

  12. Quantitative analysis of stress thallium-201 myocardial scintigrams: a multicenter trial

    International Nuclear Information System (INIS)

    Van Train, K.F.; Berman, D.S.; Garcia, E.V.

    1986-01-01

    Previously we validated a method for quantification of 201 TI myocardial stress distribution and washout in which the patient's stress and washout circumferential profiles are compared with observed normal limits. The present study reports the results of a multicenter trial in which this method, utilizing normal limits from our institution, was employed to evaluate the presence, location, and extent of coronary artery disease (CAD). The normal limits utilized were generated from 49 patients having a low likelihood of CAD. The study population included 157 patients from four centers in the United States and Canada as well as a comparative prospective population from Cedars-Sinai Medical Center (CSMC) of 51 patients with CAD, 30 patients with normal coronary arteriograms, and 30 additional low-likelihood normals. The results in the combined centers regarding overall detection of CAD revealed a sensitivity of 84% and a frequency of test normality in the patients with low likelihood of CAD of 88%, compared to a sensitivity of 82% and true normalcy rate of 83% obtained in the prospective CSMC population. The sensitivity for detecting disease increased according to the extent of angiographic CAD in both the multicenter sites and the prospective CSMC group. Regarding localization of disease, similar sensitivities and specificities for detecting disease in individual coronary arteries were found in the multicenter sites and the prospective CSMC population. The results indicate that our method for quantifying 201TI stress-redistribution scintigrams utilizing standard normal limits can be applied at other institutions using a variety of scintillation cameras with similar accuracy to that currently obtained at our institution

  13. Pretest clinical diagnosis of coronary artery disease and stress myocardial perfusion scintigram

    International Nuclear Information System (INIS)

    Kasalicky, J.; Kovac, I.; Lanska, V.

    2001-01-01

    To assess the probability of perfusion defects at exercise stress myocardial perfusion SPECT scintigraphy from pretest clinical diagnosis (medical personal history, previous ergometric investigation). To determine the value of clinical factors for probability of scintigraphic defects with respect to avoiding unnecessary investigation in subjects with low probability of abnormal scintigrams. 2143 subjects (1235 men, 908 women) were investigated by SPECT perfusion scintigraphy at stepwise increasing exercise stress. They were divided into three groups with regard to their medical history and exercise test at scintigraphy: subjects without any signs of coronary artery disease (CAD), patients with high likelihood of CAD (i.e., typical anginal pain, in particular at stress, positive stress ECG changes, angiographically documented important CAD) and patients after myocardial infarction (MI). Important risk factors (hypertension, diabetes, age and sex), as well as the role of revascularisation procedures, were taken into account for multiple logistic regression in order to express their importance for the odds of scintigraphic defect visualisation. Perfusion scintigraphic defects (PSD) were found in 5.2% of subjects without signs of CAD, in contrast to patients with manifest CAD (68.8% with PSD) and in those after MI (90.2% with PSD). There were other important factors corroborating the likelihood of PSD (in decreasing order of importance): diabetes, male, ECG changes at stress, increasing age. Successful revascularisation improved scintigraphic images. The examination of CAD symptom-free subjects, in particular with atypical chest discomfort, is useless. SMPS in patients after documented MI is to be carried out for other intended purposes, not for CAD diagnosis only. SMPS is highly recommended in patients with CAD symptoms and high CAD probability in order to decide further treatment and prognosis. (author)

  14. False-positive indium-111 labeled leukocyte scintigram in a patient with a painful hip prosthesis

    International Nuclear Information System (INIS)

    Feldman, N.; Makler, P.T. Jr.; Alavi, A.

    1986-01-01

    A Tronzo hip prosthesis is designed to elicit an inflammatory reaction in order to promote prosthesis stability. A three-phased bone scan and Ga-67 imaging in conjunction with physical examination and laboratory findings failed to demonstrate evidence for osteomyelitis in a patient with a painful hip prosthesis, in whom images obtained with In-111-labeled leukocytes were positive. This observation demonstrated that the interpretation of the latter technique in demonstrating inflammation can cause a false impression of an infectious process

  15. Myocardial visualization on a routine perfusion lung scintigram: Relationship to the amount of right-to-left shunt

    International Nuclear Information System (INIS)

    Seto, H.; Futatsuya, R.; Kamei, T.; Kakishita, M.; Hisada, K.

    1983-01-01

    Three cases of myocardial visualization on a routine perfusion lung scintigram with sup(99m)Tc-macroaggregaed albumin were reported in patients with congenital heart diseases; two cases of tetralogy of Fallot and one case of truncus arteriosus type IV. Large right-to-left shunts greater than 39% and marked hypertrophy of the ventricle suggesting the presence of increased coronary blood flow were noted in all cases. In the two patients with tetralogy of Fallot myocardial activity appeared to be located in the hypertrophic right venticles. (orig.)

  16. Myocardial visualization on a routine perfusion lung scintigram: Relationship to the amount of right-to-left shunt

    Energy Technology Data Exchange (ETDEWEB)

    Seto, H.; Futatsuya, R.; Kamei, T.; Kakishita, M.; Hisada, K.

    1983-11-14

    Three cases of myocardial visualization on a routine perfusion lung scintigram with sup(99m)Tc-macroaggregated albumin were reported in patients with congenital heart diseases; two cases of tetralogy of Fallot and one case of truncus arteriosus type IV. Large right-to-left shunts greater than 39% and marked hypertrophy of the ventricle suggesting the presence of increased coronary blood flow were noted in all cases. In the two patients with tetralogy of Fallot myocardial activity appeared to be located in the hypertrophic right venticles.

  17. Digital filtering of scintigrams and an investigation into the application of the fresnel zone plate in nuclear medicine

    International Nuclear Information System (INIS)

    Berg, C.J.M. van den

    1976-01-01

    By lack of media large enough to obtain a gamma-lens gamma radiation imaging detectors are based on collimation by absorbence. At present, routine static studies in Nuclear Medicine generally make use of gamma cameras equiped with conventional collimators of limited resolution characterized by their impulse response function. Two methods of improvement of scintigraphic imaging are investigated in this thesis: i) Digital filtering of scintigrams obtained with a conventional collimator (Chapter III); ii) Use of alternative collimation techniques i.e. the use of coded apertures, especially of Zone Plates

  18. Myocardial viability in cases with persistent perfusion defects on the dipyridamole thallium-201 scintigram. A comparative study with autopsy findings

    International Nuclear Information System (INIS)

    Nakayama, Masafumi; Mashima, Saburo; Ohkawa, Shin-ichiro; Tanno, Munehiko; Yamada, Hideo.

    1996-01-01

    The aim of this study was to assess the incidence of myocardial infarction among persistent perfusion defects in dipyridamole-stress thallium scintigraphy by inspecting autopsied hearts and to evaluate whether the regional thallium activity of a scintigraphic defect can predict the presence of infarction. Autopsied hearts were compared with dipyridamole myocardial scintigrams undertaken during life in 27 patients (mean age 85±8 years). The time interval from stress testing until death was 428±351 days. Regional thallium uptake of delayed perfusion defect was calculated on the short axis images. The grade of regional myocardial fibrosis in autopsy specimens was also quantified to correlate with the corresponding regional thallium uptake. In 6 of 15 (40%) regions with persistent defects on the scintigram, myocardial infarction was not found at autopsy. Regional thallium-201 uptake of delayed defects < 50% diagnosed infarction with a sensitivity of 82% and a specificity of 80%. A linear correlation (r=-0.67) was observed between percent thallium-201 uptake and the degree of myocardial fibrosis. In conclusion, perfusion defects at 4-hour imaging in dipyridamole-stress testing may overestimate the presence of myocardial infarction and regional thallium-201 activity is helpful in distinguishing between defects with and without infarction. (author)

  19. Role of renal function and calcemia in demonstration of kidneys in sup(99m)Tc-diphosphonate skeletal scintigrams

    International Nuclear Information System (INIS)

    Marincek, B.; Flury, W.; Roesler, H.; Bern Univ.

    1977-01-01

    Normally, in sup(99m)Tc-diphosphonate skeletal scintigrams the kidneys are delineated with the same intensity as the lumbar spine. This is not the case in patients with reduced renal function. In a series of 20 patients with varying degrees of renal insufficiency, a continuous decrease in the renal intensity with increasing serum creatinine was seen: clearly recognizable decreased renal intensity in patients with serum creatinine over 2 mg% and no visualization of the kidneys in patients with serum creatinine over 8 mg%. This effect is intensified through a simultaneously existing hypocalcemia, while a hypercalcemia has the opposite effect; i.e. the intensity decrease is partially prevented. In patients with normal renal function a hypercalcemia even leads to an increased renal intensity. As a further cause for excessive renal intensity, an increased parenchymal transit time was found in the radionephrography in 5 out of 11 patients with normal serum creatinine in whom the increased renal intensity in the skeletal scintigram was a chance finding. (orig.) [de

  20. Study of the Effect of Hemiscorpius Lepturus Venom on Levels of WBC, RBCc and Hematocrit in Rats

    Directory of Open Access Journals (Sweden)

    GHA Mosavi

    2005-04-01

    Full Text Available Introduction: Hemiscorpius lepturus scorpion present in the southern provinces of the country, especially in Khoozestan stings a lot of people that results in long-standing dangerous side effects and sometimes even mortality. As the study of the effects of this scorpion venom on some laboratory animals can determine its mechanism of action and help us to cure people stung by scorpions, this study has been done to study the effects of Hemiscorpius lepturus venom on levels of WBC, RBC and hematocrit of rats. Methods: An experimental study has been done on 51 rats of the same race with approximate age of 2-3 months, and weight of 200-250 grams. . All the hematological features including WBC (White Blood Cell, RBC (Red Blood Cell and HT (Hematocrit were measured prior to venom injection. The same procedures were followed after injection of 1 microlitre of venom. Results before and after injection have been analyzed by Wilcoxon Matched, Pairs signed and Ranks statistical tests. Results: The results of the study have shown that the venom caused changes in the levels of WBC, RBC and Hematocrit. The mean level of WBC at the start was 10234, whereas following the venom injection it reached to the level of 11757( P<0.0007. The mean number for RBC before the treatment was 7509130 and after injection, the number declined to 7065098( P<0.0001. The average amount of Hematocrit before and after injection was 40.087% and 39.0588 %, respectively (P<0.001. Conclusion: Hemiscorpius lepturus venom has some effects on the levels of WBC, RBC and hematocrit of rats. The study of the hematological changes in humans can lead to better study of the effect of this venom and consequently suitable cure for the injured.

  1. Increased incidence and clinical correlation of persistently abnormal technetium pyrophosphate myocardial scintigrams following acute myocardial infarction in patients with diabetes mellitus

    International Nuclear Information System (INIS)

    Nicod, P.; Lewis, S.E.; Corbett, J.C.; Buja, L.M.; Henderson, G.; Raskin, P.; Rude, R.E.; Willerson, J.T.

    1982-01-01

    Persistently abnormal /sup 99m/Tc stannous pyrophosphate myocardial scintigrams (PPi+) appear to be associated with a relatively poor prognosis after acute myocardial infarction (AMI). To assess the incidence and implications of PPi+, we performed a retrospective analysis in 29 patients with and 25 patients without diabetes mellitus who had abnormal myocardial scintigrams within 4 days of AMI and who had follow-up scintigrams at least 3 months after hospital discharge. There were no significant differences between patients with and without diabetes as regards age, incidence of transmural or nontransmural AMI, or degree of left ventricular dysfunction after AMI. Persistently abnormal PPi+ occurred more commonly in patients with diabetes than in nondiabetic patients (18 of 29, 62%, compared to 3 of 25, 12%; p less than 0.001). Patients with chronic PPi+ had more frequent cardiac complications following hospital discharge (p less than 0.005) including death, recurrent AMI, unstable angina, and intractable congestive heart failure. Postmortem analysis in two patients with diabetes and chronic PPi+ revealed marked myocytolysis. Thus, patients with diabetes mellitus have an increased incidence of post-AMI persistently abnormal technetium (PPi+) scintigrams and relatively poor prognosis following myocardial infarction

  2. CT and {sup 99m}Tc-WBC vs colonoscopy in the evaluation of inflammation and complications of inflammatory bowel diseases

    Energy Technology Data Exchange (ETDEWEB)

    Charron, M. [Children' s Hospital of Philadelphia, PA (United States); Lorenzo, C.D.; Kocoshis, S.

    2002-01-01

    The goal of this study was to evaluate the accuracy of computerized tomography (CT) and {sup 99m}Tc-white blood cell (WBC) scintigraphy versus colonoscopy in assessing inflammatory bowel diseases (IBD) in a large population of children. In a patient population of 313 consecutive children who had a {sup 99m}Tc-WBC scan, 106 colonoscopies were done within a median time interval of 8 days of the {sup 99m}Tc-WBC scan. One hundred and three CT scans were performed on 84 patients. Of the 42 CT scans obtained within a short time interval after the {sup 99m}Tc-WBC scan, 21 (50%) were normal. In the 21 children with a positive {sup 99m}Tc-WBC scan, 62% (13/21) of the CT scans underestimated the bowel wall inflammation in at least one segment. In the children with a negative {sup 99m}Tc-WBC study, there were 17 negative CT examinations and 4 examinations showing an abnormal terminal ileum. When CT was compared with colonoscopy in assessing inflammation, there were five true-negative CT, two true-positive CT, no false-positive, and seven false-negative CT examinations. When {sup 99m}Tc-WBC scintigraphy was compared with colonoscopy in assessing inflammation, there were seven true-positive, two false-negative, five true-negative, and no false-positive {sup 99T}c-WBC studies. The {sup 99m}Tc-WBC scan was positive in five patients with a false-negative CT examination. Of the total 103 CT scans obtained, 53 (51%) were normal. Four abscesses (3.8%) were demonstrated by CT. {sup 99m}Tc-WBC scintigraphy is more sensitive than CT for detecting inflammation of the bowel wall. The incidence of complications from IBD in this retrospective study was much lower than had been previously reported. (author)

  3. Safety of growth factor administration for leukapheresis in those with WBC counts greater than 60,000/µl.

    Science.gov (United States)

    Chen, Weihong; Rizzieri, David; Drago, Susan

    2015-02-01

    Peripheral blood stem cell mobilization using growth factors is a common method of stem cell collection for transplantation, however, little is reported concerning safety of continued growth factor delivery in exceptional responders with very high white blood cell (WBC) counts in preparation for pheresis. We performed a retrospective study of the safety of growth factor delivery for leukapheresis in those with WBC counts greater than 60,000/µl. Allogeneic donors received 5 days of granulocyte colony-stimulating factor (G-CSF) at a daily dose of 10 or 16 µg/kg. Autologous donors received G-CSF 10 µg/kg/day +/- chemotherapy until peripheral blood CD34(+) count reached 10/µl. Granulocyte donors received 300 µg dose of G-CSF the day prior to donation. Out of 3,037 leukapheresis collections from 1998 to 2005, we identified 303 collections from 204 donors or patients who had a WBC > 60,000/µl. WBC counts were ≥100,000/µl in seven of these subjects. If inadequate stem cell dose was obtained with pheresis with WBC counts this high, patients had growth factor dosing decreased 50% but still received a dose till stem cell collection was completed. Of the 204 subjects, 122 were patients and 82 were donors. These 204 donors/patients had no serious adverse events reported other than the common reports of myalgia, bone pain, and headache associated with administration of growth factors. Pain levels ranged from mild to severe and usually were managed by over the counter analgesics. Continuing ½ the dose of neupogen to complete the pheresis process appears safe in subjects with very high white blood counts. © 2014 Wiley Periodicals, Inc.

  4. New Alert Message Settings for the XN-series Automated Hematology Analyzer Are Useful for Avoiding Falsely High WBC Counts and to Detect Specimens with Giant Platelets.

    Science.gov (United States)

    Inaba, Tohru; Shimomoto, Bunta; Yuki, Yoichi; Okumura, Keita; Nishimura, Hiroshi; Koshino, Katsuhiro; Nobori, Shuji; Wada, Atsushi; Fujita, Naohisa

    2017-09-01

    We encountered blood specimens from a patient with MYH9 related diseases, which gave falsely high white blood cell (WBC) counts during laboratory analysis using Sysmex XN-series automated hematology analyzers. This overcount was revealed to be caused by the overlapping of platelet (PLT) distribution with the WBC area in the WNR channel, which was used for routine WBC count with the XN-series. On the other hand, the WBC count obtained through the WDF channel of the XN-series seemed more accurate in such a case. We then created and introduced alert message settings for such rare but critical specimens, which gives a warning when the discrepancy in WBC counts between the WNR and WDF channels is higher than 1.0×10 9 /L. By using the alert message setting, we were able to detect some specimens which gave falsely high WBC counts with the routine WNR channel from three other cases of giant PLTs. In conclusion, our alert message setting seems useful in avoiding false reporting of WBC count due to abnormal cells, including giant PLTs. © 2017 by the Association of Clinical Scientists, Inc.

  5. [Study on the relationship between WBC count levels and type 2 diabetes mellitus in Hui and Han nationality of Ningxia].

    Science.gov (United States)

    Liu, Yuan; He, Qunpeng; Chen, Lijun; Liu, Herong; Zhao, Chuan; Song, Hui

    2015-05-01

    To analyze the relationship between WBC count levels and type 2 diabetes mellitus in Hui and Han nationality of Ningxia. Using the method of case-control study, people of regional organizations and institutions aged 20 - 60 who received medical health checkup and endocrine patients in General Hospital of Ningxia Medical College and WuZhong city People's Hospital from October 2011 to October 2012 were enrolled in the study. According to the inclusion and exclusion criteria of T2DM patients and control groups, with gender, ethnic and age are not more than 3 years old cases and controls of matching, the T2DM group (case group) of 351 cases and non-T2DM group (control group) of 655 cases were determined. These subjects underwent questionnaire investigation, understand first, like the situation, the way of life, disease and medication history, family history. Physical examination: including height, weight, waist circumference (WC), systolic blood pressure (SBP) and diastolic blood pressure (DBP), and according to the height and weight to calculate body mass index (BMI), and laboratory tests, triglyceride (TG), total cholesterol (TC), high-density lipoprotein (HDL-C), low density lipoprotein (LDL-C), blood uric acid (UA ), nmda aminotransferase ( AST) , alanine aminotransferase (ALT), blood biochemical indexes. Results Diabetes group of average age (50.28 + 8.32), 194 patients with male, (55.27%), 157 patients with female (44.73%) and control group in average age (50. 17 + 7. 14) , including 337 men (51.45% ) and 318 women (48.55%). Average age, gender, the proportion between the two groups had no statistical significance of difference. The white blood cell value of T2DM group (6.66 x 10(9) ± 1.61 x 10(9)/L) was higher than that of non-T2DM group (6.11 x 10(9) ± 1.49 x 10(9)/L), there was a significant difference (t = -5.430, P Hui (6.459 x 10(9) ± 1.45 x 10(9)/L) and Han nationality (6.169 x 10(9) ± 1.63 x 10(9)/L), there was a significant difference (P Hui and Han

  6. Comparative Evaluation of C-Reactive Protein and WBC Count in Fascial Space Infections of Odontogenic Origin.

    Science.gov (United States)

    Bagul, Ravikiran; Chandan, Sanjay; Sane, Vikrant Dilip; Patil, Sujay; Yadav, Dinesh

    2017-06-01

    To assess efficacy of C-reactive protein levels as monitoring tools for patients with fascial space infections of odontogenic origin. A randomized prospective study was conducted on 20 patients suffering from fascial space infection of odontogenic origin, in the department of Oral and Maxillofacial Surgery Bharati Vidyapeeth dental college and hospital, Pune, Patients between 18 and 60 years of age of both the sexes were selected. All patients were treated and observed by the same surgeon. Patient's venous blood sample was collected pre-operatively and on 2nd and 5th post-operative days for evaluation of WBC count and C-reactive protein (CRP). All patients were encouraged for strict follow-up protocol. Where the results of WBC count and CRP when compared it was seen that the mean values of WBC were normal in 15 cases and abnormal in 5 cases on day 0, day 2 and day 5; whereas the mean values of CRP were abnormal on day 0 and day 2 and were within normal limit on day 5 in all cases. The findings of this prospective analysis indicate that White blood cells and C-reactive protein are effective markers for determining severity of infection, efficacy of treatment regime for patients with fascial space infections of odontogenic origin. Thus the markers also help in making treatment of patients with fascial space infections of odontogenic origin more cost effective and they also help protecting patients from side effects of excess drugs usage. Thus we conclude that CRP should be incorporated as monitoring tools for managing patients with fascial space infections of odontogenic origin.

  7. Hybrid Modality Fusion of Planar Scintigrams and CT Topograms to Localize Sentinel Lymph Nodes in Breast Lymphoscintigraphy: Technical Description and Phantom Studies

    OpenAIRE

    Renée L. Dickinson; William D. Erwin; Donna M. Stevens; Luc M. Bidaut; Martha V. Mar; Homer A. Macapinlac; Richard E. Wendt

    2011-01-01

    Lymphoscintigraphy is a nuclear medicine procedure that is used to detect sentinel lymph nodes (SLNs). This project sought to investigate fusion of planar scintigrams with CT topograms as a means of improving the anatomic reference for the SLN localization. Heretofore, the most common lymphoscintigraphy localization method has been backlighting with a 57Co sheet source. Currently, the most precise method of localization through hybrid SPECT/CT increases the patient absorbed dose by a factor o...

  8. Evaluation of the left ventricular function by myocardial scintigram and radionuclide angiocardiography with technetium-99m pyrophosphate in patients with acute myocardial infarct

    International Nuclear Information System (INIS)

    Suzuki, Yutaka; Sugihara, Masami; Matsuyama, Seiya; Tomoda, Haruo

    1980-01-01

    Myocardial scintigrams with sup(99m)Tc-pyrophosphate (PYP) were performed in 30 patients with acute myocardial infarct (AMI) and positive scintigrams were obtained in the 24 patients. In 12 patients the size of the AMI estimated from the scintigram with sup(99m)Tc-PYP was compared with the pulmonary capillary wedge pressure (PCWP). In the 7 patients with PCWP below 10 mmHg the mean area of the AMIs was 22 +- 5.5 cm 2 and that of in the 5 patients with PCWP beyond 10 mmHg was 41 +- 12.4 cm 2 . This difference was statistically significant (p lt 0.05). In comparison with chest x-ray findings, the average size of the AMIs among 6 patients with alveolar and/or interstitial edema was 43 +- 11.9 cm 2 and that of among 8 patients without pulmonary edema was 25 +- 9 cm 2 . The left ventricular ejection fraction (LVEF) was obtained by first pass method. In 12 patients LVEF and PXWP was compared. The 7 patients with PCWP below 10 mmHg did show significantly larger LVEF (49 +- 8.2%) than that of 5 patients with PCWP beyond 10 mmHg (33 +- 6.1%) (p lt 0.01). The mean LVEF in the 7 patients with pulmonary edema was 35 +- 10.2% and that of in the 8 patients without pulmonary was 48 +- 5.3%. Myocardial scintigram and radionuclide angiocardiography with sup(99m)Tc-PYP were useful for evaluation of the left ventricular function as well as detection of the AMI. (author)

  9. RNA-seq analysis of the effect of kanamycin and the ABC transporter AtWBC19 on Arabidopsis thaliana seedlings reveals changes in metal content.

    Directory of Open Access Journals (Sweden)

    Ayalew Mentewab

    Full Text Available Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC transporter AtWBC19 (ABCG19 is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6 in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1 was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake.

  10. Automated determination of the right ventricular ejection fraction by digital processing of sup(81m)Kr scintigrams

    International Nuclear Information System (INIS)

    Elfner, R.; Vaknine, R.; Knapp, W.H.; Tillmanns, H.; Lorenz, W.J.

    1986-01-01

    A method is presented for the automated determination of the right ventricular ejection fraction (RVEF) by digital image processing of scintigrams obtained by intravenous infusion of Krypton 81m (sup(81m)Kr) dissolved in a glucose solution. End-diastolic and end-systolic sum pictures were computed by the addition of approximately 30-40 frames selected from the time-activity curve of a preliminary, manually drawn, right ventricular region of interest. After processing these two images with an adaptive Wiener filter, the right ventricular contour was determined by a recently developed algorithm using morphological and functional criteria. The RVEF was calculated for a series of 51 patients from the counts in the detected right ventricular regions in the end-diastolic and end-systolic sum images. In 16 patients without evidence of cardiopulmonary disease, the mean RVEF was 50+-6.1%. RVEF was significantly reduced in 18 patients with obstructive pulmonary disease (42+-6.5%) and in 17 patients with congestive cardiomyopathy (36+-7.1%). The correlation coefficient between two determinations of the RVEF was r=0.94. Through digital image processing, the determination of the RVEF by radioventriculography with sup(81m)Kr showed high reliability and reproducibility. (orig.)

  11. Relationship between three phase bone scintigram and prognosis after sympathetic blockade in reflex sympathetic dystrophy of the hand

    Energy Technology Data Exchange (ETDEWEB)

    Yokono, Atsuko; Yokono, Satoshi; Oguri, Kenji (Kagawa Medical School, Miki (Japan))

    1990-11-01

    The authors attempted to correlate the changes in three phase bone scintigram (TPBS) with prognosis after sympathetic blockade in reflex sympathetic dystrophy (RSD) of the hand. Subjects were 12 patients of RSD in acute or dystrophic stage, who all had increased images on TPBS. Either intravenous regional sympathectomy with guanethidine or stellate ganglion block was performed repeatedly. We compared TPBS obtained just before and after this series of sympathetic blocks and evaluated the eventual recovery of function of the hand. In 8 patients, blood flow (phase 1) image of TPBS decreased after the blockade. Of these patients, those who showed almost normalized tracer activity not only on flow image but on blood pool (phase 2) and delayed (phase 3) image, returned to normal. But others with normalized blood flow and still increased activity in blood pool and delayed image, remained with mild contracture of the hand. These results suggest that normalization of blood pool and delayed image on TPBS is a predictor of subsequent recovery after sympathetic blockade in RSD. (author).

  12. Assessment of pulmonary aerosol deposition and epithelial permeability in [sup 99m]Tc-DTPA inhalation scintigram

    Energy Technology Data Exchange (ETDEWEB)

    Kanazawa, Minoru; Suzuki, Yukio; Ishizaka, Akitoshi; Hasegawa, Naoki; Fujishima, Seitaro; Kawashiro, Takeo; Yokoyama, Tetsuro; Kubo, Atsushi; Hashimoto, Shozo (Keio Univ., Tokyo (Japan). School of Medicine)

    1993-05-01

    The degree of lung injury in bronchiolo-alveolar lesions may be quantitated from the pulmonary epithelial permeability estimated by [sup 99m]Tc-diethylene triamine penta acetate (DTPA) aerosol inhalation scintigram. However, significant aerosol deposition sometimes occurs in the central airways and obscures the peameability change in the lung periphery. The radioaerosol deposition pattern and its effct on assessing the pulmonary epithelial permeability was studied. [sup 99m]Tc-DTPA aerosol scintigraphy was performed in 47 patients with pulmonary fibrosis (PF), 12 patients with chronic obstructive pulmonary diseases (COPD), and 27 non-smoking and 17 smoking healthy volunteers. The scintigraphic images of the lungs were classified into 4 grades: 0=homogeneous distribution; 1=patchy distribution; 2=hot spots with partial defects; and 3= hot spots with little deposition in the lung field. The rate constant was used as a parameter for the permeability. The smokers and patients with PF showed increased kep values of 2.36[+-]1.21%/min (mean[+-]SD) and 2.49[+-]1.29% min as compared with the nonsmokers with 0.94[+-]0.27% min, respectively. The nonsmokers, smokers and 36 patients with PF were classified as deposition grade 0 or 1, suggesting good aerosol penetration to the lung periphery. All patients with COPD showed either grade 2 or 3 deposition. Aerosol deposition in the central airways can cause underestimation of the permeability because of the thicker lining layer in the bronchus than in the alveolus. In conclusion, the aerosol deposition pattern should be analyzed when the method is applied clinically to assess the permeability of the bronchiolo-alveolar epithelium. (author).

  13. The Mean Transit Time of the CBD and Afferent Loop Using 99mTc-DISIDA Scintigram in Truncal Vagotomy

    International Nuclear Information System (INIS)

    Moon, Tae Young; Kim, Dong Soo

    1988-01-01

    The authors observed functional change of the CBD and the afferent loop with the transit time of 99m Tc-DISIDA scintigram in patients treated by the surgical operation of gastric ulcers and cancer at Busan National University Hospital from June, 1987 to April, 1988. So authors estimated the time between the peak activity of the CBD and the afferent loop (TCA), the half transit time of the CBD activity (t1/2 CBD) and the half transit time of the afferent loop activity (t1/2 A-loop) in 9 patients undergone truncal vagotomy, who have no specific symptoms at 2 to 6 months after the operation, 5 patients undergone the operation without truncal vagotomy, and 7 persons as a control group. The results were as follows: 1) In control group, the mean TCA, t1/2 CBD and t1/2 duodenum were 8.6±9.0 min., 38.7±17.3 min. and 28.6±10.9 min, respectively. 2) In the operation group without truncal vagotomy, the mean TCA, t1/2 CBD and t1/2 A-loop were 10.0±7.1min. 48.2±22.3 min. and 39.4±26.7 min. respectively. 3) In the operation group with truncal vagotomy, the mean TCA, t1/2 CBD and t1/2 A-loop were 15.0±8.7 min., 36.1±16.5 min. and 42.6±24.4 min, respectively. From the above results, we concluded that the transit time of the CBD and the afferent loop is not affected by truncal vagotomy.

  14. The effect of hydro-ethanolic extract of Curcuma longa rhizome and curcumin on total and differential WBC and serum oxidant, antioxidant biomarkers in rat model of asthma.

    Science.gov (United States)

    Shakeri, Farzaneh; Soukhtanloo, Mohammad; Boskabady, Mohammad Hossein

    2017-02-01

    The effects of Curcuma longa ( C. longa ) and curcumin on total and differential WBC count and oxidant, antioxidant biomarkers, in rat model of asthma were evaluated. Total and differential WBC count in the blood, NO 2 , NO 3 , MDA, SOD, CAT and thiol levels in serum were examined in control, asthma, Asthmatic rats treated with C. longa (0.75, 1.50, and 3.00 mg/ml), curcumin (0.15, 0.30, and 0.60 mg/ml), and dexamethasone (1.25 μg/ml) rats. Total and most differential WBC count, NO 2 , NO 3 and MDA were increased but lymphocytes, SOD, CAT and thiol were decreased in asthmatic animals compared to controls ( P longa and curcumin compared to asthmatic group ( P longa and curcumin ( P longa extract and its constituent curcumin in animal model of asthma was observed which suggest a therapeutic potential for the plant and its constituent on asthma.

  15. Diagnostic imaging of lung cancer with In-111-MDEGD

    International Nuclear Information System (INIS)

    Nakajima, Susumu; Hayashi, Hideo; Maeda, Tomio

    1987-01-01

    Indium-111-mono DTPA-ethyleneglycol Ga deuterporphyrin (In-111-MDEGD) is a new tumor imaging agent in lung cancer. The agent has been studied with golden hamsters bearing adenocarcinoma, C57 black mice bearing Lewis lung adenocarcinoma, and nude mice bearing human lung adenocarcinoma xerografts. It has been revealed that the tumor-to-lung, tumor-to-kidney, and tumor-to-blood ratios are higher for In-111-MDEGD than for Ga-67 citrate widely used in imaging tumors, and that the agent is not accumulated in inflammatory lesions. The results were encouraging enough to start clinical diagnostic trials in lung cancer. In this paper, an overview of In-111-MDEGD, along with its preliminary data, is given. (Namekawa, K.)

  16. Enhanced detection of proximal right coronary artery stenosis with the additional analysis of right ventricular thallium-201 uptake in stress scintigrams

    International Nuclear Information System (INIS)

    Gutman, J.; Brachman, M.; Rozanski, A.; Maddahi, J.; Waxman, A.; Berman, D.S.

    1983-01-01

    The value of right ventricular thallium-201 analysis in detecting proximal right coronary artery stenosis in exercise myocardial scintigraphy was analyzed in 52 patients, 27 with and 25 without proximal right coronary artery stenosis. For the detection of proximal right coronary artery stenosis, the sensitivity and specificity of thallium scintigraphic analysis were 59 and 88% for a right ventricular abnormality, 67 and 68% for a left ventricular inferior wall abnormality, and 93 and 56% for an abnormality of either. When both right and left ventricular thallium images were abnormal, all 9 patients had proximal right coronary artery stenoses, and when both were normal, 26 of 28 patients had a normal proximal right coronary artery. The sensitivity and specificity of blood pool scintigraphic variables during exercise (right ventricular ejection fraction and left ventricular inferior wall motion) were not significantly different for detection of proximal right coronary artery stenosis. Thus, the additional analysis of the right ventricle on thallium-201 stress scintigrams can improve the detection of proximal right coronary artery stenosis. When both right ventricular and left ventricular thallium scintigrams are abnormal (or normal), the ability to predict the presence (or absence) of proximal right coronary artery stenosis is very high

  17. Tumor scintigram, 2

    International Nuclear Information System (INIS)

    Nakano, Shunichi; Hasegawa, Yoshihisa; Shimura, Kazuo; Ifuka, Keijiro

    1975-01-01

    In various cases of malignant tumors, especially those of lung cancer and liver cancer, scans were made with 57 Co-bleomycin(BLM), and its diagnostic significance was evaluated. Tumors were visualized with 57 Co-BLM in 22 of the 26 cases of lung cancer (84.6%). Concentrations of the RI were noted in all of the cases of squamous epithelium cancer, adenoid cancer and cellule-type undifferentiated cancer. The smallest tumor that could be detected was a 2 x 2 cm adenoid cancer. Tumors were imaged in 19 of the 27 cases of liver cancer (70.4%). This detection rate was increased by a combination of 57 Co-BLM and 198 Au-colloid scanning. The authors believe that 57 Co-BLM will help to establish the diagnosis of lung cancer or liver cancer. Tumors were also imaged in 6 of the 15 cases of breast cancer, but no distinct concentration was noted in the 7 cases of thyroid cancer. (Ueda, J.)

  18. Guidelines for the labelling of leucocytes with In-111-oxine

    NARCIS (Netherlands)

    Roca, Manel; de Vries, Erik F. J.; Jamar, Francois; Israel, Ora; Signore, Alberto

    We describe here a protocol for labelling autologous white blood cells with In-111-oxine based on previously published consensus papers and guidelines. This protocol includes quality control and safety procedures and is in accordance with current European Union regulations and International Atomic

  19. Improvement of the WBC calibration of the Internal Dosimetry Laboratory of the CDTN/CNEN using MCNPX code

    Energy Technology Data Exchange (ETDEWEB)

    Guerra P, F.; Heeren de O, A. [Universidade Federal de Minas Gerais, Departamento de Engenharia Nuclear, Programa de Pos Graduacao em Ciencias e Tecnicas Nucleares, Av. Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte, Minas Gerais (Brazil); Melo, B. M.; Lacerda, M. A. S.; Da Silva, T. A.; Ferreira F, T. C., E-mail: tcff01@gmail.com [Centro de Desenvolvimento da Tecnologia Nuclear, Programa de Pos Graduacao / CNEN, Av. Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte, Minas Gerais (Brazil)

    2015-10-15

    The Plan of Radiological Protection licensed by the National Nuclear Energy Commission - CNEN in Brazil includes the risks of assessment of internal and external exposure by implementing a program of individual monitoring which is responsible of controlling exposures and ensuring the maintenance of radiation safety. The Laboratory of Internal Dosimetry of the Center for Development of Nuclear Technology - LID/CDTN is responsible for routine monitoring of internal contamination of the Individuals Occupationally Exposed (IOEs). These are, the IOEs involved in handling {sup 18}F produced by the Unit for Research and Production of Radiopharmaceuticals sources; as well a monitoring of the entire body of workers from the Research Reactor TRIGA IPR-R1/CDTN or whenever there is any risk of accidental incorporation. The determination of photon emitting radionuclides from the human body requires calibration techniques of the counting geometries, in order to obtain a curve of efficiency. The calibration process normally makes use of physical phantoms containing certified activities of the radionuclides of interest. The objective of this project is the calibration of the WBC facility of the LID/CDTN using the BOMAB physical phantom and Monte Carlo simulations. Three steps were needed to complete the calibration process. First, the BOMAB was filled with a KCl solution and several measurements of the gamma ray energy (1.46 MeV) emitted by {sup 40}K were done. Second, simulations using MCNPX code were performed to calculate the counting efficiency (Ce) for the BOMAB model phantom and compared with the measurements Ce results. Third and last step, the modeled BOMAB phantom was used to calculate the Ce covering the energy range of interest. The results showed a good agreement and are within the expected ratio between the measured and simulated results. (Author)

  20. Comparative analysis of 99mTc-depreotide and 99mTc-EDDA/HYNIC-TOC thorax scintigrams acquired for the purpose of differential diagnosis of solitary pulmonary nodules.

    Science.gov (United States)

    Płachcińska, Anna; Mikołajczak, Renata; Kozak, Józef; Rzeszutek, Katarzyna; Kuśmierek, Jacek

    2006-01-01

    Aiming at comparison of diagnostic efficacy of 2 radiopharmaceuticals: 99mTc-depreotide (Neospect, Amersham) and 99mTc-EDDA/HYNIC-Tyr3-octreotide (Tektrotyd, Polatom), in differentiation between malignant and benign etiology of solitary pulmonary nodules (SPNs), radionuclide studies with 2 radiotracers were performed in 18 patients. For both radiopharmaceuticals the same acquisition and processing protocols were applied. Studies were acquired with SPECT technique, after administration of 740 MBq of activity. Scintigrams were assessed visually, as: positive (+), equivocal (+/-) and negative (-). Additionally, uptake intensity of both radiotracers in nodules was assessed semiquantitatively, using a tumour-to-background ratio. Verification of scintigraphic results was based in 14 cases upon a pathological examination of tumour samples (histopathology) and in the remaining 4 - on clinical observation and bacteriological studies. Normal scintigrams obtained with both radiopharmaceuticals differed significantly. 99mTc-depreotide was markedly accumulated in spine, sternum, ribs and lungs (mean lung/heart ratio = 2.2). This accumulation was not observed on 99mTc- -EDDA/HYNIC-TOC scintigrams (mean lung/heart ratio = 0.7). In 6 patients a malignant etiology--lung cancer--was revealed (5--adenocarcinoma, 1--squamous cell) and the other 12 cases turned out to be benign (4 hamartomas, 3 tuberculomas, a tuberculous infiltrate, an alien body with inflammatory reaction, a hyperplasia of lymphatic tissue and 2 cases of unknown etiology, from which one had a stable size and the other resolved during a 6 month observation period). In all 6 cases of lung cancer positive results were obtained with both tracers. Moreover, in 2 patients metastases in mediastinum could be observed on scintigrams obtained with both radiopharmaceuticals. From among 12 cases of benign etiology 6 99mTc-depreotide scintigrams were true negative, 1--equivocal and 5--false positive, whereas 6 99m

  1. Comparative analysis of 99mTc-depreotide and 99mTc-EDDA/HYNIC-TOC thorax scintigrams acquired for the purpose of differential diagnosis of solitary pulmonary nodules

    International Nuclear Information System (INIS)

    Plachcinska, A.; Kusmierek, J.; Mikolajczak, R.; Kozak, J.; Rzeszutek, K.

    2006-01-01

    Aiming at comparison of diagnostic efficacy of 2 radiopharmaceuticals: 99m Tc-depreotide (Neospect, Amersham) and 99m Tc-EDDA/HYNIC-Tyr3-octreotide (Tektrotyd, Polatom), in differentiation between malignant and benign etiology of solitary pulmonary nodules (SPNs), radionuclide studies with 2 radiotracers were performed in 18 patients. For both radiopharmaceuticals the same acquisition and processing protocols were applied. Studies were acquired with SPECT technique, after administration of 740 MBq of activity. Scintigrams were assessed visually, as: positive (+), equivocal (±) and negative (-). Additionally, uptake intensity of both radiotracers in nodules was assessed semiquantitatively, using a tumour-to-background ratio. Verification of scintigraphic results was based in 14 cases upon a pathological examination of tumour samples (histopathology) and in the remaining 4 - on clinical observation and bacteriological studies. Normal scintigrams obtained with both diopharmaceuticals differed significantly. 99m Tc-depreotide was markedly accumulated in spine, sternum, ribs and lungs (mean lung/heart ratio = 2.2). This accumulation was not observed on 99m Tc- -EDDA/HYNIC-TOC scintigrams (mean lung/heart ratio = 0.7). In 6 patients a malignant etiology - lung cancer - was revealed (5 - adenocarcinoma, 1 - squamous cell) and the other 12 cases turned out to be benign (4 hamartomas, 3 tuberculomas, a tuberculous infiltrate, an alien body with inflammatory reaction, a hyperplasia of lymphatic tissue and 2 cases of unknown etiology, from which one had a stable size and the other resolved during a 6 month observation period). In all 6 cases of lung cancer positive results were obtained with both tracers. Moreover, in 2 patients metastases in mediastinum could be observed on scintigrams obtained with both radiopharmaceuticals. From among 12 cases of benign etiology 6 99m Tc-depreotide scintigrams were true negative, 1 - equivocal and 5 - false positive, whereas 6 99m Tc

  2. The effect of hydro-ethanolic extract of Curcuma longa rhizome and curcumin on total and differential WBC and serum oxidant, antioxidant biomarkers in rat model of asthma

    Science.gov (United States)

    Shakeri, Farzaneh; Soukhtanloo, Mohammad; Boskabady, Mohammad Hossein

    2017-01-01

    Objective(s): The effects of Curcuma longa (C. longa) and curcumin on total and differential WBC count and oxidant, antioxidant biomarkers, in rat model of asthma were evaluated. Materials and Methods: Total and differential WBC count in the blood, NO2, NO3, MDA, SOD, CAT and thiol levels in serum were examined in control, asthma, Asthmatic rats treated with C. longa (0.75, 1.50, and 3.00 mg/ml), curcumin (0.15, 0.30, and 0.60 mg/ml), and dexamethasone (1.25 μg/ml) rats. Results: Total and most differential WBC count, NO2, NO3 and MDA were increased but lymphocytes, SOD, CAT and thiol were decreased in asthmatic animals compared to controls (Plonga and curcumin compared to asthmatic group (Plonga and curcumin (Plonga extract and its constituent curcumin in animal model of asthma was observed which suggest a therapeutic potential for the plant and its constituent on asthma. PMID:28293392

  3. Distribution of In-111 in granulocyte and other cellular elements of blood (CEB) in human In-111-labeled mixed white cell (MWC) and platelet preparations

    International Nuclear Information System (INIS)

    Dewanjee, M.K.; Chowdhury, S.; Brown, M.L.; Wahner, H.W.

    1984-01-01

    A large number of platelets (PLT), red blood cells (RBC) are present along with granulocyte (GC) in In-111 in CEB was determined by Ficoll-Hypaque gradient (FHG) centrifugation of In-111-MWC and PLT preparation as a quality control procedure. MWC were separated by sedimentation with hydroxyethyl starch; PLT by differential centrifugation. MWC and PLT were labeled with In-111-oxine in saline, ACD-saline or with In-111-tropolone in 0.5 ml of ACD-plasma. 0.3-0.5 ml of labeled cell suspended in plasma was layered on 3 ml FHG of two densities (1.119 and 1.077 gm/ml) and spun in a clear polystyrene tube at 1800 G for 30 min. Four layers (plasma, PLT, GC, and RBC) were separated, and In-111 radioactivity in each fraction was determined with a gamma counter. Simultaneously cell types in MWC and PLT preparations were determined by Coulter counter and differential counting. Most of In-111 in In-MWC is associated with the PLT and RBC, GC/lymphocyte ratio is 6/4. GC has higher extraction efficiency than RBC and PLT. PLT preparation is pure and (96 +- 3)% of In-111 is bound to PLT, (4 +- 3)% to RBC and (0.2 +- 0.1)% to GC; PLT preparation contains PLT (97 +- 3)%, RBC (4 +- 3)% and GC (0.2 +- 0.1)%

  4. Role of cranial radiotherapy for childhood T-cell acute lymphoblastic leukemia with high WBC count and good response to prednisone. Associazione Italiana Ematologia Oncologia Pediatrica and the Berlin-Frankfurt-Münster groups.

    Science.gov (United States)

    Conter, V; Schrappe, M; Aricó, M; Reiter, A; Rizzari, C; Dördelmann, M; Valsecchi, M G; Zimmermann, M; Ludwig, W D; Basso, G; Masera, G; Riehm, H

    1997-08-01

    The ALL-BFM 90 and AIEOP-ALL 91 studies share the same treatment backbone and have 5-year event-free survival (EFS) rates close to 75%. This study evaluated the impact of differing presymptomatic CNS therapies in T-cell acute lymphoblastic leukemia (T-ALL) patients with a good response to prednisone (PGR) according to WBC count and Berlin-Frankfurt-Münster (BFM) risk factor (RF). A total of 192 patients (141 boys; median age, 7.5 years) with T-ALL, PGR, RF less than 1.7, and no CNS leukemia diagnosed between 1990 and 1995 were enrolled onto the ALL-BFM 90 (n = 123) or AIEOP-ALL 91 (n = 69) study. Presymptomatic CNS therapy consisted of cranial radiation (CRT) and intrathecal methotrexate (I.T. MTX) (11 doses) in the BFM study and of extended triple intrathecal therapy (T.I.T.) (17 doses) in the Associazione Italiana Ematologia Oncologia Pediatrica (AIEOP) study. Patients were divided into a low-WBC group (WBC count 100,000/microL). EFS was compared using the log-rank test. For patients treated with CRT and I.T. MTX (BFM group), the 3-year EFS rate was 89.8% (SE = 3.5) for 99 patients in the low-WBC group versus 81.9% (SE = 8.2) in the high-WBC group (difference not significant). Conversely, for patients treated with T.I.T. alone (AIEOP group), the EFS rate was 80.6% (SE = 5.6) in 55 patients with a low WBC count versus 17.9% (SE = 11.0) in 14 patients with a high WBC count (P < .001). These data suggest that CRT may not be necessary in PGR T-ALL patients with a WBC count less than 100,000/microL; on the contrary, in patients with a high count, extended T.I.T. may be inferior to CRT and I.T. MTX.

  5. Evaluation of possible hip prosthesis infection with In-111 leukocyte scintigraphy

    International Nuclear Information System (INIS)

    Noto, R.B.; Alavi, A.; Star, A.M.; Cuckler, J.M.; Eisenberg, B.

    1987-01-01

    To evaluate the utility of In-111 leukocyte scintigraphy in patients with possible hip prosthesis infection, the authors retrospectively reviewed 44 such scans without clinical history. The results of In-111 leukocyte scans were compared with intraoperative cultures obtained at the time of prosthesis revision in 34 patients, with hip aspirates and/or clinical follow-up obtained in the remaining ten patients. This comparison yielded a 71% sensitivity, 78% specificity, and 77% overall accuracy. They conclude that In-111 leukocyte scans can be helpful in the evaluation of suspected hip prosthesis infection, but they are not as accurate as has been previously reported elsewhere

  6. Study of the counting efficiency of a WBC setup by using a computational 3D human body library in sitting position based on polygonal mesh surfaces.

    Science.gov (United States)

    Fonseca, T C Ferreira; Bogaerts, R; Lebacq, A L; Mihailescu, C L; Vanhavere, F

    2014-04-01

    A realistic computational 3D human body library, called MaMP and FeMP (Male and Female Mesh Phantoms), based on polygonal mesh surface geometry, has been created to be used for numerical calibration of the whole body counter (WBC) system of the nuclear power plant (NPP) in Doel, Belgium. The main objective was to create flexible computational models varying in gender, body height, and mass for studying the morphology-induced variation of the detector counting efficiency (CE) and reducing the measurement uncertainties. First, the counting room and an HPGe detector were modeled using MCNPX (Monte Carlo radiation transport code). The validation of the model was carried out for different sample-detector geometries with point sources and a physical phantom. Second, CE values were calculated for a total of 36 different mesh phantoms in a seated position using the validated Monte Carlo model. This paper reports on the validation process of the in vivo whole body system and the CE calculated for different body heights and weights. The results reveal that the CE is strongly dependent on the individual body shape, size, and gender and may vary by a factor of 1.5 to 3 depending on the morphology aspects of the individual to be measured.

  7. Rapid, high-efficiency labeling of leukocytes with In-111 after hemolytic removal of erythrocytes

    International Nuclear Information System (INIS)

    Karesh, S.M.; Henkin, R.E.

    1985-01-01

    During the labeling of leukocytes with Indium-111, conventional methodology involves separation and washing to remove red cells. This technique results in the loss of a significant number of leukocytes. Citrated whole blood of ten normal volunteers was studied for an alternate labeling method following sedimentation for 30 to 45 minutes and low speed centrifugation of the leukocyte-rich plasma. The average labeling for these ten volunteers by Indium-111 was 90% versus 60% by the older technique. Viability as measured by the trypan blue exclusion test was greater than 95%, WBC losses were essentially zero, and no WBC clumping was observed. Eighteen patients referred for leukocyte imaging were studied by this method. In this patient population, there was 91% labeling with viability greater than 95% and no evidence of clumping. Less than 5% RBC's were noted in any lot. Indium-111 WBC activity 20 minutes post injection averaged 79% of whole blood activity. This modification results in decreased losses of white cells, reduces preparation time to less than 2 hours, and significantly improves the labeling efficiency of the final product. Liver/spleen ratios and image quality were unchanged from the original method

  8. In-111-leukocyte scintigraphy for detection of infection associated with peritoneal dialysis catheters

    Energy Technology Data Exchange (ETDEWEB)

    Kipper, S.L.; Steiner, R.W.; Witztum, K.F.; Basarab, R.M.; Kipper, M.S.; Halpern, S.E.; Ashburn, W.L.

    1984-05-01

    In-111-labeled leukocytes were administered to 13 patients on continuous ambulatory peritoneal dialysis in order to locate catheter-associated infections. Using a marker to indicate the catheter exit site, infections of the catheter tunnel were correctly identified prior to surgery in 4 patients with relapsing peritonitis and infections of the exit site were diagnosed in 5 out of 7 patients. The authors conclude that In-111-leukocyte scintigraphy appears to be accurate in diagnosing peritoneal infections of the dialysis catheter tunnel.

  9. Size Dependent Biodistribution and SPECT Imaging of In-111-Labeled Polymersomes

    NARCIS (Netherlands)

    Brinkhuis, Rene P.; Stojanov, Katica; Laverman, Peter; Eilander, Jos; Zuhorn, Inge S.; Rutjes, Floris P. J. T.; van Hest, Jan C. M.

    Polymersomes, self-assembled from the block copolymer polybutadiene-block-poly(ethylene glycol), were prepared with well-defined diameters between 90 and 250 nm. The presence of similar to 1% of diethylene triamine penta acetic acid on the polymersome periphery allowed to chelate radioactive In-111

  10. In-111-labeled leukocytes in the diagnosis of rejection and cytomegalovirus infection in renal transplant patients

    International Nuclear Information System (INIS)

    Forstrom, L.A.; Loken, M.K.; Cook, A.; Chandler, R.; McCullough, J.

    1981-01-01

    Indium-111-labeled (In-111) leukocytes have been shown to be useful in the localization of inflammatory processes, including renal transplant rejection. Using previously reported labeling methods, 63 studies with this agent have been performed in 53 renal transplant patients. Indications for study included suspected rejection or cytomegalovirus (CMV) infection. Studies were performed in 33 men and 20 women, with ages ranging from 6 to 68 years. Autologous cells were normally used for labeling, although leukocytes obtained from ABO-compatible donors were used in three subjects. Rectilinear scanner and/or scintillation camera images were obtained at 24 hours after intravenous administration of 0.1 to 0.6 mCi of In-111-leukocytes. There was abnormal uptake of In-111-leukocytes in the transplanted kidney in 11 of 15 cases of rejection. In three additional cases of increased transplant uptake, CMV infection was present in two. Abnormal lung uptake was present in 13 of 14 patients with CMV infection. In four additional cases, increased lung uptake was associated with other pulmonary inflammatory disease. Increased lung activity was not seen in patients with uncomplicated transplant rejection. These results suggest that In-111-leukocyte imaging may be useful in the differential diagnosis of rejection versus CMV infection in renal transplant patients

  11. In-111-labeled leukocytes in the diagnosis of rejection and cytomegalovirus infection in renal transplant patients

    International Nuclear Information System (INIS)

    Forstrom, L.A.; Loken, M.K.; Cook, A.; Chandler, R.; McCullough, J.

    1981-01-01

    Indium-111-labelled (In-111) leukocytes have been shown to be useful in the localization of inflammatory processes, including renal transplant rejection. Using previously reported labelling methods, 63 studies with this agent have been performed in 53 renal transplant patients. Indications for study included suspected rejection or cytomegalovirus (CMV) infection. Studies were performed in 33 men and 20 women, with ages ranging from 6 to 68 years. Autologous cells were normally used for labeling, although leukocytes obtained from ABO-compatible donors were used in three subjects. Rectilinear scanner and/or scintillation camera images were obtained at 24 hours after intravenous administration of 0.1 to 0.6 mCi of In-111 leukocytes. There was abnormal uptake of In-111-leukocytes in the transplanted kidney in 11 of 15 cases of rejection. In three additional cases of increased transplant uptake, CMV infection was present in two. Abnormal lung uptake was present in 13 of 14 patients with CMV infection. In four additional cases, increased lung uptake was associated with other pulmonary inflammatory disease. Increased lung activity was not seen in patients with uncomplicated transplant rejection. These results suggest that In-111-leukocyte imaging may be useful in the differential diagnosis of rejection versus CMV infection in renal transplant patients

  12. Scintigraphic detection of gastric and pancreatic carcinomas with In-111 ZCE 025 monoclonal antibody

    International Nuclear Information System (INIS)

    Abdel-Nabi, H.H.; Schwartz, A.N.; Wechter, D.G.; Higano, C.S.; Ortman-Nabi, J.A.; Unger, M.W.

    1991-01-01

    We have evaluated the role of In-111 anti-CEA (carcinoembryonic antigen) monoclonal antibody ZCE 025 in 8 patients. Three patients had a confirmed diagnosis of gastric carcinoma. Three had a confirmed diagnosis of pancreatic carcinoma. Two patients had elevated serum levels of CEA with no known primary. Each patient received 5.5 mCi In-111 ZCE 025 infused at doses of 10-80 mg. Planar and single photon emission computed tomography (SPECT) imaging at 3 and 7 days after infusion detected 9 of 12 known tumor sites and all 5 of the previously identified sites of metastasis. In-111 ZCE 025 MoAb imaging also found 6 previously unsuspected tumor sites and changed the preoperative evaluation in 50% of the patients studied. It changed the clinical management in 2 patients and established the site of primary involvement in 2 others. There were no clinical or biochemical reactions. In-111 ZCE 025 monoclonal antibody scintigraphy is a useful adjunct in the evaluation of patients with either gastric or pancreatic carcinoma. It may have a beneficial impact on the surgical decision making in these patients

  13. Imaging of cutaneous T cell lymphoma (CTCL) with In-111-T101 monoclonal antibody

    Energy Technology Data Exchange (ETDEWEB)

    Carrasquillo, J.A.; Bunn, P.A.; Keenan, A.M.; Reynolds, J.C.; Schroff, R.W.; Foon, K.A.; Ming-Hsu, S.; Gazdar, A.F.; Mulshine, J.M.; Perentesis, P.

    1985-05-01

    T101 is a murine monoclonal antibody (MoAb), IgC2a, directed against a cell surface pan T-cell antigen present in high concentration in CTCL cells. In-111 labelling was performed with a modification of the Krejcarek method (Hybritech, Inc.). I mg of DTPA conjugated T101 was labeled with 5 mCi, with a mean incorporation of 95%. Immunoreactivity was preserved, mean 88%. In vivo, less than 3.6% of the injected dose was on circulating transferrin. 11 patients (pts) received 2-6h intravenous infusion of 1 mg (5 pts), 10 mg (3 pts), 50 mg (3 pts) of In-111 T101. By 24h all pts showed avid uptake in pathologically or clinically involved nodes and erythroderma including several previously unsuspected nodal regions. Skin plaques were not visualized. In addition, there was localization in liver, spleen and bone marrow. Concentration of In-111 in biopsied nodes was 0.01, 0.02 and 0.03% of the injected dose per gram. Control studies with In-111Cl/sub 3/ or a nonspecific MoAb, 9.2.27, did not concentrate in nodes or skin disease. No dose dependent differences in tumor localization was seen although blood clearance was prolonged for doses less than or equal to 10 mgs of T101. All pts receiving less than or equal to 10 mgs developed transient itching, urticaria and chills. 1 of 8 pts tested had an antimouse immune response. Modulation of the antigen from circulating T-cells, skin and nodes was seen. This study shows the feasibility of imaging CTCL pts with In-111 T101 and suggest a potential for radioimmunotherapy.

  14. High-temperature method of rapid separation of In-111 from irradiated silver targets

    International Nuclear Information System (INIS)

    Mazgaj, Z.; Kolaczkowski, A.; Mikulski, J.; Novgorodov, A.F.; Zielinski, A.; Joint Inst. for Nuclear Research, Dubna

    1990-01-01

    A high-temperature method of separation of In-111 from α-particle activated silver targets was developed. The separation is carried out under reduced pressure, in the atmosphere of HCl and H 2 O vapours. Indium-111, adsorbed on a quartz collector, is washed out quantitatively with 0.1 N HCl. The contaminant, Cd-109 (product of decay of In-109), is removed from the preparation by means of ion-exchange chromatography. 4 tabs., 6 refs. (author)

  15. Colorectal carcinoma metastases: Detection with In-111-labeled monoclonal antibody CCR 086

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Nabi, H.H.; Levine, G.; Lamki, L.M.; Murray, J.L.; Tauxe, W.N.; Shah, A.N.; Patt, Y.Z.; Doerr, R.J.; Klein, H.A.; Gona, J. (Veterans Administration Medical Center, Buffalo, NY (USA))

    1990-07-01

    A phase I/II clinical trial with indium-111-labeled antimucin murine monoclonal antibody (MoAb) CCR 086 was conducted. Seventeen patients with histologically proved colorectal carcinoma and known metastatic disease underwent external scintigraphy after administration of 5.5 mCi (203.5 MBq) of In-111 CCR 086 at doses of 5 and 20 mg. Of 25 known lesions, 17 were detected (sensitivity, 68%). The smallest detected lesion in the lung was 1 cm and in the liver was 1.5 cm. The serum half-life of In-111-labeled CCR 086 MoAb was approximately 64 hours. The formation of human antimouse antibody (HAMA) was detected in the serum of four of five patients who received 20 mg of MoAb. No HAMAs were detected in four patients receiving 5 mg of MoAb. No side effects were encountered. Because of effective detection of liver and lung metastases with lower doses (5-20 mg) of CCR 086 conjugated with In-111, further investigations are warranted to assess clinical and therapeutic potentials of CCR 086 in the management of colorectal cancer.

  16. Colorectal carcinoma metastases: detection with In-111-labeled monoclonal antibody CCR 086.

    Science.gov (United States)

    Abdel-Nabi, H H; Levine, G; Lamki, L M; Murray, J L; Tauxe, W N; Shah, A N; Patt, Y Z; Doerr, R J; Klein, H A; Gona, J

    1990-07-01

    A phase I/II clinical trial with indium-111-labeled antimucin murine monoclonal antibody (MoAb) CCR 086 was conducted. Seventeen patients with histologically proved colorectal carcinoma and known metastatic disease underwent external scintigraphy after administration of 5.5 mCi (203.5 MBq) of In-111 CCR 086 at doses of 5 and 20 mg. Of 25 known lesions, 17 were detected (sensitivity, 68%). The smallest detected lesion in the lung was 1 cm and in the liver was 1.5 cm. The serum half-life of In-111-labeled CCR 086 MoAb was approximately 64 hours. The formation of human antimouse antibody (HAMA) was detected in the serum of four of five patients who received 20 mg of MoAb. No HAMAs were detected in four patients receiving 5 mg of MoAb. No side effects were encountered. Because of effective detection of liver and lung metastases with lower doses (5-20 mg) of CCR 086 conjugated with In-111, further investigations are warranted to assess clinical and therapeutic potentials of CCR 086 in the management of colorectal cancer.

  17. Colorectal carcinoma metastases: Detection with In-111-labeled monoclonal antibody CCR 086

    International Nuclear Information System (INIS)

    Abdel-Nabi, H.H.; Levine, G.; Lamki, L.M.; Murray, J.L.; Tauxe, W.N.; Shah, A.N.; Patt, Y.Z.; Doerr, R.J.; Klein, H.A.; Gona, J.

    1990-01-01

    A phase I/II clinical trial with indium-111-labeled antimucin murine monoclonal antibody (MoAb) CCR 086 was conducted. Seventeen patients with histologically proved colorectal carcinoma and known metastatic disease underwent external scintigraphy after administration of 5.5 mCi (203.5 MBq) of In-111 CCR 086 at doses of 5 and 20 mg. Of 25 known lesions, 17 were detected (sensitivity, 68%). The smallest detected lesion in the lung was 1 cm and in the liver was 1.5 cm. The serum half-life of In-111-labeled CCR 086 MoAb was approximately 64 hours. The formation of human antimouse antibody (HAMA) was detected in the serum of four of five patients who received 20 mg of MoAb. No HAMAs were detected in four patients receiving 5 mg of MoAb. No side effects were encountered. Because of effective detection of liver and lung metastases with lower doses (5-20 mg) of CCR 086 conjugated with In-111, further investigations are warranted to assess clinical and therapeutic potentials of CCR 086 in the management of colorectal cancer

  18. Kinetics and biodistribution of In-111 platelets in patients with bone marrow transplants, refractory to platelet transfusions

    International Nuclear Information System (INIS)

    Civelek, C.; Braine, H.; Scheffel, U.; Drew, H.; Koester, A.; LaFrance, N.; Kasecamp, W.; Wagner, H. Jr.

    1984-01-01

    The kinetics and biodistribution of HLA identical In-111 labeled platelets was studied in 10 leukemic patients with bone marrow transplants refractory to HLA matched platelet transfusions. Platelet survival time was short (x-bar +- SEM =1.64 +- 0.83 days). The mean recovery (extrapolated to zero time) was 29.9%, ranging from 14.2 to 63.0%. The deposition of the In-111 platelets in the liver and spleen was quantified by the geometric mean method using anterior and posterior imaging. In 3 patients liver uptake was significantly increased. The highest hepatic accumulation of In-111 occurred 2 hrs after injection (x-bar=76 +- 6% dose (SEM); at 48 hrs 62% of the dose remained in the liver. In 7 patients the spleen was the organ with the highest labeled platelet deposition. The splenic uptake of In-111 platelets in this group correlated with the spleen size (r=+0.95). At 30 min after injection 75+-6% of the dose was found in the spleen. Splenic activity decreased to 62% after 48 hrs. At the same time, In-111 liver accumulation increased from 14 to 31%. This finding suggests that In-111 may be released from the spleen and subsequently sequestered by the liver. Two patients with high splenic uptake underwent splenectomy after the In-111 platelet study. Both benefited from splenectomy in terms of platelet survival after transfusion

  19. Use of a new In-111-labeled solid meal for confirmation of the lag phase of gastric emptying

    International Nuclear Information System (INIS)

    Maurer, A.H.; Knight, L.S.; Siegel, J.A.; Scopinaro, F.; Perri, J.A.; Krevsky, B.; Fisher, R.S.; Malmud, L.S.

    1986-01-01

    It has been argued that the appearance of a lag phase in Tc-99m (140 keV) anterior gastric emptying (GE) studies may be artifactual. Since gastric emptying with In-111 (247 keV) is less dependent on attenuation, we have developed a new In-111 meal. Two eggs are mixed with In-111 oxine, cooked thoroughly, and eaten between two pieces of toast. In vitro stability was studied by incubating the In-111 egg in human gastric juice at 37 0 C for 3 hours (97.0% +- 0.6% was bound). In five normal volunteers the mean t1/2 for gastric emptying was 87 +- 12 minutes. This was not significantly different from the Tc-99m normal value (77 +- 10 minutes) we have measured. A lag phase for the In-111-containing egg was present in each case (mean, 40 +- 8 minutes). The authors conclude that an In-111 meal can confirm the presence of a physiologic lag phase

  20. Comparative Analysis of99mTc-MDP Three-Phase Bone Scan with SPECT/CT and99mTc-HMPAO-Labeled WBC SPECT/CT in the Differential Diagnosis of Clinically Suspicious Post-traumatic Osteomyelitis.

    Science.gov (United States)

    Kim, Chanwoo; Lee, Soo Jin; Kim, Ji Young; Hwang, Kyu Tae; Choi, Yun Young

    2017-03-01

    To identify differences between three-phase bone scan and SPECT/CT (TBS) and WBC SPECT/CT (WS) and compare diagnostic accuracies of each modality in patients with suspicious post-traumatic osteomyelitis (OM). Twenty-one patients with suspicious post-traumatic OM were enrolled. All patients performed TBS and WS within 1 week. Foci of MDP and WBC accumulation were divided into three categories: bone (OM), soft tissue (soft tissue inflammation; STI), negative for inflammation (NI). Confirmative diagnosis was made upon operative pathology or long-term clinical follow-up. Of 21 patients, four OM, eight STI, nine NI were finally diagnosed. TBS diagnosis was correct in three of four positive cases and nine of 17 negative cases. Sensitivity, specificity, accuracy, positive predictive value (PPV), negative predictive value (NPV) of TBS were 75 %, 52.9 %, 57.1 %, 27.3 %, 90 %. WS diagnosis was correct in two of four positive cases and 17 of 17 negative cases. Sensitivity, specificity, accuracy, PPV, NPV were 50 %, 100 %, 81.0 %, 100 %, 89.5 %. Twelve of 21 cases showed agreement between TBS and WS. TBS misdiagnosed nine cases (six STI and two NI as eight OM; one OM as one STI), while WS misdiagnosed four cases (two OM as two STI; two STI as two NI). Combining results from TBS and WS led to better diagnostic accuracy (91.7 %) than either TBS or WS alone. TBS and WS showed moderate agreement in assessment of clinically suspected post-traumatic OM. WS better evaluated inflammation than TBS. WS tended to underestimate inflammation whereas TBS tended to overestimate inflammation. Combining TBS and WS enhanced diagnostic accuracy.

  1. In-111-oxine red cells for imaging of intermittent G.I. bleeding sites

    International Nuclear Information System (INIS)

    Marcus, C.S.; Angulo, M.C.; Salk, R.D.; Essex, C.E.

    1985-01-01

    Sequential daily abdominal imaging was performed for up to 7 days in 11 patients with intermittent G.I. bleeding after the intravenous administration of lmCi autologous In-111-oxine labeled RBC's. The bleeding sites were identified in 3 patients. The causes were colon carcinoma, diverticulitis, and eroding distal aortic aneutysm. In addition to the imaging information, the authors have obtained preliminary biodistribution and kinetic data on the In-RBC's. Distribution to liver, spleen, and bone marrow was approximately 40%, 40%, and 20%, respectively. (This does not include the quantity of In-111 in the blood pool, which is very high initially and declines with time.) The survival of circulating In-RBC's is described by the equation: Surviving fraction=0.26e/sup -0.0021t/+0.74e/sup -0.00083t/ The halflives of the fast and slow components (x-bar+-x-bar) are 33.4 +- 1.6 hours and 35.0 +- 1.25 days, respectively. The In-oxine label is less stable than Cr-51 but more stable than Tc-99m. At 24 hours, Cr-RBC/In-RBC survival is 1.11 and Cr-RBC/Tc-RBC survival is 1.23. This imaging procedure is quite useful in selected patients

  2. In-111 oxine autologous labeled platelets in the diagnosis of kidney graft rejection

    International Nuclear Information System (INIS)

    Martin-Comin, J.; Roca, M.; Grino, J.M.; Paradell, C.; Caralps, C.

    1983-01-01

    The usefulness of In-111 oxine labeled autologous platelets in the diagnosis of renal graft rejection was studied. The method is based on imaging of the graft area at 4, 24, 48, and 72 hours after the injection of the labeled cells. The study was done in 31 renal transplant recipients. The control group included four patients with normal renal function without evidence of rejection. No platelet uptake was observed in any of them. The study group included 22 patients with acute rejection which was confirmed histologically in 13. One case of chronic vascular type rejection of the graft tracer uptake was seen. There was a false-positive result due to a perirenal hematoma. In three patients with a non-immunological sudden impairment of renal function, no activity was detected in the graft area. We also evaluated the changes in platelet trapping throughout the study and they seemed to correlate with the response to the antirejection therapy

  3. In vivo crossmatching with Tc-99m-RBC's and In-111-oxine-RBC's

    International Nuclear Information System (INIS)

    Marcus, C.S.; Myhre, B.A.; Angulo, M.C.; Salk, R.D.; Essex, C.E.

    1984-01-01

    In vitro crossmatching techniques are often inadequate for patients who have received multiple prior transfusions. These patients usually have multiple antibodies to minor blood groups, not all of which are necessarily important to vivo. It becomes increasingly difficult to obtain appropriate units for transfusion, and often units are used with hopes that a minor group antibody will not be significantly active in vivo. If a transfusion reaction occurs, the unit is stopped. The authors have developed and successfully tested a method whereby 1.5 to 3c of potential donor RBC's are labeled with 25-50 μCi of Tc-99m using the BNL kits. After injection, samples are drawn at 10, 20, 60, and 120 minutes and the RBC survival is measured. If it is desirable to test 2 units simultaneously, the authors use 400 μCi Tc-99m to label an RBC aliquot of one unit and 25 μCi In-111-oxine to label the other; both labeled aliquots are injected together. The method is simple and reliable. In addition to assessing compatibility, the authors may also estimate the % viability of transfused, compatible RBC's by starting with 400 μCi of Tc-99m and multiplying % survival at 24 hours by 1.2. For 24 hr. survival measurements of IN-111-oxine-RBC's, 25 μCi is adequate and no multiplication factor is necessary. The authors have performed 13 in vivo crossmatches, 4 of which were double, in 6 patients. One documented mild transfusion reaction occurred. There were no false positive or false negative results

  4. WBC (White Blood Cell) Differential Count

    Science.gov (United States)

    ... exposure to toxic chemicals (such as lye or insecticides) can increase the risk of an abnormal differential. ... before they are fully mature. This is a natural immune response to infection and inflammation. My complete ...

  5. Breast cancer imaging with In-111 human IgM monoclonal antibodies: preliminary studies.

    Science.gov (United States)

    Ryan, K P; Dillman, R O; DeNardo, S J; DeNardo, G L; Beauregard, J; Hagan, P L; Amox, D G; Clutter, M L; Burnett, K G; Rulot, C M

    1988-04-01

    Detection of specific tumor sites was studied with scintigraphy and radiolabeled human IgM monoclonal antibodies (MoAbs). Ten patients with metastatic breast cancer received an infusion of one of three indium-111-labeled anti-breast carcinoma MoAbs. The time of infusion ranged from 30 minutes to 2 hours. Three patients received YBB-190 at total doses of 2, 4.25, or 11 mg, four patients received YBM-209 at total doses of 1 mg (n = 1) or 20 mg (n = 3), and three patients each received 22 mg of YBY-088. Imaging was performed immediately after infusion and at 4, 24, 48, 72, 120, and 144 hours. Many presumed sites of metastatic disease were imaged in three of the four patients who received 20 mg of YBM-209 and in two of the three patients who received YBY-088. Tumor was not detected in any of the patients who received YBB-190, in the patient who received a 1-mg dose of YBM-209, or in the patient who received YBY-088 and in whom a biopsy of tumor tissue failed to demonstrate target antigen. The authors conclude that In-111-labeled human IgM MoAbs can target human breast cancer, but antigen expression and antibody dose determine successful immunoscintigraphy.

  6. Cellular basis for accumulation of In-111-labeled leukocytes and platelets in rejecting cardiac allografts: concise communication

    International Nuclear Information System (INIS)

    Wang, T.S.T.; Oluwole, S.; Fawwaz, R.A.; Wolff, M.; Kuromoto, N.; Satake, K.; Hardy, M.A.; Alderson, P.O.

    1982-01-01

    Biodistribution and imaging studies in rats showed that In-111-labeled leukocytes and platelets accumulate progressively with time after transplantation in cardiac allografts undergoing rejection, but do not accumulate in normal syngeneic heart grafts. Maximum heart allograft-to-blood ratios of 9:1 were obtained, and allograft-to-native heart ratios of 17:1. Microscopic studies of the rejecting cardiac allografts showed that histologic findings paralleled the cellular changes predicted by the radionuclide studies. Intravenously administered Ga-67 citrate and Tc-99m sulfur colloid failed to show significant accumulation in rejecting grafts. The findings suggest that cellular rejection, rather than nonspecific inflammatory changes, is the primary basis for accumulation of In-111 leukocytes and platelets in rejecting cardiac allografts

  7. Cerebral perfusion imaging with albumin microspheres tagged with Tc-99m and In-111 in cases with internal carotid occlusion.

    Science.gov (United States)

    Etani, H; Kimura, K; Yoneda, S; Tsuda, Y; Isaka, Y; Nakamura, M; Asai, T

    1982-09-01

    Cerebral perfusion imaging with dual-tracer (Tc-99m and In-111) human albumin microspheres (HAM scintigraphy) was performed in 15 cases with unilateral occlusion of the internal carotid artery, for the diagnosis and evaluation of collateral circulation patterns. After injection of Tc-99m microspheres into one common carotid artery and In-111 HAMs into the other, two perfusion images, one for each carotid artery, were clearly differentiated by appropriate pulse-height discrimination. With this method, diagnosis of internal carotid artery occlusion was definitely made in eight patients, suspected in six, and missed in one. The collateral perfusion areas from the contralateral ICA and ipsilateral external carotid artery were well demonstrated by this method, and the scintigraphic results agreed well with the angiographic findings in all cases. Dual-tracer HAM scintigraphy is capable of adding information about collaterals at the capillary level to the anatomic information obtained by angiography.

  8. Biodistribution and pharmacokinetics of In-111-labeled Stealth{reg_sign} liposomes in patients with solid tumours

    Energy Technology Data Exchange (ETDEWEB)

    Harrington, K.J.; Peters, A.M.; Mohammadtaghi, S. [Hammersmith Hospital, London (United Kingdom)] [and others

    1996-05-01

    The use of liposomal doxorubicin yields response rates of up to 70-80% in patients with AIDS-related Kaposi`s sarcoma with favourable alteration of the toxicity profile of the drug. Liposomal delivery of therapy in patients with solid cancers is currently under investigation. Our aim is to determine the biodistribution and pharmacokinetics of In-111-labeled Stealth{reg_sign} liposomes (SEQUUS{trademark}) liposomes (SEQUUS{trademark} Pharmaceuticals Inc., Menlo Park, USA) in patients with advanced solid malignant tumours. Ten patients (4 male, 6 female) with a median age of 59 (range 43 - 75) received 100 MBq of In-111-labeled Stealth{reg_sign} liposomes. Four had breast cancer, 3 head and neck tumours, 2 lung and 1 cervical cancer. Blood samples and whole body gamma camera images were obtained at 0.5, 4, 24, 48, 72, 96 and 240 hours after injection and sequential 24 hour urine collections were performed for the first 96 h. SPECT imaging was performed when indicated. High definition images of tumours were obtained in 9 patients (3/4 breast, 3/3 head and neck, 2/2 lung and 1/1 cervix cancers). One patient (breast cancer) had negative images. The median cumulative urinary excretion of In-111 over the first 96 h was 17.8 (range 3.5-21.3) % of the injected dose. The uptake of liposomes in various tissues was estimated from regions of interest on the whole body images. Prominent uptake was seen in the liver (10-15% of injected dose), lungs (4-9%) and spleen (2-8%). Tumour uptake in the first 96 h varied form 0.5-4% of the injected dose. This is approximately 10 fold higher than might be expected from experience with other targeting methods (eg monoclonal antibodies). These data confirm that Stealth liposomes have a prolonged circulation half-life and localise to solid tumour tissue.

  9. Concentration of In-111-oxine-labeled autologous leukocytes in noninfected and nonrejecting renal allografts: concise communication

    International Nuclear Information System (INIS)

    Collier, B.D.; Isitman, A.T.; Kaufman, H.M.; Rao, S.A.; Knobel, J.; Hellman, R.S.; Zielonka, J.S.; Pelc, L.

    1984-01-01

    Autologous leukocytes labeled with In-111 oxine (ILL) concentrated in the renal allografts of eight patients for whom transplant rejection, infection, or acute tubular necrosis (ATN) could be excluded. All patients had good-to-adequate renal function at the time of ILL scintigraphy, and none developed rejection or renal transplant failure during a 1-mo follow-up period. It is concluded that normally functioning renal allografts without evidence of rejection, infection, or ATN often will concentrate ILL. When a baseline study is not available for comparison, this phenomenon limits the value of ILL scintigraphy as a diagnostic test for transplant rejection or infection

  10. Tracking of In-111-labeled human umbilical tissue-derived cells (hUTC) in a rat model of cerebral ischemia using SPECT imaging

    International Nuclear Information System (INIS)

    Arbab, Ali S; Chopp, Michael; Thiffault, Christine; Navia, Bradford; Victor, Stephen J; Hong, Klaudyne; Zhang, Li; Jiang, Quan; Varma, Nadimpalli RS; Iskander, ASM

    2012-01-01

    In order to increase understanding of how infused cells work, it becomes important to track their initial movement, localization, and engraftment efficiency following transplantation. However, the available in vivo cell tracking techniques are suboptimal. The study objective was to determine the biodistribution of intravenously administered Indium-111 (In-111) oxine labeled human umbilical tissue-derived cells (hUTC) in a rat model of transient middle cerebral occlusion (tMCAo) using single photon emission computed tomography (SPECT). Rats received 3 million In-111 labeled hUTC (i.v.) 48 hrs after tMCAo. Following the administration of either hUTC or equivalent dose of In-111-oxine (18.5 MBq), animals underwent SPECT imaging on days 0, 1, and 3. Radioactivity in various organs as well as in the stroke area and contralateral hemisphere was determined, decay corrected and normalized to the total (whole body including head) radioactivity on day 0. Immunohistochemical analysis was also performed to confirm the beneficial effects of hUTC on vascular and synaptic density, and apoptosis. Most of the radioactivity (43.36±23.07% on day 0) trafficked to the lungs immediately following IV administration of In-111 labeled hUTC (day 0) and decreased drastically to 8.81±7.75 and 4.01±4.52% on days 1 and 3 post-injection, respectively. In contrast, radioactivity measured in the lung of animals that received In-111-oxine alone remained relatively unchanged from day 0 to day 1 (18.38±5.45% at day 0 to 12.59±5.94%) and decreased to 8.34±4.25% on day 3. Significantly higher radioactivity was observed in stroke areas of animals that received In-111 labeled hUTC indicating the presence of cells at the site of injury representing approximately 1% of total administered dose. In addition, there was significant increase in vascular and synaptophysin immunoreactivity in stroke areas of rats that received In-111 labeled hUTC. The present studies showed the tracking of In-111 labeled h

  11. In-111 labeled polyclonal anticollagen antibody (Type I): Detection and kinetics of tissue injury in a murine model

    International Nuclear Information System (INIS)

    Zoghbi, S.S.; Gottschalk, A.

    1986-01-01

    The authors evaluated type I anticollagen antibody (Ac-Ab-I) for the scintigraphic detection of subclinical crush injury in the rat tail. After cannulating the rat jugular vein to provide ready vascular access, we injected radiolabeled proteins at intervals after the injury. Using In-111-DTA-labeled Ac-Ab-I and sheep immunoglobulin G (IgG) as a control, they found that net uptake ratios (Ac-Ab-I/sheep IgG) from acute, 24 hour, and 48-hour experiments ranged from 1.7 to 2.4, with target uptake scintigraphically visible up to 48 hours after injury. At 72 hours, target uptake diminished. They conclude that imaging of subclinical crush injury in a murine model is feasible, and that significant temporal latitude exists to provide potential flexibility for diagnostic use

  12. [Comparison of endoscopy, radiology and scintigraphy with Tc-99m-exametazine labeled leukocytes and In-111 labeled human polyclonal immunoglobulin G in the diagnosis of inflammatory bowel disease].

    Science.gov (United States)

    de Lima Ramos, P A; Martín-Comin, J; Muñoz, A; Baliellas, C; Vilar, L; Roca, M; Ramos, M

    1998-09-12

    The 99mTc-exametazine labelled leukocytes (99mTc-WBC) scintigraphy is an established method for the inflammatory bowel disease (IBD) diagnosis, but the labelled procedure is a large and laborious process. The 111In-labelled human polyclonal immunoglobulin G (111In-IgG) can be an alternative in the non invasive IBD diagnosis. Thirty-four patients routinely referred for investigation of IBD were studied. The 99mTc-WBC and 111In-IgG were simultaneously injected and images were obtained at 30 min, 3 and 24 h post-injection. The diagnostic was established by histology of endoscopy and/or surgery samples. Images were blindly evaluated by two experienced observers who only knew of the clinical suspicion of IBD. IBD was confirmed in 27 patients (17 with Crohn's disease [CD] and 10 with ulcerative colitis [UC]). Sensitivity, specificity and accuracy were 88.5, 100 and 90.3% respectively for endoscopy, 73.7, 75 and 73.9% for radiology, 59.3, 85.7 and 64.7% for 111In-IgG scan and 96.3, 85.7 and 94.1% for 99mTc-WBC scan. In the diagnosis of CD involvement of small bowel, the 99mTc-WBC scan identified 9/11 patients with confirmed disease, whereas the 111In-IgG scan diagnosed only four of them. In the evaluation of colonic disease, the 99mTc-WBC scan correctly diagnosed 21/22 confirmed patients, being the 111In-IgG scan positive in 13 of them. As far as disease extension concerned, the 99mTc-WBC demonstrated a statistically significance rather number of disease segments than endoscopy, radiology and 111In-IgG scan. The 99mTc-WBC was an effective method in the diagnosis of suspected IBD patients, both in the evaluation of small bowel disease and colonic disease, with slightly best results for colonic disease, whereas the 111In-IgG scan seems to have no utility neither in diagnosis nor in extension evaluation of IBD.

  13. Electric field dependence of the spin relaxation anisotropy in (111) GaAs/AlGaAs quantum wells

    International Nuclear Information System (INIS)

    Balocchi, A; Amand, T; Renucci, P; Duong, Q H; Marie, X; Wang, G; Liu, B L

    2013-01-01

    Time-resolved optical spectroscopy experiments in (111)-oriented GaAs/AlGaAs quantum wells (QWs) show a strong electric field dependence of the conduction electron spin relaxation anisotropy. This results from the interplay between the Dresselhaus and Rashba spin splitting in this system with C 3v symmetry. By varying the electric field applied perpendicular to the QW plane from 20 to 50 kV cm −1 the anisotropy of the spin relaxation time parallel (τ s ∥ ) and perpendicular (τ s ⊥ ) to the growth axis can be first canceled and eventually inversed with respect to the one usually observed in III–V zinc-blende QW (τ s ⊥ = 2τ s ∥ ). This dependence stems from the nonlinear contributions of the k-dependent conduction band spin splitting terms which begin to play the dominant spin relaxing role while the linear Dresselhaus terms are compensated by the Rashba ones through the applied bias. A spin density matrix model for the conduction band spin splitting including both linear and cubic terms of the Dresselhaus Hamiltonian is used which allows a quantitative description of the measured electric field dependence of the spin relaxation anisotropy. The existence of an isotropic point where the spin relaxation tensor reduces to a scalar is predicted and confirmed experimentally. The spin splitting compensation electric field and collision processes type in the QW can be likewise directly extracted from the model without complementary measurements. (paper)

  14. Comparative analysis of {sup 99m}Tc-MDP three-phase bone scan with SPECT/CT and {sup 99m}Tc-HMPAO-labeled WBC SPECT/CT in the differential diagnosis of clinically suspicious post-traumatic osteomyelitis

    Energy Technology Data Exchange (ETDEWEB)

    KIm, Chan Woo; Lee, Soo Jin; Kim, Ji Young; Hwang, Kyu Tae; Choi, Yun Young [Hanyang University Medical CenterSeoul (Korea, Republic of)

    2017-03-15

    To identify differences between three-phase bone scan and SPECT/CT (TBS) and WBC SPECT/CT (WS) and compare diagnostic accuracies of each modality in patients with suspicious post-traumatic osteomyelitis (OM). Twenty-one patients with suspicious post-traumatic OM were enrolled. All patients performed TBS and WS within 1 week. Foci of MDP and WBC accumulation were divided into three categories: bone (OM), soft tissue (soft tissue inflammation; STI), negative for inflammation (NI). Confirmative diagnosis was made upon operative pathology or long-term clinical follow-up. Of 21 patients, four OM, eight STI, nine NI were finally diagnosed. TBS diagnosis was correct in three of four positive cases and nine of 17 negative cases. Sensitivity, specificity, accuracy, positive predictive value (PPV), negative predictive value (NPV) of TBS were 75 %, 52.9 %, 57.1 %, 27.3 %, 90 %. WS diagnosis was correct in two of four positive cases and 17 of 17 negative cases. Sensitivity, specificity, accuracy, PPV, NPV were 50 %, 100 %, 81.0 %, 100 %, 89.5 %. Twelve of 21 cases showed agreement between TBS and WS. TBS misdiagnosed nine cases (six STI and two NI as eight OM; one OM as one STI), while WS misdiagnosed four cases (two OM as two STI; two STI as two NI). Combining results from TBS and WS led to better diagnostic accuracy (91.7 %) than either TBS or WS alone. TBS and WS showed moderate agreement in assessment of clinically suspected post-traumatic OM. WS better evaluated inflammation than TBS. WS tended to underestimate inflammation whereas TBS tended to overestimate inflammation. Combining TBS and WS enhanced diagnostic accuracy.

  15. Unsuspected osteomyelitis in diabetic foot ulcers. Diagnosis and monitoring by leukocyte scanning with indium in 111 oxyquinoline

    International Nuclear Information System (INIS)

    Newman, L.G.; Waller, J.; Palestro, C.J.; Schwartz, M.; Klein, M.J.; Hermann, G.; Harrington, E.; Harrington, M.; Roman, S.H.; Stagnaro-Green, A.

    1991-01-01

    The prevalence of osteomyelitis in diabetic foot ulcers is unknown. Early diagnosis of this infection is critical, as prompt antibiotic treatment decreases the rate of amputation. The authors therefore assessed the prevalence of osteomyelitis in 35 diabetic patients with 41 foot ulcers. They compared results of roentgenograms, leukocyte scans with indium In 111 oxyquinoline, and bone scans with the diagnostic criterion standards of bone histologic and culture findings. Leukocyte scans were repeated at 2- to 3-week intervals during antibiotic treatment. Consecutive samples were obtained from 54 diabetic patients. Thirty-five patients with 41 foot ulcers were included. As determined by bone biopsy and culture, osteomyelitis was found to underlie 28 (68%) of 41 diabetic foot ulcers. Only nine (32%) of the 28 cases were diagnosed clinically by the referring physician. Underscoring the clinically silent nature of osteomyelitis in these ulcers, 19 (68%) of 28 occurred in outpatients, 19 (68%) of 28 occurred in ulcers not exposing bone, and 18 (64%) of 28 had no evidence of inflammation on physical examination. All patients with ulcers that exposed bone had osteomyelitis. Of the imaging tests, the leukocyte scan had the highest sensitivity, 89%. In patients with osteomyelitis, the leukocyte scan image intensity decreased by 16 to 34 days of antibiotic treatment and normalized by 36 to 54 days. The majority of diabetic foot ulcers have an underlying osteomyelitis that is clinically unsuspected. Leukocyte scans are highly sensitive for diagnosing osteomyelitis in diabetic foot ulcers and may be useful for monitoring the efficacy of antibiotic treatment. The recommend that diabetic patients with foot ulcers that expose bone should be treated for osteomyelitis

  16. Unsuspected osteomyelitis in diabetic foot ulcers. Diagnosis and monitoring by leukocyte scanning with indium in 111 oxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Newman, L.G.; Waller, J.; Palestro, C.J.; Schwartz, M.; Klein, M.J.; Hermann, G.; Harrington, E.; Harrington, M.; Roman, S.H.; Stagnaro-Green, A. (Mount Sinai Medical Center, New York, NY (USA))

    1991-09-04

    The prevalence of osteomyelitis in diabetic foot ulcers is unknown. Early diagnosis of this infection is critical, as prompt antibiotic treatment decreases the rate of amputation. The authors therefore assessed the prevalence of osteomyelitis in 35 diabetic patients with 41 foot ulcers. They compared results of roentgenograms, leukocyte scans with indium In 111 oxyquinoline, and bone scans with the diagnostic criterion standards of bone histologic and culture findings. Leukocyte scans were repeated at 2- to 3-week intervals during antibiotic treatment. Consecutive samples were obtained from 54 diabetic patients. Thirty-five patients with 41 foot ulcers were included. As determined by bone biopsy and culture, osteomyelitis was found to underlie 28 (68%) of 41 diabetic foot ulcers. Only nine (32%) of the 28 cases were diagnosed clinically by the referring physician. Underscoring the clinically silent nature of osteomyelitis in these ulcers, 19 (68%) of 28 occurred in outpatients, 19 (68%) of 28 occurred in ulcers not exposing bone, and 18 (64%) of 28 had no evidence of inflammation on physical examination. All patients with ulcers that exposed bone had osteomyelitis. Of the imaging tests, the leukocyte scan had the highest sensitivity, 89%. In patients with osteomyelitis, the leukocyte scan image intensity decreased by 16 to 34 days of antibiotic treatment and normalized by 36 to 54 days. The majority of diabetic foot ulcers have an underlying osteomyelitis that is clinically unsuspected. Leukocyte scans are highly sensitive for diagnosing osteomyelitis in diabetic foot ulcers and may be useful for monitoring the efficacy of antibiotic treatment. The recommend that diabetic patients with foot ulcers that expose bone should be treated for osteomyelitis.

  17. Techniques for measuring red cell, platelet, and WBC survival

    International Nuclear Information System (INIS)

    Mayer, K.; Freeman, J.E.

    1986-01-01

    Blood cell survival studies yield valuable information concerning production and destruction of cells circulating in the bloodstream. Methodologies for the measurement of red cell survival include nonisotopic methods such as differential agglutination and hemolysis. The isotopic label may be radioactive or, if not, will require availability of a mass spectrograph. These methods fall into two categories, one where red cells of all ages are labeled ( 51 Cr, DFP32, etc.) and those employing a cohort label of newly formed cells ( 14 C glycine, 75 Se methionine, etc.). Interpretation of results for methodology employed and mechanism of destruction, random or by senescence, are discussed. A similar approach is presented for platelet and leukocyte survival studies. The inherent difficulties and complications of sequestration, storage, and margination of these cells are emphasized and discussed. 38 references

  18. Indium-111 WBC detection of emphysematous gastritis in pancreatitis

    International Nuclear Information System (INIS)

    Caruana, V.; Swayne, L.C.; Salaki, J.S.

    1990-01-01

    We present a case of emphysematous gastritis initially detected with 111In oxine-labeled white blood cell scintigraphy and subsequently confirmed by computed tomography. Early aggressive antibiotic and supportive therapy resulted in a successful clinical outcome

  19. Effect of Auger electrons internalized as Indium-111 labelled N-MYC phosphorothionate antisense oligonucleotide (In-111-N-MYC-AS) on human neuroblastoma cells: In vitro and in vivo studies

    International Nuclear Information System (INIS)

    Watanabe, N.; Tanada, S.; Sasaki, Y.

    2005-01-01

    Full text: Auger electrons which enter into cells cause biological effects with high-LET short range radiation on the neighborhood. The purpose of this study was to investigate the internalization of In-111-N-myc-AS and suppression of N-MYC in human neuroblastoma cells. Fifteen-mer AS, which was complementary to the region of the mRNA of N-myc beginning with ATG start codon, was derivatized with SCN-Bn-EDTA and labeled with In-111. In-111-N-myc-AS (1.33MBq/nmol) was prepared as naked form and encapsulated in cationic multilamellar liposome (CML). The internalization of In-111-N-myc-AS with or without CML into human neuroblastoma SK-N-DZ cells was determined both in vitro (cell culture) and in vivo (tumor bearing nude mice) studies by Southern blot analysis. Quantity of N-MYC in the tumor cells was also measured by Western blot analysis. In in vitro system 0.69-02pmol of In-111-N-myc-AS (80pmol) with CML was internalized in the cells (5x106) by 12h at 4 deg. C, which increased to 8.05?0.43pmol at 37 deg. C. The internalized naked In-111-N-myc-AS was 0.58?0.01pmol and 0.92?0.03pmol at 4 and 37 0 C, respectively. In vivo study revealed the internalization of In-111-N-myc-AS (8nmol) with CML in tumor cells (5x106) as 6.44?0.71pmol, while none (0pmol) of naked In-111-N-myc-AS was internalized. The effect of Auger electrons was shown by a decrease of N-MYC of the tumor cells by 20.6?2.49% in vitro and 12.9?1.17% in vivo in the case of In-111-N-myc-AS with CML, whereas unlabeled AS with CML or In-111-phosphorothioate sense oligonucleotide did not decrease the quantity of N-MYC of the tumor cells in vitro or in vivo. In conclusion, In-111-N-myc-AS with CML could be internalized into human neuroblastoma cells and suppress the activity of N-myc gene, which may prove useful for targeted Auger electrons radiotherapy. (author)

  20. Effect of Auger electrons internalized as Indium-111-labeled N-MYC phosphorothioate antisense oligonucleotide (In-111-N-MYC-AS) on human neuroblastoma cells: In-vitro and in-vivo studies

    International Nuclear Information System (INIS)

    Watanabe, Naoyuki; Tanada, Shuju; Sasaki, Yasuhito

    2004-01-01

    Full text: Auger electrons, which enter into cells, cause biological effects with high-LET short-range radiation on the neighborhood. The purpose of this study is to investigate the internalization of In-111-N-myc-AS and suppression of NMYC in human neuroblastoma cells. Fifteen-mer AS, which was complementary to the region of the mRNA of N-myc beginning with ATG start codon, was derivated with SCN-Bn-EDTA and labeled with In-111. In-111-Nmyc-AS (1.33MBq/nmol) was prepared as naked form and encapsulated in cationic multilamellar liposome (CML). The internalization of In-111-N-myc-AS with or without CML into human neuroblastoma SK-N-DZ cells was determined both in vitro (cell culture) and in vivo (tumor bearing nude mice) studies by Southern blot analysis. Quantity of N-MYC in the tumor cells was also measured by Western blot analysis. In in-vitro system 0.69∫0.02pmol of In-111-N-myc-AS (80pmol) with CML was internalized in the cells (5x106) by 12h at 4 deg. C, which increased to 8.05±0.43pmol at 37 deg. C. The internalized naked In-111-N-myc-AS was 0.58±0.01pmol and 0.92±0.03pmol at 4 and 37 deg. C, respectively. In-vivo study revealed the internalization of In-111-N-myc-AS (8nmol) with CML in tumor cells (5x106) as 6.44±0.71pmol, while none (0pmol) of naked In-111-Nmyc-AS was internalized. The effect of Auger electrons was shown by a decrease of N-MYC of the tumor cells by 20.6±2.49% in- vitro and 12.9±1.17% in vivo in the case of In-111-N-myc-AS with CML, whereas unlabeled AS with CML or In-111-phosphorothioate sense oligonucleotide did not decrease the quantity of N-MYC of the tumor cells in- vitro or in- vivo. In-111-N-myc-AS with CML could be internalized into human neuroblastoma cells and suppress the activity of N-myc gene, which may prove useful for targeted Auger electrons radiotherapy. (author)

  1. Thallium-201 myocardial scintigram in primary pulmonary hypertension

    International Nuclear Information System (INIS)

    Fujii, Isao; Handa, Shunnosuke; Yamazaki, Hajime; Nakamura, Yoshiro

    1984-01-01

    Right heart catheterization is needed for the diagnosis of pulmonary hypertension in patients with primary pulmonary hypertension (PPH), though the procedure was reported to have an unusually high risk. We examined the usefulness of thallium-201 myocardial scintigraphy for the evaluation of right ventricular overloading in patients with PPH. This study includes 5 patients with PPH, diagnosed by the clinical criteria of research committee of PPH in the Ministry of Health and Welfare in Japan (1976). Autopsy was done and diagnosis was confirmed in 4 cases. The right ventricular (RV) free wall was visualized in all cases. They were divided into 2 groups by the degree of visualization. The cases with heavier visualization had a higher pulmonary arterial resistence. The shape of the interventricular septum was deformed in all cases. It was straight in 3 cases and convex to the left ventricle (LV) in 3. In the later group, a systolic LV-RV pressure difference was less than 25 mmHg. One of these 3 cases showed reversed pressure difference. We concluded that thallium-201 myocardial scintigraphy could non-invasively assess the degree of RV overloading in PPH. (author)

  2. Abnormal scintigrams in demyclinating diseases of the brain

    International Nuclear Information System (INIS)

    Podreka, I.; Heiss, W.D.; Jellinger, K.; Vienna Univ.

    1977-01-01

    In 6 patients with acute or exacerbating demyelinating disease and in 2 cases suffering from adrenoleucodystrophy (Schilder's disease) brain scintigraphy revealed areas with increased isotope uptake. The pathological foci were verified by autopsy in 4 cases and by inspection in 1. These foci are difficult to distinguish from other localized brain diseases causing increased isotope uptake; in addition to the clinical course and to spinal fluid abnormalities reversibility of the scintigraphic lesions indicate demyelinating diseases. The typical pattern of symmetrical lesions within the white matter and the progression of abnormalities from the occipital to the frontal lobe speak in favor of Schilder's disease. (orig.) [de

  3. The Value of Somatostatin Receptor Imaging with In-111 Octreotide and/or Ga-68 DOTATATE in Localizing Ectopic ACTH Producing Tumors

    Directory of Open Access Journals (Sweden)

    Zeynep Gözde Özkan

    2013-08-01

    Full Text Available Objective: We aimed to evaluate the value of somatostatin receptor imaging (SRI with In-111 octreotide and Ga-68 DOTATATE in localizing ectopic ACTH producing tumors. Methods: Nineteen patients who had In-111 octreotide somatostatin receptor scintigraphy (SRS and/or Ga-68 DOTATATE PET-CT to localize ectopic ACTH producing tumors between the years 2000 and 2012 were included retrospectively in our study. The results of SRI were compared with clinical onset, radiological findings and surgical data of the patients. Results: Sixteen In-111 octreotide SRS and five Ga-68 DOTATATE PET-CT were performed in 19 patients. In eight out of 19 patients, ectopic ACTH secretion site could be detected. In five patients, SRS showed pathologic uptake. In four of these patients, surgery revealed pulmonary carcinoid tumors and in one patient pancreatic neuroendocrine tumor. In one patient, Ga-68 DOTATATE PET-CT revealed pathologic uptake in lung nodule which came out to be pulmonary carcinoid tumor. In another patient who had resection of metastases of atypical carcinoid tumor prior to scans, new metastatic foci were detected both with SRS and Ga-68 DOTATATE PET-CT imaging. In one patient, although SRS was negative, CT which was performed three years later showed a lung nodule diagnosed as pulmonary carcinoid tumor. In 11 patients, ectopic ACTH secretion site could not be detected. In 10 of those patients, scintigraphic and radiological imaging did not show any lesions and in one patient, Ga-68 DOTATATE PET-CT was false positive. Conclusion: SRI has a complementary role with radiological imaging in localizing ectopic ACTH secretion sites. PET-CT imaging with Ga-68 peptide conjugates is a promising new modality for this indication.

  4. Activity measurements of the radionuclide {sup 111}In for the LNE-LNHB, France in the ongoing comparison BIPM.RI(II)-K1.In-111

    Energy Technology Data Exchange (ETDEWEB)

    Michotte, C.; Ratel, G.; Courte, S. [Bureau International des Poids et Mesures (BIPM), Pavillon de Breteuil, 92 - Sevres (France); Verdeau, E.; Amiot, M.N. [Laboratoire national de metrologie et d' essais-Laboratoire National Henri Becquerel (LNE-LNHB), 91 - Gif-sur-Yvette (France)

    2010-10-15

    In 2006, the Laboratoire national de metrologie et d'essais - Laboratoire national Henri Becquerel (LNE-LNHB) submitted a sample of known activity of {sup 111}In to the International Reference System (SIR). The value of the activity submitted was about 14 MBq. This provides a new result for France in the matrix of degrees of equivalence in the key comparison database that enables them to maintain their degrees of equivalence for this radionuclide. The key comparison reference value has been re-evaluated and the comparison, identifier BIPM.RI(II)-K1.In-111, now contains five valid results. (authors)

  5. Evaluation of the absorbed dose during studies of the renal function due to I123 / I131 (hippuran) and In111 (DTPA)

    International Nuclear Information System (INIS)

    Vasquez, M.; Castillo, C.; Sarachaga, R.; Rojas, R.; Zelada, L.; Melendez, J.; Gomez, M.; Diaz, E.

    2014-08-01

    Using the methodology MIRD and representation Cristy-Eckerman for kidneys, bladder, and whole body as organs of the bio-kinetics of I 123 / I 131 (hippuran) and the In 111 (D PTA), the absorbed dose for studies of the renal function of adults due to the I 123 is 0,0071 mGy/MBq where 88.16% corresponds to its auto-dose and 11,96% to the organs of their bio-kinetics; while for the I 131 their dose is 0,032 mGy/MBq where 95,03% corresponds to its auto-dose and 4,97% to the organs of their bio-kinetics. For the In 111 their dose is 0,0168 mGy/MBq where 71,68% corresponds to their auto-dose and 28,32% to the organs of their bio-kinetics. In all the cases the dosimetric contributions of the organs of the bio-kinetics (whole body and urinary bladder) are very significant, and this fundamentally is due to the photons of the whole body. (Author)

  6. Observation of the in-plane spin-dephasing anisotropy in [111]-grown GaAs/AlGaAs quantum well

    International Nuclear Information System (INIS)

    Zhao, Chunbo; Li, Junbin; Yu, Ying; Ni, Haiqiao; Niu, Zhichuan; Zhang, Xinhui

    2014-01-01

    The electron density and temperature dependent in-plane spin-dephasing anisotropy in [111]-grown GaAs quantum well (QW) has been investigated by time-resolved magneto-Kerr rotation technique. Due to the specific symmetry of [111]-grown quantum well, the in-plane Rashba and linear Dresselhaus effective spin-orbit magnetic field is parallel to each other for electron wave vectors in all directions. However, an obvious in-plane spin-dephasing anisotropy comparing [2 ¯ 11] with [01 ¯ 1] crystalline orientations has been observed and discussed in this work. Our results demonstrate the innegligible spin dephasing channel through inhomogeneous broadening induced by the out-of-plane non-linear Dresselhaus field, which arises naturally from the C 3 symmetry of [111]-grown GaAs QW

  7. Receptor scintigraphy using the Tc-99M-labelled somatostatin analogue EDDA-TRYCINE-HYNIC-TOC: clinical results in different tumor types and comparison with In-111 DOTATOC during Y-90 DOTATOC radioreceptor therapy

    International Nuclear Information System (INIS)

    Baum, R.P.; Schmuecking, M.; Fischer, S.; Przetak, C.; Niesen, A.; Maecke, H.R.

    2002-01-01

    Aim: To evaluate Tc-99m EDDA-TRYCINE-HYNIC-TOC in patients with somatostatin receptor positive tumours (staging, pre-therapeutic dosimetry for radioreceptor therapy and restaging after therapy) in comparison with In-111 DOTATOC. Material and Methods: The Tc-99m labelled somatostatin analogue was synthesized by an optimized procedure in our pharmaceutical laboratory using lyophilized kits (radiochemical purity by HPLC, TLC > 95%, product stability in vitro 4 to 6h). So far, 58 patients (60 examinations) were studied after injection of 580-890 MBq (median 673 MBq) EDDA-TRYCINE-HYNIC-TOC. The histologically proven tumours were neuroendocrine neoplasias, renal carcinomas, bronchial carcinoma, mesothelioma and malignant fibrous histiocytoma. The imaging protocol consisted of whole-body scans and planar images of the tumor region (15 min, 1 h, 2 h, 4 h, 8 h, 24 h p.i.) and additionally SPECT-images (1 h und 4 h p.i.). For semi-quantitative assessment, individual regions of interest (ROI) were drawn in order to generate time-activity curves and to calculate tumour-to-tissue/background ratios which were compared by visual grading (scala 0 to 3+). Furthermore, pharmacokinetic analyses were carried out (radioactivity kinetics in plasma and urine). In some selected patients, image fusion of whole-body scans was performed with CT and/or MRT and/or PET using a NUD software and a HERMES computer. Results: 10 out of 58 patients showed an intense tracer accumulation in the SSTR-positive tumours (visual 3+, tumour/background ratio >2,5). In these patients, radioreceptor therapy was carried out using Y-90 DOTATOC (simultaneous injection von 150 MBq In-111 DOTATOC). All pretherapeutic scans with the Tc-99m labelled ligand (4 h p.i.) showed a similar overall pattern of biodistribution and tumour uptake in comparison to the therapy scans with In-111 / Y-90 DOTATOC (24 h p.i.). The Tc-99m EDDA-TRYCINE-HYNIC-TOC scans (incl. SPECT) offered superior imaging properties with earlier tumour

  8. Receptor imaging with a new Tc-99m labelled somatostatin analogue (Tc-99m EDDA-TRYCINE-HYNIC-TOC): first clinical results and comparison with In-111 Dotatoc during radioreceptor therapy with Y-90 Dotatoc

    International Nuclear Information System (INIS)

    Baum, R.P.; Schmuecking, M.; Fischer, S.; Przetak, C.; Niesen, A.; Maecke, H.R.

    2002-01-01

    Full text: To evaluate Tc-99m EDDA-TRYCINE-HYNIC-TOC (TET-H-TOC) in patients with somatostatin receptor (SSTR)-positive tumors (staging, pretherapeutic indication for radioreceptor therapy and restaging after therapy) in comparison with In-111 DOTATOC. The Tc-99m labelled somatostatin analogue was synthesized by an optimized procedure in our pharmaceutical lab using lyophilized kits (radiochemical purity by HPLC, TLC > 95 %, product stability in vitro 4 to 6 h). So far, 46 patients (53 examinations) were studied after injection of 580-890 MBq (median 673 MBq) TET-H-TOC. The histologically proven tumors were endocrine neoplasias, renal carcinomas, bronchial carcinoma, mesothelioma and malignant fibrous histiocytoma. The imaging protocol consisted of whole-body scans and planar images of the tumor region (15 min, 1 h, 2 h, 4 h, 8 h, 24 h p.i.) and additionally SPECT-images (1 h and 4 h p.i.). For semi-quantitative assessment, individual regions of interest (ROI) were drawn in order to generate time-activity curves and to calculate tumor-to-tissue/background ratios which were compared by visual grading (scale 0 to 3+). Furthermore, pharmacokinetic analyses were carried out (radioactivity kinetics in plasma and urine). In some selected patients, image fusion of the whole-body scans was performed with CT and/or MRT and/or PET using a HERMES computer. 7 out of 46 patients showed an intense tracer accumulation in the SSTR-positive tumors (visual 3+, tumor / background ratio >2,5). In these patients, radioreceptor therapy was carried out using Y-90 DOTATOC (simultaneous injection of 150 MBq In-111 DOTATOC). All pretherapeutic scans with the Tc-99m labelled ligand (4 h p.i.) showed a similar overall pattern of biodistribution and tumor uptake in comparison to the therapy scans with In-111 / Y-90 DOTATOC 24 h p.i. The Tc-99m EDDA-HYNIC-TOC scans (incl. SPECT) offered superior imaging properties with earlier tumor visualization (all lesions were detected 1 h p.i.) as compared

  9. Area of ischemia assessed by physicians and software packages from myocardial perfusion scintigrams

    DEFF Research Database (Denmark)

    Edenbrandt, L.; Hoglund, P.; Frantz, S.

    2014-01-01

    medicine delineated the extent of the ischemic defects. After at least two weeks, they delineated the defects again, and were this time provided a suggestion of the defect delineation by EXINI Heart(TM) (EXINI). Summed difference scores and ischemic extent values were obtained from four software programs......Background: The European Society of Cardiology recommends that patients with > 10% area of ischemia should receive revascularization. We investigated inter-observer variability for the extent of ischemic defects reported by different physicians and by different software tools, and if inter....... Results: The median extent values obtained from the 11 physicians varied between 8% and 34%, and between 9% and 16% for the software programs. For all 25 patients, mean extent obtained from EXINI was 17.0% (+/- standard deviation (SD) 14.6%). Mean extent for physicians was 22.6% (+/- 15.6%) for the first...

  10. Clinical evaluation of 123I-metaiodobenzylguanidine myocardial scintigram in patients with vascular heart disease

    International Nuclear Information System (INIS)

    Terada, Kouji; Sugihara, Hiroki; Shiga, Koji

    1995-01-01

    Myocardial sympathetic nerve function can be evaluated by 123 I-metaiodobenzylguanidine (MIBG) scintigraphy. Congestive heart failure is closely related to myocardial sympathetic nerve function. This study evaluated the severity of congestive heart failure in 30 patients with valvular heart disease [aortic regurgitation (AR): n=20, mean age=70±13 years; mitral regurgitation (MR): n=10, mean age=61±18 years], who had chronic heart failure by MIBG myocardial scintigraphy. Single photon emission computed tomography (SPECT) and anterior planar myocardial images were obtained 15 minutes (initial images) and 4 hours (delayed images) after injection of MIBG (111 MBq). Defect score was determined by the delayed SPECT images visually as a semi-quantitative index. Myocardial MIBG uptake was quantified by the heart to upper mediastinum uptake ratio on the delayed anterior planar images (H/M) and mean cardiac MIBG washout rate during 4 hours was calculated from the bull's eye display data (clearance). These indices were compared with the NYHA class and echocardiographic findings of the patients. MIBG regional defect in the delayed image was most frequently seen in the inferoposterior wall, and defect score and clearance were significantly higher and the H/M ratio was significantly lower in NYHA class III patients than in class II patients. In patients with AR, clearance significantly correlated with left ventricular end-systolic dimension. In patients with MR, both the H/M ratio and clearance significantly correlated with left atrial dimension. Defect score, H/M, and clearance were closely related to the severity of AR and MR. These results indicate that MIBG scan can be used to assess the severity of valvular heart disease. (author)

  11. Enhanced detection of metastatic liver disease by computerized flow scintigrams: concise communication

    International Nuclear Information System (INIS)

    Sarper, R.; Fajman, W.A.; Tarcan, Y.A.; Nixon, D.W.

    1981-01-01

    The purpose of this study was to develop a method by which the sensitivity of radionuclide liver imaging for the detection of hepatic metastasis could be enhanced. Routine flow studies were performed before imaging by injecting the usual 2 to 3 mCi dose of Tc-99m sulfur colloid as a bolus and storing 30 2-sec images in a computer. With regions selected by light pen, curves were generated from the right lobe of the liver, the right kidney, and the descending aorta. The peak of the kidney curve was chosen as a marker to separate the arterial and venous phases on the liver curve. The average slopes of four points on the liver curve before this marker, and four after, were calculated and the ratio of the first slope to that of the second was defined as the arterialization index. In this study with 228 patients, the inclusion of this index raised the sensitivity from 85 to 100%

  12. Unusual ventilation perfusion scintigram in a case of immunologic pulmonary edema clinically simulating pulmonary embolism

    International Nuclear Information System (INIS)

    Campeau, R.J.; Faust, J.M.; Ahmad, S.

    1987-01-01

    A case of immunologic pulmonary edema secondary to hydrochlorothiazide allergy developed in a 55-year-old woman that clinically simulated pulmonary embolism. The patient had abnormal washin images with normal washout images on an Xe-133 ventilation study. On the perfusion study, large bilateral central and posterior perfusion defects were present that showed an unusual mirror image pattern on the lateral and posterior oblique views. Resolution of radiographic and scintigraphic abnormalities occurred over a 3-day period in conjunction with corticosteroid therapy

  13. Application of bone scintigrams in total knee replacement (Okayama MK-II type)

    Energy Technology Data Exchange (ETDEWEB)

    Umeda, T.; Inoue, S.; Matsui, N.; Moriya, H. (Chiba Univ. (Japan). School of Medicine)

    1982-02-01

    Eighteen patients with 21 total knee replacements (OKAYAMA MK-II type) were examined by radionuclide imaging in order to assess the prosthetic complaints such as loosening, infection, fracture and lasting pain. The following results and conclusions were obtained. 1) Bone imaging can reveal the condition of the attachment of bone and prosthesis. 2) Diffuse uptake gradually diminished until 18 months after surgery. 3) In front view on bone imaging, tibial uptake corresponded highly with the part of the weight area. 4) In cases of high uptake of posterior femoral component in lateral view, the range of knee flexion was mostly restricted. 5) Long-period persistent local uptake suggested loosening of the prosthesis or fracture of the tibial plateau. 6) Patello-femoral uptake showed no relation to the patellofemoral complaints. Radionuclide bone imaging is considered to represent one of the most valuable diagnostic procedures for assessing the clinical results after total knee replacement.

  14. A study on hepato-biliary and alimentary scintigram by means of triple tracer method

    International Nuclear Information System (INIS)

    Aibata, Hirofumi; Torizumi, Kazutami; Okada, Takashi; Kiji, Shigeyuki; Yamada, Ryusaku; Shimada, Kosuke; Taniguchi, Katsutoshi; Aoki, Yozo

    1987-01-01

    In order to evaluate the gastric emptying and postprandial mixing of bile with food, the scintigraphies of hepatobiliary and gastrointestinal tracts by using three different kinds of radioisotopes were performed simultaneously ( 99m Tc-E · HIDA for hepatobiliary scintigraphy, 111 In-DTPA containing orange juice and 131 I-albumin containing scrambled egg for gastrointestinal scintigraphy). This method was available for observation of gastric emptying of liquid and solid foods and also examination of the mixing effect of bile and food quantitatively. (author)

  15. Unusual ventilation perfusion scintigram in a case of immunologic pulmonary edema clinically simulating pulmonary embolism

    Energy Technology Data Exchange (ETDEWEB)

    Campeau, R.J.; Faust, J.M.; Ahmad, S.

    1987-11-01

    A case of immunologic pulmonary edema secondary to hydrochlorothiazide allergy developed in a 55-year-old woman that clinically simulated pulmonary embolism. The patient had abnormal washin images with normal washout images on an Xe-133 ventilation study. On the perfusion study, large bilateral central and posterior perfusion defects were present that showed an unusual mirror image pattern on the lateral and posterior oblique views. Resolution of radiographic and scintigraphic abnormalities occurred over a 3-day period in conjunction with corticosteroid therapy.

  16. Evaluation of myocardial abnormalities in patients with collagen diseases by thallium-201 myocardial scintigram

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru (Nara Medical Univ., Kashihara (Japan))

    1992-08-01

    This study was performed to evaluate myocardial lesions in patients with collagen diseases by rest and exercise thallium-201 myocardial scintigraphies. A total of 76 patients without ischemic ECG changes, consisting of 27 cases of systemic lupus erythematosus (SLE), 17 cases of polymyositis or dermatomyositis (PM[center dot]DM), 11 cases of progressive systemic sclerosis (PSS), and 21 cases of Sjoegren's syndrome (SjS), were enrolled in this study. Reversible exercise-induced defects suggesting myocardial ischemia were noted in 12 cases of SLE, 5 cases of PM[center dot]DM, 3 cases of PSS, and 3 cases of SjS. Of the 23 patients who had exercise-induced defects, 9 patients showed normal coronary angiograms by cardiac catheterization. Fixed hypoperfusion areas were observed in 5 cases of SLE, 6 cases of PM[center dot]DM, 4 cases of PSS and 3 cases of SjS. Rest thallium-201 myocardial scintigraphy disclosed hypoperfusion areas, which were not induced by exercise, in 1 case of SLE, 4 cases of PM[center dot]DM, 1 case of PSS and 5 cases of SjS. Endomyocardial biopsy was performed on 20 patients. Myocardial lesions in PM[center dot]DM and PSS were more severe and wide spread than in SLE. Ejection fraction and fractional shortening evaluated by echocardiography had no significant differences between each disease group and the healthy control group. These findings suggest that patients with collagen diseases show the presence of abnormalities of coronary circulation at the level of the intramyocardial vasculature in the stage before impairment of cardiac function, myocardial fibrosis and functional abnormalities of the cell membrane level that were not dependent on myocardial ischemia. (author).

  17. Morphological classification of Renal Disease Using 99mTc-DMSA Scintigram

    International Nuclear Information System (INIS)

    Moon, Tae Yong

    1991-01-01

    99m Tc-DMSA renal scan has been evaluated not only the renal functional cell mass but also some anatomical structures at a loss of the renal parenchymal function. The author classified a renal morphology of the posterior image of 99m Tc-DMSA renal scan as the groups of symmetic and asymmetric morphology, the groups of the large, normal and small sized kidneys, the groups of the central photon defects (PD) which could be noted in a dilated pelvocalyceal system due to obstructive uropathy and the cortical photon defects (CD) due to focal parenchymal lesions or scars after a loss of function and the last groups of the single and multiple CD for a suggestion of the clinical usefulness. Regarding to measurement of norrnal renal size, the longest size of the kidneys were evaluated with 5 cm of a lead scale on the posterior renal image, and those were decided to the limits beteen 104.1 and 119. 4 mm as comparison with the renal size of intravenous pyelogram (IVP) in 59 cases who were underwent 99m Tc-DMSA and IVP concommitantly. Among 85 cases of PD in 99m Tc-DMSA renal scan, the 61 (71.8%) were cases of a dilated pelvocalyceal system related with obstructive uropathy, meanwhile the 28 (27.0%) of 162 cases with CD were cases of obstructive and infectious uropathy. The probability of a presence of some uropathy in cases of CD were 99.3%, meanwhile that of the presence of CD in cases of some uropathy were 37.9%. Besides, there were some specific anatomical findings such as polycystic kidneys with symmetric enlarged kidneys with multiple CD and the kidneys of chronic renal failure and/or hypertension with syrnmetric small size in 99m Tc-DMSA renal scan.

  18. Detection of acute osteomyelitis with indium-111 labeled white blood cells in a patient with sickle cell disease

    International Nuclear Information System (INIS)

    Fernandez-Ulloa, M.; Vasavada, P.J.; Black, R.R.

    1989-01-01

    A young patient with sickle cell disease (SCD) and multiple hospitalizations for crisis was admitted because of suspected osteomyelitis. Initial laboratory work, radiographs, and bone images were not contributory. An In-111 white blood cell (WBC) study demonstrated two areas of increased radionuclide uptake consistent with osteomyelitis. One of these had associated soft tissue infection. No other areas of active osteomyelitis were visualized, in spite of the presence of several additional infection sites. Imaging with In-111 WBC is probably not justified for routine diagnosis of acute osteomyelitis in areas free of previous disease, where conventional bone images are highly efficient. In-111 WBC imaging, however, may be helpful in detecting osteomyelitis in selected patients with SCD in whom Tc-99m bone images and radiographs are usually abnormal and difficult to interpret due to previous bone infarcts. Localization of the infection focus is very important in choosing the aspiration site for bacteriologic studies. A negative study, however, should be interpreted cautiously

  19. Detection of acute osteomyelitis with indium-111 labeled white blood cells in a patient with sickle cell disease

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Ulloa, M.; Vasavada, P.J.; Black, R.R.

    1989-02-01

    A young patient with sickle cell disease (SCD) and multiple hospitalizations for crisis was admitted because of suspected osteomyelitis. Initial laboratory work, radiographs, and bone images were not contributory. An In-111 white blood cell (WBC) study demonstrated two areas of increased radionuclide uptake consistent with osteomyelitis. One of these had associated soft tissue infection. No other areas of active osteomyelitis were visualized, in spite of the presence of several additional infection sites. Imaging with In-111 WBC is probably not justified for routine diagnosis of acute osteomyelitis in areas free of previous disease, where conventional bone images are highly efficient. In-111 WBC imaging, however, may be helpful in detecting osteomyelitis in selected patients with SCD in whom Tc-99m bone images and radiographs are usually abnormal and difficult to interpret due to previous bone infarcts. Localization of the infection focus is very important in choosing the aspiration site for bacteriologic studies. A negative study, however, should be interpreted cautiously.

  20. Microgravity Cell Counter: A Simple Hand-held Low-cost Device for In-flight WBC/Differential

    Data.gov (United States)

    National Aeronautics and Space Administration — The ability to monitor hematology parameters during spaceflight is currently an unmet medical requirement (NASA-STD-3001). This project evaluated a DNA stain/CCD...

  1. Elevated Steady State WBC and Platelet Counts Are Associated with Frequent Emergency Room Use in Adults with Sickle Cell Anemia.

    Directory of Open Access Journals (Sweden)

    Susanna A Curtis

    Full Text Available Sickle cell anemia has many sequelae that result in emergency department (ED use, but a minority of patients with sickle cell disease are frequent utilizers and make up the majority of ED visits. If patients who are likely to be frequent ED can be identified in steady state, they can be treated with disease modifying agents in an attempt to reduce ED use frequency. We sought to identify steady state markers for frequent ED use.We identified all patients with SS/Sβ0 seen at our facilities in 2012. Health care utilization over the entire year was calculated and ED visit numbers categorized as either 0-1, 2-5, or 6 or more visits a year. Steady state and acutely active laboratory parameters were collected and analyzed using analysis of variance models and odds ratios.432 adult sickle cell patients were identified, ages 18-87, 54% female, and 38% had been prescribed hydroxyurea. Of the 432 patients,192 had 0-1 visits in the year, 144 had 2-5 visits in the year, and 96 had >6 visits for a total of 2259 visits. Those who had >6 visits accounted for 1750 (77% of the total visits for the year. When steady state laboratory markers were examined, each additional 50x10(9/L platelets was associated with 22% greater risk (p 6 ED visits/year. We did not observe a relationship between baseline HbF, LDH or reticulocyte count with >6 ED visits.Patients with elevated white blood cell counts, elevated platelet counts, and low hemoglobin levels exhibited higher risk for frequent ED utilization and could be candidates for early and aggressive therapy with disease modifying agents.

  2. RBC and WBC fatty acid composition following consumption of an omega 3 supplement: Lessons for future clinical trials

    Directory of Open Access Journals (Sweden)

    Ballester Oscar F

    2010-03-01

    Full Text Available Abstract Background Results from increasing numbers of in vitro and in vivo studies have demonstrated that omega 3 fatty acids incorporated in cell culture media or in the diet of the animals can suppress the growth of cancers. When human clinical trials are initiated to determine the ability of omega 3 fatty acids to alter growth or response to chemotherapeutic interventions of cancers, it will be essential to determine the omega 3 intake of individuals in the trial to determine compliance with consumption of the supplement and to correlate with endpoints of efficacy. We wondered if the fatty acid composition of RBCs might accurately indicate incorporation of omega 3 fatty acids in the WBCs. In this report we determine and compare the changes in fatty acid compositions of red blood cells and white blood cells in response to consumption of three doses of an omega 3 fatty acid supplement. Results We found that the fraction of omega 3 fatty acids in both red blood cells and white blood cells increased following consumption of the supplement. There was a linear, dose responsive increase in the fraction of omega 3 fatty acids in red blood cells but the increase in omega 3 in white blood cells was not linear. The magnitude of increase in omega 3 fatty acids was different between the two cell types. Conclusions Fatty acid analysis of red blood cells is a good measure of compliance with supplement consumption. However, fatty acid analysis of white blood cells is needed to correlate changes in fatty acid composition of white blood cells with other biochemical changes in the white blood cells. Trial Registration ClinicalTrials.gov NCT00899353.

  3. Microgravity Cell Counter: A Simple Hand-held Low-cost Device for In-flight WBC/Differential Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Spaceflight results in adverse health effects on the human body.   These effects may result in increased clinical risk to crewmembers participating in...

  4. In vivo PLT increments after transfusions of WBC-reduced PLT concentrates stored for up to 7 days

    NARCIS (Netherlands)

    Dijkstra-Tiekstra, M. J.; Pietersz, R. N. I.; Hendriks, E. C. M.; Reesink, H. W.; Huijgens, P. C.

    2004-01-01

    BACKGROUND: Bacterial screening and improvement of storage conditions of leukoreduced PLT concentrates (LR-PCs) allows extension of their storage period from 5 to 7 days. STUDY DESIGN AND METHODS: For in vitro studies, 40 LR-PCs made from five buffy coats and plasma were studied for 8 days. For in

  5. Pulmonary capillary wedge pressure, as inferred from lung areas in gated blood-pool scintigrams: concise communication

    International Nuclear Information System (INIS)

    Urbina, A.; Okada, R.D.; Palacios, I.; Osbakken, M.; Strauss, H.W.

    1981-01-01

    To determine whether the apex-to-base distribution of pulmonary blood volume, as obtained from gated cardiac blood-pool scans, could be used as a noninvasive method to estimate mean pulmonary capillary wedge pressure (PCWP), gated blood-pool scans were analyzed in 77 patients who also had PCWP measurements at cardiac catheterization. Ten of these patients had gated cardiac blood-pool scans and PCWP measurements both at rest and during exercise. The apex-to-base distribution of pulmonary blood volume was determined from the end-systolic frame of the left anterior oblique view by placing equal-sized regions of interest over the apex and base of the right lung. The ratio of apex counts over base counts (A/B ratio) was considered abnormal if greater than unity. The mean A/B ratio was 1.15 +/- 0.27 (1 s.d.) for the 32 studies associated with an abnormal mean PCWP (greater than 12 mm Hg). The mean A/B ratio was 0.85 +/- 0.23 for the 55 studies associated with a normal mean PCWP (p less than 0.01 comparing normal group with abnormal). The sensitivity of the A/B ratio for a mean PCWP greater than 12 mm Hg was 81%R (26/32). The specificity of the A/B ratio for a mean PCWP greater than or equal to 12 mm Hg was 89% (49/55). Thus, noninvasive determination of the pulmonary apex-to-base ratio from gated cardiac blood-pool scans appears to differentiate subjects with normal and abnormal mean pulmonary capillary wedge pressures

  6. Sensitivity and specificity of thallium-201 perfusion scintigrams under exercise in the diagnosis of coronary artery disease

    International Nuclear Information System (INIS)

    Verani, M.S.; Marcus, M.L.; Razzak, M.A.; Ehrhardt, J.C.

    1978-01-01

    The specificity and sensitivity of thallium-201 myocardial perfusion imaging (MPI), under exercise, in patients with suspected coronary-obstructive disease was compared with graded exercise ECG tests (GTX) in patients with angiographically normal (N = 34) and obstructed (N = 48) coronary arteries. Of the 34 patients with normal coronaries, only one had a perfusion defect on the MPI (specificity 97%). Of the 48 patients with coronary obstructive disease (>50% obstruction of at least one coronary vessel), MPI was positive in 38 (sensitivity 79%). In contrast, the GTX had a specificity of 62% and sensitivity of 88% if nondiagnostic GTX tests are excluded. When the MPI and the GTX were used in combination, however, the sensitivity of detecting patients with coronary obstructive disease was increased to 94% (p < 0.01). The MPI was particularly useful in the evaluation of the 26 patients with nondiagnostic GTX. In this group, 24 of the 26 patients were correctly identified by the MPI with respect to the presence or absence of coronary-obstructive disease. In the 14 patients with a history of classical angina but with normal coronaries, the MPI was negative in 13 and positive in one, thus suggesting that in the majority of these patients transient transmural myocardial ischemia probably does not occur during exercise. The presence or absence of angiographically demonstrable coronary collateral vessels did not seem to influence the exercise MPI in patients with coronary-obstructive disease. Thus, although the MPI does not correctly identify all patients with either coronary-obstructive disease or normal coronary arteries, it is helpful in patients who have a nondiagnostic GTX. Furthermore, when used in combination with the GTX, the MPI significantly increases the likelihood that significant coronary-obstructive disease is present when both tests are positive, and that coronary disease is absent when both tests are negative

  7. Complementary role of indium-111 labeled leukocyte imaging, ultrasonography and computed tomography in the evaluation of postoperative infection or abscess

    Energy Technology Data Exchange (ETDEWEB)

    Uno, Kimiichi; Imazeki, Keiko; Arimizu, Noboru; Ryu, Takamasa; Isono, Kaichi; Kitakata, Yusuke; Kohen, Hirobumi; Uematsu, Sadao

    1987-09-01

    We report our experiences with the combined use of indium-111 labeled leukocyte imaging (In-III WBC scan.), computed tomography (CT) and ultrasonography (US) for evaluation of suspected postoperative infection or abscess, and discuss the complementary roles of these modalities. Postoperative abscesses or infections were diagnosed in 9 of 20 patients. All patients were correctly diagnosed by In-111 WBC imaging and 4 patients could not be diagnosed by US because of bowel gas. One false-positive CT examination and another artifact on CT images due to respiratory movements were obtained. The three modalities were found to be complementary: CT and US were efficient imaging methods for diagnosis and treatment of abscess. In-111 WBC imaging could estimate the activity of inflammation.

  8. The complementary role of indium-111 labeled leukocyte imaging, ultrasonography and computed tomography in the evaluation of postoperative infection or abscess

    International Nuclear Information System (INIS)

    Uno, Kimiichi; Imazeki, Keiko; Arimizu, Noboru; Ryu, Takamasa; Isono, Kaichi; Kitakata, Yusuke; Kohen, Hirobumi; Uematsu, Sadao.

    1987-01-01

    We report our experiences with the combined use of indium-111 labeled leukocyte imaging (In-III WBC scan.), computed tomography (CT) and ultrasonography (US) for evaluation of suspected postoperative infection or abscess, and discuss the complementary roles of these modalities. Postoperative abscesses or infections were diagnosed in 9 of 20 patients. All patients were correctly diagnosed by In-111 WBC imaging and 4 patients could not be diagnosed by US because of bowel gas. One false-positive CT examination and another artifact on CT images due to respiratory movements were obtained. The three modalities were found to be complementary: CT and US were efficient imaging methods for diagnosis and treatment of abscess. In-111 WBC imaging could estimate the activity of inflammation. (author)

  9. In-111 platelet scintigraphy: carotid atherosclerosis and stroke

    International Nuclear Information System (INIS)

    Powers, W.J.

    1984-01-01

    An association between atherosclerosis of the internal carotid artery and ischemia or infarction of the ipsilateral cerebral hemisphere has been demonstrated by numerous radiographic and pathologic studies. The precise mechanism by which carotid atherosclerosis causes these problems, however, remains unclear. Several observations suggest that fibrin-platelet thrombi form on atherosclerotic plaques in the neck arteries and then embolize distally into the intracranial circulation. Unfortunately, platelet embolization does not adequately explain a variety of clinical and pathological findings in patients with cerebrovascular disease. This editorial will discuss these findings. It is obvious that the understanding of the role of platelets in the pathogenesis of ischemic cerebrvascular disease is far from complete

  10. Hyperfine interactions in 111Cd-doped lutetium sesquioxide

    International Nuclear Information System (INIS)

    Errico, L.A.; Renteria, M.; Bibiloni, A.G.; Requejo, F.G.

    1999-01-01

    We report here first Perturbed Angular Correlation (PAC) results of the electric field gradient (EFG) characterisation at 111 Cd impurities located at both non-equivalent cation sites of the bixbyite structure of Lutetium sesquioxide, between room temperature (RT) and 1273 K. The comparison with results coming from a systematic 111 Cd PAC study in bixbyites and with point-charge model (PCM) predictions shows the presence of a trapped defect at RT in the neighbourhood of the asymmetric cation site, which is completely removed at T > 623 K. The anomalous EFG temperature dependence in Lu 2 O 3 can be described in the frame of a 'two-state' model with fluctuating interactions, which enables the experimental determination of the acceptor energy level introduced by the Cd impurity in the band-gap of the semiconductor and the estimation of the oxygen vacancy density in the sample

  11. TDPAC experiments in 111In-implanted niobium oxides

    International Nuclear Information System (INIS)

    Renteria, M.; Wiarda, D.; Bibiloni, A.G.; Lieb, K.P.

    1990-01-01

    TDPAC measurements were carried out on 111 In-implanted α-Nb 2 O 5 samples at room temperature, after isochronal annealings up to 1270 K in 200 mbar oxygen and up to 1070 K in 10 -5 mbar, respectively. The observed hyperfine interactions were compared to point charge model calculations which predict 15 and 2 equivalent cation sites in α-Nb 2 O 5 and NbO 2 . The data in each system could be reproduced with one antishielding factor β=V zz exp /V zz pc for all sites, i.e. β(Nb 2 O 5 )=19.2 and β(NbO 2 )=31.2, respectively. (orig.)

  12. Microbial infection of an In-111 leucocyte preparation

    International Nuclear Information System (INIS)

    Harms, C.; Piers, D.A.; Been, M.H.; Dankert, J.

    1987-01-01

    The sterility testing of radiopharmaceuticals is mostly done afterwards, because waiting for a bacteriologic examination gives a loss of radioactivity. In this short article a positive result of Indium 111 labelled leucocytes is discussed. The authors conclude that the patient already was infected during the blood sampling. The positive result was not caused by uncareful working. 7 refs

  13. Preclinical characterisation of In-111-DTPA-trastuzumab

    NARCIS (Netherlands)

    Lub-de Hooge, MN; Kosterink, JGW; Perik, PJ; Nijnuis, H; Tran, L; Bart, J; Suurmeijer, AJH; de Jong, S; Jager, PL; de Vries, EGE

    Trastuzumab (Herceptin(R)) is a recombinant humanised IgG1 monoclonal antibody against the human epidermal growth factor receptor 2 (HER2), used for metastatic breast cancer treatment. Radiolabelled trastuzumab may have several future applications for diagnostic use. The aim of the present study was

  14. Strengthening mechanisms and dislocation processes in <111> textured nanotwinned copper

    International Nuclear Information System (INIS)

    Zhao, Xing; Lu, Cheng; Tieu, Anh Kiet; Pei, Linqing; Zhang, Liang; Cheng, Kuiyu; Huang, Minghui

    2016-01-01

    We use molecular dynamics simulations to elucidate the deformation mechanisms of <111> textured nanotwinned materials under tensile loading parallel to the twin boundary (TB). Our simulations reveal that the tensile strength of nanotwinned Cu increases monotonically as the twin spacing decreases. The strengthening effect mainly results from TB restricting the transmission of dislocations across the TB. Throughout the simulations the transmissions of dislocations across the TBs dominate the plastic deformation. Both direct and indirect transmissions are identified at atomic level. Direct transmission involves either successive transmission of the leading and trailing partials as in the Fleischer cross-slip model or absorption and desorption of the extended dislocation as in the Friedel-Escaig cross-slip mechanism. In contrast, indirect transmission involves the formation of special superjogs. The persistent slip transfer leaves zigzag slip traces on the cross-sectional view and the inhomogeneous deformation leads to the formation of intersecting slip bands on the plane view.

  15. Quantitative Assessment of Myocardial Infarction by In-111 Antimyosin Antibody

    International Nuclear Information System (INIS)

    Lee, Myung Chul; Lee, Kyung Han; Choi, Yoon Ho; Chung, June Key; Park, Young Bae; Koh, Chang Soon; Moon, Dae Hyuk

    1991-01-01

    Infarct size is a major determinant of prognosis after acute myocardial infarction. Up to date, however, clinically available tests to estimate this size have not been sufficiently accurate. Twelve lead electrocardiogram and wall motion abnormality measurement are not quantitative, and creatine phosphokinase (CPK) measurement is inaccurate in the presence of reperfusion or right ventricular infarction. Methods have been developed to localize and size acute myocardial infarcts with agents that are selectively sequestered in areas of myocardial damage, but previously used agents have lacked sufficient specificity. Antibodies that bind specifically only to damaged myocardial cells may resolve this problem and provide an accurate method for noninvasively measuring infarct size. We determined the accuracy with which infarcted myocardial mass can be measured using single photon emission computed tomography (SPECT) and radiolabeled antimyosin antibodies. Seven patients with acute myocardial infarction and one stable angina patient were injected with 2 mCi of Indium-111 labeled antimyosin antibodies. Planar image and SPECT was performed 24 hours later. None of the patients had history of prior infarcts, and none had undergone reperfusion techniques prior to the study, which was done within 4 days of the attack. Planar image showed all infarct patients to have positive uptakes in the cardiac region. The location of this uptake correlated to the infarct site as indicated by electrocardiography in most of the cases. The angina patient, however, showed no such abnormal uptake. Infarct size was determined from transverse slices of the SPECT image using a 45% threshold value obtained from a phantom study. Measured infarct size ranged from 40 to 192 gr. There was significant correlation between the infarct size measured by SPECT and that estimated from serial measurements of CPK (r=0.73, p<0,05). These date suggest that acute myocardial infarct size can be accurately measured from SPECT Indium-111 antimyosin imaging. This method may be especially valuable in situations where other methods are unreliable, such as early reperfusion technique, right ventricular infarct or presence of prior infarcts.

  16. New bands and spin-parity assignments in 111Ru

    International Nuclear Information System (INIS)

    Urban, W.; Rzaca-Urban, T.; Droste, C.; Rohozinski, S.G.; Durell, J.L.; Phillips, W.R.; Smith, A.G.; Varley, B.J.; Schulz, N.; Ahmad, I.; Pinston, J.A.

    2004-01-01

    The 111 Ru nucleus, populated in the spontaneous fission of 248 Cm has been studied by means of prompt gamma spectroscopy using the EUROGAM2 array. Spin and parity assignments, based on angular correlations, linear polarization, and conversion coefficient measurements differ from those available in the literature. New bands are reported, which incorporate γ transitions seen previously but not placed in the scheme of 111 Ru or placed incorrectly. The bands are interpreted as neutron excitations into subshells originating predominantly from the h 11/2 , g 7/2 and s 1/2 spherical orbitals. The s 1/2 band, strongly mixed with the d 3/2 , d 5/2 and g 7/2 configurations, is observed for the first time in this region. (orig.)

  17. Biodistribution parameters and radiation absorbed dose estimates for radiolabeled human low density lipoprotein

    International Nuclear Information System (INIS)

    Hay, R.V.; Ryan, J.W.; Williams, K.A.; Atcher, R.W.; Brechbiel, M.W.; Gansow, O.A.; Fleming, R.M.; Stark, V.J.; Lathrop, K.A.; Harper, P.V.

    1992-01-01

    The authors propose a model to generate radiation absorbed dose estimates for radiolabeled low density lipoprotein (LDL), based upon eight studies of LDL biodistribution in three adult human subjects. Autologous plasma LDL was labeled with Tc-99m, I-123, or In-111 and injected intravenously. Biodistribution of each LDL derivative was monitored by quantitative analysis of scintigrams and direct counting of excreta and of serial blood samples. Assuming that transhepatic flux accounts for the majority of LDL clearance from the bloodstream, they obtained values of cumulated activity (A) and of mean dose per unit administered activity (D) for each study. In each case highest D values were calculated for liver, with mean doses of 5 rads estimated at injected activities of 27 mCi, 9 mCi, and 0.9 mCi for Tc-99m-LDL, I-123-LDL, and In-111-LDL, respectively

  18. The use of a spaceflight-compatible device to perform WBC surface marker staining and whole-blood mitogenic activation for cytokine detection by flow cytometry

    Science.gov (United States)

    Crucian, B. E.; Sams, C. F.

    1999-01-01

    Significant changes have recently been described regarding circulating peripheral immune cells immediately following spaceflight. Existing methods for immunophenotype staining of peripheral blood in terrestrial labs do not meet the constraints for flight on the Space Shuttle. We have recently described the development and use of the Whole Blood Staining Device (WBSD), a simple device for staining flow cytometry specimens during spaceflight. When preparing samples with the WBSD, all liquids are safely contained as the cells are moved through staining, lysis and fixation steps. Here we briefly review the use of the WBSD, and then describe another versatile adaptation, a modification to perform intracellular staining of cytokines for detection by flow cytometry. Alterations in cytokine production have been reported both in ground-based simulated microgravity culture and in astronaut samples returning from spaceflight. Data regarding microgravity effects on cytokine production for specific subpopulations of cells is lacking. Flow cytometric cytokine analysis offers the unique ability to perform simultaneous surface marker analysis and positively identity cytokine producing subsets of cells. The utilization of the WBSD provides the ability to perform rapid and routine mitogenic activation during spaceflight coupled with the ability to perform simultaneous surface marker analysis. The only external requirements for this procedure are an in-flight 37-degree incubator and the capacity for 4-degree storage.

  19. Transient postexercise ischemic dilatation of the left ventricle on stress-redistribution T1-201 scintigrams: Marker of severe and extensive coronary artery disease

    International Nuclear Information System (INIS)

    Weiss, T.; Berman, D.; Bassir, R.; Garcia, E.; Swan, H.J.C.; Waxman, A.; Maddahi, J.

    1984-01-01

    The authors have noted that the left ventricle (LV) on the immediate post-stress T1-201 image is not infrequently larger than on the 4 hour image. To evaluate whether this transient ventricular dilatation following exercise (Ex) might be a marker of severity (S) and extent (E) of coronary artery disease (CAD), they assessed 83 consecutive pts who underwent stress-redistribution T1-201 scintigraphy and coronary arteriography. A transient ischemic dilatation (TID) ratio was obtained by dividing the LV area on the immediate post-Ex anterior image by the area of the corresponding 4 hr image. The LV cross-sectional area was determined by the computer as the number of pixels within a manually assigned region of interest encompassing the epicardial perimeter of the T1 image. The TID ratio was compared to the S and E of angiographic CAD. The TID ratio rose with increasing S and E of CAD. Pts with CAD of ≥ 90% in 2 or 3 V (E and S CAD) had a TID ratio of 1.14 +- 0.08 vs. 1.03 +- 0.07 in pts with no or less CAD (p<0.001). A TID ratio of ≥1.10 had 79% sensitivity and 82% specificity for identification of E and S CAD. A TID ratio of ≥ 1.2 was found only in E and S CAD (8/24). The authors conclude that it is useful to assess LV TID on ex-4 hr T1 images and that marked TID is highly specific for both severe and extensive disease

  20. Triple vessel coronary artery disease presenting as a markedly positive stress electrocardiographic test and a negative SPECT-TL scintigram: a case of balanced Ischemia

    Directory of Open Access Journals (Sweden)

    Eyal Herzog

    2011-09-01

    Full Text Available The presence of false negative nuclear stress test in the settings of positive electrocardiographic changes is a very unusual phenomenon and is usually secondary to balanced ischemia of the myocardial segments evaluated by SPECT-TL. We present a case of an 81- year old post-menopausal female who presented to her primary care physician for evaluation of a 6-week dyspnea on exertion and was referred to our institution for exercise stress test with Thallium SPECT with the objective of ruling out coronary artery disease and identifying possible areas of myocardial ischemia. The resting electrocardiogram was unremarkable and stress test evaluation was made. The patient was admitted to the cardiac care unit and coronary artery bypass grafting was successfully performed. The presence of false negative nuclear stress test in the settings of positive electrocardiographic changes is a very unusual phenomenon and is usually secondary to balanced ischemia of the myocardial segments evaluated by SPECT-TL. Patients undergoing stress tests with these characteristics should undergo careful evaluation and a high level of suspicion should be adopted for further diagnostic assessment of coronary artery disease.

  1. Serial change of TL/BMIPP dual SPECT myocardial scintigram in patients with acute myocardial infarction. Meaning of chronic mismatch phenomenon

    International Nuclear Information System (INIS)

    Iwasawa, Hirohito; Abe, Masahiro; Abe, Toshihiro; Nagai, Yoshikazu; Ibukiyama, Chiharu

    1999-01-01

    This study was aimed to elucidate the serial changes and clinical significance of accumulation mismatch with TL and BMIPP dual SPECT myocardial scintigraphy during 6 months in patients with acute myocardial infarction (AMI). The dual SPECT scintigraphy was performed at one, three and six months after onset of AMI in 46 patients who underwent reperfusion therapy. Long axis fractional shortening in infarct-related area and left ventricular end-diastolic volume index (LVEDVI) were measured by left ventriculography performed immediately after reperfusion and at one, six months after onset of AMI. The patients were divided into two groups: those with mismatch (Group (+)) and those without (Group (-)) at one month after reperfusion. Group (+) was subdivided into three groups according to duration of persistence of mismatch; one month persistence (1M), three months (3M) and six months (6M). Improvement of wall motion abnormality (WMA) in infarct-related area was seen at one month after reperfusion in group 1M and group 3M, while group 6M showed no apparent change in WMA throughout the study period. LVEDVI did not change at six months after reperfusion in group 1M and 3M, while significant increase was seen in group 6M. It is concluded that the case with disappearance of mismatch between TL and BMIPP until three months after reperfusion indicates myocardial stunning while in the case with long-standing mismatch left ventricular remodeling is suggested. (author)

  2. Improved stage of infarction wall motion in AMI. Association between the presence or absence of mismatch in myocardial scintigrams of Tl and BMIPP and CK release pattern

    International Nuclear Information System (INIS)

    Kurihara, Masato; Abe, Masahiro; Abe, Toshihiro; Nagai, Yoshikazu; Ibukiyama, Chiharu

    1998-01-01

    Binuclear myocardial scintigraphy with BMIPP and 201 TlCl was conducted on 40 patients with myocardial infarction. In all of 40 patients, reperfusion therapy in the acute stage succeeded. The relationship between serum CK release pattern and timing of improvement of wall motion at infarct-related area in the chronic stage was investigated. The patients were divided into 3 groups according to the early or late appearance of peak CK, and the presence or absence of B type mismatch in dual myocardial scintigraphy with BMIPP and 201 TlCl obtained one month after acute onset of myocardial infarction. Infarct size obtained from 201 TlCl scintigraphy and wall motion related to infarction were also investigated immediately after reperfusion and one month thereafter, respectively. No differences were recognized between Group I, in which the infarct area had B type mismatch with early appearance of CK peak, and Group II, in which the infarct area also had B type mismatch with the late appearance of CK peak. Although the wall motion did not change at all in Group I, it improved in Group II one month after reperfusion. Group III did not demonstrate B type mismatch with late appearance of CK peak and smaller infarct size compared to those in Group I and Group II. The wall motion in Group III had a tendency to improve immediately after reperfusion and maintain that level one month later. The timing of improvement of wall motion after successful reperfusion in the area with B type mismatch was not uniform. This suggests that the nonuniformity of the timing of improvement of wall motion in the area with B type mismatch is partly attributable to some kinds of injury to myocardium caused by reperfusion. (author)

  3. Evaluation of metallic osseous implants with nuclear medicine

    Energy Technology Data Exchange (ETDEWEB)

    Wellman, H.N.; Schauwecker, D.S.; Capello, W.N.

    1988-04-01

    Nuclear medicine has proven to have a valuable role in the evaluation of osseous metallic implants, particularly with joint prostheses, but can assist with evaluation of other appliances as well. The nuclear arthrogram has become an invaluable adjunct to simultaneously performed radiographic contrast arthrography. This application has been best evaluated in what is one of the most common of orthopedic prosthesis problems, namely, loosening of total hip prostheses. Experience indicates that both sensitivity and specificity of loosening of the femoral component can be increased to over 90% through combined use of nuclear with radiographic contrast arthrography. Furthermore the combination of routine skeletal scintimaging with the nuclear arthrogram adds a significant dimension to precise localizing of the nuclear arthrographics agent In-111 chloride. Nuclear medicine also plays an important role in further evaluating the presence of infection associated with metallic implants with In-111 WBC preparations being superior to Ga-67 as the radiopharmaceutical tracer. Infection has been detected with a sensitivity of 73% and a specificity of 93% in our series using combined In-111 WBC and simultaneous skeletal imaging with conventional Tc-99m MDP. Acute infections are more readily identifiable than chronic in association with prostheses. 29 references.

  4. Spin Dynamics in (111) GaAs/AlGaAs Undoped Asymmetric Quantum Wells

    International Nuclear Information System (INIS)

    Wang Gang; Ye Hui-Qi; Shi Zhen-Wu; Wang Wen-Xin; Liu Bao-Li; Xavier Marie; Andrea Balocchi; Thierry Amand

    2012-01-01

    The electron spin dynamics is investigated by the time-resolved Kerr rotation technique in a pair of special GaAs/AlGaAs asymmetric quantum well samples grown on (111)-oriented substrates, whose structures are the same except for their opposite directions of potential asymmetry. A large difference of spin lifetimes between the two samples is observed at low temperature. This difference is interpreted in terms of a cancellation effect between the Dresselhaus spin-splitting term in the conduction band and another term induced by interface inversion asymmetry. The deviation decreases with the increasing temperature, and almost disappears when T > 100 K because the cubic Dresselhaus term becomes more important

  5. Disintegration rate of Tc -99m and In -111 radioactive solutions in coincidence systems

    International Nuclear Information System (INIS)

    Brito, Andreia Barreto de

    2011-01-01

    The 111 In and 99 mTc standardization in a 4πβ-γ coincidence system is described. The 111 In was produced by the reaction of 111 Cd (p, n) 111 In in the cyclotron. The 111 In decays with a half life of 2.8 days by electron capture process, populating the excited levels of 111 Cd, emitting two main gamma rays with energies of 171 keV and 245 keV. The 99m Tc decay with a half life of 6.007 h for isomeric transition, from the radioactive decay of 99 Mo. 111 In standardization was carried out in a 4πβ-γ system, consisted of a gas flow proportional counter with 4π geometry coupled to a pair of NaI(Tl) scintillation counter with conventional electronics. The gamma window was set comprising the (171 keV + 245 keV) total absorption energy peaks. The choice of the window was based on the analysis of the extrapolation curves prediction, obtained by Monte Carlo simulation. The 99 mTc standardization has been accomplished by the 4πβ-γ coincidence method using a thin window proportional counter in a 4π geometry coupled to a single NaI(Tl) scintillation counter. The beta efficiency was varied by electronic discrimination using a software coincidence counting system (SCS). Two windows were selected for the gamma channel: one at 140 keV gamma ray and the other at 20 keV X ray total absorption peaks. The result of the experimental activity of 111 In two solutions agree with the results obtained by Monte Carlo simulation. The experimental activities of 99m Tc for the two gamma windows are in agreement within the experimental uncertainty, indicating that the adopted methodology is adequate. (author)

  6. In-111 labeled leukocyte scintigraphy in a case of multifocal candidiasis

    Energy Technology Data Exchange (ETDEWEB)

    Palestro, C.J.; Vega, A.; Kim, C.K.; Goldsmith, S.J. (Mount Sinai School of Medicine, New York, NY (USA))

    1990-06-01

    The value of indium-111 labeled leukocyte scintigraphy for the diagnosis of infection in the general population is well documented; there is less information available on its role in the evaluation of the immunocompromised patient. In this study, leukocyte scintigraphy was performed on a 31-year-old immunocompromised woman who had a possible intra-abdominal abscess. No abscess was detected, but intense oral, esophageal, gastric, and vaginal uptake was observed. Candida infection was histologically confirmed at all four sites.

  7. In-111 labeled leukocyte scintigraphy in a case of multifocal candidiasis

    International Nuclear Information System (INIS)

    Palestro, C.J.; Vega, A.; Kim, C.K.; Goldsmith, S.J.

    1990-01-01

    The value of indium-111 labeled leukocyte scintigraphy for the diagnosis of infection in the general population is well documented; there is less information available on its role in the evaluation of the immunocompromised patient. In this study, leukocyte scintigraphy was performed on a 31-year-old immunocompromised woman who had a possible intra-abdominal abscess. No abscess was detected, but intense oral, esophageal, gastric, and vaginal uptake was observed. Candida infection was histologically confirmed at all four sites

  8. Measurement of cerebral blood flow the blood sampling method using 99mTc-ECD. Simultaneous scintigram scanning of arterial blood samples and the brain with a gamma camera

    International Nuclear Information System (INIS)

    Hachiya, Takenori; Inugami, Atsushi; Iida, Hidehiro; Mizuta, Yoshihiko; Kawakami, Takeshi; Inoue, Minoru

    1999-01-01

    To measure regional cerebral blood flow (rCBF) by blood sampling using 99m Tc-ECD we devised a method of measuring the radioactive concentration in arterial blood sample with a gamma camera. In this method the head and a blood sample are placed within the same visual field to record the SPECT data of both specimens simultaneously. The results of an evaluation of the counting rate performance, applying the 30 hours decaying method using 99m Tc solution showed that this method is not comparable to the well-type scintillation counter and in clinical cases the active concentration in arterial blood sample remained well within the dynamic range. In addition, examination of the influence of scattered radiation from the brain by the dilution method showed that it was negligible at a distance of more than 7.5 cm between the brain and the arterial blood sample. In the present study we placed a head-shaped phantom next to the sample. The results of the examinations suggested that this method is suitable for clinical application, and because it does not require a well-type scintillation counter, it is expected to find wide application. (author)

  9. Usefulness of ECT in liver diseases

    International Nuclear Information System (INIS)

    Nishikawa, Jun-ichi

    1981-01-01

    The clinical usefulness of single photon emission tomography using rotating chair (ECT), comparing with liver scintigrams was examined with ROC (receiver operating characteristic) curve analysis. The ROC curve of ECT drew higher curved line than that of liver scintigram, i.e. true positive ratio of ECT was slightly inferior to that of liver scintigram, but false positive ratio of ECT was superior to that of liver scintigram. ECT adds useful clinical information to liver scintigram which shows questionable or suspected uptake defects. (author)

  10. Leukocyte labeling with isonitrile complexes of Tc-99m

    International Nuclear Information System (INIS)

    Van den Abbeele, A.D.; Solorzano, C.; Jones, A.G.; Beardsley, D.S.; Treves, S.; Davison, A.

    1985-01-01

    Leukocyte labelling with Tc-99m may result in a useful method for the detection and localization of active inflammatory processes in patients, particularly in the pediatric population. Previous studies qin this laboratory have shown that hexakis(alkylisonitrile)technetium(I) complexes readily label V79 lung fibroblasts in vitro, and this work is now being extended to isolated human white blood cells (WBC). Two lipophilic water-soluble technetium cations, the t-butyl [Tc-99m(TBI)] and cyclohexyl [Tc-99m(CHI)] analogs, were prepared essentially ligand-free at no-carrier-added levels in aqueous media and introduced in 10% propylene glycol/90% normal saline solution to WBC at room temperature. The cells were isolated from whole blood via sedimentation, centrifugation, and hypotonic hemolysis of the red blood cells. The labeling yield was studied as a function of incubation time (10-45 min), amount of activity (0.35-8.0 mCi), and total WBC (2.5 x 10/sup 7/-1.3 x 10/sup 8/). After 10 min incubation using 10/sup 8/ cells, the initial uptake of Tc-99m(TBI) was 40%, of which 50% remained bound after one saline wash. By contrast, the labeling efficiency with Tc-99m(CHI) was 85%, with 90% of the label still bound after washing. The labeling yield was unrelated to activity levels of incubation time, but was proportional to the number of WBC present. The entire process could be complemented in approximately one hour. The labeling yields with Tc-99m-(CHI) are comparable to those now obtained with the clinically available In-111 oxine

  11. Radioimmunoimaging of osteogenic sarcoma xenografts in nude mice using monoclonal antibodies to osteogenic sarcoma

    International Nuclear Information System (INIS)

    Sakahara, H.; Endo, K.; Nakashima, T.

    1985-01-01

    The authors have developed several monoclonal antibodies against human osteogenic sarcoma, one of which; OST7 (IgGl) selectively localized in osteogenic sarcoma xenografts in nude mice. In the present study, F(ab')/sub 2/ fragment was compared with whole IgG and those labeled with In-111 as well as I-131 were used as a radiotracer for the scintigraphic imaging of tumors. IgC and F(ab')/sub 2/ were labeled with I-131 using chloramine-T method and injected into nude mice bearing human osteogenic sarcoma. Scintigrams at day 2 clearly delineated the site of tumors with almost no radioactivity in other organs with F(ab')/sub 2/, which yielded much better images than whole IgG. Tumor-to-blood ratio of 6.09-27.87 was obtained at day 2 using F(ab')/sub 2/, whereas it was 0.76-1.12 at day 2 and 2.05-3.27 at day 7 with IgG. I-131 labeled nonspecific F(ab')/sub 2/ or IgG resulted in no or very low tumor uptake with tumor-to-blood ratio of 0.94-1.18 at day 2 for F(ab')/sub 2/ and 0.67-0.76 at day 7 for IgG, respectively. In-111 labeled F(ab')/sub 2/ fragment of OST7, which was prepared using DTPA as a bifunctional chelate, also showed a high tumor accumulation with tumor-to-blood ratio of 11.67-17.54 at day 2, but higher background activity in the liver and kidney was observed than I-131 labeled one. These results indicate that F(ab')/sub 2/ fragment of OST7 labeled with either I-131 or In-111, has a great potential for the radioimmunoimaging of osteogenic sarcoma

  12. Correlation of bone scintigraphy findings and tumor markers during follow-up prostate cancer

    International Nuclear Information System (INIS)

    Aizawa, Taku

    1996-01-01

    In the last 9 years, 217 patients with prostate cancer were treated at our department. Of these patients 153 cases treated by estrogen therapy were followed up by bone scintigraphy and tumor marker examinations (prostate specific antigen [PSA], prostate acid phosphatase [PAP], gamma-seminoprotein [γ-SM) . The correlation between changes on bone scintigrams and synchronous changes in tumor markers was evaluated retrospectively. In cases in which bone metastasis was not recognized on bone scintigrams before treatment, changes of tumor markers corresponded with subsequent changes on bone scintigrams in more than 90%. However, in cases with bone metastasis on bone scintigrams before treatment, changes of bone scintigrams and changes of tumor markers corresponded in only 55% of cases. Changes of bone scintigrams do not always correspond with changes of tumor markers. However, by taking into consideration physical examination parameters such as bone pain, in addition to changes of tumor markers, most changes on bone scintigrams can be anticipated. The reasons for lack of correspondence between changes of bone scintigrams and changes of tumor markers may be, changes of tumor markers are more rapid than the changes on bone scintigram, some poorly differentiated cancers do not have increased tumor marker levels and bone scintigrams do not demonstrate soft tissue involvement. In the follow-up of patients with prostate cancer, it is not necessary to perform bone scintigraphy regularly at 3-month intervals. Bone scintigraphy should only be performed when serum levels of tumor markers increase or bone pain appears. (author)

  13. Dielectric behavior and phase transition in [111]-oriented PIN–PMN–PT single crystals under dc bias

    Directory of Open Access Journals (Sweden)

    Yuhui Wan

    2014-01-01

    Full Text Available Temperature and electric field dependences of the dielectric behavior and phase transition for [111]-oriented 0.23PIN–0.52PMN–0.25PT (PIN-PMN–0.25PT and 0.24PIN–0.43PMN–0.33PT (PIN–PMN–0.33PT single crystals were investigated over a temperature range from -100°C to 250°C using field-heating (FH dielectric measurements. The transition phenomenon from ferroelectric microdomain to macrodomain was found in rhombohedra (R phase region in the single crystals under dc bias. This transition temperature Tf of micro-to-macrodomain is sensitive to dc bias and move quickly to lower temperature with increasing dc bias. The phase transition temperatures in the two single crystals shift toward high temperature and the dielectric permittivities at the phase transition temperature decrease with increasing dc bias. Especially, the phase transition peaks are gradually broad in PIN–PMN–0.33PT single crystal with the increasing dc bias. Effects of dc bias on the dielectric behavior and phase transition in PIN–PMN–PT single crystals are discussed.

  14. Multimodality Molecular Imaging of [18F]-Fluorinated Carboplatin Derivative Encapsulated in [111In]-Labeled Liposomes

    Science.gov (United States)

    Lamichhane, Narottam

    Platinum based chemotherapy is amongst the mainstream DNA-damaging agents used in clinical cancer therapy today. Agents such as cisplatin, carboplatin are clinically prescribed for the treatment of solid tumors either as single agents, in combination, or as part of multi-modality treatment strategy. Despite the potent anti-tumor activity of these drugs, overall effectiveness is still hampered by inadequate delivery and retention of drug in tumor and unwanted normal tissue toxicity, induced by non-selective accumulation of drug in normal cells and tissues. Utilizing molecular imaging and nanoparticle technologies, this thesis aims to contribute to better understanding of how to improve the profile of platinum based therapy. By developing a novel fluorinated derivative of carboplatin, incorporating a Flourine-18 (18F) moiety as an inherent part of the molecule, quantitative measures of drug concentration in tumors and normal tissues can be directly determined in vivo and within the intact individual environment. A potential impact of this knowledge will be helpful in predicting the overall response of individual patients to the treatment. Specifically, the aim of this project, therefore, is the development of a fluorinated carboplatin drug derivative with an inherent positron emission tomography (PET) imaging capability, so that the accumulation of the drug in the tumor and normal organs can be studied during the course of therapy . A secondary objective of this research is to develop a proof of concept for simultaneous imaging of a PET radiolabeled drug with a SPECT radiolabeled liposomal formulation, enabling thereby bi-modal imaging of drug and delivery vehicle in vivo. The approach is challenging because it involves development in PET radiochemistry, PET and SPECT imaging, drug liposomal encapsulation, and a dual-modal imaging of radiolabeled drug and radiolabeled vehicle. The principal development is the synthesis of fluorinated carboplatin 19F-FCP using 2-(5-fluoro-pentyl)-2-methyl malonic acid as the labeling agent to coordinate with the cisplatin aqua complex. It was then used to treat various cell lines and compared with cisplatin and carboplatin at different concentrations ranging from 0.001 microM to 100 microM for 72 hrs and 96 hrs. IC50 values calculated from cell viability indicated that 19F-FCP is a more potent drug than Carboplatin. Manual radiosynthesis and characterization of [18F]-FCP was performed using [18F]-2-(5-fluoro-pentyl)-2-methyl malonic acid with coordination with cisplatin aqua complex. Automated radiosynthesis of [18F]-FCP was optimized using the manual synthetic procedures and using them as macros for the radiosynthesizer. [18F]-FCP was evaluated in vivo with detailed biodistribution studies and PET imaging in normal and KB 3-1 and KB 8-5 tumor xenograft bearing nude mice. The biodistribution studies and PET imaging of [18F]-FCP showed major uptake in kidneys which attributes to the renal clearance of radiotracer. In vivo plasma and urine stability demonstrated intact [18F]-FCP. [ 111In]-Labeled Liposomes was synthesized and physiochemical properties were assessed with DLS. [111In]-Labeled Liposome was evaluated in vivo with detailed pharmacokinetic studies and SPECT imaging. The biodistribution and ROI analysis from SPECT imaging showed the spleen and liver uptake of [111In]-Labeled Liposome and subsequent clearance of activity with time. [18F]-FCP encapsulated [111In]-Labeled Liposome was developed and physiochemical properties were characterized with DLS. [18F]-FCP encapsulated [111In]-Labeled Liposome was used for in vivo dual tracer PET and SPECT imaging from the same nanoconstruct in KB 3-1 (sensitive) and COLO 205 (resistant) tumor xenograft bearing nude mice. PET imaging of [18F]-FCP in KB 3-1 (sensitive) and COLO 205 (resistant) tumor xenograft bearing nude mice was performed. Naked [18F]-FCP and [18F]-FCP encapsulated [ 111In]-Labeled Liposome showed different pharmacokinetic profiles. PET imaging of [18F]-FCP showed major uptake in kidneys and bladder. However, [18F]-FCP encapsulated [111In]-Labeled Liposome showed major uptake in RES in both PET and SPECT images. ROI analysis of SPECT image enabled by 111In corresponded with PET image enabled by 18F demonstrating the feasibility of dual tracer imaging from the single nanoconstruct. Future work involves the intensive in vitro characterization of [18F]-FCP encapsulated [ 111In]-Labeled Liposome and detailed in vivo evaluation of [ 18F]-FCP encapsulated [111In]-Labeled Liposome in various tumor models.

  15. Signatures of electronic nematicity in (111) LaAlO3/SrTiO3 interfaces

    Science.gov (United States)

    Davis, S.; Huang, Z.; Han, K.; Ariando, Venkatesan, T.; Chandrasekhar, V.

    2018-01-01

    The two-dimensional conducting gas (2DCG) that forms at the interface between LaAlO3 (LAO) and SrTiO3 (STO) has been widely studied due to the multitude of in situ tunable phenomena that exist at the interface. Recently it has been shown that nearly every property of the 2DEG that forms at the interface of (111) oriented LAO/STO is strongly anisotropic with respect to the in-plane crystal direction. This in-plane rotational symmetry breaking points to the existence of an electronic nematic phase at the interface that can be modified by an in situ electrostatic back-gate potential. Here we show that the onset temperature of the anisotropy in the longitudinal resistance is T ≈22 K , which does not match up with any known structural transition, and coincides with the onset of anisotropy in the Hall response of the system. Furthermore, below 22 K, charge transport is activated in nature with different activation energies along the two in-plane crystal directions. Such a response implies that the band edges along the two directions are different and provides further evidence of an electronic nematic state at the interface.

  16. Infected knee prosthesis: diagnosis with In-111 leukocyte, Tc-99m sulfur colloid, and Tc-99m MDP imaging

    Energy Technology Data Exchange (ETDEWEB)

    Palestro, C.J.; Swyer, A.J.; Kim, C.K.; Goldsmith, S.J. (Mount Sinai School of Medicine, New York, NY (USA))

    1991-06-01

    Forty-one possible cases of infected total knee prostheses studied with indium-111-labeled leukocyte scintigraphy were retrospectively reviewed. Twenty-four of the prostheses were studied with technetium-99m methylene diphosphonate bone scintigraphy and 19 with Tc-99m sulfur colloid marrow scintigraphy. Nine prostheses were infected, and 32 were uninfected. The accuracy of combined labeled leukocyte and sulfur colloid marrow imaging (95%) was higher than that of labeled leukocyte scintigraphy alone (78%), bone scintigraphy alone (74%), or combined labeled leukocyte and bone scintigraphy (75%). The authors conclude that combined labeled leukocyte and sulfur colloid imaging is an accurate method for diagnosis of infected knee prostheses. In this series, this technique was superior to labeled leukocyte and bone imaging, alone or in combination.

  17. Quantitative kinetics of In-111 autologous (In-AP) and homologous (Cr-HP) platelets in immune thrombocytopenic purpura (ITP)

    International Nuclear Information System (INIS)

    Lotter, M.G.; Heyns, A.D.P.; Badenhorst, P.N.; Minnaar, P.C.

    1984-01-01

    Contrary to the accepted view, the authors have found that platelet turnover is not always increased in ITP if the mean platelet survival time (PS) is measured with In-AP. The authors investigated the possible cause of the discrepancy by comparing kinetics of In-AP with those of Cr-HP in 10 patients with ITP. PS was estimated with the multiple hit model. The equilibrium and final in vivo distribution of In-AP was quantitated with the geometrical mean method. The patients could be divided into either those with splenic or diffuse RES platelet destruction. The authors conclude that in ITP platelet survival of In-AP is significantly (P < .05) longer than that of Cr-HP. Platelet turnover measured with In-AP is only normal in patients with mainly splenic platelet sequestration. Results with Cr-HP give a false impression of PS. It seems that in ITP those patients with severe disease also have a platelet production defect

  18. The Evidence of Giant Surface Flexoelectric Field in (111) Oriented BiFeO3 Thin Film.

    Science.gov (United States)

    Yang, Tieying; Zhang, Xingmin; Chen, Bin; Guo, Haizhong; Jin, Kuijuan; Wu, Xiaoshan; Gao, Xingyu; Li, Zhong; Wang, Can; Li, Xiaolong

    2017-02-15

    In this work, the surface structure of a single-domain epitaxial BiFeO 3 film with (111) orientation was investigated by in situ grazing incidence X-ray diffraction and X-ray reflectivity. We found that a large strain gradient exists in the surface region (2-3 nm) of the BiFeO 3 film. The strain gradient is approximately 10 7 m -1 , which is 2 or 3 orders of magnitude larger than the value inside the film. Moreover, we found that a surface layer with a lower electron density compared with the underlying BiFeO 3 layer exists on the surface of BiFeO 3 film, and this layer exhibits an irreversible surface structure transition occurs at 500 K, which should be associated with the surface flexoelectric field. We considered that this large strain gradient is originated from the surface depolarization field of ferroelectrics. Our results suggest a coupling between the surface structure and the flexoelectricity and imply that the surface layer and properties would be controlled by the strain gradient in ferroelectric films.

  19. Preclinical Evaluation of a Novel In-111-Labeled Bombesin Homodimer for Improved Imaging of GRPR-Positive Prostate Cancer

    NARCIS (Netherlands)

    Carlucci, G.; Ananias, H. J. K.; Yu, Z.; Hoving, H. D.; Helfrich, W.; Dierckx, R. A. J. O.; Liu, S.; de Jong, I. J.; Elsinga, P. H.

    Rational-designed multimerization of targeting ligands can be used to improve kinetic and thermodynamic properties. Multimeric targeting ligands may be produced by tethering multiple identical or two or more monomeric ligands of different binding specificities. Consequently, multimeric ligands may

  20. Sequential myocardial scintigraphy with technetium-99m stannous pyrophosphate following myocardial infarction

    International Nuclear Information System (INIS)

    Malin, F.R.; Rollo, F.D.; Gertz, E.W.

    1978-01-01

    Studies have shown that technetium-99m stannous pyrophosphate (Tc-PPi) is effective for the detection and imaging of acute myocardial infarction. Positive Tc-PPi myocardial scintigrams, however, have been reported in patients with other forms of heart disease and no evidence of recent myocardial infarction. To help define the usefulness of this test, we undertook a prospective study to ascertain when Tc-PPi myocardial scintigrams return to normal after myocardial infarction. Twenty patients with acute myocardial infarction were followed with Tc-PPi scintigrams at 1 and 2 wk, and 1, 2, 3, 6, and 9 mo after infarction. The serial scintigrams revealed that (a) 15 of 18 scintigrams were positive within the first week after infarction, (b) the number of markedly positive scintigrams decreased promptly after the first week, and (c) some scintigrams (11 of 18 at 1 mo, and 3 of 18 at 9 mo) remained positive throughout the study. The possible explanations for persistently positive scintigrams are discussed. Persistently positive scintigrams may hinder the usefulness of Tc-PPi myocardial scintigraphy for the diagnosis of acute myocardial infarction in patients who have had a myocardial infarction within the previous 9 mo

  1. Whole body counter assessment of internal radiocontamination in patients with end-stage renal disease living in areas affected by the Fukushima Daiichi nuclear power plant disaster: a retrospective observational study.

    Science.gov (United States)

    Shimmura, Hiroaki; Tsubokura, Masaharu; Kato, Shigeaki; Akiyama, Junichi; Nomura, Shuhei; Mori, Jinichi; Tanimoto, Tetsuya; Abe, Koichiro; Sakai, Shuji; Kawaguchi, Hiroshi; Tokiwa, Michio

    2015-12-07

    To assess internal radiocontamination of patients with end-stage renal disease (ESRD) who were regularly taking haemodialysis (HD) and living in areas affected by the crippled Fukushima Daiichi nuclear plant after the Great East Japan earthquake on 11 March 2011. Internal radiocontamination in 111 patients with ESRD regularly taking HD at Jyoban Hospital in Iwaki city, Fukushima from July 2012 to November 2012 was assessed with a whole body counter (WBC). The maximum annual effective dose was calculated from the detected Cs-137 levels. Interviews concerning patient dietary preferences and outdoor activities were also conducted. Among the 111 patients tested, internal radiocontamination with Cs-137 was detected in two participants, but the levels were marginal and just exceeded the detection limit (250 Bq/body). The tentatively calculated maximum annual effective dose ranged from 0.008 to 0.009 mSv/year, which is far below the 1 mSv/year limit set by the government of Japan. Relative to 238 non-ESRD participants, patients with ERSD had significantly more opportunities to consume locally grown produce that was not distributed to the market (pnuclear plant. Although HD is suggested to promote Cs-137 excretion, continuous inspection of locally grown produce together with WBC screening for radiocontamination should be continued for patients with ESRD regularly taking HD. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  2. Renovascular hypertension due to insufficient collateral flow in segmental artery occulusion

    Energy Technology Data Exchange (ETDEWEB)

    Park, Y. H.; Lee, S. Y.; Kim, S. H.; Sohn, H. S.; Chung, S. K. [College of Medicine, The Catholic Univ. of Korea, Seoul (Korea, Republic of)

    2001-07-01

    We report a case in which a 33-year-old woman with renovascular hypertension due to insufficient collateral flow in segmental renal artery occlusion demonstrated abnormality on captopril renal scintigram. Baseline renal scintigram with DTPA showed normal perfusion and excretion in left kidney and captopril renal scintigram with DTPA showed a focal area of decreased perfusion and delayed clearance in lower half of left kidney, suggesting segmental renal artery stenosis. Selective left renal arteriography showed complete obstruction in proximal portion of anterior segmental artery with multiple small collateral vessels from posterior segmental artery and capsular artery and delayed opacification in lower half of left kidney. These findings are suggestive of segmental hypoperfusion due to insufficient collateral blood flow resulting to positive captopril response. Patient's blood pressure have been controlled well with ACE (angiotensin converting enzyme) inhibitor and calcium channel blocker for 2 year. Follow-up baseline renal scintigram with MAG3 showed normal perfusion and excretion in left kidney and captopril renal scintigram with MAG3 showed a focal area of decreased perfusion and delayed clearance in lower lateral portion of left kidney, which was smaller size than that of previous renal scintigram. And captopril renal scintigram with DMSA demonstrated a small area of decreased DMSA uptake on this lesion compared to baseline DMSA scintigram.

  3. Renovascular hypertension due to insufficient collateral flow in segmental artery occulusion

    International Nuclear Information System (INIS)

    Park, Y. H.; Lee, S. Y.; Kim, S. H.; Sohn, H. S.; Chung, S. K.

    2001-01-01

    We report a case in which a 33-year-old woman with renovascular hypertension due to insufficient collateral flow in segmental renal artery occlusion demonstrated abnormality on captopril renal scintigram. Baseline renal scintigram with DTPA showed normal perfusion and excretion in left kidney and captopril renal scintigram with DTPA showed a focal area of decreased perfusion and delayed clearance in lower half of left kidney, suggesting segmental renal artery stenosis. Selective left renal arteriography showed complete obstruction in proximal portion of anterior segmental artery with multiple small collateral vessels from posterior segmental artery and capsular artery and delayed opacification in lower half of left kidney. These findings are suggestive of segmental hypoperfusion due to insufficient collateral blood flow resulting to positive captopril response. Patient's blood pressure have been controlled well with ACE (angiotensin converting enzyme) inhibitor and calcium channel blocker for 2 year. Follow-up baseline renal scintigram with MAG3 showed normal perfusion and excretion in left kidney and captopril renal scintigram with MAG3 showed a focal area of decreased perfusion and delayed clearance in lower lateral portion of left kidney, which was smaller size than that of previous renal scintigram. And captopril renal scintigram with DMSA demonstrated a small area of decreased DMSA uptake on this lesion compared to baseline DMSA scintigram

  4. An experimental comparison of the K- and L-Auger electron spectra generated in the decays of Nd-140 and In-111

    Czech Academy of Sciences Publication Activity Database

    Yakushev, E.A.; Kovalík, Alojz; Filossofov, D. V.; Korolev, N. A.; Lebedev, N. A.; Lubashevsky, A. V.; Rosch, F.; Novgorodov, A. F.

    2005-01-01

    Roč. 62, č. 3 (2005), s. 451-456 ISSN 0969-8043 R&D Projects: GA MŠk 1P04LA213 Institutional research plan: CEZ:AV0Z10480505 Keywords : positron - emission - tomography * dosimetry * yields Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders Impact factor: 0.757, year: 2005

  5. Optimization of IGF-1R SPECT/CT Imaging Using In-111-Labeled F(ab ')(2) and Fab Fragments of Article the Monoclonal Antibody R1507

    NARCIS (Netherlands)

    Heskamp, S.; Laarhoven, H.W.M. van; Molkenboer-Kuenen, J.D.M.; Bouwman, W.H.; van der Graaf, W.T.; Oyen, W.J.G.; Boerman, O.C.

    2012-01-01

    The insulin-like growth factor 1 receptor (IGF-1R) is a potential new target for the treatment of breast cancer. Patients with breast cancer lesions that express IGF-1R may benefit from treatment with anti-IGF-IR antibodies. IGF-1R expression can be visualized using radiolabeled R1507, a monoclonal

  6. Preparation of [In-111]-labeled-DTPA-bombesin conjugates at high specific activity and stability: Evaluation of labeling parameters and potential stabilizers

    Energy Technology Data Exchange (ETDEWEB)

    Pujatti, P.B., E-mail: pujatti.pb@gmail.com [Directory of Radiopharmacy, Nuclear and Energy Research Institute (IPEN/CNEN), Av. Prof. Lineu Prestes, 2242 - Cidade Universitaria da USP - Butanta, Sao Paulo - SP - Brazil - CEP: 05508-000 (Brazil); Massicano, A.V.F.; Mengatti, J.; Araujo, E.B. de [Directory of Radiopharmacy, Nuclear and Energy Research Institute (IPEN/CNEN), Av. Prof. Lineu Prestes, 2242 - Cidade Universitaria da USP - Butanta, Sao Paulo - SP - Brazil - CEP: 05508-000 (Brazil)

    2012-05-15

    The aim of the present work was to obtain stabilized high specific activity (HSA) {sup 111}In-labeled bombesin conjugates for preclinical evaluations. Parameters influencing the kinetics of labeling were investigated and the effect of stabilizers on HSA radiopeptides stability at room temperature were systematically categorized applying chromatography techniques. A SA of 174 GBq/{mu}mol was achieved with high radiochemical purity, but the labeled compounds exhibited low stability. The addition of stabilizers avoided their radiolysis and significantly increased their stability. - Highlights: Black-Right-Pointing-Pointer We aimed to obtain stabilized high specific activity (SA) {sup 111}In-labeled bombesin conjugates. Black-Right-Pointing-Pointer The effect of stabilizers on high SA radiopeptides stability were investigated. Black-Right-Pointing-Pointer A maximum specific activity of 174 GBq/{mu}mol was achieved. Black-Right-Pointing-Pointer The studied stabilizers significantly increased the stability of high SA radiopeptides. Black-Right-Pointing-Pointer These stabilized bombesin conjugates will be applied in preclinical studies.

  7. Technetium-99m stannous pyrophosphate myocardial scintigraphy. Reliability and limitations in assessment of acute myocardial infraction

    International Nuclear Information System (INIS)

    Cowley, M.J.; Mantle, J.A.; Rogers, W.J.; Rossell, R.O. Jr.; Rackley, C.E.; Logic, J.R.

    1977-01-01

    Two hundred-three patients had technetium 99m (stannous) pyrophosphate myocardial scintigrams for the evaluation of chest pain and suspected acute myocardial infarction. In addition to routine imaging at 60 to 90 minutes after injection of the radiopharmaceutical, the blood pool was imaged immediately in each patient for comparison with routine anterior, left anterior oblique, and left lateral views. Further delayed studies were obtained when residual blood pool activity was identified. Seventy patients had acute myocardial infarction by clinical, electrocardiographic, and enzymatic (CK-MB) criteria. Sixty-five of these 70 patients with acute infarction had positive myocardial scintigrams, with one technically unsatisfactory study. Only four of the 70 patients had negative scintigrams when imaged 18 to 72 hours after infarction in this study. Technically satisfactory scintigrams were recorded in 125 patients without evidence of infarction. Ninety-six had negative scintigrams at 60 to 90 minutes, while 19 patients (15%) had precordial activity at 60 to 90 minutes which was identical in distribution to early blood pool images and cleared with further delay. With these included, the true negative incidence was 92%. Ten of 125 patients had false positive scintigrams; two had recent cardioversion with resultant chest wall damage. The other eight patients had previous infarction 1 1 / 2 to 72 months earlier and had akinetic segments shown angiographically in the areas of the persistently positive scintigrams

  8. Thallium-201 scintigraphy in diagnosis of coronary stenosis

    International Nuclear Information System (INIS)

    Corne, R.A.; Gotsman, M.S.; Weiss, A.; Enlander, D.; Samuels, L.D.; Salomon, J.A.; Warshaw, B.; Atlan, H.

    1979-01-01

    The sensitivity of rest and exercise thallium-201 scintigraphy for the detection of significant coronary artery disease and myocardial ischaemia was compared with rest and exercise electrocardiography in 46 patients with chest pain. Of 26 patients with greater that 70 per cent coronary stenosis, 16 had abnormal rest thallium-201 scintigrams and 13 had Q waves. Myocardial perfusion defects in the resting scintigram correlated very well with evidence of previous myocardial infarction (16 of 17 patients, 94%) significant Q waves were present in 13 of these 17 patients (76%). After exercise, abnormal thallium-201 scintigrams consistent with ischaemia were found in 21 patients (81%). Abnormal exercise electrocardiograms were present in 15 patients (58%). The combination of abnormal exercise thallium-201 scintigrams or exercise electrocardiograms (23/26, 88%) exceeded abnormal exercise electrocardiograms alone (15/26, 58%). The two procedures were thus complementary. Abnormal rest or exercise thallium-201 scintigrams were obtained in 25/26 patients (96%) compared with abnormal rest or exercise electrocardiograms in 21/26 patients (84%). Twenty patients with less than 50 per cent coronary stenosis had normal rest thallium-201 scintigrams and no Q waves. Two had abnormal exercise thallium-201 scintigrams and 7 had abnormal exercise electrocardiograms. Thus,exercise thallium scintigraphy has higher sensitivity than exercise electrocardiography in detecting exercise induced ischaemia and is more specific. Scintigraphy appears to have a higher sensitivity than electrocardiography in detecting coronary artery disease. (author)

  9. Bone scintilography for detection of breast cancer metastases

    International Nuclear Information System (INIS)

    Silva Neto, J.B. da; Fontes, C.E.M.; Serson, D.; Oliveira Nunes, J.E. de; Quadros, J.

    1979-01-01

    Eighty seven patiensts with mammary carcinoma and positive skeletal scintigram were submitted to a roentgenologic study to determine the accuracy of the scintigram findings. The skeletal roentgenograms performed immediately after the scintigram confirmed osseous metastases in 60.9% of the cases, after 3 months in 76.5%, after 6 months in 81.5% and, finally, after 12 months the metastases were radiologically confirmed in 89.3% of the cases. The reasons of no confirmation of metastases in 10.7% of the cases are discussed. (Author) [pt

  10. Clinical studies on combined ventilation (sup(81m)Kr)/perfusion (sup(99m)Tc-MAA) scintigraphy

    International Nuclear Information System (INIS)

    Yamamoto, Keiichiro; Miyamae, Tatsuya

    1983-01-01

    One hundred fifty patients having pulmonary disease underwent pulmonary scintigraphy sequentially with sup(99m)Tc-MAA and sup(81m)Kr gases. Scintigrams of matched defect were obtained from 113 (75.3%) of the 150 patients, considered to be nonspecific universal pattern of a pulmonary disease. Scintigrams of mismatched defect (absent perfusion and homogeneous ventilation) were obtained from 20 patients (13.3%), including 6 with lung carcinoma, 3 with pulmonary embolism, 3 with connective tissue disease, 2 with aortitis syndrome and 6 with other diseases. Scintigrams of mismatch with impaired ventilation and normal perfusion were mainly seen in chronic obstructive lung diseases. Of the 10 patients with bronchial asthma, 5 had scintigrams of improved ventilation after intravenous injection of 250 mg aminophilline, but none of patients with emphysema. The combined scintigraphy has made significant contributions to diagnosis and management of patients with pulmonary disease where the chest X-ray is unhelpful. (author)

  11. Limited clinical diagnostic specificity of /sup 99m/Tc stannous pyrophosphate myocardial imaging in acute myocardial infarction

    International Nuclear Information System (INIS)

    Ahmad, M.; Dubiel, J.P.; Logan, K.W.; Verdon, T.A.; Martin, R.H.

    1977-01-01

    To test the sensitivity and specificity of technetium-99m stannous pyrophosphate myocardial imaging in the diagnosis of acute myocardial infarction, myocardial scintigrams were performed in 115 patients. Positive scintigrams were found in all 48 patients with acute myocardial infarction; uptake was localized in 29 patients with transmural infarction and diffuse in 2 patients with transmural infarction and in the remaining 17 patients with subendocardial myocardial infarction. Positive scintigrams were also found in 31 of 67 patients without clinical evidence of acute myocardial infarction. Our data confirm the previously reported sensitivity of /sup 99m/Tc-pyrophosphate imaging in detection of acute myocardial infarction but indicate that positive scintigrams are not specific for this entity

  12. Sacro-iliac joint disease in drug abusers: The role of bone scintigraphy

    International Nuclear Information System (INIS)

    Lopez-Majano, V.; Miskew, D.B.W.; Cook County Hospital, Chicago, IL

    1980-01-01

    Bone scintigrams demonstrated increased uptake in the sacroiliac joint in twenty drug addicts with low back pain and signs of localized sepsis. The localization of the disease was decisive for the orthopedist in the aspiration of the affected joint. (orig.)

  13. Osteomyelitis and infarction in sickle cell hemoglobinopathies: differentiation by combined technetium and gallium scintigraphy

    International Nuclear Information System (INIS)

    Amundsen, T.R.; Siegel, M.J.; Siegel, B.A.

    1984-01-01

    Clinical records and scintigrams were reviewed of 18 patients with sickle cell hemoglobinophaties who had undergone combined technetium and gallium scintigraphy during 22 separate episodes of suspected osseous infection. The combined scintigrams were correctly interpreted as indicating osteomyelitis in four studies. Of 18 studies in patients with infarction, the combined scintigrams were correctly interpreted in 16 and showed either no local accumulation of Ga-67 or less accumulation than that of Tc-99m MDP at symptomatic sites. In the other two studies, the scintigrams were falsely interpreted as indicating osteomyelitis and showed congruent, increased accumulation of both Tc-99, MDP and Ga-67. This pattern must be considered indeterminate. Overall, the results indicate that the combination of technetium and gallium scintigraphy is an effective means to distinguish osteomyelitis from infarction in patients with sickle cell hemoglobinopathies

  14. Complete Blood Count Reference Values of Cord Blood in Taiwan and the Influence of Gender and Delivery Route on Them

    Directory of Open Access Journals (Sweden)

    Yu-Hsun Chang

    2011-06-01

    Conclusion: We successfully obtained the normal CBC and WBC DC reference values of the cord blood in Taiwan. Gender and delivery routes were important confounding factors that influenced the cord blood CBC and WBC DC values.

  15. [131I] Hippuran renography in the detection of orthostatic hypertension

    International Nuclear Information System (INIS)

    Clorius, J.H.; Kjelle-Schweigler, M.; Ostertag, H.; Moehring, K.

    1978-01-01

    Scintigrams in prone and standing positions were done in 11 hypertensive women. All had nephroptosis with ventral rotation. On the basis of the renograms, seven patients were identified as suffering from orthostatic hypertension. Nephropexy resulted in normalization of blood pressure in six of the seven patients and normalization of the renograms of all seven. We believe that sequence scintigrams in prone and standing positions offer a simple method of identifying patients with orthostatic hypertension

  16. Relationship between segmental thallium-201 uptake and regional myocardial blood flow in patients with coronary artery disease

    International Nuclear Information System (INIS)

    Nichols, A.B.; Weiss, M.B.; Sciacca, R.R.; Cannon, P.J.; Blood, D.K.

    1983-01-01

    The relationship between the spatial distribution of thallium-201 in myocardial perfusion scintigrams and the distribution of left ventricular regional myocardial blood flow was examined in 25 patients undergoing coronary arteriography. Thallium-201 myocardial scintigrams were obtained after symptom-limited exercise and after a 4 hr delay. Regional myocardial blood flow was measured by the xenon-133 clearance method in patients at rest and during rapid atrial pacing to a double product comparable with that achieved during exercise stress testing. Patterns of regional thallium-201 activity and regional myocardial blood flow, recorded in similar left anterior oblique projections, were compared for left ventricular segments supplied by the left anterior descending (LAD) and left circumflex (CIRC) arteries. In 11 patients without significant lesions of the left coronary artery (group 1), thallium-201 was homogeneously distributed in the LAD and CIRC distributions in scintigrams taken during peak exercise; these scintigrams correspond to homogeneous regional myocardial blood flow in the LAD and CIRC regions during pacing-induced stress. In 14 patients with significant lesions of the left coronary artery (group 2), ratios of regional thallium-201 activity in the LAD and CIRC distributions of exercise scintigrams correlated well (r . .84) with ratios of regional myocardial blood flow measured during rapid pacing. Background subtraction altered the relationship between relative thallium-201 uptake and regional myocardial blood flow, causing overestimation of the magnitude of flow reduction on exercise scintigrams

  17. Immunoscintigraphic detection of infections using monoclonal antigranulocyte antibodies

    International Nuclear Information System (INIS)

    Seybold, K.

    1988-01-01

    We report on a new approach to in vivo labelling of granulocytes for scintigraphic detection of infections by using the I-123 tagged monoclonal anti-CEA antibody-47 (Mab 47). Mab 47 reacts selectively with a glycoprotein (NAC 95) present on the surface of mature granulocytes. Many in vitro tests showed that binding does not inhibit granulocyte functions (e.g. chemotaxis, initiation of 'burst'). Up till now we have performed the search for infectious lesions in 56 patients. For clinical use one dose consisted of 120 mcg Mab 47 labelled with 148-185 MBq I-123 (specific activity: 1.85 GBq/mg). We noticed that all infectious lesions were highly visible 3-6 hours after tracer infusion or could be excluded after 24 h. High counting rates permitted SPECT-studies up to 24 h p.i. which are very usefull for an exact topographic localization of a lesion. The clinical interest was concentrated on cases of bone and joint infections. It is concluded that there are distinct advantages of the new method compared with In-111 WBC scanning. Without the need for cell separation there is a rapid in vivo labelling of granulocytes so that the method is also suitable in very acute cases. No allergic reactions have been observed. In spite of these obvious advantages and the low administered dose of antibodies we recommend a restriction in immunscintigraphy of infections because of the unknown antigenicity of the compound. (orig.) [de

  18. Efficacy of high therapeutic doses of iodine-131 in patients with differentiated thyroid cancer and detectable serum thyroglobulin

    Energy Technology Data Exchange (ETDEWEB)

    Keizer, B. de; Rijk, P.P. van; Klerk, J.M.H. de [Dept. of Nuclear Medicine, University Medical Center Utrecht (Netherlands); Koppeschaar, H.P.F.; Zelissen, P.M.J.; Lips, C.J.M. [Dept. of Endocrinology, University Medical Center Utrecht (Netherlands); Dijk, A. van [Dept. of Hospital Pharmacy, University Medical Center Utrecht (Netherlands)

    2001-02-01

    Serum thyroglobulin (Tg) is usually the best marker of residual or metastatic disease after treatment of differentiated thyroid cancer. We evaluated the effect of so-called blind therapeutic doses of iodine-131 in patients with detectable Tg during suppressive levothyroxine treatment (Tg-on), and in patients with a negative diagnostic scintigram but detectable Tg during the hypothyroid phase (Tg-off). Twenty-two patients with differentiated thyroid carcinoma underwent total thyroidectomy and radioiodine ablation. During the follow-up, six patients with detectable Tg-on and 16 patients with detectable Tg-off were identified. All patients were treated with a blind therapeutic dose of 7,400 MBq iodine-131. Diagnostic scintigrams were compared with post-treatment scintigrams. Tg-off was measured in 16 cases, 1 year after the administration of the blind therapeutic dose, at the time of the follow-up diagnostic scintigram. Six patients were followed up by Tg-on only. Post-therapy scintigrams revealed previously undiagnosed local recurrence or distant metastases in 13/22 cases (59%); the remaining nine post-therapy scintigrams were negative. At the time of the blind therapeutic doses, Tg-off values ranged from 8 to 608 {mu}g/l. After 1 year of follow-up, Tg-off decreased in 14/16 (88%) patients. In all patients who were followed by Tg-on only (n=6), a decrease in Tg values was measured. It is concluded that blind therapeutic doses resulted in a decrease in Tg levels in the majority of patients with suspected recurrence or metastases. The post-treatment scintigrams revealed pathological uptake in 59% of patients. (orig.)

  19. Radionuclide bone scintigraphy in the detection of significant complications after total knee joint replacement

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S.L.; Wastie, M.L.; Forster, I

    2001-03-01

    AIM: Post-arthroplasty knee pain is common and clinically it can be difficult to identify those patients with complications requiring active treatment. The aim of this study was to determine the usefulness of{sup 99}Tc{sup m}-MDP bone scintigraphy. METHOD: A retrospective study of all patients having a{sup 99}Tc{sup m}-MDP bone scintigram for a painful knee arthroplasty between 1993 and 1999 was performed. Bone scintigrams were classified as normal or abnormal by a single observer. The results of these investigations were correlated with clinical outcome. RESULTS: Seventy-five patients with painful knee arthroplasties were referred for investigation. A total of 80 bone scintigrams were performed. The average patient age was 66.2 years (42 female and 33 male). The mean time period between surgery and onset of knee pain was 3 years. A final clinical diagnosis based on arthroscopy, open surgery, and extended clinical follow-up was available for all patients. Forty-three (53.8%) of the scintigrams were normal and 37 (46.3%) abnormal. Two patients with a normal bone scintigram has loose prostheses. Thirteen patients with an abnormal study had normal prostheses on follow-up and these tended to be patients scanned less than a year after surgery. The sensitivity, specificity, positive predictive value and negative predictive value of an unequivocally normal or abnormal bone scintigram was 92.3, 75.9, 64.9 and 95.0%, respectively. The pattern of isotope uptake in the abnormal studies was not specific enough to reliably differentiate aseptic from septic loosening. CONCLUSION: Radionuclide bone scintigraphy is useful in the assessment of the painful knee arthroplasty. A negative bone scintigram is reassuring and makes loosening or infection unlikely. Smith, S.L. et al. (2001)

  20. Gastroesophageal reflux after esophageal surgery

    International Nuclear Information System (INIS)

    Nishimura, Osamu; Yokoi, Hideki; Maebeya, Shinji

    1989-01-01

    By means of esophageal transit scintigram using 99m Tc-DTPA, 15 patients (13 esophageal carcinomas and 2 cardia carcinomas) were studied, in whom esophagogastric anastomosis was done according to the posterior invagination anastomosis technique we had devised. In all 8 patients with anastomosis at cervical region, gastroesophageal reflux was not seen on both scintigrams before and after meals, and the average pressure gradient of high pressure zone at anastomosis was 39.8 cmH 2 O. In 2 of 7 patients with intrathoracic anastomosis, the scintigram before meals showed severe reflux. and the endoscopic findings showed diffuse and moderate erosion in the esophageal mucosa. The average pressure gradient across the anastomosis was 6.5 cmH 2 O. In these 2 patients, the new fornix with a sharp angle of His was not formed. In the remaining 5 patients with intrathoracic anastomosis, reflux was not seen on the scintigram before meals. However, in 2 of them, the scintigram after meal and endoscopic examination revealed mild reflux and mild esophagitis respectively. Furthermore in one patient very mild reflux was observed only on the scintigram after meals but the endoscopic findings showed the normal esophageal mucosa. In these 5 patients, the average pressure gradient across the anastomosis was 17.0 cmH 2 O, which was significantly higher (p<0.01) than that in 2 patients with severe reflux and was significantly lower (p<0.01) than the mean value of high pressure zone in 8 patients with cervical anastomosis. In conclusion, it is presumed that the formation of a large fornix enough to store food and a sharp angle of His are important factors in maintaining an anti-reflux mechanism. The esophageal transit scintigram was proved to be an excellent technique in detecting and evaluating quantitatively gastroesophageal reflux. (author)

  1. Targeting human prostate cancer with In-111-labeled D2B IgG, F(ab ')(2) and Fab fragments in nude mice with PSMA-expressing xenografts

    NARCIS (Netherlands)

    Lutje, Susanne; van Rij, Catharina M.; Franssen, Gerben M.; Fracasso, Giulio; Helfrich, Wijnand; Eek, Annemarie; Oyen, Wim J.; Colombatti, Marco; Boerman, Otto C.

    2014-01-01

    D2B is a new monoclonal antibody directed against an extracellular domain of prostate-specific membrane antigen (PSMA), which is overexpressed in prostate cancer. The potential of D2B IgG, and F(ab)(2) and Fab fragments of this antibody for targeting prostate cancer was determined in mice bearing

  2. Electronic structure of buried LaNiO3 layers in (111-oriented LaNiO3/LaMnO3 superlattices probed by soft x-ray ARPES

    Directory of Open Access Journals (Sweden)

    F. Y. Bruno

    2017-01-01

    Full Text Available Taking advantage of the large electron escape depth of soft x-ray angle resolved photoemission spectroscopy, we report electronic structure measurements of (111-oriented [LaNiO3/LaMnO3] superlattices and LaNiO3 epitaxial films. For thin films, we observe a 3D Fermi surface with an electron pocket at the Brillouin zone center and hole pockets at the zone vertices. Superlattices with thick nickelate layers present a similar electronic structure. However, as the thickness of the LaNiO3 is reduced, the superlattices become insulating. These heterostructures do not show a marked redistribution of spectral weight in momentum space but exhibit a pseudogap of ≈50 meV.

  3. Lung scintiscanning in corrective surgery of congenital heart disease, 2. Tetralogy of Fallot

    Energy Technology Data Exchange (ETDEWEB)

    Endo, K. (Iwate Medical Coll., Morioka (Japan). School of Medicine)

    1981-06-01

    Lung scintiscanning was performed to investigate the distribution of pulmonary blood flow before and after surgery in 30 patients with tetralogy of Fallot. Uniformity of lung scintigram and the derangement of the distribution pattern were observed preoperatively and postoperatively. The results were as follows: 1) Preoperatively, uniformity of lung scintigram was 27.7 - 100% (average 63.4%). It is more necessary to construct the outflow tract in most cases, when the PA/Ao diameter ratio was lower than 0.5 and uniformity of lung scintigram was under 50%. Besides, preoperative uniformity of lung scintigram correlated with the degree of polycythemia. In 3 cases who died after corrective surgery, the value of uniformity of lung scintigram was as low as 33.3 - 61.1%. 2) Preoperative pulmonary blood flow disturbances were found in 50% of 30 cases. In all of the cases without pulmonary blood flow disturbances, total correction was successfully performed. On the other hand, in cases with pulmonary blood flow disturbances, the result of total correction was not satisfactory. 3) In cases with the slight and moderately deranged distribution preoperatively, postoperative follow up study by scintiscanning at 1 to 2 months after surgery showed considerately more improvement of pulmonary blood flow.

  4. Lung scintiscanning in corrective surgery of congenital heart disease, 2

    International Nuclear Information System (INIS)

    Endo, Kaoru

    1981-01-01

    Lung scintiscanning was performed to investigate the distribution of pulmonary blood flow before and after surgery in 30 patients with tetralogy of Fallot. Uniformity of lung scintigram and the derangement of the distribution pattern were observed preoperatively and postoperatively. The results were as follows: 1) Preoperatively, uniformity of lung scintigram was 27.7 - 100% (average 63.4%). It is more necessary to construct the outflow tract in most cases, when the PA/Ao diameter ratio was lower than 0.5 and uniformity of lung scintigram was under 50%. Besides, preoperative uniformity of lung scintigram correlated with the degree of polycythemia. In 3 cases who died after corrective surgery, the value of uniformity of lung scintigram was as low as 33.3 - 61.1%. 2) Preoperative pulmonary blood flow disturbances were found in 50% of 30 cases. In all of the cases without pulmonary blood flow disturbances, total correction was successfully performed. On the other hand, in cases with pulmonary blood flow disturbances, the result of total correction was not satisfactory. 3) In cases with the slight and moderately deranged distribution preoperatively, postoperative follow up study by scintiscanning at 1 to 2 months after surgery showed considerately more improvement of pulmonary blood flow. (author)

  5. The usefulness of postoperative pinhole bone scintigraphy in the assessment of prognosis after multiple drilling or vascularized bone graft in patients with avascular necrosis of femoral head

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Young An; Kim, Sung Hoon; Cheon, Kyung Ah; Park, Young Ha; Jeong, Soo Kyo [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of); Song Moon Kab [Eulji Medical Center, Taejon (Korea, Republic of)

    1999-08-01

    It is important to evaluate the healing process of avascular necrosis (AVN) involving femoral head after treatment. The purpose of this study was to assess the usefulness of pinhole bone scintigraphy in the AVN of femoral head after surgery. We analyzed the changing pattern of pinhole bone scintigram in 21 femoral heads of 16 patients (14 lesions/11 male, 7 lesions/5 female, mean age : 39.4 yrs) before and after multiple drilling or vascularized bone grafting for AVN of the femoral head. In all patients, pre-operative scintigrams were obtained at 1 to 3 months before treatment and the first post-operative scintigrams were obtained at 1 to 3 months after treatment. All patients were followed for 2 to 4 years after operation. The findings of the pinhole scintigrams were divided into three patterns: 1) curvilinear, 2) scattered spotty and 3) underdetermined. The 10 of 11 lesions with curvilinear pattern had good postoperative clinical and radiological follow-up findings. However, all 6 lesions with scattered spotty pattern showed poor postoperative findings, which necessitated total hip joint replacement. Of the 4 lesions with undetermined pattern, 2 required total hip joint replacement. There was significant difference in postoperative prognosis between the curvilinear and scattered spotty patterns (p<0.05). We conclude that the pattern of pinhole bone scintigram obtained within 1 to 3 months after multiple drilling or vascularized bone graft operation is a useful prognostic indicator in the AVN of femoral head.

  6. Value of scintiscanning in supporting the radiological diagnosis of loosening of total hip endoprotheses

    Energy Technology Data Exchange (ETDEWEB)

    Fritsche, H.J.; Kadner, P.; Schneider, G. (Karl-Marx-Universitaet, Leipzig (German Democratic Republic). Radiologische Klinik)

    1984-01-01

    In 80 cases of total hip endoprotheses with suspicion on loosening bone scintigraphy was performed and compared to clinical and radiological findings. The radiographs of total hip endoprotheses are often dubious and additional bone scintigrams can provide information for the evaluation of the femoral part of the prothesis. Increased radioactivity of the acetabulum can be interpreted only with caution as a sign of loosening of the prothesis. In evaluating the scintigram not only the quantity of the isotope but mainly its distribution and exact localization are of diagnostic relevance. A negative scintigram in painful hip one year following operation does not indicate instability of the prothesis, but it is highly important for the clinician.

  7. Computed tomography and brain scintigraphy in ischemic stroke

    International Nuclear Information System (INIS)

    Chiu, L.C.; Fodor, L.B.; Cornell, S.H.; Christie, J.H.

    1976-01-01

    Radionuclide and computed tomographic (CT) scans were reviewed in 215 patients with ischemic stroke. The findings vary depending on the site of vascular occlusion. In middle cerebral artery occlusion, four distinct patterns may be seen on the scintigrams. The CT scans show little variation in appearance. The tentorial confluence sign is an important finding on scintigrams of patients with occipital infarction; the absence of this sign should suggest another diagnosis. During the first week and after the fourth week following an ischemic stroke, the scintigram is usually negative, whereas the lesion is visible by CT. However, there are a significant number of false negative CT scans; therefore, both examinations are advocated in difficult cases

  8. Evaluation of initial function and long-term prognosis of renal allografts by means of computer-assisted gamma-camera scintigraphy

    International Nuclear Information System (INIS)

    Kristiansen, J.H.; Lassen, E.

    1981-01-01

    Seventy-eight renal transplanted patients were examined with computer-assisted gamma-camera scintigraphy in an attempt to evaluate the initial graft function and long-term graft prognosis. The scintigrams were quantitated according to the value of the uptake ratio and excretion ratio. The results showed a correlation between the pattern of the first post-operative scintigram and the fact that the graft had immediate, delayed or no function. Additionally a correlation was found between the first post-operative scintigram and the renal graft function at the time of discharge from the hospital. The long-term graft prognosis was found to be best in grafts with an excellent uptake and excretion ratio. (author)

  9. Bone scintigraphy in detection of bone invasion by oral carcinoma

    International Nuclear Information System (INIS)

    Higashi, Kotaro; Wakao, Hiromi; Ikuta, Hiroyuki; Kashima, Isamu; Everhart, F.R. Jr.

    1996-01-01

    Detecting osseous involvement is clinically important in the management of oral carcinoma. Thirty-one patients with osseous involvement due to oral carcinoma who underwent panoramic radiography and bone scintigraphy were evaluated retrospectively. Bone scintigraphy confirmed osseous involvement in all 31 (100%) of these patients. In 27 (87%) of 31 patients with osseous involvement, both the panoramic radiogram and bone scintigram were positive. In the remaining four patients (13%), bone scintigram was positive for mandibular or maxillary invasion, while panoramic radiogram was negative. There were no instances of an abnormal radiogram with a normal bone scintigram. These findings strongly suggest that bone scintigraphy is more sensitive than panoramic radiography in detecting osseous involvement of the mandible and maxilla due to oral carcinoma. Furthermore, bone scintigraphy was a critical pre-surgical tool in determining the extent of the osseous involvement. (author)

  10. Thallium scintigraphy in experimental toxic pulmonary edema: relationship to extravascular pulmonary fluid

    International Nuclear Information System (INIS)

    Slutsky, R.A.; Higgins, C.B.

    1984-01-01

    Pulmonary fluid volumes (PBV = lung blood volume; EVLW = extravascular lung water) were examined to define the effects of oleic acid injury and then to examine the relationship between edema formation and accumulation of pulmonary thallium. In six dogs, pulmonary fluid compartments were monitored during the induction of pulmonary injury by oleic acid (0.15 cc/kg i.v.). By 30 min after the injection, EVLW had doubled; it continued to increase slowly for 180 min, whereas PBV declined. In six anesthetized dogs, similar measurements were made in an identical preparation and pulmonary fluid volumes were compared with pulmonary counts derived from sequential thallium scintigrams obtained after the injection of oleic acid. Measures of EVLW and PBV were obtained sequentially along with thallium scintigrams. The authors conclude that sequential thallium scintigrams provide useful information about the degree of change of EVLW over time in a model of noncardiogenic pulmonary edema

  11. Studies on 201Th myocardial scintiscanning

    International Nuclear Information System (INIS)

    Buchner, U.

    1979-01-01

    The diagnostical evidence of myocardial scintiscanning with thallium-201 was tested on 98 patients with coronary heart disease. 2 mCi thallium-201 were injected into an arm vene and then scintigrams of the heart were registered partly with a scanner, partly with a gamma camera in several views. The healthy myocardium was found in the thallium-201-scintigram to be a rather homogeneous, horeshoe-shaped activity pattern with intramyocardial activity differences of up to 20% of the maximal thallium-201-activity above the myocard which can be declared to be physiological. In dependency on the local blood flow conditions, thallium-201 is stored only in the healthy, but not in the ischaemic or infarcted myocardium. In the scintigram, these regions are seen as regions with reduced radioactivity. A comparison of the localisation of the infarction in the scintigram with those in the electrocardiagram and coronary angiogram showed a good congrucucy. Scintigrams taken at different times after the infarction brought a decrease in the number of diagnosed storage failures, from 90% to 68% in infarctions older than 6 weeks. A scintigraphical differentiation between fresh and old infarctions was not possible. In cases of angiographically established coronary heart disease without infarction, pathological storage reductions were observed. By comparing the findings obtained by scintiscanning with the results of laevocardiography it was seen that hypokinetic regions in the thallium-201-myocardial scintigram showed in only 6% of the cases a pathological storage defect; akinetic, dyskinetic, and aneurysmatic regions, however, were seen in 65% of the cases as clear activity reductions or failures. (orig./MG) [de

  12. Cold pressor 201Tl myocardial scintigraphy in the diagnosis of coronary artery disease

    International Nuclear Information System (INIS)

    Ahmad, M.; Dubiel, J.P.; Haibach, H.

    1982-01-01

    201 Tl myocardial scintigraphy was performed during cold pressor stimulation in 36 patients aged 36 to 69 years. Thirty-one patients had coronary artery disease and 5 patients did not, as confirmed by coronary cineangiography. 201 Tl (1.5 to 2 mCi) was injected at 30 seconds of the cold pressor stimulation. The product of systolic pressure X heart rate increased from a baseline of 77.4 +/- 16 (standard deviation [SD]) to 103.6 +/- 17 at 30 seconds of the cold pressor test (p less than 0.0005). Transient perfusion deficits developed in 24 of 31 patients with coronary artery disease (sensitivity 77%), and all 5 patients without coronary artery disease had normal scintigrams. The sensitivity in detecting coronary artery disease was 40% in patients with 1 vessel disease, 91% in patients with 2 vessel disease, and 100% in patients with 3 vessel disease. Exercise electrocardiograms (available in 29 of 36 patients) were positive for ischemia in 18 of 24 patients with coronary artery disease and in 1 of 5 patients without coronary artery disease (sensitivity 75% and specificity less than 80%). Exercise 201 Tl scintigrams, obtained in 16 patients, were positive in 11 patients with coronary artery disease and positive cold pressor 201 Tl scintigrams. Five patients without coronary artery disease and with normal cold pressor 201 Tl scintigrams had normal exercise 201 Tl scintigrams. Coronary cineangiography performed during cold pressor stimulation in 6 patients who had positive cold pressor and exercise 201 Tl scintigrams did not show coronary spasm. Our data indicate that cold pressor thallium-201 scintigraphy offers promise as a noninvasive test in the diagnosis of coronary artery disease and may be used in patients in whom exercise testing is not feasible

  13. Substantial interobserver variation of thyroid volume and function by visual evaluation of thyroid (99m)Tc scintigraphy

    DEFF Research Database (Denmark)

    Soelberg, Kerstin; Grupe, Peter; Boel-Jørgensen, Henrik

    2014-01-01

    (99m)Tc-pertechnetate scintigraphy is much used in the evaluation of patients with nodular goitre. We investigated the ability of experienced observers to estimate the thyroid 24-h (131)I uptake (RAIU) and the thyroid volume by visual evaluation of the scintigram.......(99m)Tc-pertechnetate scintigraphy is much used in the evaluation of patients with nodular goitre. We investigated the ability of experienced observers to estimate the thyroid 24-h (131)I uptake (RAIU) and the thyroid volume by visual evaluation of the scintigram....

  14. 99mTc-phosphate scintigraphy in the early diagnostics of reflex distrophy and in assessing the results of calcitonin treatment

    International Nuclear Information System (INIS)

    Balint, Geza; Hejj, Gabor; Bossanyi, Ada

    1987-01-01

    Patients suffering from Sudeck's syndrome receiving calcitonin or placebo treatment with 99m Tc diphosphonate scintigraphy were examined before and one or three months after a 4-week treatment period. Before the treatment the involved feet of the patients accumulated more isotope than the healthy ones. One month after the end of treatment the scintigrams of both calcitonin and placebo treated patients improved, and no significant difference was found between them. Three months after the close of treatment the scintigrams of all the calcitonin treated patients, but only half of the placebo treated patients became normal. (author) 14 refs.; 3 figs

  15. A study of old lesions of caisson disease of bone by radiography and bone scintigraphy.

    Science.gov (United States)

    Gregg, P J; Walder, D N

    1981-02-01

    A group of patients were studied 10 years after stopping work in a high-pressure environment. Radiographs of their long bones showed little change during the period, but only two of 12 scintigrams were normal. The 10 abnormal scintigrams contained 18 "hot-spots" which were not always associated with an abnormal radiographic appearance; the findings suggest that some lesions may never become visible on a radiograph. A reactive or repair process associated with these lesions may be prolonged and may not be beneficial, as structural failure of the joint may subsequently occur. Prognosis should therefore be guarded.

  16. In-flight Blood Analysis Technology for Astronaut Health Monitoring

    Data.gov (United States)

    National Aeronautics and Space Administration — Blood staining and testing procedure optimization: A 5-part WBC differential (Lymphocyte, Monocyte, Neutrophil, Eosinophil, and Basophil) assay using a...

  17. Whole-Body Cryotherapy Decreases the Levels of Inflammatory, Oxidative Stress, and Atherosclerosis Plaque Markers in Male Patients with Active-Phase Ankylosing Spondylitis in the Absence of Classical Cardiovascular Risk Factors

    Directory of Open Access Journals (Sweden)

    Agata Stanek

    2018-01-01

    Full Text Available Objective. The aim of the study was to estimate the impact of whole-body cryotherapy (WBC on cardiovascular risk factors in patients with ankylosing spondylitis (AS. Material and Methods. We investigated the effect of WBC with subsequent kinesiotherapy on markers of inflammation, oxidative stress, lipid profile, and atherosclerosis plaque in male AS patients (WBC group. To assess the disease activity, the BASDAI and BASFI were also calculated. The results from the WBC group were compared with results from the kinesiotherapy (KT group. Results. The results showed that in the WBC group, the plasma hsCRP level decreased without change to the IL-6 level. The ICAM-1 level showed a decreasing tendency. The CER concentration, as well as the BASDAI and BASFI, decreased in both groups, but the index changes of disease activity were higher in the WBC than KT patients. Additionally, in the WBC group, we observed a decrease in oxidative stress markers, changes in the activity of some antioxidant enzymes and nonenzymatic antioxidant parameters. In both groups, the total cholesterol and LDL cholesterol, triglycerides, sCD40L, PAPP-A, and PLGF levels decreased, but the parameter changes were higher in the WBC group. Conclusion. WBC appears to be a useful method of atherosclerosis prevention in AS patients.

  18. Association of Insulin Resistance and Hematologic Parameters: Study of a Middle-aged and Elderly Chinese Population in Taiwan

    Directory of Open Access Journals (Sweden)

    Liang-Kung Chen

    2006-06-01

    Conclusion: Elevated WBC count but not RBC count was significantly associated with insulin resistance and glycemic metabolism. The relationship between platelet count and insulin resistance deserves further investigations.

  19. Nonspecificity of the rim sign in the scintigraphic diagnosis of missed testicular torsion

    Energy Technology Data Exchange (ETDEWEB)

    Vieras, F.; Kuhn, C.R.

    1983-02-01

    Causes of a hyperemic peritesticular rim on dynamic and static scintigrams are reviewed. Of 6 patients exhibiting such a pattern, 3 had missed testicular torsion; the other 3 had tumor, trauma, or inflamation. The authors conclude that a hyperemic peritesticular rim is a nonspecific finding reflecting underlying pathophysiological changes and is not pathognomonic of missed torsion.

  20. Results of nonlinear and nonstationary image processing

    International Nuclear Information System (INIS)

    Pizer, S.M.; Correla, J.A.; Chesler, D.A.; Metz, C.E.

    1973-01-01

    A nonstationary method, multiple z-divided filtering, and a nonlinear method, biased smearing have been applied to scintigrams. Biased smearing does not appear to hold much promise. Multiple z-divided filtering, on the other hand, appears to be justified, and initial results at minimum encourage further research into the possibility that this technique may become a method of choice

  1. Distinction by radioisotope technique of a subgroup with increased thrombophilic potential among patients submitted to major abdominal surgery

    DEFF Research Database (Denmark)

    Rasmussen, A; Toftdahl, D; Lindholt, J

    1986-01-01

    Deep vein thrombosis (DVT) detectable by the 99mTechnetium-labeled plasmin test developed in 13 (37%) of 35 sequentially studied patients, all above 40 years, undergoing elective major abdominal surgery. Ten of the 13 patients with DVT had an abnormal pulmonary perfusion scintigram, suggesting pu...

  2. Radiological and scintigraphic evaluation of hip prostheses

    International Nuclear Information System (INIS)

    Bessler, W.; Schaub, W.

    1979-01-01

    The radiological findings following the introduction of hip prostheses are often equivocal. Additional bone scintigrams often provide important information for the evaluation of the prostheses. 1. An unstable hip prosthesis is characterised by abnormal uptake in bone, due to static and mechanical stress. 2. A positive scintigram does not necessarily indicate instability of the prosthesis. Increased uptake may also be due to inflammatory bone changes, healing, bone replacement, abnormal local stresses or soft tissue calcification. 3. In evaluating the scintigram one must take account not only of the intensity of isotope uptake, but also its distribution and exact localisation. 4. It is essential to compare the scintigram with the radiograph. Radiological features of possible instability become diagnostic if they correspond with appropriate increased radioactivity. If the latter is absent, the of instability remains doubtful. 5. In some cases early loosening of the stem of the prosthesis can be diagnosed while the radiograph is still negative. Increased radioactivity in the acetabulum is frequently seen in the presence of a stable acetabular prosthesis and must be interpreted with caution as a sign of loosening of the prosthesis. (orig.) [de

  3. Budd-Chiari syndrome: diagnosis with ultrasound and nuclear medicine calcium colloid liver scan following non-diagnostic contrasted CT scan

    Energy Technology Data Exchange (ETDEWEB)

    Mulholland, J.P.; Fong, S.M.; Kafaghi, F.A.; Fong, W. [Royal Brisbane Hospital, Herston, QLD (Australia)

    1997-02-01

    Budd-Chiari syndrome is a rare condition characterized by thrombosis within the hepatic veins and inferior vena cava. A case of Budd-Chiari syndrome is presented in a patient who experienced acutely 3 days following laparoscopic cholecystectomy for a calculous cholecystitis. A discussion of pathology and findings on calcium colloid scintigram, CT scan and Doppler ultrasound is provided. 5 refs., 4 figs.

  4. Assessment of chest pain in hypertrophic cardiomyopathy using exercise thallium-201 myocardial scintigraphy

    International Nuclear Information System (INIS)

    Pitcher, D.; Wainwright, R.; Maisey, M.; Curry, P.; Sowton, E.

    1980-01-01

    Exercise thallium-201 myocardial scintigraphy was performed in 23 patients with hypertrophic cardiomyopathy. Eighteen patients presented with chest pain which was a persistent symptom in 11. Selective coronary arteriography was performed in 16 patients and showed normal coronary arteries in 15 and insignificant luminal irregularities in one patient. Eighteen patients had abnormal scintigrams. Three had an abnormal distribution of tracer entirely attributable to asymmetric septal hypertrophy, whereas 15 had discrete tracer uptake defects which could not be explained solely by myocardial hypertrophy. In this latter group of patients three scintigraphic patterns were identified: (1) in 10 patients defects were seen in scintigrams immediately after exercise but not in delayed images obtained four to six hours later. Eight of these patients had chest pain. (2) Four patients had uptake defects seen in both initial and delayed images. One patient had chest pain. (3) In three patients, one of whom had chest pain, tracer defects were seen only in delayed images and were not apparent in the initial scintigrams. Chest pain occurred in eight out of 10 patients with scintigraphic evidence of myocardial ischaemia but was present in only three out of 13 patients with non-ischaemic scintigrams. The value of exercise thallium-201 myocardial imaging as a diagnostic technique in hypertrophic cardiomyopathy appears limited. Scintigraphic evidence of regional myocardial ischaemia in the absence of significant coronary artery disease, however, contributes to an understanding of the mechanism of angina production in patients with hypertrophic cardiomyopathy. (author)

  5. The natural course of radionuclide bone scanning in the evaluation of total knee replacement--a 2 year prospective study

    DEFF Research Database (Denmark)

    Duus, B R; Boeckstyns, M; Stadeager, Carsten Preben

    1990-01-01

    completed the entire program. A total of 143 99Tcm medronic acid complex scintigrams was performed. No significant difference between the grades of total scintigraphic uptake at any of the four examinations nor any difference between the first and the last examinations could be demonstrated (P = 0...

  6. Quantitative analysis of planar bone scintigraphy in patients with unilateral condylar hyperplasia

    NARCIS (Netherlands)

    Saridin, Carrol P.; Raijmakers, Pieter; Becking, Alfred G.

    2007-01-01

    This study compares quantitative analysis of planar bone scintigrams with visual interpretation in patients having unilateral condylar hyperplasia (UCH) and normal control subjects. The possibility of using a bony structure in a region near the condyle as an objective measurement of bone activity is

  7. Quantitative analysis of planar bone scintigraphy in patients with unilateral condylar hyperplasia

    NARCIS (Netherlands)

    Saridin, C.P.; Raijmakers, P.; Becking, A.G.

    2007-01-01

    Objective This study compares quantitative analysis of planar bone scintigrams with visual interpretation in patients having unilateral condylar hyperplasia (UCH) and normal control subjects. The possibility of using a bony structure in a region near the condyle as an objective measurement of bone

  8. Thymic scintigraphy using 201Tl-chloride

    International Nuclear Information System (INIS)

    Fukuda, Teruo; Itami, Michimasa; Sawa, Hisashi; Furukawa, Takashi; Harada, Shigeru

    1980-01-01

    Thymic scintigraphy using Thallium-201 Chloride ( 201 TlCl) was performed on 3 cases of thymoma (2 malignant mediastinal thymomas and 1 benign cervical thymoma). All of the 3 cases exhibited high abnormal activities corresponding to the tumor on the scintigram. Thus it is useful to perform the scintigraphy using 201 TlCl for the detection of thymoma. (author)

  9. Automated counting of white blood cells in synovial fluid.

    NARCIS (Netherlands)

    R. de Jonge (Robert); R.W. Brouwer (Reinoud); M. Smit (Marij); M. de Frankrijker-Merkestijn; R.J. Dolhain; J.M.W. Hazes (Mieke); A.W. van Toorenenbergen (Albert); J. Lindemans (Jan)

    2004-01-01

    textabstractOBJECTIVES: To evaluate the performance of automated leucocyte (white blood cell; WBC) counting by comparison with manual counting. METHODS: The number of WBC was determined in heparinized synovial fluid samples by the use of (i) a standard urine cytometer (Kova) and a

  10. White blood cell fragments in platelet concentrates prepared by the platelet-rich plasma or buffy-coat methods

    NARCIS (Netherlands)

    Dijkstra-Tiekstra, M. J.; van der Schoot, C. E.; Pietersz, R. N. I.; Reesink, H. W.

    2005-01-01

    BACKGROUND AND OBJECTIVES: White blood cell (WBC) fragments in platelet concentrates (PCs) may induce allo-immunization in the recipient. MATERIALS AND METHODS: As the level of WBC fragments can differ between PCs produced using different methods, we compared PCs prepared by using the buffy-coat

  11. elevation acute myoc

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... high-sensitive C-reactive protein (hs-CRP), interleukin-6 (IL-6), soluble intercellular cell adhesion molecule-1 (sICAM-1), PS and white blood cell (WBC) count were collected before PCI. The WBC count, neutrophil granulocyte count and PS level were significantly higher in the HBTF group than in the LBTF.

  12. Nutritive effect of cabbage ( Brassica oleracea ) on growth, obesity ...

    African Journals Online (AJOL)

    Cabbage supplementation suppressed broiler eosinophil levels, indicating effects on mediators of innate immune surveillance, but did not influence any other blood haematological parameter, though Broilers exhibited higher (p<0.05) total WBC count and proportion (%) of WBC represented by neutrophils, basophils and ...

  13. The Effect of Submaximal Exercise Preceded by Single Whole-Body Cryotherapy on the Markers of Oxidative Stress and Inflammation in Blood of Volleyball Players

    Directory of Open Access Journals (Sweden)

    Celestyna Mila-Kierzenkowska

    2013-01-01

    Full Text Available The aim of the study was to determine the effect of single whole-body cryotherapy (WBC session applied prior to submaximal exercise on the activity of antioxidant enzymes, the concentration of lipid peroxidation products, total oxidative status, and the level of cytokines in blood of volleyball players. The study group consisted of 18 male professional volleyball players, who were subjected to extremely cold air (−130∘C prior to exercise performed on cycloergometer. Blood samples were taken five times: before WBC, after WBC procedure, after exercise preceded by cryotherapy (WBC exercise, and before and after exercise without WBC (control exercise. The activity of catalase statistically significantly increased after control exercise. Moreover, the activity of catalase and superoxide dismutase was lower after WBC exercise than after control exercise (P<0.001. After WBC exercise, the level of IL-6 and IL-1β was also lower (P<0.001 than after control exercise. The obtained results may suggest that cryotherapy prior to exercise may have some antioxidant and anti-inflammatory properties. The relations between the level of studied oxidative stress and inflammatory markers may testify to the contribution of reactive oxygen species in cytokines release into the blood system in response to exercise and WBC.

  14. White Blood Cell Counts and Malaria

    National Research Council Canada - National Science Library

    McKenzie, F. E; Prudhomme, Wendy A; Magill, Alan J; Forney, J. R; Permpanich, Barnyen; Lucas, Carmen; Gasser, Jr., Robert A; Wongsrichanalai, Chansuda

    2005-01-01

    .... In Thailand, one-sixth of the P. falciparum infected patients had WBC counts of !4000 cells/mL. Leukopenia may confound population studies that estimate parasite densities on the basis of an assumed WBC count of 8000 cells/mL...

  15. Effect of interval training program on white blood cell count in the ...

    African Journals Online (AJOL)

    Objective: Elevated white blood cell (WBC) count is considered to be prospectively and positively associated with cardiovascular diseases, particularly hypertension. Also, the positive role of exercise in the management of hypertension has been well and long established. However the relationship between WBC count and ...

  16. Label-free identification of white blood cell using optical diffraction tomography (Conference Presentation)

    Science.gov (United States)

    Yoon, Jonghee; Kim, Kyoohyun; Kim, Min-hyeok; Kang, Suk-Jo; Park, YongKeun

    2016-03-01

    White blood cells (WBC) have crucial roles in immune systems which defend the host against from disease conditions and harmful invaders. Various WBC subsets have been characterized and reported to be involved in many pathophysiologic conditions. It is crucial to isolate a specific WBC subset to study its pathophysiological roles in diseases. Identification methods for a specific WBC population are rely on invasive approaches, including Wright-Gimesa staining for observing cellular morphologies and fluorescence staining for specific protein markers. While these methods enable precise classification of WBC populations, they could disturb cellular viability or functions. In order to classify WBC populations in a non-invasive manner, we exploited optical diffraction tomography (ODT). ODT is a three-dimensional (3-D) quantitative phase imaging technique that measures 3-D refractive index (RI) distributions of individual WBCs. To test feasibility of label-free classification of WBC populations using ODT, we measured four subtypes of WBCs, including B cell, CD4 T cell, CD8 T cell, and natural killer (NK) cell. From measured 3-D RI tomograms of WBCs, we obtain quantitative structural and biochemical information and classify each WBC population using a machine learning algorithm.

  17. Haematological alteration in Leprosy patients treated with dapsone ...

    African Journals Online (AJOL)

    Objective: To evaluate the haemoglobin concentration (Hb); total white blood cell count (WBC), differential WBC count; platelet count and reticulocyte count in leprosy patients already treated with dapsone. Design: A case-control study. Setting: Specialist Hospital Ossiomo, which is a Leprosarium and Haematology ...

  18. Meta-analysis of rare and common exome chip variants identifies S1PR4 and other loci influencing blood cell traits

    NARCIS (Netherlands)

    V.S. Pankratz (Shane); U.M. Schick (Ursula); Zhou, Y. (Yi); Zhou, W. (Wei); T.S. Ahluwalia (Tarunveer Singh); Allende, M.L. (Maria Laura); P. Auer (Paul); J. Bork-Jensen (Jette); J. Brody (Jennifer); M.-H. Chen (Ming-Huei); Clavo, V. (Vinna); Eicher, J.D. (John D.); N. Grarup (Niels); Hagedorn, E.J. (Elliott J.); Hu, B. (Bella); Hunker, K. (Kristina); A.D. Johnson (Andrew); M. Leusink (Maarten); Y. Lu (Yingchang); L.-P. Lyytikäinen (Leo-Pekka); A. Manichaikul (Ani); R.E. Marioni (Riccardo); M.A. Nalls (Michael); R. Pazoki (Raha); A.V. Smith (Albert Vernon); F.J.A. van Rooij (Frank); M.-L. Yang (Min-Lee); Zhang, X. (Xiaoling); Zhang, Y. (Yan); F.W. Asselbergs (Folkert); E.A. Boerwinkle (Eric); I.B. Borecki (Ingrid); E.P. Bottinger (Erwin); M. Cushman (Mary Ann); P.I.W. de Bakker (Paul); I.J. Deary (Ian J.); Dong, L. (Liguang); M.F. Feitosa (Mary Furlan); J. Floyd (James); N. Franceschini (Nora); O.H. Franco (Oscar); M. Garcia (Melissa); M.L. Grove (Megan); V. Gudnason (Vilmundur); T. Hansen (T.); T.B. Harris (Tamara); Hofman, A. (Albert); R.D. Jackson (Rebecca); Jia, J. (Jia); M. Kähönen (Mika); Launer, L.J. (Lenore J.); T. Lehtimäki (Terho); D.C. Liewald (David C.); A. Linneberg (Allan); Y. Liu (YongMei); R.J.F. Loos (Ruth); Nguyen, V.M. (Vy M.); M.E. Numans (Mattijs); O. Pedersen (Oluf); Psaty, B.M. (Bruce M.); O.T. Raitakari (Olli T.); S.S. Rich (Stephen); F. Rivadeneira Ramirez (Fernando); Di Sant, A.M.R. (Amanda M. Rosa); Rotter, J.I. (Jerome I.); J.M. Starr (John); K.D. Taylor (Kent); Thuesen, B.H. (Betina Heinsbek); R.P. Tracy (Russell); A.G. Uitterlinden (André); Wang, J. (Jiansong); J. Wang (Judy); A. Dehghan (Abbas); Huo, Y. (Yong); L. Adrienne Cupples (L.); J.F. Wilson (James); Proia, R.L. (Richard L.); L.I. Zon (Leonard); C.J. O'Donnell (Christopher); Reiner, A.P. (Alex P.); S.K. Ganesh (Santhi)

    2016-01-01

    textabstractHematologic measures such as hematocrit and white blood cell (WBC) count are heritable and clinically relevant. We analyzed erythrocyte and WBC phenotypes in 52,531 individuals (37,775 of European ancestry, 11,589 African Americans, and 3,167 Hispanic Americans) from 16 population-based

  19. Meta-analysis of rare and common exome chip variants identifies S1PR4 and other loci influencing blood cell traits

    NARCIS (Netherlands)

    Pankratz, Nathan; Schick, Ursula M.; Zhou, Yi; Zhou, Wei; Ahluwalia, Tarunveer Singh; Allende, Maria Laura; Auer, Paul L.; Bork-Jensen, Jette; Brody, Jennifer A.; Chen, Ming Huei; Clavo, Vinna; Eicher, John D.; Grarup, Niels; Hagedorn, Elliott J.; Hu, Bella; Hunker, Kristina; Johnson, Andrew D.; Leusink, Maarten; Lu, Yingchang; Lyytikainen, Leo Pekka; Manichaikul, Ani; Marioni, Riccardo E.; Nalls, Mike A.; Pazoki, Raha; Smith, Albert Vernon; Van Rooij, Frank J A; Yang, Min Lee; Zhang, Xiaoling; Zhang, Yan; Asselbergs, Folkert W.; Boerwinkle, Eric; Borecki, Ingrid B.; Bottinger, Erwin P.; Cushman, Mary; De Bakker, Paul I W; Deary, Ian J.; Dong, Liguang; Feitosa, Mary F.; Floyd, James S.; Franceschini, Nora; Franco, Oscar H.; Garcia, Melissa E.; Grove, Megan L.; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B.; Hofman, Albert; Jackson, Rebecca D.; Jia, Jia; Kahonen, Mika; Launer, Lenore J.; Lehtimaki, Terho; Liewald, David C.; Linneberg, Allan; Liu, Yongmei; Loos, Ruth J F; Nguyen, Vy M.; Numans, Mattijs E.; Pedersen, Oluf; Psaty, Bruce M.; Raitakari, Olli T.; Rich, Stephen S.; Rivadeneira, Fernando; Di Sant, Amanda M Rosa; Rotter, Jerome I.; Starr, John M.; Taylor, Kent D.; Thuesen, Betina Heinsbek; Tracy, Russell P.; Uitterlinden, Andre G.; Wang, Jiansong; Wang, Judy; Dehghan, Abbas; Huo, Yong; Adrienne Cupples, L.; Wilson, James G.; Proia, Richard L.; Zon, Leonard I.; O'Donnell, Christopher J.; Reiner, Alex P.; Ganesh, Santhi K.

    2016-01-01

    Hematologic measures such as hematocrit and white blood cell (WBC) count are heritable and clinically relevant. We analyzed erythrocyte and WBC phenotypes in 52,531 individuals (37,775 of European ancestry, 11,589 African Americans, and 3,167 Hispanic Americans) from 16 population-based cohorts with

  20. Meta-analysis of rare and common exome chip variants identifies S1PR4 and other loci influencing blood cell traits

    DEFF Research Database (Denmark)

    Pankratz, Nathan; Schick, Ursula M; Zhou, Yi

    2016-01-01

    Hematologic measures such as hematocrit and white blood cell (WBC) count are heritable and clinically relevant. We analyzed erythrocyte and WBC phenotypes in 52,531 individuals (37,775 of European ancestry, 11,589 African Americans, and 3,167 Hispanic Americans) from 16 population-based cohorts w...

  1. Multiple loci are associated with white blood cell phenotypes

    NARCIS (Netherlands)

    M.A. Nalls (Michael); D. Couper (David); T. Tanaka (Toshiko); F.J.A. van Rooij (Frank); M-H. Chen (Ming-Huei); A.V. Smith (Albert Vernon); D. Toniolo (Daniela); N.A. Zakai (Neil); Q. Yang (Qiong Fang); A. Greinacher (Andreas); A.R. Wood (Andrew); M. Garcia (Melissa); P. Gasparini (Paolo); Y. Liu (YongMei); T. Lumley (Thomas); A.R. Folsom (Aaron); A.P. Reiner (Alex); C. Gieger (Christian); V. Lagou (Vasiliki); J.F. Felix (Janine); H. Völzke (Henry); N.A. Gouskova (Natalia); A. Biffi (Alessandro); A. Döring (Angela); U. Völker (Uwe); S. Chong (Sean); K.L. Wiggins (Kerri); A. Rendon (Augusto); A. Dehghan (Abbas); M. Moore (Matt); K.D. Taylor (Kent); J.G. Wilson (James); G. Lettre (Guillaume); A. Hofman (Albert); J.C. Bis (Joshua); N. Pirastu (Nicola); C.S. Fox (Caroline); C. Meisinger (Christa); J.G. Sambrook (Jennifer); S. Arepalli (Sampath); M. Nauck (Matthias); H. Prokisch (Holger); J. Stephens (Jonathan); N.L. Glazer (Nicole); L.A. Cupples (Adrienne); Y. Okada (Yukinori); A. Takahashi (Atsushi); Y. Kamatani (Yoichiro); K. Matsuda (Koichi); T. Tsunoda (Tatsuhiko); M. Kubo (Michiaki); Y. Nakamura (Yusuke); K. Yamamoto (Kazuhiko); M. Stumvoll (Michael); A. Tönjes (Anke); I. Prokopenko (Inga); T. Illig (Thomas); K.V. Patel (Kushang); S.F. Garner (Stephen); B. Kuhnel (Brigitte); M. Mangino (Massimo); B.A. Oostra (Ben); S.L. Thein; J. Coresh (Josef); H.E. Wichmann (Heinz Erich); S. Menzel (Stephan); J. Lin; G. Pistis (Giorgio); A.G. Uitterlinden (André); T.D. Spector (Timothy); A. Teumer (Alexander); G. Eiriksdottir (Gudny); V. Gudnason (Vilmundur); S. Bandinelli (Stefania); T.M. Frayling (Timothy); A. Chakravarti (Aravinda); P. Tikka-Kleemola (Päivi); D. Melzer (David); W.H. Ouwehand (Willem); D. Levy (Daniel); E.A. Boerwinkle (Eric); A. Singleton (Andrew); D.G. Hernandez (Dena); D.L. Longo (Dan); N. Soranzo (Nicole); J.C.M. Witteman (Jacqueline); B.M. Psaty (Bruce); L. Ferrucci (Luigi); T.B. Harris (Tamara); C.J. O'Donnell (Christopher); S.K. Ganesh (Santhi)

    2011-01-01

    textabstractWhite blood cell (WBC) count is a common clinical measure from complete blood count assays, and it varies widely among healthy individuals. Total WBC count and its constituent subtypes have been shown to be moderately heritable, with the heritability estimates varying across cell types.

  2. Leukocyte profile of different breeds of the Nigerian cattle in ...

    African Journals Online (AJOL)

    The total white blood cell (WBC) count and differential counts of WBC were determined using Neubauer Chamber and Thin blood smear techniques. Data generated were analysed using Genstat statistical software, with sex, breed and haemparasite species detected as factors. Results showed that 22% of the cattle were ...

  3. Elevated White Blood Cell Count Is Associated with Higher Risk of Glucose Metabolism Disorders in Middle-Aged and Elderly Chinese People

    Directory of Open Access Journals (Sweden)

    Hua Jiang

    2014-05-01

    Full Text Available White blood cell (WBC count has been associated with diabetic risk, but whether the correlation is independent of other risk factors has hardly been studied. Moreover, very few such studies with large sample sizes have been conducted in Chinese. Therefore, we investigated the relationship between WBC count and glucose metabolism in china. We also examined the relevant variables of WBC count. A total of 9,697 subjects (mean age, 58.0 ± 9.1 years were recruited. The subjects were classified into four groups, including subjects with normal glucose tolerance, isolated impaired fasting glucose, impaired glucose tolerance and type 2 diabetes mellitus (T2DM. We found that WBC count increased as glucose metabolism disorders exacerbated. WBC count was also positively correlated with waist hip ratio, body mass index, smoking, triglycerides, glycosylated haemoglobin A1c (HbA1c and 2-h postprandial glucose. In addition, high density lipoprotein and the female gender were inversely correlated with WBC count. In patients with previously diagnosed T2DM, the course of T2DM was not correlated with WBC count. Our findings indicate that elevated WBC count is independently associated with worsening of glucose metabolism in middle-aged and elderly Chinese. In addition, loss of weight, smoking cessation, lipid-modifying therapies, and control of postprandial plasma glucose and HbA1c may ameliorate the chronic low-grade inflammation.

  4. Impulsivity-related traits are associated with higher white blood cell counts

    NARCIS (Netherlands)

    Sutin, A.R.; Milaneschi, Y.; Cannas, A.; Ferrucci, L.; Uda, M.; Schlessinger, D.; Zonderman, A.B.; Terracciano, A.

    2012-01-01

    A chronically elevated white blood cell (WBC) count is a risk factor for morbidity and mortality. The present research tests whether facets of impulsivity - impulsiveness, excitement-seeking, self-discipline, and deliberation - are associated with chronically elevated WBC counts. Community-dwelling

  5. White blood cell counting on smartphone paper electrochemical sensor.

    Science.gov (United States)

    Wang, Xinhao; Lin, Guohong; Cui, Guangzhe; Zhou, Xiangfei; Liu, Gang Logan

    2017-04-15

    White blood cell (WBC) analysis provides rich information in rapid diagnosis of acute bacterial and viral infections as well as chronic disease management. For patients with immune deficiency or leukemia WBC should be persistently monitored. Current WBC counting method relies on bulky instrument and trained personnel and is time consuming. Rapid, low-cost and portable solution is in highly demand for point of care test. Here we demonstrate a label-free smartphone based electrochemical WBC counting device on microporous paper with patterned gold microelectrodes. WBC separated from whole blood was trapped by the paper with microelectrodes. WBC trapped on the paper leads to the ion diffusion blockage on microelectrodes, therefore cell concentration is determined by peak current on the microelectrodes measured by a differential pulse voltammeter and the quantitative results are collected by a smartphone wirelessly within 1min. We are able to rapidly quantify WBC concentrations covering the common physiological and pathological range (200-20000μL -1 ) with only 10μL sample and high repeatability as low as 10% in CoV (Coefficient of Variation). The unique smartphone paper electrochemical sensor ensures fast cell quantification to achieve rapid and low-cost WBC analysis at the point-of-care under resource limited conditions. Copyright © 2016. Published by Elsevier B.V.

  6. Haematological and biochemical changes in dogs naturally infected with Angiostrongylus vasorum before and after treatment

    DEFF Research Database (Denmark)

    Willesen, Jakob; Jensen, Asger Lundorff; Kristensen, Annemarie Thuri

    2009-01-01

    eosinophilia, whereas increased total white blood cell (WBC) counts and neutrophilia were observed in only 4.2%. WBC counts and concentrations of neutrophils, eosinophils and monocytes decreased significantly from days 0 to 42, indicating that, even in dogs without elevated absolute blood values, a low grade...

  7. Comparison of white blood cell counts by WNR, WDF, and WPC channels in Sysmex XN hematology analyzer.

    Science.gov (United States)

    Kim, H; Hur, M; Choi, S-G; Oh, K-M; Moon, H-W; Yun, Y-M

    2015-12-01

    The Sysmex XN modular system (Sysmex, Kobe, Japan) uses a novel technology for white blood cell (WBC) count and differential, using separate channels: white cell nucleated (WNR), WBC differential (WDF), and white progenitor cell (WPC) channels. We questioned how concordant WBC counts would be between them. In a total of 6327 consecutive specimens, WBC counts were compared between WNR and WDF channels. They were also compared in three groups of WBC counts and two groups of chemotherapy status. In 508 specimens from the 4361 specimens that were run on the XN-20 module, the WPC channel was used for reflex test. Data were compared using Pearson's correlation, absolute difference, and percent difference (%D). WBC counts between WNR and WDF channels showed very high correlations in total specimens (r = 0.9976) and in the groups of WBC counts and chemotherapy. As WBC count increased, absolute difference increased, while %D decreased (P WPC channels are highly correlated, and they are overall interchangeable and reliable. © 2015 John Wiley & Sons Ltd.

  8. Role of ventilation scintigraphy in diagnosis of acute pulmonary embolism: an evaluation using artificial neural networks

    International Nuclear Information System (INIS)

    Evander, Eva; Holst, Holger; Jaerund, Andreas; Wollmer, Per; Edenbrandt, Lars; Ohlsson, Mattias; Aastroem, Karl

    2003-01-01

    The purpose of this study was to assess the value of the ventilation study in the diagnosis of acute pulmonary embolism using a new automated method. Either perfusion scintigrams alone or two different combinations of ventilation/perfusion scintigrams were used as the only source of information regarding pulmonary embolism. A completely automated method based on computerised image processing and artificial neural networks was used for the interpretation. Three artificial neural networks were trained for the diagnosis of pulmonary embolism. Each network was trained with 18 automatically obtained features. Three different sets of features originating from three sets of scintigrams were used. One network was trained using features obtained from each set of perfusion scintigrams, including six projections. The second network was trained using features from each set of (joint) ventilation and perfusion studies in six projections. A third network was trained using features from the perfusion study in six projections combined with a single ventilation image from the posterior view. A total of 1,087 scintigrams from patients with suspected pulmonary embolism were used for network training. The test group consisted of 102 patients who had undergone both scintigraphy and pulmonary angiography. Performances in the test group were measured as area under the receiver operation characteristic curve. The performance of the neural network in interpreting perfusion scintigrams alone was 0.79 (95% confidence limits 0.71-0.86). When one ventilation image (posterior view) was added to the perfusion study, the performance was 0.84 (0.77-0.90). This increase was statistically significant (P=0.022). The performance increased to 0.87 (0.81-0.93) when all perfusion and ventilation images were used, and the increase in performance from 0.79 to 0.87 was also statistically significant (P=0.016). The automated method presented here for the interpretation of lung scintigrams shows a significant

  9. Results of substitution of the Nal by a Ge detector in a simple shadow shield whole body counter

    Energy Technology Data Exchange (ETDEWEB)

    Sahre, P.; Schoenmuth, T. [Nuclear Engineering and Analytics Inc. Rossendorf, Dresden (Germany); Thieme, K. [Amersham Buchler Ltd. und Co., Braunschweig (Germany)

    1997-12-01

    Since 1976 a whole body counter (WBC) has been used at the Rossendorf Research Centre for measuring the internal contamination of workers. The WBC with the Germanium detector is given schematically and visually. The WBC is a shadow shield type with a tilted chair having only one detector. Table 1 contains the parameters of the WBC. It can be seen that the WBC is a simple counter. Therefore, taking into account the experiences of McCurdy, a lot of improvements were expected form the simple substitution of a HP Germanium detector for a NaI (TI) detector, i.e. despite a decrease in the sensitive detection volume, an enhancement of all quantifiable results (e.g. lower limit of detection and time for analysis of the spectrum) and above all the reliability and automation of nuclide identification were expected. (orig./SR)

  10. Thermal and hemodynamic response to whole-body cryostimulation in healthy subjects.

    Science.gov (United States)

    Zalewski, Pawel; Klawe, Jacek J; Pawlak, Joanna; Tafil-Klawe, Malgorzata; Newton, Julia

    2013-06-01

    Whole-body cryotherapy (WBC) is an increasing applied cryotherapeutic method, that involves application of a cryotherapeutic factor to stimulate the body by the means of intense hypothermia of virtually the body's entire area. This method is still not well recognized in Western Europe. However in recent years it is becoming increasingly popular in sports medicine and also in clinical application. Cryotherapeutic agents used in WBC are considered to be a strong stress stimulus which is associated with a variety of changes in functional parameters, particularly of the cardiovascular and autonomic nervous systems. However, such strong influence upon the entire body could be associated with the risk of unexpected reactions which might be dangerous for homeostasis. The present study evaluated the complex hemodynamic physiological reactions in response to WBC exposure in healthy subjects. Thirty healthy male volunteers participated. Each subject was exposed to WBC (-120°C) for 3-min. None of the participants had been exposed to such conditions previously. The research was conducted with modern and reliable measurements techniques, which assessed complex hemodynamic reactions and skin temperature changes non-invasively. All measurements were performed four times (before WBC, after WBC, WBC+3h and WBC+6h) with a Task Force Monitor (TFM - CNSystems, Medizintechnik, Gratz, Austria). Body superficial temperature was measured by infrared thermographic techniques - infra-red camera Flir P640 (Flir Systems Inc., Sweden). Our results show a significant decrease in heart rate, cardiac output, and increase in stroke volume, total peripheral resistance and baroreceptors reflex sensitivity. These changes were observed just after WBC exposure. At stages WBC+3h and WBC+6h there was observed a significant drop in baroreceptors reflex sensitivity due to increased thermogenesis. In conclusion, the present findings suggest that WBC strongly stimulates the baroreceptor cardiac reflex in

  11. The Effect of Submaximal Exercise Preceded by Single Whole-Body Cryotherapy on the Markers of Oxidative Stress and Inflammation in Blood of Volleyball Players

    Science.gov (United States)

    Mila-Kierzenkowska, Celestyna; Szpinda, Michał; Augustyńska, Beata; Woźniak, Bartosz

    2013-01-01

    The aim of the study was to determine the effect of single whole-body cryotherapy (WBC) session applied prior to submaximal exercise on the activity of antioxidant enzymes, the concentration of lipid peroxidation products, total oxidative status, and the level of cytokines in blood of volleyball players. The study group consisted of 18 male professional volleyball players, who were subjected to extremely cold air (−130°C) prior to exercise performed on cycloergometer. Blood samples were taken five times: before WBC, after WBC procedure, after exercise preceded by cryotherapy (WBC exercise), and before and after exercise without WBC (control exercise). The activity of catalase statistically significantly increased after control exercise. Moreover, the activity of catalase and superoxide dismutase was lower after WBC exercise than after control exercise (P cryotherapy prior to exercise may have some antioxidant and anti-inflammatory properties. The relations between the level of studied oxidative stress and inflammatory markers may testify to the contribution of reactive oxygen species in cytokines release into the blood system in response to exercise and WBC. PMID:24489985

  12. The Effectiveness of Whole Body Cryotherapy Compared to Cold Water Immersion: Implications for Sport and Exercise Recovery

    Directory of Open Access Journals (Sweden)

    Michael Holmes

    2016-10-01

    Full Text Available Background: Cryotherapy is the process of cooling the body, is typically used therapeutically, and is often used as a method of recovery relative to sport and exercise performance.  The purpose of this review is to compare the current literature on WBC to that of CWI and determine whether WBC provides any additional enhancements for sport and exercise recovery. These include tissue temperature reduction, markers of muscle damage, markers of inflammation, and parasympathetic reactivation. Method: Common methods of cryotherapy include cold water immersion (CWI, ice packs, ice massages, and gel or cooling creams. CWI is the most common method among athletes; however, a new form of cryotherapy, known as whole-body cryotherapy (WBC, has recently emerged.  Since its introduction, WBC has grown in popularity among practitioners and athletes. WBC involves short exposures (generally between 2-4 minutes to very cold air (-100o C to -140o C in a controlled room and setting. Furthermore, many of the studies on WBC were observational and did not contain a control group. Conclusion: Despite its growing popularity, the alleged benefits of WBC are largely based on anecdotal evidence as randomized, clinically-controlled studies regarding its efficacy are limited.  Keywords: cryotherapy, cold water immersion, exercise, recovery, muscle damage, inflammation

  13. White Blood Cell Count and Total and Cause-Specific Mortality in the Women's Health Initiative.

    Science.gov (United States)

    Kabat, Geoffrey C; Kim, Mimi Y; Manson, JoAnn E; Lessin, Lawrence; Lin, Juan; Wassertheil-Smoller, Sylvia; Rohan, Thomas E

    2017-07-01

    White blood cell (WBC) count appears to predict total mortality and coronary heart disease (CHD) mortality, but it is unclear to what extent the association reflects confounding by smoking, underlying illness, or comorbid conditions. We used data from the Women's Health Initiative to examine the associations of WBC count with total mortality, CHD mortality, and cancer mortality. WBC count was measured at baseline in 160,117 postmenopausal women and again in year 3 in 74,375 participants. Participants were followed for a mean of 16 years. Cox proportional hazards models were used to estimate the relative mortality hazards associated with deciles of baseline WBC count and of the mean of baseline + year 3 WBC count. High deciles of both baseline and mean WBC count were positively associated with total mortality and CHD mortality, whereas the association with cancer mortality was weaker. The association of WBC count with mortality was independent of smoking and did not appear to be influenced by previous disease history. The potential clinical utility of this common laboratory test in predicting mortality risk warrants further study. © The Author 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Optimization of the freezing process for hematopoietic progenitor cells: effect of precooling, initial dimethyl sulfoxide concentration, freezing program, and storage in vapor-phase or liquid nitrogen on in vitro white blood cell quality.

    Science.gov (United States)

    Dijkstra-Tiekstra, Margriet J; Setroikromo, Airies C; Kraan, Marcha; Gkoumassi, Effimia; de Wildt-Eggen, Janny

    2014-12-01

    Adding dimethyl sulfoxide (DMSO) to hematopoietic progenitor cells (HPCs) causes an exothermic reaction, potentially affecting their viability. The freezing method might also influence this. The aim was to investigate the effect of 1) precooling of DMSO and plasma (D/P) and white blood cell (WBC)-enriched product, 2) DMSO concentration of D/P, 3) freezing program, and 4) storage method on WBC quality. WBC-enriched product without CD34+ cells was used instead of HPCs. This was divided into six or eight portions. D/P (20 or 50%; precooled or room temperature [RT]) was added to the WBC-enriched product (precooled or RT), resulting in 10% DMSO, while monitoring temperature. The product was frozen using controlled-rate freezing ("fast-rate" or "slow-rate") and placed in vapor-phase or liquid nitrogen. After thawing, WBC recovery and viability were determined. Temperature increased most for precooled D/P to precooled WBC-enriched product, without influence of 20 or 50% D/P, but remained for all variations below 30°C. WBC recovery for both freezing programs was more than 95%. Recovery of WBC viability was higher for slow-rate freezing compared to fast-rate freezing (74% vs. 61%; p Effect of precooling D/P or WBC-enriched product and of storage in vapor-phase or liquid nitrogen was marginal. Based on these results, precooling is not necessary. Fifty percent D/P is preferred over 20% D/P. Slow-rate freezing is preferred over fast-rate freezing. For safety reasons storage in vapor-phase nitrogen is preferred over storage in liquid nitrogen. Additional testing using real HPCs might be necessary. © 2014 AABB.

  15. Whole-body cryotherapy: empirical evidence and theoretical perspectives

    Directory of Open Access Journals (Sweden)

    Bleakley CM

    2014-03-01

    Full Text Available Chris M Bleakley,1 François Bieuzen,2 Gareth W Davison,1 Joseph T Costello3 1Sport and Exercise Science Research Institute, Faculty of Life and Health Sciences, University of Ulster, Newtownabbey, Northern Ireland; 2Research Department, Laboratory of Sport, Expertise and Performance, French National Institute of Sport (INSEP, Paris, France; 3School of Exercise and Nutrition Sciences and Institute of Health and Biomedical Innovation, Queensland University of Technology, Brisbane, Australia Abstract: Whole-body cryotherapy (WBC involves short exposures to air temperatures below –100°C. WBC is increasingly accessible to athletes, and is purported to enhance recovery after exercise and facilitate rehabilitation postinjury. Our objective was to review the efficacy and effectiveness of WBC using empirical evidence from controlled trials. We found ten relevant reports; the majority were based on small numbers of active athletes aged less than 35 years. Although WBC produces a large temperature gradient for tissue cooling, the relatively poor thermal conductivity of air prevents significant subcutaneous and core body cooling. There is weak evidence from controlled studies that WBC enhances antioxidant capacity and parasympathetic reactivation, and alters inflammatory pathways relevant to sports recovery. A series of small randomized studies found WBC offers improvements in subjective recovery and muscle soreness following metabolic or mechanical overload, but little benefit towards functional recovery. There is evidence from one study only that WBC may assist rehabilitation for adhesive capsulitis of the shoulder. There were no adverse events associated with WBC; however, studies did not seem to undertake active surveillance of predefined adverse events. Until further research is available, athletes should remain cognizant that less expensive modes of cryotherapy, such as local ice-pack application or cold-water immersion, offer comparable

  16. Predictive value of postprocedural leukocyte count on myocardial perfusion, left ventricular function and clinical outcomes in ST-elevated myocardial infarction after percutaneous coronary intervention.

    Science.gov (United States)

    He, Rong; Li, Hai-yan; Guo, Li-jun; Zhang, Fu-chun; Niu, Jie; Zhang, Yong-zhen; Wang, Gui-song; Yang, Zhen-hua; Gao, Wei

    2012-03-01

    Baseline white blood cell (WBC) count was correlated with ischemic events occurrence in patients with ST-elevated myocardial infarction (STEMI). However, circulating WBC count is altered after percutaneous coronary intervention (PCI). The aim of this study was to assess the relationship between postprocedural WBC count and clinical outcomes in STEMI patients who underwent PCI. A total of 242 consecutive acute STEMI patients who underwent successful primary PCI were enrolled and followed up for two years. WBC counts were measured within 12 hours after PCI. ST-segment resolution (ST-R) and myocardial blush grades (MBG) were evaluated immediately after PCI. Left ventricular ejection fraction (LVEF) was obtained at baseline and 12 - 18 months after PCI. Postprocedural WBC count was an independent inverse predictor of ST-R (OR 0.80, P < 0.0001) and MBG 3 (OR 0.82, P < 0.0001). It was negatively correlated with LVEF (baseline r = -0.22, P = 0.001; 12 - 18 months r = -0.29, P < 0.0001). The best cutoff value of WBC for predicting death was determined to be 13.0 × 10(9)/L. The patients with a postprocedural WBC count above 13.0 × 10(9)/L showed a significantly lower cumulative survival rate (30 days, 82.4% vs. 99.0%, P < 0.0001 and 2 years 75.0% vs. 96.4%, P < 0.0001). Multivariate Cox regression analysis showed that a postprocedural WBC count was a strong independent predictor of 30-day mortality (HR 8.48, P = 0.019) and 2-year mortality (HR 4.93, P = 0.009). Increased postprocedural WBC count is correlated with myocardial malperfusion and left ventricular dysfunction, and is an independent predictor of poor clinical outcomes in STEMI patients who underwent PCI.

  17. Leukocyte count is a modulating factor for the mortality benefit of bivalirudin in ST-segment-elevation acute myocardial infarction: the HORIZONS-AMI trial.

    Science.gov (United States)

    Palmerini, Tullio; Brener, Sorin J; Mehran, Roxana; Dangas, George; Genereux, Philippe; Riva, Diego Della; Mariani, Andrea; Xu, Ke; Stone, Gregg W

    2013-10-01

    Although the reduction in mortality with bivalirudin compared with unfractionated heparin plus glycoprotein IIb/IIIa inhibitors in the Harmonizing Outcome with Revascularization and Stent in Acute Myocardial Infarction (HORIZONS-AMI) trial has been attributed to lower rates of major bleeding, alternative mechanisms have not been investigated in depth. We sought to investigate whether there might be an interaction between white blood cell (WBC) count and bivalirudin for the risk of mortality, and whether this interaction is independent of major bleeding. Among the 3602 patients enrolled in the HORIZONS-AMI trial, WBC count was available in 3433 (95.3%) patients. Patients were stratified according to WBC tertiles. At 1-year follow-up, bivalirudin was associated with significantly lower rates of mortality and cardiac mortality compared with unfractionated heparin plus glycoprotein IIb/IIIa inhibitors in patients in the upper WBC tertile (all-cause death: 4.1% versus 9.3%, respectively; P=0.0004; cardiac death: 2.0% versus 6.9%; respectively; P<0.0001) but not in patients in the mid-WBC or lower WBC tertiles. The reduction of mortality with bivalirudin across WBC tertiles was independent of major bleeding, and a significant interaction was apparent for 1-year all-cause mortality and cardiac mortality between WBC and bivalirudin therapy. Similar findings were apparent at 3 years. In patients with ST-segment-elevation myocardial infarction, a significant interaction between bivalirudin therapy and admission WBC count was apparent for 1-year mortality. The reduction in mortality was independent of major bleeding, suggesting that other mechanisms may be implicated in the survival benefit observed with bivalirudin. http://www.clinicaltrials.gov. Unique identifier: NCT00433966.

  18. Normal preoperative white blood cell count is predictive of outcomes for endovascular procedures.

    Science.gov (United States)

    Amaranto, Daniel J; Wang, Edward C; Eskandari, Mark K; Morasch, Mark D; Rodriguez, Heron E; Pearce, William H; Kibbe, Melina R

    2011-11-01

    An abnormally elevated preoperative white blood cell count (WBC) has been associated with postoperative morbidity and mortality. However, it is unknown if a normal WBC is predictive of postoperative outcomes following vascular interventions. Thus, the objective of this study is to determine if a WBC within the normal range is predictive of outcomes following vascular interventions. The medical records of patients undergoing endovascular and open repair of carotid stenosis, aortic aneurysm, and peripheral arterial disease from 1999 to 2009 were retrospectively reviewed. Major adverse events (MAE) were defined as death, stroke, and myocardial infarction. Of 1773 cases with normal preoperative WBC (3.5-10.5 K/μL), there were 804 [45.3%] endovascular and 969 [54.7%] open vascular surgeries. Patients with complications (55) or MAE (19) after endovascular intervention had higher preoperative WBC compared with patients without complications (WBC 7.7 ± 1.47 vs 7.1 ± 1.57, respectively, P = .002) or MAE (WBC 8.3 ± 1.26 vs 7.1 ± 0.06, respectively, P = .001). No difference was observed for patients who received open surgery. Patients undergoing endovascular intervention were 2.3, 4.8, and 22 times more likely to experience complications (P = .004), MAE (P = .003), or death (P = .036) when WBC exceeded 7.5 K/μL. Multivariate analysis showed that preoperative normal WBC was an independent predictor of complications, MAE, and death in patients after endovascular procedures but only for death in patients after open vascular procedures. This study demonstrates a strong linear correlation between an increasing preoperative WBC within the normal range and an increased risk for postoperative complications and death following endovascular interventions. The study also found a significant curvilinear U-shaped relation between a normal preoperative WBC and death in the open surgical cohort, with patients in the very low and very high normal WBC range at an increased risk of death

  19. Comparison of 99Tcm-HMPAO-labelled white blood cells and 67Ga citrate scans to detect myocarditis in the acute phase of Kawasaki disease

    International Nuclear Information System (INIS)

    Kao, C.H.; Hsieh, K.S.; Wang, Y.L.; Chen, C.W.; Liao, S.Q.; Wang, S.J.; Yeh, S.H.

    1991-01-01

    Myocardial imaging with 99 Tc m -HMPAO-labelled white blood cells (WBC) and 67 Ga citrate was used to detect myocarditis in the acute phase of Kawasaki disease among 22 infants and children; 18 cases of myocarditis were detected by 99 Tc m -HMPAO-labelled WBC heart scans, but only one case was detected by 67 Ga citrate heart scans. In conclusion, 99 Tc m -HMPAO-labelled WBC scanning provides a more sensitive method than 67 Ga citrate scanning in the detection of myocarditis in Kawasaki disease. (author)

  20. False positive indium-111 white blood cell scan in a closed clavicle fracture

    International Nuclear Information System (INIS)

    Friedman, R.J.; Gordon, L.

    1988-01-01

    Aggressive treatment of the multiply injured patient often requires early fixation of many fractures, some of which may be open. Often, patients develop postoperative fevers requiring a thorough workup to rule out infection. Recently, indium-111 white blood cell (WBC) imaging has become a valuable adjunct in the diagnosis of acute infection. The patient described had a simple, closed clavicle fracture with markedly increased activity on an indium-111 WBC scan obtained for fever workup. This subsequently proved to be a normal, healing, noninfected fracture by other diagnostic techniques. Noninfected, simple closed fractures should be added to the list of causes for a false-positive indium-111 WBC scan

  1. Simultaneous achievement of high dielectric constant and low temperature dependence of capacitance in (111-oriented BaTiO3-Bi(Mg0.5Ti0.5O3-BiFeO3 solid solution thin films

    Directory of Open Access Journals (Sweden)

    Junichi Kimura

    2016-01-01

    Full Text Available The temperature dependence of the capacitance of (111c-oriented (0.90–xBaTiO3-0.10Bi(Mg0.5Ti0.5O3-xBiFeO3 solid solution films is investigated. These films are prepared on (111cSrRuO3/(111Pt/TiO2/SiO2/(100Si substrates by the chemical solution deposition technique. All the films have perovskite structures and the crystal symmetry at room temperature varies with increasing x ratio, from pseudocubic when x = 0–0.30 to rhombohedral when x = 0.50–0.90. The pseudocubic phase shows a high relative dielectric constant (εr (ranging between 400 and 560 at room temperature and an operating frequency of 100 kHz and a low temperature dependence of capacitance up to 400°C, while maintaining a dielectric loss (tan δ value of less than 0.2 at 100 kHz. In contrast, εr for the rhombohedral phase increases monotonically with increasing temperature up to 250°C, and increasingly high tan δ values are recorded at higher temperatures. These results indicate that pseudocubic (0.90–xBaTiO3-0.10Bi(Mg0.5Ti0.5O3-xBiFeO3 solid solution films with (111 orientation are suitable candidates for high-temperature capacitor applications.

  2. Accumulation of leucocytes labelled with technetium-99m hexamethylpropylene amine oxime in malignant abdominal tumours

    Energy Technology Data Exchange (ETDEWEB)

    Lantto, E. (Paeijaet-Haeme Central Hospital, Lahti (Finland). Dept. of Radiology); Jaervi, K. (Paeijaet-Haeme Central Hospital, Lahti (Finland). Dept. of Pathology); Lantoo, T.; Vorne, M. (Paeijaet-Haeme Central Hospital, Lahti (Finland). Dept. of Nuclear Medicine); Ristkari, S. (Paeijaet-Haeme Central Hospital, Lahti (Finland). Dept. of Surgery)

    1991-10-01

    A total of 343 leucocyte scans labelled with technetium-99m hexamethylprophylene amine oxime were reviewed that had been performed patients suspected of having abdominal infection or inflammation. There was uptake by malignant abdominal tumours in 10 cases (2,9%), which represents 62.5% of known malignancies at the time of the scintigram. Accumulation was seen in 8 patients with adenocarcinoma of the colon associated with a secondary infection in the tumour or pericolic inflammation. A large tumour that had spread beyond the bowel wall was related to a positive scintigram. Accumulation was also found twice in a malignant fibrous histiocytoma in which bleeding and an inflammatory reaction to necrosis were probably responsible for the uptake. The relevant treatment was delayed for 2 weeks-2 months in 4 patients with adenocarcinoma of the colon in whom the positive uptake was regarded as confirmation of the clinically suspected cute diverticulitis. (orig.).

  3. Quantitative determination of peripheral arterio-venous shunts by means of radioactively labelled microspheres

    International Nuclear Information System (INIS)

    Friese, K.H.

    1981-01-01

    In the present work a nuclear method of quantitative measurement of peripheral arterio-venous shunts with a whole-body scanner is standardized. This method, developed at the beginning of the 70s at Tuebingen, stands out in contrast with earlier measuring methods by the application of the theory of quantitative scintiscanning. This means that the scintigram obtained after injection of sup(99m)technetium-labelled human albumin microspheres into an artery before the shunt is corrected for the quantitative shunt calculation by several factors using a computer, to avoid systematic mistakes. For the standardization of the method, 182 scintigrams were taken during model experiments and experiments on animals and human beings. This method, having a deviation of 10% at most, is excellently suited for the quantitative determination of peripheral arterio-venous shunts. Already for a pulmonary activity of 3% a peripheral shunt is proved with 97.5% probability. (orig./MG) [de

  4. The significance of bone scintiscanning in orthopedics

    International Nuclear Information System (INIS)

    Sperling, J.

    1981-01-01

    Bone scintiscanning is a method applied for detecting zones of increased osseous metabolism. Not the focus itself but only the reactive transformation processes are imaged. Therefore it is not possible to give differential diagnostic statements exclusively on the basis of a positive scintigram: the evaluation can only be provided together with the clinical and roentgenological findings. Even though the detection of osseous metastases is the domaine of bone scintiscanning, it was possible to prove on the basis of scintigrams made with 99m-Tc-phosphor compounds in 153 patients that in certain cases this method can be a valuable and informative supplement to diagnosis and therapy when the diagnosis is established carefully. (orig.) [de

  5. Usefulness of emission CT in the liver

    International Nuclear Information System (INIS)

    Maeda, Hiroko; Kawai, Takeshi; Fukuda, Tetsuo; Akagi, Hiroaki

    1981-01-01

    Since April in 1980, we have been performing single photon emission tomography of the liver, using rotating chair and rotating scintillation camera, as a routin examination. We experienced about 500 cases, in which 141 cases were also examined by XCT and the final diagnosis of these cases was confirmed by clinical course including other examinations. The detection rate of SOL was 96.4% in XCT, 92.9% in ECT, 82.1% in Scintigram. Among modes of section of ECT (transverse, frontal, sagital), the detection rate was 84.3% in frontal section, 82.9% in transverse section and 72.9% in sagital section. In conclusion, ECT is useful in the detection of space occupying lesions as routine examination, and we think that the combination of scintigram, ECT of transverse and frontal section is a very favourable and useful method from the clinical consideration comparing with other methods; Echography, XCT, and Angiography. (author)

  6. Detection of elliptical contours

    International Nuclear Information System (INIS)

    Blokland, J.A.K.

    1987-01-01

    This dissertation describes the quantitation of myocardial perfusion defects in planar thallium-201 scintigrams. To be able to quantify the distribution of 201 Tl in the myocardium as imaged by the scintigram, accurate delineation of the target object is a prerequisite. The distribution of the radionuclide within the contour of the left ventricle can be described by application of circumferential profiles. By comparing the computed circumferential profile with those of normal subjects, humans with no evidence of coronary artery disease, segments of the left ventricle with decreased bloodflow can be detected. In practice there is no real standard to compare with, and due to noise and biological variations, it is not always possible to make a definite decision regarding the presence of a defect in the distribution of the radionuclide. The value and limitations of the developed quantification procedure are discussed. Some future developments are suggested. 108 refs.; 57 figs.; 5 tabs

  7. Accumulation of leucocytes labelled with technetium-99m hexamethylpropylene amine oxime in malignant abdominal tumours

    International Nuclear Information System (INIS)

    Lantto, E.; Jaervi, K.; Lantoo, T.; Vorne, M.; Ristkari, S.

    1991-01-01

    A total of 343 leucocyte scans labelled with technetium-99m hexamethylprophylene amine oxime were reviewed that had been performed patients suspected of having abdominal infection or inflammation. There was uptake by malignant abdominal tumours in 10 cases (2,9%), which represents 62.5% of known malignancies at the time of the scintigram. Accumulation was seen in 8 patients with adenocarcinoma of the colon associated with a secondary infection in the tumour or pericolic inflammation. A large tumour that had spread beyond the bowel wall was related to a positive scintigram. Accumulation was also found twice in a malignant fibrous histiocytoma in which bleeding and an inflammatory reaction to necrosis were probably responsible for the uptake. The relevant treatment was delayed for 2 weeks-2 months in 4 patients with adenocarcinoma of the colon in whom the positive uptake was regarded as confirmation of the clinically suspected cute diverticulitis. (orig.)

  8. Diagnostic value of (111)In-granulocyte scintigraphy in patients with fever of unknown origin

    DEFF Research Database (Denmark)

    Kjaer, Andreas; Lebech, Anne-Mette

    2002-01-01

    111In-granulocyte scintigraphy is often used as a diagnostic tool in patients with fever of unknown origin (FUO). However, its diagnostic performance has been studied in only a limited number of investigations, with most having been published more than 10 y ago; in addition, a broad range...... to identify infection or chronic inflammatory bowel disease as the cause of FUO. In addition, leukocyte counts and CRP values were recorded. RESULTS: Scintigrams were true-positive in 6 cases, false-positive in 4 cases, true-negative in 19 cases, and false-negative in 2 cases. Sensitivity was 75%, specificity...... and specificity in cases of FUO, when one takes into account that (111)In-granulocyte scintigraphy is not a first-line test. The high predictive value of a scintigram showing negative findings may be especially valuable for ruling out an infectious cause of FUO. Neither peripheral leukocyte count nor CRP levels...

  9. Preliminary studies of pulmonary perfusion scanning in patients with pulmonary hypertension

    International Nuclear Information System (INIS)

    Shi Rongfang; Liu Xiujie; Wang Yanqun

    1986-01-01

    A comparative analysis of pulmonary perfusion scanning through cardiac catheterization of 57 patients including 32 patients with congenital heart disease, 8 patients with chronic pulmonary thromboembolism and 7 patients with primary pulmonary hypertension is reported. The lung scintigram obtained with In-113m or Tc-99m-MAA represents the distribution of pulmonary blood. It has been found that the lung scintigram was abnormal in patients of congenital heart disease with pulmonary hypertension (i. e. pulmonary artery pressure between 41-80 mmHg) and the extent of radoiactive regional defects is proportional to the level of pulmonary hypertension. The results of the analysis indicated that pulmonary perfusion scanning being a noninvasive technique would be a useful method in evaluating the level of pulmonary hypertension in patients with left to right shunt before and after surgical operation

  10. Myocardial scintigraphy in acute myocardial infarction

    International Nuclear Information System (INIS)

    Faerestrand, S.

    1984-01-01

    The sensitivity and specificity of 99m Tc-PYP myocardial scintigraphy for detecting an acute myocardial infarction were studied in 39 patients hospitalized because of central chest pain. One myocardial scintigraphic examination was done in each patient between the first and sixth day after the chest pain had started. Twenty-two patients had a myocardial infarction based on history, ECG and enzym values and myocardial scintigraphy was positive in twenty of these. Three patients with left bundle branch block and myocardial infarction all had a positive myocardial scintigram and the one patient with negative ECG and myocardial infarction also had a positive myocardial scintigram. The sensitivity is 91% and the specificity is 91.7% for 99m Tc-PYP myocardial scintigraphy in the detection of acute myocardial infarction. No complications were seen. (Auth.)

  11. Bone scintigraphy in drug addiction

    International Nuclear Information System (INIS)

    Lopez-Majano, V.; Miskew, D.; Sansi, P.

    1981-01-01

    In 22 drug addicts, the clinical diagnosis of osteomyelitis and/or septic arthritis was suspected because of symptoms of sepsis and pain in various locations. All patients underwent bone scintigraphy with 17-20 mCi of 99 sup(m)Tc labeling either pyrophosphate or methylene diphosphonate. Whole body and spot scans located the area of disease in most patients. This permitted biopsy of the affected area when the pathogen recurs. One of the two patients whose scintigrams were normal was on adequate treatment before the bone scintigram and the other was on oxacillin. Radiographs of the affected areas were normal, which indicates bone scintigraphy should be preferred to radiography in the early diagnosis of osseous infections. (orig.) [de

  12. Scintigraphy versus radiography in the early diagnosis of experimental bone necrosis with special reference to caisson disease of bone

    International Nuclear Information System (INIS)

    Gregg, P.J.; Walder, D.N.

    1980-01-01

    The early diagnosis of caisson disease of bone is hindered by the long delay which must elapse before an abnormality becomes apparent on a radiograph. The possible use of bone scintigraphy for this purpose was investigated. Necrosis of the bone and marrow was produced in rabbits by glass microspheres to simulate persistent gas-bubble emboli and then serial radiographs and scintigrams using sup(99m)Tc-diphosphonate were obtained. Regions of necrosis could be detected as 'hot spots' on the scintigrams as early as three weeks after the causative insult, which was many weeks before any abnormality could be detected on the radiographs. Histological examination of excised femora suggested that the scintigraphic abnormality might depend on the new bone formation established during a reactive or repair process. It is suggested that scintigraphy may have clinical value in caisson disease. (author)

  13. Scintigraphy versus radiography in the early diagnosis of experimental bone necrosis, with special reference to caisson disease of bone.

    Science.gov (United States)

    Gregg, P J; Walder, D N

    1980-05-01

    The early diagnosis of caisson disease of bone is hindered by the long delay which must elapse before an abnormality becomes apparent on a radiograph. The possible use of bone scintigraphy for this purpose was investigated. Necrosis of the bone and marrow was produced in rabbits by glass microspheres to simulate persistent gas-bubble emboli and then serial radiographs and scintigrams using 99mTc-diphosphonate were obtained. Regions of necrosis could be detected as "hot-spots" on the scintigrams as early as three weeks after the causative insult, which was many weeks before any abnormality could be detected on the radiographs. Histological examination of excised femora suggested that the scintigraphic abnormality might depend on the new bone formation during a reactive or repair process. It is suggested that scintigraphy may have clinical value in caisson disease.

  14. The clinical evaluation of CT and radionuclide examination in renal diseases

    International Nuclear Information System (INIS)

    Kutani, Wataru; Ishida, Hirofumi; Shirakawa, Shigetoshi; Shintaku, Takao; Funaki, Ryo

    1980-01-01

    One hundred and twelve cases of renal diseases were studied by computed tomography (CT) using EMI 5005/12. Of them, 60 were examined by both CT and renal scintigraphy, and comparatively evaluated. The CT units were checked before and after the contrast enhancement. Renal scintigrams were obtained by gamma cameras (PHO/GAMMA HP 6406, PHO/GAMMA LFOV) using 99 M Tc-DMSA. CT was especially useful in diagnosing the renal cysts and the hydronephrosis. Cysts in other organs (liver, spleen and pancreas) were simultaneously ascertained in polycystic diseases. CT was not helpful in diagnosing nephritis and diabetic nephropathy. Floating kidney and horse-shoe kidney were difficult to diagnose with CT. The renal scintigram was the reflection of the renal function, and was relatively more useful than CT in diagnosing horse-shoe kidney, floating kidney and nephritis, while it was not useful for non-functioning kidneys. (author)

  15. Utility of peripheral film findings and its correlation with automated analyzer – an audit from tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Sidra Asad

    2017-01-01

    Conclusion: Peripheral smear review was performed in 42% of the cases. The analyzer identified NRBC, immature WBC precursors, and atypical lymphocytes as the most common abnormality. The information correlated in 77% of the cases.

  16. As2O3 in children 1998-2003

    Indian Academy of Sciences (India)

    2003. 11 children. Median WBC count at diagnosis was 3400/mm3 (range: 800–. 9800). CHR: 10 patients (91%). Molecular Remission : 10. Minimal toxicity. Leukocytosis 6; ichthyosis and hyperpigmentation of skin 5; mild peripheral ...

  17. Clinical utility of chitotriosidase enzyme activity in nephropathic cystinosis

    NARCIS (Netherlands)

    Elmonem, M.A.; Makar, S.H.; Heuvel, L.P.W.J. van den; Abdelaziz, H.; Abdelrahman, S.M.; Bossuyt, X.; Janssen, M.C.; Cornelissen, E.; Lefeber, D.J.; Joosten, L.A.; Nabhan, M.M.; Arcolino, F.O.; Hassan, F.A.; Chevronnay, H.P. Gaide; Soliman, N.A.; Levtchenko, E.N.

    2014-01-01

    BackgroundNephropathic cystinosis is an inherited autosomal recessive lysosomal storage disorder characterized by the pathological accumulation and crystallization of cystine inside different cell types. WBC cystine determination forms the basis for the diagnosis and therapeutic monitoring with the

  18. Oreochromis niloticus

    African Journals Online (AJOL)

    USER

    2015-06-01

    Oreochromis niloticus) fed on diets containing watermelon (Citrullus lanatus) seedmeal were evaluated using packed cell volume. (PCV); haemoglobin content (Hb), white blood cell count (WBC), red blood cell count (RBC), ...

  19. Removal of Trypanosoma cruzi by white cell-reduction filters: an electronmicroscopic study

    Directory of Open Access Journals (Sweden)

    Fabron Junior Antonio

    1999-01-01

    Full Text Available White cell (WBC-reduction filters have been shown to be effective in removing infectious agents from infected blood products. In this study, the mechanisms of Trypanosoma cruzi (T. cruzi retention by WBC-reduction filters were assessed. Human packed red blood cell (PRBC and platelet concentrate (PC samples were contaminated with T. cruzi organisms (Y strain; 3.4 x 10(6/ml, and then filtered using WBC-reduction experimental filters that provided about 3 log10 WBC removal. Transmission electron microscopy sections showed that T. cruzi parasites were removed from contaminated PRBC and PC samples primarily by mechanical mechanism without interacting with filter fibbers or blood cells. In addition, we found that T. cruzi parasites were also removed by a direct fibber adhesion. These data indicate that T. cruzi parasites are removed from infected blood not only by mechanical mechanism but also by biological mechanism probably mediated by parasite surface proteins.

  20. Correlation of C-reactive protein with other acute inflammatory ...

    African Journals Online (AJOL)

    sCRP), white blood cell count (WBC), erythrocyte sedimentation rate (ESR) and random plasma glucose (RPG) in the blood of trauma patients on the first, third and eighth day following trauma with simultaneous temperature monitoring. Method: ...

  1. Performance Evaluation and HaematologicalParameters of West ...

    African Journals Online (AJOL)

    Performance Evaluation and HaematologicalParameters of West African Dwarf Goats Fed Diet Containing Graded Level of Raw and Fermented Malted Sorghum ... influenced white blood cell count (WBC), lymphocytes, monocytes, basophil and mean corpuscular haemoglobin concentration across the dietary treatments.

  2. Marker list: QM118798 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ACTCCCT P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG13 ... 10.1371/journal.pone.0077022 24155917 ... QM118798 Pyrus communis Rosaceae NH021a SSR ATCTCAATTTTCTCGGTAACCA CTGATATCTCTCTGC

  3. Marker list: QM118797 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM118797 Pyrus communis Rosaceae NH013a SSR GGTTTGAAGAGGAATGAGGAG CATTGACTTTAGGGCA...CATTTC P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG_01 ... 10.1371/journal.pone.0077022 24155917

  4. Marker list: QM118793 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AATCTCC P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG_11 ... 10.1371/journal.pone.0077022 24155917 ... QM118793 Pyrus communis Rosaceae NB105a SSR AAACAACCGACTGAGCAACATC AAAATCTTAGCCCAA

  5. Marker list: QM118783 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM118783 Pyrus communis Rosaceae CH04c10 SSR GGGTTAGGTTGTCTTCTCTCCT GCTTCTCGGGTGAG...TTTTTC P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG17 ... 10.1371/journal.pone.0077022 24155917

  6. Marker list: QM118780 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available AGGTGGA P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG14 ... 10.1371/journal.pone.0077022 24155917 ... QM118780 Pyrus communis Rosaceae CH03g06 SSR ATCCCACAGCTTCTGTTTTTG TCACAGAGAATCACA

  7. Marker list: QM118786 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM118786 Pyrus communis Rosaceae CH05a04 SSR GAAGCGAATTTTGCACGAAT GCTTTTGTTTCATTGA...ATCCCC P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG16 ... 10.1371/journal.pone.0077022 24155917

  8. Marker list: QM118800 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ATATTAG P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG_09 ... 10.1371/journal.pone.0077022 24155917 ... QM118800 Pyrus communis Rosaceae NH029a SSR GAAGAAAACCAGAGCAGGGCA CCTCCCGTCTCCCACC

  9. Marker list: QM118778 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ACAAGGC P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG12 ... 10.1371/journal.pone.0077022 24155917 ... QM118778 Pyrus communis Rosaceae CH03c02 SSR TCACTATTTACGGGATCAAGCA GTGCAGAGTCTTTG

  10. Marker list: QM118784 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM118784 Pyrus communis Rosaceae CH04e05 SSR AGGCTAACAGAAATGTGGTTTG ATGGCTCCTATTGC...CATCAT P128R068T003 x 'Moonglow'|WBC ('Bartlett' consensus map) LG_07 ... 10.1371/journal.pone.0077022 24155917

  11. Comparison of some functional properties and chemical constituents ...

    African Journals Online (AJOL)

    use

    2011-12-14

    ; Abdul-Hamid and Luan, 2000). In addition to nutritional effects, dietary fibre has functional properties such as water binding capacity (WBC) and fat binding capacity (FBC). So, addition of dietary fiber to a wide range of ...

  12. Children's white blood cell counts in relation to developmental exposures to methylmercury and persistent organic pollutants

    DEFF Research Database (Denmark)

    Oulhote, Youssef; Shamim, Z; Kielsen, Katrine

    2017-01-01

    Background To explore possible markers of developmental immunotoxicity, we prospectively examined 56 children to determine associations between exposures to methylmercury and persistent organic pollutants since birth and the comprehensive differential counts of white blood cells (WBC) at age 5...

  13. Etiology and laboratory abnormalities in bacterial meningitis in neonates and young infants

    Directory of Open Access Journals (Sweden)

    David Kotzbauer

    2017-04-01

    Full Text Available We conducted a retrospective review of electronic medical records of all cases of bacterial meningitis in neonates and young infants at our institution from 2004 to 2014. Fifty-six cases were identified. The most common causative organism was group B streptococcus, followed by Escherichia coli and then Listeria monocytogenes. Fortyfour of the 56 patients in the study had abnormalities of the blood white blood cell (WBC count. The most common WBC count abnormalities were leukopenia and elevation of the immature to total (I:T neutrophil ratio. Six patients in the case series lacked cerebrospinal fluid (CSF pleocytosis. Overall, just 3 of the 56 patients had normal WBC count with differential, CSF WBC count, and urinalysis. Only 1 of the 56 patients was well appearing with all normal lab studies. Our study indicates that bacterial meningitis may occur without CSF pleocytosis but very infrequently occurs with all normal lab studies and well appearance.

  14. Etiology and Laboratory Abnormalities in Bacterial Meningitis in Neonates and Young Infants.

    Science.gov (United States)

    Kotzbauer, David; Travers, Curtis; Shapiro, Craig; Charbonnet, Margaux; Cooley, Anthony; Andresen, Deborah; Frank, Gary

    2017-04-06

    We conducted a retrospective review of electronic medical records of all cases of bacterial meningitis in neonates and young infants at our institution from 2004 to 2014. Fifty-six cases were identified. The most common causative organism was group B streptococcus, followed by Escherichia coli and then Listeria monocytogenes . Forty-four of the 56 patients in the study had abnormalities of the blood white blood cell (WBC) count. The most common WBC count abnormalities were leukopenia and elevation of the immature to total (I:T) neutrophil ratio. Six patients in the case series lacked cerebrospinal fluid (CSF) pleocytosis. Overall, just 3 of the 56 patients had normal WBC count with differential, CSF WBC count, and urinalysis. Only 1 of the 56 patients was well appearing with all normal lab studies. Our study indicates that bacterial meningitis may occur without CSF pleocytosis but very infrequently occurs with all normal lab studies and well appearance.

  15. Initial effect of enalapril on kidney function in patients with moderate to severe chronic nephropathy

    DEFF Research Database (Denmark)

    Kamper, A L; Thomsen, H S; Nielsen, S L

    1990-01-01

    Angiotensin converting enzyme (ACE) inhibitors has been suggested to halt the progression of chronic renal failure. As the initial step of a controlled trial of this hypothesis, it was investigated whether start of enalapril in patients with severe chronic nephropathy might cause a critical fall...... and the scintigrams showed no intrarenal activity defects. In conclusion, enalapril caused a fall in GFR, which was clinically acceptable in most of the patients....

  16. Primary amyloid heart disease presenting as hypertrophic obstructive cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Weston, L.T.; Raybuck, B.D.; Robinowitz, M.; Brinker, J.A.; Oetgen, W.J.

    1986-01-01

    This report describes the unusual presentation of a patient with primary cardiac amyloidosis. Initial clinical symptoms and hemodynamic studies, including Technetium-99m-pyrophosphate scintigraphy, suggested hypertrophic obstructive cardiomyopathy, but endomyocardial biopsy revealed diffuse amyloid infiltration. Only two other cases of left ventricular outflow tract obstruction due to cardiac amyloidosis have been reported. The false-negative technetium-99m-pyrophosphate scintigram in this patient argues for the use of endomyocardial biopsy to aid in the diagnosis of left ventricular hypertrophy.

  17. Investigation of Marfan's syndrome by nuclear medicine

    International Nuclear Information System (INIS)

    D'haene, E.G.M.; Fintelman, H.

    1985-01-01

    Combining an isotope angiogram with an ECG-triggered blood pool scintigram is very appropriate to follow the course of Marfan's syndrome, especially to diagnose and to quantify occurrence of aneurysms, valve insufficiency and other cardiovascular defects like ventricle hypertrophy and decompensatio cordis. In this paper, results are described in a family of 4 members that show different stages of this disease. (G.J.P.)

  18. Detection of degenerative disease of the temporomandibular joint by bone scintigraphy: concise communication

    International Nuclear Information System (INIS)

    Goldstein, H.A.; Bloom, C.Y.

    1980-01-01

    Nine patients with facial pain were evaluated with limited bone scans. The scintigrams correlated with microscopy in all patients, although radiographs correlated with microscopy in only five patients. The degenerative disease process in the temporomandibular joint was more extensive in the patients with radiographic and scintigraphic abnormalities than in those with scintigraphic abnormalities alone. The limited bone scan appears useful in detecting early degenerative changes in the temporomandibular joint

  19. Recommendations of the Strahlenschutzkommission (radiation protection commission) on quality control in nuclear medicine. Progress or a step backwards?; Empfehlungen der Strahlenschutzkommission zur Qualitaetskontrolle in der Nuklearmedizin. Fortschritt oder Rueckschritt?

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Juergen

    2015-07-01

    Recommendations of the Strahlenschutzkommission (radiation protection commission) on quality control in nuclear medicine specification of reaction threshold and tolerance limits that were adopted in September 2010 were supposed to harmonize the consideration of results. The author shows that based on the compiled experiences the specification o reaction thresholds and tolerance limits in imaging systems is not sufficient to release a gamma camera after quality control without visual evaluation of the scintigram.

  20. A study of preclinical myocardial damage in diabetes mellitus

    International Nuclear Information System (INIS)

    Mizuno, Sumio

    1986-01-01

    The scintigrams were evaluated by visual and circumferential profile analysis. In addition, mechanocardiography (MCG) and functional tests of the autonomic nerves were done. Coronary angiography and left ventriculography (LVG) were performed in 22 patients having cardiac symptoms. Of 61 patients, 20 (32, 8 %) showed perfusion defects in the scintigram (positive cases), consisting of 5 with stress-induced defect and 15 with fixed defect. The scintigrams in 41 patients showed normal perfusion of thallium (negative cases). The positive cases had more severe diabetic complications and longer duration of diabetes compared with the negative cases. The positive cases were incident to the treatment with insulin or oral drugs. Both systolic time intervals (STIs) in MCG and coefficients of variation of heart rate (CV) decreased in the diabetics, particularly in the positive cases. However, the decrement of STIs and CV was not significantly different in quantity between positive and negative cases; results therefore suggest that these two parameters may not correlate directly with the perfusion defects on Tl-201 scintigraphy. Twenty-two patients, 9 positive and 13 negative cases, had undergone cardiac catheterization, and showed normal coronary angiograms. On hemodynamic study, an ejection fraction decreased more in the positive cases than in the negative cases. The 13 negative cases showed normal wall motion in the LVG. Seven of the 9 positive cases, however, showed local hypokinetic wall motion. Abnormalities of the LVG corresponded to findings of the scintigram, i. e., perfusion defects or decrement of washout rate. On circumferential profile analysis, the mean washout rate of the whole heart decreased only in the positive cases. (J.P.N.)

  1. Significance of thymic scintigraphy

    International Nuclear Information System (INIS)

    Baba, Hiromi; Oshiumi, Yoshihiko; Nakayama, Chikashi; Morita, Kazunori; Koga, Ichinari

    1978-01-01

    Thymic scintigraphy by 67 Ga-citrate and 75 Se-methionine was done on 6 cases of thymoma, and 5 cases of myasthenia gravis. Scan was positive on 5 of 6 cases of thymoma. All patients with malignant thymoma were positive. Among the 7 cases of myasthenia gravis, scintigrams revealed 2 thymomas and 1 hyperplasia on whom no thymic mass suspected. Thymic scintigraphy is useful examination when dealing with myasthenia gravis. (auth.)

  2. Parasympathetic activity and blood catecholamine responses following a single partial-body cryostimulation and a whole-body cryostimulation.

    Directory of Open Access Journals (Sweden)

    Christophe Hausswirth

    Full Text Available The aim of this study was to compare the effects of a single whole-body cryostimulation (WBC and a partial-body cryostimulation (PBC (i.e., not exposing the head to cold on indices of parasympathetic activity and blood catecholamines. Two groups of 15 participants were assigned either to a 3-min WBC or PBC session, while 10 participants constituted a control group (CON not receiving any cryostimulation. Changes in thermal, physiological and subjective variables were recorded before and during the 20-min after each cryostimulation. According to a qualitative statistical analysis, an almost certain decrease in skin temperature was reported for all body regions immediately after the WBC (mean decrease±90% CL, -13.7±0.7°C and PBC (-8.3±0.3°C, which persisted up to 20-min after the session. The tympanic temperature almost certainly decreased only after the WBC session (-0.32±0.04°C. Systolic and diastolic blood pressures were very likely increased after the WBC session, whereas these changes were trivial in the other groups. In addition, heart rate almost certainly decreased after PBC (-10.9% and WBC (-15.2% sessions, in a likely greater proportion for WBC compared to PBC. Resting vagal-related heart rate variability indices (the root-mean square difference of successive normal R-R intervals, RMSSD, and high frequency band, HF were very likely increased after PBC (RMSSD: +54.4%, HF: +138% and WBC (RMSSD: +85.2%, HF: +632% sessions without any marked difference between groups. Plasma norepinephrine concentrations were likely to very likely increased after PBC (+57.4% and WBC (+76.2%, respectively. Finally, cold and comfort sensations were almost certainly altered after WBC and PBC, sensation of discomfort being likely more pronounced after WBC than PBC. Both acute cryostimulation techniques effectively stimulated the autonomic nervous system (ANS, with a predominance of parasympathetic tone activation. The results of this study also suggest

  3. Increment of absolute neutrophil count in the third trimester and increased risk of small-for-gestational-age birth: Hirakata Risk Associated with Pregnancy Assessment Research (HIRAPAR).

    Science.gov (United States)

    Harita, Nobuko; Kariya, Masatoshi; Hayashi, Tomoshige; Sato, Kyoko Kogawa; Nakamura, Kimihiko; Endo, Ginji; Narimoto, Katsuhiko

    2012-09-01

    Small-for-gestational-age (SGA) infants, who have growth restriction, have higher perinatal morbidity and mortality. Excessive inflammatory reaction such as neutrophil activation has been observed in pregnant women whose offspring had restricted fetal growth, but the association between white blood cell (WBC) counts and SGA birth has not yet been assessed. We therefore examined the association of WBC count and its change with the risk of SGA birth. We enrolled 2356 pregnant women who had full-term singleton delivery at a private maternity hospital in Hirakata, Japan. SGA was defined as under the 10th percentile of birthweight for gestational age, baby sex, and mother's parity according to the Japanese neonatal anthropometric charts renewed in 2010. Blood samples were measured in the first and third trimesters. We performed multiple logistic regression analysis to assess associations between total and differential WBC counts and SGA birth. Women with SGA birth tended to have higher total WBC count in the third trimester compared with women who did not have SGA birth. This tendency was not observed for total WBC count in the first trimester. After adjustment for age, height, body mass index at entry, smoking habit, weekly gestational weight gain, and pregnancy-induced hypertension, higher total WBC count in the third trimester was associated with an increased risk of SGA birth. Total WBC count in the first trimester did not show any significant association with SGA birth. The ratio of total WBC count in the third trimester to that in the first trimester was associated with SGA birth; the odds ratio for 1 unit increase was 3.02 (95% CI: 1.54-5.92). Regarding differential WBC counts in the third trimester, neutrophil count but not lymphocyte count was associated positively with SGA birth. Higher total WBC and absolute neutrophil counts in the third trimester were associated with SGA birth. In addition, greater ratio of increase in total WBC counts during pregnancy

  4. What is the exact predictive role of preoperative white blood cell count for new-onset atrial fibrillation following open heart surgery?

    Directory of Open Access Journals (Sweden)

    Seyed Jalil Mirhosseini

    2013-01-01

    Full Text Available Background: Atrial fibrillation (AF occurs in 30% patients on the second or third day post operation; therefore, it is the most prevalent and complicated arrhythmia after open heart surgery. White blood cell (WBC count seems to be most significantly associated with cardiovascular disorders. This study was designed to evaluate the exact relationship between preoperative WBC count and post-Coronary artery bypass graft (CABG AF in patients with severe left ventricle (LV dysfunction who underwent elective off-pump coronary artery bypass. Methods: This study was conducted on 104 patients from among 400 patients with severe LV dysfunction undergoing elective off-pump CABG surgery from February 2011 to February 2012, in Afshar Cardiovascular Center, Yazd, Iran. Patients with emergency surgery, unstable angina creatinine higher than 2.0 mg/dL, malignancy, or immunosuppressive disease were excluded. Preoperative serological tests of the participants, such as WBC counts, were saved in their medical dossiers. Of the 400 patients undergoing CABG, AF was found in 54 cases; these 54 male patients formed the experimental group and 60 other patients in the intensive care unit (ICU and hospital stay without postoperative AF were part of the control group. Results: The average age of the patients was 68.5±12.8 years. WBC counts in patients with and without AF three days before surgery were 12,340±155 and 8,950±170, respectively. On surgical day, WBC counts in the patients with and without AF were 13,188±140 and 9,145±255, respectively (P value three days before surgery: 0.04; P value on surgical day: 0.01. Of the 54 male patients with postoperative AF (POAF, duration of AF was more in cases with elevated WBC count (12,000-14,000 than in those with lower elevated WBC count (10,000-12,000 ( P=0.025, but there was no relationship between frequency of recurrence of AF and grading of elevation of WBC count ( P=0.81. Conclusion: These findings show that three days

  5. COMPARISON OF TOTAL LEUKOCYTE QUANTIFICATION METHODS IN FREE-LIVING GALAPAGOS TORTOISES (CHELONOIDIS SPP.).

    Science.gov (United States)

    Sheldon, Julie D; Stacy, Nicole I; Blake, Stephen; Cabrera, Fredy; Deem, Sharon L

    2016-03-01

    Reptile hematologic data provide important health information for conservation efforts of vulnerable wildlife species such as the Galapagos tortoise (Chelonoidis spp.). Given the reported discrepancies between manual leukocyte counts for nonmammalian species, two manual leukocyte quantification methods, the Natt and Herrick's (NH) and the Eopette (EO), were compared to white blood cell (WBC) estimates from blood films of 42 free-living, clinically healthy, adult female Galapagos tortoises. To investigate the effects of delay in sample processing, estimated WBC counts and leukocyte differentials were compared for blood films prepared at time of collection under field conditions (T0) to blood films prepared from samples that were stored for 18-23 hr at 4°C in the laboratory (T1). Passing-Bablok regression analysis revealed no constant or proportional error between the NH and WBC estimates (T0 and T1) with slopes of 1.1 and 0.9, respectively. However both constant and proportional errors were present between EO and WBC estimates (T0 and T1) with slopes of 3.1 and 2.7, respectively. Bland Altman plots also showed agreement between the NH and WBC estimates where the points fell within the confidence-interval limit lines and were evenly distributed about the mean. In contrast, the EO and WBC estimate comparisons showed numerous points above the upper limit line, especially at higher concentrations. WBC estimates obtained from T0 and T1 films were in agreement, whereas heterophil and monocyte percentages based on differentials were not. Cell morphology and preservation were superior in T0 blood films because thrombocytes exhibited swelling after storage, becoming difficult to differentiate from lymphocytes. In this study, the highest quality and most reliable hematologic data in Galapagos tortoises were obtained by combining immediate blood film preparation with the NH leukocyte quantification method and a confirmatory WBC estimate from the blood film.

  6. White blood cell count and the risk for coronary artery disease in young adults.

    Directory of Open Access Journals (Sweden)

    Gilad Twig

    Full Text Available BACKGROUND: The association between white blood cell (WBC count and coronary artery disease (CAD is unknown in young adults. Our objective was to assess the association between WBC count and its changes over time with CAD incidence in the Metabolic, Life-style and Nutrition Assessment in Young adults (MELANY study, a cohort of Israeli army personnel. METHODS AND FINDINGS: 29,120 apparently healthy young men (mean age; 31.2±5.5 years with a normal baseline WBC count (3,000-12,000 cells/mm(3 were followed during a mean follow up of 7.5±3.8 years for incidence of CAD. Participants were screened every 3-5 years using a stress test, and CAD was confirmed by coronary angiography. In a multivariate model adjusted for age, body mass index (BMI, LDL- and HDL-cholesterol, blood pressure, family history of CAD, physical activity, diabetes, triglycerides and smoking status, WBC levels (divided to quintiles above 6,900 cells/mm(3 (quintile 4 were associated with a 2.17-fold increase (95%CI = 1.18-3.97 in the risk for CAD as compared with men in quintile 1 (WBC≤5,400 cells/mm(3. When modeled as a continuous variable, a WBC increment of 1000 cells/mm(3 was associated with a 17.4% increase in CAD risk (HR 1.174; 95%CI = 1.067-1.290, p = 0.001. A decrease in the WBC level (within the normal range during the follow-up period was associated with increased physical activity and decreased triglyceride levels as well as with reduced incidence of CAD. CONCLUSIONS: WBC count is an independent risk factor for CAD in young adults at values well within the normal range. WBC count may assist in detecting subgroups of young men at either low or high risk for progression to CAD.

  7. Predictors of Septic Arthritis in the Adult Population.

    Science.gov (United States)

    Borzio, Robert; Mulchandani, Neil; Pivec, Robert; Kapadia, Bhaveen H; Leven, Dante; Harwin, Steven F; Urban, William P

    2016-07-01

    Septic arthritis is a devastating condition; well-established criteria for diagnosis exist in the pediatric population, but not for adults. This study evaluated patient factors and laboratory parameters that may be associated with the diagnosis of septic arthritis in adults. A total of 458 knee aspirates for suspected septic arthritis were evaluated with serum and synovial leukocyte counts and differentials as well as Kocher criteria for pediatric septic arthritis. Twenty-two patients (4.8%) had septic arthritis confirmed by a positive synovial fluid culture. Erythrocyte sedimentation rate (ESR) and serum white blood cell (WBC) counts were not statistically different between the 2 groups, with 64% of septic arthritis patients having a normal serum WBC count and 77% being afebrile. Mean synovial fluid WBC count was 26,758 cells/µL and 70,581 cells/µL in the nonseptic and septic groups, respectively. The likelihood ratio for a synovial fluid WBC count greater than 65,000 cells/µL was 2.8 (95% confidence interval, 1.2-6.7). Evaluation receiver operating characteristic curves using synovial WBC counts resulted in a significant area under the curve of 0.66 (P=.02). To achieve 90% specificity, a WBC cutoff of 64,000 cells/µL was required with a corresponding sensitivity of 40%. There was no significant difference in the synovial cell differential of 80% vs 90% in diagnosing infection. Synovial fluid WBC count greater than 64,000 cells/µL yielded the optimal combination of sensitivity and specificity. Polymorphonuclear leukocytes, ESR, serum WBC count, fever, and weight-bearing status were not significant predictors of septic arthritis. This study demonstrates the limited utility of Kocher criteria in the adult population and the importance of synovial leukocyte counts. [Orthopedics. 2016; 39(4):e657-e663.]. Copyright 2016, SLACK Incorporated.

  8. Performance evaluation of the Sysmex XE-5000 hematology analyzer for white blood cell analysis in cerebrospinal fluid.

    Science.gov (United States)

    Perné, Andrea; Hainfellner, Johannes A; Womastek, Irene; Haushofer, Alexander; Szekeres, Thomas; Schwarzinger, Ilse

    2012-02-01

    The newest generation hematology analyzer, Sysmex XE-5000 (Sysmex Corporation, Kobe, Japan) is equipped with an improved body fluid analysis mode. To evaluate the applicability of the XE-5000 analyzer to white blood cell (WBC) analysis in cerebrospinal fluid (CSF). A total of 425 routinely collected, consecutive CSF samples were included in the study. For a comparison of total WBC counts, the results of routine chamber counts were grouped into categories of 0 to 5 (n  =  330), >5 to 10 (n  =  36), >10 to 50 (n  =  39), >50 to 200 (n  =  15), and >200 (n  =  5) WBC/µL. Microscopic differential counts were performed using cytospins from 276 samples. Results were grouped according to the percent content of polymorphonuclear (PMN) cells, 0% to 25% (n  =  263), >25% to 50% (n  =  7), >50% to 75% (n  =  3), and >75% to 100% (n  =  3) of WBC. Corresponding results of XE-5000 analysis were matched to these particular count categories. For total WBC counts, the proportions of samples correctly classified by the XE-5000 from the percentage groups described above were 88%, 47%, 72%, 93%, and 100%, respectively. After the two lowest count categories were combined into one range of 0 to 10 WBC/µL, matches increased to 95%. For PMN counts in the 0% to 25% group, 37% of samples were misclassified by the XE-5000. Conversely, for samples with microscopic PMN counts of more than 25%, there was a trend toward underestimation by the XE-5000. Mismatches were most pronounced in samples with fewer than 10 WBC/µL. The Sysmex XE-5000 hematology analyzer yields valid total CSF cell counts and may be considered an acceptable alternative to the traditional chamber method, even for samples with low WBC counts. However, it cannot be recommended as a suitable alternative for manual differential cytologic workup.

  9. Low white blood cell count is independently associated with chronic kidney disease progression in the elderly: the CKD-ROUTE study.

    Science.gov (United States)

    Arai, Yohei; Kanda, Eiichiro; Iimori, Soichiro; Naito, Shotaro; Noda, Yumi; Sasaki, Sei; Sohara, Eisei; Okado, Tomokazu; Rai, Tatemitsu; Uchida, Shinichi

    2018-04-01

    Elevated white blood cell (WBC) count is a well-known predictor of chronic kidney disease (CKD) progression. However, elderly patients commonly fail to develop a high WBC count in response to several diseased states and may instead present a low WBC count. Therefore, we hypothesized that low WBC count, in addition to high WBC count, is associated with CKD progression in the elderly. We conducted a prospective cohort study using 3-year follow-up data from the CKD Research of Outcomes in Treatment and Epidemiology study. In the present study, participants aged over 60 years with pre-dialysis CKD stages G2-G5 were eligible. Patients were stratified into three groups according to WBC count using tertiles (T). The primary outcome was a composite of end-stage renal disease and a 50% reduction in estimated glomerular filtration rate. Data were analyzed using Cox proportional hazard models with adjustments for covariates. We enrolled 697 patients (males, 69%). The median WBC count was 6100 cells/µl (T1, <5400, n =  222; T2, 5400-6900, n =  235; T3, ≥6900, n = 240). During a median follow-up of 868 days, the primary outcome was observed in 170 patients, whereas 54 patients died. T1 and T3 had significantly higher hazard ratios (HR) than T2 (T1, HR 1.69, 95% confidence interval 1.14-2.51; T3, HR 1.63, 95% confidence interval 1.10-2.41). Moreover, T1 had a significantly higher adjusted HR (1.54, 95% confidence interval 1.00-2.37). Low WBC count is independently associated with CKD progression in the elderly.

  10. Efficacy and Safety of Frozen Blood for Transfusion in Trauma Patients - A Multi-Center Trial

    Science.gov (United States)

    2015-04-01

    physiologic significance by playing a role in inflammation, hemostasis, vascular dysfunction, and transfusion reactions [102,103]. Indeed, data from our...process can bring the WBC count below the 5 × 108 WBC threshold that is effective in reducing transfusion reactions [126]. 2.3.3 Clinical Use of CPRBCs...erythrocytes for freezing. The institution of frozen blood was associated with a decrease in the incidence of transfusion reactions from 0.57% to 0.11

  11. Single Cell Characterization of Prostate Cancer-Circulating Tumor Cells

    Science.gov (United States)

    2013-09-01

    contaminating WBC. Scale bar = 20 microns. (E) MagSweeper versus CellSearch comparison. Samples with 0 CTC were assigned a value of 1. 10...cancer patient blood sample, and contaminating WBC found after MagSweeper isolation. Scale bar = 20 microns. (E) MagSweeper versus CellSearch...Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144: 646–674. 4. Ashworth TR (1869) A case of cancer in which cells similar to those in

  12. Effect of Chronic Exposure to petroleum products on some ...

    African Journals Online (AJOL)

    In the control subjects, the level of red blood cell (RBC) white blood cell (WBC), hemoglobin (Hb), packed cell +0.9x10 3mm3, 13.7+1.2g/dl, 41.2+2.6% and 296.7+5.4x10 3mm3 respectively. In petrol station attendants that were exposed by inhalation and through the skin, the levels of RBC, WBC, Hb, PCV and Platelets ...

  13. Sex differences in the relationship between leukocyte count and chronic kidney disease: the 2007 Korean National Health and Nutrition Examination Survey.

    Science.gov (United States)

    Na, Ha-Young; Shim, Jae-Yong; Lee, Hye-Ree; Jung, Dong-Hyuk; Kim, Hong-Bae; Park, Byoung-Jin; Jung, Rae-Jun; Lee, Yong-Jae

    2011-01-01

    Chronic kidney disease (CKD) has emerged as an independent predictor for cardiovascular disease (CVD), which is now regarded as an inflammatory disease. This study aimed to determine the association of CKD with white blood cell (WBC) count as a marker of systemic inflammation. We examined the association of WBC count with CKD in 2825 Korean adults (1155 men, 1670 women) in the 2007 Korean National Health and Nutrition Examination Survey (KNHANES). CKD was defined as either proteinuria or a glomerular filtration rate (GFR) <60 mL/min/1.73 m(2). The odds ratios (ORs) for CKD were calculated using multivariate logistic regression analysis after adjusting for confounding variables across gender-specific WBC count quartiles. The proportion of CKD increased with increasing WBC quartiles, from 9.7% in the lowest quartile to 20.7% in the highest quartile for women. In multivariate logistic regression analysis, the corresponding odds ratios (95% confidence intervals [CIs]) for a CKD across WBC count quartiles among women were 1.00, 1.45 (0.91-2.31), 1.65 (1.03-2.63), and 2.11 (1.33-3.35), after adjusting for age, body mass index (BMI), systolic blood pressure, fasting plasma glucose, smoking status, current drinking high-density lipoprotein cholesterol (HDL-C), and triglyceride. In contrast, compared with women, men appeared to have no significant results of a relationship between WBC quartiles and CKD. Our study shows a significant association between WBC count and the risk for CKD in women. Accordingly, potential health benefits of early detection of a higher level of WBC count may be useful for CKD risk assessment in women.

  14. A storage and display method for radioisotope imaging using scan conversion memory

    International Nuclear Information System (INIS)

    Takizawa, Masaomi; Kobayashi, Toshio; Nakanishi, Fumiko; Suzuki, Shigeo; Miyabayashi, Hiroyasu

    1975-01-01

    The scan conversion memory (SCM) has been applied to a method for the storage and display of radioisotope images. Scan data were fed into SCM as pulse signals with X and Y axis from the scinti-scanner or the scinti-camera. The electric charge on the SCM target is directly proportional to the pulse density. A TV display was executed immediately after the recording of a radioisotope image. If necessary, a seven additive color display to the image density could be obtained by a simple color slicer, and the image could be hard-copied by a video hard-copy printer. Characteristics of the SCM were experimentally clarified as follows: the practical resolution was 700 line/TV; ten levels gray scale were discriminated on the video monitor, the uniformity, measured by an oscilloscope was less than 20%, and dead time of the pulse interval at full scale signal was 5 μ sec. In their representation, the SCM scintigrams were observed as closely resembling conventional film scintigrams. Superimposed imaging of an X-ray picture and a radioisotope image can be realized by using the SCM, for an increase in anatomical localization on reading images. The SCM scintigram can be applied rapidly and can be the viewer of radioisotope imaging. (auth.)

  15. Exercise-induced thallium-201 myocardial perfusion defects in angina pectoris without significant coronary artery stenosis

    International Nuclear Information System (INIS)

    Nakazato, Masayasu; Maruoka, Yuji; Sunagawa, Osahiko; Kinjo, Kunihiko; Tomori, Masayuki; Fukiyama, Koshiro

    1990-01-01

    We performed exercise thallium-201 myocardial scintigraphy in 32 patients with angina pectoris to study the incidence of perfusion defects, who had no significant organic stenosis on coronary angiography. None of them had myocardial infarction or cardiomyopathy. Thallium-201 myocardial scintigraphy and 12-lead ECG recording were performed during supine bicycle ergometer exercise. Perfusion defects in thallium-201 scintigrams in SPECT images were assessed during visual analysis by two observers. In the coronary angiograms obtained during intravenous infusion of nitroglycerin, the luminal diameter of 75% stenosis or less in the AHA classification was regarded as an insignificant organic stenosis. Myocardial perfusion defects in the thallium-201 scintigrams were detected in eight (25%) of the 32 patients. Six of these eight patients had variant angina documented during spontaneous attacks with ST elevations in standard 12-lead ECGs. Perfusion defects were demonstrated at the inferior or infero-posterior regions in six patients, one of whom had concomitant anteroseptal defect. The defects were not always accompanied by chest pain. All but one patient demonstrating inferior or inferoposterior defects showed ST depression in leads II, III and aV F on their ECGs, corresponding to inferior wall ischemia. The exception was a case with right bundle branch block. Thus, 25% of the patients with angina pectoris, who had no evidence of significant organic stenosis on their coronary angiograms, exhibited exercise-induced perfusion defects in their thallium-201 scintigrams. Coronary spasms might have caused myocardial ischemia in these patients. (author)

  16. MRI for early diagnosis of avascular necrosis of the femoral head

    International Nuclear Information System (INIS)

    Kokubo, Takashi; Takatori, Yoshio; Kamogawa, Morihide; Ninomiya, Setsuo; Yoshikawa, Kohki; Itai, Yuji; Iio, Masahiro; Mitamura, Tadayuki

    1988-01-01

    Magnetic resonance imaging (MRI) was performed in forty patients on long-term oral steroid therapy for early detection of avascular necrosis (AN) of the femoral head. In 13 patients, AN was diagnosed in the unilateral femoral head from abnormal plain radiographs while the contralateral femoral head was normal radiographically. In the other 27 patients, radiographs were normal. A total of 67 femoral heads with normal radiographs is studied in this paper. In 36 of 67 femoral heads (54 %), MRI demonstrated abnormal low intensity area. The abnormal findings on MRI were divided into five patterns: whole type (type A), peripheral type (type B), ring or band type (type C), small change type (type D) and distal type (type E). Type A, B, C, D and E were found in 2, 11, 5, 16 and 2 femoral heads, respectively. In cases to be followed up over 6 months, AN was manifested radiographically in 4 femoral heads of 5 in type C and in one of 14 in type D. Meanwhile, in 6 of 41 femoral heads examined (15 %), bone scintigrams was abnormal. Followed-up study over 6 months revealed that AN was manifested radiographically in one femoral head of 6 with abnormal scintigram. However, in 4 of 30 with normal scintigram, AN was manifested subsequently. MRI was a better diagnostic modality for early AN. Ring or band-like low intensity (type C) on MRI was considered to be characteristic pattern of early AN. (author)

  17. Experimental study of lung perfusion scintigraphy with sup(99m)Tc-MAA to radiation damaged lung

    International Nuclear Information System (INIS)

    Harada, Tateki

    1976-01-01

    The histological changes including blood flow damage due to the irradiation were studied on the rabbits which received the fractionated irradiation of 60 Co from the standpoint of the correlationship with the nuclide concentration of the lesion. 1) The histological changes, such as edema, and the congestion in the alveolar wall, initiated right after the 4,000 R of 60 Co irradiation, and they become worse with the increase of irradiation dose and with passage of time. In the group of rabbits which was given 10,000 R of irradiation, the remarkable hyperplasia of the alveolar wall, and emphysema manifested, and the fibrosis of the stroma advanced remarkably. 2) X-ray examination revealed the abnormal shadow in the lung only in the group of 10,000 R irradiation right after the end of irradiation. 3) Digital scintigram revealed that in the groups of less than 8,000 R of irradiation blood flow damage recovered, on the other hand, in the group of 10,000 R irradiation, remarkable damage continued for 3 months. These results were assumed to correspond to the degree of abnormality of the histological findings, such as the hyperplasia of the alveolar wall and the blood vessels, emphysem, and fibrosis. 4) Digital scintigram which was processed with computer provided the clearer image of the degree and extent of blood flow damage than those of the original scintigram. (Mukohata, S.)

  18. Exercise-induced thallium-201 myocardial perfusion defects in angina pectoris without significant coronary artery stenosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakazato, Masayasu; Maruoka, Yuji; Sunagawa, Osahiko; Kinjo, Kunihiko; Tomori, Masayuki; Fukiyama, Koshiro (Ryukyu Univ., Nishihara, Okinawa (Japan). School of Medicine)

    1990-01-01

    We performed exercise thallium-201 myocardial scintigraphy in 32 patients with angina pectoris to study the incidence of perfusion defects, who had no significant organic stenosis on coronary angiography. None of them had myocardial infarction or cardiomyopathy. Thallium-201 myocardial scintigraphy and 12-lead ECG recording were performed during supine bicycle ergometer exercise. Perfusion defects in thallium-201 scintigrams in SPECT images were assessed during visual analysis by two observers. In the coronary angiograms obtained during intravenous infusion of nitroglycerin, the luminal diameter of 75% stenosis or less in the AHA classification was regarded as an insignificant organic stenosis. Myocardial perfusion defects in the thallium-201 scintigrams were detected in eight (25%) of the 32 patients. Six of these eight patients had variant angina documented during spontaneous attacks with ST elevations in standard 12-lead ECGs. Perfusion defects were demonstrated at the inferior or infero-posterior regions in six patients, one of whom had concomitant anteroseptal defect. The defects were not always accompanied by chest pain. All but one patient demonstrating inferior or inferoposterior defects showed ST depression in leads II, III and aV{sub F} on their ECGs, corresponding to inferior wall ischemia. The exception was a case with right bundle branch block. Thus, 25% of the patients with angina pectoris, who had no evidence of significant organic stenosis on their coronary angiograms, exhibited exercise-induced perfusion defects in their thallium-201 scintigrams. Coronary spasms might have caused myocardial ischemia in these patients. (author).

  19. Clinical assessment of the early myocardial Tc-99m-PYP uptake as an indicator of successful recanalization in the acutely infarcted vessels

    International Nuclear Information System (INIS)

    Kondo, Makoto; Yuzuki, Yousuke; Miyazaki, Yukio; Kurose, Takesi; Matsunaga, Kazuhiko; Simono, Yukio

    1986-01-01

    A noninvasive useful method is required to early ascertain the effect of intracoronary thrombolysis (ICT) currently performed for acute myocardial infarction (AMI). In the present study, Tc-99m-pyrophosphate (PYP) scintigraphy was performed early (2.8 - 9.3 hr) after the onset of symptoms in 34 patients undergoing ICT. Of 27 patients in whom favorable recanalization was obtained, 24 had positive early scintigrams. In the other 7 patients in whom ICT was unsuccessful, scintigrams were negative. In 3 of them, favorable collateral circulation was seen. The findings were compared with those within 16 hr after the onset for the peak levels of creatine kinase (CK) and MB-CK. Early PYP scintigraphy had a sensitivity of 89 %, specificity of 100 %, and predictive accuracy of 91 % in assessing the recanalization in the infarcted vessels. The corresponding figiures were 70 %, 86 %, and 74 % for CK levels; and 70 %, 71 %, and 71 % for MB-CK levels. The results indicate that PYP scintigraphy may be a useful aid in the diagnosis of recanalization. The mechanism for PYP uptake on early scintigrams may be explained by the passage of excessive Ca ion into the ischemic myocardial cells through the rapid recanalization, resulting in accelerated cell death (reperfusion necrosis). (Namekawa, K.)

  20. 111-Indium labelled autologous leucocytes in diagnosis of inflammatory bowel disease

    Energy Technology Data Exchange (ETDEWEB)

    Wandall, J.H.; Edeling, C.J.; Jensen, J.T.; Lund, J.O.; Bonnevie, O.; Haxholdt, H.; Jensen, H.C.; Matzen, P.; Myschetsky, P.S.; Nielsen, A.M.

    1984-01-01

    111-Indium labelled leucocytes have been used to visualize inflammatory lesions in ulcerative colitis (CU) and in Crohn's disease (CD). The aim of this study was to compare findings by scintigraphy, radiology and endoscopy. Material: Twelve patients with CU and 15 patients with CD were studied. All patients were non-febrile. Two patients received prednisolone 5 mg/daily, 8 sulphasalazine. Methods: Autologous leucocytes were labelled with 111-In-Oxine and given i.v. Scintigrams were obtained 3 and 24 hrs. p.i. Double contrast x-ray studies were done of the colon and small intestine after 2 and 14 days respectively. Colonscopy with biopsy was done after 4 days. Results: Active lesions were found in 24 and 27 patients. Scintigrams 24 hrs.p.i. did not give and additional information compared with scintigrams 3 hrs.p.i. Intraluminal activity masked the location and extension of lesions after 24 hrs. Excretion in the stool was 2.4-25.8% of administered activity. Compared with scintigraphy a corresponding extension and location was found by colonscopy. In 4 patients x-ray of the colon was normal but scintigraphy and colonscopy showed active inflammation. Conclusion: Scintigraphy after injection of 111-In labelled leucocytes is a atraumatic method for visualization of inflammatory lesions in UC and CD. Furthermore, it appears to be more sensitive than conventional x-ray studies.

  1. Systemic inflammation in 222.841 healthy employed smokers and nonsmokers: white blood cell count and relationship to spirometry

    Directory of Open Access Journals (Sweden)

    Fernández José Antonio

    2012-05-01

    Full Text Available Abstract Background Smoking has been linked to low-grade systemic inflammation, a known risk factor for disease. This state is reflected in elevated white blood cell (WBC count. Objective We analyzed the relationship between WBC count and smoking in healthy men and women across several age ranges who underwent preventive medical check-ups in the workplace. We also analysed the relationship between smoking and lung function. Methods Cross-sectional descriptive study in 163 459 men and 59 382 women aged between 16 and 70 years. Data analysed were smoking status, WBC count, and spirometry readings. Results Total WBC showed higher counts in both male and female smokers, around 1000 to 1300 cell/ml (t test, P 1% was higher in nonsmokers for both sexes between 25 to 54 years (t test, P 1% were found to have higher WBC counts, in comparison to smokers with a normal FEV1% among similar age and BMI groups. Conclusions Smoking increases WBC count and affects lung function. The effects are evident across a wide age range, underlining the importance of initiating preventive measures as soon as an individual begins to smoke.

  2. The use of technetium-99m hexamethylpropylene amine oxime labelled white blood cells to detect subclinical inflammation of the heart after cardiopulmonary bypass in children with congenital heart disease

    International Nuclear Information System (INIS)

    Kao Chiahung; Wang Yenliang; Wang Shyhjen; Hsieh Kaisheng

    1992-01-01

    Ten children (6 boys and 4 girls, aged 1-9 years old) underwent operations with a cardiopulmonary bypass, and the technetium-99m hexamehtylpropylene amine oxine ( 99m Tc-HMPAO) labelled white blood cell (WBC) heart scans were used to detect postoperative leukocyte infiltration in the hearts. The results showed that 80% (8/10) of the cases had subclinical inflammation in the hearts (grading of WBC scans ≥score 2), and a positive correlation (R=0.77) was noted between the severity of the inflammation (grading of the WBC scans) and the duration of the cardiopulmonary bypass in the operations. Another control group (9 boys and 2 girls, aged 2-13 years old) underwent operations without a cardiopulmonary bypass, and subclinical inflammation of hearts was demonstrated in only 1 case (9%) by the 99m Tc-HMPAO labelled WBC scans (grading of WBC scans 99m Tc-HMPAO labelled WBC heart scans may provide non-invasive and directly discernible evidence of subclinical inflammation in the heart due to a transient ischaemic state during a cardiopulmonary bypass, even if the clinical symptoms and signs of carditis are not apparent. (orig.)

  3. Elevated white cell count in acute coronary syndromes: relationship to variants in inflammatory and thrombotic genes

    Directory of Open Access Journals (Sweden)

    Cannon Christopher P

    2004-06-01

    Full Text Available Abstract Background Elevated white blood cell counts (WBC in acute coronary syndromes (ACS increase the risk of recurrent events, but it is not known if this is exacerbated by pro-inflammatory factors. We sought to identify whether pro-inflammatory genetic variants contributed to alterations in WBC and C-reactive protein (CRP in an ACS population. Methods WBC and genotype of interleukin 6 (IL-6 G-174C and of interleukin-1 receptor antagonist (IL1RN intronic repeat polymorphism were investigated in 732 Caucasian patients with ACS in the OPUS-TIMI-16 trial. Samples for measurement of WBC and inflammatory factors were taken at baseline, i.e. Within 72 hours of an acute myocardial infarction or an unstable angina event. Results An increased white blood cell count (WBC was associated with an increased C-reactive protein (r = 0.23, p 3 (95% CI = -0.41, 0.77, and -0.03/mm3 (95% CI = -0.55, 0.86 for IL1RN. Moreover, the composite endpoint was not significantly affected by an interaction between WBC and the IL1 (p = 0.61 or IL6 (p = 0.48 genotype. Conclusions Cytokine pro-inflammatory genetic variants do not influence the increased inflammatory profile of ACS patients.

  4. Systemic inflammation in 222.841 healthy employed smokers and nonsmokers: white blood cell count and relationship to spirometry.

    Science.gov (United States)

    Fernández, José Antonio Fiz; Prats, Josép Morera; Artero, José Vicente Monsonis; Mora, Alberto Calvo; Fariñas, Anna Vazquez; Espinal, Anna; Méndez, José Antonio Gelpi

    2012-05-21

    Smoking has been linked to low-grade systemic inflammation, a known risk factor for disease. This state is reflected in elevated white blood cell (WBC) count. We analyzed the relationship between WBC count and smoking in healthy men and women across several age ranges who underwent preventive medical check-ups in the workplace. We also analysed the relationship between smoking and lung function. Cross-sectional descriptive study in 163 459 men and 59 382 women aged between 16 and 70 years. Data analysed were smoking status, WBC count, and spirometry readings. Total WBC showed higher counts in both male and female smokers, around 1000 to 1300 cell/ml (t test, P Smokers with airway obstruction measured by FEV1% were found to have higher WBC counts, in comparison to smokers with a normal FEV1% among similar age and BMI groups. Smoking increases WBC count and affects lung function. The effects are evident across a wide age range, underlining the importance of initiating preventive measures as soon as an individual begins to smoke.

  5. Genome-wide association study of white blood cell count in 16,388 African Americans: the continental origins and genetic epidemiology network (COGENT.

    Directory of Open Access Journals (Sweden)

    Alexander P Reiner

    2011-06-01

    Full Text Available Total white blood cell (WBC and neutrophil counts are lower among individuals of African descent due to the common African-derived "null" variant of the Duffy Antigen Receptor for Chemokines (DARC gene. Additional common genetic polymorphisms were recently associated with total WBC and WBC sub-type levels in European and Japanese populations. No additional loci that account for WBC variability have been identified in African Americans. In order to address this, we performed a large genome-wide association study (GWAS of total WBC and cell subtype counts in 16,388 African-American participants from 7 population-based cohorts available in the Continental Origins and Genetic Epidemiology Network. In addition to the DARC locus on chromosome 1q23, we identified two other regions (chromosomes 4q13 and 16q22 associated with WBC in African Americans (P<2.5×10(-8. The lead SNP (rs9131 on chromosome 4q13 is located in the CXCL2 gene, which encodes a chemotactic cytokine for polymorphonuclear leukocytes. Independent evidence of the novel CXCL2 association with WBC was present in 3,551 Hispanic Americans, 14,767 Japanese, and 19,509 European Americans. The index SNP (rs12149261 on chromosome 16q22 associated with WBC count is located in a large inter-chromosomal segmental duplication encompassing part of the hydrocephalus inducing homolog (HYDIN gene. We demonstrate that the chromosome 16q22 association finding is most likely due to a genotyping artifact as a consequence of sequence similarity between duplicated regions on chromosomes 16q22 and 1q21. Among the WBC loci recently identified in European or Japanese populations, replication was observed in our African-American meta-analysis for rs445 of CDK6 on chromosome 7q21 and rs4065321 of PSMD3-CSF3 region on chromosome 17q21. In summary, the CXCL2, CDK6, and PSMD3-CSF3 regions are associated with WBC count in African American and other populations. We also demonstrate that large inter

  6. Accuracy and feasibility of point-of-care white blood cell count and C-reactive protein measurements at the pediatric emergency department.

    Directory of Open Access Journals (Sweden)

    Lauri Ivaska

    Full Text Available Several point-of-care (POC tests are available for evaluation of febrile patients, but the data about their performance in acute care setting is sparse. We investigated the analytical accuracy and feasibility of POC tests for white blood cell (WBC count and C-reactive protein (CRP at the pediatric emergency department (ED.In the first part of the study, HemoCue WBC and Afinion AS100 CRP POC analyzers were compared with laboratory's routine WBC (Sysmex XE-2100 and CRP (Modular P analyzers in the hospital central laboratory in 77 and 48 clinical blood samples, respectively. The POC tests were then adopted in use at the pediatric ED. In the second part of the study, we compared WBC and CRP levels measured by POC and routine methods during 171 ED patient visits by 168 febrile children and adolescents. Attending physicians performed POC tests in capillary fingerprick samples.In parallel measurements in the laboratory both WBC and CRP POC analyzers showed good agreement with the reference methods. In febrile children at the emergency department (median age 2.4 years, physician performed POC determinations in capillary blood gave comparable results with those in venous blood analyzed in the laboratory. The mean difference between POC and reference test result was 1.1 E9/L (95% limits of agreement from -6.5 to 8.8 E9/L for WBC and -1.2 mg/L (95% limits of agreement from -29.6 to 27.2 mg/L for CRP.POC tests are feasible and relatively accurate methods to assess CRP level and WBC count among febrile children at the ED.

  7. Relationship between high white blood cell count and insulin resistance (HOMA-IR) in Korean children and adolescents: Korean National Health and Nutrition Examination Survey 2008-2010.

    Science.gov (United States)

    Park, J-M; Lee, D-C; Lee, Y-J

    2017-05-01

    Increasing evidence has indicated that insulin resistance is associated with inflammation. However, few studies have investigated the association between white blood cell (WBC) count and insulin resistance, as measured by a homeostasis model assessment of insulin resistance (HOMA-IR) in a general pediatric population. This study aimed to examine the association between WBC count and insulin resistance as measured by HOMA-IR in a nationally representative sample of children and adolescents. In total, 2761 participants (1479 boys and 1282 girls) aged 10-18 years were selected from the 2008-2010 Korean National Health and Nutrition Examination Survey. Insulin resistance was defined as a HOMA-IR value greater than the 90th percentile. The odds ratios and 95% confidence intervals for insulin resistance were determined using multiple logistic regression analysis. The mean values of most cardiometabolic variables tended to increase proportionally with WBC count quartiles. The prevalence of insulin resistance significantly increased in accordance with WBC count quartiles in both boys and girls. Compared to individuals in the lowest WBC count quartile, the odds ratio for insulin resistance for individuals in the highest quartile was 2.84 in boys and 3.20 in girls, after adjusting for age, systolic blood pressure, body mass index, and waist circumference. A higher WBC count was positively associated with an increased risk of insulin resistance in Korean children and adolescents. This study suggests that WBC count could facilitate the identification of children and adolescents with insulin resistance. Copyright © 2017 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  8. Leukopenia associated with long-term colchicine administration.

    Science.gov (United States)

    Beggs, Ashton E; Reeves, David J; Noel, Nancy S

    2012-12-15

    A case of leukopenia in a patient receiving colchicine for calcium pyrophosphate dihydrate deposition disease, or pseudogout, is reported. An 85-year-old man experienced leukopenia likely due to colchicine. His medical history included chronic lymphocytic leukemia (CLL), pseudogout, osteoarthritis, and hypertension. In February 2011, his white blood cell (WBC) count was 2700 cells/μL, and his absolute neutrophil count (ANC) was 2200 cells/μL. Colchicine 0.6 mg orally daily was initiated in March for the prophylaxis of pseudogout. His WBC count decreased, and his colchicine dosage was reduced to 0.6 mg every other day. Despite this decreased dosage, his WBC count and ANC were 600 and 100 cells/μL, respectively, in September. In October, the patient received chemotherapy for presumed worsening of his CLL. One month later, his WBC count and ANC were 400 and 200 cells/μL, respectively. Subcutaneous filgrastim was administered, and colchicine was discontinued. At the end of November, he received another cycle of chemotherapy followed by pegfilgrastim. On the day of pegfilgrastim administration, the patient's WBC count and ANC were 2000 and 1300 cells/μL, respectively. Two weeks later, his WBC count was 8800 cells/μL, and his ANC was 8300 cells/μL. Daily colchicine was restarted at the end of December. Two months later, his WBC count and ANC were 800 and 500 cells/μL, respectively. Given the symptomatic relief with colchicine, therapy was continued with close monitoring. A patient with CLL developed leukopenia in association with colchicine administration for pseudogout.

  9. Improving diagnosis of acute appendicitis with atypical findings by Tc-99m HMPAO leukocyte scan

    Energy Technology Data Exchange (ETDEWEB)

    Shung-Shung, S.; Kao, A. [China Medical Coll. Hospital, Taichung (Taiwan). Dept. of Nuclear Medicine; Yu-Chien, S. [Dept. of Nuclear Medicine, Far Eastern Memorial Hospital, National Taiwan Univ., Taipei (Taiwan); Inst. of Biomedical Engineering, Coll. of Electrical Engineering, National Taiwan Univ., Taipei (Taiwan); Mei-Due, Y.; Hwei-Chung, W. [Dept. of Surgery, China Medical Coll. Hospital, Taichung (Taiwan)

    2002-02-01

    Aim: Even with careful observation, the overall false-positive rate of laparotomy remains 10-15% when acute appendicitis was suspected. Therefore, the clinical efficacy of Tc-99m HMPAO labeled leukocyte (TC-WBC) scan for the diagnosis of acute appendicitis in patients presenting with atypical clinical findings is assessed. Patients and Methods: Eighty patients presenting with acute abdominal pain and possible acute appendicitis but atypical findings were included in this study. After intravenous injection of TC-WBC, serial anterior abdominal/pelvic images at 30, 60, 120 and 240 min with 800 k counts were obtained with a gamma camera. Any abnormal localization of radioactivity in the right lower quadrant of the abdomen, equal to or greater than bone marrow activity, was considered as a positive scan. Results: 36 out of 49 patients showing positive TC-WBC scans received appendectomy. They all proved to have positive pathological findings. Five positive TC-WBC were not related to acute appendicitis, because of other pathological lesions. Eight patients were not operated and clinical follow-up after one month revealed no acute abdominal condition. Three of 31 patients with negative TC-WBC scans received appendectomy. They also presented positive pathological findings. The remaining 28 patients did not receive operations and revealed no evidence of appendicitis after at least one month of follow-up. The overall sensitivity, specificity, accuracy, positive and negative predictive values for TC-WBC scan to diagnose acute appendicitis were 92, 78, 86, 82, and 90%, respectively. Conclusion: TC-WBC scan provides a rapid and highly accurate method for the diagnosis of acute appendicitis in patients with equivocal clinical examination. It proved useful in reducing the false-positive rate of laparotomy and shortens the time necessary for clinical observation. (orig.)

  10. Characteristics of Febrile Patients with Normal White Blood Cell Counts and High C-Reactive Protein Levels in an Emergency Department

    Directory of Open Access Journals (Sweden)

    Kuan-Ting Liu

    2008-05-01

    Full Text Available Fever is one of the more common chief complaints of patients who visit emergency departments (ED. Many febrile patients have markedly elevated C-reactive protein (CRP levels and normal white blood cell (WBC counts. Most of these patients have bacterial infection and no previous underlying disease of impaired WBC functioning. We reviewed patients who visited our ED between November 2003 and July 2004. The WBC count and CRP level of patients over 18 years of age who visited the ED because of or with fever were recorded. Patients who had normal WBC count (4,000–10,000/mL and high CRP level (> 100 mg/L were included. The data, including gender, age and length of hospital stay, were reviewed. Underlying diseases, diagnosis of the febrile disease and final condition were recorded according to the chart. Within the study period, 54,078 patients visited our ED. Of 5,628 febrile adults, 214 (3.8% had elevated CRP level and normal WBC count. The major cause of febrility was infection (82.24%. Most of these patients were admitted (92.99%. There were 32 patients with malignant neoplasm, nine with liver cirrhosis, 66 with diabetes mellitus and 11 with uremia. There were no significant differences in age and gender between patients with and those without neoplasm. However, a higher inhospital mortality rate and other causes of febrility were noted in patients with neoplasm. It was not rare in febrile patients who visited the ED to have a high CRP level but normal WBC count. These patients did not necessarily have an underlying malignant neoplasm or hematologic illness. Factors other than malignant neoplasm or hematologic illness may be associated with the WBC response, and CRP may be a better indicator of infection under such conditions.

  11. Vaginal Fornix Discharge Cellularity and Its Leukocyte Esterase Activity for Diagnosis of Endometritis in Dairy Cows

    Directory of Open Access Journals (Sweden)

    Abolfazl HAJIBEMANI

    2016-01-01

    Full Text Available The objective of the present study was to evaluate the application of some strip test markers (i.e., leukocyte esterase (LE activity, protein, nitrate and pH for diagnosis of endometritis in dairy cows using vaginal fornix discharge. Also, the total white blood cell count (t-WBC/l of this secretion and degenerative changes of neutrophils in cervical cytology were used as alternative methods to predict progression of the endometritis severity. Holstein cows (n=215 between 30-40 days in milk (DIM were included and examined. Giemsa-stained smear was prepared from cervical mucus. Cervical cytology test was considered as reference screening method for the detection of subclinical endometritis. The LE activity and t-WBC in the vaginal fornix discharge of subclinical endometritis cows were significantly higher than those from healthy cows. Sensitivity and specificity were 78% and 73% for LE10 activity (10 minutes after contacting with discharges and 60% and 69% for t-WBC (cut off point=210 cells/l for diagnosis of subclinical endometritis, respectively. There was a good agreement between LE10 activity, t-WBC and cervical cytology test with a Kappa coefficient of 0.4 and 0.42, respectively (P<0.0001. Total WBC count in discharge and degenerative neutrophils (DN percentages increase simultaneously with the degree and severity of endometritis. There was a highly significant (P<0.01 correlation between t-WBC and some reagent strip test markers (LE activity, protein and nitrate in clear discharge of studied cows. In conclusion, the present results suggest the LE activity and t-WBC in vaginal fornix discharge could be used as non-invasive reliable and valid methods for screening of subclinical endometritis in postpartum dairy herds.

  12. Improved Early Detection of Sepsis in the ED With a Novel Monocyte Distribution Width Biomarker.

    Science.gov (United States)

    Crouser, Elliott D; Parrillo, Joseph E; Seymour, Christopher; Angus, Derek C; Bicking, Keri; Tejidor, Liliana; Magari, Robert; Careaga, Diana; Williams, JoAnna; Closser, Douglas R; Samoszuk, Michael; Herren, Luke; Robart, Emily; Chaves, Fernando

    2017-09-01

    Sepsis most often presents to the ED, and delayed detection is harmful. WBC count is often used to detect sepsis, but changes in WBC count size also correspond to sepsis. We sought to determine if volume increases of circulating immune cells add value to the WBC count for early sepsis detection in the ED. A blinded, prospective cohort study was conducted in two different ED populations within a large academic hospital. Neutrophil and monocyte volume parameters were measured in conjunction with routine CBC testing on a UniCel DxH 800 analyzer at the time of ED admission and were evaluated for the detection of sepsis. There were 1,320 subjects in the ED consecutively enrolled and categorized as control subjects (n = 879) and those with systemic inflammatory response syndrome (SIRS) (n = 203), infection (n = 140), or sepsis (n = 98). Compared with other parameters, monocyte distribution width (MDW) best discriminated sepsis from all other conditions (area under the curve [AUC], 0.79; 95% CI, 0.73-0.84; sensitivity, 0.77; specificity, 0.73; MDW threshold, 20.50), sepsis from SIRS (AUC, 0.74; 95% CI, 0.67-0.84), and severe sepsis from noninfected patients in the ED (AUC, 0.88; 95% CI, 0.75-0.99; negative predictive value, 99%). The added value of MDW to WBC count was statistically significant (AUC, 0.89 for MDW + WBC vs 0.81 for WBC alone; P sepsis compared with WBC count alone at the time of admission in the ED. ClinicalTrials.gov; No.: NCT02232750; URL: www.clinicaltrials.gov. Copyright © 2017 American College of Chest Physicians. Published by Elsevier Inc. All rights reserved.

  13. Hematopoietic diseases

    International Nuclear Information System (INIS)

    Dohi, Hiroo

    1992-01-01

    A-bombing panicked many people with anxiety because they suffered from various symptoms after A-bombing (ie, they generally called them A-bomb disease). In this chapter, major two conditions (ie, leukopenia and anemia), which caused their symptoms, are reviewed based on the early data soon after A-bombing. According to the chronological changes in both white blood cell (WBC) and red blood cell (RBC) counts, both leukopenia and anemia are discussed. The findings can be divided into acute (one week or at least 10 days), subacute (2 weeks to one month), and delayed (thereafter) periods. During an acute period, some exposed even at ≤200 m from the hypocenter showed WBC count of 6,000/mm 3 or more one week after exposure but others exposed at 1,500-2,000 m showed WBC count of less than 3,000/mm 3 , suggesting the influence of shielding on WBC count. WBC count sometimes became the lowest during a subacute period, although it was normal during an acute period. A survey for WBC count during a delayed period (one year later) showed that WBC count of less than 4,000/mm 3 was more frequent in the exposed group (78/523 A-bomb survivors, 14.9%) than the non-exposed group (6/173 persons, 3.5%). In the exposed group, leukopenia was independent of distance and symptoms at the time of exposure. For anemia, there was no data available during an acute period. Anemia frequently occurred during a subacute period. Morphological abnormality of RBC tended to be high in death cases. A delayed survey on anemia 10 years after exposure showed that there was no statistically significant difference in any of the factors, such as hemoglobin, RBC count, hematocrit, mean corpuscular volume and mean corpuscular hemoglobin, between the exposed and non-exposed groups. (N.K.)

  14. Does whole-body cryotherapy improve vertical jump recovery following a high-intensity exercise bout?

    Directory of Open Access Journals (Sweden)

    Vieira A

    2015-02-01

    Full Text Available Amilton Vieira,1 Martim Bottaro,1 Joao B Ferreira-Junior,1,4 Carlos Vieira,1 Vitor A Cleto,1 Eduardo L Cadore,2 Herbert G Simões,3 Jake Do Carmo,1 Lee E Brown5 1College of Physical Education, University of Brasília, Brasília, 2College of Physical Education, Federal University of Rio Grande do Sul (UFRGS, Porto Alegre, 3College of Physical Education, Catholic University of Brasília, Brasília, 4Federal Institute of Triângulo Mineiro, Paracatu, Brazil; 5Department of Kinesiology, California State University, Fullerton, CA, USA Abstract: Whole-body cryotherapy (WBC has been used as a recovery strategy following different sports activities. Thus, the aim of the study reported here was to examine the effect of WBC on vertical jump recovery following a high-intensity exercise (HIE bout. Twelve trained men (mean ± standard deviation age = 23.9±5.9 years were randomly exposed to two different conditions separated by 7 days: 1 WBC (3 minutes of WBC at −110°C immediately after the HIE and 2 control (CON; no WBC after the HIE. The HIE consisted of six sets of ten repetitions of knee extensions at 60° · s−1 concentric and 180° · s−1 eccentric on an isokinetic dynamometer. The vertical jump test was used to evaluate the influence of HIE on lower extremity muscular performance. The vertical jump was performed on a force platform before HIE (T1 and 30 minutes after (T2 the WBC and CON conditions. As a result of HIE, jump height, muscle power, and maximal velocity (Vmax had significant decreases between T1 and T2, however no significance was found between the WBC and CON conditions. The results indicate that one session of WBC had no effect on vertical jump following an HIE compared with a CON condition. WBC may not improve muscle-function (dependent on stretch-shortening cycle recovery in very short periods (ie, 30 minutes following HIE. Keywords: functional performance, muscular recovery, countermovement jump

  15. Correlation of circulating MMP-9 with white blood cell count in humans: effect of smoking.

    Directory of Open Access Journals (Sweden)

    Soren Snitker

    Full Text Available Matrix metalloproteinase-9 (MMP-9 is an emerging biomarker for several disease conditions, where white blood cell (WBC count is also elevated. In this study, we examined the relationship between MMP-9 and WBC levels in apparently healthy smoking and non-smoking human subjects.We conducted a cross-sectional study to assess the relationship of serum MMP-9 with WBC in 383 men and 356 women. Next, we divided the male population (women do not smoke in this population into three groups: never (n = 243, current (n = 76 and former (n = 64 smokers and compared the group differences in MMP-9 and WBC levels and their correlations within each group.Circulating MMP-9 and WBC count are significantly correlated in men (R(2 = 0.13, p<0.001 and women (R(2 = 0.19, p<0.001. After stratification by smoking status, MMP-9 level was significantly higher in current smokers (mean ± SE; 663.3±43.4 ng/ml, compared to never (529.7±20.6 and former smokers (568±39.3. WBC count was changed in a similar pattern. Meanwhile, the relationship became stronger in current smokers with increased correlation coefficient of r = 0.45 or R(2 = 0.21 (p<0.001 and steeper slope of ß = 1.16±0.30 (p<0.001 in current smokers, compared to r = 0.26 or R(2 = 0.07 (p<0.001 and ß = 0.34±0.10 (p<0.001 in never smokers.WBC count accounts for 13% and 19% of MMP-9 variance in men and women, respectively. In non-smoking men, WBC count accounts for 7% of MMP-9 variance, but in smoking subjects, it accounts for up to 21% of MMP-9 variance. Thus, we have discovered a previously unrecognized correlation between the circulating MMP-9 and WBC levels in humans.

  16. Changes in reticulocyte in 2 patients with acute radiation sickness

    International Nuclear Information System (INIS)

    Huang Yuan; Chen Jiankui; Zheng Naxin; Kang Shuwei; Jin Xin

    2007-01-01

    Objective: To assess the clinical value of routine blood and reticulocyte parameters in acute radiation sickness(ARS). Methods: Two patients with ARS were analyzed. White blood cell count (WBC), red blood cell count (RBC), platelet count (Plt), reticulocyte count (RET), absolute reticulocyte count, immature reticulocyte fraction (IRF), high fluorescence reticulocytes (HFR), middle fluorescence reticulocytes (MFR), and low fluorescence reticulocytes (LFR) were measured using Sysmex XT-2000i automatic hematology analyzer. Results: During early days after exposure, an increase in WBC, decrease in lymphocyte count, RET and absolute RET were observed, HFR and IRF were zero. After hematopoietic stem cell transplantation, HFR and IRF recovered at first, 1 day before the rise in WBC, 2 days before the rise in RET and absolute RET, and 3 days before the rise in Plt. Conclusion: During early days, WBC, lymphocyte count, RET and absolute RET are related to radiation dose. The rises of WBC, HFR and IRF can reflect marrow recovery after hematopoietic stem cell transplantation in ARS. (authors)

  17. Laser-photophoretic migration and fractionation of human blood cells

    International Nuclear Information System (INIS)

    Monjushiro, Hideaki; Tanahashi, Yuko; Watarai, Hitoshi

    2013-01-01

    Graphical abstract: -- Highlights: •RBCs were migrated faster than WBCs and blood pellets by laser photophoresis. •Photophoretic efficiency of RBC and WBC was simulated by the Mie scattering theory. •Spontaneous orientation of RBC parallel to the migration direction was elucidated. •Laser photophoretic separation of RBC and WBC was possible in a tip flow system. -- Abstract: Laser photophoretic migration behavior of human blood cells in saline solution was investigated under the irradiation of Nd:YAG laser beam (532 nm) in the absence and the presence of the flow in a fused silica capillary. Red blood cells (RBC) were migrated faster than white blood cells (WBC) and blood pellets to the direction of propagation of laser light. The observed photophoretic velocity of RBC was about 11 times faster than those of others. This was understood from the larger photophoretic efficiency of RBC than that of WBC, which was simulated based on the Mie scattering theory. Furthermore, it was found that, during the photophoretic migration, RBCs spontaneously orientated parallel to the migration direction so as to reduce the drag force. Finally, it was demonstrated that RBC and WBC were separated in a micro-channel flow system by the laser photophoresis

  18. Laser-photophoretic migration and fractionation of human blood cells

    Energy Technology Data Exchange (ETDEWEB)

    Monjushiro, Hideaki; Tanahashi, Yuko; Watarai, Hitoshi, E-mail: watarai@chem.sci.osaka-u.ac.jp

    2013-05-13

    Graphical abstract: -- Highlights: •RBCs were migrated faster than WBCs and blood pellets by laser photophoresis. •Photophoretic efficiency of RBC and WBC was simulated by the Mie scattering theory. •Spontaneous orientation of RBC parallel to the migration direction was elucidated. •Laser photophoretic separation of RBC and WBC was possible in a tip flow system. -- Abstract: Laser photophoretic migration behavior of human blood cells in saline solution was investigated under the irradiation of Nd:YAG laser beam (532 nm) in the absence and the presence of the flow in a fused silica capillary. Red blood cells (RBC) were migrated faster than white blood cells (WBC) and blood pellets to the direction of propagation of laser light. The observed photophoretic velocity of RBC was about 11 times faster than those of others. This was understood from the larger photophoretic efficiency of RBC than that of WBC, which was simulated based on the Mie scattering theory. Furthermore, it was found that, during the photophoretic migration, RBCs spontaneously orientated parallel to the migration direction so as to reduce the drag force. Finally, it was demonstrated that RBC and WBC were separated in a micro-channel flow system by the laser photophoresis.

  19. Comparative Value of Simple Inflammatory Markers in the Prediction of Left Ventricular Systolic Dysfunction in Postacute Coronary Syndrome Patients

    Directory of Open Access Journals (Sweden)

    Panagiotis Aggelopoulos

    2009-01-01

    Full Text Available Objectives. We sought to assess the comparative value of inflammatory markers on the occurrence of left ventricular systolic dysfunction (LVSD after an acute coronary syndrome (ACS. Methods. During 2006–2008, 760 patients with an ACS were enrolled. C-reactive protein (CRP and white blood cell (WBC count were measured during the first 12 hours of hospital admission. Results. CRP levels and WBC count were significantly higher in those who developed LVSD compared to those who did not. The analysis revealed that a 10 mg/dL increase of CRP levels and a 1000/L increase in WBC are associated with a 6% and a 7% increase in the likelihood of developing LVSD, respectively. Furthermore, WBC count at entry and CRP have almost the same predictive value for development of LVSD after an ACS (2=0.109 versus 2=0.093. Conclusions. Serum CRP levels and WBC count at entry are almost equally powerful independent predictors of LVSD, after an ACS.

  20. Drain amylase aids detection of anastomotic leak after esophagectomy.

    Science.gov (United States)

    Baker, Erin H; Hill, Joshua S; Reames, Mark K; Symanowski, James; Hurley, Susie C; Salo, Jonathan C

    2016-04-01

    Anastomotic leak following esophagectomy is associated with significant morbidity and mortality. As hospital length of stay decreases, the timely diagnosis of leak becomes more important. We evaluated CT esophagram, white blood count (WBC), and drain amylase levels in the early detection of anastomotic leak. The diagnostic performance of CT esophagram, drain amylase >800 IU/L, and WBC >12,000/µL within the first 10 days after surgery in predicting leak at any time after esophagectomy was calculated. Anastomotic leak occurred in 13 patients (13%). CT esophagram performed within 10 days of surgery diagnosed six of these leaks with a sensitivity of 0.54. Elevation in drain amylase level within 10 days of surgery diagnosed anastomotic leak with a sensitivity of 0.38. When the CT esophagram and drain amylase were combined, the sensitivity rose to 0.69 with a specificity of 0.98. WBC elevation had a sensitivity of 0.92, with a specificity of 0.34. Among 30 patients with normal drain amylase and a normal WBC, one developed an anastomotic leak. Drain amylase adds to the sensitivity of CT esophagram in the early detection of anastomotic leak. Selected patients with normal drain amylase levels and normal WBC may be able to safely forgo CT esophagram.

  1. Effects of whole-body cryotherapy in the management of adhesive capsulitis of the shoulder.

    Science.gov (United States)

    Ma, Sang-Yeol; Je, Hyun Dong; Jeong, Ji Hoon; Kim, Hae-Young; Kim, Hyeong-Dong

    2013-01-01

    To compare 2 different treatment approaches, physical therapy modalities, and joint mobilization versus whole-body cryotherapy (WBC) combined with physical therapy modalities and joint mobilization, for symptoms of adhesive capsulitis (AC) of the shoulder. A randomized trial. Hospital. Patients with AC of the shoulder (N=30). Patients were randomly assigned to 2 groups. The WBC group received physical therapy modalities, passive joint mobilization of the shoulder, and WBC, whereas the non-WBC group received only physical therapy modalities and passive joint mobilization of the shoulder. Visual analog scale (VAS), active range of motion (ROM) of flexion, abduction, internal and external rotation of the shoulder, and the American Shoulder and Elbow Surgeons Standardized Shoulder Assessment Form (ASES) were measured before and after the intervention. A statistically significant difference between groups was found for the VAS, active ROM of flexion, abduction, internal rotation, and external rotation, and the ASES with greater improvements in the WBC group (PsRehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  2. Can Whole-Body Cryotherapy with Subsequent Kinesiotherapy Procedures in Closed Type Cryogenic Chamber Improve BASDAI, BASFI, and Some Spine Mobility Parameters and Decrease Pain Intensity in Patients with Ankylosing Spondylitis?

    Science.gov (United States)

    Stanek, Agata; Cholewka, Armand; Gadula, Jolanta; Drzazga, Zofia; Sieron, Aleksander; Sieron-Stoltny, Karolina

    2015-01-01

    The present study investigated whether whole-body cryotherapy (WBC) procedures could potentially have more beneficial effects on index of BASDAI and BASFI, pain intensity, and spine mobility parameters: Ott test, modified Schober test, chest expansion in ankylosing spondylitis (AS) patients, than kinesiotherapy procedures used separately. AS patients were exposed to a cycle of WBC procedures lasting 3 minutes a day, with a subsequent 60 minutes of kinesiotherapy or 60 minutes of kinesiotherapy only, for 10 consecutive days excluding weekend. After the completion of the cycle of WBC procedures with subsequent kinesiotherapy in the AS patients, BASDAI index decreased about 40% in comparison with the input value, whereas in the group of patients who received only kinesiotherapy it decreased only about 15% in comparison with the input value. After the completion of the treatment in the WBC group, BASFI index decreased about 30% in comparison with the input value, whereas in the kinesiotherapy group it only decreased about 16% in comparison with the input value. The important conclusion was that, in WBC group with subsequent kinesiotherapy, we observed on average about twice better results than in the group treated only by kinesiotherapy. PMID:26273618

  3. Effect of Whole-Body Cryotherapy on Antioxidant Systems in Experimental Rat Model

    Directory of Open Access Journals (Sweden)

    Bronisława Skrzep-Poloczek

    2017-01-01

    Full Text Available Background. The purpose of this study was to verify the effect of whole-body cryotherapy (WBC in rats on their antioxidant systems, lipid peroxidation products, and their total oxidative status at different exposure times and temperatures. Methods. Antioxidants in serum, plasma, liver, and erythrocytes were evaluated in two study groups following 1 min of exposure to −60°C and −90°C, for 5 and 10 consecutive days. Results. WBC increased the activity of superoxide dismutase, catalase in the group subjected to 5 and 10 days exposure, −60°C. The glutathione S-transferase activity increased in the groups subjected to 10 days WBC sessions. Total antioxidant capacity increased after 5 and 10 days of 1 min WBC, −60°C; a decrease was observed at −90°C. A decreased level of erythrocyte malondialdehyde concentration was observed at −60°C after 5 and 10 days of cryostimulation. An increased concentration was measured at −90°C after 10 days, and increase of erythrocyte malondialdehyde concentration after 5 days, −90°C. Conclusions. To the best of our knowledge, this is the first research showing the effect of WBC in rats at different exposure times and temperatures. The effect of cryotherapy on enzymatic and nonenzymatic antioxidant systems was observed in the serum of animals exposed to a temperature of −60°C in comparison to control.

  4. Effect of anabolic steroid on the recovery of white blood cell count after irradiation

    International Nuclear Information System (INIS)

    Yamagishi, Motohisa; Niki, Takamichi; Hiraoka, Atsunobu; Uchino, Haruto

    1979-01-01

    In order to observe the effects of nandrolone decanoate (NAN-D), an anabolic steroid, on granulocytes, its effect on the recovery of white blood cells (WBC) and granulocytes after radiation injuries was studied. Male mice were irradiated with 405 to 410 R of γ rays, and a 2.5 mg/dose of NAN-D was given subcutaneously 6 to 7 days after irradiation (group I) or immediately after irradiation (group II). The degree of decrease in WBC after irradiation was the same in both groups, but the recovery of WBC 18 days after irradiation was marked in group II, the control group, and group I, respectively. The recovery of granulocytes was the most marked in group II and was more marked in group I than in the control group. In an experiment in which NAN-D was given 2 to 3 days before irradiation (group III), WBC showed higher values in group III than in the control group 9 days after irradiation. The difference in WBC between group III and the control group was the greatest 17 days after irradiation. A gross count of granulocyte precursor cells in one femur clearly increased in the groups given this agent. (Tsunoda, M.)

  5. Correlation of the leucocyte count with traditional and non-traditional components of metabolic syndrome.

    Science.gov (United States)

    Su, Bai-Yu; Tian, Chun-Feng; Gao, Bu-Lang; Tong, Yu-Hong; Zhao, Xu-Hong; Zheng, Ying

    2016-11-01

    To investigate correlation of the white blood cell (WBC) and its subtype count with the traditional and non-traditional components of the metabolic syndrome. Between January 2012 and December 2013, 18,222 people were enrolled in this study. The height, weight, body mass index (BMI) and blood pressure were measured, and blood samples were tested for all subjects after an overnight fast. The count of WBC and its subtypes, total cholesterol, triglyceride, high density lipoprotein (HDL), low-density lipoprotein, aminotransferases, fibrinogen, uric acid, and fasting blood glucose were all assessed. Metabolic syndrome was found in 2502 of 18,222 healthy Chinese people (16.41%). The prevalence of metabolic syndrome was 22.61% for men significantly (P metabolic syndrome. With increase of the WBC count, BMI, systolic and diastolic pressure, fasting blood glucose, triglyceride, glutamic-oxaloacetic transaminase, glutamic-pyruvic transaminase, glutamyltranspetidase, blood urea nitrogen fibrinogen and uric acid all went up significantly (P creatinine remained relatively sTable After adjustment of age, sex, alcoholic drinking and education, the metabolic components of obesity, hypertension, diabetes and hyperlipidemia rose significantly (P metabolic syndrome. Aminotransferases, fibrinogen and uric acid all significantly increase with increased WBC count in a dose-dependent manner. Increased counts of the total WBC and its subtypes are positively associated with presence of metabolic syndrome.

  6. Comparison of three methods of exposing rats to cigarette smoke

    International Nuclear Information System (INIS)

    Mauderly, J.L.; Bechtold, W.E.; Bond, J.A.; Brooks, A.L.; Chen, B.T.; Cuddihy, R.G.; Harkema, J.R.; Henderson, R.F.; Johnson, N.F.; Ritchideh, K.; Thomassen, D.G.

    1988-01-01

    We compared smoke composition and biological effects resulting from exposures of rats for 5 wk to cigarette smoke by nose-only intermittent (NOI), nose-only continuous (NOC) and whole-body continuous (WBC) exposure methods. Exposure concentrations and times were adjusted to achieve the same daily concentration x time product for particulate matter. There were few differences in smoke composition or biological effects among exposure modes. WBC smoke was lower in particle-borne nicotine and higher in some organic vapors and carbon monoxide than smoke in nose-only modes. Body weight was depressed less by WBC than by NOI or NOC exposures. Plasma and urine nicotine levels were higher for WBC than for NOI or NOC, suggesting greater absorption from body surfaces or by grooming. Smoke exposures increased nasal epithelial proliferation, tracheal epithelial cell transformation, chromosomal aberrations in alveolar macrophages, and lung DNA adduct levels, and caused inflammatory changes in airway fluid and slight alterations of respiratory function, but there were no significant differences among exposure modes. The results indicate that WBC exposures should produce long-term effects similar to those of nose-only exposures, but might allow increased delivery of smoke to lungs while reducing stress, acute toxicity and the manpower requirements associated with performing these experiments. (author)

  7. CRP and leukocyte-count after lumbar spine surgery: fusion vs. nucleotomy.

    Science.gov (United States)

    Kraft, Clayton N; Krüger, Tobias; Westhoff, Jörn; Lüring, Christian; Weber, Oliver; Wirtz, Dieter C; Pennekamp, Peter H

    2011-08-01

    Despite the fact that C-reactive protein (CRP) levels and white blood cell (WBC) count are routine blood chemistry parameters for the early assessment of wound infection after surgical procedures, little is known about the natural history of their serum values after major and minimally invasive spinal procedures. Pre- and postoperative CRP serum levels and WBC count in 347 patients were retrospectively assessed after complication-free, single-level open posterior lumbar interlaminar fusion (PLIF) (n = 150) for disc degeneration and spinal stenosis and endoscopically assisted lumbar discectomy (n = 197) for herniated lumbar disc. Confounding variables such as overweight, ASA classification, arterial hypertension, diabetes mellitus, and perioperative antibiotics were recorded to evaluate their influence on the kinetics of CRP values and WBC count postoperatively. In both procedures, CRP peaked 2-3 days after surgery. The maximum CRP level was significantly higher after fusion: mean 127 (SD 57) (p 25 and long duration of surgery were associated with higher peak CRP values. WBC count did not show a typical and therefore interpretable profile. CRP is a predictable and responsive serum parameter in postoperative monitoring of inflammatory responses in patients undergoing spine surgery, whereas WBC kinetics is unspecific. We suggest that CRP could be measured on the day before surgery, on day 2 or 3 after surgery, and also between days 4 and 6, to aid in early detection of infectious complications.

  8. Comparison of fumonisin contamination using HPLC and ELISA methods in bt and near-isogenic maize hybrids infested with European corn borer or western bean cutworm.

    Science.gov (United States)

    Bowers, Erin; Hellmich, Richard; Munkvold, Gary

    2014-07-09

    Field trials were conducted from 2007 to 2010 to compare grain fumonisin levels among non-Bt maize hybrids and Bt hybrids with transgenic protection against manual infestations of European corn borer (ECB) and Western bean cutworm (WBC). HPLC and ELISA were used to measure fumonisin levels. Results of the methods were highly correlated, but ELISA estimates were higher. Bt hybrids experienced less insect injury, Fusarium ear rot, and fumonisin contamination compared to non-Bt hybrids. WBC infestation increased fumonisin content compared to natural infestation in non-Bt and hybrids expressing Cry1Ab protein in five of eight possible comparisons; in Cry1F hybrids, WBC did not impact fumonisins. These results indicate that WBC is capable of increasing fumonisin levels in maize. Under WBC infestation, Cry1F mitigated this risk more consistently than Cry1Ab or non-Bt hybrids. Transgenically expressed Bt proteins active against multiple lepidopteran pests can provide broad, consistent reductions in the risk of fumonisin contamination.

  9. Comparison of simultaneous 99mTc-HMPAO and 111In oxine labelled white cell scans in the assessment of inflammatory bowel disease

    International Nuclear Information System (INIS)

    Allan, R.A.; Bassingham, S.; Lazarus, C.; Clarke, S.E.M.; Fogelman, I.; Sladen, G.E.

    1993-01-01

    Forty-seven patients, 29 with chronic inflammatory bowel disease (IBD) and 18 with presumed irritable bowel syndrome, including one with uncomplicated diverticular disease, were studied with simultaneous technetium-99m hexamethylpropylene amine oxime and indium-III oxine labelled leucocyte scans performed at 1, 3 and 24 h. Twenty-seven patients with IBD had active disease as judged by clinical and laboratory criteria and all of these had positive scans with both agents. No false positive studies were obtained. The 1-h 99m Tc-HMPAO WBC scans showed the same distribution to disease as the 3-h 111 -In WBC scans, with no difference in intensity (P 111 -In scans. The 3-h 99m Tc-HMPAO WBC scans showed more extensive disease (P 111 In WBC scans. Physiological bowel activity on 3-h 99m Tc-HMPAO WBC scans was present in 12 patients but was faint and did not interfere with assessment of disease extent and activity. It is concluded that in terms of isotope availability, radiation dosimetry and image quality, 99m Tc-HMPAO is the agent of choice in detecting active IBD, with localization of disease possible at 1-h after re-injection and optimal resolution and definition of disease extent at 3 h. A negative scan reliably excludes active disease. (orig.)

  10. Global DNA methylation and oxidative stress biomarkers in workers exposed to metal oxide nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Liou, Saou-Hsing; Wu, Wei-Te; Liao, Hui-Yi [National Institute of Environmental Health Sciences, National Health Research Institutes, Zhunan, Miaoli County, Taiwan (China); Chen, Chao-Yu; Tsai, Cheng-Yen; Jung, Wei-Ting [Department of Chemistry, Fu Jen Catholic University, New Taipei City, Taiwan (China); Lee, Hui-Ling, E-mail: huilinglee3573@gmail.com [Department of Chemistry, Fu Jen Catholic University, New Taipei City, Taiwan (China)

    2017-06-05

    Highlights: • Global methylation and oxidative DNA damage levels in nanomaterial handling workers were assessed. • 8-isoprostane in exhaled breath condensate of workers exposed to nanoparticles was higher. • 8-OHdG was negatively correlated with global methylation. • Exposure to metal oxide nanoparticles may lead to global methylation and DNA oxidative damage. - Abstract: This is the first study to assess global methylation, oxidative DNA damage, and lipid peroxidation in workers with occupational exposure to metal oxide nanomaterials (NMs). Urinary and white blood cell (WBC) 8-hydroxydeoxyguanosine (8-OHdG), and exhaled breath condensate (EBC) 8-isoprostane were measured as oxidative stress biomarkers. WBC global methylation was measured as an epigenetic alteration. Exposure to TiO{sub 2}, SiO{sub 2,} and indium tin oxide (ITO) resulted in significantly higher oxidative biomarkers such as urinary 8-OHdG and EBC 8-isoprostane. However, significantly higher WBC 8-OHdG and lower global methylation were only observed in ITO handling workers. Significant positive correlations were noted between WBC and urinary 8-OHdG (Spearman correlation r = 0.256, p = 0.003). Furthermore, a significant negative correlation was found between WBC 8-OHdG and global methylation (r = −0.272, p = 0.002). These results suggest that exposure to metal oxide NMs may lead to global methylation, DNA oxidative damage, and lipid peroxidation.

  11. Exchange Transfusion and Leukapheresis in Pediatric Patients with AML With High Risk of Early Death by Bleeding and Leukostasis.

    Science.gov (United States)

    Creutzig, Ursula; Rössig, Claudia; Dworzak, Michael; Stary, Jan; von Stackelberg, Arend; Wössmann, Wilhelm; Zimmermann, Martin; Reinhardt, Dirk

    2016-04-01

    The risk of early death (ED) by bleeding/leukostasis is high in patients with AML with hyperleukocytosis (>100,000/μl). Within the pediatric AML-BFM (Berlin-Frankfurt-Münster) 98/04 studies, emergency strategies for these children included exchange transfusion (ET) or leukapheresis (LPh). Risk factors for ED and interventions performed were analyzed. Two hundred thirty-eight of 1,251 (19%) patients with AML presented with hyperleukocytosis; 23 of 1,251 (1.8%) patients died of bleeding/leukostasis. ED due to bleeding/leukostasis was highest at white blood cell (WBC) count >200,000/μl (14.3%). ED rates were even higher (20%) in patients with FAB (French-American-British) M4/M5 and hyperleukocytosis >200,000/μl. Patients with WBC >200,000/μl did slightly better with ET/LPh compared to those without ET/LPh (ED rate 7.5% vs. 21.2%, P = 0.055). Multivariate WBC >200,000/μl was of strongest prognostic significance for ED (P(χ(2) ) rate due to bleeding/leukostasis and is recommended at WBC >200,000/μl, and in FAB M4/M5 even at lower WBC. © 2015 Wiley Periodicals, Inc.

  12. Decreased sensitivity of the automatic white precursor cell channel (WPC) for blast flagging in patients with leukopenia.

    Science.gov (United States)

    Lee, Nuri; Jun, Ju Hyun; Lee, Dong Soon

    2016-06-01

    The advantage of Sysmex XN system is its performance of an automatic reflex test in white cell precursor (WPC) channel, which gives an accurate differential count. We performed a real-time evaluation of the automatic differential count according to WBC number with Sysmex XN series and demonstrated a significant differential impact on blast distinction depending on the number of WBC. We categorized the 49,699 specimen according to WBC number and compared the results of blast flagging in the white cell differential (WDF) channel and WPC channel on the basis of the results of manual differential count. Additionally, clinical impact of missed blasts after running WPC reflex test was analyzed. For patients with WBC under 1.5×10(9)/L, blast flagging for WPC channel showed markedly decreased sensitivity (56%) compared to that of WDF mode (100%). Most of the patients with missed blasts in WPC mode were under chemotherapy or hematopoietic stem cell transplantation. The specificity and efficiency for WPC channel were much higher than that of WDF mode in all range of WBC. Considering the additional reagent cost required for the WPC channel, WPC reflex test is not suitable for patients with leukopenia if it is operated alone. Instead, manual blood film review or double-check with other supplemental equipment should be accompanied. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  13. Whole body counter calibration using Monte Carlo modeling with an array of phantom sizes based on national anthropometric reference data

    Science.gov (United States)

    Shypailo, R. J.; Ellis, K. J.

    2011-05-01

    During construction of the whole body counter (WBC) at the Children's Nutrition Research Center (CNRC), efficiency calibration was needed to translate acquired counts of 40K to actual grams of potassium for measurement of total body potassium (TBK) in a diverse subject population. The MCNP Monte Carlo n-particle simulation program was used to describe the WBC (54 detectors plus shielding), test individual detector counting response, and create a series of virtual anthropomorphic phantoms based on national reference anthropometric data. Each phantom included an outer layer of adipose tissue and an inner core of lean tissue. Phantoms were designed for both genders representing ages 3.5 to 18.5 years with body sizes from the 5th to the 95th percentile based on body weight. In addition, a spherical surface source surrounding the WBC was modeled in order to measure the effects of subject mass on room background interference. Individual detector measurements showed good agreement with the MCNP model. The background source model came close to agreement with empirical measurements, but showed a trend deviating from unity with increasing subject size. Results from the MCNP simulation of the CNRC WBC agreed well with empirical measurements using BOMAB phantoms. Individual detector efficiency corrections were used to improve the accuracy of the model. Nonlinear multiple regression efficiency calibration equations were derived for each gender. Room background correction is critical in improving the accuracy of the WBC calibration.

  14. Water properties and structure of pork sausages as affected by high-pressure processing and addition of carrot fibre

    DEFF Research Database (Denmark)

    Møller, Sandie Mejer; Grossi, Alberto Blak; Christensen, Mette

    2011-01-01

    The effects of high-pressure processing (HPP) and addition of carrot fibre on pork sausages have been studied using NMR T(2) relaxometry and measurements of water-binding capacity (WBC) by centrifugation. Significant effects of temperature (raw, 40, 50, or 60°C), holding time (1s, 3, 6, or 9min......), and addition of carrot fibre on the distribution and mobility of water were found. However, the effect of carrot fibre could not be explained by structural changes in the sausages when examined by confocal laser scanning microscopy (CLSM). Correlations between T(2) relaxation measurements and WBC determined...... by centrifugation revealed that T(2) relaxation times were able to explain more than 90% of the variation in WBC for both non-pressure and pressure-treated sausages. However, only 49% of the variation was explained for pressure-treated sausages with carrot fibre, indicating that combining addition of fibre and high...

  15. C-reactive protein and white blood cell levels in schizophrenia, bipolar disorders and depression - associations with mortality and psychiatric outcomes

    DEFF Research Database (Denmark)

    Horsdal, H T; Köhler-Forsberg, O; Benros, Michael E

    2017-01-01

    BACKGROUND: Mental disorders have been associated with increased levels of inflammatory markers, which can affect disease trajectories. We aimed to assess levels of C-reactive protein (CRP) and white blood cells (WBC) across individuals with schizophrenia, bipolar disorder, and depression......, and to investigate associations with subsequent psychiatric admission and mortality. METHODS: We identified all adults in the Central Denmark Region during 2000-2012 with a first diagnosis of schizophrenia, bipolar disorder, or depression and a baseline measurement of CRP and/or WBC count. We followed.......5mg/L) (particularly during manic states, 3.9mg/L), followed by schizophrenia (3.1mg/L), and depression (2.8mg/L), while baseline WBC count did not differ (median 7.1×10(9)/L). Elevated CRP levels were associated with increased all-cause mortality by adjusted HRs of 1.56 (95% CI: 1.02-2.38) for levels...

  16. Diagnostic accuracy of C-reactive protein for intraabdominal infections after colorectal resections

    DEFF Research Database (Denmark)

    Kørner, Hartwig; Nielsen, Hans Jørgen; Søreide, Jon Arne

    2009-01-01

    BACKGROUND: Intraabdominal infections are caused mainly by anastomotic leaks and represent a serious complication. Diagnosis is usually made when patients become critically ill. Though inflammatory markers, including C-reactive protein (CRP) and white blood count (WBC), may contribute to an early...... diagnosis, their clinical roles remain unclear. The diagnostic accuracy of continuous tests depends on the choice of cut-off values. We analyzed the diagnostic accuracy of serial CRP and WBC measurements to detect infectious complications after colorectal resections. PATIENTS AND METHODS: The CRP and WBC...... of CRP was similar. CONCLUSION: Serial CRP measurements are helpful for detecting intraabdominal infections after colorectal resection. Persistently elevated CRP values after POD 3 should be investigated for intraabdominal infection....

  17. Influence of the blood bacterial load on the meningeal inflammatory response in Streptococcus pneumoniae meningitis

    DEFF Research Database (Denmark)

    Østergaard, C; O´Reilly, T; Brandt, C

    2006-01-01

    was induced by intracisternal injection of approximately 1 x 10(6) CFU Streptococcus pneumoniae, type 3, and the 26 rabbits were either provided with approximately 1 x 10(6) CFU S. pneumoniae intravenously at 0 hour ("bacteraemic" rabbits, n = 9), immunized with paraformaldehyde-killed S. pneumoniae for 5...... weeks prior to the experiment ("immunized" rabbits", n = 8), or not treated further ("control" rabbits, n = 9). WBC and bacterial concentrations were determined in CSF and blood every second hour during a 16 hours study period together with CSF IL-8 and protein levels. We also studied CSF and blood WBC...... bacterial levels were observed (P > 0.05). Blood WBC decreased in bacteraemic rabbits between approximately 10-16 hours after the bacterial inoculation in contrast to an increase for both the immunized rabbits and controls (P rabbits as compared...

  18. Sirolimus: a switch option for mycophenolate mofetil-induced leukopenia in renal transplant recipients.

    Science.gov (United States)

    Shin, B C; Chung, J H; Kim, H L

    2013-10-01

    Mycophenolate mofetil (MMF) is a potent immunosuppressive agent used to prevent acute and chronic rejection in kidney transplantation or for rescue therapy. One side effect of MMF is bone marrow toxicity, including leukopenia, which may necessitate drug withdrawal. We report 2 patients who underwent kidney transplantation and developed leukopenia while receiving MMF and safely switched to sirolimus. A 35-year-old woman underwent deceased donor kidney transplantation. She received basiliximab, tacrolimus, MMF, and a corticosteroid. On postoperative day (POD) 75, her white blood cell (WBC) count was 1800/μL. A 44-year-old women underwent deceased donor kidney transplantation and received basiliximab, tacrolimus, MMF, valganciclovir, and a corticosteroid. On POD 88, her WBC count was 1320/μL. MMF was switched to sirolimus, resulting in recovery of WBC count without rejection. Switch from MMF to sirolimus is safe and favorable in MMF-induced leukopenia in renal transplant recipient. Copyright © 2013. Published by Elsevier Inc.

  19. Effects of 1-methyl-5-guanylhydrazone-6-oxo-2,3,5,6-tetrahydroindole mesylate (S Adchnon 50) on radiation-induced leukopenia

    International Nuclear Information System (INIS)

    Tatsuno, Ikuro; Tada, Akira; Choutou, Shuichi

    1985-01-01

    S Adchnon 50 (300 mg/day) was administered, in combination with radiation therapy, to 30 patients with malignancy. Two patients were excluded from the study because one had side effects of S Adchnon 50 and another had leukopenia induced by other drugs. When the rate of decrease in WBC counts was 35 % or less or 45 % or less after the completion of radiation therapy (Criteria I) and when postirradiation WBC counts were 3,500/mm 3 or more (Criteria II), patients were regarded as responding to the drug. WBC counts decreased by 23.4 % during radiation therapy and by 22.5 % after the completion of radiation therapy. The response rates were 79 % for the Criteria I and 89 % for the Criteria II. It is therefore concluded that S Adchnon is an effective and safe drug in preventing leukopenia from radiation therapy. (Namekawa, K.)

  20. Leukocytes in a Plasmodium falciparum-infected blood meal reduce transmission of malaria to Anopheles mosquitoes.

    Science.gov (United States)

    Lensen, A H; Bolmer-Van de Vegte, M; van Gemert, G J; Eling, W M; Sauerwein, R W

    1997-01-01

    Mosquitoes are infected with Plasmodium falciparum by taking a blood meal from a gametocyte carrier. Since a mosquito takes a volume of 1 to 2 microl, a blood meal may contain 1 x 10(4) to 3 x 10(4) leukocytes (WBC). The majority of WBC are composed of neutrophils which may phagocytose and kill developing gametes inside the mosquito midgut. Phagocytosis was measured in vitro by a luminol-dependent chemiluminescence (CL) assay. In the presence of P. falciparum gametes, sera from areas of endemicity had an increased CL response compared to controls. In mosquito membrane feeding experiments some such sera showed a transmission reduction which was related to the presence of viable WBC. The results of this study suggest that phagocytosis of opsonized gametes inside the mosquito midgut occurs and can contribute to a reduction in the transmission of P. falciparum parasites. PMID:9284160

  1. A Framework for White Blood Cell Segmentation in Microscopic Blood Images Using Digital Image Processing

    Science.gov (United States)

    2009-01-01

    Evaluation of blood smear is a commonly clinical test these days. Most of the time, the hematologists are interested on white blood cells (WBCs) only. Digital image processing techniques can help them in their analysis and diagnosis. For example, disease like acute leukemia is detected based on the amount and condition of the WBC. The main objective of this paper is to segment the WBC to its two dominant elements: nucleus and cytoplasm. The segmentation is conducted using a proposed segmentation framework that consists of an integration of several digital image processing algorithms. Twenty microscopic blood images were tested, and the proposed framework managed to obtain 92% accuracy for nucleus segmentation and 78% for cytoplasm segmentation. The results indicate that the proposed framework is able to extract the nucleus and cytoplasm region in a WBC image sample. PMID:19517206

  2. Whole-body counter survey results 4 months after the Fukushima Dai-ichi NPP accident in Minamisoma City, Fukushima

    International Nuclear Information System (INIS)

    Hayano, Ryugo S; Watanabe, Yuni N; Nomura, Shuhei; Nemoto, Tsuyoshi; Tsubokura, Masaharu; Hanai, Tatsuo; Kumemoto, Yuki; Kowata, Satoshi; Oikawa, Tomoyoshi; Kanazawa, Yukio

    2014-01-01

    Using the first WBC unit installed in Fukushima Prefecture after the accident, the radiocesium body burdens of 566 high-risk residents of Minamisoma city were measured in July 2011 at the Minamisoma Municipal General Hospital. The analysis of the data was challenging because this chair-type, WBC unit, did not have sufficient shielding against background gamma rays and methods had to be developed to reliably compensate for the body-attenuated background radiation. Fortunately, data for repeated tests of hospital staff members using both the chair-type and well-shielded FASTSCAN WBC units, installed in September 2011, were available and could be used to check the validity of the analysis. The CEDs of all subjects, estimated under the assumption of acute inhalation in March 2011, were found to be less than 1 mSv. (paper)

  3. Laser-photophoretic migration and fractionation of human blood cells.

    Science.gov (United States)

    Monjushiro, Hideaki; Tanahashi, Yuko; Watarai, Hitoshi

    2013-05-13

    Laser photophoretic migration behavior of human blood cells in saline solution was investigated under the irradiation of Nd:YAG laser beam (532 nm) in the absence and the presence of the flow in a fused silica capillary. Red blood cells (RBC) were migrated faster than white blood cells (WBC) and blood pellets to the direction of propagation of laser light. The observed photophoretic velocity of RBC was about 11 times faster than those of others. This was understood from the larger photophoretic efficiency of RBC than that of WBC, which was simulated based on the Mie scattering theory. Furthermore, it was found that, during the photophoretic migration, RBCs spontaneously orientated parallel to the migration direction so as to reduce the drag force. Finally, it was demonstrated that RBC and WBC were separated in a micro-channel flow system by the laser photophoresis. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Effects of Whole-Body Cryotherapy in Comparison with Other Physical Modalities Used with Kinesitherapy in Rheumatoid Arthritis.

    Science.gov (United States)

    Gizińska, Małgorzata; Rutkowski, Radosław; Romanowski, Wojciech; Lewandowski, Jacek; Straburzyńska-Lupa, Anna

    2015-01-01

    Whole-body cryotherapy (WBC) has been frequently used to supplement the rehabilitation of patients with rheumatoid arthritis (RA). The aim of this study was to compare the effect of WBC and traditional rehabilitation (TR) on clinical parameters and systemic levels of IL-6, TNF-α in patients with RA. The study group comprised 25 patients who were subjected to WBC (-110 °C) and 19 patients who underwent a traditional rehabilitation program. Some clinical variables and levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) were used to assess the outcomes. After therapy both groups exhibited similar improvement in pain, disease activity, fatigue, time of walking, and the number of steps over a distance of 50 m. Only significantly better results were observed in HAQ in TR group (p physical procedure.

  5. Evaluation of musculoskeletal sepsis with indium-111 white blood cell imaging

    International Nuclear Information System (INIS)

    Ouzounian, T.J.; Thompson, L.; Grogan, T.J.; Webber, M.M.; Amstutz, H.C.

    1987-01-01

    The detection of musculoskeletal sepsis, especially following joint replacement, continues to be a challenging problem. Often, even with invasive diagnostic evaluation, the diagnosis of infection remains uncertain. This is a report on the first 55 Indium-111 white blood cell (WBC) images performed in 39 patients for the evaluation of musculoskeletal sepsis. There were 40 negative and 15 positive Indium-111 WBC images. These were correlated with operative culture and tissue pathology, aspiration culture, and clinical findings. Thirty-eight images were performed for the evaluation of possible total joint sepsis (8 positive and 30 negative images); 17 for the evaluation of nonarthroplasty-related musculoskeletal sepsis (7 positive and 10 negative images). Overall, there were 13 true-positive, 39 true-negative, two false-positive, and one false-negative images. Indium-111 WBC imaging is a sensitive and specific means of evaluating musculoskeletal sepsis, especially following total joint replacement

  6. Typical signature of DNA damage in white blood cells: a pilot study on etheno adducts in Danish mother-newborn child pairs

    DEFF Research Database (Denmark)

    Arab, K; Pedersen, Marie; Nair, J

    2009-01-01

    in mother and newborn shows a similar pattern. Two adducts 1,N(6)-ethenodeoxyadenosine (epsilondA) and 3,N(4)-ethenodeoxycytidine (epsilondC) were measured by our ultrasensitive immunoaffinity (32)P-post-labeling method. These miscoding etheno-DNA adducts are generated by the reaction of lipid peroxidation...... (LPO) end products such as 4-hydroxy-2-nonenal with DNA bases. Mean epsilondA and epsilondC levels when expressed per 10(9) parent nucleotides in WBC-DNA from cord blood were 138 and 354, respectively; in maternal WBC-DNA, the respective values were 317 and 916. Thus, the DNA-etheno adduct levels were......The impact of DNA damage commonly thought to be involved in chronic degenerative disease causation is particularly detrimental during fetal development. Within a multicenter study, we analyzed 77 white blood cell (WBC) samples from mother-newborn child pairs to see if imprinting of DNA damage...

  7. Monitoring of a new approach of immunotherapy with allogenic 111In-labelled NK cells in patients with renal cell carcinoma

    International Nuclear Information System (INIS)

    Meller, Birgit; Lauer, Isabel; Schelper, Lutz F.; Hof, Katharina von; Richter, Eckart; Baehre, Manfred; Frohn, Christoph; Brand, Joerg-Matthias; Kirchner, Holger

    2004-01-01

    The transfusion of allogenic, in vitro expanded natural killer cells (NKC) is a novel therapy option in oncology. To date, however, the biodistribution and kinetics of allogenic NKC have not been investigated. Therefore, in this study three patients with renal cell carcinoma received 3-7 x 10 8 NKC labelled with indium-111 oxine with a tenfold excess of unlabelled cells during NKC therapy. Whole-body scintigrams were obtained (0.5-144 h) in the anterior and posterior views. Scintigrams were analysed using a region of interest technique, and single-photon emission tomography (SPET) studies of the abdomen were performed. Results were compared to those obtained with polymerase chain reaction (PCR) of the peripheral blood (determination of foreign DNA, nested PCR, limit of detection 0.01%). Shortly after transfusion of NKC, more than 50% of the activity was accumulated in the lungs. We observed redistribution effects from lungs to liver, spleen and bone marrow. No significant loss of activity could be detected. In two of four large metastases, tracer accumulation could be proven by SPET. As confirmed by scintigrams and PCR, the fraction of circulating transfused cells was low at all times. Long-term activity retention might be caused either by survival of the allogenic cells, as confirmed by PCR (up to 3 days p.i.), or by phagocytosis of labelled cellular fragments. However, PCR data and uptake in metastases indicated long survival of a portion of allogenic NKC. Such long survival and low retention of the cells in the lung are requirements for an effective immunotherapeutic approach. (orig.)

  8. Monitoring of a new approach of immunotherapy with allogenic {sup 111}In-labelled NK cells in patients with renal cell carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Meller, Birgit; Lauer, Isabel; Schelper, Lutz F.; Hof, Katharina von; Richter, Eckart; Baehre, Manfred [Clinic of Radiotherapy and Nuclear Medicine, University of Luebeck, Ratzeburger Allee 160, 23538, Luebeck (Germany); Frohn, Christoph; Brand, Joerg-Matthias; Kirchner, Holger [Institute of Immunology and Transfusion Medicine, University of Luebeck, Ratzeburger Allee 160, 23538, Luebeck (Germany)

    2004-03-01

    The transfusion of allogenic, in vitro expanded natural killer cells (NKC) is a novel therapy option in oncology. To date, however, the biodistribution and kinetics of allogenic NKC have not been investigated. Therefore, in this study three patients with renal cell carcinoma received 3-7 x 10{sup 8} NKC labelled with indium-111 oxine with a tenfold excess of unlabelled cells during NKC therapy. Whole-body scintigrams were obtained (0.5-144 h) in the anterior and posterior views. Scintigrams were analysed using a region of interest technique, and single-photon emission tomography (SPET) studies of the abdomen were performed. Results were compared to those obtained with polymerase chain reaction (PCR) of the peripheral blood (determination of foreign DNA, nested PCR, limit of detection 0.01%). Shortly after transfusion of NKC, more than 50% of the activity was accumulated in the lungs. We observed redistribution effects from lungs to liver, spleen and bone marrow. No significant loss of activity could be detected. In two of four large metastases, tracer accumulation could be proven by SPET. As confirmed by scintigrams and PCR, the fraction of circulating transfused cells was low at all times. Long-term activity retention might be caused either by survival of the allogenic cells, as confirmed by PCR (up to 3 days p.i.), or by phagocytosis of labelled cellular fragments. However, PCR data and uptake in metastases indicated long survival of a portion of allogenic NKC. Such long survival and low retention of the cells in the lung are requirements for an effective immunotherapeutic approach. (orig.)

  9. Utilization of radioisotopes in medical field

    Energy Technology Data Exchange (ETDEWEB)

    Sasaki, Yasuhito [National Inst. of Radiological Sciences, Chiba (Japan)

    2000-03-01

    The establishment and advance of nuclear medicine was briefly described here and the present situations and recent topics on clinical nuclear medicine were summarized as well as its prospects for the future. A labeling method to monitor dynamic changes of living substances using radioisotope (RI) was established by Hevesy using radionuclides. The radiotracing method has been applied to chemical field. The numbers of yearly application in 1982, 1987, 1992 and 1997 were reported in respects of in vivo assays (scintigram, SPECT, PET), the treatments with unsealed RI, PET and in vitro examination (RIA, IRMA). The data show that the application of in vivo examination greatly increased for the last 5 years. Bone scintigram was most frequent (26.9%) followed by myocardial scintigram (19.6%). On the other hand, application of in vitro radioassay is gradually decreasing now after the peak in 1992 (241,000 cases per day). The determination of blood concentrations of various tumor markers such as CEA, CA19-9, CA15-3 ar3, etc. became able using radioimmunodetection (RID). Positron emission computed tomography (PET) is valuable for detection of malignant tumor especially for postoperative recurrence or metastasis, evaluation of myocardial viability and identification of epileptic focus. PET using {sup 15}O labeled H{sub 2}O is thought useful for the study on higher functions of human brain such as language, thinking, and prognostic evaluation of damages in the brain. Nuclear medicinal examination, which has been used for diagnosis would be utilized for designing of clinical therapy and evaluation of its effects and prognosis. (M.N.)

  10. Thallium-201 scintigraphy in complete left bundle branch block

    Energy Technology Data Exchange (ETDEWEB)

    Hirzel, H.O.; Senn, M.; Nuesch, K.; Buettner, C.; Pfeiffer, A.; Hess, O.M.; Krayenbuehl, H.P.

    1984-03-01

    Nineteen symptomatic patients with left bundle branch block (LBBB) were examined by thallium-201 (TI-201) exercise scintigraphy and selective coronary arteriography. All elicited significant anteroseptal perfusion defects in the exercise scintigrams, but in only 4 was coronary artery disease (CAD) involving the left anterior descending coronary artery present. To further elucidate the effect of LBBB on septal TI-201 uptake in the absence of CAD, TI-201 scintigrams combined with regional myocardial blood flow measurements using radioactive microspheres were carried out in 7 dogs during right atrial and right ventricular pacing (LBBB in the ECG) at similar heart rates. During right atrial pacing, TI-201 uptake was homogeneous in the entire left ventricle, as were tissue flows. During right ventricular pacing, TI-201 activity was reduced to 69% of maximal TI-201 activity within the septum, whereas it averaged 90% in the lateral wall (p less than 0.05) in 6 dogs. Correspondingly, regional myocardial blood flow was lower within the septum as compared with that in the lateral wall, averaging 89 and 120 ml/min/100 g, respectively (p less than 0.005). In 1 dog, normal TI-201 distribution and tissue flows were found in both studies. Thus, symptomatic patients with LBBB may elicit abnormal TI-201 exercise scintigrams, suggesting anteroseptal ischemia despite normal coronary arteries. The electrical induction of LBBB in dogs results, in most instances, in a comparable reduction in septal TI-201 uptake associated with diminished septal blood flow. Therefore, exercise-induced septal perfusion defects in the presence of LBBB do not necessarily indicate CAD even in symptomatic patients, but may reflect functional ischemia due to asynchronous septal contraction.

  11. Diagnostic value for coronary artery disease of ST depression and chest pain during dipyridamole loading

    International Nuclear Information System (INIS)

    Yonezawa, Yoshihiro; Doi, Yoshinori; Aono, Tadashi; Odawara, Hiroaki; Chikamori, Taishiro; Yamada, Mitsutoshi; Takata, Jun; Ozawa, Toshio; Hamashige, Naohisa.

    1991-01-01

    The diagnostic significance of both ST depression and chest pain during dipyridamole loading was assessed in 437 patients with coronary artery disease (CRD) who have received dipyridamole-loading thallium-201 myocardial scintigraphy and coronary arteriography. ST depression and chest pain were induced in 35% and 42%, respectively. ST depression occurred in 23% for one vessel disease, 55% for two-vessel disease, 67% for three-vessel disease, and 11% for non-significant disease. In the absence of myocardial infarction, it occurred in as many as 78% for two-vessel disease and 94% for three-vessel disease. ST depression had a sensitivity of 51% and a specificity of 89%. Chest pain had a lower specificity (77%), whereas the sensitivity remained the same (51%). In 42 (31%) of 134 patients with ST depression, coronary revascularization was necessary in the early stage. With a median follow up of 29 months, 3 patients (2%) died of cardiac events, and 12 (9%) had nonfatal cardiac complications. There was a significant correlation between reversible defects (RD) on myocardial scintigrams and ST depression; RD were seen in 81% of ST depression cases, and ST depression occurred in 51% of 210 RD cases. The more diseased vessels, the more frequently ST depression occurred in accordance with RD on myocardial scintigrams. Both ST depression and chest pain during dipyridamole loading tended to be associated with myocardial ischemia, suggesting the diagnostic value in CRD patients with limited exercise loading. RD on myocardial scintigrams was considered attributable to coronary steal phenomenon for multi-vessel disease and to the difference in the relative increase of the coronary flow for single vessel disease. (N.K.)

  12. Pharmacokinetics and organ distribution of 125I-aprindine

    International Nuclear Information System (INIS)

    Becker, H.

    1981-01-01

    An attempt was made to label aprindine hydrochloride with I-125 by means of an exchange reaction. Organ distribution was determined in 10 rats where radioactivity was measured in the lung, heart, liver, kidney, spleen, brain, transverse muscle tissue and bone sections 5, 10, 30 and 60 min following i.v. injection. The high organ concentration was found in the lung, and also the maximum ratio organ: blood radioactivity was found for this organ. Whole body activity measurements revealed a half-life of nearly 6 hr. Excretion occurred primarily via the faeces. The pharmacokinetic properties of 14 C- and 125 I-aprindine hydrochloride do not therefore differ significantly. A whole body scintiscanning was carried out on an additional 12 rats and 6 rabbits. This revealed a marked enrichment in the lung compared to other organs in the time period 5 to 10 min. An image of relatively good quality was obtained compared to that of conventional perfusion scintiscanning with 131 I-HSA. It is assumed that 125 I-aprindine hydrochloride is concentrated in the lung parenchyma and is therefore largely unaffected by the immediate perfusion conditions. This is also confirmed in preliminary studies with 131 I-aprindine in the scintiscanning of rabbits where voids of pneumonia activity are shown in the aprindine scintigram whereas with the perfusion method these are not. As expected, the reverse was shown to be true following experimental pulmonary embolism where voids were seen in the perfusion scintigram whilst the 131 I-aprindine scintigram revealed hardly any areas of drops in activity. These properties possibly offer an improved diagnostic procedure for differentiating between pneumonia and lung infarct by combination with perfusion scintiscanning. (orig./MG) [de

  13. Software package for integrated data processing for internal dose assessment in nuclear medicine (SPRIND).

    Science.gov (United States)

    Visser, Eric; Postema, Ernst; Boerman, Otto; Visschers, Jeroen; Oyen, Wim; Corstens, Frans

    2007-03-01

    Internal radiation dose calculations are normally carried out using the Medical Internal Radiation Dose (MIRD) schema. This requires residence times of radiopharmaceutical activity and S-values for all organs of interest. Residence times can be obtained by quantitative nuclear imaging modalities. For dealing with S-values, the freeware packages MIRDOSE and, more recently, OLINDA/EXM are available. However, these software packages do not calculate residence times from image data. For this purpose, we developed an IDL-based software package for integrated data processing for internal dose assessment in nuclear medicine (SPRIND). SPRIND allows reading and viewing of planar whole-body scintigrams. Organ and background regions of interest (ROIs) can be drawn and are automatically mirrored from the anterior to the posterior view. ROI statistics are used to obtain anterior-posterior averaged counts for each organ, corrected for background activity and attenuation. Residence times for each organ are calculated based on effective decay. The total body biological half-time is calculated for use in the voiding bladder model. Red bone marrow absorbed dose can be calculated using bone regions in the scintigrams or by a blood-derived method. Finally, the results are written to a file in MIRDOSE-OLINDA/EXM format. Using scintigrams in DICOM, the complete analysis is gamma camera vendor independent, and can be performed on any computer using an IDL virtual machine. SPRIND is an easy-to-use software package for radiation dose assessment studies. It has made these studies less time consuming and less error prone.

  14. Dental diseases and radionuclide imaging of the jaws.

    Science.gov (United States)

    Arias, Jose A; Pardo, Carlos; Olmos, Antonio; Cuadrado, Maria L; Ruibal, Alvaro

    2004-03-01

    The aim of this study was to compare the results of radionuclide bone scans of the jaws with data obtained at the nuclear medicine department from a brief and feasible dental history, taking special account of cases with a positive scan and no recent dental events. Ninety-eight patients undergoing radionuclide bone scan as part of their diagnosis in non-dental, oncological and non-oncological diseases were imaged with 99mTc-labelled oxidronate. Superior and inferior halves of the mandible and maxilla (392 quadrants) were regarded as normal or having an abnormally high uptake. A recent (1 year) dental history was also obtained through a brief questionnaire and data were referred to each quadrant of the jaws. The association between the bone scan and dental disease was assessed by means of the chi-squared test. The overall results of scintigraphy and history coincided in 66 patients (46 with abnormal and 20 with normal findings; P = 0.002). Twenty-five patients had a positive scintigram without any known dental disorder. Results of scintigraphy and history coincided in 254 quadrants (78 with abnormal and 176 with normal findings; P < 0.001). Eighty-three quadrants had hot spots in the scintigram without any known dental lesion. It can be concluded that abnormal jaw scintigrams are frequent in patients without known dental disease, and this may indicate silent osteoblastic activity. These observations should be reported to the dentist for several reasons. First, they may reveal asymptomatic dental lesions. Second, the use of oral prostheses and implants is increasing and they require the support of healthy alveolar bone.

  15. Evaluation of portal circulation by 99mTcO4-per-rectal scintigraphy

    International Nuclear Information System (INIS)

    Shiomi, Susumu; Kuroki, Tetsuo; Kurai, Osamu

    1987-01-01

    Portal circulation in patients with chronic liver diseases was evaluated by a new method named per-rectal portal scintigraphy. Following instillation of a solution containing 10 mCi of 99m TcO 4 - into the upper part of the rectum, serial scintigrams were taken sequentially. At the same time, the radioactivity curves over the liver and the heart were recorded sequentially. 1) The findings of per-rectal portal scintigrams were classified into two basic patterns. In pattern (I), the inferior mesenteric vein, portal vein, liver and the heart were visualized continuously after rectal instillation of the radioisotope. This pattern reflects direct blood flow from the rectum to the liver via the portal vein. In contrast, in pattern (II), the portal scintigrams demonstrated the vena cava inferior and the heart at an early phase when neither the portal system nor the liver have received the isotope. This pattern indicates that a part or all of the blood flow from the rectum is directed to the vena caval system via the portacaval shunts on the periphery of the inferior mesenteric vein. 2) Per-rectal portal shunt indices (SI) were calculated from serial radioactivities on the liver and the heart. In the healthy subjects, SI ranged from 1.9 % to 5.2 % (mean 4.1 %). In patients with hepatitis the mean SI was 6.9 %, and in patients with cirrhosis it was 52.9 %. 3) The SI was higher in cirrhotic patients with esophageal varices than in those without (p < 0.001). The SI was higher in cirrhotic patients with encephalopathy than in those without (p < 0.01). Thus, per-rectal portal scintigraphy is a simple, noninvasive and practical method for analyzing portal hemodynamics. (author)

  16. Gallium 67 scintigraphy in glomerular disease

    Energy Technology Data Exchange (ETDEWEB)

    Bakir, A.A.; Lopez-Majano, V.; Levy, P.S.; Rhee, H.L.; Dunea, G.

    1988-12-01

    To evaluate the diagnostic usefulness of gallium 67 scintigraphy in glomerular disease, 45 patients with various glomerulopathies, excluding lupus nephritis and renal vasculitis, were studied. Persistent renal visualization 48 hours after the gallium injection, a positive scintigram, was graded as + (less than), ++ (equal to), and +++ (greater than) the hepatic uptake. Positive scintigrams were seen in ten of 16 cases of focal segmental glomerulosclerosis, six of 11 cases of proliferative glomerulonephritis, and one case of minimal change, and one of two cases of membranous nephropathy; also in three of six cases of sickle glomerulopathy, two cases of diabetic neuropathy, one of two cases of amyloidosis, and one case of mild chronic allograft rejection. The 25 patients with positive scans were younger than the 20 with negative scans (31 +/- 12 v 42 +/- 17 years; P less than 0.01), and exhibited greater proteinuria (8.19 +/- 7.96 v 2.9 +/- 2.3 S/d; P less than 0.01) and lower serum creatinine values (2 +/- 2 v 4.1 +/- 2.8 mg/dL; P less than 0.01). The amount of proteinuria correlated directly with the intensity grade of the gallium image (P less than 0.02), but there was no correlation between the biopsy diagnosis and the outcome of the gallium scan. It was concluded that gallium scintigraphy is not useful in the differential diagnosis of the glomerular diseases under discussion. Younger patients with good renal function and heavy proteinuria are likely to have a positive renal scintigram regardless of the underlying glomerulopathy.

  17. Quantitative analysis of scintigraphic findings in tibial stress fractures in Thoroughbred racehorses.

    Science.gov (United States)

    Valdés-Martínez, Alejandro; Seiler, Gabriela; Mai, Wilfried; Bolt, David M; Mudge, Margaret; Dukti, Sarah A; Hubert, Jeremy D

    2008-07-01

    To develop a quantitative method of interpreting tibial scintigrams of Thoroughbred racehorses with tibial stress fractures that may facilitate diagnosis of fractures and to provide prognostic information regarding future performance of affected horses. 35 Thoroughbred racehorses. Static bone-phase scintigrams of tibial stress fractures were quantitatively analyzed by use of ratios of the mean radionuclide counts per pixel in a region of interest (ROI) drawn around the area of increased uptake of radiopharmaceutical to mean counts per pixel in a second ROI drawn around an apparently normal area of the tibial diaphysis. In horses with unilateral fractures, ratios for the contralateral tibia were determined by use of 2 ROIs drawn at the same positions as the ROIs in the fractured tibia. Ratios were compared between fractured versus apparently normal tibias, between horses that returned to racing versus those that did not, and among horses with various grades of lameness. The association between ratios for fractured tibias and intervals between diagnosis and return to racing was also assessed. Mean ratio of ROIs in apparently normal tibias was 1.35 (95% confidence interval [CI], 1.21 to 1.50); that in tibias with stress fractures was 3.55 (95% CI, 2.50 to 4.60). These ratios were significantly different. None of the associations between ratios for fractured tibias and grades of lameness or performance outcomes were significant. Tibial stress fracture scintigrams can be quantitatively analyzed. A prospective study with a controlled rehabilitation period is necessary to evaluate the possible applications of this method.

  18. Evaluation of /sup 99m/Tc-albumin distribution ratio in cardiac chambers and lungs

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tadashige; Kanai, Hisakata; Tanaka, Masao and others

    1989-01-01

    In order to assess blood volume of the cardiac chambers and lungs, distribution ratio of /sup 99m/Tc-albumin (HSA) was obtained from radionuclide angiocardiogram and non-gated or gated equilibrium cardiac pool scintigram, using a scintillation camera coupled to a minicomputer. The radioactivity of /sup 99m/Tc of the entire cardiac blood pool including the large vessels (T), the right ventricle including the right atrium (RV) and the left ventricle (LV) was calculated from the 30deg anterior oblique cardiac pool scintigram. That of the both lungs (Lu) was calculated from the anterior cardiac pool scintigram. The radioactivity of total injected dose of HSA (H) was estimated from the initial transit of the tracer obtained by the radionuclide angiocardiogram. Then, distribution ratio of HSA of the each region of interest was expressed as RV/H, LV/H, T/H and Lu/H. RV/H, LV/H and T/H were 3.4+-0.6%, 3.1+-0.5% and 10.4+-2.0% in controls, 6.0+-0.8%, 2.6+-0.8% and 14.2+-2.4% in cor pulmonale, and 7.9+-1.7%, 7.7+-3.5% and 20.7+-4.3% in heart diseases with left heart failure, respectively. Lu/H was 4.9+-1.4% in controls, 4.4+-1.1% in cor pulmonale and 6.6+-1.9% in heart diseases without left heart failure. LV/H was correlated with left ventricular end-diastolic volume by contrast ventriculography. LV/H and RV/H were related with functional classification of NYHA. In conclusion, these parameters may be utilized as indices of the volume of blood pool of the heart chambers and lungs, and this method seems to be clinically applicable for the evaluation of pathophysiology in heart diseases.

  19. The mean filtration pressure of leukocyte suspensions and its relation to the passage of leukocytes through nuclepore filters and capillary networks.

    Science.gov (United States)

    Eppihimer, M J; Lipowsky, H H

    1994-12-01

    To quantitatively evaluate the deformability of bulk suspensions of leukocytes (WBCs), account for the variance of individual cell mechanical properties, and deduce the potential for WBC entrapment within the capillary network in response to alterations in cell properties. The transient washout of WBCs initially trapped under low perfusion pressure in 5-microns pores of Nuclepore filters was analyzed for a 0.2-ml bolus of WBCs (derived from hamsters) with equal numbers of filter pores and cells, to characterize the statistical distribution of pressures, Pyield, required to dislodge the cells. Contributions of the variance in WBC diameter, pore diameter, and cremaster muscle capillary diameter to Pyield were estimated with a WBC cortical shell model and an analysis of the probability function of the ratio of WBC to pore diameter, lambda. For normal WBCs, Pyield exhibited a log-normal distribution with mean (Pyield) of 0.59 cmH2O. Incubation of cells in cytochalasin-B reduced (Pyield) almost 50%, whereas phorbol myristate acetate increased (Pyield) twofold. Incubation in N-formyl-methiolnyl-leucyl-phenylalanine had no significant effect on (Pyield), as polymorphonuclear cells became permanently trapped in the filter. The fluorescent dyes acridine orange, acridine red, and tetramethylrhodamine isothiocyanate increased (Pyield) as much as 10-fold, whereas steady-flow filtration methods showed no alteration. Analysis of the distribution of lambda revealed that due to their smaller pore diameters, in vitro filtration methods may overestimate in vivo values of (Pyield) by almost twofold. The transient filtration of WBC suspensions appears to be much more sensitive to subtle alterations in WBC deformability than steady-flow methods and may provide greater insight into the determinants of capillary perfusion. Estimates of (Pyield) are comparable to those obtained with micropipettes and permit analysis of substantially greater numbers of cells within a sample. Fluorescence

  20. Nucleated red blood cells and early EEG: predicting Sarnat stage and two year outcome.

    LENUS (Irish Health Repository)

    Walsh, B H

    2012-01-31

    AIMS: Hypoxic Ischaemic Encephalopathy (HIE) causes characteristic changes of the electroencephalogram (EEG), and a raised Nucleated Red Blood Cell (NRBC) count compared to controls. We wished to examine whether combining these markers could improve their ability to predict HIE severity in the first 24h. METHODS: Term infants with HIE were recruited. NRBC count and continuous multi-channel EEG were recorded within the first 24h. Neurological assessment was carried out at 24 months. A control population with NRBC counts in the first 24h was recruited. RESULTS: 44 infants with HIE and 43 control infants were recruited. Of the HIE population 39 completed a 2 year follow-up. The median NRBC count differed significantly between the controls and those with HIE (3\\/100 WBC [range of 0-11] vs 12.3\\/100 WBC [0-240]) (p<0.001). Within the HIE population the median NRBC count was significantly greater in infants with moderate\\/severe HIE than mild (16\\/100 WBC [range of 0-240] vs 8\\/100 WBC [1-23]) (p=0.016), and among infants with abnormal outcome compared to normal (21.3\\/100 WBC [1-239.8] vs 8.3\\/100 WBC [0-50])(p=0.03). The predictive ability of EEG changed with time post-delivery, therefore results are given at both 12 and 24h of age. At both time points the combined marker had a stronger correlation than EEG alone; with HIE severity (12h: r=0.661 vs r=0.622), (24h: r=0.645 vs r=0.598), and with outcome at 2 years (12h: r=0.756 vs r=0.652), (24h: r=0.802 vs r=0.746). CONCLUSION: Combining early EEG and NRBC count to predict HIE severity and neurological outcome, improved the predictive ability of either in isolation.

  1. Effects of a simple educational intervention in well-baby clinics on women's knowledge about and intake of folic acid supplements in the periconceptional period: a controlled trial.

    Science.gov (United States)

    de Smit, Denhard J; Weinreich, Stephanie S; Cornel, Martina C

    2015-04-01

    To test the hypothesis that a concise intervention to promote the preconception use of folic acid (FA) supplements among mothers who visit a well-baby clinic (WBC) for the 6-month check-up of their youngest child is effective. Effectiveness was measured as intention to use or actual use of FA supplements before a next pregnancy among women who expected to be pregnant within 0-12 months. Controlled intervention study with independent samples of intervention and control mothers. The intervention took place at the 6-month visit. A post-intervention measurement was done in the intervention group and a comparable measurement in the control group at the 11-month check-up visit. The intervention, verbal and in writing, was implemented in four Dutch WBC and given by the WBC physician to the mothers who visited the WBC. All mothers visiting the WBC were eligible for inclusion, unless they were unable to complete a questionnaire. The intervention group consisted of 198 (68 %) mothers recruited from 291 6-month intervention visits and the control group of 215 (84%) mothers recruited from 255 11-month normal visits. In mothers who expected to be pregnant within 0-12 months, the proportion using or intending to use FA was 65% in the intervention group (n 49) v. 42% in the control group (n 43; difference 23%, 95% CI 4, 43%, P<0·05). Health education intervention at the 6-month WBC visit is an effective means to promote the use of FA supplements or the intention to do so.

  2. Association of Leukocytosis with Amphetamine and Cocaine Use

    Directory of Open Access Journals (Sweden)

    John R. Richards

    2014-01-01

    Full Text Available Objective. Determining the etiology of unexplained leukocytosis in asymptomatic patients may incur unnecessary testing, cost, and prolonged emergency department stay. The objective was to delineate if use of amphetamines and/or cocaine is a factor. Methods. For two years we reviewed all psychiatric patients presenting for medical clearance with exclusions for infection, epilepsy, trauma, or other nonpsychiatric medical conditions. Results. With a total of 1,206 patients, 877 (72.7% amphetamines/cocaine-negative drug screen controls had mean WBC 8.4±2.6×103/µL. The 240 (19.9% amphetamines-positive, cocaine-negative, patients had WBC 9.4±3.3×103/µL (P<0.0001. The 72 (6.0% amphetamines-negative, cocaine-positive, patients had WBC 7.1±1.8×103/µL (P<0.0001. The remaining 17 (1.4% amphetamines/cocaine-positive patients had WBC 10.0±4.2×103/µL (P=0.01. Amphetamines-positive patients had a supranormal WBC ratio significantly higher than controls (23.8% versus 14.8%, P=0.001, whereas only one cocaine-positive patient had a supranormal WBC count, with significantly lower ratio (1.4%, P=0.0003. Conclusion. Use of amphetamines, not cocaine, may be associated with idiopathic leukocytosis. This may be explained by unique pharmacologic, neuroendocrine, and immunomodulatory differences.

  3. Influence of the blood bacterial load on the meningeal inflammatory response in Streptococcus pneumoniae meningitis

    Directory of Open Access Journals (Sweden)

    Frimodt-Møller Niels

    2006-04-01

    Full Text Available Abstract Background Despite bacteraemia is present in the majority of patients with pneumococcal, little is known about the influence of the systemic infection on the meningeal inflammatory response. Methods To explore the role of systemic infection on the meningeal inflammation, experimental meningitis was induced by intracisternal injection of ~1 × 106 CFU Streptococcus pneumoniae, type 3, and the 26 rabbits were either provided with ~1 × 106 CFU S. pneumoniae intravenously at 0 hour ("bacteraemic" rabbits, n = 9, immunized with paraformaldehyde-killed S. pneumoniae for 5 weeks prior to the experiment ("immunized" rabbits", n = 8, or not treated further ("control" rabbits, n = 9. WBC and bacterial concentrations were determined in CSF and blood every second hour during a 16 hours study period together with CSF IL-8 and protein levels. We also studied CSF and blood WBC levels in 153 pneumococcal meningitis patients with and without presence of bacteraemia. Results As designed, blood bacterial concentrations were significantly different among three experimental groups during the 16 hours study period (Kruskal Wallis test, P P > 0.05. Blood WBC decreased in bacteraemic rabbits between ~10–16 hours after the bacterial inoculation in contrast to an increase for both the immunized rabbits and controls (P P In patients with pneumococcal meningitis, no significant difference in CSF WBC was observed between patients with or without bacteraemia at admission (n = 103, 1740 cells/μL (123–4032 vs. n = 50, 1961 cells/μL (673–5182, respectively, P = 0.18, but there was a significant correlation between CSF and blood WBC (n = 127, Spearman rho = 0.234, P = 0.008. Conclusion Our results suggest that a decrease in peripheral WBC induced by enhanced bacteraemia in pneumococcal meningitis results in an attenuated CSF pleocytosis.

  4. Valdose program: methodologies for dose assessment in internal contamination, 1997 census; Programma valdose: metodologie di valutazione della dose da contaminazione interna, censimento 1997

    Energy Technology Data Exchange (ETDEWEB)

    Castellani, C.M.; Battisti, P.; Tarroni, G. [ENEA, Centro Ricerche `Ezio Clementel`, Bologna (Italy). Dip. Ambiente

    1998-12-31

    Dose assessment in internal dosimetry needs computational and interpretative tools that allow carrying out, as a first step, an evaluation of intake on the base of bioassay measurements or WBC measurements, and as a second step, dose evaluation on the base of estimated intake. In the frame of the MIDIA Co-ordination (WBC operating in Italy), in the first months of 1997 a census on methodologies for dose evaluation in internal contamination has been proposed. A technical form has been sent to all the WBC Centres allowing an accurate description of modalities used in each centre. 9 out of 17 centres sent the answers to the technical form in time. In this paper all the forms filled in are reported. A careful comparative evaluation of the answers has been made both for routine monitoring and for special monitoring. The various radionuclides present in the Italian reality, calculation methodologies both for intake and dose, hypotheses adopted for date, path and modalities of contaminations are also presented. Proposals for conforming to the methodology in Italy after the introduction of the models following ICRP 60 publication that are the base of the Euratom 96/29 Directive are also discussed. [Italiano] La valutazione di dose in contaminazione interna necessita di strumenti interpretativi che permettano di effettuare in una prima la valutazione dell`intake sulla base delle misure dei campioni biologici o del corpo intero (WBC), ed in una seconda fase la valutazione della dose sulla base dell`intake. All`interno del coordinamento MIDIA dei WBC operanti in Italia e` stato proposto, nel primo trimestre del 1997, un censimento sulle metodologie di valutazione di dose da contaminazione interna. Ai diversi centri e` stato inviato una scheda tecnica che, mediante un particolareggiato schema di domande, aiutava i diversi centri nella esposizione delle modalita` di valutazione di dose che ogni centro segue. 9 au 17 centri WBC operanti al momemnto in Italia hanno inviato la

  5. Diagnostic efficacy of optimised evaluation of planar MIBI myocardium perfusion scintigraphy: a probabilistic approach

    International Nuclear Information System (INIS)

    Kusmierek, J.; Plachcinska, A.

    1999-01-01

    Background: The Bayesian (probabilistic) approach to the results of a diagnostic test appears to be more informative than an interpretation of results in binary terms (having disease or not). The aim of our study was the analysis of the effect of an optimised evaluation of myocardium perfusion scintigrams on the probability of CAD in individual patients. Methods: 197 patients (132 males and 65 females) suspected of CAD, with no history of myocardial infarction were examined. Scintigraphic images were evaluated applying two methods of analysis: visual (semiquantitative) and quantitative, and the combination of both. The sensitivity and specificity of both methods (and their combination) in the detection of CAD were determined and optimal methods of scintigram evaluation, separately for males and females, were selected. All patients were subjected to coronary angiography. The pre-test probability of CAD was assessed according to Diamond (1) and the post-test probability was evaluated in accordance with Bayes's theorem. Patients were divided, according to a pre-test probability of CAD, into 3 groups: with low, medium and high probability of the disease. The same subdivision was made in relation to post-test probability of CAD. The numbers of patients in respective subgroups, before and after the test, were compared. Moreover, in order to test the reliability of post-test probability, its values were compared with real percentages of CAD occurrence among the patients under study, as demonstrated by the angiography. Results: The combination of visual and quantitative methods was accepted as the optimal method of male scintigram evaluation (with sensitivity and specificity equalling 95% and 82%, respectively) and a sole quantitative analysis as the optimal method of female scintigram evaluation (sensitivity and specificity amounted to 81% and 84%, respectively). In the subgroup of males the percentage of individuals with medium pre-test CAD probability equalled 52 and

  6. Diagnostic possibilities of radionuclide investigation in patterns with stable and unstable angina pectoris

    International Nuclear Information System (INIS)

    Ponomareva, A.G.; Zudbinov, Yu.I.; Sokolov, O.K.; Kudinov, V.I.

    1986-01-01

    Myocardial radiocardiography and scintigraphy with 99m Tc-pyrophosphate was performed in 58 patients with stable angina and 60 patients with unstable angina. In patients with stable angina, positive scintigrams were mostly recorded after anginal attacks. Their central hemodynamic parameters deteriorated progressively as angina increased in severity. Patients with unstable angina typically showed myocardial accumulation of the label that was unrelated to anginal attacks and recordable by direct-projection scintigraphy. The assessment of myocardial radiocardiographic and scintigraphic data allows one to differentiate between stable and unstable angina

  7. Aerosol scintigraphy in the assessment of therapy for cystic fibrosis

    International Nuclear Information System (INIS)

    Kuni, C.C.; Regelmann, W.E.; Budd, J.R.; Cret, R.P. du; Boudreau, R.J.

    1990-01-01

    This paper evaluates respiration therapy, counselling, and antibiotic therapy in the treatment of exacerbations of cystic fibrosis. Thirteen patients with cystic fibrosis, aged 11-32 years, who were hospitalized for exacerbation and who had sputum cultures positive for Pseudomonas were treated initially for 3 days with respiration therapy and counselling followed by 14 days of therapy with antibiotics (n = 7) or placebo (n = 6). Tc-99m-DTPA aerosol scintigraphy was performed on days, 1, 4, and 17. Scintigrams were evaluated for change in number of nonventilated segments, change in number of bronchial deposits of aerosol, and subjective overall change

  8. Critical evaluation of lung scintigraphy in cystic fibrosis: study of 113 patients

    International Nuclear Information System (INIS)

    Piepsz, A.; Wetzburger, C.; Spehl, M.; Machin, D.; Dab, I.; Ham, H.R.; Vandevivere, J.; Baran, D.

    1980-01-01

    A long-term study has been performed on 285 lung perfusion scintigrams obtained from 113 patients with cystic fibrosis. Transverse and longitudinal comparisons with clinical and radiological scores, as well as retrospective analysis of the deceased patients, were the methods used in order to evaluate the importance of the scintigraphic images. It appears that lung scintigraphy is the best index of the regional lung impairment, and contributes, as does a chest radiograph, to the early detection of lung lesions, the two methods being complementary

  9. Biodistibution of 2,6 diisopropyliminodiacetic acid 99mTc (Disida-99mTc) in normal rats and with experimental hepatic lesion

    International Nuclear Information System (INIS)

    Colturato, M.T.; Muramoto, E.; Hamada, E.S.; Barbosa, M.R.F. de; Herrerias, R.; Silva, C.P.G. da.

    1988-07-01

    The biodistribution and elimination of 99m Tc-DISIDA were examined by performing scintigrams on rats at different times. Normal animals (rats) and those with experimental hepatobiliary alterations were used. Results showed a delayed clearance of 99m Tc-DISIDA into the small intestine of the experimental animals. The elimination of the labelled compound by the kidney was 14% dose/g 120 minutes after the injection of which 70% was found in its original form. The data indicate that in spite the compound is intact in bile it undergoes a degradative process, not yet known. (author) [pt

  10. The influence of Ki-67 proliferation index on Tc-99m-EDDA-HYNIC-TOC somatostatin receptor scintigraphy in patients with carcinoids

    OpenAIRE

    Vlajković Marina; Rajić Milena; Ilić Slobodan; Stević Miloš; Kojić Marko; Živković Vesna; Karanikolić Aleksandar; Matović Milovan

    2014-01-01

    The aim of this paper is to determine the influence of Ki-67 proliferation index on somatostatin receptor scintigraphy (SSRS) with Tc-99m-EDDA-HYNIC-TOC (Tc-99m-Tektrotyd) somatostatin analogue in patients with carcinoid tumors. Sixty-one patients (31 female, 30 male; age range: 33-76 years) were examined: 13 patients highly suspected of having a carcinoid, and 48 patients who had undergone the surgical removal of the tumor. Whole body SSRS at 4 h postinjection, spot scintigrams and SPECT of ...

  11. Differentiation of infantile jaundice with 99mTc-EHIDA hepatobiliary scintigraphy and determination of bilixanthine from duodenal drainage

    International Nuclear Information System (INIS)

    Zhao Ming; Wu Hua; Huang Zhihua

    1996-01-01

    The purpose of this study was to develop an effective diagnostic method for infantile jaundice. 99m Tc-EHIDA hepatobiliary scintigraphy and determination of bilixanthine from duodenal drainage were carried out in 33 infants with persistent jaundice. The final diagnosis was confirmed by surgical operation, pathology or clinical follow-up. For diagnosing biliary atresia, the sensitivity and specificity of scintigraphy were 100% and 72.7% respectively and those of bilixanthine measurement were 100% and 95.5%. Hepatobiliary scintigraphy may be a sensitive, simple, safe and noninvasive method for differentiating infantile jaundice. Duodenal bilixanthine determination may improve the specificity in the case without intestinal radioactivity in scintigram

  12. Digital subtraction arthrography in preoperative evaluation of painful total hip arthroplasty

    Energy Technology Data Exchange (ETDEWEB)

    Ginai, A.Z. [Dept. of Radiology, Univ. Hospital Dijkzigt, Rotterdam (Netherlands); Biezen, F.C. van [Dept. of Orthopaedics, Univ. Hospital Dijkzigt and Erasmus Univ., Rotterdam (Netherlands); Kint, P.A.M. [Dept. of Radiology, Univ. Hospital Dijkzigt, Rotterdam (Netherlands); Oei, H.Y. [Dept. of Nuclear Medicine, Univ. Hospital Dijkzigt and Erasmus Univ., Rotterdam (Netherlands); Hop, W.C.J. [Dept. of Biostatistics, Univ. Hospital Dijkzigt and Erasmus Univ., Rotterdam (Netherlands)

    1996-05-01

    Digital subtraction arthrograms, scintigrams and plain radiographs of 70 consecutive patients who underwent revision hip arthroplasty were scored individually and in masked fashion for the presence or absence of features indicating loosening of femoral and/or acetabular components. The operative findings acted as the gold standard. Digital subtraction arthrography was best for predicting a loose acetabular component, while no significant additional predictive value was found for plain radiographs and scintigraphy. Digital subtraction arthrography was also the most important modality for predicting a loose femoral component, while the plain radiograph was of significant additional value and scintigraphy was of no additional value on multivariate analysis. (orig./MG)

  13. Digital subtraction arthrography in preoperative evaluation of painful total hip arthroplasty

    International Nuclear Information System (INIS)

    Ginai, A.Z.; Biezen, F.C. van; Kint, P.A.M.; Oei, H.Y.; Hop, W.C.J.

    1996-01-01

    Digital subtraction arthrograms, scintigrams and plain radiographs of 70 consecutive patients who underwent revision hip arthroplasty were scored individually and in masked fashion for the presence or absence of features indicating loosening of femoral and/or acetabular components. The operative findings acted as the gold standard. Digital subtraction arthrography was best for predicting a loose acetabular component, while no significant additional predictive value was found for plain radiographs and scintigraphy. Digital subtraction arthrography was also the most important modality for predicting a loose femoral component, while the plain radiograph was of significant additional value and scintigraphy was of no additional value on multivariate analysis. (orig./MG)

  14. Persistent dural cerebrospinal fluid leak shown by retrograde radionuclide myelography: case report

    International Nuclear Information System (INIS)

    Kadrie, H.; Driedger, A.A.; McInnis, W.

    1976-01-01

    Following inadvertent spinal anesthesia for delivery, a patient developed incapacitating post-lumbar puncture headache that persisted for 9 weeks. Scintigrams of the lumbar region, obtained after injection of /sup 99m/Tc-human serum albumin into the cisterna magna, showed the cerebrospinal fluid leak. Blood patch repair was carried out, with immediate relief of all symptoms. Because of subsequent atypical headaches, a second cisternogram was done by the same technique. This study confirmed that there was no further dural leak, and other evidence indicated that the recurrent headache was related to functional problems

  15. Emission computerized tomography (ECT) - an introduction

    International Nuclear Information System (INIS)

    Oberhausen, E.

    1985-01-01

    It is first shown that the qualitative requirement of ECT, with regard to both the gamme camera and the possibilities of the computer system, are much higher than those of normal planar scintigraphy. A comparison of planar scintigrams and ECT pictures demonstrates that the SPECT technique is clearly superior, especially in cases of expected superpositions by tissue activity. The factors determing the visuability of lesions in the ECT pictures are discussed. Finally a classification of scintigraphic examinations is proposed to show the applications of planar imaging and those of ECT technique. This proposal is thought to stimulate further discussions. (orig.) [de

  16. Urinary tract infection in childhood: lower or upper level? DMSA scintigraphic validation of a new clinical risk index

    International Nuclear Information System (INIS)

    Bayet-Papin, B.; Decomps-Hofmann, A.; Bovier-Lapierre, M.

    2001-01-01

    Urinary tract infection in children can be limited most of time at the lower level of the urinary tractus but an extension to the upper level of the tractus should not be neglected due to the asymptomatic nature of the disease. In our study, we suggest a new graph to predict the probability of acute pyelonephritis only if the bacteriological urinary analyse were obtained in good conditions and without any treatment. In the other cases, a DMSA scintigram should be proposed at the earlier phase of the diagnosis not to underestimate the risk of asymptomatic pyelonephritis. (authors)

  17. Renal uptake of dimercaptosuccinic acid and glomerular filtration rate in chronic nephropathy at angiotensin converting enzyme inhibition

    International Nuclear Information System (INIS)

    Kamper, A.L.; Thomsen, H.S.; Nielsen, S.L.; Strandgaard, S.; Herlev Hospital

    1990-01-01

    Glomerular filtration rate (GFR) and renal uptake of dimercaptosuccinic acid (DMSA) were measured in 31 patients with progressive chronic nephropathy before and immediately after the start of treatment with angiotensin converting enzyme (ACE) inhibitor in order to control adverse effects on kidney function. Scintigrams of the kidneys showed an unaltered distribution of DMSA during treatment. GFR estimated by 51 Cr-EDTA plasma clearance fell by 14% (P 99m Tc-DMSA increased by 10% (P<0.01). It is concluded that DMSA in chronic renal failure is mainly taken up by the tubular cells from the peritubular capillaries since the uptake was unaffected by the acute decrease in GFR. (orig.)

  18. Primary diagnosis of multiple pheochromocytomas in the brother of a MEN-2 patient by simultaneous MIBG scintigraphy and low-dose computed tomography

    DEFF Research Database (Denmark)

    Kjaer, Andreas; Petersen, Claus Leth

    2002-01-01

    Metaiodobenzylguanidine (MIBG) scintigraphy is a well-established functional imaging method for localizing pheochromocytomas. However, the morphologic information revealed on the scintigram is often too sparse and thus, accordingly, supplemental computed tomography (CT) or magnetic resonance...... in both adrenal glands and one extra-adrenal pheochromocytoma located in the liver. The combined imaging ensured the final diagnosis without any need for further imaging. Based on the findings of this case, the authors believe that combined MIBG scintigraphy and low-dose CT is a promising future single...

  19. Atlas of liver imaging

    International Nuclear Information System (INIS)

    1989-05-01

    This atlas is an outcome of an IAEA co-ordinated research programme. In addition to Japan, nine other Asian countries participated in the project and 293 liver scintigrams (116 from Japanese institutions and 177 from seven Asian countries) were evaluated by physicians from the participating Asian countries. The computer analysis of the scan findings of the individual physicians was carried out and individual scores have been separately tabulated for: (a) scan abnormality; (b) space occupying lesions; (c) cirrhosis and (d) diffuse liver diseases like hepatitis. Refs, figs and tabs

  20. Radionuclide bone scanning in reflex sympathetic dystrophy syndrome. L'exploration scintigraphique dans l'algodystrophie sympathique reflexe

    Energy Technology Data Exchange (ETDEWEB)

    Manicourt, D.H. (Louvain Univ., Brussels (Belgium). Cliniques Universitaires St. Luc)

    1994-11-01

    Three-phase radionuclide bone scanning is extremely useful in patients with suspected reflex sympathetic dystrophy syndrome. The functional data it provides can be analyzed either visually or semiquantitatively. Its many advantages include good sensitivity; however, its specificity varies substantially across sites and clinical patterns. The main differential diagnoses are reviewed. Semiquantitative analysis of scintigram data is of limited diagnostic usefulness but provides valuable pathophysiological information and can be helpful in guiding therapeutic decisions. Semiquantitative analysis has demonstrated that the severity and duration of changes in radionuclide uptake vary widely across sites and that effects on scintigraphic parameters differ between calcitonin and pamidronate. (author). 85 refs., 10 figs., 6 tabs.

  1. Clinical evaluation of /sup 67/Ga-citrate scintigraphy to detect inflammatory lesions in patients with unknown fever

    Energy Technology Data Exchange (ETDEWEB)

    Tonami, N.; Ichiyanagi, K.; Matsuda, H. (Kanazawa Univ. (Japan). School of Medicine)

    1980-12-01

    /sup 67/Ga scintigraphy was performed in 34 patients with unknown fever and suspected inflammatory lesions. Twenty out of 22 patients (91%) with inflammatory lesions were positive on /sup 67/Ga scintigram. False negative result was seen in two patients, one with subcutaneous abscess under antibiotic treatment and another with ulcerative collitis being diagnosed to have only physiological /sup 67/Ga uptake. One false positive uptake was seen on the operative scar. /sup 67/Ga scintigraphy was useful to detect not only localized abdominal inflammatory lesions but also pulmonary infections which were negative on chest X-ray films.

  2. Carotid body paraganglioma metastatic to bone: report of two cases

    International Nuclear Information System (INIS)

    Kawai, A.; Healey, J.H.; Wilson, S.C.; Huvos, A.G.; Yeh, S.D.J.

    1998-01-01

    Two patients with carotid body paraganglioma developed bone metastases 3 and 6 years respectively after surgical excision of the primary tumors. Plain radiographs showed ill-defined metastatic lesions. Scintigram using radiolabeled metaiodobenzylguanidine, an analogue of noradrenaline that is taken up by neurosecretary granules, showed an abnormal accumulation in the corresponding metastatic lesion. Histologically, nests of epithelioid cells with clear cytoplasm and pyknotic nuclei and abundant collagen fibers were observed within destroyed trabeculae. Treatment including external radiation and surgery provided pain relief and early local disease control. (orig.)

  3. Verification on the use of the Inoue method for precisely determining glomerular filtration rate in Philippine pediatrics

    Science.gov (United States)

    Magcase, M. J. D. J.; Duyan, A. Q.; Carpio, J.; Carbonell, C. A.; Trono, J. D.

    2015-06-01

    The objective of this study is to validate the Inoue method so that it would be the preferential choice in determining glomerular filtration rate (GFR) in Philippine pediatrics. The study consisted of 36 patients ranging from ages 2 months to 19 years old. The subjects used were those who were previously subjected to in-vitro method. The scintigrams of the invitro method was obtained and processed for split percentage uptake and for parameters needed to obtain Inoue GFR. The result of this paper correlates the Inoue GFR and In-vitro method (r = 0.926). Thus, Inoue method is a viable, simple, and practical technique in determining GFR in pediatric patients.

  4. Urinary tract infection in childhood: lower or upper level? DMSA scintigraphic validation of a new clinical risk index; Infection urinaire de l'enfant: est-elle haute ou basse? proposition d'un score diagnostique valide par la scintigraphie renale au DMSA

    Energy Technology Data Exchange (ETDEWEB)

    Bayet-Papin, B.; Decomps-Hofmann, A.; Bovier-Lapierre, M. [Centre Hospitalier, Service de Medecine Nucleaire, 73 - Chambery (France)

    2001-04-01

    Urinary tract infection in children can be limited most of time at the lower level of the urinary tractus but an extension to the upper level of the tractus should not be neglected due to the asymptomatic nature of the disease. In our study, we suggest a new graph to predict the probability of acute pyelonephritis only if the bacteriological urinary analyse were obtained in good conditions and without any treatment. In the other cases, a DMSA scintigram should be proposed at the earlier phase of the diagnosis not to underestimate the risk of asymptomatic pyelonephritis. (authors)

  5. Exercise electrocardiography and myocardial scintigraphy in the serial evaluation of the results of percutaneous transluminal coronary angioplasty

    International Nuclear Information System (INIS)

    Schall, J.M.; Chaitman, B.R.; David, P.R.; Dupras, G.; Brevers, G; Val, P.G.; Crepeau, J.; Lesperance, J.; Bourassa, M.G.

    1982-01-01

    The diagnostic value of exercise electrocardiography using 14 leads and thallium-201 scintigraphy were evaluated in 54 of 70 patients who underwent percutaneous transluminal coronary angioplasty (PTCA), both in the initial assessment and serial follow-up of patients after PTCA. Of the 45 patients who had successful PTCA, 36 had complete noninvasive studies performed before and 1 month after PTCA. The use of clinical symptoms in conjunction with the physiologic data, ECG and myocardial scintigram acquired during exercise provide important short-term data on the angiographic evolution of PTCA results. The noninvasive tests may be useful in determining guidelines for repeat angiography in patients who have had PTCA

  6. Clinical evaluation of adrenal computed tomography and scintigraphy

    International Nuclear Information System (INIS)

    Hayasaka, Kazumasa; Yoshikawa, Hiroyuki; Asano, Akira; Kikuchi, Yuzo; Amo, Kazuo

    1983-01-01

    In 15 cases with adrenal lesion, we studied the clinical usefulness of computed tomography (CT) and scintigram. CT and RI have been successfully to locate adrenal funtioning cortical tumors (6/6) as small as 10 mm in diameter. In 5 adrenal non-funtioning cortical and medullary disorders, RI finding only shows RI activity is decreasing, but CT may be helpful in differential diagnosis. At present, CT is a reliable technique for locating adrenal disorders, and we should suggest that it should be the initial radiographic investigation. (author)

  7. Radionuclide bone imaging in spondylolysis of the lumbar spine in children

    International Nuclear Information System (INIS)

    Gelfand, M.J.; Strife, J.L.; Kereiakes, J.G.

    1981-01-01

    Bone scintigraphy and radiography were performed in seven children with back pain. Six of the children with radiographic evidence of a pars interarticularis defect also had abnormal scintigrams. Increased uptake of the bone imaging agent occurred at six of the ten sites of radiographic pars interarticularis defects, implying increased bone metabolic activity. However, the location of scintigraphic abnormalities did not correspond to the location of radiographic abnormalities in several cases. Measurements of absorbed radiation dose indicate that plain radiography, including oblique views where appropriate, has a lower absorbed radiation dose than scintigraphy or tomography and should be performed prior to these studies

  8. Radionuclide bone imaging in spondylolysis of the lumbar spine in children

    Energy Technology Data Exchange (ETDEWEB)

    Gelfand, M.J.; Strife, J.L.; Kereiakes, J.G.

    1981-07-01

    Bone scintigraphy and radiography were performed in seven children with back pain. Six of the children with radiographic evidence of a pars interarticularis defect also had abnormal scintigrams. Increased uptake of the bone imaging agent occurred at six of the ten sites of radiographic pars interarticularis defects, implying increased bone metabolic activity. However, the location of scintigraphic abnormalities did not correspond to the location of radiographic abnormalities in several cases. Measurements of absorbed radiation dose indicate that plain radiography, including oblique views where appropriate, has a lower absorbed radiation dose than scintigraphy or tomography and should be performed prior to these studies.

  9. Sympathetic neuropathy in diabetes mellitus patients does not elicit Charcot osteoarthropathy

    DEFF Research Database (Denmark)

    Christensen, Tomas M; Simonsen, Lene; Holstein, Per E

    2011-01-01

    was the patients with acute Charcot foot (n=17) or chronic Charcot foot (n=7). The inclusion criterion for an acute Charcot foot was a temperature difference of more than 2° between the two feet, oedema of the affected foot, typical hotspots in a bone scintigram and a typical clinical course. In addition, patients......: The patients with acute Charcot foot and first toe amputation had an increased blood flow in the affected foot and weakened but not absent venoarteriolar sympathetic axon reflex. In the other patient groups, a normal venoarteriolar sympathetic axon reflex in the feet was found. CONCLUSIONS: Peripheral...

  10. Clinical value of renal images obtained incidentally to bone scintigraphy

    International Nuclear Information System (INIS)

    Ohishi, Y.; Machida, T.; Miki, M.; Kido, A.; Tanaka, A.

    1982-01-01

    Various studies were made on 400 renal (including 325 clinical cases) observed during whole-body bone scintigraphy using 99mTc-MDP. Asymmetrical renal images in bone scintigrams were obtained from 40% of the urologic patients and 7.5% of the nonurologic patients. Out of the asymmetrical images of the urologic patients, 50% provided nonvisualized kidneys and 35% showed unilateral renal high accumulation. It can be said from the above that renal images incidentally obtained during whole-body bone scintigraphy should not be overlooked

  11. Artificial intelligence. Application of the Statistical Neural Networks computer program in nuclear medicine

    International Nuclear Information System (INIS)

    Stefaniak, B.; Cholewinski, W.; Tarkowska, A.

    2005-01-01

    Artificial Neural Networks (ANN) may be a tool alternative and complementary to typical statistical analysis. However, in spite of many computer application of various ANN algorithms ready for use, artificial intelligence is relatively rarely applied to data processing. In this paper practical aspects of scientific application of ANN in medicine using the Statistical Neural Networks Computer program, were presented. Several steps of data analysis with the above ANN software package were discussed shortly, from material selection and its dividing into groups to the types of obtained results. The typical problems connected with assessing scintigrams by ANN were also described. (author)

  12. Head Exposure to Cold during Whole-Body Cryostimulation: Influence on Thermal Response and Autonomic Modulation.

    Directory of Open Access Journals (Sweden)

    Julien Louis

    Full Text Available Recent research on whole-body cryotherapy has hypothesized a major responsibility of head cooling in the physiological changes classically reported after a cryostimulation session. The aim of this experiment was to verify this hypothesis by studying the influence of exposing the head to cold during whole-body cryostimulation sessions, on the thermal response and the autonomic nervous system (ANS. Over five consecutive days, two groups of 10 participants performed one whole-body cryostimulation session daily, in one of two different systems; one exposing the whole-body to cold (whole-body cryostimulation, WBC, and the other exposing the whole-body except the head (partial-body cryostimulation, PBC.10 participants constituted a control group (CON not receiving any cryostimulation. In order to isolate the head-cooling effect on recorded variables, it was ensured that the WBC and PBC systems induced the same decrease in skin temperature for all body regions (mean decrease over the 5 exposures: -8.6°C ± 1.3°C and -8.3 ± 0.7°C for WBC and PBC, respectively, which persisted up to 20-min after the sessions (P20. The WBC sessions caused an almost certain decrease in tympanic temperature from Pre to P20 (-0.28 ± 0.11°C, while it only decreased at P20 (-0.14 ± 0.05°C after PBC sessions. Heart rate almost certainly decreased after PBC (-8.6% and WBC (-12.3% sessions. Resting vagal-related heart rate variability indices (the root-mean square difference of successive normal R-R intervals, RMSSD, and high frequency band, HF were very likely to almost certainly increased after PBC (RMSSD:+49.1%, HF: +123.3% and WBC (RMSSD: +38.8%, HF:+70.3%. Plasma norepinephrine concentration was likely increased in similar proportions after PBC and WBC, but only after the first session. Both cryostimulation techniques stimulated the ANS with a predominance of parasympathetic tone activation from the first to the fifth session and in slightly greater proportion with

  13. Rare Higgs three body decay induced by top-Higgs FCNC coupling in the littlest Higgs model with T-parity

    Science.gov (United States)

    Yang, Bing-Fang; Liu, Zhi-Yong; Liu, Ning

    2017-04-01

    Motivated by the search for flavor-changing neutral current (FCNC) top quark decays at the LHC, we calculate the rare Higgs three body decay H → Wbc induced by top-Higgs FCNC coupling in the littlest Higgs model with T-parity (LHT). We find that the branching ratio of H → Wbc in the LHT model can reach O(10-7) in the allowed parameter space. Supported by National Natural Science Foundation of China (11305049, 11405047), Startup Foundation for Doctors of Henan Normal University (11112, qd15207) and Education Department Foundation of Henan Province(14A140010)

  14. Multiple loci are associated with white blood cell phenotypes.

    Directory of Open Access Journals (Sweden)

    Michael A Nalls

    2011-06-01

    Full Text Available White blood cell (WBC count is a common clinical measure from complete blood count assays, and it varies widely among healthy individuals. Total WBC count and its constituent subtypes have been shown to be moderately heritable, with the heritability estimates varying across cell types. We studied 19,509 subjects from seven cohorts in a discovery analysis, and 11,823 subjects from ten cohorts for replication analyses, to determine genetic factors influencing variability within the normal hematological range for total WBC count and five WBC subtype measures. Cohort specific data was supplied by the CHARGE, HeamGen, and INGI consortia, as well as independent collaborative studies. We identified and replicated ten associations with total WBC count and five WBC subtypes at seven different genomic loci (total WBC count-6p21 in the HLA region, 17q21 near ORMDL3, and CSF3; neutrophil count-17q21; basophil count- 3p21 near RPN1 and C3orf27; lymphocyte count-6p21, 19p13 at EPS15L1; monocyte count-2q31 at ITGA4, 3q21, 8q24 an intergenic region, 9q31 near EDG2, including three previously reported associations and seven novel associations. To investigate functional relationships among variants contributing to variability in the six WBC traits, we utilized gene expression- and pathways-based analyses. We implemented gene-clustering algorithms to evaluate functional connectivity among implicated loci and showed functional relationships across cell types. Gene expression data from whole blood was utilized to show that significant biological consequences can be extracted from our genome-wide analyses, with effect estimates for significant loci from the meta-analyses being highly corellated with the proximal gene expression. In addition, collaborative efforts between the groups contributing to this study and related studies conducted by the COGENT and RIKEN groups allowed for the examination of effect homogeneity for genome-wide significant associations across

  15. Multiple Loci Are Associated with White Blood Cell Phenotypes

    Science.gov (United States)

    Yang, Qiong; Greinacher, Andreas; Wood, Andrew R.; Garcia, Melissa; Gasparini, Paolo; Liu, Yongmei; Lumley, Thomas; Folsom, Aaron R.; Reiner, Alex P.; Gieger, Christian; Lagou, Vasiliki; Felix, Janine F.; Völzke, Henry; Gouskova, Natalia A.; Biffi, Alessandro; Döring, Angela; Völker, Uwe; Chong, Sean; Wiggins, Kerri L.; Rendon, Augusto; Dehghan, Abbas; Moore, Matt; Taylor, Kent; Wilson, James G.; Lettre, Guillaume; Hofman, Albert; Bis, Joshua C.; Pirastu, Nicola; Fox, Caroline S.; Meisinger, Christa; Sambrook, Jennifer; Arepalli, Sampath; Nauck, Matthias; Prokisch, Holger; Stephens, Jonathan; Glazer, Nicole L.; Cupples, L. Adrienne; Okada, Yukinori; Takahashi, Atsushi; Kamatani, Yoichiro; Matsuda, Koichi; Tsunoda, Tatsuhiko; Tanaka, Toshihiro; Kubo, Michiaki; Nakamura, Yusuke; Yamamoto, Kazuhiko; Kamatani, Naoyuki; Stumvoll, Michael; Tönjes, Anke; Prokopenko, Inga; Illig, Thomas; Patel, Kushang V.; Garner, Stephen F.; Kuhnel, Brigitte; Mangino, Massimo; Oostra, Ben A.; Thein, Swee Lay; Coresh, Josef; Wichmann, H.-Erich; Menzel, Stephan; Lin, JingPing; Pistis, Giorgio; Uitterlinden, André G.; Spector, Tim D.; Teumer, Alexander; Eiriksdottir, Gudny; Gudnason, Vilmundur; Bandinelli, Stefania; Frayling, Timothy M.; Chakravarti, Aravinda; van Duijn, Cornelia M.; Melzer, David; Ouwehand, Willem H.; Levy, Daniel; Boerwinkle, Eric; Singleton, Andrew B.; Hernandez, Dena G.; Longo, Dan L.; Soranzo, Nicole; Witteman, Jacqueline C. M.; Psaty, Bruce M.; Ferrucci, Luigi; Harris, Tamara B.; O'Donnell, Christopher J.; Ganesh, Santhi K.

    2011-01-01

    White blood cell (WBC) count is a common clinical measure from complete blood count assays, and it varies widely among healthy individuals. Total WBC count and its constituent subtypes have been shown to be moderately heritable, with the heritability estimates varying across cell types. We studied 19,509 subjects from seven cohorts in a discovery analysis, and 11,823 subjects from ten cohorts for replication analyses, to determine genetic factors influencing variability within the normal hematological range for total WBC count and five WBC subtype measures. Cohort specific data was supplied by the CHARGE, HeamGen, and INGI consortia, as well as independent collaborative studies. We identified and replicated ten associations with total WBC count and five WBC subtypes at seven different genomic loci (total WBC count—6p21 in the HLA region, 17q21 near ORMDL3, and CSF3; neutrophil count—17q21; basophil count- 3p21 near RPN1 and C3orf27; lymphocyte count—6p21, 19p13 at EPS15L1; monocyte count—2q31 at ITGA4, 3q21, 8q24 an intergenic region, 9q31 near EDG2), including three previously reported associations and seven novel associations. To investigate functional relationships among variants contributing to variability in the six WBC traits, we utilized gene expression- and pathways-based analyses. We implemented gene-clustering algorithms to evaluate functional connectivity among implicated loci and showed functional relationships across cell types. Gene expression data from whole blood was utilized to show that significant biological consequences can be extracted from our genome-wide analyses, with effect estimates for significant loci from the meta-analyses being highly corellated with the proximal gene expression. In addition, collaborative efforts between the groups contributing to this study and related studies conducted by the COGENT and RIKEN groups allowed for the examination of effect homogeneity for genome-wide significant associations across populations

  16. White Blood Cell Counts as Risk Markers of Developing Metabolic Syndrome and Its Components in the Predimed Study

    Science.gov (United States)

    Babio, Nancy; Ibarrola-Jurado, Núria; Bulló, Mònica; Martínez-González, Miguel Ángel; Wärnberg, Julia; Salaverría, Itziar; Ortega-Calvo, Manuel; Estruch, Ramón; Serra-Majem, Lluís; Covas, Maria Isabel; Sorli, José Vicente; Salas-Salvadó, Jordi

    2013-01-01

    Background The Metabolic Syndrome (MetS) is a cluster of metabolic abnormalities that includes hyperglucemia, hypertension, dyslipidemia and central obesity, conferring an increased risk of cardiovascular disease. The white blood cell (WBC) count has been proposed as a marker for predicting cardiovascular risk. However, few prospective studies have evaluated the relationship between WBC subtypes and risk of MetS. Methods Participants were recruited from seven PREDIMED study centers. Both a baseline cross-sectional (n = 4,377) and a prospective assessment (n = 1,637) were performed. Participants with MetS at baseline were excluded from the longitudinal analysis. The median follow-up was 3.9 years. Anthropometric measurements, blood pressure, fasting glucose, lipid profile and WBC counts were assessed at baseline and yearly during the follow-up. Participants were categorized by baseline WBC and its subtype count quartiles. Adjusted logistic regression models were fitted to assess the risk of MetS and its components. Results Of the 4,377 participants, 62.6% had MetS at baseline. Compared to the participants in the lowest baseline sex-adjusted quartile of WBC counts, those in the upper quartile showed an increased risk of having MetS (OR, 2.47; 95%CI, 2.03–2.99; P-trend<0.001). This association was also observed for all WBC subtypes, except for basophils. Compared to participants in the lowest quartile, those in the top quartile of leukocyte, neutrophil and lymphocyte count had an increased risk of MetS incidence. Leukocyte and neutrophil count were found to be strongly associated with the MetS components hypertriglyceridemia and low HDL-cholesterol. Likewise, lymphocyte counts were found to be associated with the incidence of the MetS components low HDL-cholesterol and high fasting glucose. An increase in the total WBC during the follow-up was also associated with an increased risk of MetS. Conclusions Total WBC counts, and some subtypes, were positively

  17. White blood cell counts as risk markers of developing metabolic syndrome and its components in the PREDIMED study.

    Directory of Open Access Journals (Sweden)

    Nancy Babio

    Full Text Available BACKGROUND: The Metabolic Syndrome (MetS is a cluster of metabolic abnormalities that includes hyperglucemia, hypertension, dyslipidemia and central obesity, conferring an increased risk of cardiovascular disease. The white blood cell (WBC count has been proposed as a marker for predicting cardiovascular risk. However, few prospective studies have evaluated the relationship between WBC subtypes and risk of MetS. METHODS: Participants were recruited from seven PREDIMED study centers. Both a baseline cross-sectional (n = 4,377 and a prospective assessment (n = 1,637 were performed. Participants with MetS at baseline were excluded from the longitudinal analysis. The median follow-up was 3.9 years. Anthropometric measurements, blood pressure, fasting glucose, lipid profile and WBC counts were assessed at baseline and yearly during the follow-up. Participants were categorized by baseline WBC and its subtype count quartiles. Adjusted logistic regression models were fitted to assess the risk of MetS and its components. RESULTS: Of the 4,377 participants, 62.6% had MetS at baseline. Compared to the participants in the lowest baseline sex-adjusted quartile of WBC counts, those in the upper quartile showed an increased risk of having MetS (OR, 2.47; 95%CI, 2.03-2.99; P-trend<0.001. This association was also observed for all WBC subtypes, except for basophils. Compared to participants in the lowest quartile, those in the top quartile of leukocyte, neutrophil and lymphocyte count had an increased risk of MetS incidence. Leukocyte and neutrophil count were found to be strongly associated with the MetS components hypertriglyceridemia and low HDL-cholesterol. Likewise, lymphocyte counts were found to be associated with the incidence of the MetS components low HDL-cholesterol and high fasting glucose. An increase in the total WBC during the follow-up was also associated with an increased risk of MetS. CONCLUSIONS: Total WBC counts, and some subtypes

  18. The degree of myelosuppression during maintenance therapy of adolescents with B-lineage intermediate risk acute lymphoblastic leukemia predicts risk of relapse

    DEFF Research Database (Denmark)

    Schmiegelow, K; Donovan, Martin Heyman; Sherson, Maiken Gustafsson

    2010-01-01

    Drug doses, blood levels of drug metabolites and myelotoxicity during 6-mercaptopurine/methotrexate (MTX) maintenance therapy were registered for 59 adolescents (10 years) and 176 non-adolescents (...) maintenance therapy (mWBC) was related to age (rS=0.36, P=0.02), which became nonsignificant for those who relapsed (r......S=0.05, P=0.9). The best-fit multivariate Cox regression model to predict risk of relapse included mWBC and thiopurine methyltransferase activity, which methylates mercaptopurine and reduces the intracellular availability of cytotoxic 6-thioguanine nucleotides (coefficient: 0.11, P=0...

  19. 25-hydroxyvitamin D is associated with adiposity and cardiometabolic risk factors in a predominantly vitamin D-deficient and overweight/obese but otherwise healthy cohort.

    Science.gov (United States)

    Mousa, Aya; Naderpoor, Negar; de Courten, Maximilian P J; Scragg, Robert; de Courten, Barbora

    2017-10-01

    Vitamin D deficiency has reached epidemic proportions worldwide and has recently been linked to cardiometabolic risk factors including obesity, insulin resistance, hypertension, dyslipidemia, as well as type 2 diabetes and cardiovascular disease. The objective of this study was to examine the associations between circulating 25-hydrovitamin D (25(OH)D) levels and cardiometabolic risk factors using direct measures of adiposity, glucose intolerance, and insulin resistance, as well as lipids, blood pressure, and plasma markers of inflammation. We measured circulating 25(OH)D, physical activity (International Physical Activity Questionnaire- IPAQ), anthropometry (body mass index (BMI), waist-to-hip ratio (WHR), % body fat (dual energy X-ray absorptiometry)), metabolic parameters (fasting and 2-h plasma glucose levels during oral glucose tolerance test; insulin sensitivity (M, hyperinsulinaemic-euglycaemic clamp), and cardiovascular and inflammatory profiles (blood pressure (BP), pulse pressure (PP), mean arterial pressure (MAP), plasma lipid levels, white blood cell count (WBC), and plasma high-sensitivity C-reactive protein levels (hsCRP)) in 111 healthy, non-diabetic adults (66 males/45 females; age 31.1±9.2years; % body fat 36.0±10.2%). Mean 25(OH)D was 39.8±19.8 nmol/L with no difference between genders (p=0.4). On univariate analysis, 25(OH)D was associated with% body fat (r=-0.27; p=0.005), 2-h glucose (r=-0.21; p=0.03), PP (r=0.26; p=0.006), and insulin sensitivity (r=0.20, p=0.04), but not with age, BMI, WHR, fasting glucose, BP, MAP, lipids, or inflammatory markers (all p>0.05). After adjusting for age and sex, 25(OH)D remained associated with% body fat (β=-0.12%; p=0.003), 2-h glucose (β=-0.13mmol/L; p=0.02), PP (β=0.12mmHg; p=0.009), and insulin sensitivity (β=0.22mg/kg/min; p=0.03), and became associated with fasting glucose (β=-0.04mmol/L; p=0.04) and hsCRP (β=-0.51mg/L; p=0.04). After adjusting for age, sex, and % body fat, 25(OH)D was no longer

  20. Vitamin B 12 absorption: correction of intestinal retention by whole-body profile activity of vitamin B 12-58 cobalt and by double tracer technique

    International Nuclear Information System (INIS)

    Goncalves, M.R. Bencke; Gheldof, R.; Paternot, L. van Tricht; Delmotte, E.; Verschaeren, A.; Martin, P.; Verhas, M.; Universidade Federal, Rio de Janeiro, RJ

    1997-01-01

    Full text. Intestinal retention could give false negative results in determining the whole-body retention of vitamin B 12 absorption (WBC B12-58Co). After having validate the WBC B12-58Co, taking the Schilling test as reference, we have studied the feasibility to evaluate the intestinal contamination by measurement of the profile activity distribution of vitamin B12-58Co and by a double tracer technique (WBC B12-58Co/ WBC 51 Cr Cl3). Methodology: twenty five patients were studied for the setting up of the new methodology. For eleven of them the WBC B12-58 Co retention was measured at the 7th day after the oral administration of 37KBq of B12-58Co using a four detectors whole body counter. One week later, a Schilling test was performed after the oral absorption of 18,5 KBq B12-57Co. Results were expressed as %ID. In these patients, one single peak of hepatic activity was observed on the whole body profile and thus no further intestinal correction was needed. In order to evaluate the intestinal contribution, we made in nine other patients the profile of the whole body distribution of activity at 1 h, 1 week and two weeks after the oral administration of B12-58Co. For five other patients a double tracer technique was used for intestinal correction after the simultaneous oral administration of 37 KBq of B12-58Co and 1,85 MBq of 51 Cr Cl3. The B12-58Co absorption was evaluated after intestinal correction based on subtraction of the 51Cr Cl3 contribution after the formula: B12-58Co(%ID) = WBC B12-58Co - WBC 51 Cr Cl3/1 - WBC 51 Cr Cl3. Results: the correlation with the Schilling test was found excellent: r=0,94 (n=11). The normality for WBC retention (n=7) was define as 53,2 +-12,4% ID (SD). For nine patients studied at the 7th day, the presence of a double peak (hepatic and intestinal peaks) allowed the subtraction by exponential extrapolation; the correction range was 4,4% to 37,2%. With the exception of one observation there was no difference in the measure of vitamin

  1. Clinical uses of I-123 produced by 127I(p, 5n)123Xe to 123I reaction in NIRS

    International Nuclear Information System (INIS)

    Saegusa, Kenji; Arimizu, Noboru; Uchiyama, Guio; Tateno, Yukio; Rikitake, Tomoyuki.

    1978-01-01

    123 I capsules produced by NIRS which are believed to be uncontaminated by radioactive impurities other than 125 I were compared with commercial 123 I capsules regarding gamma-ray spectra, thyroid phantoms and clinical scintigrams. Absorbed radiation doses of 123 I contaminated with nuclides other than 123 I to thyroid and whole body were also estimated. Regarding gamma-ray spectra, any nuclides other than 125 I(0.53%) did not contaminate in 123 I produced by NIRS, and it was superior to commercial capsules. Regarding phantoms and clinical scintigrams, background counts around the thyroid gland seemed to be slightly higher in commercial capsules than that produced by NIRS because of contamination with other nuclides. Exposed doses in thyroid and whole body were counted. Ratios in thyroid and whole body were increased by 30% and 9%, respectively in 123 I produced by NIRS because of contamination with 0.53% of 125 I in the event that the intake ratio of thyroid was determined as 25%. In commercial capsules the doses in thyroid and whole body were increased by 500% and 150%, respectively. Doses of commercial capsules and NIRS capsules were 7.87 rad and 1.72 rad, respectively per 100 μCi in thyroid. The ratio of NIRS capsules to commercial capsules in thyroid was 1/4.6, and that in the whole body was less than 1/2. (Ichikawa, K.)

  2. Noninvasive detection of coronary thrombi with 111In platelets: concise communication

    International Nuclear Information System (INIS)

    Bergmann, S.R.; Lerch, R.A.; Mathias, C.J.; Sobel, B.E.; Welch, M.J.

    1983-01-01

    The need for rapid, definitive identification of coronary thrombosis has been intensified by the advent of thrombolytic therapy and by interest in the role of thrombosis in the etiology of coronary artery disease. To determine whether platelet thrombi can be detected noninvasively with 111 In platelets, a method was developed in which /sup 99m/Tc-tagged red blood cells were used to correct for activity within the blood attributable to platelets circulating but not associated with thrombus. In 18 dogs coronary thrombi were induced closed-chest with a copper coil introduced into the coronary artery. 111 In platelets and /sup 99m/Tc RBCs were administered either before or 1 hr after induction of thrombus, and serial scintigrams obtained. Coronary thrombus was identified readily in the processed scintigrams. In six dogs, thrombolysis was achieved with intracoronary streptokinase. In each case serial scintigraphy demonstrated resolution of the clot. The dual radiotracer technique should permit serial noninvasive delineation of the temporal relationship between platelet deposition and coronary heart disease in patients, and should facilitate the evaluation of interventions designed to prevent platelet aggregation or to lyse existing thrombi

  3. [sup 99m]Tc-DMSA scintigraphy in children with vesico-ureteral reflux and previous urinary tract infections. Ergebnisse der [sup 99m]Tc-DMSA-Szintigraphie bei Kindern mit vesiko-ureterorenalem Reflux und vorausgegangenen Harnwegsinfektionen

    Energy Technology Data Exchange (ETDEWEB)

    Tamminen-Moebius, T. (Kinderklinik, Universitaetsklinikum Essen (Germany)); Piepsz, A. (Klinik und Poliklinik fuer Nuklearmedizin, Universitaetsklinikum Essen (Germany)); Reiners, C. (Hospital St. Pierre, Dept. of Radioisotopes, Brussels (Belgium) Koordinationszentrum ' International Reflux Study in Children' , Universitaetskinderklinik Essen (Germany))

    1994-04-01

    401 children were studied the correlation between [sup 99m]TcDMSA-scintigraphy and intravenous urogram in with vesicoureteric reflux and previous urinary tract infections (time interval from infection more than 4 weeks). Scintigraphy, together with differential uptake percentage, is an exellent method for the detection and followup of regional functional kidney abnormalities. It should however be associated with other imaging techniques. Comparing scintigraphy with intravenous urography, there is, in most cases, a good agreement of the presence of lesions with both methods. The divergences are related to the characteristics of both techniques, the scintigraphy detecting functional alterations, while intravenous urography describing the morphological changes, like kidney scars or parenchymal thinning. Although the differential diagnosis between scar and thinning was not possible by scintigraphy, the scintigram showed regional changes which were not present or recognized on the intravenous urogram. In 20% of children scintigraphic changes were observed in radiologically normal kidneys with vesicoureral reflux (past or present) and 10% of children with scars or thin areas of renal parenchyma had normal DMSA scintigram and normal uptake %. (orig./MG)

  4. Technetium 99mTc Pertechnetate Brain Scanning

    International Nuclear Information System (INIS)

    Rhee, Sang Min; Park, Jin Yung; Lee, Ahn Ki; Chung, Choo Il; Hong, Chang Gi; Rhee, Chong Heon; Koh, Chang Soon

    1968-01-01

    Technetium 99 mTc pertechnetate brain scanning were performed in 3 cases of head injury (2 chronic subdural hematomas and 1 acute epidural hematoma), 2 cases of brain abscess and 1 case of intracerebral hematoma associated with arteriovenous anomaly. In all the cases brain scintigrams showed 'hot areas.' Literatures on radioisotope scanning of intracranial lesions were briefly reviewed. With the improvement of radioisotope scanner and development of new radiopharmaceuticals brain scanning became a safe and useful screening test for diagnosis of intracranial lesions. Brain scanning can be easily performed even to a moribund patient without any discomfort and risk to the patient which are associated with cerebral angiography or pneumoencephalography. Brain scanning has been useful in diagnosis of brain tumor, brain abscess, subdural hematoma, and cerebral vascular diseases. In 80 to 90% of brain tumors positive scintigrams can be expected. Early studies were done with 203 Hg-Neohydrin or 131 I-serum albumin. With these agents, however, patients receive rather much radiation to the whole body and kidneys. In 1965 Harper introduced 99 mTc to reduce radiation dose to the patient and improve statistical variation in isotope scanning.

  5. Thyroid scintigraphy for the detection of radiation-induced thyroid cancer

    International Nuclear Information System (INIS)

    Puylaert, J.B.; Pauwels, E.K.; Goslings, B.M.; Van Daal, W.A.

    1985-01-01

    Thyroid scintigraphy with Tc-99m pertechnetate was performed in 249 patients who received radiation therapy for abnormalities in the head or neck in order to determine the role of this examination in the detection of abnormal nodules arising from cancer. These patients received a mean total dose of about 10.1 Gy. The mean follow-up period was 39 years. All patients underwent physical examination without prior knowledge of the scintigram. Scintigrams were evaluated without prior knowledge of the physical examination. In 158 cases, both the physical examination and scintigraphy were negative. In 64 cases, both examinations were positive. In ten patients, the physical examination was positive and scintigraphy was negative and vice versa in 17 patients. Of 249 patients, 28 ultimately underwent thyroid surgery; a total of four had carcinoma. A cost-benefit relationship as to routine scintigraphy as a screening procedure is presented. If patients are first screened by palpation, a number of abnormal nodules will be missed. In addition, a considerable number with positive palpation would probably undergo surgery unnecessarily. From a clinical and financial point of view, it is believed that scintigraphy is the examination of choice for screening for radiation-induced thyroid malignancies

  6. Functional scintigraphy of the thyroid

    International Nuclear Information System (INIS)

    Baehre, M.; Emrich, D.

    1983-01-01

    In order to obtain more diagnostic information by thyroid scintigraphy we used a gamma camera with a high resolution collimator and a computer. This led to an improvement of thyroid scintigrams and their documentation. Additionally it allowed to obtain values for global and regional uptake of pertechnetate before and under suppression. The usefulness of this method was proven by investigation of 50 individuals with normal thyroid function and 32 euthyroid patients with pathological suppressibility in an area of iodine deficiency. In normals global thyroid uptake and its suppression correlated with the FT 4 I and Δ TSH after TRH in dependence of their iodine excretion. Three types of pathological reaction under suppression could be delineated: 1. pure focal autonomy, 2. generalized (disseminated) autonomy, 3. combined focal and disseminated autonomy. The means of Δ TSH decreased stepwise from group 1 to 3 indicating increasing autonomy. The method is predominantly helpful to detect autonomy in euthyroid goitre. It is superior to qualitative evaluation of scintigrams. Additionally it is useful for decisions in therapy, especially for functionally orientated operation. (orig.) [de

  7. Scintigraphy of the heart using sup(99m)Tc diphosphonate in combination with selective coronary perfusion scintigraphy and coronaroangiography

    International Nuclear Information System (INIS)

    Neumann, G.; Trenckmann, H.; Duck, H.J.; Katzschmann, R.; Neugebauerova, A.; Schneider, G.; Gottschild, D.

    1980-01-01

    In 45 patients with ischemic heart disease the results obtained by myocardial scintigraphy using technetium-99m diphosphonate (Tc-99m-DP) were compared with those obtained at selective coronary angiography and selective coronary perfusion scintigraphy. The cumulation of activity in the heart muscle was seen in twelve patients. This group is analyzed in the present paper in more detail. The ventriculographic examination of the left ventricle showed disturbed motility of the wall in six patients, of whom five had a positive myocardial scintigram. In view of this, myocardial scintigraphy using Tc-99m-DP may be considered a complementary, non-invasive method for proving significant disturbances of the motility of the heart wall. Positive myocardial scintigrams were also found in angna pectoris, in a patient after aorto-coronary bypass, in cardiomyopathy and myocarditis. In view of the fact that myocardial scintigraphy using Tc-99m-DP is capable of proving disturbances of cells of the heart muscle taking place at the moment, conclusions can be drawn as to the activity in the heart muscle. It further follows that myocardial scintigraphy may be significant in indicating the aorto-coronary bypass. We failed to prove an unequivocal correlation between myocardial scintigraphy, the number of sclerotically changed coronary vessels and the degree of their narrowing. An immediate relationship could not be proved between the extent of perfusion disturbance and the results of myocardial scintigraphy

  8. Investigations on the kinetics of sup(99m)Tc methylene diphosphonate with particular consideration given to quantitative skeletal whole-body scintigraphy

    International Nuclear Information System (INIS)

    Buehler, M.

    1981-01-01

    Within the framework of this investigation the kinetics of sup(99m)Tc methylene diphosphonate was studied in 15 patients. A normal scintiscan was drawn up from a number of unremarkable single scintiscans to serve as a mean. The plasma activity curve was biexponential in character. The two compartments are expressed by two different half-lives. A half-life of 16.81 min was found for the fast compartment and a halflife of 132.63 min for the slow one. The central volume amounted an average to 6.68 l, the distribution volume in equilibrium 13.96 l and the clearance 96.69 ml/min. Nuclide excretion via the kidneys was determined from two urine samples. On average, 47.51% of the dose was excreted after 2 hr and 61.24% after 4 hr. Via a double detector system whole-body scintiscans were completed in the mean scan time of 3.64 hr p.i. These were evaluated according to the principle of the geometrical mean with subsequent norming and proportionation. A normal scintigram derived from unremarkable whole body scintigrams was taken as mean and presented optically in qualitative terms and mathematically in quantitative terms. The accuracy of whole body activity measurement is achieved by correlating measured whole-body activity with the whole-body activity expected following urination. The substance, apparatus and results are discussed. (orig./MG) [de

  9. The usefulness of bone marrow scintigraphy in the detection of bone metastasis from prostatic cancer

    International Nuclear Information System (INIS)

    Otsuka, Nobuaki; Fukunaga, Masao; Morita, Rikushi

    1985-01-01

    A combination study of bone and bone marrow scintigraphy was performed on 25 pts with prostatic cancer, and, in order to study the usefulness in the diagnosis of bone metastasis, the findings of 2 scintigraphies were compared with those of skeletal roentgenography. Out of the 18 cases with the hot spots of sup(99m)Tc-MDP in the lower lumbar spine or/and the pelvic bone, 8 showed normal bone marrow scintigrams which were eventually proved to have degenerative changes of the spine accompanied by aging. On the other hand, nine cases of the ten, who had accumulation defects on the bone marrow scintigrams were finally proved having bone metastasis. All six cases with extensive bone metastases shown by bone scintigraphy with sup(99m)Tc-MDP, demonstrated multiple accumulation defects on bone marrow scintigraphy with sup(99m)Tc-sulfur colloid. In conclusion, bone marrow scintigraphy was thought to be helpful in distinguishing the metastatic lesions from the benign spinal degenerative changes in the cases with suspicions bone involvement and in evaluating equivocal lesions in the pelvis. Therefore, it was shown that, in the detection and diagnosis of bone metastasis from prostatic cancer, bone scintigraphy alone was insufficient, and that combination with bone marrow scintigraphy was found to be useful. (author)

  10. Scintiscanning of arthritis and analysis of build-up curves

    International Nuclear Information System (INIS)

    Yamagishi, Tsuneo; Omori, Shigeo; Miyawaki, Haruo; Maniwa, Masato; Yoshizaki, Kenichi

    1975-01-01

    In the present study 40 knee joints with rheumatoid arthritis, 23 knee joints with osteoarthrosis deformans, 3 knee joints with non-synovitis, one knee joint with pyogenic arthritis and 4 normal knee joints were scanned. By analysis of build-up curves obtained immediately after the intravenous injection of sup(99m)Tc-pertechnetate, the rate of accumulation of radioactivity (t 1/2) in the affected joints was simultaneously estimated in order to compare them with clinical findings. 1. Scintiscanning of arthritis, rheumatoid arthritis, osteoarthrosis deformans of the knee joint, non-specific synovitis, and pyogenic arthritis of the knee joint, yielded a positive scan for all of the joint diseases. 2. In the scintigram of healthy knee joints, there are no areas of RI accumulation or right to left difference. 3. In some instances abnormal uptake of RI was seen on scintigrams of arthritis even after normal clinical and laboratory findings had been achieved with therapy. 4. sup(99m)Tc-pertechnetate, a radionuclide with a short half-life, allows repeated scans and provides a useful radiologic means of evaluating therapeutic course and effectiveness. 5. Analysis of build-up curves revealed that the rate of accumulation of RI was faster in rheumatoid arthritis than in osteoarthrosis deformans. (auth.)

  11. Prognostic implications of acute myocardial infarct scintigraphy with /sup 99m/Tc-pyrophosphate

    International Nuclear Information System (INIS)

    Holman, B.L.; Chisholm, R.J.; Braunwald, E.

    1978-01-01

    The predictive value of myocardial scintigraphy with /sup 99m/Tc-pyrophosphate was studied in 100 patients admitted to the coronary care unit with suspected acute myocardial infarction. None of the 21 patients with normal scintigrams had acute myocardial infarction by other criteria. Fifty-five percent of patients with diffuse uptake (pattern B), 73% of patients with focal uptake (pattern C) and all patients with intense focal uptake (pattern D) and massive uptake (pattern E) had acute infarction. The complication rate in the hospital and after discharge (mean followup: 6.1 months) for patients with pattern E was 88% compared to 42% for D, 30% for C, 36% for B and 10% for patients with normal scintigrams (A). For patients with acute infarction with patterns C, D, and E, the complication rate rose with increasing size of the myocardial uptake of /sup 99m/Tc-pyrophosphate. In addition to its diagnostic potential, scintigraphy provides prognostic information which is useful for patient triage and for therapeutic decisions early in the evolution of the infarct

  12. Myocardial infarct imaging using 99sup(m) technetium pyrophosphate

    International Nuclear Information System (INIS)

    Monzon, O.; Bravo, P.; Torres, J.; Villacorta, E.; Guzman, S.; Reloza, A.

    1977-01-01

    Technetium 99sup(m) phosphate compounds have been shown to label the activity infarcted myocardium and continue to be a widely used radiopharmaceutical for this procedure. Thirty-four patients underwent myocardial scintigraphy using 99sup(m) Tc pyrophosphate. Seventeen had acute myocardial infarction. Acute M1 is established by at least two of the following criteria: (1) history of prolonged and typical chest pain; (2) evolution of electrocardiographic changes; and (3) serial elevation of serum enzymes - CPK, SGOT and/or LDH. Seventeen control patients with no myocardial infarction have negative scintigrams (100%). Fifteen of the seventeen patients (AM1) had positive myocardial images for acute infarct. Among the thirteen patients with acute transmural infarction, the scintigrams were positive in 12 (92%) and negative in one (8%). Among the four patients with acute non-transmural studies, three (75%) were positive, and negative in one (25%). Average days from insult of myocardial damage to imaging was 3 - 18 days (mean .9 days). Good correlation in the site of myocardial infarct is established between scan and EKG

  13. Apparently normal accumulation in the patellae on bone scintigraphy

    International Nuclear Information System (INIS)

    Kato, Katsuhiko; Ikeda, Mitsuru; Tadokoro, Masanori; Yoshida, Kiyo; Kobayashi, Hidetoshi; Ishigaki, Takeo

    1997-01-01

    In the present study, we examined the influences of gender and ages on accumulation in the patellae on scintigram. The subjects were 828 patients who underwent bone scintigraphy during the past one and half years at the Department of Radiology, Nagoya University Hospital. Patients younger than 20 years old and those with abnormality of the patellae were excluded. The degree of accumulation in the patellae was evaluated using the A-P whole body scintigraphy in comparison with accumulation at the diaphysis of the femur and classified to two categories, ''Positive'' (higher accumulation than that of the diaphysis of the femur) and ''Negative'' (equal or lower than that of the diaphysis of the femur). In general, the degree of accumulation was higher in females than in males. In both males and females, the degree of accumulation increased with age. A difference between the two sides in the degree of accumulation in the patellae was observed in 32% of subjects. The results of this study may serve as basic data for the interpretation of bone scintigrams. (author)

  14. Experience with a New Colour-Scintillographic Method for Diagnosing Liver Tumours and Inflammatory Liver Disorders

    International Nuclear Information System (INIS)

    Spârchez, T.; Gheorghescu, B.; Steclaci, A.; Merculiev, E.; Popovici, M.

    1964-01-01

    In order to obtain a better picture of the structural details of the diseased parenchyma of the liver, we have been using a device which has been adapted for use with the Scanner- Tracerlab and which produces liver scans made up of seven colours. The colours are chosen arbitrarily, each one corresponding to a given number of counts and representing zones of isoradioactivity, i.e. zones of liver tissue of relatively equivalent volume. The white in these colour scintigrams represents the radiation background and the black corresponds to the peak activity in the centre of the liver, where the parenchyma is thickest. The colours in between correspond to the different zones of isoradioactivity. This method has been used to examine 150 patients suffering from malignant (primary and secondary) and benign tumours, 80 patients suffering from chronic hepatitis and cirrhosis and 50 normal subjects. In most of the cases studied, intravenous injections of colloidal gold-198 (Amersham, UK) were used. In numerous cases parallel studies were carried out with mechanical scans, black-and-white photoscintigrams and colour scintigrams. Diagnoses were checked by means of punctures, laparoscopy, laparophotography or cinematography, biopsic punctures, surgery and necropsy. Colour scintillography brings out more clearly the variations in the intensity of the radioactivity, i.e. the disorganization of the parenchyma of the liver or its substitution by tumoral processes. (author) [fr

  15. Cleansing the colon in gallium-67 scintigraphy: a prospective comparison of regimens

    International Nuclear Information System (INIS)

    Novetsky, G.J.; Turner, D.A.; Ali, A.; Raynor, W.J.; Fordham, E.W.

    1981-01-01

    Colonic accumulation of gallium-67 frequently complicates the interpretation of gallium-67 scintigrams. Although various modes of cleansing the colon prior to scintigraphy have been suggested, there is controversy over their efficacy and none have been tested prospectively. Three hundred nine patients undergoing gallium-67 scintigraphy were randomly assigned to one of four cleansing regimens: (1) a high fiber diet (78 patients); (2) castor oil (76); (3) milk of magnesia and cascara (76); and (4) no preparation (79). Patient compliance rates for the four regimens were 17%, 32%, 36%, and 46%, respectively. After noncompliant patients were excluded, gallium-67 scintigrams were graded for colonic activity on a scale of 0-3 by three independent, experienced observers. Gallium-67 activity in the colon was significantly less after adminstration of castor oil than after no prepartion (p = 0.083). Regimen 3 did not produce significantly better results than regimen 4 (p = 0.42). A major impediment to the success of any cleansing regimen seems to be poor compliance of patients

  16. Cleansing the colon in gallium-67 scintigraphy: a prospective comparison of regimens.

    Science.gov (United States)

    Novetsky, G J; Turner, D A; Ali, A; Raynor, W J; Fordham, E W

    1981-11-01

    Colonic accumulation of gallium-67 frequently complicates the interpretation of gallium-67 scintigrams. Although various modes of cleansing the colon prior to scintigraphy have been suggested, there is controversy over their efficacy and none have been tested prospectively. Three hundred nine patients undergoing gallium-67 scintigraphy were randomly assigned to one of four cleansing regimens: (1) a high fiber diet (78 patients); (2) castor oil (76); (3) milk of magnesia and cascara (76); and (4) not preparation (79). Patient compliance rates for the four regimens were 17%, 32%, 36%, and 46%, respectively. After noncompliant patients were excluded, gallium-67 scintigrams were graded for colonic activity on a scale of 0-3 by three independent, experienced observers. Gallium-67 activity in the colon was significantly less after administration of castor oil than after no preparation (p = 0.047). A high fiber diet also resulted in a substantial reduction of colonic activity when compared with no preparation; the difference, however, was not statistically significant (p = 0.083). Regimen 3 did not produce significantly better results than regimen 4 (p = 0.42). A major impediment to the success of any cleansing regimen seems to be poor compliance of patients.

  17. Cleansing the colon in gallium-67 scintigraphy: a prospective comparison of regimens

    International Nuclear Information System (INIS)

    Novetsky, G.J.; Turner, D.A.; Ali, A.; Raynor, W.J. Jr.; Fordham, E.W.

    1981-01-01

    Colonic accumulation of gallium-67 frequently complicates the interpretation of gallium-67 scintigrams. Although various modes of cleansing the colon prior to scintigraphy have been suggested, there is controversy over their efficacy and none have been tested prospectively. Three hundred nine patients undergoing gallium-67 scintigraphy were randomly assigned to one of four cleansing regimens: (1) a high fiber diet (78 patients); (2) castor oil (76); (3) milk of magnesia and cascara (76); and (4) not preparation (79). Patient compliance rates for the four regimens were 17%, 32%, 36%, and 46%, respectively. After noncompliant patients were excluded, gallium-67 scintigrams were graded for colonic activity on a scale of 0-3 by three independent, experienced observers. Gallium-67 activity in the colon was significantly less after administration of castor oil than after no preparation (p . 0.047). A high fiber diet also resulted in a substantial reduction of colonic activity when compared with no preparation; the difference, however, was not statistically significant (p . 0.083). Regimen 3 did not produce significantly better results than regimen 4 (p . 0.42). A major impediment to the success of any cleansing regimen seems to be poor compliance of patients

  18. Quantitative bone scintigraphy. A study in patients with prostatic carcinoma

    International Nuclear Information System (INIS)

    Sundkvist, G.

    1991-01-01

    Quantitative bone scintigraphy was performed in patients with prostatic carcinoma before orchiectomy as well as two weeks, two and six months after operation. The count rate was recorded as serial gamma camera images over the lower thoracic and all lumbar vertebrae from 1 to 240 min and at 24 h after injection of 99T c m -MDP. In almost all abnormal vertebrae an increased count rate was observed within one hour after injection. Most of the vertebrae which were considered normal at 4 h after injection, but had an increased 24h/4h ratio developed into abnormal vertebrae later in the study. The patients with normal bone scintigrams showed no change in 99 Tc m -MDP uptake during the study. The reproducibility of quantitative bone scintigraphy was found to be ± 7% (1 SD). In response to therapy, most of the patients with abnormal bone scintigrams showed an increase in count rate two weeks after operation followed by a decrease to the pre-operative level after two months and a further decrease after six months. This so called 'flare phenomenon' was found to indicate 99 Tc m -MDP in the vascular phase as well as an active bone uptake. In some of the patients the whole-body retention of 99 Tc m -MDP after 24 h and the bone mineral density in the vertebrae were determined and found to be valuable in the interpretation of skeletal metastases and the assessment of response to therapy. (71 refs.)

  19. Myocardial involvement in diabetic patients evaluated by exercise thallium-201 scintigraphy and cardiac catheterization

    International Nuclear Information System (INIS)

    Mizuno, Sumio; Genda, Akira; Nakayama, Akira; Igarashi, Yutaka; Takeda, Ryoyu

    1985-01-01

    To evaluate myocardial involvement in diabetes mellitus, we studied 39 patients with negative double-Master's test and without hypertension by exercise thallium-201 (Tl-201) myocardial scintigraphy using a bicycle ergometer. Among the 39 patients, 12 (30.8 %) showed filling defects in the scintigrams (positive cases), including eight with stress-induced defects and four with fixed defects. The positive cases had higher scores of diabetic complications (3.6 +- 2.4 vs 2.1 +- 1.8; p < 0.05) and longer durations of diabetes as compared with those of the negative cases. The frequency of insulin therapy was also greater in the positive cases. Eleven patients (5 positive and 6 negative cases) who underwent cardiac catheterization had no significant stenotic lesions of their coronary arteries. However, all of the positive cases showed abnormal wall motion, mainly hypokinesis, by left ventriculography (LVG). The abnormalities of the LVG corresponded to the findings of the scintigrams (i.e. filling defects and decrease in washout ratios by circumferential profile analysis). These results suggest that in some diabetics myocardial involvement exists in the early stage without overt cardiac disease and exercise Tl-201 scintigraphy is useful in detecting pre-clinical cardiomyopathy. Cardiomyopathy in diabetics seems to be due to disturbances of the myocardial microcirculation. (author)

  20. Correlation of 111In-labeled leukocyte scintigraphy with clinical and laboratory findings

    International Nuclear Information System (INIS)

    Uchida, Yoshitaka; Kitakata, Yuusuke; Uno, Kimiichi; Minoshima, Satoshi; Arimizu, Noboru.

    1993-01-01

    This study evaluated the relationship between 111 In-labeled leukocyte scintigraphy and clinical information and laboratory findings in 24 patients with bone infection and 35 patients with abdominal infection. Fifty-nine scintigrams were retrospectively reviewed and classified into positive or negative results. As the laboratory findings, C-reactive protein (CRP) level, erythrocyte sedimentation rate (ESR) at 60 minutes, and peripheral blood leukocyte counts (WBCC) were evaluated. Clinical information such as presence of fever and administration of antibiotics was also compared. No significant relationship between the scintigraphic results and clinical as well as laboratory findings was observed in bone infection patients. CRP levels in positive scintigraphic patients were significantly higher than those in negative scintigraphic patients in the abdominal infection group, otherwise the other indices were not correlated with the scintigraphic results. A few patients with slightly increased CRP (mostly chronic cases) did not show positive scintigrams, suggesting an increased false negative rate of leukocyte scintigraphy in such circumstances. These results suggest that it is inappropriate to determine the application of leukocyte scintigraphy depending on clinical as well as laboratory findings, and leukocyte scintigraphy would yield additional information different from other indices when evaluating inflammatory foci. (author)

  1. The superiority and benefits of whole body imaging after radioiodine -131 therapy over radioiodine 131 diagnostic imaging in management of thyroid carcinomas

    International Nuclear Information System (INIS)

    Aleid, M.A.

    1995-01-01

    A comparison between diagnostic and post therapeutic radioiodine imaging methods utilized in detection of thyroid metastases in 34 patients with well differentiated thyroid cancer was performed. The study revealed that the differences in detection on neck activity only between the two methods for papillary and follicular thyroid cancer were 35% and 27% respectively. While the overall detection percentages in both papillary and follicular thyroid cancers cases were 23% in diagnostic and 76% in post therapy scintigrams and the detection difference between the methods was 53% when all lesions throughout the body were seen on scintigram for only follicular thyroid cancer cases were counted, the detection percentage was increased up to 109%. It is clear that post therapeutic scans visualize an additional site activity not shown in diagnostic scans. There fore, post therapeutic imaging method is far superior to diagnostic imaging method and highly sensitive in visualization of thyroid metastases. On the other hand, this research also achieves many scientific and financial benefits. Therefore. This method should be adopted in management and follow up of well differentiated malignancies. 2 figs., 2 tabs

  2. Usefulness of 67Ga scintigraphy in deciding surgical indication in secondary hyperparathyroidism

    International Nuclear Information System (INIS)

    Otsuka, Nobuaki; Mimura, Hiroaki; Sone, Teruki; Tamada, Tsutomu; Yanagimoto, Shinichi; Tomomitsu, Tatsushi; Fukunaga, Masao; Katagiri, Makoto

    1999-01-01

    In order to evaluate the usefulness in deciding surgical indication in secondary hyperparathyroidism (SHP), 67 Ga scintigraphy was performed in 37 patients of SHP before parathyroidectomy (PTx). The radionuclide accumulation in skull and submandible was classified into 4 patterns (skull-submandibular pattern, skull pattern, submandibular pattern and normal pattern). Serum alkaline phosphatase levels were significantly elevated in patients of skull-submandibular pattern (13 cases) compared with skull pattern (6 cases), submandibular pattern (6 cases) and normal pattern (12 cases). Serum intact parathyroid hormone levels were significantly elevated in patients of skull-submandibular and skull patterns compared with normal pattern. No significant difference was observed among the weight of resected parathyroid glands. In 4 of 6 patients of normal pattern on 67 Ga scintigram, bone scintigraphy showed a characteristic pattern of SHP including an increased accumulation in the skull and submandible. Bone mineral density (BMD) in the distal radius was increased within six to twelve months after PTx in 10 of 11 patients of skull-submandibular pattern on 67 Ga scintigram, whereas only one patient showed an increase in BMD in 9 patients of normal pattern. In summary, it was concluded that 67 Ga scintigraphy could provide a useful information in deciding the indication for PTx in secondary hyperparathyroidism. (author)

  3. Somatostatin receptor scintigraphy in patients with cat-scratch disease

    International Nuclear Information System (INIS)

    Krause, R.; Schnedl, W.J.; Hoier, S.; Piswanger-Soelkner, C.; Lipp, R.W.; Daxboeck, F.; Reisinger, E.C.

    2006-01-01

    Aim: somatostatin receptor scintigraphy images various neoplastic, granulomatous, and auto-immun diseases. Cat-scratch disease in an infectious granulomatous disease usually affecting the lymphnodes. It is not known whether cat-scratch disease provides positive somatostatin receptor scintigrams. Patients, methods: twelve patients with lymphadenitis and suspected cat-scratch disease were investigated by immunofluorescence antibody testing and somatostatin receptor scintigraphy. Suppurated lymphnodes were extracted or drained and Bartonella henselae specific PCR was then performed. Results: eleven of 12 patients showed IgG antibodies against B. henselea. SRS showed positive scintigraphic results in 6 of 11 patients with CSD. B. henselae DNA was detected in tissue of lymphnodes from 4 of 5 patients with lymphnode extraction or lymphnode drainage. SRS demonstrated positive scintigrams in all patients with a positive PCR. In one patient with suspected CSD SRS was negative as well as antibody testing. Conclusion: somatostatin receptor scintigraphy correlated with positive Bartonella henselae specific PCR tests and positive Bartonella henselae specific antibody tests in patients with CSD. (orig.)

  4. Somatostatin receptor scintigraphy in patients with cat-scratch disease

    Energy Technology Data Exchange (ETDEWEB)

    Krause, R.; Schnedl, W.J.; Hoier, S. [Div. of Infectious Diseases, Dept. of Internal Medicine, Univ. Graz (Austria); Piswanger-Soelkner, C.; Lipp, R.W. [Div. of Nuclear Medicine, Dept. of Internal Medicine, Univ. Graz (Austria); Daxboeck, F. [Clinical Inst. for Hygiene and Medical Microbiology, Div. of Hospital Hygiene, Univ. of Vienna (Austria); Reisinger, E.C. [Div. of Infectious Diseases and Tropical Medicine, Dept. of Internal Medicine, Univ. Rostock (Germany)

    2006-07-01

    Aim: somatostatin receptor scintigraphy images various neoplastic, granulomatous, and auto-immun diseases. Cat-scratch disease in an infectious granulomatous disease usually affecting the lymphnodes. It is not known whether cat-scratch disease provides positive somatostatin receptor scintigrams. Patients, methods: twelve patients with lymphadenitis and suspected cat-scratch disease were investigated by immunofluorescence antibody testing and somatostatin receptor scintigraphy. Suppurated lymphnodes were extracted or drained and Bartonella henselae specific PCR was then performed. Results: eleven of 12 patients showed IgG antibodies against B. henselea. SRS showed positive scintigraphic results in 6 of 11 patients with CSD. B. henselae DNA was detected in tissue of lymphnodes from 4 of 5 patients with lymphnode extraction or lymphnode drainage. SRS demonstrated positive scintigrams in all patients with a positive PCR. In one patient with suspected CSD SRS was negative as well as antibody testing. Conclusion: somatostatin receptor scintigraphy correlated with positive Bartonella henselae specific PCR tests and positive Bartonella henselae specific antibody tests in patients with CSD. (orig.)

  5. Exercise and redistribution myocardial scintigraphy with thallium-201 in patients with coronary artery disease

    International Nuclear Information System (INIS)

    Ruzyllo, W.; Letowski, A.; Wroblewska, M.; Stepinska, J.

    1980-01-01

    Exercise and redistribution myocardial scintigraphy using thallium-201 was performed in 23 patients with clinically typical coronary artery disease or with suspected coronary disease. Coronarographic findings were compared with the results of scintigraphic examination and exercise test. New defect appearance or enlargement of the pre-existing defect in exercise scintigram in comparison to redistribution scintigram was found in 12 out of 15 patients with at least 50% stenosis of at least one of three main coronary arteries. In this group electrocardiographic effort tolerance test was positive in 9 cases. In 2 patients with clinical suspicion of coronary arterial disease but normal ventriculography and coronarography the myocardial pattern was normal during exercise scintigraphy, while the result of the effort tolerance test was positive in one case. Myocardial scintigraphy using one dose of thallium-201 connected with effort tolerance test is a non-invasive method for determination of local disturbances in myocardial perfusion and may serve as a screening test for coronarographic investigations. (author)

  6. The influence of sex on the haematological values of apparently ...

    African Journals Online (AJOL)

    Blood samples were collected from fifty apparently healthy adult Sahel goats, twenty five each of male and female in Maiduguri to assess the influence of sex on their haematology. The red blood cell (RBC) counts, white blood cell (WBC) counts, haemoglobin (Hb) concentration, packed cell volume (PCV), platelet counts, ...

  7. Sex Comparison of White Fulani Cattle Blood Profile in ...

    African Journals Online (AJOL)

    Data obtained were subjected to one-way analysis of variance (AOVA). The results show that white blood cell count (WBC) was significantly (P<0.05) higher in females (17.23±1.08) than in males (12.25±0.77). Mean Corpuscular haemoglobin concentration (MCHC) also showed sex differences with females having higher ...

  8. Comparing leukapheresis protocols for an AML patient with symptomatic leukostasis.

    Science.gov (United States)

    Cline, Abigail; Jajosky, Ryan; Shikle, James; Bollag, Roni

    2017-09-22

    Acute myeloid leukemia (AML) is a malignancy characterized by rapid clonal proliferation of myeloid precursors, which can result in hyperleukocytosis. Leukapheresis can be used to rapidly reduce the white blood cell count (WBC). However, the only FDA cleared device for WBC depletion, the COBE Spectra, will no longer be supported by the manufacturer in 2017, and there are few studies comparing different methods of leukapheresis. A 68-year-old African American female was admitted to the hospital for relapse of her AML. Laboratory data demonstrated a WBC count of 291 600/μL and flow cytometry of the peripheral blood demonstrated 85% myeloid blasts. Leukapheresis was ordered to help treat the leukostasis. Three different apheresis protocols were used to achieve cytoreduction: Spectra Optia mononuclear collection (MNC) protocol, Spectra Optia granulocyte collection (PMN) protocol, and Therakos CELLEX buffy coat collection without return. Due to different inlet flow rates, the procedures were evaluated based on the number of WBCs collected and volume of blood processed (VBP). The Spectra Optia PMN collected the most WBCs and collected nearly as many WBCs per VBP as the Therakos CELLEX, which had the highest value. To our knowledge, we are reporting the first use of Therakos CELLEX and Spectra Optia PMN protocol for WBC depletion. While the Spectra Optia granulocyte protocol showed the best performance for this AML patient, further studies will be needed to compare the Spectra Optia PMN protocol to the MNC protocol for AML patients. © 2017 Wiley Periodicals, Inc.

  9. Download this PDF file

    African Journals Online (AJOL)

    USER

    cell count, platelet, red cell indices (MCV, MCH, and MCHC) and reticulocyte count were estimated using the Sysmex XT 2000i Haematology analyser according to the instructions given by the manufacturer. Results: The mean values in the males were: Haematocrit; 47±3%; white blood cell count (WBC);. 9. 9. 5.4±1.6x10 /l, ...

  10. Monocytosis In Acute Malaria Infection | Halim | Nigerian Journal of ...

    African Journals Online (AJOL)

    The Haematocrit (Hct); the white blood cell (WBC) count (total and differential), platelet count and reticulocyte count were determined prior to administration of antimalaria therapy and one week after. A sysmex 2000, auto-analyzer was used to determine all the parameters excluding reticulocyte count which was determined ...

  11. Haematology and serum biochemistry of starter broiler chickens fed ...

    African Journals Online (AJOL)

    At the end of the trial, the effect of MSP and wheat offal inclusion showed a significant effect (P<0.05) for uric acid and ALT. However, uric acid, total protein, Albumin and Globulin were highest for wheat offal diet. Furthermore, the results show that values obtained for PCV,RBC, WBC, uric acid, total protein, albumin, globulin, ...

  12. Disease: H01468 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available cases, but the use of biological agents such as rituximab or mepolizumab seems to be a promising therapeutic... (>10% of total WBC) PR3-ANCA (+) Prednisolone [DG:DG00093] Cyclophosphamide [DG:DG00675] Rituximab [DR:D029...hy P, Guillevin L, Merkel PA, Jayne DR ... TITLE ... Rituximab for the treatment of eosinophilic granulomatosi

  13. Download this PDF file

    African Journals Online (AJOL)

    (haemoglobin (Hb) levels, platelet, neutrophil, lymphocyte counts, and total white cell count (WBC) measured. o .... 1(MSP-1), MSP-2 and Glutamate-Rich Protein ..... Low plasma concentrationsof interleukin 10 in severe malarial anaemia compared with cerebraland uncomplicated malaria. Lancet 1998. 351:17681772.

  14. Impulsivity-related Traits Are Associated with Higher White Blood Cell Counts

    Science.gov (United States)

    Sutin, Angelina R.; Milaneschi, Yuri; Cannas, Alessandra; Ferrucci, Luigi; Uda, Manuela; Schlessinger, David; Zonderman, Alan B.; Terracciano, Antonio

    2012-01-01

    A chronically elevated white blood cell (WBC) count is a risk factor for morbidity and mortality. The present research tests whether facets of impulsivity – impulsiveness, excitement-seeking, self-discipline, and deliberation – are associated with chronically elevated WBC counts. Community-dwelling participants (N=5,652) from Sardinia, Italy, completed a standard personality questionnaire and provided blood samples concurrently and again three years later. Higher scores on impulsivity, in particular impulsiveness and excitement-seeking, were related to higher total WBC counts and higher lymphocyte counts at both time points. Impulsiveness was a predictor of chronic inflammation: For every standard deviation difference in this trait, there was an almost 25% higher risk of elevated WBC counts at both time points (OR=1.23, 95% CI=1.10–1.38). These associations were mediated, in part, by smoking and body mass index. The findings demonstrate that links between psychological processes and immunity are not limited to acute stressors; stable personality dispositions are associated with a chronic inflammatory state. PMID:22190235

  15. A Survey Of Normal Haematological Variables Among Adults In ...

    African Journals Online (AJOL)

    Main outcome measures: Haematological values of the following blood parameters were determined; Haemoglobin (Hb), Haematocrit(PCV), Erythrocyte (RBC) count, Leucocyte (WBC) count, Platelet count and the differential cells count (consisting of the Neutrophils, Eosinophils, Basophiles, Lymphocytes and Monocyte ...

  16. Prevalence of trypanosomiasis in relation to some haematological ...

    African Journals Online (AJOL)

    The mean white blood cell count (WBC) was higher in the infected group and gave an indication of the presence of infection while the mean packed cell volume (PVC) was lower in the infected group, an indication of anaemia. Two species of trypanosome namely T. vivax (6.09%) and T. brucei (20.0%) were encountered.

  17. Effect of Prolong Exposure to Gas Flaring on some Haematological ...

    African Journals Online (AJOL)

    MICHAEL

    morphology. The result showed that the PVC, Hb and RBC count respectively reduced, WBC count and ... packed cell volume (PVC) using the methods of .... London, pp 502-503. Eyong, EU (2000). Biochemical and toxicological implications following ingestion of shellfish exposed to crude oil polluted water. Ph.D. Thesis ...

  18. Large-Scale Exome-wide Association Analysis Identifies Loci for White Blood Cell Traits and Pleiotropy with Immune-Mediated Diseases

    NARCIS (Netherlands)

    Tajuddin, S.M. (Salman M.); U.M. Schick (Ursula); Eicher, J.D. (John D.); Chami, N. (Nathalie); Giri, A. (Ayush); J. Brody (Jennifer); W.D. Hill (W. David); T. Kacprowski (Tim); Li, J. (Jin); L.-P. Lyytikäinen (Leo-Pekka); A. Manichaikul (Ani); E. Mihailov (Evelin); M.L. O'Donoghue (Michelle L.); V.S. Pankratz (Shane); R. Pazoki (Raha); Polfus, L.M. (Linda M.); A.V. Smith (Albert Vernon); C. Schurmann (Claudia); Vacchi-Suzzi, C. (Caterina); D. Waterworth (Dawn); E. Evangelou (Evangelos); L.R. Yanek (Lisa); A.D. Burt (Alastair); M.-H. Chen (Ming-Huei); F.J.A. van Rooij (Frank); J. Floyd (James); A. Greinacher (Andreas); T.B. Harris (Tamara); H. Highland (Heather); L.A. Lange (Leslie); Y. Liu (YongMei); R. Mägi (Reedik); M.A. Nalls (Michael); J. Mathias (Jasmine); D.A. Nickerson (Deborah); K. Nikus (Kjell); J.M. Starr (John); J.-C. Tardif (Jean-Claude); I. Tzoulaki; Velez Edwards, D.R. (Digna R.); L.C. Wallentin (Lars); T.M. Bartz (Traci M.); L.C. Becker (Lewis); Denny, J.C. (Joshua C.); Raffield, L.M. (Laura M.); J.D. Rioux (John); N. Friedrich (Nele); M. Fornage (Myriam); Gao, H. (He); J.N. Hirschhorn (Joel); D.C. Liewald (David C.); S.S. Rich (Stephen); A.G. Uitterlinden (André); Bastarache, L. (Lisa); D.M. Becker (Diane); E.A. Boerwinkle (Eric); de Denus, S. (Simon); E.P. Bottinger (Erwin); C. Hayward (Caroline); Hofman, A. (Albert); G. Homuth (Georg); E.M. Lange (Ethan); Launer, L.J. (Lenore J.); T. Lehtimäki (Terho); Y. Lu (Yingchang); A. Metspalu (Andres); C.J. O'Donnell (Christopher); Quarells, R.C. (Rakale C.); Richard, M. (Melissa); Torstenson, E.S. (Eric S.); K.D. Taylor (Kent); Vergnaud, A.-C. (Anne-Claire); A.B. Zonderman; D.R. Crosslin (David); I.J. Deary (Ian J.); M. Dörr (Marcus); P. Elliott (Paul); M. Evans (Michele); V. Gudnason (Vilmundur); M. Kähönen (Mika); B.M. Psaty (Bruce); Rotter, J.I. (Jerome I.); Slater, A.J. (Andrew J.); A. Dehghan (Abbas); White, H.D. (Harvey D.); S.K. Ganesh (Santhi); R.J.F. Loos (Ruth); T. Esko (Tõnu); Faraday, N. (Nauder); J.F. Wilson (James); M. Cushman (Mary Ann); A.D. Johnson (Andrew); T.L. Edwards (Todd L.); N.A. Zakai (Neil); G. Lettre (Guillaume); A. Reiner (Alexander); P. Auer (Paul)

    2016-01-01

    textabstractWhite blood cells play diverse roles in innate and adaptive immunity. Genetic association analyses of phenotypic variation in circulating white blood cell (WBC) counts from large samples of otherwise healthy individuals can provide insights into genes and biologic pathways involved in

  19. Total leukocyte counts and neutrophil-lymphocyte count ratios among Helicobacter pylori-infected patients with peptic ulcers: independent of bacterial CagA status.

    Science.gov (United States)

    Jafarzadeh, A; Akbarpoor, V; Nabizadeh, M; Nemati, M; Rezayati, M T

    2013-01-01

    Elevated leukocyte counts can be a marker of inflammation and infection. The aim of this study was to determine the total leukocyte count and neutrophil-lymphocyte count ratio (NLCR) among Helicobacter pylori-infected patients with peptic ulcer disease (PU) and among asymptomatic subjects (AS) and to evaluate if there is an association between these lab values and the presence of the H. pylori virulence factor cytotoxin-associated gene A (CagA). Sixty H. pylori-infected PU patients, 63 AS carriers and 32 healthy H. pylori-negative subjects (controls) were included in the study. The total white blood cell (WBC) counts and differentials were determined using standard hematological methods. The mean total WBC count, mean neutrophil count and NLCR were significantly higher among PU patients than in controls (p < 0.001, p < 0.001 and p < 0.001, respectively). Similarly, the mean WBC count, mean neutrophil count and NLCR were significantly higher among AS patients than in controls (p < 0.005, p < 0.001 and p < 0.02, respectively). The differences of mean WBC counts mean neutrophil counts and NLCR were also significantly different (p < 0.005, p < 0.001 and p < 0.001, respectively) between the PU and AS patients. There were no differences in the PU and AS patients in regard to anti-CagA positivity. These results show the CagA factor was not associated with the presence or absence of symptoms in H. pylori infected patients.

  20. Some haematological and biochemical profile of blood of Nile tilapia ...

    African Journals Online (AJOL)

    The haematological and biochemical profile of blood of Nile tilapia (Oreochromis niloticus) fed on diets containing watermelon (Citrullus lanatus) seedmeal were evaluated using packed cell volume (PCV); haemoglobin content (Hb), white blood cell count (WBC), red blood cell count (RBC), mean corpuscular haemoglobin ...

  1. Methods for counting residual leukocytes in leukocyte-depleted plasma-a comparison between a routine hematology instrument, the Nageotte chamber, flow cytometry, and a fluorescent microscopy analyzer.

    Science.gov (United States)

    Petersson, Annika; Ekblom, Kim

    2017-05-01

    Counting very low levels of leukocytes is technically challenging but mandatory for quality control of leukocyte-depleted plasma. Established assays, such as flow cytometry and counting in the Nageotte chamber, are laborious and expensive. The aim of this study was to test two alternative assays, the cerebrospinal fluid program in the routine hematology analyzer ADVIA 2120 and a fluorescence microscopy analyzer, the ADAM-rWBC. Linearity, accuracy, and precision were established for the ADVIA 2120, the ADAM-rWBC analyzer and the Nageotte chamber with flow cytometry as the reference method. Two hundred consecutive leukocyte-depleted donor plasma samples were also tested. The ADAM-rWBC analyzer and the Nageotte chamber fulfilled all quality requirements. Flow cytometry fulfilled the requirements for linearity and precision. The ADVIA 2120 analyzer did not fully reach the quality criteria, and flow cytometry did not reach quality criteria on accuracy. No false-positive results on donor plasma samples were recorded. The ADAM-rWBC is suitable for the purpose of quality control of residual leukocytes in leukocyte-depleted plasma. For the ADVIA 2120, further improvements and studies are needed to reach the quality requirements stated in this study. © 2017 AABB.

  2. Nutritive evaluation of Telfairia occidentalis leaf protein concentrate ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... Fractionation led to increase in the gross energy by 22.0% and decrease in the phytate and tannin contents ..... SBM = Soybean meal, LPC = Telfairia occidentalis leaf protein concentrate, SBM = Soybean meal, PCV= Packed cell volume, WBC = White blood cell, RBC = Redblood cell, Hbc = Haemoglobin.

  3. The Treatment of the Occult in General Encyclopedias.

    Science.gov (United States)

    Sonnenfeld, Gary F.

    This paper is a content analysis of three general encyclopedias, "Encyclopedia Americana" (EA), "Encyclopaedia Brittanica" (EB), and "World Book Encyclopedia" (WBC), which quantifies the treatment of the occult. Entries are selected from each by starting with the article "Occultism" and tracing all…

  4. Effect of organic contrast Media on the haematology and Serum ...

    African Journals Online (AJOL)

    In addition, value of the serum sodium, potassium, chloride and bicarbonate ions were determined, while the sodium/potassium ratio (Na/K) and anion gap (AG) were calculated. In this study, the administration of 76% urograffin does not significantly (P>0.05%) alter the PCV, Hb, RBC, WBC and Platelets. Similarly the serum ...

  5. Effect of alcohol and paracetamol on aspect of the hematology of ...

    African Journals Online (AJOL)

    WBC) and lymphocyte counts as well as serum cholesterol level were used to access the effects of administration of alcohol and paracetamol to albino rats. Fifteen male albino rats weighing between 75 – 160 grams were grouped into five and ...

  6. Hematological clozapine monitoring with a point-of-care device

    DEFF Research Database (Denmark)

    Nielsen, Jimmi; Thode, Dorrit; Stenager, Elsebeth

    2012-01-01

    for several reasons, perhaps most importantly because of the mandatory hematological monitoring. The Chempaq Express Blood Counter (Chempaq XBC) is a point-of-care device providing counts of white blood cells (WBC) and granulocytes based on a capillary blood sampling. A randomized cross-over trial design...

  7. Hematological clozapine monitoring with a point-of-care device: A randomized cross-over trial

    DEFF Research Database (Denmark)

    Nielsen, Jimmi; Thode, Dorrit; Stenager, Elsebeth

    for several reasons, perhaps most importantly because of the mandatory hematological monitoring. The Chempaq Express Blood Counter (Chempaq XBC) is a point-of-care device providing counts of white blood cells (WBC) and granulocytes based on a capillary blood sampling. A randomized cross-over trial design...

  8. Cactus (Opuntia ficus indica f. inermis) fruit juice protects against ...

    African Journals Online (AJOL)

    HICHEM

    2013-12-18

    Dec 18, 2013 ... (MCHC), platelet (Plt) and white blood cell number (WBC)) using a hematology analyzer Coulter MAXM (Beckman Coulter, Inc.,. Fullerton, USA). Evaluation of biochemical parameters. Serum samples were obtained by the centrifugation of the blood collected in the dry tubes at 1000 x g for 10 min at 4°C, ...

  9. Single Whole-Body Cryostimulation Procedure versus Single Dry Sauna Bath: Comparison of Oxidative Impact on Healthy Male Volunteers

    Directory of Open Access Journals (Sweden)

    Paweł Sutkowy

    2015-01-01

    Full Text Available Exposure to extreme heat and cold is one of the environmental factors whose action is precisely based on the mechanisms involving free radicals. Fluctuations in ambient temperature are among the agents that toughen the human organism. The goal of the study was to evaluate the impact of extremely high (dry sauna, DS and low (whole-body cryostimulation, WBC environmental temperatures on the oxidant-antioxidant equilibrium in the blood of healthy male subjects. The subjects performed a single DS bath (n=10; 26.2 ± 4.6 years and a single WBC procedure (n=15; 27.5 ± 3.1 years. In the subjects’ blood taken immediately before and 20 min after the interventions, the activity of superoxide dismutase (SOD, catalase (CAT, and glutathione peroxidase (GPx and the concentration of thiobarbituric acid reactive substances in erythrocytes (TBARSer and blood plasma (TBARSpl were determined. Single WBC and DS procedures induced an increase in the activity of SOD and GPx, as well as SOD and CAT, respectively. The SOD activity was higher after WBC than after DS. Extremely high and low temperatures probably induce the formation of reactive oxygen species in the organisms of healthy men and, therefore, disturb the oxidant-antioxidant balance.

  10. The Development of Web-Based Collaborative Training Model for Enhancing Human Performances on ICT for Students in Banditpattanasilpa Institute

    Science.gov (United States)

    Pumipuntu, Natawut; Kidrakarn, Pachoen; Chetakarn, Somchock

    2015-01-01

    This research aimed to develop the model of Web-based Collaborative (WBC) Training model for enhancing human performances on ICT for students in Banditpattanasilpa Institute. The research is divided into three phases: 1) investigating students and teachers' training needs on ICT web-based contents and performance, 2) developing a web-based…

  11. Evaluation of Methylation Biomarkers for Detection of Circulating Tumor DNA and Application to Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Susan M. Mitchell

    2016-12-01

    Full Text Available Solid tumors shed DNA into circulation, and there is growing evidence that the detection of circulating tumor DNA (ctDNA has broad clinical utility, including monitoring of disease, prognosis, response to chemotherapy and tracking tumor heterogeneity. The appearance of ctDNA in the circulating cell-free DNA (ccfDNA isolated from plasma or serum is commonly detected by identifying tumor-specific features such as insertions, deletions, mutations and/or aberrant methylation. Methylation is a normal cell regulatory event, and since the majority of ccfDNA is derived from white blood cells (WBC, it is important that tumour-specific DNA methylation markers show rare to no methylation events in WBC DNA. We have used a novel approach for assessment of low levels of DNA methylation in WBC DNA. DNA methylation in 29 previously identified regions (residing in 17 genes was analyzed in WBC DNA and eight differentially-methylated regions (DMRs were taken through to testing in clinical samples using methylation specific PCR assays. DMRs residing in four genes, BCAT1, GRASP, IKZF1 and IRF4, exhibited low positivity, 3.5% to 7%, in the plasma of colonoscopy-confirmed healthy subjects, with the sensitivity for detection of ctDNA in colonoscopy-confirmed patients with colorectal cancer being 65%, 54.5%, 67.6% and 59% respectively.

  12. effect of amaranthus spinosus leaf extract on haematology and ...

    African Journals Online (AJOL)

    0.05) changes in the value of haematological parameters such as total red blood cell (RBC), white blood cell (WBC), packed cell volume (PCV), haemoglobin concentration (Hb) and blood coagulation time of the rats. A significant (p<0.05) ...

  13. Image acquisition and interpretation criteria for Tc-99m-HMPAO-labelled white blood cell scintigraphy : results of a multicentre study

    NARCIS (Netherlands)

    Erba, Paola A.; Glaudemans, Andor W. J. M.; Veltman, Niels C.; Sollini, Martina; Pacilio, Marta; Galli, Filippo; Dierckx, Rudi A. J. O.; Signore, Alberto

    Purpose There is no consensus yet on the best protocol for planar image acquisition and interpretation of radiolabelled white blood cell (WBC) scintigraphy. This may account for differences in reported diagnostic accuracy amongst different centres. Methods This was a multicentre retrospective study

  14. Association of acute-phase reactants with arterial stiffness in patients with type 2 diabetes mellitus.

    Science.gov (United States)

    Wakabayashi, Ichiro; Masuda, Hiroshi

    2006-03-01

    The relationship between chronic low-grade inflammation and atherosclerotic progress in patients with diabetes mellitus has not been confirmed. We determined whether acute-phase reactants are associated with arterial stiffness in diabetic patients. Relationships of blood inflammatory markers [high-sensitivity C-reactive protein (CRP), amyloid A protein (SAA), sialic acid, fibrinogen and white blood cells (WBC)] with atherosclerosis were investigated in a cross-sectional study using 114 subjects with type 2 diabetes. The degree of atherosclerosis was evaluated by arterial stiffness measured using cardio-ankle vascular index (CAVI), a new index of arterial stiffness, which is compatible with conventional aortic pulse-wave velocity. CRP, SAA, sialic acid, fibrinogen and WBC showed significant correlations with CAVI. CAVI was significantly higher in the highest tertile of sialic acid, fibrinogen and WBC compared with the lowest tertile or lowest and middle tertiles. This association was independent of age, sex and smoking. By logistic regression analysis, the highest levels of these acute-phase reactants showed increased risk of high CAVI, while CRP and SAA were not associated with an increased risk in this analysis. CAVI was also significantly correlated with duration of diabetes, blood pressure and serum total cholesterol. Acute-phase reactants, such as CRP, SAA, sialic acid, fibrinogen and WBC, are associated with arterial stiffness in patients with type 2 diabetes mellitus.

  15. Performance and egg quality characteristics of egg-type chickens as ...

    African Journals Online (AJOL)

    Performance and egg quality characteristics of egg-type chickens as influenced by fluted pumpkin ( Telfaria occidentalis ) leaf extract. ... However results for Red blood cell count (RBC) and White blood cell count (WBC) and differential were increased with FPLE intake with birds administered 120ml/litre of FPLE having the ...

  16. Nuclear Medicine Imaging in Pediatric Infection or Chronic Inflammatory Diseases

    NARCIS (Netherlands)

    Signore, Alberto; Glaudemans, Andor W. J. M.; Gheysens, Olivier; Lauri, Chiara; Catalano, Onofrio A.

    In this review article, we focus on the most recent applications of nuclear medicine techniques (mainly (99m)Tc/(111)In white blood cells (WBC) scan, [(18)F]-FDG-PET/CT, [(18)F]-FDG-PET/MRI, and (99m)Tc-IL-2 scintigraphy) in the study of children affected by peripheral bone osteomyelitis, fungal

  17. Magnesium, zinc and copper in plasma and blood cellular components in children with IDDM.

    Science.gov (United States)

    Rohn, R D; Pleban, P; Jenkins, L L

    1993-04-16

    The levels of magnesium (Mg), zinc (Zn) and copper (Cu) in the plasma, erythrocytes (RBC) and polymorphonuclear (PMN) and lymphocyte (L), leukocytes (WBC) of 45 diabetic children were compared to those of 12 normal children and were related to the diabetic control via HbA1 and fasting blood sugar (FBS) assessments. Mineral levels were determined via Zeeman-effect atomic absorption spectrophotometry following separation of plasma, RBC, and WBC fractions (PMN vs. M). ANOVA (four-way, blood components, by two-way, diabetic vs. normal children) was significant for Mg only (F = 4.60, P < 0.004). Plasma Mg and M-WBC Mg were significantly lower in children with diabetes (780 +/- 16 vs. 860 +/- 29 mumol/l and 519 +/- 33 vs. 866 +/- 86 micrograms/10(10) cells, respectively). RBC Zn was significantly lower in diabetic youngsters by t-test (0.48 +/- 0.012 vs. 0.57 +/- 0.046 per mumol/g Hgb, t = 2.79, P < 0.004), but the ANOVA for Zn was not significant. Cu level differences were not significant. HbA1 was predicted only by PMN-WBC Mg (F = 8.78, P < 0.04) and FBS by none. In conclusion, the mineral status of these diabetic children was altered in regard to Mg, but was mainly independent of diabetic control.

  18. Dietary value of honey and it effects on abdominal fat deposit, blood ...

    African Journals Online (AJOL)

    Journal of Agriculture, Forestry and the Social Sciences ... The haematological formations of Packed cell volume, Red blood cell, Haemoglobin and serum biochemical components (serum protein, albumin and creatinines) of birds improved with increasing dietary honey inclusion, while the WBC and its differential counts ...

  19. Production of cytokine and chemokines by human mononuclear cells and whole blood cells after infection with Trypanosoma cruzi

    Directory of Open Access Journals (Sweden)

    Karine Rezende-Oliveira

    2012-02-01

    Full Text Available INTRODUCTION: The innate immune response is the first mechanism of protection against Trypanosoma cruzi, and the interaction of inflammatory cells with parasite molecules may activate this response and modulate the adaptive immune system. This study aimed to analyze the levels of cytokines and chemokines synthesized by the whole blood cells (WBC and peripheral blood mononuclear cells (PBMC of individuals seronegative for Chagas disease after interaction with live T. cruzi trypomastigotes. METHODS: IL-12, IL-10, TNF-α, TGF-β, CCL-5, CCL-2, CCL-3, and CXCL-9 were measured by ELISA. Nitrite was determined by the Griess method. RESULTS: IL-10 was produced at high levels by WBC compared with PBMC, even after incubation with live trypomastigotes. Production of TNF-α by both PBMC and WBC was significantly higher after stimulation with trypomastigotes. Only PBMC produced significantly higher levels of IL-12 after parasite stimulation. Stimulation of cultures with trypomastigotes induced an increase of CXCL-9 levels produced by WBC. Nitrite levels produced by PBMC increased after the addition of parasites to the culture. CONCLUSIONS: Surface molecules of T. cruzi may induce the production of cytokines and chemokines by cells of the innate immune system through the activation of specific receptors not evaluated in this experiment. The ability to induce IL-12 and TNF-α contributes to shift the adaptive response towards a Th1 profile.

  20. Equatorward western boundary current in the Bay of Bengal during November - December 1983

    Digital Repository Service at National Institute of Oceanography (India)

    Babu, M.T.

    eastward at about 12 degrees N where curlz is zero. Subsequently, a cold core gyre (CCG) is formed in the central Bay when the zonal flow merges with the northward current at 9 degrees C. It is concluded that the WBC is mainly driven by the cross...

  1. 343-IJBCS-Article-Nwiloh Barine Innocent

    African Journals Online (AJOL)

    Dr Gatsing

    The effects of crude leaf extract of Carica papaya (Linn) on aspartate aminostransferase (AST), alanine aminotransferase (ALT), total white blood cells (WBC), lymphocytes, neutrophils, thrombocytes and on body weight of normal albino rats were investigated. Albino rats weighing between 74 g and 90.5 g, of both sexes.

  2. Physical Exercise Combined with Whole-Body Cryotherapy in Evaluating the Level of Lipid Peroxidation Products and Other Oxidant Stress Indicators in Kayakers

    Directory of Open Access Journals (Sweden)

    Paweł Sutkowy

    2014-01-01

    Full Text Available The influence of exercise combined with whole-body cryotherapy (WBC on the oxidant/antioxidant balance in healthy men was assessed. The study included 16 kayakers of the Polish National Team, aged 22.7 ± 2.6, subjected to WBC (−120°C–−145°C; 3 min twice a day for the first 10 days of a 19-day physical training cycle: pre exercise morning stimulation and post exercise afternoon recovery. Blood samples were taken on Day 0 (baseline and on Days 5, 11 and 19. The serum concentration of malondialdehyde (MDA, conjugated dienes (CD, thiobarbituric acid reactive substances (TBARS, protein carbonyls, vitamin E, urea, cortisol, and testosterone were determined, along with the glutathione peroxidase (GPx activity, the total antioxidant capacity (TAC, and morphological blood parameters. On 5th day of exercise/WBC, the baseline GPx activity decreased by 15.1% (P<0.05, while on 19th day, it increased by 19.7% (P<0.05 versus Day 5. On Day 19 TBARS concentration decreased versus baseline and Day 5 (by 15.9% and 17.4%, resp.; P<0.01. On 19 Day urea concentration also decreased versus 11 Day; however, on 5th and 11th days the level was higher versus baseline. Combining exercise during longer training cycles with WBC may be advantageous.

  3. 77 FR 46550 - Data Collection Available for Public Comments and Recommendations

    Science.gov (United States)

    2012-08-03

    ... (SBA) business counseling and training programs and Small Business Administration strategic plan is to... prospective Entrepreneurs and other student of enterprise. Form Number: 2214, SBDC, Score, WBC, Impact. Annual... request for comments. SUMMARY: In accordance with the Paperwork Reduction Act of 1995, this notice...

  4. Combat Wound Initiative Program

    Science.gov (United States)

    2010-07-01

    presence of local or systemic infection, nutritional status, and nonspecific serum markers of inflammation such as white blood cell count (WBC), erythro...6. Wang CJ, Huang HY, Pai CH: Shock wave-enhanced neovascularization at the tendon -bone junction: an experiment in dogs. J Foot Ankle Surg 2002

  5. phytochemistry and some haematological changes following oral

    African Journals Online (AJOL)

    Daniel Owu

    ORAL ADMINISTRATION OF ETHANOLIC ROOT EXTRACT OF. GONGLONEMA LATIFOLIUM IN ... respectively. WBC was significantly (P<0.01) higher in the high dose (group 3) compared with control. Mean ... eosinophils and monocytes count were significantly increased in the test groups than in controls. In conclusion,.

  6. Fulltext PDF

    Indian Academy of Sciences (India)

    Unknown

    Towler P H, Smith J D and Dixon D R 1996 Anal. Chim. Acta. 328 53. Wang W and Baptista J L 1998 J. Mater. Sci: Mater. Med. 9 159. Yamoto H, Kawaguchi T and Nagakura M 1979 IEEE Trans. Magn. 15 1141. Figure 5. Plot of percent viability of WBC as a function of time (days). Materials were kept in contact with media.

  7. The effect of aqueous extract of Carica papaya leaves on liver ...

    African Journals Online (AJOL)

    The effects of crude leaf extract of Carica papaya (Linn) on aspartate aminostransferase (AST), alanine aminotransferase (ALT), total white blood cells (WBC), lymphocytes, neutrophils, thrombocytes and on body weight of normal albino rats were investigated. Albino rats weighing between 74 g and 90.5 g, of both sexes ...

  8. Profile of C-reactive protein, white cells and neutrophil populations in febrile children from rural north-eastern Tanzania

    DEFF Research Database (Denmark)

    Mahende, Coline; Ngasala, Billy; Lusingu, John

    2017-01-01

    INTRODUCTION: C-reactive protein (CRP), white blood cell (WBC) and absolute neutrophil counts (ANC) are important inflammatory biomarkers in the early diagnosis of infections. However, little is known on their profile and usefulness in fever case management in children attending outpatient clinic...

  9. Investigation into the effects of oral contraceptives on some ...

    African Journals Online (AJOL)

    The blood PCV, WBC, platelet, neutrophil and lymphocyte analysis also showed increases. The possible implications of these findings on the female rat and by extrapolation on the female 'homo sapiens' are that laboratory tests involving full blood analysis should be undergone before these drugs are taken. Check-up tests ...

  10. Screening for Postpartum Depression in Well-Baby Care Settings : A Systematic Review

    NARCIS (Netherlands)

    van der Zee-van den Berg, Angarath I.; Boere-Boonekamp, Magda M.; IJzerman, Maarten J; Haasnoot-Smallegange, Riet M. E.; Reijneveld, Sijmen A.

    Introduction Postpartum depression (PPD) is a mental health problem frequently experienced by mothers in the first year postpartum. Early detection and treatment can help to reduce its negative effect on the development of the newborn child. Well-baby care (WBC) is a promising screening setting for

  11. Leukopenia is associated with worse but not prohibitive outcomes following emergent abdominal surgery.

    Science.gov (United States)

    Gulack, Brian C; Englum, Brian R; Lo, David D; Nussbaum, Daniel P; Keenan, Jeffrey E; Scarborough, John E; Shapiro, Mark L

    2015-09-01

    There are little data currently available to guide surgical decision making regarding emergent surgical interventions in leukopenic patients. The purpose of this study was to investigate the impact of leukopenia among patients undergoing emergency abdominal operations to better guide preoperative decision making. The 2005 to 2012 American College of Surgeons' National Surgical Quality Improvement Program database was queried to identify patients who underwent emergent laparotomy. Patients were stratified by preoperative white blood cell (WBC) count (leukopenia and mortality, taking into account the robust array of patient-related factors. Of the 20,443 patients who met study criteria, 2,057 (8.2%) were leukopenic (WBC leukopenia compared with patients with a normal preoperative WBC count. Only 46.0% (n = 947) of patients with leukopenia before surgery were able to avoid major morbidity or mortality compared with 69.4% (n = 15,974) of patients with a normal preoperative WBC count (p leukopenia was maintained as a significant predictor of mortality. Although leukopenia remains associated with mortality in patients undergoing emergent laparotomy despite adjustment for other patient-related factors, it is not necessarily prohibitive. Understanding the risk of complications and mortality associated with these procedures is pertinent for preoperative clinical decision making. Prognostic and epidemiologic study, level III.

  12. Effect of Smoking on Pharmacokinetics of Clopidogrel, an ...

    African Journals Online (AJOL)

    Conclusion: Smoking behavior may not be a significant determinant of the pharmacokinetics of clopidogrel following oral administration .... LDH, lactate dehydrogenase; RBC, red blood cell;. WBC, white blood cell; Hgb, hemoglobin ..... Montalescot G, Hacke W, Fox KA, Lincoff AM, Topol. EJ et al. Smoking, clopidogrel, and ...

  13. Characterization of sweet potato starch – the effect of cultivation time ...

    African Journals Online (AJOL)

    The physicochemical properties of the starches of seven sweet potato varieties at two harvesting times were studied. The yield of starch, pH, moisture, Water Binding Capacity (WBC), solubility, swelling volume, swelling power, ash and viscosity were monitored. Starch from the 4 month varieties had higher yields ...

  14. Koffuor et al., Afr J Tradit Complement Altern Med. (2014) 11(3):166 ...

    African Journals Online (AJOL)

    cadewumi

    1994). The therapeutically important actions of thymopoietin are probably targeting stimulation of phagocytosis and stimulation of regulatory T-cells to restore homeostasis in perturbed immune system. Throughout the experiment, Levamisole caused an increase in the WBC count of the immune compromised mice making it ...

  15. 123 - 128 Sadau et al.

    African Journals Online (AJOL)

    User

    neutrophil count in response to WRS for 3.5 hours. Some of the haematological values (PCV, RBC,. WBC, Hb, neutrophils ... homeostasis (Anil et al., 2010). Stress induces organ injury causing diseases, including, gastric ulcers ... immune systems (Ebulunlomoet al., 2012). Cytokines and cortisol play an important role in the.

  16. Do stigma and its psychosocial impact differ between Asian-born Chinese immigrants and Western-born Caucasians with head and neck cancer?

    Science.gov (United States)

    Lebel, Sophie; Payne, Ada Y M; Mah, Kenneth; Irish, Jonathan; Rodin, Gary; Devins, Gerald M

    2016-07-01

    Stigma appears to influence emotional distress and well-being in cancer survivors, but cross-cultural differences have been ignored. Previous studies suggest that stigma may be especially relevant for survivors of Asian origin. However, their study designs (e.g. focused on female cancers, qualitative designs, and an absence of comparison groups) limit the strength of this conclusion. We hypothesized that (1) Asian-born Chinese immigrants (AI) would report more perceived cancer-related stigma than Western-born Caucasians (WBC); and (2) the impact of stigma on emotional distress and well-being would be greater in AI as compared to WBC. Head and neck cancer survivors (n = 118 AI and n = 404 WBC) completed measures of well-being, emotional distress, and a three-item indicator of stigma in structured interviews. The majority of respondents (59%) reported one or more indicators of stigma. Stigma correlated significantly with emotional distress (r = .13, p = .004) and well-being (r = -.09, p = .032). Contrary to our hypotheses, WBCs and AIs did not differ in reported stigma nor did we detect differences in its psychosocial impact. Stigma exerts a deleterious psychosocial impact on head and neck cancer survivors. It did not differ significantly between AI and WBC survivors.

  17. Haematological profiles and serum lead levels in male fuel ...

    African Journals Online (AJOL)

    The haematological profiles and serum lead levels of male fuel station attendants in Calabar metropolis were determined. The haematological parameters assessed included haemoglobin concentration (Hb), haematocrit (HCT), total white blood cell count (WBC), differential white cell counts and platelet count. Age range of ...

  18. Predictors of CD4+ lymphocyte count among HIV-Seropositive and ...

    African Journals Online (AJOL)

    ... the CD4+ lymphocyte count increased by about 16 cells/mm3 for each increment of 1000 WBC cells/mm3, while each 10 mm/hr increase in ESR was associated with a reduction of CD4+ lymphocyte count of about 8 cells/mm3. Conclusion: These results show that simple and inexpensive haematological indices cannot be ...

  19. Growth pattern and structural nature of amylases produced by some ...

    African Journals Online (AJOL)

    The growth pattern and microbial biomass formed during metabolic activities of the Bacillus species on starchy substrates was determined. The result showed that the strains B. subtilis (WBS), B. licheniformis (WBL) and B. coagulans (MBC) generally had high growth rate. B. circulans (SBC) and B. coagulans (WBC) has ...

  20. Effect Of Gavage Treatment With Pulverised Garcinia Kola Seeds On ...

    African Journals Online (AJOL)

    Packed red cell volume (PCV), hemoglobin concentration (Hb), and red blood cell count (RBC) showed significantly (P < 0.05, Student's t-test) increased response to treatment with GKS; while the platelet and white blood cell (WBC) counts showed no corresponding increase with increasing GKS dosage. The mean red ...