WorldWideScience

Sample records for impairs murine immune

  1. Impaired Cellular Immunity in the Murine Neural Crest Conditional Deletion of Endothelin Receptor-B Model of Hirschsprung's Disease.

    Directory of Open Access Journals (Sweden)

    Ankush Gosain

    Full Text Available Hirschsprung's disease (HSCR is characterized by aganglionosis from failure of neural crest cell (NCC migration to the distal hindgut. Up to 40% of HSCR patients suffer Hirschsprung's-associated enterocolitis (HAEC, with an incidence that is unchanged from the pre-operative to the post-operative state. Recent reports indicate that signaling pathways involved in NCC migration may also be involved in the development of secondary lymphoid organs. We hypothesize that gastrointestinal (GI mucosal immune defects occur in HSCR that may contribute to enterocolitis. EdnrB was deleted from the neural crest (EdnrBNCC-/- resulting in mutants with defective NCC migration, distal colonic aganglionosis and the development of enterocolitis. The mucosal immune apparatus of these mice was interrogated at post-natal day (P 21-24, prior to histological signs of enterocolitis. We found that EdnrBNCC-/- display lymphopenia of their Peyer's Patches, the major inductive site of GI mucosal immunity. EdnrBNCC-/- Peyer's Patches demonstrate decreased B-lymphocytes, specifically IgM+IgDhi (Mature B-lymphocytes, which are normally activated and produce IgA following antigen presentation. EdnrBNCC-/- animals demonstrate decreased small intestinal secretory IgA, but unchanged nasal and bronchial airway secretory IgA, indicating a gut-specific defect in IgA production or secretion. In the spleen, which is the primary source of IgA-producing Mature B-lymphocytes, EdnrBNCC-/- animals display decreased B-lymphocytes, but an increase in Mature B-lymphocytes. EdnrBNCC-/- spleens are also small and show altered architecture, with decreased red pulp and a paucity of B-lymphocytes in the germinal centers and marginal zone. Taken together, these findings suggest impaired GI mucosal immunity in EdnrBNCC-/- animals, with the spleen as a potential site of the defect. These findings build upon the growing body of literature that suggests that intestinal defects in HSCR are not restricted

  2. Helicobacter pylori impairs murine dendritic cell responses to infection.

    Directory of Open Access Journals (Sweden)

    Ya-Hui Wang

    Full Text Available BACKGROUND: Helicobacter pylori, a human pathogen associated with chronic gastritis, peptic ulcer and gastric malignancies, is generally viewed as an extracellular microorganism. Here, we show that H. pylori replicates in murine bone marrow derived-dendritic cells (BMDCs within autophagosomes. METHODOLOGY/PRINCIPAL FINDINGS: A 10-fold increase of CFU is found between 2 h and 6 h p.i. in H. pylori-infected BMDCs. Autophagy is induced around the bacterium and participates at late time points of infection for the clearance of intracellular H. pylori. As a consequence of infection, LC3, LAMP1 and MHC class II molecules are retained within the H. pylori-containing vacuoles and export of MHC class II molecules to cell surface is blocked. However, formalin-fixed H. pylori still maintain this inhibitory activity in BMDC derived from wild type mice, but not in from either TLR4 or TLR2-deficient mice, suggesting the involvement of H. pylori-LPS in this process. TNF-alpha, IL-6 and IL-10 expression was also modulated upon infection showing a TLR2-specific dependent IL-10 secretion. No IL-12 was detected favoring the hypothesis of a down modulation of DC functions during H. pylori infection. Furthermore, antigen-specific T cells proliferation was also impaired upon infection. CONCLUSIONS/SIGNIFICANCE: H. pylori can infect and replicate in BMDCs and thereby affects DC-mediated immune responses. The implication of this new finding is discussed for the biological life cycle of H. pylori in the host.

  3. Partial immunity in murine by immunization with a toxoplasmic DNA ...

    African Journals Online (AJOL)

    arsenal

    2012-06-12

    Jun 12, 2012 ... vaccine can be effective in partial protection against this parasite. In this study ... that mice immunized by pcROP1 with or without alum produced high Th1 immune response compared .... antigen-specific antibodies, 96-well costar plates were coated .... vaccines against some protozoa, for example, malaria,.

  4. Acute lethal toxicity following passive immunization for treatment of murine cryptococcosis.

    OpenAIRE

    Savoy, A C; Lupan, D M; Manalo, P B; Roberts, J S; Schlageter, A M; Weinhold, L C; Kozel, T R

    1997-01-01

    Passive immunization with monoclonal antibodies (MAbs) specific for the major capsular polysaccharide of Cryptococcus neoformans alters the course of murine cryptococcosis. During studies of passive immunization for treatment of murine cryptococcosis, we noted the occurrence of an acute, lethal toxicity. Toxicity was characterized by scratching, lethargy, respiratory distress, collapse, and death within 20 to 60 min after injection of antibody. The toxic effect was observed only in mice with ...

  5. Differential immune microenvironments and response to immune checkpoint blockade amongst molecular subtypes of murine medulloblastoma

    Science.gov (United States)

    Pham, Christina D.; Flores, Catherine; Yang, Changlin; Pinheiro, Elaine M.; Yearley, Jennifer H.; Sayour, Elias J.; Pei, Yanxin; Moore, Colin; McLendon, Roger E.; Huang, Jianping; Sampson, John H.; Wechsler-Reya, Robert; Mitchell, Duane A.

    2016-01-01

    PURPOSE Despite significant strides in the identification and characterization of potential therapeutic targets for medulloblastoma (MB), the role of the immune system and its interplay with the tumor microenvironment within these tumors are poorly understood. To address this, we adapted two syngeneic animal models of human Sonic Hedgehog (SHH)-driven and Group 3 MB for preclinical evaluation in immunocompetent C57BL/6 mice. METHODS AND RESULTS Multicolor flow cytometric analyses were used to phenotype and characterize immune infiltrating cells within established cerebellar tumors. We observed significantly higher percentages of dendritic cells, infiltrating lymphocytes, myeloid derived suppressor cells and tumor-associated macrophages in murine SHH model tumors compared with Group 3 tumors. However, murine Group 3 tumors had higher percentages of CD8+ PD-1+ T cells within the CD3 population. PD-1 blockade conferred superior antitumor efficacy in animals bearing intracranial Group 3 tumors compared to SHH group tumors, indicating that immunologic differences within the tumor microenvironment can be leveraged as potential targets to mediate antitumor efficacy. Further analysis of anti-PD-1 monoclonal antibody localization revealed binding to PD-1+ peripheral T cells, but not tumor infiltrating lymphocytes within the brain tumor microenvironment. Peripheral PD-1 blockade additionally resulted in a marked increase in CD3+ T cells within the tumor microenvironment. CONCLUSIONS This is the first immunologic characterization of preclinical models of molecular subtypes of MB and demonstration that response to immune checkpoint blockade differs across subtype classification. Our findings also suggest that effective anti-PD-1 blockade does not require that systemically administered antibodies penetrate the brain tumor microenvironment. PMID:26405194

  6. Differential Immune Microenvironments and Response to Immune Checkpoint Blockade among Molecular Subtypes of Murine Medulloblastoma.

    Science.gov (United States)

    Pham, Christina D; Flores, Catherine; Yang, Changlin; Pinheiro, Elaine M; Yearley, Jennifer H; Sayour, Elias J; Pei, Yanxin; Moore, Colin; McLendon, Roger E; Huang, Jianping; Sampson, John H; Wechsler-Reya, Robert; Mitchell, Duane A

    2016-02-01

    Despite significant strides in the identification and characterization of potential therapeutic targets for medulloblastoma, the role of the immune system and its interplay with the tumor microenvironment within these tumors are poorly understood. To address this, we adapted two syngeneic animal models of human Sonic Hedgehog (SHH)-driven and group 3 medulloblastoma for preclinical evaluation in immunocompetent C57BL/6 mice. Multicolor flow cytometric analyses were used to phenotype and characterize immune infiltrating cells within established cerebellar tumors. We observed significantly higher percentages of dendritic cells, infiltrating lymphocytes, myeloid-derived suppressor cells, and tumor-associated macrophages in murine SHH model tumors compared with group 3 tumors. However, murine group 3 tumors had higher percentages of CD8(+) PD-1(+) T cells within the CD3 population. PD-1 blockade conferred superior antitumor efficacy in animals bearing intracranial group 3 tumors compared with SHH group tumors, indicating that immunologic differences within the tumor microenvironment can be leveraged as potential targets to mediate antitumor efficacy. Further analysis of anti-PD-1 monoclonal antibody localization revealed binding to PD-1(+) peripheral T cells, but not tumor infiltrating lymphocytes within the brain tumor microenvironment. Peripheral PD-1 blockade additionally resulted in a marked increase in CD3(+) T cells within the tumor microenvironment. This is the first immunologic characterization of preclinical models of molecular subtypes of medulloblastoma and demonstration that response to immune checkpoint blockade differs across subtype classification. Our findings also suggest that effective anti-PD-1 blockade does not require that systemically administered antibodies penetrate the brain tumor microenvironment. ©2015 American Association for Cancer Research.

  7. Murine immune responses to oral BCG immunization in the presence or absence of prior BCG sensitization.

    Science.gov (United States)

    Cross, Martin L; Lambeth, Matthew R; Aldwell, Frank E

    2010-02-01

    Oral delivery of live Mycobacterium bovis BCG in a lipid matrix invokes cell-mediated immune (CMI) responses in mice and consequent protection against pulmonary challenge with virulent mycobacteria. To investigate the influence of prior BCG sensitization on oral vaccine efficacy, we assessed CMI responses and BCG colonization of the alimentary tract lymphatics 5 months after oral vaccination, in both previously naive mice and in mice that had been sensitized to BCG by injection 6 months previously. CMI responses did not differ significantly between mice that received subcutaneous BCG followed by oral BCG and those that received either injected or oral BCG alone. In vivo BCG colonization was predominant in the mesenteric lymph nodes after oral vaccination; this colonizing ability was not influenced by prior BCG sensitization. From this murine model study, we conclude that although prior parenteral-route BCG sensitization does not detrimentally affect BCG colonization after oral vaccination, there is no significant immune-boosting effect of the oral vaccine either.

  8. Local IL-23 expression in murine vaginal candidiasis and its relationship with infection and immune status.

    Science.gov (United States)

    Wu, Yan; Tan, Zhijian; Liu, Zhixiang; Xia, Dechao; Li, Jiawen

    2006-01-01

    To investigate the expression of vaginal IL-23 and its role in experimental murine vaginal candidiasis and its relationship with infection and immune status, immuno-competent (group A) and immuno-suppressed (group B) murine models of vaginal candidiasis were established in estrogen-treated mice. Non-estrogen-treated mice were used as controls (group C). The level of IL-23 p19 mRNA in murine vaginal tissue was determined by RT-PCR. Significantly increased levels of IL-23p19mRNA were observed on the 4th, the 7th and 14th day after inoculation in immuno-competent group when compared with that in control group (Pvaginal candidiasis and has a protective function during infection. Low vaginal IL-23 level may correlate with the increased susceptibility to Candida albicans in immuno-suppressed group.

  9. Murine model for congenital CMV infection and hearing impairment

    Directory of Open Access Journals (Sweden)

    Tao Liu

    2011-02-01

    Full Text Available Abstract Background Congenital cytomegalovirus (CMV infection is the leading cause of sensorineural hearing loss (SNHL, and SNHL is the most frequent sequela of congenital CMV infection. But the pathogenic mechanism remains unknown, and there is no ideal CMV intrauterine infection animal model to study the mechanisms by which SNHL develops. Methods We established the congenital murine cytomegalovirus (MCMV infection model by directly injecting the virus into the placenta on day 12.5 of gestation. Then, we observed the development and the MCMV congenital infection rate of the fetuses on the day they were born. Furthermore, we detected the auditory functions, the conditions of the MCMV infection, and the histological change of the inner ears of 28-day-old and 70-day-old offspring. Results Both the fetal loss rate and the teratism rate of offspring whose placentas were inoculated with MCMV increased, and their body length, head circumference, and weight decreased. The hearing level of offspring both decreased at both 28- and 70-days post birth; the 70-day-old mice developed lower hearing levels than did the 28-day old mice. No significant inflammatory changes in the cochleae of the mice were observed. MCMV DNA signals were mainly detected in the spiral ganglion neurons and the endolymph area, but not in the perilymph area. The number of neurons decreased, and their ultrastructures changed. Moreover, with age, the number of neurons dramatically decreased, and the ultrastructural lesions of neurons became much more severe. Conclusions The results suggest that the direct injection of MCMV into the placenta may efficiently cause fetal infection and disturb the intrauterine development of the fetus, and placental inoculation itself has no obvious adverse effects on offspring. The reduction in the number of spiral ganglion neurons and the ultrastructural lesions of the neurons may be the major cause of congenital CMV infection-induced progressive SNHL.

  10. Persistent G. lamblia impairs growth in a murine malnutrition model.

    Science.gov (United States)

    Bartelt, Luther A; Roche, James; Kolling, Glynis; Bolick, David; Noronha, Francisco; Naylor, Caitlin; Hoffman, Paul; Warren, Cirle; Singer, Steven; Guerrant, Richard

    2013-06-01

    Giardia lamblia infections are nearly universal among children in low-income countries and are syndemic with the triumvirate of malnutrition, diarrhea, and developmental growth delays. Amidst the morass of early childhood enteropathogen exposures in these populations, G. lamblia–specific associations with persistent diarrhea, cognitive deficits, stunting, and nutrient deficiencies have demonstrated conflicting results, placing endemic pediatric giardiasis in a state of equipoise. Many infections in endemic settings appear to be asymptomatic/ subclinical, further contributing to uncertainty regarding a causal link between G. lamblia infection and developmental delay. We used G. lamblia H3 cyst infection in a weaned mouse model of malnutrition to demonstrate that persistent giardiasis leads to epithelial cell apoptosis and crypt hyperplasia. Infection was associated with a Th2-biased inflammatory response and impaired growth. Malnutrition accentuated the severity of these growth decrements. Faltering malnourished mice exhibited impaired compensatory responses following infection and demonstrated an absence of crypt hyperplasia and subsequently blunted villus architecture. Concomitantly, severe malnutrition prevented increases in B220+ cells in the lamina propria as well as mucosal Il4 and Il5 mRNA in response to infection. These findings add insight into the potential role of G. lamblia as a "stunting" pathogen and suggest that, similarly, malnourished children may be at increased risk of G. lamblia– potentiated growth decrements.

  11. Effects of fenbendazole on the murine humoral immune system.

    Science.gov (United States)

    Landin, Ana Marie; Frasca, Daniela; Zaias, Julia; Van der Put, Elaine; Riley, Richard L; Altman, Norman H; Blomberg, Bonnie B

    2009-05-01

    Pinworms are highly contagious parasites that have been effectively treated in laboratory rodents with fenbendazole (FBZ). Whether FBZ has any detrimental side effects that may compromise experimental results is unknown. Here we asked whether the immune systems from young and aged mice are altered under FBZ treatment. We compared control and FBZ-treated groups of young (age, 2 to 4 mo) and old (age, 22 to 24 mo) BALB/cN mice. The treated mice received a total of 4 wk (alternating-week treatment regimen) of FBZ-medicated feed. Spleen and bone marrow were collected for immunologic assays, and heart, stomach, intestines, kidneys, and liver were evaluated by histopathology. Our results indicate that FBZ treatment has significant effects on the immune systems of mice; these effects are greater in aged mice. FBZ treatment adversely affected mRNA and protein expression of E2A (a transcription factor crucial for B lymphocytes) in activated precursor B lymphocytes obtained from the bone marrow of young and old mice. These effects were reversed by 6 wk on regular feed after the end of treatment. Activated B lymphocytes from the spleens of young and old mice showed decreased function (cell proliferation, E2A mRNA and protein expression) through the last time point of FBZ treatment but recovered by 2 to 4 wk after treatment. Our findings suggest that FBZ treatment may alter sensitive immune and molecular measures as presented here, and postponing the experimental use of mice until at least 6 wk after treatment should be considered.

  12. Immune tolerance induction using fetal directed placental injection in rodent models: a murine model.

    Directory of Open Access Journals (Sweden)

    Kei Takahashi

    Full Text Available Induction of the immune response is a major problem in replacement therapies for inherited protein deficiencies. Tolerance created in utero can facilitate postnatal treatment. In this study, we aimed to induce immune tolerance towards a foreign protein with early gestational cell transplantation into the chorionic villi under ultrasound guidance in the murine model.Pregnant C57BL/6 (B6 mice on day 10 of gestation were anesthetized and imaged by high resolution ultrasound. Murine embryos and their placenta were positioned to get a clear view in B-mode with power mode of the labyrinth, which is the equivalent of chorionic villi in the human. Bone marrow cells (BMCs from B6-Green Fluorescence Protein (B6GFP transgenic mice were injected into the fetal side of the placenta which includes the labyrinth with glass microcapillary pipettes. Each fetal mouse received 2 x 105 viable GFP-BMCs. After birth, we evaluated the humoral and cell-mediated immune response against GFP.Bone marrow transfer into fetal side of placenta efficiently distributed donor cells to the fetal mice. The survival rate of this procedure was 13.5%(5 out of 37. Successful engraftment of the B6-GFP donor skin grafts was observed in all recipient (5 out of 5 mice 6 weeks after birth. Induction of anti-GFP antibodies was completely inhibited. Cytotoxic immune reactivity of thymic cells against cells harboring GFP was suppressed by ELISPOT assay.In this study, we utilized early gestational placental injection targeting the murine fetus, to transfer donor cells carrying a foreign protein into the fetal circulation. This approach is sufficient to induce both humoral and cell-mediated immune tolerance against the foreign protein.

  13. Neuroblastoma arginase activity creates an immunosuppressive microenvironment that impairs autologous and engineered immunity

    Science.gov (United States)

    Mussai, Francis; Egan, Sharon; Hunter, Stuart; Webber, Hannah; Fisher, Jonathan; Wheat, Rachel; McConville, Carmel; Sbirkov, Yordan; Wheeler, Kate; Bendle, Gavin; Petrie, Kevin; Anderson, John; Chesler, Louis; De Santo, Carmela

    2015-01-01

    Neuroblastoma is the most common extra cranial solid tumour of childhood, and survival remains poor for patients with advanced disease. Novel immune therapies are currently in development, but clinical outcomes have not matched preclinical results. Here, we describe key mechanisms in which neuroblastoma inhibits the immune response. We show that murine and human neuroblastoma tumour cells suppress T cell proliferation, through increased arginase activity. Arginase II is the predominant isoform expressed and creates an arginine deplete local and systemic microenvironment. Neuroblastoma arginase activity results in inhibition of myeloid cell activation and suppression of bone marrow CD34+ progenitor proliferation. Finally we demonstrate that the arginase activity of neuroblastoma impairs NY-ESO-1 specific TCR and GD2-specific CAR engineered T cell proliferation and cytotoxicity. High arginase II expression correlates with poor survival for neuroblastoma patients. The results support the hypothesis that neuroblastoma creates an arginase-dependent immunosuppressive microenvironment in both the tumour and blood that leads to impaired immune surveillance and sub-optimal efficacy of immunotherapeutic approaches. PMID:26054597

  14. Transient immune impairment after a simulated long-haul flight.

    Science.gov (United States)

    Wilder-Smith, Annelies; Mustafa, Fatima B; Peng, Chung Mien; Earnest, Arul; Koh, David; Lin, Gen; Hossain, Iqbal; MacAry, Paul A

    2012-04-01

    Almost 2 billion people travel aboard commercial airlines every year, with about 20% developing symptoms of the common cold within 1 wk after air travel. We hypothesize that hypobaric hypoxic conditions associated with air travel may contribute to immune impairment. We studied the effects of hypobaric hypoxic conditions during a simulated flight at 8000 ft (2438 m) cruising altitude on immune and stress markers in 52 healthy volunteers (mean age 31) before and on days 1, 4, and 7 after the flight. We did a cohort study using a generalized estimating equation to examine the differences in the repeated measures. Our findings show that the hypobaric hypoxic conditions of a 10-h overnight simulation flight are not associated with severe immune impairment or abnormal IgA or cortisol levels, but with transient impairment in some parameters: we observed a transient decrease in lymphocyte proliferative responses combined with an upregulation in CD69 and CD14 cells and a decrease in HLA-DR in the immediate days following the simulated flight that normalized by day 7 in most instances. These transient immune changes may contribute to an increased susceptibility to respiratory infections commonly seen after long-haul flights.

  15. Candesartan ameliorates impaired fear extinction induced by innate immune activation.

    Science.gov (United States)

    Quiñones, María M; Maldonado, Lizette; Velazquez, Bethzaly; Porter, James T

    2016-02-01

    Patients with post-traumatic stress disorder (PTSD) tend to show signs of a relatively increased inflammatory state suggesting that activation of the immune system may contribute to the development of PTSD. In the present study, we tested whether activation of the innate immune system can disrupt acquisition or recall of auditory fear extinction using an animal model of PTSD. Male adolescent rats received auditory fear conditioning in context A. The next day, an intraperitoneal injection of lipopolysaccharide (LPS; 100 μg/kg) prior to auditory fear extinction in context B impaired acquisition and recall of extinction. LPS (100 μg/kg) given after extinction training did not impair extinction recall suggesting that LPS did not affect consolidation of extinction. In contrast to cued fear extinction, contextual fear extinction was not affected by prior injection of LPS (100 μg/kg). Although LPS also reduced locomotion, we could dissociate the effects of LPS on extinction and locomotion by using a lower dose of LPS (50 μg/kg) which impaired locomotion without affecting extinction. In addition, 15 h after an injection of 250 μg/kg LPS in adult rats, extinction learning and recall were impaired without affecting locomotion. A sub-chronic treatment with candesartan, an angiotensin II type 1 receptor blocker, prevented the LPS-induced impairment of extinction in adult rats. Our results demonstrate that activation of the innate immune system can disrupt auditory fear extinction in adolescent and adult animals. These findings also provide direction for clinical studies of novel treatments that modulate the innate immune system for stress-related disorders like PTSD. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. 3,3′-Diindolylmethane Stimulates Murine Immune Function In Vitro and In Vivo*

    OpenAIRE

    Xue, Ling; Pestka, James J.; Li, Maoxiang; Firestone, Gary L; Bjeldanes, Leonard F.

    2007-01-01

    3,3′-Diindolylmethane (DIM), a major condensation product of indole-3-carbinol (I3C), exhibits chemopreventive properties in animal models of cancer. Recent studies have shown that DIM stimulates interferon-gamma (IFN-γ) production and potentiates the IFN-γ signaling pathway in human breast cancer cells via a mechanism that includes increased expression of the IFN-γ receptor. The goal of this study was to test the hypothesis that DIM modulates the murine immune function. Specifically, the eff...

  17. Oral administration of kefiran induces changes in the balance of immune cells in a murine model.

    Science.gov (United States)

    Medrano, Micaela; Racedo, Silvia M; Rolny, Ivanna S; Abraham, Analía G; Pérez, Pablo F

    2011-05-25

    The aim of the present study was to evaluate the effect of the oral administration of kefiran on the balance of immune cells in a murine model. Six week old BALB/c mice were treated with kefiran (300 mg/L) for 0, 2 and 7 days. Kefiran treatment increased the number of IgA+ cells in lamina propria after 2 and 7 days. Percentage of B220+/MHCII(high) cells in mesenteric lymph nodes (2 days) and Peyer's patches (7 days) was higher compared to untreated control mice. An increase of macrophages (F4/80+ cells) was observed in lamina propria and peritoneal cavity (2 and 7 days). In contrast, at day 7, macrophage population decreased in Peyer's patches. These results show the ability of kefiran to modify the balance of immune cells in intestinal mucosa. This property could be highly relevant for the comprehension of the probiotic effect attributed to kefir.

  18. CD44 antibodies and immune thrombocytopenia in the amelioration of murine inflammatory arthritis.

    Directory of Open Access Journals (Sweden)

    Patrick J Mott

    Full Text Available Antibodies to CD44 have been used to successfully ameliorate murine models of autoimmune disease. The most often studied disease model has been murine inflammatory arthritis, where a clear mechanism for the efficacy of CD44 antibodies has not been established. We have recently shown in a murine passive-model of the autoimmune disease immune thrombocytopenia (ITP that some CD44 antibodies themselves can induce thrombocytopenia in mice, and the CD44 antibody causing the most severe thrombocytopenia (IM7, also is known to be highly effective in ameliorating murine models of arthritis. Recent work in the K/BxN serum-induced model of arthritis demonstrated that antibody-induced thrombocytopenia reduced arthritis, causing us to question whether CD44 antibodies might primarily ameliorate arthritis through their thrombocytopenic effect. We evaluated IM7, IRAWB14.4, 5035-41.1D, KM201, KM114, and KM81, and found that while all could induce thrombocytopenia, the degree of protection against serum-induced arthritis was not closely related to the length or severity of the thrombocytopenia. CD44 antibody treatment was also able to reverse established inflammation, while thrombocytopenia induced by an anti-platelet antibody targeting the GPIIbIIIa platelet antigen, could not mediate this effect. While CD44 antibody-induced thrombocytopenia may contribute to some of its therapeutic effect against the initiation of arthritis, for established disease there are likely other mechanisms contributing to its efficacy. Humans are not known to express CD44 on platelets, and are therefore unlikely to develop thrombocytopenia after CD44 antibody treatment. An understanding of the relationship between arthritis, thrombocytopenia, and CD44 antibody treatment remains critical for continued development of CD44 antibody therapeutics.

  19. Salmonella enterica serovar Typhimurium lacking hfq gene confers protective immunity against murine typhoid.

    Directory of Open Access Journals (Sweden)

    Uday Shankar Allam

    Full Text Available Salmonella enterica is an important enteric pathogen and its various serovars are involved in causing both systemic and intestinal diseases in humans and domestic animals. The emergence of multidrug-resistant strains of Salmonella leading to increased morbidity and mortality has further complicated its management. Live attenuated vaccines have been proven superior over killed or subunit vaccines due to their ability to induce protective immunity. Of the various strategies used for the generation of live attenuated vaccine strains, focus has gradually shifted towards manipulation of virulence regulator genes. Hfq is a RNA chaperon which mediates the binding of small RNAs to the mRNA and assists in post-transcriptional gene regulation in bacteria. In this study, we evaluated the efficacy of the Salmonella Typhimurium Δhfq strain as a candidate for live oral vaccine in murine model of typhoid fever. Salmonella hfq deletion mutant is highly attenuated in cell culture and animal model implying a significant role of Hfq in bacterial virulence. Oral immunization with the Salmonella hfq deletion mutant efficiently protects mice against subsequent oral challenge with virulent strain of Salmonella Typhimurium. Moreover, protection was induced upon both multiple as well as single dose of immunizations. The vaccine strain appears to be safe for use in pregnant mice and the protection is mediated by the increase in the number of CD4(+ T lymphocytes upon vaccination. The levels of serum IgG and secretory-IgA in intestinal washes specific to lipopolysaccharide and outer membrane protein were significantly increased upon vaccination. Furthermore, hfq deletion mutant showed enhanced antigen presentation by dendritic cells compared to the wild type strain. Taken together, the studies in murine immunization model suggest that the Salmonella hfq deletion mutant can be a novel live oral vaccine candidate.

  20. mEBT: multiple-matching Evidence-based Translator of Murine Genomic Responses for Human Immunity Studies.

    Science.gov (United States)

    Tae, Donghyun; Seok, Junhee

    2018-05-29

    In this paper, we introduce multiple-matching Evidence-based Translator (mEBT) to discover genomic responses from murine expression data for human immune studies, which are significant in the given condition of mice and likely have similar responses in the corresponding condition of human. mEBT is evaluated over multiple data sets and shows improved inter-species agreement. mEBT is expected to be useful for research groups who use murine models to study human immunity. http://cdal.korea.ac.kr/mebt/. jseok14@korea.ac.kr. Supplementary data are available at Bioinformatics online.

  1. Analysis of the Murine Immune Response to Pulmonary Delivery of Precisely Fabricated Nano- and Microscale Particles

    Science.gov (United States)

    Roberts, Reid A.; Shen, Tammy; Allen, Irving C.; Hasan, Warefta; DeSimone, Joseph M.; Ting, Jenny P. Y.

    2013-01-01

    Nanomedicine has the potential to transform clinical care in the 21st century. However, a precise understanding of how nanomaterial design parameters such as size, shape and composition affect the mammalian immune system is a prerequisite for the realization of nanomedicine's translational promise. Herein, we make use of the recently developed Particle Replication in Non-wetting Template (PRINT) fabrication process to precisely fabricate particles across and the nano- and micro-scale with defined shapes and compositions to address the role of particle design parameters on the murine innate immune response in both in vitro and in vivo settings. We find that particles composed of either the biodegradable polymer poly(lactic-co-glycolic acid) (PLGA) or the biocompatible polymer polyethylene glycol (PEG) do not cause release of pro-inflammatory cytokines nor inflammasome activation in bone marrow-derived macrophages. When instilled into the lungs of mice, particle composition and size can augment the number and type of innate immune cells recruited to the lungs without triggering inflammatory responses as assayed by cytokine release and histopathology. Smaller particles (80×320 nm) are more readily taken up in vivo by monocytes and macrophages than larger particles (6 µm diameter), yet particles of all tested sizes remained in the lungs for up to 7 days without clearance or triggering of host immunity. These results suggest rational design of nanoparticle physical parameters can be used for sustained and localized delivery of therapeutics to the lungs. PMID:23593509

  2. Therapeutic immunization strategies against cervical cancer : induction of cell-mediated immunity in murine models

    NARCIS (Netherlands)

    Bungener, Laura Barbara

    2004-01-01

    The aim of the study described in this thesis is the development of a therapeutic immunization strategy against cervical cancer and pre-malignant precursor lesions of cervical cancer (CIN lesions). Cervical cancer is caused by high risk human papillomavirus (HPV). Two of the early proteins of high

  3. Contribution of murine innate serum inhibitors toward interference within influenza virus immune assays.

    Science.gov (United States)

    Cwach, Kevin T; Sandbulte, Heather R; Klonoski, Joshua M; Huber, Victor C

    2012-03-01

    Prior to detection of an antibody response toward influenza viruses using the hemagglutination inhibition assay (HAI), sera are routinely treated to inactivate innate inhibitors using both heat inactivation (56°C) and recombinant neuraminidase [receptor-destroying enzyme (RDE)]. We revisited the contributions of innate serum inhibitors toward interference with influenza viruses in immune assays, using murine sera, with emphasis on the interactions with influenza A viruses of the H3N2 subtype. We used individual serum treatments: 56°C alone, RDE alone, or RDE + 56°C, to treat sera prior to evaluation within HAI, microneutralization, and macrophage uptake assays. Our data demonstrate that inhibitors present within untreated murine sera interfere with the HAI assay in a manner that is different from that seen for the microneutralization assay. Specifically, the γ class inhibitor α(2) -Macroglobulin (A2-M) can inhibit H3N2 viruses within the HAI assay, but not in the microneutralization assay. Based on these findings, we used a macrophage uptake assay to demonstrate that these inhibitors can increase uptake by macrophages when the influenza viruses express an HA from a 1968 H3N2 virus isolate, but not a 1997 H3N2 isolate. The practice of treating sera to inactivate innate inhibitors of influenza viruses prior to evaluation within immune assays has allowed us to effectively detect influenza virus-specific antibodies for decades. However, this practice has yielded an under-appreciation for the contribution of innate serum inhibitors toward host immune responses against these viruses, including contributions toward neutralization and macrophage uptake. © 2011 Blackwell Publishing Ltd.

  4. Beneficial immune modulatory effects of a specific nutritional combination in a murine model for cancer cachexia

    Science.gov (United States)

    Faber, J; Vos, P; Kegler, D; van Norren, K; Argilés, J M; Laviano, A; Garssen, J; van Helvoort, A

    2008-01-01

    The majority of patients with advanced cancer are recognised by impaired immune competence influenced by several factors, including the type and stage of the tumour and the presence of cachexia. Recently, a specific nutritional combination containing fish oil, specific oligosaccharide mixture, high protein content and leucine has been developed aimed to support the immune system of cancer patients in order to reduce the frequency and severity of (infectious) complications. In a recently modified animal model cachexia is induced by inoculation of C26 tumour cells in mice. In a pre-cachectic state, no effect was observed on contact hypersensitivity, a validated in vivo method to measure Th1-mediated immune function, after adding the individual nutritional ingredients to the diet of tumour-bearing mice. However, the complete mixture resulted in significantly improved Th1 immunity. Moreover, in a cachectic state, the complete mixture reduced plasma levels of pro-inflammatory cytokines and beneficially affected ex vivo immune function. Accordingly, the combination of the nutritional ingredients is required to obtain a synergistic effect, leading to a reduced inflammatory state and improved immune competence. From this, it can be concluded that the specific nutritional combination has potential as immune-supporting nutritional intervention to reduce the risk of (infectious) complications in cancer patients. PMID:19018259

  5. Oxaliplatin but Not Irinotecan Impairs Posthepatectomy Liver Regeneration in a Murine Model

    Directory of Open Access Journals (Sweden)

    Perry A. Soriano

    2011-01-01

    Full Text Available Introduction. We examined the murine hepatectomy model of liver regeneration (LR in the setting of neoadjuvant chemotherapy. Methods. C57BL/6 mice were randomized to receive neoadjuvant intraperitoneal (IP injections of a control, oxaliplatin (15 mg/kg, or irinotecan (100 mg/Kg or 250 mg/Kg solution. Hepatectomy (70% was performed 14 days after the final IP treatment. Animals were sacrificed at postoperative day (D 0, 1, 2, 3, and 7. Liver remnants and serum were collected for analysis. -tests for independent samples were used for statistical comparisons. Results. For oxaliplatin, percent LR did not differ at D1 or D2 but was significantly less at D3 (89.0% versus 70.0%, =0.048 with no difference on D7 (=0.21. Irinotecan-treated mice at both dose levels (100 mg/Kg and 250 mg/Kg showed no significant differences in LR. BrdU incorporation was significantly decreased in oxaliplatin-treated animals (D1,2,3. Conclusions. Neoadjuvant oxaliplatin but not irinotecan impairs early LR in a posthepatectomy murine model which correlates with decreased DNA synthesis.

  6. Oxaliplatin but Not Irinotecan Impairs Posthepatectomy Liver Regeneration in a Murine Model

    Science.gov (United States)

    Soriano, Perry A.; Liu, Nian; Castillo, Erick; Foster, Brock; Artinyan, Avo; Kim, Joseph; Huang, Wendong; Wagman, Lawrence D.

    2011-01-01

    Introduction. We examined the murine hepatectomy model of liver regeneration (LR) in the setting of neoadjuvant chemotherapy. Methods. C57BL/6 mice were randomized to receive neoadjuvant intraperitoneal (IP) injections of a control, oxaliplatin (15 mg/kg), or irinotecan (100 mg/Kg or 250 mg/Kg) solution. Hepatectomy (70%) was performed 14 days after the final IP treatment. Animals were sacrificed at postoperative day (D) 0, 1, 2, 3, and 7. Liver remnants and serum were collected for analysis. T-tests for independent samples were used for statistical comparisons. Results. For oxaliplatin, percent LR did not differ at D1 or D2 but was significantly less at D3 (89.0% versus 70.0%, P = 0.048) with no difference on D7 (P = 0.21). Irinotecan-treated mice at both dose levels (100 mg/Kg and 250 mg/Kg) showed no significant differences in LR. BrdU incorporation was significantly decreased in oxaliplatin-treated animals (D1,2,3). Conclusions. Neoadjuvant oxaliplatin but not irinotecan impairs early LR in a posthepatectomy murine model which correlates with decreased DNA synthesis. PMID:22164336

  7. Influence of maternal gestational treatment with mycobacterial antigens on postnatal immunity in an experimental murine model.

    Directory of Open Access Journals (Sweden)

    Muhammad Jubayer Rahman

    Full Text Available BACKGROUND: It has been proposed that the immune system could be primed as early as during the fetal life and this might have an impact on postnatal vaccination. Therefore, we addressed in murine models whether gestational treatment with mycobacterial antigens could induce better immune responses in the postnatal life. METHODS/FINDINGS: BALB/c mice were treated subcutaneously (s.c. at the second week of gestation with antigen (Ag85A or heparin-binding hemagglutinin (HBHA in the absence of adjuvant. Following birth, offspring mice were immunized intranasally (i.n. with the same antigens formulated with the adjuvant cholera toxin (CT at week 1 and week 4. One week after the last immunization, we assessed antigen-specific recall interferon gamma (IFN-gamma responses by in vitro restimulation of lung-derived lymphocytes. Protection against infection was assessed by challenge with high dose Mycobacterium bovis Bacille Calmette-Guérin (BCG given i.n. We found that recall IFN-gamma responses were higher in the offspring born to the treated mother compared to the untreated-mother. More importantly, we observed that the offspring born to the treated mother controlled infection better than the offspring born to the untreated mother. Since the gestational treatment was done in absence of adjuvant, essentially there was no antibody production observed in the pregnant mice and therefore no influence of maternal antibodies was expected. We hypothesized that the effect of maternal treatment with antigen on the offspring occurred due to antigen transportation through placenta. To trace the antigens, we conjugated fluorescent nanocrystals with Ag85A (Qdot-ITK-Ag85A. After inoculation in the pregnant mice, Qdot-ITK-Ag85A conjugates were detected in the liver, spleen of pregnant females and in all the fetuses and placentas examined. CONCLUSION: The fetal immune system could be primed in utero by mycobacterial antigens transported through the placenta.

  8. Engineered Murine HSCs Reconstitute Multi-lineage Hematopoiesis and Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Yi-Fen Lu

    2016-12-01

    Full Text Available Hematopoietic stem cell (HSC transplantation is curative for malignant and genetic blood disorders, but is limited by donor availability and immune-mismatch. Deriving HSCs from patient-matched embryonic/induced-pluripotent stem cells (ESCs/iPSCs could address these limitations. Prior efforts in murine models exploited ectopic HoxB4 expression to drive self-renewal and enable multi-lineage reconstitution, yet fell short in delivering robust lymphoid engraftment. Here, by titrating exposure of HoxB4-ESC-HSC to Notch ligands, we report derivation of engineered HSCs that self-renew, repopulate multi-lineage hematopoiesis in primary and secondary engrafted mice, and endow adaptive immunity in immune-deficient recipients. Single-cell analysis shows that following engraftment in the bone marrow niche, these engineered HSCs further specify to a hybrid cell type, in which distinct gene regulatory networks of hematopoietic stem/progenitors and differentiated hematopoietic lineages are co-expressed. Our work demonstrates engineering of fully functional HSCs via modulation of genetic programs that govern self-renewal and lineage priming.

  9. Acute lethal toxicity following passive immunization for treatment of murine cryptococcosis.

    Science.gov (United States)

    Savoy, A C; Lupan, D M; Manalo, P B; Roberts, J S; Schlageter, A M; Weinhold, L C; Kozel, T R

    1997-01-01

    Passive immunization with monoclonal antibodies (MAbs) specific for the major capsular polysaccharide of Cryptococcus neoformans alters the course of murine cryptococcosis. During studies of passive immunization for treatment of murine cryptococcosis, we noted the occurrence of an acute, lethal toxicity. Toxicity was characterized by scratching, lethargy, respiratory distress, collapse, and death within 20 to 60 min after injection of antibody. The toxic effect was observed only in mice with a cryptococcal infection and was reduced or absent in the early and late stages of disease. The clinical course and histopathology were consistent with those for shock. There was considerable variation between mouse strains in susceptibility to toxicity. Swiss Webster mice from the Charles River colony were most susceptible, followed by C3H/He, BALB/c, and C57BL/6 mice. DBA/2 mice and Swiss Webster mice from the Simonsen colony were resistant. Acute toxicity was mimicked by injection of preformed complexes of MAb and purified polysaccharide. The toxic effect was also produced by injection of MAbs into mice that were preloaded with polysaccharide. The toxic effect was not blocked by treatment of mice with chloropheniramine or anti-tumor necrosis factor alpha antibodies or by depletion of complement components via pretreatment with cobra venom factor. Toxicity was reduced by treatment of mice with high doses of epinephrine, dexamethasone, or chlorpromazine. Finally, the toxic effect was completely blocked by treatment of mice with the platelet-activating factor antagonist WEB 2170 BS or by pretreatment of mice with the liposome-encapsulated drug dichloromethylene diphosphonate, a procedure which depletes macrophages from the spleen and liver. PMID:9125564

  10. Interleukin-4 Receptor Alpha: From Innate to Adaptive Immunity in Murine Models of Cutaneous Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Ramona Hurdayal

    2017-11-01

    . major. Finally, we extend these innate responses and mechanisms to control of adaptive immunity and the effect of IL-4Rα-responsiveness on T and B lymphocytes orchestrating the development of CD4+ Th1/Th2 and B effector 1/B effector 2 B cells in response to L. major infection in the murine host.

  11. Focal Solute Trapping and Global Glymphatic Pathway Impairment in a Murine Model of Multiple Microinfarcts.

    Science.gov (United States)

    Wang, Minghuan; Ding, Fengfei; Deng, SaiYue; Guo, Xuequn; Wang, Wei; Iliff, Jeffrey J; Nedergaard, Maiken

    2017-03-15

    Microinfarcts occur commonly in the aging brain as a consequence of diffuse embolic events and are associated with the development of vascular dementia and Alzheimer's disease. However, the manner in which disperse microscopic lesions reduce global cognitive function and increase the risk for Alzheimer's disease is unclear. The glymphatic system, which is a brain-wide perivascular network that supports the recirculation of CSF through the brain parenchyma, facilitates the clearance of interstitial solutes including amyloid β and tau. We investigated whether glymphatic pathway function is impaired in a murine model of multiple microinfarcts induced by intraarterial injection of cholesterol crystals. The analysis showed that multiple microinfarcts markedly impaired global influx of CSF along the glymphatic pathway. Although suppression of global glymphatic function was transient, resolving within 2 weeks of injury, CSF tracers also accumulated within tissue associated with microinfarcts. The effect of diffuse microinfarcts on global glymphatic pathway function was exacerbated in the mice aged 12 months compared with the 2- to 3-month-old mice. These findings indicate that glymphatic function is focally disrupted around microinfarcts and that the aging brain is more vulnerable to this disruption than the young brain. These observations suggest that microlesions may trap proteins and other interstitial solutes within the brain parenchyma, increasing the risk of amyloid plaque formation. SIGNIFICANCE STATEMENT Microinfarcts, small (glymphatic system is a brain-wide network of channels surrounding brain blood vessels that allows CSF to exchange with interstitial fluid, clearing away cellular wastes such as amyloid β. We observed that, in mice, microinfarcts impaired global glymphatic function and solutes from the CSF became trapped in tissue associated with microinfarcts. These data suggest that small, disperse ischemic lesions can impair glymphatic function across the

  12. Innate immunity drives the initiation of a murine model of primary biliary cirrhosis.

    Directory of Open Access Journals (Sweden)

    Chao-Hsuan Chang

    Full Text Available Invariant natural killer T (iNKT cells play complex roles in bridging innate and adaptive immunity by engaging with glycolipid antigens presented by CD1d. Our earlier work suggested that iNKT cells were involved in the initiation of the original loss of tolerance in primary biliary cirrhosis (PBC. To address this issue in more detail and, in particular, to focus on whether iNKT cells activated by a Th2-biasing agonist (2s,3s,4r-1-O-(α-D-galactopyranosyl-N-tetracosanoyl-2-amino-1,3,4-nonanetriol (OCH, can influence the development of PBC in a xenobiotic-induced PBC murine model. Groups of mice were treated with either OCH or, as a control, α-galactosylceramide (α-GalCer and thence serially followed for cytokine production, markers of T cell activation, liver histopathology and anti-mitochondrial antibody responses. Further, additional groups of CD1d deleted mice were similarly studied. Our data indicate that administration of OCH has a dramatic influence with exacerbation of portal inflammation and hepatic fibrosis similar to mice treated with α-GalCer. Further, iNKT cell deficient CD1d knockout mice have decreased inflammatory portal cell infiltrates and reduced anti-mitochondrial antibody responses. We submit that activation of iNKT cells can occur via overlapping and/or promiscuous pathways and highlight the critical role of innate immunity in the natural history of autoimmune cholangitis. These data have implications for humans with PBC and emphasize that therapeutic strategies must focus not only on suppressing adaptive responses, but also innate immunity.

  13. Local expression of vaginal Th1 and Th2 cytokines in murine vaginal candidiasis under different immunity conditions.

    Science.gov (United States)

    Chen, Shanjuan; Li, Shaohua; Wu, Yan; Liu, Zhixiang; Li, Jiawen

    2008-08-01

    To investigate the expression of vaginal Th1 and Th2 cytokines in rats with experimental vaginal candidiasis under different immune conditions, ICR murine vaginal candidiasis model was established and immno-suppressed murine models of vaginal cadidiasis were established in estrogen-treated mice. Non-estrogen-treated mice were used as controls. The mRNA level of Th1 (IL-2)/Th2 (IL-4, IL-10, TGF-beta1) cytokines in murine vaginal tissues was determined by RT-PCR. The cykotine in local tissues was increased to different extent under normal immune condition. IL-2 mRNA was increased during early stage of infection, while IL-10 was increased transiently during late stage of infection. TGF-beta1 production was found to be increased persistently. At same time, the expression of IL-2 mRNA was suppressed in immno-suppressed group, and the level of IL-4, IL-10, and TGF-beta1 were higher than the normal immunity group to different degree during infection. The high level of IL-2 mRNA during early stage of infection was associated with clearance of mucosal Candidia albicans (C. albicans), and its expression suppressed leading to decreased clearance of mucosal C. albican in immuno-suppression. The over-expression of IL-4 and IL-10 could significantly enhance the susceptibility to C. albicans infection in mice.

  14. Protective effect of intranasal immunization with Neospora caninum membrane antigens against murine neosporosis established through the gastrointestinal tract

    Science.gov (United States)

    Ferreirinha, Pedro; Dias, Joana; Correia, Alexandra; Pérez-Cabezas, Begoña; Santos, Carlos; Teixeira, Luzia; Ribeiro, Adília; Rocha, António; Vilanova, Manuel

    2014-01-01

    Neospora caninum is an Apicomplexa parasite that in the last two decades was acknowledged as the main pathogenic agent responsible for economic losses in the cattle industry. In the present study, the effectiveness of intranasal immunization with N. caninum membrane antigens plus CpG adjuvant was assessed in a murine model of intragastrically established neosporosis. Immunized mice presented a lower parasitic burden in the brain on infection with 5 × 107 tachyzoites, showing that significant protection was achieved by this immunization strategy. Intestinal IgA antibodies raised by immunization markedly agglutinated live N. caninum tachyzoites whereas previous opsonization with IgG antibodies purified from immunized mice sera reduced parasite survival within macrophage cells. Although an IgG1 : IgG2a ratio < 1 was detected in the immunized mice before and after infection, indicative of a predominant T helper type 1 immune response, no increased production of interferon-γ was detected in the spleen or mesenteric lymph nodes of the immunized mice. Altogether, these results show that mucosal immunization with N. caninum membrane proteins plus CpG adjuvant protect against intragastrically established neosporosis and indicate that parasite-specific mucosal and circulating antibodies have a protective role against this parasitic infection. PMID:24128071

  15. Aberrant innate immune activation following tissue injury impairs pancreatic regeneration.

    Directory of Open Access Journals (Sweden)

    Alexandra E Folias

    Full Text Available Normal tissue architecture is disrupted following injury, as resident tissue cells become damaged and immune cells are recruited to the site of injury. While injury and inflammation are critical to tissue remodeling, the inability to resolve this response can lead to the destructive complications of chronic inflammation. In the pancreas, acinar cells of the exocrine compartment respond to injury by transiently adopting characteristics of progenitor cells present during embryonic development. This process of de-differentiation creates a window where a mature and stable cell gains flexibility and is potentially permissive to changes in cellular fate. How de-differentiation can turn an acinar cell into another cell type (such as a pancreatic β-cell, or a cell with cancerous potential (as in cases of deregulated Kras activity is of interest to both the regenerative medicine and cancer communities. While it is known that inflammation and acinar de-differentiation increase following pancreatic injury, it remains unclear which immune cells are involved in this process. We used a combination of genetically modified mice, immunological blockade and cellular characterization to identify the immune cells that impact pancreatic regeneration in an in vivo model of pancreatitis. We identified the innate inflammatory response of macrophages and neutrophils as regulators of pancreatic regeneration. Under normal conditions, mild innate inflammation prompts a transient de-differentiation of acinar cells that readily dissipates to allow normal regeneration. However, non-resolving inflammation developed when elevated pancreatic levels of neutrophils producing interferon-γ increased iNOS levels and the pro-inflammatory response of macrophages. Pancreatic injury improved following in vivo macrophage depletion, iNOS inhibition as well as suppression of iNOS levels in macrophages via interferon-γ blockade, supporting the impairment in regeneration and the

  16. Promotion of accelerated repair in a radiation impaired wound healing model in murine skin

    International Nuclear Information System (INIS)

    Walker, M.D.

    2000-02-01

    Surgical resection of many tumours following radiotherapy is well established as the preferred approach to eradicating the disease. However, prior irradiation compromises the healing of surgical wounds in 30-60% of cases, depending on the site of treatment. There is a need therefore, to understand the deficit in the repair process and to develop therapeutic interventions that may help address this problem. To this end, the aims of this thesis were to characterise a wound healing model in irradiated murine skin and to investigate the effects of topical- compounds and therapeutic modalities upon this wound healing model. Full-thickness dorsal skin excisions were made within a pre-irradiated area (20Gy) in male Balb/c mice and wounds were made in a corresponding area in control animals. Biopsies were removed for histological and immunohistochemical analysis, whilst wound closure experiments were used to determine effects of topical compounds and therapeutic modalities (Low Intensity Laser Therapy, Therapeutic Ultrasound and Transcutaneous Electrical Nerve Stimulation) upon the rate of repair. X-ray irradiation (20Gy) caused a significant delay in the rate of wound closure, whilst histological results indicated that prior irradiation delays the influx of inflammatory cells, delays wound reepithelialisation and reduces granulation tissue formation and collagen deposition. Macrophage and endothelial cell numbers were found to be significantly lower in the irradiated wounds when compared to unirradiated control wounds. Furthermore, apoptosis was affected by irradiation. Although results failed to support any claimed stimulatory effects of various therapeutic modalities upon wound healing, topical application of glucans were shown to have a slight beneficial effect upon the rate of repair. In conclusion, the observed cellular effects caused by irradiation may be a result of permanent damage to stem cells and their ability to replicate and reproduce. Furthermore, the

  17. Nicotine impairs cyclooxygenase-2-dependent kinin-receptor-mediated murine airway relaxations

    International Nuclear Information System (INIS)

    Xu, Yuan; Cardell, Lars-Olaf

    2014-01-01

    Introduction: Cigarette smoke induces local inflammation and airway hyperreactivity. In asthmatics, it worsens the symptoms and increases the risk for exacerbation. The present study investigates the effects of nicotine on airway relaxations in isolated murine tracheal segments. Methods: Segments were cultured for 24 h in the presence of vehicle, nicotine (10 μM) and/or dexamethasone (1 μM). Airway relaxations were assessed in myographs after pre-contraction with carbachol (1 μM). Kinin receptors, cyclooxygenase (COX) and inflammatory mediator expressions were assessed by real-time PCR and confocal-microscopy-based immunohistochemistry. Results: The organ culture procedure markedly increased bradykinin- (selective B 2 receptor agonist) and des-Arg 9 -bradykinin- (selective B 1 receptor agonist) induced relaxations, and slightly increased relaxation induced by isoprenaline, but not that induced by PGE 2 . The kinin receptor mediated relaxations were epithelium-, COX-2- and EP2-receptor-dependent and accompanied by drastically enhanced mRNA levels of kinin receptors, as well as inflammatory mediators MCP-1 and iNOS. Increase in COX-2 and mPGES-1 was verified both at mRNA and protein levels. Nicotine selectively suppressed the organ-culture-enhanced relaxations induced by des-Arg 9 -bradykinin and bradykinin, at the same time reducing mPGES-1 mRNA and protein expressions. α7-nicotinic acetylcholine receptor inhibitors α-bungarotoxin and MG624 both blocked the nicotine effects on kinin B 2 receptors, but not those on B 1 . Dexamethasone completely abolished kinin-induced relaxations. Conclusion: It is tempting to conclude that a local inflammatory process per se could have a bronchoprotective component by increasing COX-2 mediated airway relaxations and that nicotine could impede this safety mechanism. Dexamethasone further reduced airway inflammation together with relaxations. This might contribute to the steroid resistance seen in some patients with asthma

  18. Nicotine impairs cyclooxygenase-2-dependent kinin-receptor-mediated murine airway relaxations

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Yuan, E-mail: yuan.xu@ki.se; Cardell, Lars-Olaf

    2014-02-15

    Introduction: Cigarette smoke induces local inflammation and airway hyperreactivity. In asthmatics, it worsens the symptoms and increases the risk for exacerbation. The present study investigates the effects of nicotine on airway relaxations in isolated murine tracheal segments. Methods: Segments were cultured for 24 h in the presence of vehicle, nicotine (10 μM) and/or dexamethasone (1 μM). Airway relaxations were assessed in myographs after pre-contraction with carbachol (1 μM). Kinin receptors, cyclooxygenase (COX) and inflammatory mediator expressions were assessed by real-time PCR and confocal-microscopy-based immunohistochemistry. Results: The organ culture procedure markedly increased bradykinin- (selective B{sub 2} receptor agonist) and des-Arg{sup 9}-bradykinin- (selective B{sub 1} receptor agonist) induced relaxations, and slightly increased relaxation induced by isoprenaline, but not that induced by PGE{sub 2}. The kinin receptor mediated relaxations were epithelium-, COX-2- and EP2-receptor-dependent and accompanied by drastically enhanced mRNA levels of kinin receptors, as well as inflammatory mediators MCP-1 and iNOS. Increase in COX-2 and mPGES-1 was verified both at mRNA and protein levels. Nicotine selectively suppressed the organ-culture-enhanced relaxations induced by des-Arg{sup 9}-bradykinin and bradykinin, at the same time reducing mPGES-1 mRNA and protein expressions. α7-nicotinic acetylcholine receptor inhibitors α-bungarotoxin and MG624 both blocked the nicotine effects on kinin B{sub 2} receptors, but not those on B{sub 1}. Dexamethasone completely abolished kinin-induced relaxations. Conclusion: It is tempting to conclude that a local inflammatory process per se could have a bronchoprotective component by increasing COX-2 mediated airway relaxations and that nicotine could impede this safety mechanism. Dexamethasone further reduced airway inflammation together with relaxations. This might contribute to the steroid resistance seen in

  19. Antibody blockade of IL-17 family cytokines in immunity to acute murine oral mucosal candidiasis.

    Science.gov (United States)

    Whibley, Natasha; Tritto, Elaine; Traggiai, Elisabetta; Kolbinger, Frank; Moulin, Pierre; Brees, Dominique; Coleman, Bianca M; Mamo, Anna J; Garg, Abhishek V; Jaycox, Jillian R; Siebenlist, Ulrich; Kammüller, Michael; Gaffen, Sarah L

    2016-06-01

    Antibodies targeting IL-17A or its receptor, IL-17RA, are approved to treat psoriasis and are being evaluated for other autoimmune conditions. Conversely, IL-17 signaling is critical for immunity to opportunistic mucosal infections caused by the commensal fungus Candida albicans, as mice and humans lacking the IL-17R experience chronic mucosal candidiasis. IL-17A, IL-17F, and IL-17AF bind the IL-17RA-IL-17RC heterodimeric complex and deliver qualitatively similar signals through the adaptor Act1. Here, we used a mouse model of acute oropharyngeal candidiasis to assess the impact of blocking IL-17 family cytokines compared with specific IL-17 cytokine gene knockout mice. Anti-IL-17A antibodies, which neutralize IL-17A and IL-17AF, caused elevated oral fungal loads, whereas anti-IL-17AF and anti-IL-17F antibodies did not. Notably, there was a cooperative effect of blocking IL-17A, IL-17AF, and IL-17F together. Termination of anti-IL-17A treatment was associated with rapid C. albicans clearance. IL-17F-deficient mice were fully resistant to oropharyngeal candidiasis, consistent with antibody blockade. However, IL-17A-deficient mice had lower fungal burdens than anti-IL-17A-treated mice. Act1-deficient mice were much more susceptible to oropharyngeal candidiasis than anti-IL-17A antibody-treated mice, yet anti-IL-17A and anti-IL-17RA treatment caused equivalent susceptibilities. Based on microarray analyses of the oral mucosa during infection, only a limited number of genes were associated with oropharyngeal candidiasis susceptibility. In sum, we conclude that IL-17A is the main cytokine mediator of immunity in murine oropharyngeal candidiasis, but a cooperative relationship among IL-17A, IL-17AF, and IL-17F exists in vivo. Susceptibility displays the following hierarchy: IL-17RA- or Act1-deficiency > anti-IL-17A + anti-IL-17F antibodies > anti-IL-17A or anti-IL-17RA antibodies > IL-17A deficiency. © Society for Leukocyte Biology.

  20. Possible Immune Regulation of Natural Killer T Cells in a Murine Model of Metal Ion-Induced Allergic Contact Dermatitis

    Directory of Open Access Journals (Sweden)

    Kenichi Kumagai

    2016-01-01

    Full Text Available Metal often causes delayed-type hypersensitivity reactions, which are possibly mediated by accumulating T cells in the inflamed skin, called irritant or allergic contact dermatitis. However, accumulating T cells during development of a metal allergy are poorly characterized because a suitable animal model is unavailable. We have previously established novel murine models of metal allergy and found accumulation of both metal-specific T cells and natural killer (NK T cells in the inflamed skin. In our novel models of metal allergy, skin hypersensitivity responses were induced through repeated sensitizations by administration of metal chloride and lipopolysaccharide into the mouse groin followed by metal chloride challenge in the footpad. These models enabled us to investigate the precise mechanisms of the immune responses of metal allergy in the inflamed skin. In this review, we summarize the immune responses in several murine models of metal allergy and describe which antigen-specific responses occur in the inflamed skin during allergic contact dermatitis in terms of the T cell receptor. In addition, we consider the immune regulation of accumulated NK T cells in metal ion–induced allergic contact dermatitis.

  1. Antiretroviral therapy, immune suppression and renal impairment in HIV-positive persons

    DEFF Research Database (Denmark)

    Nielsen, Lene Ryom; Mocroft, Amanda; Lundgren, Jens D

    2014-01-01

    The purpose of this article is to review recent literature on antiretroviral treatment (ART) and immune suppression as risk factors for renal impairment in HIV-positive persons, and to discuss pending research questions within this field.......The purpose of this article is to review recent literature on antiretroviral treatment (ART) and immune suppression as risk factors for renal impairment in HIV-positive persons, and to discuss pending research questions within this field....

  2. Murine and bovine γδ T cells enhance innate immunity against Brucella abortus infections.

    Directory of Open Access Journals (Sweden)

    Jerod A Skyberg

    Full Text Available γδ T cells have been postulated to act as a first line of defense against infectious agents, particularly intracellular pathogens, representing an important link between the innate and adaptive immune responses. Human γδ T cells expand in the blood of brucellosis patients and are active against Brucella in vitro. However, the role of γδ T cells in vivo during experimental brucellosis has not been studied. Here we report TCRδ(-/- mice are more susceptible to B. abortus infection than C57BL/6 mice at one week post-infection as measured by splenic colonization and splenomegaly. An increase in TCRγδ cells was observed in the spleens of B. abortus-infected C57BL/6 mice, which peaked at two weeks post-infection and occurred concomitantly with diminished brucellae. γδ T cells were the major source of IL-17 following infection and also produced IFN-γ. Depletion of γδ T cells from C57BL/6, IL-17Rα(-/-, and GMCSF(-/- mice enhanced susceptibility to B. abortus infection although this susceptibility was unaltered in the mutant mice; however, when γδ T cells were depleted from IFN-γ(-/- mice, enhanced susceptibility was observed. Neutralization of γδ T cells in the absence of TNF-α did not further impair immunity. In the absence of TNF-α or γδ T cells, B. abortus-infected mice showed enhanced IFN-γ, suggesting that they augmented production to compensate for the loss of γδ T cells and/or TNF-α. While the protective role of γδ T cells was TNF-α-dependent, γδ T cells were not the major source of TNF-α and activation of γδ T cells following B. abortus infection was TNF-α-independent. Additionally, bovine TCRγδ cells were found to respond rapidly to B. abortus infection upon co-culture with autologous macrophages and could impair the intramacrophage replication of B. abortus via IFN-γ. Collectively, these results demonstrate γδ T cells are important for early protection to B. abortus infections.

  3. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell–directed gene therapy of murine hemophilia A

    Directory of Open Access Journals (Sweden)

    Allison M Lytle

    2016-01-01

    Full Text Available Immune responses to coagulation factors VIII (FVIII and IX (FIX represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV.

  4. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell–directed gene therapy of murine hemophilia A

    Science.gov (United States)

    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B

    2016-01-01

    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV. PMID:26909355

  5. The use of 125I-labelled protein A for the detection of humoral immunity of gross murine leukaemia virus

    International Nuclear Information System (INIS)

    Holmes, H.C.; Tuffrey, M.; Barnes, R.D.; Steuden, J.; Hilgers, J.

    1980-01-01

    A solid-phase radioimmunoassay utilising binding of 125 I-labelled protein A to antibodies bound to virus adsorbed onto microtitre plates was shown to be suitable for detection of humoral immunity to Gross murine leukaemia virus (MuLV). The specificity of the reaction was shown by the fact that only homologous or closely related viruses effectively inhibited binding of antibodies to adsorbed virus. With this method a low level of spontaneous humoral immunity was demonstrated in sera from AKR/Crc mice, a strain with high concentrations of endogenous virus, whereas little or no anti-viral activity was found in CBA/H-T6Crc, a subline that does not appear to express MuLV. (Auth.)

  6. Interleukin 37 limits monosodium urate crystal-induced innate immune responses in human and murine models of gout.

    Science.gov (United States)

    Liu, Lei; Xue, Yu; Zhu, Yingfeng; Xuan, Dandan; Yang, Xue; Liang, Minrui; Wang, Juan; Zhu, Xiaoxia; Zhang, Jiong; Zou, Hejian

    2016-11-18

    Interleukin (IL)-37 has emerged as a fundamental inhibitor of innate immunity. Acute gout is a self-limiting inflammatory response to monosodium urate (MSU) crystals. In the current study, we assessed the preventive and therapeutic effect of recombinant human IL-37 (rhIL-37) in human and murine gout models. We investigated the expression of IL-37 in patients with active and inactive gouty arthritis and assessed the effect of rhIL-37 in human and murine gout models: a human monocyte cell line (THP-1) and human synovial cells (containing macrophage-like and fibroblast-like synoviocytes) exposed to MSU crystals, a peritoneal murine model of gout and a murine gouty arthritis model. After inhibition of Mer receptor tyrosine kinase (Mertk), levels of IL-1β, IL-8 and chemokine (C-C motif) ligand 2 (CCL-2) were detected by ELISA and expression of mammalian homologs of the drosophila Mad gene 3 (Smad), suppressor of cytokine signaling 3 (SOCS3), NACHT-LRR-PYD-containing protein 3 (NLRP3), and IL-8R of THP-1 were assessed by qPCR and western blot to explore the molecular mechanisms. Our studies strongly indicated that rhIL-37 played a potent immunosuppressive role in the pathogenesis of experimental gout models both in vitro and in vivo, by downregulating proinflammatory cytokines and chemokines, markedly reducing neutrophil and monocyte recruitment, and mitigating pathological joint inflammation. In our studies, rhIL-37 suppressed MSU-induced innate immune responses by enhancing expression of Smad3 and IL-1R8 to trigger multiple intracellular switches to block inflammation, including inhibition of NLRP3 and activation of SOCS3. Mertk signaling participated in rhIL-37 inhibitory pathways in gout models. By inhibition of Mertk, the anti-inflammatory effect of rhIL-37 was partly abrogated, and IL-1R8, Smad3 and S​OCS3 expression were suppressed, whereas NLRP3 expression was reactivated. Our studies reveal that IL-37 limits runaway inflammation initiated by MSU crystal

  7. A Murine Model of Persistent Inflammation, Immune Suppression, and Catabolism Syndrome

    Directory of Open Access Journals (Sweden)

    Amanda M. Pugh

    2017-08-01

    Full Text Available Critically ill patients that survive sepsis can develop a Persistent Inflammation, Immunosuppression, and Catabolism Syndrome (PICS, which often leads to extended recovery periods and multiple complications. Here, we utilized a cecal ligation and puncture (CLP method in mice with the goal of creating a model that concurrently displays all the characteristics of PICS. We observed that, after eight days, mice that survive the CLP develop persistent inflammation with significant myelopoiesis in the bone marrow and spleen. These mice also demonstrate ongoing immune suppression, as evidenced by the decreased total and naïve splenic CD4 and CD8 T cells with a concomitant increase in immature myeloid cells. The mice further display significant weight loss and decreased muscle mass, indicating a state of ongoing catabolism. When PICS mice are challenged with intranasal Pseudomonas aeruginosa, mortality is significantly elevated compared to sham mice. This mortality difference is associated with increased bacterial loads in the lung, as well as impaired neutrophil migration and neutrophil dysfunction in the PICS mice. Altogether, we have created a sepsis model that concurrently exhibits PICS characteristics. We postulate that this will help determine the mechanisms underlying PICS and identify potential therapeutic targets to improve outcomes for this patient population.

  8. Porcine humoral immune responses to multiple injections of murine monoclonal antibodies

    DEFF Research Database (Denmark)

    Lohse, Louise; Nielsen, Jens; Kamstrup, Søren

    2005-01-01

    In humans and cattle, multiple injections of murine monoclonal antibodies (m-mAbs) induce anti-mouse antibody responses. The objectives of the present. study were to investigate whether a similar response could be seen when pigs were subjected to m-mAb therapy, and to study the kinetics of such a...

  9. Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.

    Science.gov (United States)

    Chen, Lili; He, Zhengxiang; Qin, Li; Li, Qinyan; Shi, Xibao; Zhao, Siting; Chen, Ling; Zhong, Nanshan; Chen, Xiaoping

    2011-01-01

    Lung cancer is the most common malignancy in humans and its high fatality means that no effective treatment is available. Developing new therapeutic strategies for lung cancer is urgently needed. Malaria has been reported to stimulate host immune responses, which are believed to be efficacious for combating some clinical cancers. This study is aimed to provide evidence that malaria parasite infection is therapeutic for lung cancer. Antitumor effect of malaria infection was examined in both subcutaneously and intravenously implanted murine Lewis lung cancer (LLC) model. The results showed that malaria infection inhibited LLC growth and metastasis and prolonged the survival of tumor-bearing mice. Histological analysis of tumors from mice infected with malaria revealed that angiogenesis was inhibited, which correlated with increased terminal deoxynucleotidyl transferase-mediated (TUNEL) staining and decreased Ki-67 expression in tumors. Through natural killer (NK) cell cytotoxicity activity, cytokine assays, enzyme-linked immunospot assay, lymphocyte proliferation, and flow cytometry, we demonstrated that malaria infection provided anti-tumor effects by inducing both a potent anti-tumor innate immune response, including the secretion of IFN-γ and TNF-α and the activation of NK cells as well as adaptive anti-tumor immunity with increasing tumor-specific T-cell proliferation and cytolytic activity of CD8(+) T cells. Notably, tumor-bearing mice infected with the parasite developed long-lasting and effective tumor-specific immunity. Consequently, we found that malaria parasite infection could enhance the immune response of lung cancer DNA vaccine pcDNA3.1-hMUC1 and the combination produced a synergistic antitumor effect. Malaria infection significantly suppresses LLC growth via induction of innate and adaptive antitumor responses in a mouse model. These data suggest that the malaria parasite may provide a novel strategy or therapeutic vaccine vector for anti-lung cancer

  10. Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.

    Directory of Open Access Journals (Sweden)

    Lili Chen

    Full Text Available BACKGROUND: Lung cancer is the most common malignancy in humans and its high fatality means that no effective treatment is available. Developing new therapeutic strategies for lung cancer is urgently needed. Malaria has been reported to stimulate host immune responses, which are believed to be efficacious for combating some clinical cancers. This study is aimed to provide evidence that malaria parasite infection is therapeutic for lung cancer. METHODOLOGY/PRINCIPAL FINDINGS: Antitumor effect of malaria infection was examined in both subcutaneously and intravenously implanted murine Lewis lung cancer (LLC model. The results showed that malaria infection inhibited LLC growth and metastasis and prolonged the survival of tumor-bearing mice. Histological analysis of tumors from mice infected with malaria revealed that angiogenesis was inhibited, which correlated with increased terminal deoxynucleotidyl transferase-mediated (TUNEL staining and decreased Ki-67 expression in tumors. Through natural killer (NK cell cytotoxicity activity, cytokine assays, enzyme-linked immunospot assay, lymphocyte proliferation, and flow cytometry, we demonstrated that malaria infection provided anti-tumor effects by inducing both a potent anti-tumor innate immune response, including the secretion of IFN-γ and TNF-α and the activation of NK cells as well as adaptive anti-tumor immunity with increasing tumor-specific T-cell proliferation and cytolytic activity of CD8(+ T cells. Notably, tumor-bearing mice infected with the parasite developed long-lasting and effective tumor-specific immunity. Consequently, we found that malaria parasite infection could enhance the immune response of lung cancer DNA vaccine pcDNA3.1-hMUC1 and the combination produced a synergistic antitumor effect. CONCLUSIONS/SIGNIFICANCE: Malaria infection significantly suppresses LLC growth via induction of innate and adaptive antitumor responses in a mouse model. These data suggest that the malaria

  11. Isolation and characterisation of Ebolavirus-specific recombinant antibody fragments from murine and shark immune libraries.

    Science.gov (United States)

    Goodchild, Sarah A; Dooley, Helen; Schoepp, Randal J; Flajnik, Martin; Lonsdale, Stephen G

    2011-09-01

    Members of the genus Ebolavirus cause fulminating outbreaks of disease in human and non-human primate populations with a mortality rate up to 90%. To facilitate rapid detection of these pathogens in clinical and environmental samples, robust reagents capable of providing sensitive and specific detection are required. In this work recombinant antibody libraries were generated from murine (single chain variable domain fragment; scFv) and nurse shark, Ginglymostoma cirratum (IgNAR V) hosts immunised with Zaire ebolavirus. This provides the first recorded IgNAR V response against a particulate antigen in the nurse shark. Both murine scFv and shark IgNAR V libraries were panned by phage display technology to identify useful antibodies for the generation of immunological detection reagents. Two murine scFv were shown to have specificity to the Zaire ebolavirus viral matrix protein VP40. Two isolated IgNAR V were shown to bind to the viral nucleoprotein (NP) and to capture viable Zaire ebolavirus with a high degree of sensitivity. Assays developed with IgNAR V cross-reacted to Reston ebolavirus, Sudan ebolavirus and Bundibugyo ebolavirus. Despite this broad reactivity, neither of IgNAR V showed reactivity to Côte d'Ivoire ebolavirus. IgNAR V was substantially more resistant to irreversible thermal denaturation than murine scFv and monoclonal IgG in a comparative test. The demonstrable robustness of the IgNAR V domains may offer enhanced utility as immunological detection reagents in fieldable biosensor applications for use in tropical or subtropical countries where outbreaks of Ebolavirus haemorrhagic fever occur. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  12. Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses.

    Science.gov (United States)

    Mahanty, Siddhartha; Hutchinson, Karen; Agarwal, Sudhanshu; McRae, Michael; Rollin, Pierre E; Pulendran, Bali

    2003-03-15

    Acute infection of humans with Ebola and Lassa viruses, two principal etiologic agents of hemorrhagic fevers, often results in a paradoxical pattern of immune responses: early infection, characterized by an outpouring of inflammatory mediators such as TNF-alpha, IL-1 beta, and IL-6, vs late stage infections, which are associated with poor immune responses. The mechanisms underlying these diverse outcomes are poorly understood. In particular, the role played by cells of the innate immune system, such as dendritic cells (DC), is not known. In this study, we show that Ebola and Lassa viruses infect human monocyte-derived DC and impair their function. Monocyte-derived DC exposed to either virus fail to secrete proinflammatory cytokines, do not up-regulate costimulatory molecules, and are poor stimulators of T cells. These data represent the first evidence for a mechanism by which Ebola and Lassa viruses target DC to impair adaptive immunity.

  13. Impaired immune function in children and adults with Fanconi anemia.

    Science.gov (United States)

    Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

    2017-11-01

    Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.

  14. Innate and adaptive immune response to chronic pulmonary infection of hyphae of Aspergillus fumigatus in a new murine model.

    Science.gov (United States)

    Wang, Fengyuan; Zhang, Caiyun; Jiang, Yuan; Kou, Caixia; Kong, Qingtao; Long, Nanbiao; Lu, Ling; Sang, Hong

    2017-10-01

    The pathogenesis of chronic pulmonary aspergillosis (CPA) has seldom been studied due partly to a lack of animal models. Since hypha is the main morphology colonizing the airway in CPA, it's critical to study the immune reaction to chronic pulmonary infection of hyphae of Aspergillus fumigatus, which also has seldom been studied in vivo before. We established a novel murine model of chronic pulmonary infection of hyphae by challenging immunocompetent mice with tightly-structured hyphae balls intratracheally, and described the ensuing immunoreaction to hyphae and conidia, and the pathogenesis of CPA. Our experiment proved that the hyphae balls could induce a chronic pulmonary infection for 28 days with a considerable recrudescence at day 28 post-infection. Lungs infected with hyphae balls were remarkable for the many neutrophils and macrophages that flooded into airway lumens, with peribronchiolar infiltration of leukocytes. There was a transient increase of Th2 cells and Th17 cells at day 7 post-infection in the lung tissue. In contrast, lungs infected with conidia showed no peribronchiolar infiltration of leukocytes, but an influx of a great number of macrophages, and a much less number of neutrophils in the lumen. Besides, conidia activated the co-response of Th1, Th2 and Th17 cells with an increase of Treg cells in the lung tissue (quite different from most previous studies). We established a new murine model of chronic infection of hyphae to mimic the formation of CPA, and provide a new marker for different immune responses to hyphae and conidia.

  15. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Science.gov (United States)

    Fink, Annette; Renzaho, Angeliqué; Reddehase, Matthias J.; Lemmermann, Niels A. W.

    2013-01-01

    The MHC-class I (MHC-I)-like viral (MHC-Iv) m152 gene product of murine cytomegalovirus (mCMV) was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK) cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q), we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1γ complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1γ interface. PMID:24351798

  16. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Directory of Open Access Journals (Sweden)

    Annette Fink

    2013-12-01

    Full Text Available The MHC-class I (MHC-I-like viral (MHC-Iv m152 gene product of murine cytomegalovirus (mCMV was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q, we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1g complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1g interface.

  17. Experimental murine fascioliasis derives early immune suppression with increased levels of TGF-β and IL-4.

    Science.gov (United States)

    Chung, Joon-Yong; Bae, Young-An; Yun, Doo-Hee; Yang, Hyun-Jong; Kong, Yoon

    2012-12-01

    In fascioliasis, T-helper 2 (Th2) responses predominate, while little is known regarding early immune phenomenon. We herein analyzed early immunophenotype changes of BALB/c, C57BL/6, and C3H/He mice experimentally infected with 5 Fasciola hepatica metacercariae. A remarkable expansion of CD19(+) B cells was observed as early as week 1 post-infection while CD4(+)/CD8(+) T cells were down-regulated. Accumulation of Mac1(+) cells with time after infection correlated well with splenomegaly of all mice strains tested. The expression of tumor necrosis factor (TNF)-α mRNA in splenocytes significantly decreased while that of IL-4 up-regulated. IL-1β expression was down-modulated in BALB/c and C57BL/6 mice, but not in C3H/He. Serum levels of transforming growth factor (TGF)-β were considerably elevated in all mice during 3 weeks of infection period. These collective results suggest that experimental murine fascioliasis might derive immune suppression with elevated levels of TGF-β and IL-4 during the early stages of infection.

  18. Induction of regulatory T cells by high-dose gp96 suppresses murine liver immune hyperactivation.

    Directory of Open Access Journals (Sweden)

    Xinghui Li

    Full Text Available Immunization with high-dose heat shock protein gp96, an endoplasmic reticulum counterpart of the Hsp90 family, significantly enhances regulatory T cell (Treg frequency and suppressive function. Here, we examined the potential role and mechanism of gp96 in regulating immune-mediated hepatic injury in mice. High-dose gp96 immunization elicited rapid and long-lasting protection of mice against concanavalin A (Con A-and anti-CD137-induced liver injury, as evidenced by decreased alanine aminotransaminase (ALT levels, hepatic necrosis, serum pro-inflammatory cytokines (IFN-γ, TNF-α, and IL-6, and number of IFN-γ (+ CD4(+ and IFN-γ (+ CD8(+ T cells in the spleen and liver. In contrast, CD4(+CD25(+Foxp3(+ Treg frequency and suppressive function were both increased, and the protective effect of gp96 could be generated by adoptive transfer of Treg cells from gp96-immunized mice. In vitro co-culture experiments demonstrated that gp96 stimulation enhanced Treg proliferation and suppressive function, and up-regulation of Foxp3, IL-10, and TGF-β1 induced by gp96 was dependent on TLR2- and TLR4-mediated NF-κB activation. Our work shows that activation of Tregs by high-dose gp96 immunization protects against Con A- and anti-CD137-induced T cell-hepatitis and provides therapeutic potential for the development of a gp96-based anti-immune hyperactivation vaccine against immune-mediated liver destruction.

  19. Intrauterine Growth Restriction Impairs Small Intestinal Mucosal Immunity in Neonatal Piglets

    Science.gov (United States)

    Dong, Li; Zhong, Xiang; Ahmad, Hussain; Li, Wei; Wang, Yuanxiao; Zhang, Lili

    2014-01-01

    Intrauterine growth restriction (IUGR) is a very common problem in both piglet and human neonate populations. We hypothesized that IUGR neonates have impaired intestinal mucosal immunity from birth. Using neonatal piglets as IUGR models, immune organ weights, the weight and length of the small intestine (SI), intestinal morphology, intraepithelial immune cell numbers, levels of cytokines and immunoglobulins, and the relative gene expression of cytokines in the SI were investigated. IUGR neonatal piglets were observed to have lower absolute immune organ weight and SI length, decreased relative weights of the thymus, spleen, mesenteric lymph node, and thinner but longer SIs. Damaged and jagged villi, shorter microvilli, presence of autophagosomes, swelled mitochondria, and decreased villus surface areas were also found in the SIs of IUGR neonatal piglets. We also found a smaller number of epithelial goblet cells and lymphocytes in the SIs of IUGR neonates. In addition, we detected reduced levels of the cytokines TNF-α and IFN-γ and decreased gene expression of cytokines in IUGR neonates. In conclusion, IUGR was shown to impair the mucosal immunity of the SI in neonatal piglets, and the ileum was the major site of impairment. PMID:24710659

  20. Hepatic Mitochondrial Dysfunction and Immune Response in a Murine Model of Peanut Allergy

    Directory of Open Access Journals (Sweden)

    Giovanna Trinchese

    2018-06-01

    Full Text Available Background: Evidence suggests a relevant role for liver and mitochondrial dysfunction in allergic disease. However, the role of hepatic mitochondrial function in food allergy is largely unknown. We aimed to investigate hepatic mitochondrial dysfunction in a murine model of peanut allergy. Methods: Three-week-old C3H/HeOuJ mice were sensitized by the oral route with peanut-extract (PNT. We investigated: 1. the occurrence of effective sensitization to PNT by analysing acute allergic skin response, anaphylactic symptoms score, body temperature, serum mucosal mast cell protease-1 (mMCP-1 and anti-PNT immunoglobulin E (IgE levels; 2. hepatic involvement by analysing interleukin (IL-4, IL-5, IL-13, IL-10 and IFN-γ mRNA expression; 3. hepatic mitochondrial oxidation rates and efficiency by polarography, and hydrogen peroxide (H2O2 yield, aconitase and superoxide dysmutase activities by spectrophotometry. Results: Sensitization to PNT was demonstrated by acute allergic skin response, anaphylactic symptoms score, body temperature decrease, serum mMCP-1 and anti-peanut IgE levels. Liver involvement was demonstrated by a significant increase of hepatic Th2 cytokines (IL-4, IL-5 and IL-13 mRNA expression. Mitochondrial dysfunction was demonstrated by lower state 3 respiration rate in the presence of succinate, decreased fatty acid oxidation in the presence of palmitoyl-carnitine, increased yield of ROS proven by the inactivation of aconitase enzyme and higher H2O2 mitochondrial release. Conclusions: We provide evidence of hepatic mitochondrial dysfunction in a murine model of peanut allergy. These data could open the way to the identification of new mitochondrial targets for innovative preventive and therapeutic strategies against food allergy.

  1. The Probiotic Compound VSL#3 Modulates Mucosal, Peripheral, and Systemic Immunity Following Murine Broad-Spectrum Antibiotic Treatment

    Directory of Open Access Journals (Sweden)

    Ira Ekmekciu

    2017-05-01

    Full Text Available There is compelling evidence linking the commensal intestinal microbiota with host health and, in turn, antibiotic induced perturbations of microbiota composition with distinct pathologies. Despite the attractiveness of probiotic therapy as a tool to beneficially alter the intestinal microbiota, its immunological effects are still incompletely understood. The aim of the present study was to assess the efficacy of the probiotic formulation VSL#3 consisting of eight distinct bacterial species (including Streptococcus thermophilus, Bifidobacterium breve, B. longum, B. infantis, Lactobacillus acidophilus, L. plantarum, L. paracasei, and L. delbrueckii subsp. Bulgaricus in reversing immunological effects of microbiota depletion as compared to reassociation with a complex murine microbiota. To address this, conventional mice were subjected to broad-spectrum antibiotic therapy for 8 weeks and perorally reassociated with either VSL#3 bacteria or a complex murine microbiota. VSL#3 recolonization resulted in restored CD4+ and CD8+ cell numbers in the small and large intestinal lamina propria as well as in B220+ cell numbers in the former, whereas probiotic intervention was not sufficient to reverse the antibiotic induced changes of respective cell populations in the spleen. However, VSL#3 application was as efficient as complex microbiota reassociation to attenuate the frequencies of regulatory T cells, activated dendritic cells and memory/effector T cells in the small intestine, colon, mesenteric lymph nodes, and spleen. Whereas broad-spectrum antibiotic treatment resulted in decreased production of cytokines such as IFN-γ, IL-17, IL-22, and IL-10 by CD4+ cells in respective immunological compartments, VSL#3 recolonization was sufficient to completely recover the expression of the anti-inflammatory cytokine IL-10 without affecting pro-inflammatory mediators. In summary, the probiotic compound VSL#3 has an extensive impact on mucosal, peripheral, and

  2. Human Milk Oligosaccharide 2′-Fucosyllactose Improves Innate and Adaptive Immunity in an Influenza-Specific Murine Vaccination Model

    Directory of Open Access Journals (Sweden)

    Ling Xiao

    2018-03-01

    Full Text Available BackgroundHuman milk is uniquely suited to provide optimal nutrition and immune protection to infants. Human milk oligosaccharides are structural complex and diverse consisting of short chain and long chain oligosaccharides typically present in a 9:1 ratio. 2′-Fucosyllactose (2′FL is one of the most prominent short chain oligosaccharides and is associated with anti-infective capacity of human milk.AimTo determine the effect of 2′FL on vaccination responsiveness (both innate and adaptive in a murine influenza vaccination model and elucidate mechanisms involved.MethodsA dose range of 0.25–5% (w/w dietary 2′FL was provided to 6-week-old female C57Bl/6JOlaHsd mice 2 weeks prior primary and booster vaccination until the end of the experiment. Intradermal (i.d. challenge was performed to measure the vaccine-specific delayed-type hypersensitivity (DTH. Antigen-specific antibody levels in serum as well as immune cell populations within several organs were evaluated using ELISA and flow cytometry, respectively. In an ex vivo restimulation assay, spleen cells were cocultured with influenza-loaded bone marrow-derived dendritic cells (BMDCs to study the effects of 2′FL on vaccine-specific CD4+ and CD8+ T-cell proliferation and cytokine secretions. Furthermore, the direct immune regulatory effects of 2′FL were confirmed using in vitro BMDCs T-cell cocultures.ResultsDietary 2′FL significantly (p < 0.05 enhanced vaccine specific DTH responses accompanied by increased serum levels of vaccine-specific immunoglobulin (Ig G1 and IgG2a in a dose-dependent manner. Consistently, increased activation marker (CD27 expression on splenic B-cells was detected in mice receiving 2′FL as compared to control mice. Moreover, proliferation of vaccine-specific CD4+ and CD8+ T-cells, as well as interferon-γ production after ex vivo restimulation were significantly increased in spleen cells of mice receiving 2′FL as compared to control mice, which were

  3. Effect of tick saliva on immune interactions between Borrelia afzelii and murine dendritic cells

    Czech Academy of Sciences Publication Activity Database

    Slámová, M.; Skallová, A.; Páleníková, J.; Kopecký, Jan

    2011-01-01

    Roč. 33, č. 12 (2011), 654-660 ISSN 0141-9838 R&D Projects: GA AV ČR IAA600960811; GA MŠk(CZ) LC06009 Institutional research plan: CEZ:AV0Z60220518 Keywords : Borrelia * dendritic cell * immune modulation * Ixodes ricinus Subject RIV: EC - Immunology Impact factor: 2.601, year: 2011

  4. Innate immunity based cancer immunotherapy: B16-F10 murine melanoma model

    Czech Academy of Sciences Publication Activity Database

    Caisová, V.; Vieru, A.; Kumžáková, Z.; Glaserová, S.; Husniková, H.; Vácová, N.; Krejčová, G.; Paďouková, L.; Jochmanová, I.; Wolf, K. I.; Chmelař, J.; Kopecký, Jan; Ženka, J.

    2016-01-01

    Roč. 16, č. 1 (2016), č. článku 940. ISSN 1471-2407 Institutional support: RVO:60077344 Keywords : cancer immunotherapy * innate immunity * melanoma * neutrophils * resiquimod * mannan * phagocytosis Subject RIV: EC - Immunology Impact factor: 3.288, year: 2016

  5. CD8+ T cells provide immune protection against murine disseminated endotheliotropic Orientia tsutsugamushi infection.

    Directory of Open Access Journals (Sweden)

    Guang Xu

    2017-07-01

    Full Text Available Scrub typhus, caused by a Gram-negative obligately intracellular coccobacillus, Orientia tsutsugamushi, is a long neglected but important tropical disease. Orientia tsutsugamushi causes illness in one million people each year, and 1 billion people are at risk. Without appropriate diagnosis and treatment, the disease can cause severe multiorgan failure with a case fatality rate of 7-15%. The current gaps in knowledge of immunity include the unknown mechanisms of host immunity to O. tsutsugamushi. Using an intravenous (i.v. disseminated infection mouse model, we observed that more CD8+ T cells than CD4+ T cells were present in the spleen of infected mice at 12 dpi. We also determined that Treg cells and the proportion of T cells producing IL-10 were significantly increased from 6 dpi, which correlated with the onset of illness, body weight loss, and increased bacterial loads. We further studied CD8-/-, MHC I-/- and wild type control (WT C57BL/6J mice to determine the importance of CD8+ T cells and MHC I molecules. After infection with an ordinarily sub-lethal dose of O. tsutsugamushi, all CD8-/- and MHC I-/- mice were moribund between 12 and 15 dpi, whereas all WT mice survived. Bacterial loads in the lung, kidney, liver and spleen of CD8-/- and MHC I-/- mice were significantly greater than those in WT mice. Interferon-γ (IFN-γ and granzyme B mRNA levels in the liver of CD8-/- and MHC I-/- mice were significantly greater than in WT mice. In addition, more severe histopathologic lesions were observed in CD8-/- mice. Finally, adoptive transfer confirmed a major role of immune CD8+ T cells as well as a less effective contribution by immune CD8 T cell-depleted splenocytes in protection against O. tsutsugamushi infection. These studies demonstrated the critical importance of CD8+ T cells in the host immune response during O. tsutsugamushi infection.

  6. IL-22 and IDO1 Affect Immunity and Tolerance to Murine and Human Vaginal Candidiasis

    Science.gov (United States)

    De Luca, Antonella; Carvalho, Agostinho; Cunha, Cristina; Iannitti, Rossana G.; Pitzurra, Lucia; Giovannini, Gloria; Mencacci, Antonella; Bartolommei, Lorenzo; Moretti, Silvia; Massi-Benedetti, Cristina; Fuchs, Dietmar; De Bernardis, Flavia; Puccetti, Paolo; Romani, Luigina

    2013-01-01

    The ability to tolerate Candida albicans, a human commensal of the gastrointestinal tract and vagina, implicates that host defense mechanisms of resistance and tolerance cooperate to limit fungal burden and inflammation at the different body sites. We evaluated resistance and tolerance to the fungus in experimental and human vulvovaginal candidiasis (VVC) as well as in recurrent VVC (RVVC). Resistance and tolerance mechanisms were both activated in murine VVC, involving IL-22 and IL-10-producing regulatory T cells, respectively, with a major contribution by the enzyme indoleamine 2,3-dioxygenase 1 (IDO1). IDO1 was responsible for the production of tolerogenic kynurenines, such that replacement therapy with kynurenines restored immunoprotection to VVC. In humans, two functional genetic variants in IL22 and IDO1 genes were found to be associated with heightened resistance to RVVC, and they correlated with increased local expression of IL-22, IDO1 and kynurenines. Thus, IL-22 and IDO1 are crucial in balancing resistance with tolerance to Candida, their deficiencies are risk factors for RVVC, and targeting tolerance via therapeutic kynurenines may benefit patients with RVVC. PMID:23853597

  7. The entomopathogenic fungus Nomuraea rileyi impairs cellular immunity of its host Helicoverpa armigera.

    Science.gov (United States)

    Zhong, Ke; Liu, Zhan-Chi; Wang, Jia-Lin; Liu, Xu-Sheng

    2017-09-01

    In this study, we investigated the effect of the entomopathogenic fungus Nomuraea rileyi on Helicoverpa armigera cellular immune responses. Nomuraea rileyi infection had no effect on total hemocyte count (THC), but impaired hemocyte-mediated phagocytosis, nodulation, and encapsulation responses. Nomuraea rileyi infection led to a significant reduction in hemocyte spreading. An in vitro assay revealed that plasma from N. rileyi infected H. armigera larvae suppressed the spreading ability of hemocytes from naïve larvae. We infer that N. rileyi suppresses the cellular immune response of its host, possibly by secreting exogenous, cytotoxic compounds into the host's hemolymph. © 2017 Wiley Periodicals, Inc.

  8. DNAs from Brucella strains activate efficiently murine immune system with production of cytokines, reactive oxygen and nitrogen species.

    Science.gov (United States)

    Tavakoli, Zahra; Ardestani, Sussan K; Lashkarbolouki, Taghi; Kariminia, Amina; Zahraei Salehi, Taghi; Tavassoli, Nasser

    2009-09-01

    Brucellosis is an infectious disease with high impact on innate immune responses which is induced partly by its DNA. In the present study the potential differences of wild type and patients isolates versus attenuated vaccine strains in terms of cytokines, ROS and NO induction on murine splenocytes and peritoneal macrophages were investigated. This panel varied in base composition and included DNA from B. abortus, B. melitensis, B.abortus strain S19 and melitensis strain Rev1, as attenuated live vaccine. Also we included Escherichia coli DNA, calf thymus DNA (a mammalian DNA), as controls. These DNA were evaluated for their ability to stimulate IL-12, TNF-alpha, IL-10, IFN-gamma and ROS production from spleenocytes as well as NO production from peritoneal macrophages. Spleen cells were cultured in 24 well at a concentration of 106 cells/ ml with subsequent addition of 10 microg/ml of Brucella or Ecoli DNAs. These cultures were incubated at 37 degrees C with 5% CO2 for 5 days. Supernatants were harvested and cytokines, ROS and NOx were evaluated. It was observed that TNF-alpha was induced in days 1,3,5 by all Brucella strains DNAs and E. coli DNA, IL-10 only was induced in day 1, IFN- gamma was induced only in day 5 and IL-12 not induced. ROS and NOx were produced by all strains; however, we observed higher production of NOx which were stimulated by DNA of B. melitensis.

  9. Investigation of HIFU-induced anti-tumor immunity in a murine tumor model

    Directory of Open Access Journals (Sweden)

    Lyerly H Kim

    2007-07-01

    Full Text Available Abstract Background High intensity focused ultrasound (HIFU is an emerging non-invasive treatment modality for localized treatment of cancers. While current clinical strategies employ HIFU exclusively for thermal ablation of the target sites, biological responses associated with both thermal and mechanical damage from focused ultrasound have not been thoroughly investigated. In particular, endogenous danger signals from HIFU-damaged tumor cells may trigger the activation of dendritic cells. This response may play a critical role in a HIFU-elicited anti-tumor immune response which can be harnessed for more effective treatment. Methods Mice bearing MC-38 colon adenocarcinoma tumors were treated with thermal and mechanical HIFU exposure settings in order to independently observe HIFU-induced effects on the host's immunological response. In vivo dendritic cell activity was assessed along with the host's response to challenge tumor growth. Results Thermal and mechanical HIFU were found to increase CD11c+ cells 3.1-fold and 4-fold, respectively, as compared to 1.5-fold observed for DC injection alone. In addition, thermal and mechanical HIFU increased CFSE+ DC accumulation in draining lymph nodes 5-fold and 10-fold, respectively. Moreover, focused ultrasound treatments not only caused a reduction in the growth of primary tumors, with tumor volume decreasing by 85% for thermal HIFU and 43% for mechanical HIFU, but they also provided protection against subcutaneous tumor re-challenge. Further immunological assays confirmed an enhanced CTL activity and increased tumor-specific IFN-γ-secreting cells in the mice treated by focused ultrasound, with cytotoxicity induced by mechanical HIFU reaching as high as 27% at a 10:1 effector:target ratio. Conclusion These studies present initial encouraging results confirming that focused ultrasound treatment can elicit a systemic anti-tumor immune response, and they suggest that this immunity is closely related to

  10. Mucosal immunization with recombinant adenoviral vectors expressing murine gammaherpesvirus-68 genes M2 and M3 can reduce latent viral load

    DEFF Research Database (Denmark)

    Hoegh-Petersen, Mette; Thomsen, Allan R; Christensen, Jan P

    2009-01-01

    -68 (MHV-68) is a member of the Gammaherpesvirinae subfamily and represents a useful murine model for this category of infections, in which new vaccination strategies may initially be evaluated. Two attenuated variants of MHV-68 have successfully been used as vaccines, but the oncogenic potential...... of the gammaherpesvirinae speaks against using a similar approach in humans. DNA immunization with plasmids encoding the MHV-68 genes M2 or M3 caused a reduction in either acute or early latent viral load, respectively, but neither immunization had an effect at times later than 14 days post-infection. Adenovirus......-based vaccines are substantially more immunogenic than DNA vaccines and can be applied to induce mucosal immunity. Here we show that a significant reduction of the late viral load in the spleens, at 60 days post-infection, was achieved when immunizing mice both intranasally and subcutaneously with adenoviral...

  11. Peripheral post-ischemic vascular repair is impaired in a murine model of Alzheimer's disease.

    Science.gov (United States)

    Merkulova-Rainon, Tatyana; Mantsounga, Chris S; Broquères-You, Dong; Pinto, Cristina; Vilar, José; Cifuentes, Diana; Bonnin, Philippe; Kubis, Nathalie; Henrion, Daniel; Silvestre, Jean-Sébastien; Lévy, Bernard I

    2018-03-07

    The pathophysiology of sporadic Alzheimer's disease (AD) remains uncertain. Along with brain amyloid-β (Aβ) deposits and neurofibrillary tangles, cerebrovascular dysfunction is increasingly recognized as fundamental to the pathogenesis of AD. Using an experimental model of limb ischemia in transgenic APPPS1 mice, a model of AD (AD mice), we showed that microvascular impairment also extends to the peripheral vasculature in AD. At D70 following femoral ligation, we evidenced a significant decrease in cutaneous blood flow (- 29%, P < 0.001), collateral recruitment (- 24%, P < 0.001), capillary density (- 22%; P < 0.01) and arteriole density (- 28%; P < 0.05) in hind limbs of AD mice compared to control WT littermates. The reactivity of large arteries was not affected in AD mice, as confirmed by unaltered size, and vasoactive responses to pharmacological stimuli of the femoral artery. We identified blood as the only source of Aβ in the hind limb; thus, circulating Aβ is likely responsible for the impairment of peripheral vasculature repair mechanisms. The levels of the majority of pro-angiogenic mediators were not significantly modified in AD mice compared to WT mice, except for TGF-β1 and PlGF-2, both of which are involved in vessel stabilization and decreased in AD mice (P = 0.025 and 0.019, respectively). Importantly, endothelin-1 levels were significantly increased, while those of nitric oxide were decreased in the hind limb of AD mice (P < 0.05). Our results suggest that vascular dysfunction is a systemic disorder in AD mice. Assessment of peripheral vascular function may therefore provide additional tools for early diagnosis and management of AD.

  12. Dendritic cells pulsed with a tumor-specific peptide induce long-lasting immunity and are effective against murine intracerebral melanoma.

    Science.gov (United States)

    Heimberger, Amy B; Archer, Gary E; Crotty, Laura E; McLendon, Roger E; Friedman, Allan H; Friedman, Henry S; Bigner, Darell D; Sampson, John H

    2002-01-01

    Dendritic cells (DCs) are specialized cells of the immune system that are capable of generating potent immune responses that are active even within the "immunologically privileged" central nervous system. However, immune responses generated by DCs have also been demonstrated to produce clinically significant autoimmunity. Targeting the epidermal growth factor receptor variant III (EGFRvIII), which is a mutation specific to tumor tissue, could eliminate this risk. The purpose of this study was to demonstrate that DC-based immunizations directed solely against this tumor-specific antigen, which is commonly found on tumors that originate within or metastasize to the brain, could be efficacious. C3H mice were vaccinated with DCs mixed with a keyhole limpet hemocyanin conjugate of the tumor-specific peptide, PEP-3, which spans the EGFRvIII mutation, or the random-sequence peptide, PEP-1, and were intracerebrally challenged with a syngeneic melanoma expressing a murine homologue of EGFRvIII. Systemic immunization with DCs mixed with PEP-3-keyhole limpet hemocyanin generated antigen-specific immunity. Among mice challenged with intracerebral tumors, this resulted in an approximately 600% increase in the median survival time (>300 d, P < 0.0016), relative to control values. Sixty-three percent of mice treated with DCs mixed with the tumor-specific peptide survived in the long term and 100% survived rechallenge with tumor, indicating that antitumor immunological memory was also induced. In a murine melanoma model, immunization with DCs mixed with tumor-specific peptide results in an antigen-specific immunological response that recognizes the EGFRvIII mutation, has potent antitumor efficacy against intracerebral tumors that express EGFRvIII, and results in long-lasting antitumor immunity.

  13. Impairment of innate immune responses in cirrhotic patients and treatment by branched-chain amino acids

    Science.gov (United States)

    Nakamura, Ikuo

    2014-01-01

    It has been reported that host defense responses, such as phagocytic function of neutrophils and natural killer (NK) cell activity of lymphocytes, are impaired in cirrhotic patients. This review will concentrate on the impairment of innate immune responses in decompensated cirrhotic patients and the effect of the treatment by branched-chain amino acids (BCAA) on innate immune responses. We already reported that phagocytic function of neutrophils was significantly improved by 3-mo BCAA supplementation. In addition, the changes of NK activity were also significant at 3 mo of supplementation compared with before supplementation. Also, Fisher’s ratios were reported to be significantly increased at 3 mo of BCAA supplementation compared with those before oral supplementation. Therefore, administration of BCAA could reduce the risk of bacterial and viral infection in patients with decompensated cirrhosis by restoring impaired innate immune responses of the host. In addition, it was also revealed that BCAA oral supplementation could reduce the risk of development of hepatocellular carcinoma in cirrhotic patients. The mechanisms of the effects will also be discussed in this review article. PMID:24966600

  14. Stem cells rejuvenate radiation-impaired vasculogenesis in murine distraction osteogenesis.

    Science.gov (United States)

    Deshpande, Sagar S; Gallagher, Kathleen K; Donneys, Alexis; Nelson, Noah S; Guys, Nicholas P; Felice, Peter A; Page, Erin E; Sun, Hongli; Krebsbach, Paul H; Buchman, Steven R

    2015-03-01

    Radiotherapy is known to be detrimental to bone and soft-tissue repair. Bone marrow stromal cells have been shown to enhance bone regeneration during distraction osteogenesis following radiation therapy. The authors posit that transplanted bone marrow stromal cells will significantly augment the mandibular vascularity devastated by radiation therapy. Nineteen male Lewis rats were split randomly into three groups: distraction osteogenesis only (n = 5), radiation therapy plus distraction osteogenesis (n = 7), and radiation therapy plus distraction osteogenesis with intraoperative placement of 2 million bone marrow stromal cells (n = 7). A mandibular osteotomy was performed, and an external fixator device was installed. From postoperative days 4 through 12, rats underwent a gradual 5.1-mm distraction followed by a 28-day consolidation period. On postoperative day 40, Microfil was perfused into the vasculature and imaging commenced. Vascular radiomorphometric values were calculated for regions of interest. An analysis of variance with post hoc Tukey or Games-Howell tests was used, dependent on data homogeneity. Stereologic analysis indicated significant remediation in vasculature in the bone marrow stromal cell group compared with the radiation therapy/distraction osteogenesis group. Each of five metrics idicated significant improvements from radiation therapy/distraction osteogenesis to the bone marrow stromal cell group, with no difference between the bone marrow stromal cell group and the distraction osteogenesis group. Bone marrow stromal cells used together with distraction osteogenesis can rejuvenate radiation-impaired vasculogenesis in the mandible, reversing radiation therapy-induced isotropy and creating a robust vascular network. Bone marrow stromal cells may offer clinicians an alternative reconstructive modality that could improve the lifestyle of patients with hypovascular bone.

  15. Dynamic changes of the early protein synthesis in murine immune cells after low dose radiation

    International Nuclear Information System (INIS)

    Chen Shali; Liu Shuzheng

    1997-01-01

    It was shown that there was a marked increase in protein synthesis of thymocytes that were metabolically labelled with 3 H-Leu for 4,6,8 and 12 hours in low dose irradiated mice showing 33.26%, 51.48%, 51.54% and 34.98% increase respectively at different time intervals of incubation when the thymic and splenic cells were sampled 4 hours after whole body irradiation (WBI) with 75 mGy X-rays. The results suggest that there is an increase in protein synthesis with its peak at 6∼8 hours after radiation. Changes in protein synthesis of immune cells in mice 4 hours after radiation and incubated for 4∼12 h were observed with SDS-PAGE followed by densitometrical scanning. It is revealed that 28 kD protein synthesis was increased gradually within 12 hours of incubation and 43 kD protein synthesis was increased in the thymocytes rapidly reaching a maximum 2 hours after incubation. It was also exhibited that the synthesis of 43 kD protein and 32 kD protein was increased in the splenocytes 2 hours after incubation. These findings may have implications in the mechanism of immunoenhancement and adaptive response induced by low dose radiation

  16. Amelioration of murine passive immune thrombocytopenia by IVIg and a therapeutic monoclonal CD44 antibody does not require the Myd88 signaling pathway.

    Directory of Open Access Journals (Sweden)

    Andrew R Crow

    Full Text Available Immune thrombocytopenia (ITP is an autoimmune bleeding disorder characterized by a low platelet count and the production of anti-platelet antibodies. The majority of ITP patients have antibodies to platelet integrin α(IIbβ₃ (GPIIbIIIa which can direct platelet phagocytosis by macrophages. One effective treatment for patients with ITP is intravenous immunoglobulin (IVIg which rapidly reverses thrombocytopenia. The exact mechanism of IVIg action in human patients is unclear, although in mouse models of passive ITP, IVIg can rapidly increase platelet counts in the absence of adaptive immunity. Another antibody therapeutic that can similarly increase platelet counts independent of adaptive immunity are CD44 antibodies. Toll-like receptors (TLRs are pattern recognition receptors which play a central role in helping direct the innate immune system. Dendritic cells, which are notable for their expression of TLRs, have been directly implicated in IVIg function as an initiator cell, while CD44 can associate with TLR2 and TLR4. We therefore questioned whether IVIg, or the therapeutic CD44 antibody KM114, mediate their ameliorative effects in a manner dependent upon normal TLR function. Here, we demonstrate that the TLR4 agonist LPS does not inhibit IVIg or KM114 amelioration of antibody-induced thrombocytopenia, and that these therapeutics do not ameliorate LPS-induced thrombocytopenia. IVIg was able to significantly ameliorate murine ITP in C3H/HeJ mice which have defective TLR4. All known murine TLRs except TLR3 utilize the Myd88 adapter protein to drive TLR signaling. Employing Myd88 deficient mice, we found that both IVIg and KM114 ameliorate murine ITP in Myd88 deficient mice to the same extent as normal mice. Thus both IVIg and anti-CD44 antibody can mediate their ameliorative effects in murine passive ITP independent of the Myd88 signaling pathway. These data help shed light on the mechanism of action of IVIg and KM114 in the amelioration of

  17. Activation of specific cellular immunity toward murine leukemia in mice rejecting syngeneic somatic hybrid cells

    International Nuclear Information System (INIS)

    Liang, W.; Cohen, E.P.

    1977-01-01

    ASL-1 x LM(TK) - somatic hybrid cells form both H-2/sup a/ and H-2/sup k/ antigen complexes. After forming a localized tumor in syngeneic (A/J x C 3 H/HeJ)F 1 mice, they are rejected. Such mice are resistant to otherwise invariably lethal injections of ASL-1 cells, surviving for prolonged and, in some instances, indefinite periods. To examine the basis of immunity, the capacity of spleen cells from mice rejecting hybrid cells to stimulate the release of 51 Cr from labeled ASL-1 cells was investigated. Cells from the spleens of mice rejecting ASL-1 x LM(TK) - cells stimulated the release of 51 Cr from labeled ASL-1 cells, but not from Ehrlich ascites or P815 cells. Cells from mice injected with mitomycin-C-treated ASL-1 cells led to the release of 51 Cr from labeled ASL-1 cells as well, but the extent of 51 Cr release was approximately one-third as occurred in the presence of cells from hybrid cell-injected mice. Cells from noninjected mice or from mice injected with LM(TK) - cells failed to lead to the specific release of 51 Cr from ASL-1 cells. The presence of unlabeled ASL-1 cells, but not Ehrlich ascites cells, competitively inhibited the spleen cell-stimulated release of 51 Cr from labeled ASL-1 cells. Sera from A/J mice injected with mitomycin-C-treated ASL-1 cells contained antibodies specific for the tumor-associated antigen of ASL-1 cells

  18. Murine immune response induced by Leishmania major during the implantation of paraffin tablets.

    Science.gov (United States)

    Reis, Maria Letícia Costa; Ferreira, Vanessa Martins; Zhang, Xia; Gonçalves, Ricardo; Vieira, Leda Quércia; Tafuri, Washington Luiz; Mosser, David M; Tafuri, Wagner Luiz

    2010-11-01

    We carried out a model of chronic inflammation using a subcutaneous paraffin tablet in mice experimentally infected with Leishmania major. It was previously reported that the parasite load following paraffin implantation occurred at a peak of 21 days in both BALB/c and C57BL/6 mice. At the present study, we have investigated what cytokines and chemokines are directly related to the parasite load in C57BL/6 mice. All mice were divided in four groups: mice implanted with paraffin tablets; mice experimentally infected with L. major; mice implanted with paraffin tablets and experimentally infected with L. major; and mice submitted only to the surgery were used for the Real-Time Polymerase Chain Reaction (RT-PCR) controls. Fragments of skin tissue and the tissue surrounding the paraffin tablets (inflammatory capsule) were collected for histopathology and RT-PCR studies. By 21 days, a diffuse chronic inflammatory reaction was mainly observed in the deep dermis where macrophages parasitized with Leishmania amastigotes were also found. RT-PCR analysis has shown that BALB/c mice showed strong IL-4 and IL-10 mRNA expression than controls with very little expression of IFN-γ. In contrast, both IFN-γ and IL-10 mRNA was found in higher levels in C57BL/6 animals. Moreover, in C57BL/6 mice the expression of chemokines mRNA of CCL3/MIP-1α was more highly expressed than CCL2/MCP-1. We conclude that the Th1 immune response C57BL/6 did not change to a Th2 response, even though C57BL/6 animals presented higher parasitism than BALB/c mice 21 days after infection and paraffin implantation.

  19. Natural and vaccine-mediated immunity to Salmonella Typhimurium is impaired by the helminth Nippostrongylus brasiliensis.

    Directory of Open Access Journals (Sweden)

    Saeeda Bobat

    2014-12-01

    Full Text Available The impact of exposure to multiple pathogens concurrently or consecutively on immune function is unclear. Here, immune responses induced by combinations of the bacterium Salmonella Typhimurium (STm and the helminth Nippostrongylus brasiliensis (Nb, which causes a murine hookworm infection and an experimental porin protein vaccine against STm, were examined.Mice infected with both STm and Nb induced similar numbers of Th1 and Th2 lymphocytes compared with singly infected mice, as determined by flow cytometry, although lower levels of secreted Th2, but not Th1 cytokines were detected by ELISA after re-stimulation of splenocytes. Furthermore, the density of FoxP3+ T cells in the T zone of co-infected mice was lower compared to mice that only received Nb, but was greater than those that received STm. This reflected the intermediate levels of IL-10 detected from splenocytes. Co-infection compromised clearance of both pathogens, with worms still detectable in mice weeks after they were cleared in the control group. Despite altered control of bacterial and helminth colonization in co-infected mice, robust extrafollicular Th1 and Th2-reflecting immunoglobulin-switching profiles were detected, with IgG2a, IgG1 and IgE plasma cells all detected in parallel. Whilst extrafollicular antibody responses were maintained in the first weeks after co-infection, the GC response was less than that in mice infected with Nb only. Nb infection resulted in some abrogation of the longer-term development of anti-STm IgG responses. This suggested that prior Nb infection may modulate the induction of protective antibody responses to vaccination. To assess this we immunized mice with porins, which confer protection in an antibody-dependent manner, before challenging with STm. Mice that had resolved a Nb infection prior to immunization induced less anti-porin IgG and had compromised protection against infection.These findings demonstrate that co-infection can radically alter

  20. Elicitation of strong immune responses by a DNA vaccine expressing a secreted form of hepatitis C virus envelope protein E2 in murine and porcine animal models

    DEFF Research Database (Denmark)

    Li, Yiping; Kang, H.N.; Babiuk, L.A.

    2006-01-01

    boosting with a recombinant E2 protein vaccine formulated with CpG ODN and 10% Emulsigen. The immunogenicity of HCV E2 vaccines was analyzed by ELISA for antibody responses, MTT assay for lymphocyte proliferation, ELISPOT for the number of interferon-gamma secreting cells, and cytotoxic T lymphocyte assays...... and shifted the immune response towards Th2-like ones in piglets. CONCLUSION: A DNA vaccine expressing a secreted form of HCV E2 protein elicited E2-specific immune responses in mice and piglets. Recombinant E2 protein vaccination following DNA immunization significantly increased the antibody response......AIM: To characterize the immunogenicity of a hepatitis C virus (HCV) E2 DNA vaccine alone or with a protein vaccine boost in murine and porcine animal models. METHODS: A DNA vaccine expressing a secreted form of HCV E2 protein was constructed and used to vaccinate mice and piglets with or without...

  1. Tumor regression induced by intratumor therapy with a disabled infectious single cycle (DISC) herpes simplex virus (HSV) vector, DISC/HSV/murine granulocyte-macrophage colony-stimulating factor, correlates with antigen-specific adaptive immunity.

    Science.gov (United States)

    Ali, Selman A; Lynam, June; McLean, Cornelia S; Entwisle, Claire; Loudon, Peter; Rojas, José M; McArdle, Stephanie E B; Li, Geng; Mian, Shahid; Rees, Robert C

    2002-04-01

    Direct intratumor injection of a disabled infectious single cycle HSV-2 virus encoding the murine GM-CSF gene (DISC/mGM-CSF) into established murine colon carcinoma CT26 tumors induced a significant delay in tumor growth and complete tumor regression in up to 70% of animals. Pre-existing immunity to HSV did not reduce the therapeutic efficacy of DISC/mGM-CSF, and, when administered in combination with syngeneic dendritic cells, further decreased tumor growth and increased the incidence of complete tumor regression. Direct intratumor injection of DISC/mGM-CSF also inhibited the growth of CT26 tumor cells implanted on the contralateral flank or seeded into the lungs following i.v. injection of tumor cells (experimental lung metastasis). Proliferation of splenocytes in response to Con A was impaired in progressor and tumor-bearer, but not regressor, mice. A potent tumor-specific CTL response was generated from splenocytes of all mice with regressing, but not progressing tumors following in vitro peptide stimulation; this response was specific for the gp70 AH-1 peptide SPSYVYHQF and correlated with IFN-gamma, but not IL-4 cytokine production. Depletion of CD8(+) T cells from regressor splenocytes before in vitro stimulation with the relevant peptide abolished their cytolytic activity, while depletion of CD4(+) T cells only partially inhibited CTL generation. Tumor regression induced by DISC/mGM-CSF virus immunotherapy provides a unique model for evaluating the immune mechanism(s) involved in tumor rejection, upon which tumor immunotherapy regimes may be based.

  2. Mucosal immunization with recombinant adenoviral vectors expressing murine gammaherpesvirus-68 genes M2 and M3 can reduce latent viral load.

    Science.gov (United States)

    Hoegh-Petersen, Mette; Thomsen, Allan R; Christensen, Jan P; Holst, Peter J

    2009-11-12

    Gammaherpesviruses establish life-long latent infections in their hosts. If the host becomes immunosuppressed, these viruses may reactivate and cause severe disease, and even in immunocompetent individuals the gammaherpesviruses are presumed to have an oncogenic potential. Murine gammaherpesvirus-68 (MHV-68) is a member of the Gammaherpesvirinae subfamily and represents a useful murine model for this category of infections, in which new vaccination strategies may initially be evaluated. Two attenuated variants of MHV-68 have successfully been used as vaccines, but the oncogenic potential of the gammaherpesvirinae speaks against using a similar approach in humans. DNA immunization with plasmids encoding the MHV-68 genes M2 or M3 caused a reduction in either acute or early latent viral load, respectively, but neither immunization had an effect at times later than 14 days post-infection. Adenovirus-based vaccines are substantially more immunogenic than DNA vaccines and can be applied to induce mucosal immunity. Here we show that a significant reduction of the late viral load in the spleens, at 60 days post-infection, was achieved when immunizing mice both intranasally and subcutaneously with adenoviral vectors encoding both M2 and M3. Additionally we show that M3 immunization prevented the usual development of virus-induced splenomegaly at 2-3 weeks post-infection. This is the first time that immunization with a non-replicating vaccine has lead to a significantly reduced viral load at time points beyond 14 days post-infection, and thus demonstrates that a non-replicating vaccine may successfully be employed to reduce the viral burden during chronic gammaherpesvirus infection.

  3. Blocking Indolamine-2,3-Dioxygenase Rebound Immune Suppression Boosts Antitumor Effects of Radio-Immunotherapy in Murine Models and Spontaneous Canine Malignancies.

    Science.gov (United States)

    Monjazeb, Arta M; Kent, Michael S; Grossenbacher, Steven K; Mall, Christine; Zamora, Anthony E; Mirsoian, Annie; Chen, Mingyi; Kol, Amir; Shiao, Stephen L; Reddy, Abhinav; Perks, Julian R; T N Culp, William; Sparger, Ellen E; Canter, Robert J; Sckisel, Gail D; Murphy, William J

    2016-09-01

    Previous studies demonstrate that intratumoral CpG immunotherapy in combination with radiotherapy acts as an in-situ vaccine inducing antitumor immune responses capable of eradicating systemic disease. Unfortunately, most patients fail to respond. We hypothesized that immunotherapy can paradoxically upregulate immunosuppressive pathways, a phenomenon we term "rebound immune suppression," limiting clinical responses. We further hypothesized that the immunosuppressive enzyme indolamine-2,3-dioxygenase (IDO) is a mechanism of rebound immune suppression and that IDO blockade would improve immunotherapy efficacy. We examined the efficacy and immunologic effects of a novel triple therapy consisting of local radiotherapy, intratumoral CpG, and systemic IDO blockade in murine models and a pilot canine clinical trial. In murine models, we observed marked increase in intratumoral IDO expression after treatment with radiotherapy, CpG, or other immunotherapies. The addition of IDO blockade to radiotherapy + CpG decreased IDO activity, reduced tumor growth, and reduced immunosuppressive factors, such as regulatory T cells in the tumor microenvironment. This triple combination induced systemic antitumor effects, decreasing metastases, and improving survival in a CD8(+) T-cell-dependent manner. We evaluated this novel triple therapy in a canine clinical trial, because spontaneous canine malignancies closely reflect human cancer. Mirroring our mouse studies, the therapy was well tolerated, reduced intratumoral immunosuppression, and induced robust systemic antitumor effects. These results suggest that IDO maintains immune suppression in the tumor after therapy, and IDO blockade promotes a local antitumor immune response with systemic consequences. The efficacy and limited toxicity of this strategy are attractive for clinical translation. Clin Cancer Res; 22(17); 4328-40. ©2016 AACR. ©2016 American Association for Cancer Research.

  4. Ubiquitin-specific Protease-7 Inhibition Impairs Tip60-dependent Foxp3+ T-regulatory Cell Function and Promotes Antitumor Immunity

    Directory of Open Access Journals (Sweden)

    Liqing Wang

    2016-11-01

    Full Text Available Foxp3+ T-regulatory (Treg cells are known to suppress protective host immune responses to a wide variety of solid tumors, but their therapeutic targeting is largely restricted to their transient depletion or “secondary” modulation, e.g. using anti-CTLA-4 monoclonal antibody. Our ongoing studies of the post-translational modifications that regulate Foxp3 demonstrated that the histone/protein acetyltransferase, Tip60, plays a dominant role in promoting acetylation, dimerization and function in Treg cells. We now show that the ubiquitin-specific protease, Usp7, controls Treg function largely by stabilizing the expression and promoting the multimerization of Tip60 and Foxp3. Genetic or pharmacologic targeting of Usp7 impairs Foxp3+ Treg suppressive functions, while conventional T cell responses remain intact. As a result, pharmacologic inhibitors of Usp7 can limit tumor growth in immunocompetent mice, and promote the efficacy of antitumor vaccines and immune checkpoint therapy with anti-PD1 monoclonal antibody in murine models. Hence, pharmacologic therapy with Usp7 inhibitors may have an important role in future cancer immunotherapy.

  5. CD4+ and CD8+ T cells can act separately in tumour rejection after immunization with murine pneumotropic virus chimeric Her2/neu virus-like particles.

    Directory of Open Access Journals (Sweden)

    Kalle Andreasson

    Full Text Available BACKGROUND: Immunization with murine pneumotropic virus virus-like particles carrying Her2/neu (Her2MPtVLPs prevents tumour outgrowth in mice when given prophylactically, and therapeutically if combined with the adjuvant CpG. We investigated which components of the immune system are involved in tumour rejection, and whether long-term immunological memory can be obtained. METHODOLOGY AND RESULTS: During the effector phase in BALB/c mice, only depletion of CD4+ and CD8+ in combination, with or without NK cells, completely abrogated tumour protection. Depletion of single CD4+, CD8+ or NK cell populations only had minor effects. During the immunization/induction phase, combined depletion of CD4+ and CD8+ cells abolished protection, while depletion of each individual subset had no or negligible effect. When tumour rejection was studied in knock-out mice with a C57Bl/6 background, protection was lost in CD4-/-CD8-/- and CD4-/-, but not in CD8-/- mice. In contrast, when normal C57Bl/6 mice were depleted of different cell types, protection was lost irrespective of whether only CD4+, only CD8+, or CD4+ and CD8+ cells in combination were eradicated. No anti-Her2/neu antibodies were detected but a Her2/neu-specific IFNgamma response was seen. Studies of long-term memory showed that BALB/c mice could be protected against tumour development when immunized together with CpG as long as ten weeks before challenge. CONCLUSION: Her2MPtVLP immunization is efficient in stimulating several compartments of the immune system, and induces an efficient immune response including long-term memory. In addition, when depleting mice of isolated cellular compartments, tumour protection is not as efficiently abolished as when depleting several immune compartments together.

  6. Vaccination with a HSV-2 UL24 mutant induces a protective immune response in murine and guinea pig vaginal infection models.

    Science.gov (United States)

    Visalli, Robert J; Natuk, Robert J; Kowalski, Jacek; Guo, Min; Blakeney, Susan; Gangolli, Seema; Cooper, David

    2014-03-10

    The rational design and development of genetically attenuated HSV-2 mutant viruses represent an attractive approach for developing both prophylactic and therapeutic vaccines for genital herpes. Previously, HSV-2 UL24 was shown to be a virulence determinant in both murine and guinea pig vaginal infection models. An UL24-βgluc insertion mutant produced syncytial plaques and replicated to nearly wild type levels in tissue culture, but induced little or no pathological effects in recipient mice or guinea pigs following vaginal infection. Here we report that immunization of mice or guinea pigs with high or low doses of UL24-βgluc elicited a highly protective immune response. UL24-βgluc immunization via the vaginal or intramuscular routes was demonstrated to protect mice from a lethal vaginal challenge with wild type HSV-2. Moreover, antigen re-stimulated splenic lymphocytes harvested from immunized mice exhibited both HSV-2 specific CTL activity and IFN-γ expression. Humoral anti-HSV-2 responses in serum were Th1-polarized (IgG2a>IgG1) and contained high-titer anti-HSV-2 neutralizing activity. Guinea pigs vaccinated subcutaneously with UL24-βgluc or the more virulent parental strain (186) were challenged with a heterologous HSV-2 strain (MS). Acute disease scores were nearly indistinguishable in guinea pigs immunized with either virus. Recurrent disease scores were reduced in UL24-βgluc immunized animals but not to the same extent as those immunized with strain 186. In addition, challenge virus was not detected in 75% of guinea pigs subcutaneously immunized with UL24-βgluc. In conclusion, disruption of the UL24 gene is a prime target for the development of a genetically attenuated live HSV-2 vaccine. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Yulangsan polysaccharide improves redox homeostasis and immune impairment in D-galactose-induced mimetic aging.

    Science.gov (United States)

    Doan, Van Minh; Chen, Chunxia; Lin, Xing; Nguyen, Van Phuc; Nong, Zhihuan; Li, Weisi; Chen, Qingquan; Ming, Jianjun; Xie, Qiuqiao; Huang, Renbin

    2015-05-01

    Yulangsan polysaccharide (YLSP) is a traditional Chinese medicine used in long-term treatment as a modulator of brain dysfunction and immunity. In this study, we evaluated the protective effect of YLSP against D-galactose-induced impairment of oxidative stress and the immune system and evaluated its possible mechanism of action. D-galactose was subcutaneously injected into the dorsal neck of mice daily for 8 weeks to establish the aging model. YLSP was simultaneously administered once daily. The results indicate that YLSP significantly improves the general appearance of the aging mice. YLSP significantly increased the levels of antioxidant enzymes, such as super oxide dismutase, glutathione peroxidase, catalase and total anti-oxidation capability, while decreasing the content of malondialdehyde in different tissues, including the liver, brain, and serum. YLSP also increased the interleukin-2 level while decreasing the interleukin-6 level. Moreover, YLSP significantly inhibited advanced glycation end product formation. Furthermore, YLSP decreased p21 and p53 gene expressions in the liver and brain of D-galactose-treated mice. These results suggest that YLSP may have a protective effect suppressing the aging process by enhancing antioxidant activity and immunity, as well as modulating aging-related gene expression.

  8. The effect of perioperative analgesic drugs omnopon and dexketoprofen on the functional activity of immune cells in murine model of tumor surgery.

    Science.gov (United States)

    Sydor, R I; Khranovska, N M; Skachkova, O V; Skivka, L M

    2016-01-01

    We aimed to investigate the effect of perioperative analgesia with nonselective cyclooxygenase-2 inhibitor dexketoprofen and opioid drug omnopon on the functional activity of immune cells in tumor excision murine model. Lewis lung carcinoma cells were transplanted into hind paw of C57/black mice. On the 23th day tumor was removed. Analgesic drugs were injected 30 min before and once a day for 3 days after the surgery. Biological material was obtained a day before, 1 day and 3 days after the tumor removal. IFN-γ, IL-4, IL-10 and TGF-β mRNA levels in splenic cells were assessed by quantitative real-time RT-PCR. Cytotoxic activity of splenocytes was estimated by flow cytometry. We found that in splenocytes of mice received opioid analgesia IL-10 mRNA level was increased 2.3 times on day one after the surgery compared to preoperative level (P dexketoprofen group this parameter did not change. IFN-γ gene expression level on day 3 after tumor removal was 40% higher in splenocytes of dexketoprofen treated mice as compared with omnopon treated animals (P dexketoprofen against (50.2 ± 3.3)% in omnopon group. In conclusion, perioperative analgesia with cyclooxygenase inhibitor dexketoprofen in contrast to opioid analgesia with omnopon preserves higher functional activity of murine immune cells in the experimental model of tumor surgery.

  9. Francisella tularensis Catalase Restricts Immune Function by Impairing TRPM2 Channel Activity.

    Science.gov (United States)

    Shakerley, Nicole L; Chandrasekaran, Akshaya; Trebak, Mohamed; Miller, Barbara A; Melendez, J Andrés

    2016-02-19

    As an innate defense mechanism, macrophages produce reactive oxygen species that weaken pathogens and serve as secondary messengers involved in immune function. The Gram-negative bacterium Francisella tularensis utilizes its antioxidant armature to limit the host immune response, but the mechanism behind this suppression is not defined. Here we establish that F. tularensis limits Ca(2+) entry in macrophages, thereby limiting actin reorganization and IL-6 production in a redox-dependent fashion. Wild type (live vaccine strain) or catalase-deficient F. tularensis (ΔkatG) show distinct profiles in their H2O2 scavenging rates, 1 and 0.015 pm/s, respectively. Murine alveolar macrophages infected with ΔkatG display abnormally high basal intracellular Ca(2+) concentration that did not increase further in response to H2O2. Additionally, ΔkatG-infected macrophages displayed limited Ca(2+) influx in response to ionomycin, as a result of ionophore H2O2 sensitivity. Exogenously added H2O2 or H2O2 generated by ΔkatG likely oxidizes ionomycin and alters its ability to transport Ca(2+). Basal increases in cytosolic Ca(2+) and insensitivity to H2O2-mediated Ca(2+) entry in ΔkatG-infected cells are reversed by the Ca(2+) channel inhibitors 2-aminoethyl diphenylborinate and SKF-96365. 2-Aminoethyl diphenylborinate but not SKF-96365 abrogated ΔkatG-dependent increases in macrophage actin remodeling and IL-6 secretion, suggesting a role for H2O2-mediated Ca(2+) entry through the transient receptor potential melastatin 2 (TRPM2) channel in macrophages. Indeed, increases in basal Ca(2+), actin polymerization, and IL-6 production are reversed in TRPM2-null macrophages infected with ΔkatG. Together, our findings provide compelling evidence that F. tularensis catalase restricts reactive oxygen species to temper macrophage TRPM2-mediated Ca(2+) signaling and limit host immune function. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Herpes simplex virus type 2 induces rapid cell death and functional impairment of murine dendritic cells in vitro

    NARCIS (Netherlands)

    Jones, CA; Fernandez, M; Herc, K; Bosnjak, L; Miranda-Saksena, M; Boadle, RA; Cunningham, A

    2003-01-01

    Dendritic cells (DC) are critical for stimulation of naive T cells. Little is known about the effect of herpes simplex virus type 2 (HSV-2) infection on DC structure or function or if the observed effects of HSV-1 on human DC are reproduced in murine DC. Here, we demonstrate that by 12 h

  11. Maternal immune activation during pregnancy in rats impairs working memory capacity of the offspring.

    Science.gov (United States)

    Murray, Brendan G; Davies, Don A; Molder, Joel J; Howland, John G

    2017-05-01

    Maternal immune activation during pregnancy is an environmental risk factor for psychiatric illnesses such as schizophrenia in the offspring. Patients with schizophrenia display an array of cognitive symptoms, including impaired working memory capacity. Rodent models have been developed to understand the relationship between maternal immune activation and the cognitive symptoms of schizophrenia. The present experiment was designed to test whether maternal immune activation with the viral mimetic polyinosinic:polycytidylic acid (polyI:C) during pregnancy affects working memory capacity of the offspring. Pregnant Long Evans rats were treated with either saline or polyI:C (4mg/kg; i.v.) on gestational day 15. Male offspring of the litters (2-3months of age) were subsequently trained on a nonmatching-to-sample task with odors. After a criterion was met, the rats were tested on the odor span task, which requires rats to remember an increasing span of different odors to receive food reward. Rats were tested using delays of approximately 40s during the acquisition of the task. Importantly, polyI:C- and saline-treated offspring did not differ in performance of the nonmatching-to-sample task suggesting that both groups could perform a relatively simple working memory task. In contrast, polyI:C-treated offspring had reduced span capacity in the middle and late phases of odor span task acquisition. After task acquisition, the rats were tested using the 40s delay and a 10min delay. Both groups showed a delay-dependent decrease in span, although the polyI:C-treated offspring had significantly lower spans regardless of delay. Our results support the validity of the maternal immune activation model for studying the cognitive symptoms of neurodevelopmental disorders such as schizophrenia. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. FTY720 ameliorates murine sclerodermatous chronic graft-versus-host disease by promoting expansion of splenic regulatory cells and inhibiting immune cell infiltration into skin.

    Science.gov (United States)

    Huu, Doanh Le; Matsushita, Takashi; Jin, Guihua; Hamaguchi, Yasuhito; Hasegawa, Minoru; Takehara, Kazuhiko; Fujimoto, Manabu

    2013-06-01

    Sphingosine 1-phosphate (S1P) exerts a variety of activities in immune, inflammatory, and vascular systems. S1P plays an important role in systemic sclerosis (SSc) pathogenesis. Regulation of S1P in fibrotic diseases as well as in SSc was recently reported. FTY720, an oral S1P receptor modulator, has been shown to be a useful agent for the prevention of transplant rejection and autoimmune diseases. Murine sclerodermatous chronic graft-versus-host disease (GVHD) is a model for human sclerodermatous chronic GVHD and SSc. We undertook this study to investigate the effects of FTY720 in murine sclerodermatous chronic GVHD. FTY720 was orally administered to allogeneic recipient mice from day 0 to day 20 (short-term, early-treatment group), from day 0 to day 42 (full-term, early-treatment group), or from day 22 to day 42 (delayed-treatment group) after bone marrow transplantation. Delayed administration of FTY720 attenuated, and early administration of FTY720 inhibited, the severity and fibrosis in murine sclerodermatous chronic GVHD. With early treatment, FTY720 induced expansion of splenic myeloid-derived suppressor cells, Treg cells, and Breg cells. Vascular damage in chronic GVHD was inhibited by FTY720 through down-regulating serum levels of S1P and soluble E-selectin. FTY720 inhibited infiltration of immune cells into skin. Moreover, FTY720 diminished the expression of messenger RNA for monocyte chemotactic protein 1, macrophage inflammatory protein 1α, RANTES, tumor necrosis factor α, interferon-γ, interleukin-6 (IL-6), IL-10, IL-17A, and transforming growth factor β1 in the skin. FTY720 suppressed the immune response by promoting the expansion of regulatory cells and reducing vascular damage and infiltration of immune cells into the skin. Taken together, these results have important implications for the potential use of FTY720 in the treatment of sclerodermatous chronic GVHD and SSc in humans. Copyright © 2013 by the American College of Rheumatology.

  13. Cancer associated fibroblasts promote tumor growth and metastasis by modulating the tumor immune microenvironment in a 4T1 murine breast cancer model.

    Directory of Open Access Journals (Sweden)

    Debbie Liao

    2009-11-01

    Full Text Available Local inflammation associated with solid tumors commonly results from factors released by tumor cells and the tumor stroma, and promotes tumor progression. Cancer associated fibroblasts comprise a majority of the cells found in tumor stroma and are appealing targets for cancer therapy. Here, our aim was to determine the efficacy of targeting cancer associated fibroblasts for the treatment of metastatic breast cancer.We demonstrate that cancer associated fibroblasts are key modulators of immune polarization in the tumor microenvironment of a 4T1 murine model of metastatic breast cancer. Elimination of cancer associated fibroblasts in vivo by a DNA vaccine targeted to fibroblast activation protein results in a shift of the immune microenvironment from a Th2 to Th1 polarization. This shift is characterized by increased protein expression of IL-2 and IL-7, suppressed recruitment of tumor-associated macrophages, myeloid derived suppressor cells, T regulatory cells, and decreased tumor angiogenesis and lymphangiogenesis. Additionally, the vaccine improved anti-metastatic effects of doxorubicin chemotherapy and enhanced suppression of IL-6 and IL-4 protein expression while increasing recruitment of dendritic cells and CD8(+ T cells. Treatment with the combination therapy also reduced tumor-associated Vegf, Pdgfc, and GM-CSF mRNA and protein expression.Our findings demonstrate that cancer associated fibroblasts promote tumor growth and metastasis through their role as key modulators of immune polarization in the tumor microenvironment and are valid targets for therapy of metastatic breast cancer.

  14. Cancer associated fibroblasts promote tumor growth and metastasis by modulating the tumor immune microenvironment in a 4T1 murine breast cancer model.

    Science.gov (United States)

    Liao, Debbie; Luo, Yunping; Markowitz, Dorothy; Xiang, Rong; Reisfeld, Ralph A

    2009-11-23

    Local inflammation associated with solid tumors commonly results from factors released by tumor cells and the tumor stroma, and promotes tumor progression. Cancer associated fibroblasts comprise a majority of the cells found in tumor stroma and are appealing targets for cancer therapy. Here, our aim was to determine the efficacy of targeting cancer associated fibroblasts for the treatment of metastatic breast cancer. We demonstrate that cancer associated fibroblasts are key modulators of immune polarization in the tumor microenvironment of a 4T1 murine model of metastatic breast cancer. Elimination of cancer associated fibroblasts in vivo by a DNA vaccine targeted to fibroblast activation protein results in a shift of the immune microenvironment from a Th2 to Th1 polarization. This shift is characterized by increased protein expression of IL-2 and IL-7, suppressed recruitment of tumor-associated macrophages, myeloid derived suppressor cells, T regulatory cells, and decreased tumor angiogenesis and lymphangiogenesis. Additionally, the vaccine improved anti-metastatic effects of doxorubicin chemotherapy and enhanced suppression of IL-6 and IL-4 protein expression while increasing recruitment of dendritic cells and CD8(+) T cells. Treatment with the combination therapy also reduced tumor-associated Vegf, Pdgfc, and GM-CSF mRNA and protein expression. Our findings demonstrate that cancer associated fibroblasts promote tumor growth and metastasis through their role as key modulators of immune polarization in the tumor microenvironment and are valid targets for therapy of metastatic breast cancer.

  15. Superior therapeutic efficacy of alphavirus-mediated immunization against human papilloma virus type 16 antigens in a murine tumour model : effects of the route of immunization

    NARCIS (Netherlands)

    Daemen, T; Riezebos-Brilman, A; Regts, J; Dontje, B; van der Zee, A; Wilschut, J

    2004-01-01

    In our efforts to develop a strong, effective immune response against cervical carcinoma and premalignant disease, we study the use of recombinant Semliki Forest virus (SFV) encoding the oncoproteins E6 and E7 from high-risk human papilloma viruses (HPVs). Optimal immunization conditions are

  16. The effect of perioperative analgesic drugs omnopon and dexketoprofen on the functional activity of immune cells in murine model of tumor surgery

    Directory of Open Access Journals (Sweden)

    R. I. Sydor

    2016-08-01

    Full Text Available We aimed to investigate the effect of perioperative analgesia with nonselective cyclooxygenase-2 inhibitor dexketoprofen and opioid drug omnopon on the functional activity of immune cells in tumor excision murine model. Lewis lung carcinoma cells were transplanted into hind paw of C57/black mice. On the 23th day tumor was removed. Analgesic drugs were injected 30 min before and once a day for 3 days after the surgery. Biological material was obtained a day before, 1 day and 3 days after the tumor removal. IFN-γ, IL-4, IL-10 and TGF-β mRNA levels in splenic cells were assessed by quantitative real-time RT-PCR. Cytotoxic activity of splenocytes was estimated by flow cytometry. We found that in splenocytes of mice received opioid analgesia IL-10 mRNA level was increased 2.3 times on day one after the surgery compared to preoperative level (P < 0.05, while in dexketoprofen group this parameter did not change. IFN-γ gene expression level on day 3 after tumor removal was 40% higher in splenocytes of dexketoprofen treated mice as compared with omnopon treated animals (P < 0.05. Cytotoxic activity of splenocytes on day 3 postsurgery was (62.2 ± 2.4% in dexketoprofen against (50.2 ± 3.3% in omnopon group. In conclusion, perioperative analgesia with cyclooxygenase inhibitor dexketoprofen in contrast to opioid analgesia with omnopon preserves higher functional activity of murine immune cells in the experimental model of tumor surgery.

  17. Effects of Lactobacillus plantarum Strain OLL2712 Culture Conditions on the Anti-inflammatory Activities for Murine Immune Cells and Obese and Type 2 Diabetic Mice.

    Science.gov (United States)

    Toshimitsu, T; Ozaki, S; Mochizuki, J; Furuichi, K; Asami, Y

    2017-04-01

    Studies on the health-promoting effects of lactic acid bacteria (LAB) are numerous, but few provide examples of the relationship between LAB function and culture conditions. We verified the effect of differences in culture conditions on Lactobacillus plantarum OLL2712 functionality; this strain exhibits anti-inflammatory activity and preventive effects against metabolic disorders. We measured interleukin-10 (IL-10) and IL-12 production in murine immune cells treated with OLL2712 cells prepared under various culture conditions. The results showed that the IL-10-inducing activities of OLL2712 cells on murine immune cells differed dramatically between OLL2712 groups at different culture phases and using different culture medium components, temperatures, and neutralizing pHs. In particular, exponential-phase cells had much more IL-10-inducing activity than stationary-phase cells. We confirmed that the Toll-like receptor 2 (TLR2) stimulation activity of OLL2712 cells depended on culture conditions in conjunction with IL-10-inducing activity. We also demonstrated functional differences by culture phases in vivo ; OLL2712 cells at exponential phase had more anti-inflammatory activity and anti-metabolic-disorder effects on obese and diabetic mice than those by their stationary-phase counterparts. These results suggest that culture conditions affect the functionality of anti-inflammatory LAB. IMPORTANCE While previous studies demonstrated that culture conditions affected the immunomodulatory properties of lactic acid bacteria (LAB), few have comprehensively investigated the relationship between culture conditions and LAB functionality. In this study, we demonstrated several culture conditions of Lactobacillus plantarum OLL2712 for higher anti-inflammatory activity. We also showed that culture conditions concretely influenced the health-promoting functions of OLL2712 in vivo , particularly against metabolic disorders. Further, we characterized a novel mechanism by which

  18. IgG4 subclass antibodies impair antitumor immunity in melanoma

    Science.gov (United States)

    Karagiannis, Panagiotis; Gilbert, Amy E.; Josephs, Debra H.; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L.C.; Healy, Ciaran; Harries, Mark; Acland, Katharine M.; Blower, Philip J.; Mitchell, Tracey; Fear, David J.; Spicer, James F.; Lacy, Katie E.; Nestle, Frank O.; Karagiannis, Sophia N.

    2013-01-01

    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10–driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4+-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell–mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches. PMID:23454746

  19. The association of fatigue, pain, depression and anxiety with work and activity impairment in immune mediated inflammatory diseases.

    Directory of Open Access Journals (Sweden)

    Murray W Enns

    Full Text Available Impairment in work function is a frequent outcome in patients with chronic conditions such as immune-mediated inflammatory diseases (IMID, depression and anxiety disorders. The personal and economic costs of work impairment in these disorders are immense. Symptoms of pain, fatigue, depression and anxiety are potentially remediable forms of distress that may contribute to work impairment in chronic health conditions such as IMID. The present study evaluated the association between pain [Medical Outcomes Study Pain Effects Scale], fatigue [Daily Fatigue Impact Scale], depression and anxiety [Hospital Anxiety and Depression Scale] and work impairment [Work Productivity and Activity Impairment Scale] in four patient populations: multiple sclerosis (n = 255, inflammatory bowel disease (n = 248, rheumatoid arthritis (n = 154 and a depression and anxiety group (n = 307, using quantile regression, controlling for the effects of sociodemographic factors, physical disability, and cognitive deficits. Each of pain, depression symptoms, anxiety symptoms, and fatigue individually showed significant associations with work absenteeism, presenteeism, and general activity impairment (quantile regression standardized estimates ranging from 0.3 to 1.0. When the distress variables were entered concurrently into the regression models, fatigue was a significant predictor of work and activity impairment in all models (quantile regression standardized estimates ranging from 0.2 to 0.5. These findings have important clinical implications for understanding the determinants of work impairment and for improving work-related outcomes in chronic disease.

  20. Lactobacillus acidophilus induces virus immune defence genes in murine dendritic cells by a Toll-like receptor-2-dependent mechanism

    DEFF Research Database (Denmark)

    Weiss, Gudrun Margarethe; Rasmussen, Simon; Hjerrild Zeuthen, L.

    2010-01-01

    Lactobacilli are probiotics that, among other health-promoting effects, have been ascribed immunostimulating and virus-preventive properties. Certain Lactobacillus spp. have been shown to possess strong interleukin-12 (IL-12) -inducing properties. As IL-12 production depends on the up......-regulation of type I interferons (IFNs), we hypothesized that the strong IL-12-inducing capacity of Lactobacillus acidophilus NCFM in murine bone-marrow-derived dendritic cells (DCs) is caused by an up-regulation of IFN-beta, which subsequently induces IL-12 and the double-stranded RNA binding Toll-like receptor-3...... detected in another L. acidophilus strain (X37), but was not a property of other probiotic strains tested, i.e. Bifidobacterium bifidum Z9 and Escherichia coli Nissle 1917. The IFN-beta expression was markedly reduced in TLR-2(-/-) DCs, dependent on endocytosis, and the major cause of the induction of Il...

  1. Clinical assay stage I clinical trial with the murine monoclonal antibody IOR-T1: Pharmacokinetic and immune answers

    International Nuclear Information System (INIS)

    Faxas Garcia, Maria E.; Guerra Yi, Marta E.; Alvarez, Alejandro; Calderon, Carlos

    2003-01-01

    As part of the stage I clinical trial with the murine monoclonal antibody IOR-T1 at repeated doses (200-800 mg) in patients carriers of cutaneous T-cell lymphoma, the pharmacokinetics and the response against the mouse protein (HAMA) were studied in the 10 patients under treatment. It was observed a great individual variation in the maximum concentration in serum, which was estimated at 2 hours. The mean life time of the monoclonal antibody was between 13.93 and 19.6 hours. Most of the patients developed antibodies against the monoclonal antibody IOR-T1. The presence of this second antibody did not alter significantly the pharmacokinetics of the administered monoclonal antibody

  2. Gliadin stimulation of murine macrophage inflammatory gene expression and intestinal permeability are MyD88-dependent: role of the innate immune response in Celiac disease.

    Science.gov (United States)

    Thomas, Karen E; Sapone, Anna; Fasano, Alessio; Vogel, Stefanie N

    2006-02-15

    Recent studies have demonstrated the importance of TLR signaling in intestinal homeostasis. Celiac disease (CD) is an autoimmune enteropathy triggered in susceptible individuals by the ingestion of gliadin-containing grains. In this study, we sought to test the hypothesis that gliadin initiates this response by stimulating the innate immune response to increase intestinal permeability and by up-regulating macrophage proinflammatory gene expression and cytokine production. To this end, intestinal permeability and the release of zonulin (an endogenous mediator of gut permeability) in vitro, as well as proinflammatory gene expression and cytokine release by primary murine macrophage cultures, were measured. Gliadin and its peptide derivatives, 33-mer and p31-43, were found to be potent inducers of both a zonulin-dependent increase in intestinal permeability and macrophage proinflammatory gene expression and cytokine secretion. Gliadin-induced zonulin release, increased intestinal permeability, and cytokine production were dependent on myeloid differentiation factor 88 (MyD88), a key adapter molecule in the TLR/IL-1R signaling pathways, but were neither TLR2- nor TLR4-dependent. Our data support the following model for the innate immune response to gliadin in the initiation of CD. Gliadin interaction with the intestinal epithelium increases intestinal permeability through the MyD88-dependent release of zonulin that, in turn, enables paracellular translocation of gliadin and its subsequent interaction with macrophages within the intestinal submucosa. There, the interaction of gliadin with macrophages elicits a MyD88-dependent proinflammatory cytokine milieu that facilitates the interaction of T cells with APCs, leading ultimately to the Ag-specific adaptive immune response seen in patients with CD.

  3. Simultaneous administration of vitamin A and DTP vaccine modulates the immune response in a murine cerebral malaria model

    DEFF Research Database (Denmark)

    Hein-Kristensen, L; Jørgensen, M J; Ravn, H

    2010-01-01

    The World Health Organisation recommends vitamin A supplementation (VAS) to children aged 6 months to 5 years in low-income countries, and for logistic reasons, this has been linked to routine childhood immunizations. Observational studies suggest that VAS given with diphtheria-tetanus-pertussis ......The World Health Organisation recommends vitamin A supplementation (VAS) to children aged 6 months to 5 years in low-income countries, and for logistic reasons, this has been linked to routine childhood immunizations. Observational studies suggest that VAS given with diphtheria...

  4. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    National Research Council Canada - National Science Library

    Ribot, Wilson J; Panchal, Rekha G; Brittingham, Katherine C; Ruthel, Gordon; Kenny, Tara A; Lane, Douglas; Curry, Bob; Hoover, Timothy A; Friedlander, Arthur M; Bavari, Sina

    2006-01-01

    Alveolar macrophages (AM) are very important for pulmonary innate immune responses against invading inhaled pathogens because they directly kill the organisms and initiate a cascade of innate and adaptive immune responses...

  5. A Protocol for the Comprehensive Flow Cytometric Analysis of Immune Cells in Normal and Inflamed Murine Non-Lymphoid Tissues

    Science.gov (United States)

    Yu, Yen-Rei A.; O’Koren, Emily G.; Hotten, Danielle F.; Kan, Matthew J.; Kopin, David; Nelson, Erik R.; Que, Loretta; Gunn, Michael D.

    2016-01-01

    Flow cytometry is used extensively to examine immune cells in non-lymphoid tissues. However, a method of flow cytometric analysis that is both comprehensive and widely applicable has not been described. We developed a protocol for the flow cytometric analysis of non-lymphoid tissues, including methods of tissue preparation, a 10-fluorochrome panel for cell staining, and a standardized gating strategy, that allows the simultaneous identification and quantification of all major immune cell types in a variety of normal and inflamed non-lymphoid tissues. We demonstrate that our basic protocol minimizes cell loss, reliably distinguishes macrophages from dendritic cells (DC), and identifies all major granulocytic and mononuclear phagocytic cell types. This protocol is able to accurately quantify 11 distinct immune cell types, including T cells, B cells, NK cells, neutrophils, eosinophils, inflammatory monocytes, resident monocytes, alveolar macrophages, resident/interstitial macrophages, CD11b- DC, and CD11b+ DC, in normal lung, heart, liver, kidney, intestine, skin, eyes, and mammary gland. We also characterized the expression patterns of several commonly used myeloid and macrophage markers. This basic protocol can be expanded to identify additional cell types such as mast cells, basophils, and plasmacytoid DC, or perform detailed phenotyping of specific cell types. In examining models of primary and metastatic mammary tumors, this protocol allowed the identification of several distinct tumor associated macrophage phenotypes, the appearance of which was highly specific to individual tumor cell lines. This protocol provides a valuable tool to examine immune cell repertoires and follow immune responses in a wide variety of tissues and experimental conditions. PMID:26938654

  6. Ablating hedgehog signaling in tenocytes during development impairs biomechanics and matrix organization of the adult murine patellar tendon enthesis.

    Science.gov (United States)

    Breidenbach, Andrew P; Aschbacher-Smith, Lindsey; Lu, Yinhui; Dyment, Nathaniel A; Liu, Chia-Feng; Liu, Han; Wylie, Chris; Rao, Marepalli; Shearn, Jason T; Rowe, David W; Kadler, Karl E; Jiang, Rulang; Butler, David L

    2015-08-01

    Restoring the native structure of the tendon enthesis, where collagen fibers of the midsubstance are integrated within a fibrocartilaginous structure, is problematic following injury. As current surgical methods fail to restore this region adequately, engineers, biologists, and clinicians are working to understand how this structure forms as a prerequisite to improving repair outcomes. We recently reported on the role of Indian hedgehog (Ihh), a novel enthesis marker, in regulating early postnatal enthesis formation. Here, we investigate how inactivating the Hh pathway in tendon cells affects adult (12-week) murine patellar tendon (PT) enthesis mechanics, fibrocartilage morphology, and collagen fiber organization. We show that ablating Hh signaling resulted in greater than 100% increased failure insertion strain (0.10 v. 0.05 mm/mm, p<0.01) as well as sub-failure biomechanical deficiencies. Although collagen fiber orientation appears overtly normal in the midsubstance, ablating Hh signaling reduces mineralized fibrocartilage by 32%, leading to less collagen embedded within mineralized tissue. Ablating Hh signaling also caused collagen fibers to coalesce at the insertion, which may explain in part the increased strains. These results indicate that Ihh signaling plays a critical role in the mineralization process of fibrocartilaginous entheses and may be a novel therapeutic to promote tendon-to-bone healing. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  7. Immunization

    Science.gov (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  8. Maternal immune activation in rats produces temporal perception impairments in adult offspring analogous to those observed in schizophrenia.

    Directory of Open Access Journals (Sweden)

    Ashley R Deane

    Full Text Available The neurophysiology underlying temporal perception significantly overlaps with areas of dysfunction identified in schizophrenia. Patients commonly exhibit distorted temporal perception, which likely contributes to functional impairments. Thus, study of temporal perception in animal models of the disease may help to understand both cognitive and neurobiological factors involved in functional impairments in patients. As maternal immune activation (MIA has been shown to be a significant etiological risk factor in development of schizophrenia and other developmental psychiatric diseases, we tested interval timing in a rat model of MIA that has previously been shown to recapitulate several behavioural and neurophysiological impairments observed in the disease. Rats were tested on a temporal-bisection task, in which temporal duration stimuli were categorized as either "short" or "long" by responding to a corresponding lever. Data from this task were modeled to provide estimates of accuracy and sensitivity of temporal perception. Parameter estimates derived from the model fitting showed that MIA rats significantly overestimated the passage of time compared to controls. These results indicate that the MIA rat paradigm recapitulates timing distortions that are phenotypical of schizophrenia. These findings lend further support to the epidemiological validity of this MIA rat model, supporting its relevance for future research into the role of maternal immune activation in producing neurobiological and behavioural impairments in schizophrenia.

  9. Genome wide transcriptome profiling of a murine acute melioidosis model reveals new insights into how Burkholderia pseudomallei overcomes host innate immunity

    Directory of Open Access Journals (Sweden)

    Nathan Sheila

    2010-11-01

    Full Text Available Abstract Background At present, very little is known about how Burkholderia pseudomallei (B. pseudomallei interacts with its host to elicit melioidosis symptoms. We established a murine acute-phase melioidosis model and used DNA microarray technology to investigate the global host/pathogen interaction. We compared the transcriptome of infected liver and spleen with uninfected tissues over an infection period of 42 hr to identify genes whose expression is altered in response to an acute infection. Results Viable B. pseudomallei cells were consistently detected in the blood, liver and spleen during the 42 hr course of infection. Microarray analysis of the liver and spleen over this time course demonstrated that genes involved in immune response, stress response, cell cycle regulation, proteasomal degradation, cellular metabolism and signal transduction pathways were differentially regulated. Up regulation of toll-like receptor 2 (TLR2 gene expression suggested that a TLR2-mediated signalling pathway is responsible for recognition and initiation of an inflammatory response to the acute B. pseudomallei infection. Most of the highly elevated inflammatory genes are a cohort of "core host immune response" genes commonly seen in general inflammation infections. Concomitant to this initial inflammatory response, we observed an increase in transcripts associated with cell-death, caspase activation and peptidoglysis that ultimately promote tissue injury in the host. The complement system responsible for restoring host cellular homeostasis and eliminating intracellular bacteria was activated only after 24 hr post-infection. However, at this time point, diverse host nutrient metabolic and cellular pathways including glycolysis, fatty acid metabolism and tricarboxylic acid (TCA cycle were repressed. Conclusions This detailed picture of the host transcriptional response during acute melioidosis highlights a broad range of innate immune mechanisms that are

  10. Childhood exposure to ambient polycyclic aromatic hydrocarbons is linked to epigenetic modifications and impaired systemic immunity in T cells

    Science.gov (United States)

    Hew, K. M.; Walker, A. I.; Kohli, A.; Garcia, M.; Syed, A.; McDonald-Hyman, C.; Noth, E. M.; Mann, J. K.; Pratt, B.; Balmes, J.; Hammond, S. Katharine; Eisen, E. A.; Nadeau, K. C.

    2015-01-01

    Summary Background Evidence suggests that exposure to polycyclic aromatic hydrocarbons (PAHs) increases atopy; it is unclear how PAH exposure is linked to increased severity of atopic diseases. Objective We hypothesized that ambient PAH exposure is linked to impairment of immunity in atopic children (defined as children with asthma and/or allergic rhinitis) from Fresno, California, an area with elevated ambient PAHs. Methods We recruited 256 subjects from Fresno, CA. Ambient PAH concentrations (ng/m3) were measured using a spatial-temporal regression model over multiple time periods. Asthma diagnosis was determined by current NHLBI criteria. Phenotyping and functional immune measurements were performed from isolated cells. For epigenetic measurements, DNA was isolated and pyrosequenced. Results We show that higher average PAH exposure was significantly associated with impaired Treg function and increased methylation in the forkhead box protein 3 (FOXP3) locus (P < 0.05), conditional on atopic status. These epigenetic modifications were significantly linked to differential protein expression of FOXP3 (P < 0.001). Methylation was associated with cellular functional changes, specifically Treg dysfunction, and an increase in total plasma IgE levels. Protein expression of IL-10 decreased and IFN-γ increased as the extent of PAH exposure increased. The strength of the associations generally increased as the time window for average PAH exposure increased from 24 hr to 1 year, suggesting more of a chronic response. Significant associations with chronic PAH exposure and immune outcomes were also observed in subjects with allergic rhinitis. Conclusions and Clinical Relevance Collectively, these results demonstrate that increased ambient PAH exposure is associated with impaired systemic immunity and epigenetic modifications in a key locus involved in atopy: FOXP3, with a higher impact on atopic children. The results suggest that increased atopic clinical symptoms in children

  11. Ukrain, a plant derived semi-synthetic compound, exerts antitumor effects against murine and human breast cancer and induce protective antitumor immunity in mice.

    Science.gov (United States)

    Bozeman, E N; Srivatsan, S; Mohammadi, H; Daniels, D; Shashidharamurthy, R; Selvaraj, P

    2012-12-01

    Despite the recent advances in anti-cancer therapies, breast cancer accounts for the highest percentage of estimated new cases among female cancer patients. The anti-cancer drug Ukrain, a plant-derived semi-synthetic compound, has been shown to be effective in a variety of tumor models including colon, brain, ovarian, melanoma and lymphoma. However, the direct cytotoxic effects of Ukrain have yet to be investigated in breast cancer models. Herein, we investigated the in vitro and in vivo cytotoxicity of Ukrain using murine (4T07 and TUBO) and human (SKBR-3) breast cancer cell lines. Cells were treated with varying concentrations of Ukrain for up to 72 h and analyzed for viability by trypan blue exclusion, apoptosis by intracellular caspase 3 and Annexin V staining, and proliferative potential by a clonogenic assay. Female BALB/c mice were challenged subcutaneously (s.c.) with 4T07-RG cells and administered 5 mg/kg or 12.5 mg/kg body weight Ukrain intravenously (i.v.) on the same day and 3 days later. Protective immune responses were determined following re-challenge of tumor-free mice 35 days post primary challenge. Ukrain exposure induced apoptosis in a dose and time-dependent manner with 50 µg/mL Ukrain leading to >50% cell death after 48 h exposure for all three breast cancer cell lines. Ukrain administration (12.5 mg/kg) led to significant inhibition of 4T07 tumor growth in vivo and sustained protective anti-tumor immunity following secondary challenge. Our findings demonstrate the in vitro and in vivo cytotoxic effects of Ukrain on breast cancer cells and may provide insight into designing Ukrain-based therapies for breast cancer patients.

  12. Establishing a model for assessing DNA damage in murine brain cells as a molecular marker of chemotherapy-associated cognitive impairment.

    Science.gov (United States)

    Krynetskiy, Evgeny; Krynetskaia, Natalia; Rihawi, Diana; Wieczerzak, Katarzyna; Ciummo, Victoria; Walker, Ellen

    2013-10-17

    Chemotherapy-associated cognitive impairment often follows cancer chemotherapy. We explored chemotherapy-induced DNA damage in the brain cells of mice treated with 5-fluorouracil (5FU), an antineoplastic agent, to correlate the extent of DNA damage to behavioral functioning in an autoshaping-operant mouse model of chemotherapy-induced learning and memory deficits (Foley et al., 2008). Male, Swiss-Webster mice were injected once with saline or 75 mg/kg 5FU at 0, 12, and 24h and weighed every 24h. Twenty-four h after the last injection, the mice were tested in a two-day acquisition and the retention of a novel response task for food reinforcement. Murine brain cells were analyzed for the presence of single- and double-strand DNA breaks by the single cell gel electrophoresis assay (the Comet assay). We detected significant differences (p<0.0001) for all DNA damage characteristics (DNA "comet" tail shape, migration pattern, tail moment and olive moments) between control mice cohort and 5FU-treated mice cohort: tail length - 119 vs. 153; tail moment - 101 vs. 136; olive moment - 60 vs. 82, correspondingly. We found a positive correlation between increased response rates (r=0.52, p<0.05) and increased rate of errors (r=0.51, p<0.05), and DNA damage on day 1. For all 15 mice (saline-treated and 5FU-treated mice), we found negative correlations between DNA damage and weight (r=-0.75, p<0.02). Our results indicate that chemotherapy-induced DNA damage changes the physiological status of the brain cells and may provide insights to the mechanisms for cognitive impairment after cancer chemotherapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Replacement of the murine leukemia virus (MLV) envelope gene with a truncated HIV envelope gene in MLV generates a virus with impaired replication capacity

    International Nuclear Information System (INIS)

    Nack, Ursula; Schnierle, Barbara S.

    2003-01-01

    Murine leukemia virus (MLV) capsid particles can be efficiently pseudotyped with a variant of the HIV-1 envelope protein (Env) containing the surface glycoprotein gp120-SU and a carboxyl-terminally truncated transmembrane (TM) protein, with only seven cytoplasmic amino acids. MLV/HIV pseudotyped vector particles acquire the natural host tropism of HIV-1 and their entry is dependent on the presence of CD4 and an appropriate co-receptor on the surface of the target cell. We describe here the construction of chimeric MLV/HIV proviruses containing the truncated HIV envelope gene. The MLV/HIV provirus was generated by direct replacement of the MLV envelope gene with HIV Env coding sequences either with or without the additional inclusion of the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). Chimeric MLV/HIV particles could be generated from transfected 293T cells and were able to infect CD4/CXCR4-positive target cells. However, the second round of infection of target cells was severely impaired, despite the fact that the WPRE element enhanced the amount of viral mRNA detected. Viral particles released from infected cells showed reduced HIV Env incorporation, indicating that additional factors required for efficient replication of MLV/HIV pseudotyped viruses are missing

  14. Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

    Energy Technology Data Exchange (ETDEWEB)

    Ross, P.S. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Swart, R.L. de [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands); Timmerman, H.H.; Loveren, H. van [National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Osterhaus, A.D.M.E. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands)

    1995-12-31

    Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoid organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.

  15. Exposure to microgravity for 30 days onboard Bion M1 caused muscle atrophy and impaired regeneration in murine femoral Quadriceps

    Science.gov (United States)

    Radugina, E. A.; Almeida, E. A. C.; Blaber, E.; Poplinskaya, V. A.; Markitantova, Y. V.; Grigoryan, E. N.

    2018-02-01

    Mechanical unloading in microgravity during spaceflight is known to cause muscular atrophy, changes in muscle fiber composition, gene expression, and reduction in regenerative muscle growth. Although some limited data exists for long-term effects of microgravity in human muscle, these processes have mostly been studied in rodents for short periods of time. Here we report on how long-term (30-day long) mechanical unloading in microgravity affects murine muscles of the femoral Quadriceps group. To conduct these studies we used muscle tissue from 6 microgravity mice, in comparison to habitat (7), and vivarium (14) ground control mice from the NASA Biospecimen Sharing Program conducted in collaboration with the Institute for Biomedical Problems of the Russian Academy of Sciences, during the Russian Bion M1 biosatellite mission in 2013. Muscle histomorphology from microgravity specimens showed signs of extensive atrophy and regenerative hypoplasia relative to ground controls. Specifically, we observed a two-fold decrease in the number of myonuclei, compared to vivarium and ground controls, and central location of myonuclei, low density of myofibers in the tissue, and of myofibrils within a fiber, as well as fragmentation and swelling of myofibers. Despite obvious atrophy, muscle regeneration nevertheless appeared to have continued after 30 days in microgravity as evidenced by thin and short newly formed myofibers. Many of them, however, showed evidence of apoptotic cells and myofibril degradation, suggesting that long-term unloading in microgravity may affect late stages of myofiber differentiation. Ground asynchronous and vivarium control animals demonstrated normal, well-developed tissue structure with sufficient blood and nerve supply and evidence of regenerative formation of new myofibers free of apoptotic nuclei. Regenerative activity of satellite cells in muscles was observed both in microgravity and ground control groups, using Pax7 and Myogenin

  16. Effects of Trauma-Hemorrhage and IL-6 Deficiency on Splenic Immune Function in a Murine Trauma Model

    Directory of Open Access Journals (Sweden)

    P. Mommsen

    2012-01-01

    Full Text Available Splenic immune function is known to be depressed following hemorrhage. The present study investigates the effects of femoral shaft fracture, isolated or in combination with hemorrhage, on early stage cytokine production capacity of splenocytes and observes the role of IL-6 under these conditions. Male IL-6 knockout (IL-6−/− and wild-type mice (WT were randomly divided into three groups: sham (S, isolated femoral fracture (Fx, and femoral fracture + volume controlled hemorrhage (TH-Fx (=6 per group. Animals were sacrificed four hours after induction of hemorrhage and fracture. Cytokine release (TNF-α, IL-6, and IL-10 of isolated and LPS-stimulated splenocytes was determined by cytometric bead array. Femoral fracture with or without hemorrhage caused a suppression of in vitro cytokine production capacity of splenocytes at an early posttraumatic stage in WT and IL-6−/−. In the absence of IL-6, the profile of splenic cytokine secretion is significantly altered, identifying this cytokine as a potential therapeutic target to modulate the posttraumatic immune response.

  17. Abnormalities of thymic stroma may contribute to immune dysregulation in murine models of leaky severe combined immunodeficiency

    Directory of Open Access Journals (Sweden)

    Francesca eRucci

    2011-05-01

    Full Text Available Lymphostromal cross-talk in the thymus is essential to allow generation of a diversified repertoire of T lymphocytes and to prevent autoimmunity by self-reactive T cells. Hypomorphic mutations in genes that control T cell development have been associated with immunodeficiency and immune dysregulation both in humans and in mice. We have studied T cell development and thymic stroma architecture and maturation in two mouse models of leaky SCID, carrying hypomorphic mutations in Rag1 and Lig4 genes. Defective T cell development was associated with abnormalities of thymic architecture that predominantly affect the thymic medulla, with reduction of the pool of mature medullary thymic epithelial cells (mTECs. While the ability of mTECs to express Aire is preserved in mutant mice, the frequency of mature mTECs expressing Aire and tissue-specific antigens (TSAs is severely reduced. Similarly, the ability of CD4+ T cells to differentiate into Foxp3+ natural regulatory T cells is preserved in Rag1 and Lig4 mutant mice, but their number is greatly reduced. These data indicate that hypomorphic defects in T cell development may cause defective lymphostromal cross-talk and impinge on thymic stromal cells maturation, and thus favor immune dysregulation.

  18. Characterization of the local immune response to cyst antigens during the acute and elimination phases of primary murine giardiasis.

    Science.gov (United States)

    Abdul-Wahid, Aws; Faubert, Gaétan

    2008-05-01

    During the course of a giardial infection, the host's immune system is presented with a variety of Giardia antigens as trophozoites differentiate, through encysting cells, to form the infective cysts. Previous studies examining the host's immune response during giardial infections have focused on trophozoite-derived antigens (Ags). In this study, we were interested to determine if the host's immune system reacts to cyst Ags during the acute and elimination phases, when there is cyst shedding. For this purpose, we used antigenic extracts from trophozoites (Troph), encysting cells (ENC), and purified giardial cyst walls (PCW), as well as purified recombinant cyst wall protein 2 (rCWP2). Comparative analysis of the parasite extracts using SDS-PAGE analysis and surface-enhanced laser desorption/ionization time of flight mass spectrometry resulted in the detection of 175 protein entities, of which 26 were Troph-specific proteins, 17 ENC-specific proteins, and 31 were PCW-specific proteins. On the other hand, we detected 34 proteins shared between Troph and ENC, 19 proteins that were shared between ENC and PCW, and 29 proteins that were common to Troph and PCW. Finally, we detected 19 proteins that were shared by all three extract samples. BALB/c mice were infected with 10(5)Giardia muris cysts and sacrificed either at the acute or elimination phases of infection (days 12 and 40, respectively), and lymphocytes were isolated from the Peyer's patches (PP). Using flow cytometry, we detected significant increases in the number of PP-derived CD4(+) and CD19(+), but not CD8(+) lymphocytes. Quantification of the number of mucosal IL-4 and IFN-gamma secreting T-lymphocytes by enzyme-linked immunosorbent spot assay showed that these cells reacted by secreting similar levels of IL-4 and IFN-gamma, regardless of the Ag or the phase of infection. Analysis of intestinal humoral immune responses by ELISA resulted in the detection of Ag-specific IgA and IgG intestinal antibodies

  19. Protein Kinase A Deregulation in the Medial Prefrontal Cortex Impairs Working Memory in Murine Oligophrenin-1 Deficiency.

    Science.gov (United States)

    Zhang, Chun-Lei; Aime, Mattia; Laheranne, Emilie; Houbaert, Xander; El Oussini, Hajer; Martin, Christelle; Lepleux, Marilyn; Normand, Elisabeth; Chelly, Jamel; Herzog, Etienne; Billuart, Pierre; Humeau, Yann

    2017-11-15

    Classical and systems genetics have identified wide networks of genes associated with cognitive and neurodevelopmental diseases. In parallel to deciphering the role of each of these genes in neuronal or synaptic function, evaluating the response of neuronal and molecular networks to gene loss of function could reveal some pathophysiological mechanisms potentially accessible to nongenetic therapies. Loss of function of the Rho-GAP oligophrenin-1 is associated with cognitive impairments in both human and mouse. Upregulation of both PKA and ROCK has been reported in Ophn1 -/ y mice, but it remains unclear whether kinase hyperactivity contributes to the behavioral phenotypes. In this study, we thoroughly characterized a prominent perseveration phenotype displayed by Ophn1 -deficient mice using a Y-maze spatial working memory (SWM) test. We report that Ophn1 deficiency in the mouse generated severe cognitive impairments, characterized by both a high occurrence of perseverative behaviors and a lack of deliberation during the SWM test. In vivo and in vitro pharmacological experiments suggest that PKA dysregulation in the mPFC underlies cognitive dysfunction in Ophn1 -deficient mice, as assessed using a delayed spatial alternation task results. Functionally, mPFC neuronal networks appeared to be affected in a PKA-dependent manner, whereas hippocampal-PFC projections involved in SWM were not affected in Ophn1 -/y mice. Thus, we propose that discrete gene mutations in intellectual disability might generate "secondary" pathophysiological mechanisms, which are prone to become pharmacological targets for curative strategies in adult patients. SIGNIFICANCE STATEMENT Here we report that Ophn1 deficiency generates severe impairments in performance at spatial working memory tests, characterized by a high occurrence of perseverative behaviors and a lack of decision making. This cognitive deficit is consecutive to PKA deregulation in the mPFC that prevents Ophn1 KO mice to exploit a

  20. Pteromalus puparum venom impairs host cellular immune responses by decreasing expression of its scavenger receptor gene

    Science.gov (United States)

    Insect host/parasitoid interactions are co-evolved systems in which host defenses are balanced by parasitoid mechanisms to disable or hide from host immune effectors. Although there is a rich literature on these systems, parasitoid immune-disabling mechanisms have not been fully elucidated. Here we ...

  1. Protein malnutrition impairs the immune response and influences the severity of infection in a hamster model of chronic visceral leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Eugenia Carrillo

    Full Text Available Leishmaniasis remains one of the world's most devastating neglected tropical diseases. It mainly affects developing countries, where it often co-exists with chronic malnutrition, one of the main risk factors for developing the disease. Few studies have been published, however, on the relationship between leishmaniasis progression and malnutrition. The present paper reports the influence of protein malnutrition on the immune response and visceral disease development in adult hamsters infected with Leishmania infantum fed either standard or low protein diets. The low protein diet induced severe malnutrition in these animals, and upon infection with L. infantum 33% had severe visceral leishmaniasis compared to only 8% of animals fed the standard diet. The infected, malnourished animals showed notable leukocyte depletion, mild specific antibody responses, impairment of lymphoproliferation, presence of parasites in blood (16.67% of the hamsters and significant increase of the splenic parasite burden. Animals fed standard diet suffered agranulocytosis and monocytopenia, but showed stronger specific immune responses and had lower parasite loads than their malnourished counterparts. The present results show that protein malnutrition promotes visceral leishmaniasis and provide clues regarding the mechanisms underlying the impairment of the immune system.

  2. Fibroblast-Specific Deletion of Hypoxia Inducible Factor-1 Critically Impairs Murine Cutaneous Neovascularization and Wound Healing.

    Science.gov (United States)

    Duscher, Dominik; Maan, Zeshaan N; Whittam, Alexander J; Sorkin, Michael; Hu, Michael S; Walmsley, Graham G; Baker, Hutton; Fischer, Lauren H; Januszyk, Michael; Wong, Victor W; Gurtner, Geoffrey C

    2015-11-01

    Diabetes and aging are known risk factors for impaired neovascularization in response to ischemic insult, resulting in chronic wounds, and poor outcomes following myocardial infarction and cerebrovascular injury. Hypoxia-inducible factor (HIF)-1α, has been identified as a critical regulator of the response to ischemic injury and is dysfunctional in diabetic and elderly patients. To better understand the role of this master hypoxia regulator within cutaneous tissue, the authors generated and evaluated a fibroblast-specific HIF-1α knockout mouse model. The authors generated floxed HIF-1 mice (HIF-1) by introducing loxP sites around exon 1 of the HIF-1 allele in C57BL/6J mice. Fibroblast-restricted HIF-1α knockout (FbKO) mice were generated by breeding our HIF-1 with tamoxifen-inducible Col1a2-Cre mice (Col1a2-CreER). HIF-1α knockout was evaluated on a DNA, RNA, and protein level. Knockout and wild-type mice were subjected to ischemic flap and wound healing models, and CD31 immunohistochemistry was performed to assess vascularity of healed wounds. Quantitative real-time polymerase chain reaction of FbKO skin demonstrated significantly reduced Hif1 and Vegfa expression compared with wild-type. This finding was confirmed at the protein level (p wound closure and vascularity (p wound healing, reduced wound vascularity, and significant impairment in the ischemic neovascular response. These findings provide new insight into the importance of cell-specific responses to hypoxia during cutaneous neovascularization.

  3. Expression of membrane anchored cytokines and B7-1 alters tumor microenvironment and induces protective antitumor immunity in a murine breast cancer model.

    Science.gov (United States)

    Bozeman, Erica N; Cimino-Mathews, Ashley; Machiah, Deepa K; Patel, Jaina M; Krishnamoorthy, Arun; Tien, Linda; Shashidharamurthy, Rangaiah; Selvaraj, Periasamy

    2013-05-07

    Many studies have shown that the systemic administration of cytokines or vaccination with cytokine-secreting tumors augments an antitumor immune response that can result in eradication of tumors. However, these approaches are hampered by the risk of systemic toxicity induced by soluble cytokines. In this study, we have evaluated the efficacy of 4TO7, a highly tumorigenic murine mammary tumor cell line, expressing glycosyl phosphatidylinositol (GPI)-anchored form of cytokine molecules alone or in combination with the costimulatory molecule B7-1 as a model for potential cell or membrane-based breast cancer vaccines. We observed that the GPI-anchored cytokines expressed on the surface of tumor cells greatly reduced the overall tumorigenicity of the 4TO7 tumor cells following direct live cell challenge as evidenced by transient tumor growth and complete regression within 30 days post challenge. Tumors co-expressing B7-1 and GPI-IL-12 grew the least and for the shortest duration, suggesting that this combination of immunostimulatory molecules is most potent. Protective immune responses were also observed following secondary tumor challenge. Further, the 4TO7-B7-1/GPI-IL-2 and 4TO7-B7-1/GPI-IL-12 transfectants were capable of inducing regression of a wild-type tumor growing at a distant site in a concomitant tumor challenge model, suggesting the tumor immunity elicited by the transfectants can act systemically and inhibit the tumor growth at a distant site. Additionally, when used as irradiated whole cell vaccines, 4TO7-B7-1/GPI-IL-12 led to a significant inhibition in tumor growth of day 7 established tumors. Lastly, we observed a significant decrease in the prevalence of myeloid-derived suppressor cells and regulatory T-cells in the tumor microenvironment on day 7 post challenge with 4TO7-B7-1/GPI-IL-12 cells, which provides mechanistic insight into antitumor efficacy of the tumor-cell membrane expressed IL-12. These studies have implications in designing membrane

  4. Impaired B cell immunity in acute myeloid leukemia patients after chemotherapy.

    Science.gov (United States)

    Goswami, Meghali; Prince, Gabrielle; Biancotto, Angelique; Moir, Susan; Kardava, Lela; Santich, Brian H; Cheung, Foo; Kotliarov, Yuri; Chen, Jinguo; Shi, Rongye; Zhou, Huizhi; Golding, Hana; Manischewitz, Jody; King, Lisa; Kunz, Lauren M; Noonan, Kimberly; Borrello, Ivan M; Smith, B Douglas; Hourigan, Christopher S

    2017-07-10

    Changes in adaptive immune cells after chemotherapy in adult acute myeloid leukemia (AML) may have implications for the success of immunotherapy. This study was designed to determine the functional capacity of the immune system in adult patients with AML who have completed chemotherapy and are potential candidates for immunotherapy. We used the response to seasonal influenza vaccination as a surrogate for the robustness of the immune system in 10 AML patients in a complete remission post-chemotherapy and performed genetic, phenotypic, and functional characterization of adaptive immune cell subsets. Only 2 patients generated protective titers in response to vaccination, and a majority of patients had abnormal frequencies of transitional and memory B-cells. B-cell receptor sequencing showed a B-cell repertoire with little evidence of somatic hypermutation in most patients. Conversely, frequencies of T-cell populations were similar to those seen in healthy controls, and cytotoxic T-cells demonstrated antigen-specific activity after vaccination. Effector T-cells had increased PD-1 expression in AML patients least removed from chemotherapy. Our results suggest that while some aspects of cellular immunity recover quickly, humoral immunity is incompletely reconstituted in the year following intensive cytotoxic chemotherapy for AML. The observed B-cell abnormalities may explain the poor response to vaccination often seen in AML patients after chemotherapy. Furthermore, the uncoupled recovery of B-cell and T-cell immunity and increased PD-1 expression shortly after chemotherapy might have implications for the success of several modalities of immunotherapy.

  5. Immunity against Ixodes scapularis salivary proteins expressed within 24 hours of attachment thwarts tick feeding and impairs Borrelia transmission.

    Directory of Open Access Journals (Sweden)

    Sukanya Narasimhan

    2007-05-01

    Full Text Available In North America, the black-legged tick, Ixodes scapularis, an obligate haematophagus arthropod, is a vector of several human pathogens including Borrelia burgdorferi, the Lyme disease agent. In this report, we show that the tick salivary gland transcriptome and proteome is dynamic and changes during the process of engorgement. We demonstrate, using a guinea pig model of I. scapularis feeding and B. burgdorferi transmission, that immunity directed against salivary proteins expressed in the first 24 h of tick attachment - and not later - is sufficient to evoke all the hallmarks of acquired tick-immunity, to thwart tick feeding and also to impair Borrelia transmission. Defining this subset of proteins will promote a mechanistic understanding of novel I. scapularis proteins critical for the initiation of tick feeding and for Borrelia transmission.

  6. Exposure to Silver Nanospheres Leads to Altered Respiratory Mechanics and Delayed Immune Response in an in Vivo Murine Model

    Directory of Open Access Journals (Sweden)

    Danielle Botelho

    2018-03-01

    Full Text Available Here we examine the organ level toxicology of both carbon black (CB and silver nanoparticles (AgNP. We aim to determine metal-specific effects to respiratory function, inflammation and potential interactions with lung lining fluid (LLF. C57Bl6/J male mice were intratracheally instilled with saline (control, low (0.05 μg/g or high (0.5 μg/g doses of either AgNP or CB 15 nm nanospheres. Lung histology, cytology, surfactant composition and function, inflammatory gene expression, and pulmonary function were measured at 1, 3, and 7 days post-exposure. Acutely, high dose CB resulted in an inflammatory response, increased neutrophilia and cytokine production, without alteration in surfactant composition or respiratory mechanics. Low dose CB had no effect. Neither low nor high dose AgNPs resulted in an acute inflammatory response, but there was an increase in work of breathing. Three days post-exposure with CB, a persistent neutrophilia was noted. High dose AgNP resulted in an elevated number of macrophages and invasion of lymphocytes. Additionally, AgNP treated mice displayed increased expression of IL1B, IL6, CCL2, and IL10. However, there were no significant changes in respiratory mechanics. At day 7, inflammation had resolved in AgNP-treated mice, but tissue stiffness and resistance were significantly decreased, which was accompanied by an increase in surfactant protein D (SP-D content. These data demonstrate that the presence of metal alters the response of the lung to nanoparticle exposure. AgNP-surfactant interactions may alter respiratory function and result in a delayed immune response, potentially due to modified airway epithelial cell function.

  7. Comparison of altered expression of histocompatibility antigens with altered immune function in murine spleen cells treated with ultraviolet radiation and/or TPA

    International Nuclear Information System (INIS)

    Pretell, J.O.; Cone, R.E.

    1985-01-01

    Previous studies in our laboratory demonstrated that several treatments that inhibited the ability of cells to stimulate the mixed lymphocyte reaction (MLR) also blocked the shedding of histocompatibility antigens and Ia antigens from murine spleen cells. In the present studies, one of these treatments, ultraviolet radiation (UV), was shown to cause an initial loss in the density of H-2K, IA, and IE antigens prior to the block in shedding observed after culture of these cells. Further analysis revealed that the UV-induced loss of antigens could be prevented by the presence of colchicine during irradiation. Biosynthetic analyses revealed the IA antigen synthesis was also inhibited in the UV-irradiated cells. Examination of the effects of a second agent, 12-0-tetradecanoylphorbol-13-acetate (TPA) on the turnover of histocompatibility antigens revealed that the biosynthesis and shedding of these antigens were accelerated by this agent. However, addition of TPA to UV-irradiated cells did not result in a reversal of the UV-induced block in biosynthesis of IA antigens. Results of immune function assays correlated with the biochemical studies: UV-irradiation inhibited the generation of the MLR, but TPA enhanced this reaction, and addition of TPA to mixed lymphocyte cultures with UV-irradiated stimulators did not reverse the UV-induced inhibition. These results suggest that, although the turnover of histocompatibility antigens may be affected by TPA and UV in an antagonistic fashion, additional factors other than the expression of histocompatibility antigens are operating in the inhibition of stimulation of an MLR by UV radiation or its enhancement by TPA

  8. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    Science.gov (United States)

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  9. Constant illumination reduces circulating melatonin and impairs immune function in the cricket Teleogryllus commodus

    Directory of Open Access Journals (Sweden)

    Joanna Durrant

    2015-07-01

    Full Text Available Exposure to constant light has a range of negative effects on behaviour and physiology, including reduced immune function in both vertebrates and invertebrates. It is proposed that the associated suppression of melatonin (a ubiquitous hormone and powerful antioxidant in response to the presence of light at night could be an underlying mechanistic link driving the changes to immune function. Here, we investigated the relationship between constant illumination, melatonin and immune function, using a model invertebrate species, the Australian black field cricket, Teleogryllus commodus. Crickets were reared under either a 12 h light: 12 h dark regimen or a constant 24 h light regimen. Circulating melatonin concentration and immune function (haemocyte concentration, lytic activity and phenoloxidase (PO activity were assessed in individual adult crickets through the analysis of haemolymph. Constant illumination reduced melatonin and had a negative impact on haemocyte concentrations and lytic activity, but its effect on PO activity was less apparent. Our data provide the first evidence, to our knowledge, of a link between exposure to constant illumination and variation in haemocyte concentration in an invertebrate model, while also highlighting the potential complexity of the immune response following exposure to constant illumination. This study provides insight into the possible negative effect of artificial night-time lighting on the physiology of invertebrates, but whether lower and potentially more ecologically relevant levels of light at night produce comparable results, as has been reported in several vertebrate taxa, remains to be tested.

  10. Neurofibromin 1 Impairs Natural Killer T-Cell-Dependent Antitumor Immunity against a T-Cell Lymphoma

    Directory of Open Access Journals (Sweden)

    Jianyun Liu

    2018-01-01

    Full Text Available Neurofibromin 1 (NF1 is a tumor suppressor gene encoding a Ras GTPase that negatively regulates Ras signaling pathways. Mutations in NF1 are linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. In terms of antitumor immunity, CD1d-dependent natural killer T (NKT cells play an important role in the innate antitumor immune response. Generally, Type-I NKT cells protect (and Type-II NKT cells impair host antitumor immunity. We have previously shown that CD1d-mediated antigen presentation to NKT cells is regulated by cell signaling pathways. To study whether a haploinsufficiency in NF1 would affect CD1d-dependent activation of NKT cells, we analyzed the NKT-cell population as well as the functional expression of CD1d in Nf1+/− mice. Nf1+/− mice were found to have similar levels of NKT cells as wildtype (WT littermates. Interestingly, however, reduced CD1d expression was observed in Nf1+/− mice compared with their WT littermates. When inoculated with a T-cell lymphoma in vivo, Nf1+/− mice survived longer than their WT littermates. Furthermore, blocking CD1d in vivo significantly enhanced antitumor activity in WT, but not in Nf1+/− mice. In contrast, a deficiency in Type-I NKT cells increased antitumor activity in Nf1+/− mice, but not in WT littermates. Therefore, these data suggest that normal NF1 expression impairs CD1d-mediated NKT-cell activation and antitumor activity against a T-cell lymphoma.

  11. Immunization with DAT fragments is associated with long-term striatal impairment, hyperactivity and reduced cognitive flexibility in mice

    Directory of Open Access Journals (Sweden)

    Adriani Walter

    2012-11-01

    Full Text Available Abstract Background Possible interactions between nervous and immune systems in neuro-psychiatric disorders remain elusive. Levels of brain dopamine transporter (DAT have been implicated in several impulse-control disorders, like attention deficit / hyperactivity disorder (ADHD and obsessive-compulsive disorder (OCD. Here, we assessed the interplay between DAT auto-immunity and behavioural / neurochemical phenotype. Methods Male CD-1 mice were immunized with DAT peptide fragments (DAT-i, or vehicle alone (VEH, to generate elevated circulating levels of DAT auto-antibodies (aAbs. Using an operant delay-of-reward task (20 min daily sessions; timeout 25 sec, mice had a choice between either an immediate small amount of food (SS, or a larger amount of food after a delay (LL, which increased progressively across sessions (from 0 to 150 sec. Results DAT-i mice exhibited spontaneous hyperactivity (2 h-longer wake-up peak; a wake-up attempt during rest. Two sub-populations differing in behavioural flexibility were identified in the VEH control group: they showed either a clear-cut decision to select LL or clear-cut shifting towards SS, as expected. Compared to VEH controls, choice-behaviour profile of DAT-i mice was markedly disturbed, together with long-lasting alterations of the striatal monoamines. Enhanced levels of DA metabolite HVA in DAT-i mice came along with slower acquisition of basal preferences and with impaired shifting; elevation also in DOPAC levels was associated with incapacity to change a rigid selection strategy. This scarce flexibility of performance is indicative of a poor adaptation to task contingencies. Conclusions Hyperactivity and reduced cognitive flexibility are patterns of behaviour consistent with enduring functional impairment of striatal regions. It is yet unclear how anti-DAT antibodies could enter or otherwise affect these brain areas, and which alterations in DAT activity exactly occurred after immunization

  12. UVB-induced decreased resistance to Trichinella spiralis in the rat is related to impaired cellular immunity

    International Nuclear Information System (INIS)

    Goettsch, W.; Garssen, J.; Loveren, H. van; Gruijl, F.R. de

    1996-01-01

    Our laboratory has demonstrated in preliminary experiments that UVB exposure using the Kromayer lamp can induce increased numbers of Trichinella spiralis larvae in carcasses of infected Wistar rats, without affecting specific antibody titers to this parasite. In this study, orally T.spiralis-infected Wistar rats were exposed to subery-thermal doses of UVB radiation using FS40 lamps during different time periods before or after infection. A significant increase in the number of T. spiralis larvae was found in the carcasses of rats that were UVB irradiated daily for 7 consecutive days in the second week after infection. Additionally, increased numbers of larvae were also detected histologically in the tongue of rats that were exposed the first and the second week after infection. Lymphocyte stimulation assays using mesenteral lymph node cells indicated that UVB exposure also impaired the specific lymphocyte response to T. spiralis. Moreover, DTH responses to T. spiralis were severely impaired in rats that were UVB irradiated daily for 7 consecutive days in the second week after infection. Thus, these data combined with the data of the Kromayer study indicate that exposure of rats to FS40 irradiation following oral infection with T. spiralis leads to increased numbers of larvae in systemic sites and impaired T-cell immunity to the parasite. (Author)

  13. Hepatitis B virus surface antigen impairs myeloid dendritic cell function: a possible immune escape mechanism of hepatitis B virus

    Science.gov (United States)

    Op den Brouw, Marjoleine L; Binda, Rekha S; van Roosmalen, Mark H; Protzer, Ulrike; Janssen, Harry L A; van der Molen, Renate G; Woltman, Andrea M

    2009-01-01

    Chronic hepatitis B virus (HBV) infection is the result of an inadequate immune response towards the virus. Myeloid dendritic cells (mDC) of patients with chronic HBV are impaired in their maturation and function, resulting in more tolerogenic rather than immunogenic responses, which may contribute to viral persistence. The mechanism responsible for altered mDC function remains unclear. The HBV-infected patients display large amounts of HBV particles and viral proteins in their circulation, especially the surface antigen HBsAg, which allows multiple interactions between the virus, its viral proteins and DC. To assess whether HBV directly influences mDC function, the effects of HBV and HBsAg on human mDC maturation and function were investigated in vitro. As already described for internalization of HBV by DC, the present study shows that peripheral blood-derived mDC of healthy controls also actively take up HBsAg in a time-dependent manner. Cytokine-induced maturation in the presence of HBV or HBsAg resulted in a significantly more tolerogenic mDC phenotype as demonstrated by a diminished up-regulation of costimulatory molecules and a decreased T-cell stimulatory capacity, as assessed by T-cell proliferation and interferon-γ production. In addition, the presence of HBV significantly reduced interleukin-12 production by mDC. These results show that both HBV particles and purified HBsAg have an immune modulatory capacity and may directly contribute to the dysfunction of mDC in patients with chronic HBV. The direct immune regulatory effect of HBV and circulating HBsAg particles on the function of DC can be considered as part of the mechanism by which HBV escapes immunity. PMID:18624732

  14. Impaired immune responses in the lungs of aged mice following influenza infection

    Directory of Open Access Journals (Sweden)

    Toapanta Franklin R

    2009-11-01

    Full Text Available Abstract Background Each year, influenza virus infection causes severe morbidity and mortality, particularly in the most susceptible groups including children, the elderly (>65 years-old and people with chronic respiratory diseases. Among the several factors that contribute to the increased susceptibility in elderly populations are the higher prevalence of chronic diseases (e.g. diabetes and the senescence of the immune system. Methods In this study, aged and adult mice were infected with sublethal doses of influenza virus (A/Puerto Rico/8/1934. Differences in weight loss, morbidity, virus titer and the kinetics of lung infiltration with cells of the innate and adaptive immune responses were analyzed. Additionally, the main cytokines and chemokines produced by these cells were also assayed. Results Compared to adult mice, aged mice had higher morbidity, lost weight more rapidly, and recovered more slowly from infection. There was a delay in the accumulation of granulocytic cells and conventional dendritic cells (cDCs, but not macrophages in the lungs of aged mice compared to adult animals. The delayed infiltration kinetics of APCs in aged animals correlated with alteration in their activation (CD40 expression, which also correlated with a delayed detection of cytokines and chemokines in lung homogenates. This was associated with retarded lung infiltration by natural killer (NK, CD4+ and CD8+ T-cells. Furthermore, the percentage of activated (CD69+ influenza-specific and IL-2 producer CD8+ T-cells was higher in adult mice compared to aged ones. Additionally, activation (CD69+ of adult B-cells was earlier and correlated with a quicker development of neutralizing antibodies in adult animals. Conclusion Overall, alterations in APC priming and activation lead to delayed production of cytokines and chemokines in the lungs that ultimately affected the infiltration of immune cells following influenza infection. This resulted in delayed activation of the

  15. Ganoderma atrum polysaccharide improves age-related oxidative stress and immune impairment in mice.

    Science.gov (United States)

    Li, Wen-Juan; Nie, Shao-Ping; Peng, Xiao-Ping; Liu, Xiao-Zhen; Li, Chang; Chen, Yi; Li, Jing-En; Song, Wan-Rui; Xie, Ming-Yong

    2012-02-15

    The aim of the present study was to investigate whether oxidative stress and immune dysfunction could be attenuated by Ganoderma atrum polysaccharide (PSG-1) in d-galactose (d-gal)-induced aging mice, and provide evidence for its effects. The results showed that PSG-1 significantly decreased lipid peroxidation in liver, brain, and spleen, but concomitantly increased the activities of superoxide dismutase, catalase, and glutathione peroxidase compared with the d-gal group. Elevation of glutathione contents and attenuation of glutathione disulfide contents were also found in PSG-1-treated animals. Furthermore, the results showed that PSG-1 treatment increased basal lymphocyte proliferation as well as T cell and B cell proliferation and enhanced interleukin-2 production. Taken together, the results suggested that PSG-1 had potential as a novel agent to promote health and improve aging-associated pathologies, at least in part, via modification of the redox system and improvement of immune function.

  16. Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Wang, Yong [Department of Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Weng, Zhiping; Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Harrod, Kevin S. [Department of Anesthesiology and Perioperative Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S., E-mail: treena@uab.edu [Department of Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2016-10-01

    Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4{sup +/+} wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4{sup +/−} heterozygous mice. To confirm these observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca{sup ++} homeostasis. ATO induces Ca{sup ++}-dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca{sup ++} homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic. - Highlights: • ATF4 regulates arsenic-mediated impairment in macrophage functions. • Arsenic-mediated alterations in pulmonary macrophage are diminished in ATF4{sup +/−} mice

  17. Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Wang, Yong; Weng, Zhiping; Elmets, Craig A.; Harrod, Kevin S.; Deshane, Jessy S.; Athar, Mohammad

    2016-01-01

    Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4 +/+ wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4 +/− heterozygous mice. To confirm these observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca ++ homeostasis. ATO induces Ca ++ -dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca ++ homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic. - Highlights: • ATF4 regulates arsenic-mediated impairment in macrophage functions. • Arsenic-mediated alterations in pulmonary macrophage are diminished in ATF4 +/− mice. • Changes in macrophage

  18. Impaired intrinsic immunity to HSV-1 in human iPSC-derived TLR3-deficient CNS cells

    Science.gov (United States)

    Lafaille, Fabien G; Pessach, Itai M.; Zhang, Shen-Ying; Ciancanelli, Michael J.; Herman, Melina; Abhyankar, Avinash; Ying, Shui-Wang; Keros, Sotirios; Goldstein, Peter A.; Mostoslavsky, Gustavo; Ordovas-Montanes, Jose; Jouanguy, Emmanuelle; Plancoulaine, Sabine; Tu, Edmund; Elkabetz, Yechiel; Al-Muhsen, Saleh; Tardieu, Marc; Schlaeger, Thorsten M.; Daley, George Q.; Abel, Laurent; Casanova, Jean-Laurent; Studer, Lorenz; Notarangelo, Luigi D.

    2012-01-01

    In the course of primary infection with herpes simplex virus 1 (HSV-1), children with inborn errors of TLR3 immunity are prone to HSV-1 encephalitis (HSE) 1–3. We tested the hypothesis that the pathogenesis of HSE involves non hematopoietic central nervous system (CNS)-resident cells. We derived induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of TLR3- and UNC-93B-deficient patients and from controls. These iPSCs were differentiated into highly purified populations of neural stem cells (NSCs), neurons, astrocytes and oligodendrocytes. The induction of IFN-β and/or IFN-γ1 in response to poly(I:C) stimulation was dependent on TLR3 and UNC-93B in all cells tested. However, the induction of IFN-β and IFN-γ1 in response to HSV-1 infection was impaired selectively in UNC-93B-deficient neurons and oligodendrocytes. These cells were also much more susceptible to HSV-1 infection than control cells, whereas UNC-93B-deficient NSCs and astrocytes were not. TLR3-deficient neurons were also found to be susceptible to HSV-1 infection. The rescue of UNC-93B- and TLR3-deficient cells with the corresponding wild-type allele demonstrated that the genetic defect was the cause of the poly(I:C) and HSV-1 phenotypes. The viral infection phenotype was further rescued by treatment with exogenous IFN-α/β, but not IFN-γ1.Thus, impaired TLR3- and UNC-93B-dependent IFN-α/β intrinsic immunity to HSV-1 in the CNS, in neurons and oligodendrocytes in particular, may underlie the pathogenesis of HSE in children with TLR3 pathway deficiencies. PMID:23103873

  19. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    Science.gov (United States)

    Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei

    2017-11-01

    Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  20. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    Directory of Open Access Journals (Sweden)

    Yushi Yao

    2017-11-01

    Full Text Available Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM, which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  1. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Periconception onset diabetes is associated with embryopathy and fetal growth retardation, reproductive tract hyperglycosylation and impaired immune adaptation to pregnancy.

    Science.gov (United States)

    Brown, Hannah M; Green, Ella S; Tan, Tiffany C Y; Gonzalez, Macarena B; Rumbold, Alice R; Hull, M Louise; Norman, Robert J; Packer, Nicolle H; Robertson, Sarah A; Thompson, Jeremy G

    2018-02-01

    Diabetes has been linked with impaired fertility but the underlying mechanisms are not well defined. Here we use a streptozotocin-induced diabetes mouse model to investigate the cellular and biochemical changes in conceptus and maternal tissues that accompany hyperglycaemia. We report that streptozotocin treatment before conception induces profound intra-cellular protein β-O-glycosylation (O-GlcNAc) in the oviduct and uterine epithelium, prominent in early pregnancy. Diabetic mice have impaired blastocyst development and reduced embryo implantation rates, and delayed mid-gestation growth and development. Peri-conception changes are accompanied by increased expression of pro-inflammatory cytokine Trail, and a trend towards increased Il1a, Tnf and Ifng in the uterus, and changes in local T-cell dynamics that skew the adaptive immune response to pregnancy, resulting in 60% fewer anti-inflammatory regulatory T-cells within the uterus-draining lymph nodes. Activation of the heat shock chaperones, a mechanism for stress deflection, was evident in the reproductive tract. Additionally, we show that the embryo exhibits elevated hyper-O-GlcNAcylation of both cytoplasmic and nuclear proteins, associated with activation of DNA damage (ɣH2AX) pathways. These results advance understanding of the impact of peri-conception diabetes, and provide a foundation for designing interventions to support healthy conception without propagation of disease legacy to offspring.

  3. Adaptive Immune Response Impairs the Efficacy of Autologous Transplantation of Engineered Stem Cells in Dystrophic Dogs

    Science.gov (United States)

    Sitzia, Clementina; Farini, Andrea; Jardim, Luciana; Razini, Paola; Belicchi, Marzia; Cassinelli, Letizia; Villa, Chiara; Erratico, Silvia; Parolini, Daniele; Bella, Pamela; da Silva Bizario, Joao Carlos; Garcia, Luis; Dias-Baruffi, Marcelo; Meregalli, Mirella; Torrente, Yvan

    2016-01-01

    Duchenne muscular dystrophy is the most common genetic muscular dystrophy. It is caused by mutations in the dystrophin gene, leading to absence of muscular dystrophin and to progressive degeneration of skeletal muscle. We have demonstrated that the exon skipping method safely and efficiently brings to the expression of a functional dystrophin in dystrophic CD133+ cells injected scid/mdx mice. Golden Retriever muscular dystrophic (GRMD) dogs represent the best preclinical model of Duchenne muscular dystrophy, mimicking the human pathology in genotypic and phenotypic aspects. Here, we assess the capacity of intra-arterial delivered autologous engineered canine CD133+ cells of restoring dystrophin expression in Golden Retriever muscular dystrophy. This is the first demonstration of five-year follow up study, showing initial clinical amelioration followed by stabilization in mild and severe affected Golden Retriever muscular dystrophy dogs. The occurrence of T-cell response in three Golden Retriever muscular dystrophy dogs, consistent with a memory response boosted by the exon skipped-dystrophin protein, suggests an adaptive immune response against dystrophin. PMID:27506452

  4. Enrichment of sialylated IgG by lectin fractionation does not enhance the efficacy of immunoglobulin G in a murine model of immune thrombocytopenia

    NARCIS (Netherlands)

    Guhr, T.; Bloem, J.; Derksen, N.I.L.; Wuhrer, M.; Koenderman, A.H.L.; Aalberse, R.C.; Rispens, T.

    2011-01-01

    Intravenous immunoglobulin G (IVIg) is widely used against a range of clinical symptoms. For its use in immune modulating therapies such as treatment of immune thrombocytopenic purpura high doses of IVIg are required. It has been suggested that only a fraction of IVIg causes this anti immune

  5. No evidence for impaired humoral immunity to pneumococcal proteins in Australian Aboriginal children with otitis media.

    Science.gov (United States)

    Thornton, Ruth B; Kirkham, Lea-Ann S; Corscadden, Karli J; Coates, Harvey L; Vijayasekaran, Shyan; Hillwood, Jessica; Toster, Sophie; Edminston, Phillipa; Zhang, Guicheng; Keil, Anthony; Richmond, Peter C

    2017-01-01

    The Australian Aboriginal population experiences disproportionately high rates of otitis media (OM). Streptococcus pneumoniae is one of the main pathogens responsible for OM and currently no vaccine offering cross strain protection exists. Vaccines consisting of conserved antigens to S. pneumoniae may reduce the burden of OM in high-risk populations; however no data exists examining naturally acquired antibody in Aboriginal children with OM. Serum and salivary IgA and IgG were measured against the S. pneumoniae antigens PspA1 and 2, CbpA and Ply in a cross sectional study of 183 children, including 36 non-Aboriginal healthy control children and 70 Aboriginal children and 77 non-Aboriginal children undergoing surgery for OM using a multiplex bead assay. Significant differences were observed between the 3 groups for serum anti-PspA1 IgA, anti-CbpA and anti-Ply IgG and for all salivary antibodies assessed. Aboriginal children with a history of OM had significantly higher antibody titres than non-Aboriginal healthy children with no history of OM and non-Aboriginal children with a history of OM for several proteins in serum and saliva. Non-Aboriginal children with a history of OM had significantly higher salivary anti-PspA1 IgG than healthy children, while all other titres were comparable between the groups. Conserved vaccine candidate proteins from S. pneumoniae induce serum and salivary antibody responses in Aboriginal and non-Aboriginal children with a history of OM. Aboriginal children do not have an impaired antibody response to the antigens measured from S. pneumoniae and they may represent vaccine candidates in Indigenous populations. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  6. Hepatitis B virus infection status and infertility causes in couples seeking fertility treatment-Indicator of impaired immune response?

    Science.gov (United States)

    Lao, Terence T; Mak, Jennifer S M; Li, Tin-Chiu

    2017-04-01

    The relationship between hepatitis B (HBV) infection in infertile couples seeking in vitro fertilization (IVF) treatment and infertility causes is unknown. A total of 831 infertile couples attending our unit seeking IVF during January to December 2015 were recruited. HBV infection was found in 6.3% and 7.3% of female and male partners, respectively, and infection in one or both partners was associated with less primary infertility (44.2% vs 55.1%, P=.038). Infected female partners had increased tubal (69.2% vs 43.2%, Pinfertility, while infected male partners were associated with increased tubal (62.3% vs 43.4%, P=.004) causes and reduced endometriosis (62.3% vs 73.9%, P=.050). Our results suggest HBV infection in either partner was associated with tubal infertility. HBV infection in either partner probably increases the risk of pelvic infection in female partner through impaired immune response to sexually transmitted infections, with consequent tubal damage and infertility. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Protection from genital herpes disease, seroconversion and latent infection in a non-lethal murine genital infection model by immunization with an HSV-2 replication-defective mutant virus.

    Science.gov (United States)

    Diaz, Fernando M; Knipe, David M

    2016-01-15

    Viral vaccines have traditionally protected against disease, but for viruses that establish latent infection, it is desirable for the vaccine to reduce infection to reduce latent infection and reactivation. While seroconversion has been used in clinical trials of herpes simplex virus (HSV) vaccines to measure protection from infection, this has not been modeled in animal infection systems. To measure the ability of a genital herpes vaccine candidate to protect against various aspects of infection, we established a non-lethal murine model of genital HSV-2 infection, an ELISA assay to measure antibodies specific for infected cell protein 8 (ICP8), and a very sensitive qPCR assay. Using these assays, we observed that immunization with HSV-2 dl5-29 virus reduced disease, viral shedding, seroconversion, and latent infection by the HSV-2 challenge virus. Therefore, it may be feasible to obtain protection against genital disease, seroconversion and latent infection by immunization, even if sterilizing immunity is not achieved. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. μ-opioid Receptor-Mediated Alterations of Allergen-Induced Immune Responses of Bronchial Lymph Node Cells in a Murine Model of Stress Asthma

    Directory of Open Access Journals (Sweden)

    Kaori Okuyama

    2012-01-01

    Conclusions: Restraint stress aggravated allergic airway inflammation in association with alterations in local immunity characterized by greater Th2-associated cytokine production and a reduced development of regulatory T cells, mediated by MORs.

  9. Immunization with PIII, a fraction of Schistosoma mansoni soluble adult worm antigenic preparation, affects nitric oxide production by murine spleen cells

    Directory of Open Access Journals (Sweden)

    Diana Magalhães de Oliveira

    1998-01-01

    Full Text Available Nitric oxide (NO is an important effector molecule involved in immune regulation and defense. NO produced by cytokine-activated macrophages was reported to be cytotoxic against the helminth Schistosoma mansoni. Identification and characterization of S. mansoni antigens that can provide protective immunity is crucial for understanding the complex immunoregulatory events that modulate the immune response in schistosomiasis. It is, then, essential to have available defined, purified parasite antigens. Previous work by our laboratory identified a fraction of S. mansoni soluble adult worm antigenic preparation (SWAP, named PIII, able to elicit significant in vitro cell proliferation and at the same time lower in vitro and in vivo granuloma formation when compared either to SEA (soluble egg antigen or to SWAP. In the present work we report the effect of different in vivo trials with mice on their spleen cells ability to produce NO. We demonstrate that PIII-immunization is able to significantly increase NO production by spleen cells after in vitro stimulation with LPS. These data suggest a possible role for NO on the protective immunity induced by PIII.

  10. A method for high purity intestinal epithelial cell culture from adult human and murine tissues for the investigation of innate immune function.

    Science.gov (United States)

    Graves, Christina L; Harden, Scott W; LaPato, Melissa; Nelson, Michael; Amador, Byron; Sorenson, Heather; Frazier, Charles J; Wallet, Shannon M

    2014-12-01

    Intestinal epithelial cells (IECs) serve as an important physiologic barrier between environmental antigens and the host intestinal immune system. Thus, IECs serve as a first line of defense and may act as sentinel cells during inflammatory insults. Despite recent renewed interest in IEC contributions to host immune function, the study of primary IEC has been hindered by lack of a robust culture technique, particularly for small intestinal and adult tissues. Here, a novel adaptation for culture of primary IEC is described for human duodenal organ donor tissue as well as duodenum and colon of adult mice. These epithelial cell cultures display characteristic phenotypes and are of high purity. In addition, the innate immune function of human primary IEC, specifically with regard to Toll-like receptor (TLR) expression and microbial ligand responsiveness, is contrasted with a commonly used intestinal epithelial cell line (HT-29). Specifically, TLR expression at the mRNA level and production of cytokine (IFNγ and TNFα) in response to TLR agonist stimulation is assessed. Differential expression of TLRs as well as innate immune responses to ligand stimulation is observed in human-derived cultures compared to that of HT-29. Thus, use of this adapted method to culture primary epithelial cells from adult human donors and from adult mice will allow for more appropriate studies of IECs as innate immune effectors. Published by Elsevier B.V.

  11. A DNA vaccine co-expressing Trichinella spiralis MIF and MCD-1 with murine ubiquitin induces partial protective immunity in mice.

    Science.gov (United States)

    Tang, F; Xu, L; Yan, R; Song, X; Li, X

    2013-03-01

    Co-expression of Trichinella spiralis macrophage migration inhibitory factor (TsMIF) with T. spiralis cystatin-like domain protein (TsMCD-1) in a DNA vaccine induces a Th1 immune response and partial protection against T. spiralis infection. The present study evaluated whether co-expression of mouse ubiquitin (Ub) with TsMIF and TsMCD-1 might improve the immune response against T. spiralis infection. Groups of BALB/c mice were immunized twice at 2-week intervals with 100 μg of plasmid DNA encoding either a TsMIF-TsMCD-1 fusion protein (pVAX1-Tsmif-Tsmcd-1) or an Ub-co-expressing triple fusion protein Ub-TsMIF-TsMCD-1 (pVAX1-Ub-Tsmif-Tsmcd-1). Control animals were immunized with pVAX1-Ub or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17), CD4+/CD8+ T cells and cytotoxic T lymphocyte (CTL) responses were monitored. Challenge infection was performed 2 weeks after the second immunization and worm burden was assayed at 35 days post-challenge. Antibody responses induced by pVAX1-Ub-Tsmif-Tsmcd-1 were significantly lower than for TsMIF-TsMCD-1, but the vaccine induced increased levels of Th1 cytokine (IFN-γ) and increased T-cell cytotoxicity. The reduction of worm burden (37.95%) following immunization with pVAX1-Ub-Tsmif-Tsmcd-1 was significantly greater than that induced by the pVAX1-Tsmif-Tsmcd-1 vaccine (23.17%; P< 0.05).

  12. Impairment of Several Immune Functions and Redox State in Blood Cells of Alzheimer’s Disease Patients. Relevant Role of Neutrophils in Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Carmen Vida

    2018-01-01

    Full Text Available Since aging is considered the most risk factor for sporadic Alzheimer’s Disease (AD, the age-related impairment of the immune system (immunosenescence, based on a chronic oxidative-inflammatory stress situation, could play a key role in the development and progression of AD. Although AD is accompanied by systemic disturbance, reflecting the damage in the brain, the changes in immune response and redox-state in different types of blood cells in AD patients have been scarcely studied. The aim was to analyze the variations in several immune functions and oxidative-inflammatory stress and damage parameters in both isolated peripheral neutrophils and mononuclear blood cells, as well as in whole blood cells, from patients diagnosed with mild (mAD and severe AD, and of age-matched controls (elderly healthy subjects as well as of adult controls. The cognitive decline of all subjects was determined by Mini-Mental State Examination (MMSE test (mAD stage was established at 20 ≤ MMSE ≤ 23 score; AD stage at <18 MMSE; elderly subjects >27 MMSE. The results showed an impairment of the immune functions of human peripheral blood neutrophils and mononuclear cells of mAD and AD patients in relation to healthy elderly subjects, who showed the typical immunosenescence in comparison with the adult individuals. However, several alterations were only observed in severe AD patients (lower chemotaxis, lipopolysaccharide lymphoproliferation, and interleukin (IL-10 release; higher basal proliferation, tumor necrosis factor (TNF-α release, and IL-10/TNF-α ratio, others only in mAD subjects (higher adherence, meanwhile others appeared in both mAD and AD patients (lower phytohemaglutinin lymphoproliferation and higher IL-6 release. This impairment of immune functions could be mediated by: (1 the higher oxidative stress and damage also observed in blood cells from mAD and AD patients and in isolated neutrophils [lower glutathione (GSH levels, high oxidized

  13. INDUCTION OF A SECRETORY IGA RESPONSE IN THE MURINE FEMALE UROGENITAL TRACT BY IMMUNIZATION OF THE LUNGS WITH LIPOSOME-SUPPLEMENTED VIRAL SUBUNIT ANTIGEN

    NARCIS (Netherlands)

    DEHAAN, A; RENEGAR, KB; SMALL, PA; WILSCHUT, J

    This study demonstrates that liposomes administered to the lower respiratory tract of mice have the capacity to stimulate secretory IgA (s-IgA) antibody production in the female urogenital system. Total respiratory tract immunization of mice with influenza virus subunit antigen simply mixed with

  14. Protein-Energy Malnutrition (PEM is Believed to Lead to an Increased Susceptibility to Infection, or cause Impaired Immunity

    Directory of Open Access Journals (Sweden)

    Mellova Amir Masrizal

    2003-08-01

    Full Text Available Infection, occurring with malnutrition, is a major cause of morbidity in all age groups and is responsible for two-thirds of all death under 5 yr of age in developing countries. Many cells of the immune system are known to depend for their function on metabolic pathways that employ various nutrients as critical factors. The most consistent changes in immune competence in PEM are in cell-mediated immunity, the bactericidal function of neutrophils, the complement system, the secretory immunoglobin A, and antibody response.

  15. RNA-Seq revealed the impairment of immune defence of tilapia against the infection of Streptococcus agalactiae with simulated climate warming.

    Science.gov (United States)

    Wang, Le; Liu, Peng; Wan, Zi Yi; Huang, Shu Qing; Wen, Yan Fei; Lin, Grace; Yue, Gen Hua

    2016-08-01

    Global warming is one of the causes of disease outbreaks in fishes. Understanding its mechanisms is critical in aquaculture and fisheries. We used tilapia to study the effects of a high temperature on the infection of a bacterial pathogen Streptococcus agalactiae using RNA-Seq. We found that the dissolved oxygen level in water at 32 °C is lower than at 22 °C, and tilapia infected with the pathogen died more rapidly at 32 °C. The gene expression profiles showed significant differences in fish raised under different conditions. We identified 126 and 576 differentially expressed genes (DEGs) at 4 and 24 h post infection at 22 °C, respectively, whereas at 32 °C, the data were 312 and 1670, respectively. Almost all responding pathways at 22 °C were involved in the immune responses, whereas at 32 °C, the enriched pathways were not only involved in immune responses but also involved in oxygen and energy metabolisms. We identified significant signals of immunosuppression of immune responses at 32 °C. In addition, many of the enriched transcription factors and DEGs under positive selection were involved in immune responses, oxygen and/or energy metabolisms. Our results suggest that global warming could reduce the oxygen level in water and impair the defence of tilapia against bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Genomic analysis and immune response in a murine mastitis model of vB_EcoM-UFV13, a potential biocontrol agent for use in dairy cows

    DEFF Research Database (Denmark)

    Duarte, Vinicius da Silva; Dias, Roberto Sousa; Kropinski, Andrew M.

    2018-01-01

    Bovine mastitis remains the main cause of economic losses for dairy farmers. Mammary pathogenic Escherichia coli (MPEC) is related to an acute mastitis and its treatment is still based on the use of antibiotics. In the era of antimicrobial resistance (AMR), bacterial viruses (bacteriophages......, such as IL-6 and TNF-alpha, were observed after viral treatment. This work brings the whole characterization and immune response to vB_EcoM-UFV13, a biocontrol candidate for bovine mastitis.......) present as an efficient treatment or prophylactic option. However, this makes it essential that its genetic structure, stability and interaction with the host immune system be thoroughly characterized. The present study analyzed a novel, broad host-range anti-mastitis agent, the T4virus vB_EcoM-UFV13...

  17. Induction of a specific strong polyantigenic cellular immune response after short-term chemotherapy controls bacillary reactivation in murine and guinea pig experimental models of tuberculosis.

    Science.gov (United States)

    Guirado, Evelyn; Gil, Olga; Cáceres, Neus; Singh, Mahavir; Vilaplana, Cristina; Cardona, Pere-Joan

    2008-08-01

    RUTI is a therapeutic vaccine that is generated from detoxified and liposomed Mycobacterium tuberculosis cell fragments that has demonstrated its efficacy in the control of bacillus reactivation after short-term chemotherapy. The aim of this study was to characterize the cellular immune response generated after the therapeutic administration of RUTI and to corroborate the lack of toxicity of the vaccine. Mouse and guinea pig experimental models were infected with a low-dose M. tuberculosis aerosol. RUTI-treated animals showed the lowest bacillary load in both experimental models. RUTI also decreased the percentage of pulmonary granulomatous infiltration in the mouse and guinea pig models. This was not the case after Mycobacterium bovis BCG treatment. Cellular immunity was studied through the characterization of the intracellular gamma interferon (IFN-gamma)-producing cells after the splenocytes' stimulation with M. tuberculosis-specific structural and growth-related antigens. Our data show that the difference between the therapeutic administration of BCG and RUTI resides mainly in the stronger activation of IFN-gamma(+) CD4(+) cells and CD8(+) cells against tuberculin purified protein derivative, ESAT-6, and Ag85B that RUTI generates. Both vaccines also triggered a specific immune response against the M. tuberculosis structural antigens Ag16kDa and Ag38kDa and a marked mRNA expression of IFN-gamma, tumor necrosis factor, interleukin-12, inducible nitric oxide synthase, and RANTES in the lung. The results show that RUTI's therapeutic effect is linked not only to the induction of a Th1 response but also to the stimulation of a quicker and stronger specific immunity against structural and growth-related antigens that reduces both the bacillary load and the pulmonary pathology.

  18. Impaired immunity in harbour seals (Phoca vitulina) exposed to bioaccumulated environmental contaminants: review of a long-term feeding study.

    NARCIS (Netherlands)

    R.L. de Swart (Rik); P.S. Ross (Peter); J.G. Vos (Joseph); A.D.M.E. Osterhaus (Albert)

    1996-01-01

    textabstractMass mortalities among seals and dolphins inhabiting contaminated marine regions have led to speculation about a possible involvement of immunosuppression associated with environmental pollution. To evaluate whether contaminants at ambient environmental levels can affect immune function

  19. Murine B cell development and antibody responses to model antigens are not impaired in the absence of the TNF receptor GITR.

    Directory of Open Access Journals (Sweden)

    Lenka Sinik Teodorovic

    Full Text Available The Glucocorticoid-Induced Tumor necrosis factor Receptor GITR, a member of the tumor necrosis factor receptor superfamily, has been shown to be important in modulating immune responses in the context of T cell immunity. B lymphocytes also express GITR, but a role of GITR in humoral immunity has not been fully explored. To address this question, we performed studies to determine the kinetics of GITR expression on naïve and stimulated B cells and the capacity of B cells to develop and mount antibody responses in GITR(-/- mice. Results of our studies indicate that all mature B cells express GITR on the cell surface, albeit at different levels. Expression of GITR on naïve mature B cells is upregulated by BCR signaling, but is counteracted by helper T cell-related factors and other inflammatory signals in vitro. In line with these findings, expression of GITR on germinal center and memory B cells is lower than that on naïve B cells. However, the expression of GITR is strongly upregulated in plasma cells. Despite these differences in GITR expression, the absence of GITR has no effect on T cell-dependent and T cell-independent antibody responses to model antigens in GITR(-/- mice, or on B cell activation and proliferation in vitro. GITR deficiency manifests only with a slight reduction of mature B cell numbers and increased turnover of naïve B cells, suggesting that GITR slightly contributes to mature B cell homeostasis. Overall, our data indicate that GITR does not play a significant role in B cell development and antibody responses to T-dependent and independent model antigens within the context of a GITR-deficient genetic background.

  20. HLA-G mediated immune regulation is impaired by a single amino acid exchange in the alpha 2 domain.

    Science.gov (United States)

    Celik, Alexander A; Simper, Gwendolin S; Huyton, Trevor; Blasczyk, Rainer; Bade-Döding, Christina

    2018-06-01

    The trade-off from HLA class I expression to HLA-G expression support the immune evasion of malignant cells. The essential role of the virtually invariant HLA-G in immune tolerance, tumor immunology and its expression frequency in immune privileged tissues is known; however the specific importance of allelic subtypes in immune responses is still not well understood. HLA-G ∗ 01:01, ∗ 01:03 and ∗ 01:04 are the most prevalent allelic variants differing at residues 31 and 110, respectively. In cytotoxicity assays applying K562 cells transduced with the HLA-G variants as targets and NK cells as effectors the differential protective potential of HLA-G variants was analyzed. Their peptide profiles were determined utilizing soluble HLA technology. An increased protective potential of HLA-G ∗ 01:04 could be observed. All variants exhibit a unique peptide repertoire with marginal overlap, while G ∗ 01:04 differs in its peptide anchor profile substantially. The functional differences between HLA-G subtypes could be explained by the constraint of the bound peptides, modifying the pHLA-G accessible surface. For the first time a contribution of amino acid alterations within the HLA-G heavy chain for peptide selection and NK cell recognition could be observed. These results will be a step towards understanding immune tolerance and will guide towards personalized immune therapeutic strategies. Copyright © 2018. Published by Elsevier Inc.

  1. Beneficial effects of ursodeoxycholic acid via inhibition of airway remodelling, apoptosis of airway epithelial cells, and Th2 immune response in murine model of chronic asthma.

    Science.gov (United States)

    Işık, S; Karaman, M; Çilaker Micili, S; Çağlayan-Sözmen, Ş; Bağrıyanık, H Alper; Arıkan-Ayyıldız, Z; Uzuner, N; Karaman, Ö

    In previous studies, anti-inflammatory, anti-apoptotic and immunomodulatory effects of ursodeoxycholic acid (UDCA) on liver diseases have been shown. In this study, we aimed to investigate the effects of UDCA on airway remodelling, epithelial apoptosis, and T Helper (Th)-2 derived cytokine levels in a murine model of chronic asthma. Twenty-seven BALB/c mice were divided into five groups; PBS-Control, OVA-Placebo, OVA-50mg/kg UDCA, OVA-150mg/kg UDCA, OVA-Dexamethasone. Mice in groups OVA-50mg/kg UDCA, OVA-150mg/kg UDCA, OVA-Dexamethasone received the UDCA (50mg/kg), UDCA (150mg/kg), and dexamethasone, respectively. Epithelium thickness, sub-epithelial smooth muscle thickness, number of mast and goblet cells of samples isolated from the lung were measured. Immunohistochemical scorings of the lung tissue for matrix metalloproteinase-9 (MMP-9), vascular endothelial growth factor (VEG-F), transforming growth factor-beta (TGF-β), terminal deoxynucleotidyl transferase-mediated dUTP nick endlabeling (TUNEL) and cysteine-dependent aspartate-specific proteases (caspase)-3 were determined. IL-4, IL-5, IL-13, Nitric oxide, ovalbumin-specific immunoglobulin (Ig) E levels were quantified. The dose of 150mg/kg UDCA treatment led to lower epithelial thickness, sub-epithelial smooth muscle thickness, goblet and mast cell numbers compared to placebo. Except for MMP-9 and TUNEL all immunohistochemical scores were similar in both UDCA treated groups and the placebo. All cytokine levels were significantly lower in group IV compared to the placebo. These findings suggested that the dose of 150mg/kg UDCA improved all histopathological changes of airway remodelling and its beneficial effects might be related to modulating Th-2 derived cytokines and the inhibition of apoptosis of airway epithelial cells. Copyright © 2017 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

  2. Dim light at night interferes with the development of the short-day phenotype and impairs cell-mediated immunity in Siberian hamsters (Phodopus sungorus).

    Science.gov (United States)

    Aubrecht, Taryn G; Weil, Zachary M; Nelson, Randy J

    2014-10-01

    Winter is a challenging time to survive and breed outside of the tropics. Animals use day length (photoperiod) to regulate seasonally appropriate adaptations in anticipation of challenging winter conditions. The net result of these photoperiod-mediated adjustments is enhanced immune function and increased survival. Thus, the ability to discriminate day length information is critical for survival and reproduction in small animals. However, during the past century, urban and suburban development has rapidly expanded and filled the night sky with light from various sources, obscuring crucial light-dark signals, which alters physiological interpretation of day lengths. Furthermore, reduced space, increased proximity to people, and the presence of light at night may act as stressors for small animals. Whereas acute stressors typically enhance immune responses, chronic exposure to stressors often impairs immune responses. Therefore, we hypothesized that the combination of dim light at night and chronic stress interferes with enhanced cell-mediated immunity observed during short days. Siberian hamsters (Phodopus sungorus) were assigned to short or long days with dark nights (0 lux) or dim (5 lux) light at night for 10 weeks. Following 2 weeks of chronic restraint (6 hr/day), a model of chronic stress, delayed type hypersensitivity (DTH) responses were assessed. Both dim light at night and restraint reduced the DTH response. Dim light at night during long nights produced an intermediate short day phenotype. These results suggest the constant presence of light at night could negatively affect survival of photoperiodic rodents by disrupting the timing of breeding and immune responses. © 2014 Wiley Periodicals, Inc.

  3. E3L and F1L Gene Functions Modulate the Protective Capacity of Modified Vaccinia Virus Ankara Immunization in Murine Model of Human Smallpox

    Directory of Open Access Journals (Sweden)

    Asisa Volz

    2018-01-01

    Full Text Available The highly attenuated Modified Vaccinia virus Ankara (MVA lacks most of the known vaccinia virus (VACV virulence and immune evasion genes. Today MVA can serve as a safety-tested next-generation smallpox vaccine. Yet, we still need to learn about regulatory gene functions preserved in the MVA genome, such as the apoptosis inhibitor genes F1L and E3L. Here, we tested MVA vaccine preparations on the basis of the deletion mutant viruses MVA-ΔF1L and MVA-ΔE3L for efficacy against ectromelia virus (ECTV challenge infections in mice. In non-permissive human tissue culture the MVA deletion mutant viruses produced reduced levels of the VACV envelope antigen B5. Upon mousepox challenge at three weeks after vaccination, MVA-ΔF1L and MVA-ΔE3L exhibited reduced protective capacity in comparison to wildtype MVA. Surprisingly, however, all vaccines proved equally protective against a lethal ECTV infection at two days after vaccination. Accordingly, the deletion mutant MVA vaccines induced high levels of virus-specific CD8+ T cells previously shown to be essential for rapidly protective MVA vaccination. These results suggest that inactivation of the anti-apoptotic genes F1L or E3L modulates the protective capacity of MVA vaccination most likely through the induction of distinct orthopoxvirus specific immunity in the absence of these viral regulatory proteins.

  4. A targeted and adjuvanted nanocarrier lowers the effective dose of liposomal amphotericin B and enhances adaptive immunity in murine cutaneous leishmaniasis.

    Science.gov (United States)

    Daftarian, Pirouz M; Stone, Geoffrey W; Kovalski, Leticia; Kumar, Manoj; Vosoughi, Aram; Urbieta, Maitee; Blackwelder, Pat; Dikici, Emre; Serafini, Paolo; Duffort, Stephanie; Boodoo, Richard; Rodríguez-Cortés, Alhelí; Lemmon, Vance; Deo, Sapna; Alberola, Jordi; Perez, Victor L; Daunert, Sylvia; Ager, Arba L

    2013-12-01

    Amphotericin B (AmB), the most effective drug against leishmaniasis, has serious toxicity. As Leishmania species are obligate intracellular parasites of antigen presenting cells (APC), an immunopotentiating APC-specific AmB nanocarrier would be ideally suited to reduce the drug dosage and regimen requirements in leishmaniasis treatment. Here, we report a nanocarrier that results in effective treatment shortening of cutaneous leishmaniasis in a mouse model, while also enhancing L. major specific T-cell immune responses in the infected host. We used a Pan-DR-binding epitope (PADRE)-derivatized-dendrimer (PDD), complexed with liposomal amphotericin B (LAmB) in an L. major mouse model and analyzed the therapeutic efficacy of low-dose PDD/LAmB vs full dose LAmB. PDD was shown to escort LAmB to APCs in vivo, enhanced the drug efficacy by 83% and drug APC targeting by 10-fold and significantly reduced parasite burden and toxicity. Fortuitously, the PDD immunopotentiating effect significantly enhanced parasite-specific T-cell responses in immunocompetent infected mice. PDD reduced the effective dose and toxicity of LAmB and resulted in elicitation of strong parasite specific T-cell responses. A reduced effective therapeutic dose was achieved by selective LAmB delivery to APC, bypassing bystander cells, reducing toxicity and inducing antiparasite immunity.

  5. Apoptosis modulation in the immune system reveals a role of neutrophils in tissue damage in a murine model of chlamydial genital infection.

    Science.gov (United States)

    Zortel, Tom; Schmitt-Graeff, Annette; Kirschnek, Susanne; Häcker, Georg

    2018-03-07

    Chlamydial infection frequently causes damage to the female genital tract. The precise mechanisms of chlamydial clearance and tissue damage are unknown but studies suggest immunopathology with a particular role of neutrophils. The goal of this study was to understand the contribution of the immune system, in particular neutrophils. Using Chlamydia muridarum, we infected mice with a prolonged immune response due to expression of Bcl-2 in haematopoietic cells (Bcl-2-mice), and mice where mature neutrophils are lacking due to the deletion of Mcl-1 in myeloid cells (LysM-cre-mcl-1-flox-mice; Mcl-1-mice). We monitored bacterial clearance, cellular infiltrate and long-term tissue damage. Both mutant strains showed slightly delayed clearance of the acute infection. Bcl-2-mice had a strongly increased inflammatory infiltrate concerning almost all cell lineages. The infection of Bcl-2-mice caused increased tissue damage. The loss of neutrophils in Mcl-1-mice was associated with substantial quantitative and qualitative alterations of the inflammatory infiltrate. Mcl-1-mice had higher chlamydial burden and reduced tissue damage, including lower incidence of hydrosalpinx and less uterine dilation. Inhibition of apoptosis in the haematopoietic system increases inflammation and tissue damage. Neutrophils have broad functions, including a role in chlamydial clearance and in tissue destruction.

  6. Enhancement of anti-murine colon cancer immunity by fusion of a SARS fragment to a low-immunogenic carcinoembryonic antigen

    Directory of Open Access Journals (Sweden)

    Lin Chen-Si

    2012-02-01

    Full Text Available Abstract Background It is widely understood that tumor cells express tumor-associated antigens (TAAs, of which many are usually in low immunogenicity; for example, carcinoembryonic antigen (CEA is specifically expressed on human colon cancer cells and is viewed as a low-immunogenic TAA. How to activate host immunity against specific TAAs and to suppress tumor growth therefore becomes important in cancer therapy development. Results To enhance the immune efficiency of CEA in mice that received, we fused a partial CEA gene with exogenous SARS-CoV fragments. Oral vaccination of an attenuated Salmonella typhimurium strain transformed with plasmids encoding CEA-SARS-CoV fusion gene into BALB/c mice elicited significant increases in TNF-α and IL-10 in the serum. In addition, a smaller tumor volume was observed in CT26/CEA-bearing mice who received CEA-SARS-CoV gene therapy in comparison with those administered CEA alone. Conclusion The administration of fusing CEA-SARS-CoV fragments may provide a promising strategy for strengthening the anti-tumor efficacy against low-immunogenic endogenous tumor antigens.

  7. Cell Type Preference of a Novel Human Derived Cell-Permeable Peptide dNP2 and TAT in Murine Splenic Immune Cells.

    Directory of Open Access Journals (Sweden)

    Sangho Lim

    Full Text Available Cell-permeable peptides (CPPs have been widely studied as an attractive drug delivery system to deliver therapeutic macromolecules such as DNA, RNA, and protein into cells. However, its clinical application is still limited and controversial due to the lack of a complete understanding of delivery efficiency in target cells. Previously we identified and characterized the novel and superior CPP, named dNP2, and here we comparatively analyzed intracellular delivery efficiency of dNP2 and TAT in various immune cells of mouse spleen to demonstrate their cell type preference. dNP2- or TAT-conjugated fluorescent proteins were most efficiently taken up by phagocytic cells such as dendritic cells and macrophages while little protein uptake was seen by lymphocytes including T cells, B cells, and NK cells. Interestingly CD8+ lymphoid dendritic cells and CD62LloCD44hi memory like T cell subsets showed significantly better uptake efficiency in vitro and in vivo relative to other dendritic cells or T cells, respectively. In addition, activated macrophages, T cells, and B cells took up the proteins more efficiently relative to when in the resting state. Importantly, only dNP2, not TAT, shows significant intracellular protein delivery efficiency in vivo. Collectively, this study provides important information regarding heterogeneous intracellular delivery efficiency of CPPs such as dNP2 and TAT with cell type preference in the spleen needed for its application in phagocytic cells or activated immune cells.

  8. Mycobacterium tuberculosis controls microRNA-99b (miR-99b) expression in infected murine dendritic cells to modulate host immunity.

    Science.gov (United States)

    Singh, Yogesh; Kaul, Vandana; Mehra, Alka; Chatterjee, Samit; Tousif, Sultan; Dwivedi, Ved Prakash; Suar, Mrutyunjay; Van Kaer, Luc; Bishai, William R; Das, Gobardhan

    2013-02-15

    Mycobacterium tuberculosis resides and replicates within host phagocytes by modulating host microbicidal responses. In addition, it suppresses the production of host protective cytokines to prevent activation of and antigen presentation by M. tuberculosis-infected cells, causing dysregulation of host protective adaptive immune responses. Many cytokines are regulated by microRNAs (miRNAs), a newly discovered class of small noncoding RNAs, which have been implicated in modulating host immune responses in many bacterial and viral diseases. Here, we show that miRNA-99b (miR-99b), an orphan miRNA, plays a key role in the pathogenesis of M. tuberculosis infection. We found that miR-99b expression was highly up-regulated in M. tuberculosis strain H37Rv-infected dendritic cells (DCs) and macrophages. Blockade of miR-99b expression by antagomirs resulted in significantly reduced bacterial growth in DCs. Interestingly, knockdown of miR-99b in DCs significantly up-regulated proinflammatory cytokines such as IL-6, IL-12, and IL-1β. Furthermore, mRNA and membrane-bound protein data indicated that inhibition of miR-99b augments TNF-α and TNFRSF-4 production. Thus, miR-99b targets TNF-α and TNFRSF-4 receptor genes. Treatment of anti-miR-99b-transfected DCs with anti-TNF-α antibody resulted in increased bacterial burden. Thus, our findings unveil a novel host evasion mechanism adopted by M. tuberculosis via miR-99b, which may open up new avenues for designing miRNA-based vaccines and therapies.

  9. Mycobacterium tuberculosis Controls MicroRNA-99b (miR-99b) Expression in Infected Murine Dendritic Cells to Modulate Host Immunity*

    Science.gov (United States)

    Singh, Yogesh; Kaul, Vandana; Mehra, Alka; Chatterjee, Samit; Tousif, Sultan; Dwivedi, Ved Prakash; Suar, Mrutyunjay; Van Kaer, Luc; Bishai, William R.; Das, Gobardhan

    2013-01-01

    Mycobacterium tuberculosis resides and replicates within host phagocytes by modulating host microbicidal responses. In addition, it suppresses the production of host protective cytokines to prevent activation of and antigen presentation by M. tuberculosis-infected cells, causing dysregulation of host protective adaptive immune responses. Many cytokines are regulated by microRNAs (miRNAs), a newly discovered class of small noncoding RNAs, which have been implicated in modulating host immune responses in many bacterial and viral diseases. Here, we show that miRNA-99b (miR-99b), an orphan miRNA, plays a key role in the pathogenesis of M. tuberculosis infection. We found that miR-99b expression was highly up-regulated in M. tuberculosis strain H37Rv-infected dendritic cells (DCs) and macrophages. Blockade of miR-99b expression by antagomirs resulted in significantly reduced bacterial growth in DCs. Interestingly, knockdown of miR-99b in DCs significantly up-regulated proinflammatory cytokines such as IL-6, IL-12, and IL-1β. Furthermore, mRNA and membrane-bound protein data indicated that inhibition of miR-99b augments TNF-α and TNFRSF-4 production. Thus, miR-99b targets TNF-α and TNFRSF-4 receptor genes. Treatment of anti-miR-99b-transfected DCs with anti-TNF-α antibody resulted in increased bacterial burden. Thus, our findings unveil a novel host evasion mechanism adopted by M. tuberculosis via miR-99b, which may open up new avenues for designing miRNA-based vaccines and therapies. PMID:23233675

  10. Scanning electron microscopy of the neuropathology of murine cerebral malaria

    Directory of Open Access Journals (Sweden)

    Brenneis Christian

    2006-11-01

    Full Text Available Abstract Background The mechanisms leading to death and functional impairments due to cerebral malaria (CM are yet not fully understood. Most of the knowledge about the pathomechanisms of CM originates from studies in animal models. Though extensive histopathological studies of the murine brain during CM are existing, alterations have not been visualized by scanning electron microscopy (SEM so far. The present study investigates the neuropathological features of murine CM by applying SEM. Methods C57BL/6J mice were infected with Plasmodium berghei ANKA blood stages. When typical symptoms of CM developed perfused brains were processed for SEM or light microscopy, respectively. Results Ultrastructural hallmarks were disruption of vessel walls, parenchymal haemorrhage, leukocyte sequestration to the endothelium, and diapedesis of macrophages and lymphocytes into the Virchow-Robin space. Villous appearance of observed lymphocytes were indicative of activated state. Cerebral oedema was evidenced by enlargement of perivascular spaces. Conclusion The results of the present study corroborate the current understanding of CM pathophysiology, further support the prominent role of the local immune system in the neuropathology of CM and might expose new perspectives for further interventional studies.

  11. Knockout of the murine cysteine dioxygenase gene results in severe impairment in ability to synthesize taurine and an increased catabolism of cysteine to hydrogen sulfide

    Science.gov (United States)

    Ueki, Iori; Roman, Heather B.; Valli, Alessandro; Fieselmann, Krista; Lam, Jimmy; Peters, Rachel; Hirschberger, Lawrence L.

    2011-01-01

    Cysteine homeostasis is dependent on the regulation of cysteine dioxygenase (CDO) in response to changes in sulfur amino acid intake. CDO oxidizes cysteine to cysteinesulfinate, which is further metabolized to either taurine or to pyruvate plus sulfate. To gain insight into the physiological function of CDO and the consequence of a loss of CDO activity, mice carrying a null CDO allele (CDO+/− mice) were crossed to generate CDO−/−, CDO+/−, and CDO+/+ mice. CDO−/− mice exhibited postnatal mortality, growth deficit, and connective tissue pathology. CDO−/− mice had extremely low taurine levels and somewhat elevated cysteine levels, consistent with the lack of flux through CDO-dependent catabolic pathways. However, plasma sulfate levels were slightly higher in CDO−/− mice than in CDO+/− or CDO+/+ mice, and tissue levels of acid-labile sulfide were elevated, indicating an increase in cysteine catabolism by cysteine desulfhydration pathways. Null mice had lower hepatic cytochrome c oxidase levels, suggesting impaired electron transport capacity. Supplementation of mice with taurine improved survival of male pups but otherwise had little effect on the phenotype of the CDO−/− mice. H2S has been identified as an important gaseous signaling molecule as well as a toxicant, and pathology may be due to dysregulation of H2S production. Control of cysteine levels by regulation of CDO may be necessary to maintain low H2S/sulfane sulfur levels and facilitate the use of H2S as a signaling molecule. PMID:21693692

  12. Deficiency of autoimmune regulator impairs the immune tolerance effect of bone marrow-derived dendritic cells in mice.

    Science.gov (United States)

    Huo, Feifei; Li, Dongbei; Zhao, Bo; Luo, Yadong; Zhao, Bingjie; Zou, Xueyang; Li, Yi; Yang, Wei

    2018-02-01

    As a transcription factor, autoimmune regulator (Aire) participates in thymic negative selection and maintains immune tolerance mainly by regulating the ectopic expression of tissue-restricted antigens (TRAs) in medullary thymic epithelial cells (mTECs). Aire is also expressed in dendritic cells (DCs). DCs are professional antigen-presenting cells (APCs) that affect the differentiation of T cells toward distinct subpopulations and participate in the immune response and tolerance, thereby playing an important role in maintaining homeostasis. To determine the role of Aire in maintaining immune tolerance by bone marrow-derived dendritic cells (BMDCs), in the present study we utilized Aire-knockout mice to examine the changes of maturation status and TRAs expression on BMDCs, additionally investigate the differentiation of CD4 + T cells. The results showed that expression of costimulatory molecule and major histocompatibility complex class II (MHC-II) molecule was increased and expression of various TRAs was decreased in BMDCs from Aire-knockout mice. Aire deficiency reduced the differentiation of naïve CD4 + T cells into type 2T helper (Th2) cells and regulatory T cells (Tregs) but enhanced the differentiation of naïve CD4 + T cells into Th1 cells, Th17 cells, and follicular helper T (Tfh) cells. The results demonstrate that Aire expressed by BMDCs plays an important role in the maintenance of homeostasis by regulating TRA expression and the differentiation of T cell subsets.

  13. Successful Therapy of Murine Visceral Leishmaniasis with Astrakurkurone, a Triterpene Isolated from the Mushroom Astraeus hygrometricus, Involves the Induction of Protective Cell-Mediated Immunity and TLR9

    Science.gov (United States)

    Mallick, Suvadip; Dutta, Aritri; Chaudhuri, Ankur; Mukherjee, Debasri; Dey, Somaditya; Halder, Subhadra; Ghosh, Joydip; Mukherjee, Debarati; Sultana, Sirin Salma; Biswas, Gunjan; Lai, Tapan Kumar; Patra, Pradyumna; Sarkar, Indranil; Chakraborty, Sibani; Saha, Bhaskar; Acharya, Krishnendu

    2016-01-01

    In our previous report, we showed that astrakurkurone, a triterpene isolated from the Indian mushroom Astraeus hygrometricus (Pers.) Morgan, induced reactive oxygen species, leading to apoptosis in Leishmania donovani promastigotes, and also was effective in inhibiting intracellular amastigotes at the 50% inhibitory concentration of 2.5 μg/ml. The aim of the present study is to characterize the associated immunomodulatory potentials and cellular activation provided by astrakurkurone, leading to effective antileishmanial activity in vitro and in vivo. Astrakurkurone-mediated antileishmanial activity was evaluated by real-time PCR and flow cytometry. The involvement of Toll-like receptor 9 (TLR9) was studied by in vitro assay in the presence of a TLR9 agonist and antagonist and by in silico modeling of a three-dimensional structure of the ectodomain of TLR9 and its interaction with astrakurkurone. Astrakurkurone caused a significant increase in TLR9 expression of L. donovani-infected macrophages along with the activation of proinflammatory responses. The involvement of TLR9 in astrakurkurone-mediated amastigote killing has been evidenced from the fact that a TLR9 agonist (CpG, ODN 1826) in combination with astrakurkurone enhanced the amastigote killing, while a TLR9 antagonist (bafilomycin A1) alone or in combination with astrakurkurone curbed the amastigote killing, which could be further justified by in silico evidence of docking between mouse TLR9 and astrakurkurone. Astrakurkurone was found to reduce the parasite burden in vivo by inducing protective cytokines, gamma interferon and interleukin 17. Moreover, astrakurkurone was nontoxic toward peripheral blood mononuclear cells of immunocompromised patients with visceral leishmaniasis. Astrakurkurone, a nontoxic antileishmanial, enhances the immune efficiency of host cells, leading to parasite clearance in vitro and in vivo. PMID:26883702

  14. Evasion of Immunity to Plasmodium falciparum: Rosettes of Blood Group A Impair Recognition of PfEMP1

    Science.gov (United States)

    Moll, Kirsten; Palmkvist, Mia; Ch'ng, Junhong; Kiwuwa, Mpungu Steven; Wahlgren, Mats

    2015-01-01

    The ABO blood group antigens are expressed on erythrocytes but also on endothelial cells, platelets and serum proteins. Notably, the ABO blood group of a malaria patient determines the development of the disease given that blood group O reduces the probability to succumb in severe malaria, compared to individuals of groups A, B or AB. P. falciparum rosetting and sequestration are mediated by PfEMP1, RIFIN and STEVOR, expressed at the surface of the parasitized red blood cell (pRBC). Antibodies to these antigens consequently modify the course of a malaria infection by preventing sequestration and promoting phagocytosis of pRBC. Here we have studied rosetting P. falciparum and present evidence of an immune evasion mechanism not previously recognized. We find the accessibility of antibodies to PfEMP1 at the surface of the pRBC to be reduced when P. falciparum forms rosettes in blood group A RBC, as compared to group O RBC. The pRBC surrounds itself with tightly bound normal RBC that makes PfEMP1 inaccessible to antibodies and clearance by the immune system. Accordingly, pRBC of in vitro cloned P. falciparum devoid of ABO blood group dependent rosetting were equally well detected by anti-PfEMP1 antibodies, independent of the blood group utilized for their propagation. The pathogenic mechanisms underlying the severe forms of malaria may in patients of blood group A depend on the ability of the parasite to mask PfEMP1 from antibody recognition, in so doing evading immune clearance. PMID:26714011

  15. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  16. Long-term exposure to arsenic affects head kidney and impairs humoral immune responses of Clarias batrachus

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Debabrata [Immunobiology Laboratory, School of Life Sciences, Visva-Bharati University, Santiniketan 731235 (India); Datta, Soma [Immunobiology Laboratory, School of Life Sciences, Visva-Bharati University, Santiniketan 731235 (India); Bhattacharya, Shelley [Environmental Toxicology Laboratory, School of Life Sciences, Visva-Bharati University, Santiniketan 731235 (India); Mazumder, Shibnath [Immunobiology Laboratory, School of Life Sciences, Visva-Bharati University, Santiniketan 731235 (India)]. E-mail: shibnath1@yahoo.co.in

    2007-02-15

    The present study was aimed at determining the effects of long-term arsenic exposure on the head kidney (HK) and ensuing humoral immune responses in Clarias batrachus L. Long-term exposure (150 days) to non-lethal concentrations of arsenic (42.42 {mu}M) resulted in significant time-dependent alterations in HK cell number eventually affecting the HK somatic index. Prolonged exposure to arsenic also suppressed HK-B cell proliferation and led to significant reduction in serum immunoglobulin levels and antigen-specific serum bacterial agglutinin titers. A decline in the number of antigen-specific plaque-forming cells with duration of arsenic exposure was noted in the HK. Enzyme linked immunosorbent assays further revealed that arsenic exposure inhibited the release of 'IL-4 like factors' from HK-T cells. Histological studies documented time-dependent changes in the structure and cellular composition of HK characterized by extensive lymphocytopenia, decrease in melano-macrophage population and hemosiderin accumulation. From exposure-challenge studies with Aeromonas hydrophila it was evident that pathogens could efficiently disseminate and colonize distant host tissues in the exposed fish. Moreover, the ability to decrease the pathogen load was also significantly reduced in the arsenic-exposed fish. Thus long-term exposure to non-lethal concentrations of arsenic affects HK and interferes with the humoral immune system of C. batrachus rendering them immunocompromised and susceptible to pathogenic challenge.

  17. Long-term exposure to arsenic affects head kidney and impairs humoral immune responses of Clarias batrachus

    International Nuclear Information System (INIS)

    Ghosh, Debabrata; Datta, Soma; Bhattacharya, Shelley; Mazumder, Shibnath

    2007-01-01

    The present study was aimed at determining the effects of long-term arsenic exposure on the head kidney (HK) and ensuing humoral immune responses in Clarias batrachus L. Long-term exposure (150 days) to non-lethal concentrations of arsenic (42.42 μM) resulted in significant time-dependent alterations in HK cell number eventually affecting the HK somatic index. Prolonged exposure to arsenic also suppressed HK-B cell proliferation and led to significant reduction in serum immunoglobulin levels and antigen-specific serum bacterial agglutinin titers. A decline in the number of antigen-specific plaque-forming cells with duration of arsenic exposure was noted in the HK. Enzyme linked immunosorbent assays further revealed that arsenic exposure inhibited the release of 'IL-4 like factors' from HK-T cells. Histological studies documented time-dependent changes in the structure and cellular composition of HK characterized by extensive lymphocytopenia, decrease in melano-macrophage population and hemosiderin accumulation. From exposure-challenge studies with Aeromonas hydrophila it was evident that pathogens could efficiently disseminate and colonize distant host tissues in the exposed fish. Moreover, the ability to decrease the pathogen load was also significantly reduced in the arsenic-exposed fish. Thus long-term exposure to non-lethal concentrations of arsenic affects HK and interferes with the humoral immune system of C. batrachus rendering them immunocompromised and susceptible to pathogenic challenge

  18. Restimulation-induced T-cell death through NTB-A/SAP signaling pathway is impaired in tuberculosis patients with depressed immune responses.

    Science.gov (United States)

    Hernández Del Pino, Rodrigo E; Pellegrini, Joaquín M; Rovetta, Ana I; Peña, Delfina; Álvarez, Guadalupe I; Rolandelli, Agustín; Musella, Rosa M; Palmero, Domingo J; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E

    2017-09-01

    Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T- and B-cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25 high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T-cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype.

  19. Cancer exosomes and NKG2D receptor-ligand interactions: impairing NKG2D-mediated cytotoxicity and anti-tumour immune surveillance.

    Science.gov (United States)

    Mincheva-Nilsson, Lucia; Baranov, Vladimir

    2014-10-01

    Human cancers constitutively produce and release endosome-derived nanometer-sized vesicles called exosomes that carry biologically active proteins, messenger and micro RNAs and serve as vehicles of intercellular communication. The tumour exosomes are present in the blood, urine and various malignant effusions such as peritoneal and pleural fluid of cancer patients and can modulate immune cells and responses thus deranging the immune system of cancer patients and giving advantage to the cancer to establish and spread itself. Here, the role of exosomes in the NKG2D receptor-ligand system's interactions is discussed. The activating NK cell receptor NKG2D and its multiple ligands, the MHC class I-related chain (MIC) A/B and the retinoic acid transcript-1/UL-16 binding proteins (RAET1/ULBP) 1-6 comprise a powerful stress-inducible danger detector system that targets infected, inflamed and malignantly transformed cells and plays a decisive role in anti-tumour immune surveillance. Mounting evidence reveals that the MIC- and RAET1/ULBP ligand family members are enriched in the endosomal compartment of various tumour cells and expressed and released into the intercellular space and bodily fluids on exosomes thus preserving their entire molecule, three-dimensional protein structure and biologic activity. The NKG2D ligand-expressing exosomes serve as decoys with a powerful ability to down regulate the cognate receptor and impair the cytotoxic function of NK-, NKT-, gamma/delta- and cytotoxic T cells. This review summarizes recent findings concerning the role of NKG2D receptor-ligand system in cancer with emphasis on regulation of NKG2D ligand expression and the immunosuppressive role of exosomally expressed NKG2D ligands. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Dietary pyridoxine deficiency reduced growth performance and impaired intestinal immune function associated with TOR and NF-κB signalling of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Zheng, Xin; Feng, Lin; Jiang, Wei-Dan; Wu, Pei; Liu, Yang; Jiang, Jun; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

    2017-11-01

    The objective of this study was to evaluate the effects of dietary pyridoxine (PN) deficiency on growth performance, intestinal immune function and the potential regulation mechanisms in young grass carp (Ctenopharyngodon idella). Fish were fed six diets containing graded levels of PN (0.12-7.48 mg/kg) for 70 days. After that, a challenge test was conducted by infection of Aeromonas hydrophila for 14 days. The results showed that compared with the optimal PN level, PN deficiency: (1) reduced the production of innate immune components such as lysozyme (LZ), acid phosphatase (ACP), complements and antimicrobial peptides and adaptive immune components such as immunoglobulins in three intestinal segments of young grass carp (P TOR) signalling [TOR/ribosomal protein S6 kinases 1 (S6K1) and eIF4E-binding proteins (4E-BP)] in three intestinal segments of young grass carp; (3) up-regulated the mRNA levels of pro-inflammatory cytokines such as tumour necrosis factor α (TNF-α) [not in the proximal intestine (PI) and distal intestine (DI)], IL-1β, IL-6, IL-8, IL-12p35, IL-12p40, IL-15 and IL-17D [(rather than interferon γ2 (IFN-γ2)] partly relating to nuclear factor kappa B (NF-κB) signalling [IκB kinase β (IKKβ) and IKKγ/inhibitor of κBα (IκBα)/NF-κB (p65 and c-Rel)] in three intestinal segments of young grass carp. These results suggest that PN deficiency could impair the intestinal immune function, and the potential regulation mechanisms were partly associated with TOR and NF-κB signalling pathways. In addition, based on percent weight gain (PWG), the ability against enteritis and LZ activity, the dietary PN requirements for young grass carp were estimated to be 4.43, 4.75 and 5.07 mg/kg diet, respectively. Copyright © 2017. Published by Elsevier Ltd.

  1. A double-edged sword: does highly active antiretroviral therapy contribute to syphilis incidence by impairing immunity to Treponema pallidum?

    Science.gov (United States)

    Rekart, Michael L; Ndifon, Wilfred; Brunham, Robert C; Dushoff, Jonathan; Park, Sang Woo; Rawat, Sanjana; Cameron, Caroline E

    2017-08-01

    Recently, the world has experienced a rapidly escalating outbreak of infectious syphilis primarily affecting men who have sex with men (MSM); many are taking highly active antiretroviral therapy (HAART) for HIV-1 infection. The prevailing hypothesis is that HAART availability and effectiveness have led to the perception among both individuals who are HIV-1 infected and those who are uninfected that HIV-1 transmission has become much less likely, and the effects of HIV-1 infection less deadly. This is expected to result in increased sexual risk-taking, especially unprotected anal intercourse, leading to more non-HIV-1 STDs, including gonorrhoea, chlamydia and syphilis. However, syphilis incidence has increased more rapidly than other STDs. We hypothesise that HAART downregulates the innate and acquired immune responses to Treponema pallidum and that this biological explanation plays an important role in the syphilis epidemic. We performed a literature search and developed a mathematical model of HIV-1 and T. pallidum confection in a population with two risk groups with assortative mixing to explore the consequence on syphilis prevalence of HAART-induced changes in behaviour versus HAART-induced biological effects. Since rising syphilis incidence appears to have outpaced gonorrhoea and chlamydia, predominantly affecting HIV-1 positive MSM, behavioural factors alone may be insufficient to explain the unique, sharp increase in syphilis incidence. HAART agents have the potential to alter the innate and acquired immune responses in ways that may enhance susceptibility to T. pallidum . This raises the possibility that therapeutic and preventative HAART may inadvertently increase the incidence of syphilis, a situation that would have significant and global public health implications. We propose that additional studies investigating the interplay between HAART and enhanced T. pallidum susceptibility are needed. If our hypothesis is correct, HAART should be combined with

  2. Novel hypomorphic mutation in IKBKG impairs NEMO-ubiquitylation causing ectodermal dysplasia, immunodeficiency, incontinentia pigmenti, and immune thrombocytopenic purpura.

    Science.gov (United States)

    Ramírez-Alejo, Noé; Alcántara-Montiel, Julio C; Yamazaki-Nakashimada, Marco; Duran-McKinster, Carola; Valenzuela-León, Paola; Rivas-Larrauri, Francisco; Cedillo-Barrón, Leticia; Hernández-Rivas, Rosaura; Santos-Argumedo, Leopoldo

    2015-10-01

    NF-κB essential modulator (NEMO) is a component of the IKK complex, which participates in the activation of the NF-κB pathway. Hypomorphic mutations in the IKBKG gene result in different forms of anhidrotic ectodermal dysplasia with immunodeficiency (EDA-ID) in males without affecting carrier females. Here, we describe a hypomorphic and missense mutation, designated c.916G>A (p.D306N), which affects our patient, his mother, and his sister. This mutation did not affect NEMO expression; however, an immunoprecipitation assay revealed reduced ubiquitylation upon CD40-stimulation in the patient's cells. Functional studies have demonstrated reduced phosphorylation and degradation of IκBα, affecting NF-κB recruitment into the nucleus. The patient presented with clinical features of ectodermal dysplasia, immunodeficiency, and immune thrombocytopenic purpura, the latter of which has not been previously reported in a patient with NEMO deficiency. His mother and sister displayed incontinentia pigmenti indicating that, in addition to amorphic mutations, hypomorphic mutations in NEMO can affect females. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Id1 suppresses anti-tumour immune responses and promotes tumour progression by impairing myeloid cell maturation.

    Science.gov (United States)

    Papaspyridonos, Marianna; Matei, Irina; Huang, Yujie; do Rosario Andre, Maria; Brazier-Mitouart, Helene; Waite, Janelle C; Chan, April S; Kalter, Julie; Ramos, Ilyssa; Wu, Qi; Williams, Caitlin; Wolchok, Jedd D; Chapman, Paul B; Peinado, Hector; Anandasabapathy, Niroshana; Ocean, Allyson J; Kaplan, Rosandra N; Greenfield, Jeffrey P; Bromberg, Jacqueline; Skokos, Dimitris; Lyden, David

    2015-04-29

    A central mechanism of tumour progression and metastasis involves the generation of an immunosuppressive 'macroenvironment' mediated in part through tumour-secreted factors. Here we demonstrate that upregulation of the Inhibitor of Differentiation 1 (Id1), in response to tumour-derived factors, such as TGFβ, is responsible for the switch from dendritic cell (DC) differentiation to myeloid-derived suppressor cell expansion during tumour progression. Genetic inactivation of Id1 largely corrects the myeloid imbalance, whereas Id1 overexpression in the absence of tumour-derived factors re-creates it. Id1 overexpression leads to systemic immunosuppression by downregulation of key molecules involved in DC differentiation and suppression of CD8 T-cell proliferation, thus promoting primary tumour growth and metastatic progression. Furthermore, advanced melanoma patients have increased plasma TGFβ levels and express higher levels of ID1 in myeloid peripheral blood cells. This study reveals a critical role for Id1 in suppressing the anti-tumour immune response during tumour progression and metastasis.

  4. Aging impairs recipient T cell intrinsic and extrinsic factors in response to transplantation.

    Directory of Open Access Journals (Sweden)

    Hua Shen

    Full Text Available As increasing numbers of older people are listed for solid organ transplantation, there is an urgent need to better understand how aging modifies alloimmune responses. Here, we investigated whether aging impairs the ability of donor dendritic cells or recipient immunity to prime alloimmune responses to organ transplantation.Using murine experimental models, we found that aging impaired the host environment to expand and activate antigen specific CD8(+ T cells. Additionally, aging impaired the ability of polyclonal T cells to induce acute allograft rejection. However, the alloimmune priming capability of donor dendritic cells was preserved with aging.Aging impairs recipient responses, both T cell intrinsic and extrinsic, in response to organ transplantation.

  5. Transcriptomic Analysis of Persistent Infection with Foot-and-Mouth Disease Virus in Cattle Suggests Impairment of Apoptosis and Cell-Mediated Immunity in the Nasopharynx.

    Directory of Open Access Journals (Sweden)

    Michael Eschbaumer

    Full Text Available In order to investigate the mechanisms of persistent foot-and-mouth disease virus (FMDV infection in cattle, transcriptome alterations associated with the FMDV carrier state were characterized using a bovine whole-transcriptome microarray. Eighteen cattle (8 vaccinated with a recombinant FMDV A vaccine, 10 non-vaccinated were challenged with FMDV A24 Cruzeiro, and the gene expression profiles of nasopharyngeal tissues collected between 21 and 35 days after challenge were compared between 11 persistently infected carriers and 7 non-carriers. Carriers and non-carriers were further compared to 2 naïve animals that had been neither vaccinated nor challenged. At a controlled false-discovery rate of 10% and a minimum difference in expression of 50%, 648 genes were differentially expressed between FMDV carriers and non-carriers, and most (467 had higher expression in carriers. Among these, genes associated with cellular proliferation and the immune response-such as chemokines, cytokines and genes regulating T and B cells-were significantly overrepresented. Differential gene expression was significantly correlated between non-vaccinated and vaccinated animals (biological correlation +0.97, indicating a similar transcriptome profile across these groups. Genes related to prostaglandin E2 production and the induction of regulatory T cells were overexpressed in carriers. In contrast, tissues from non-carrier animals expressed higher levels of complement regulators and pro-apoptotic genes that could promote virus clearance. Based on these findings, we propose a working hypothesis for FMDV persistence in nasopharyngeal tissues of cattle, in which the virus may be maintained by an impairment of apoptosis and the local suppression of cell-mediated antiviral immunity by inducible regulatory T cells.

  6. Prenatal vitamin A deficiency impairs adaptive immune responses to pentavalent rotavirus vaccine (RotaTeq®) in a neonatal gnotobiotic pig model.

    Science.gov (United States)

    Kandasamy, Sukumar; Chattha, Kuldeep S; Vlasova, Anastasia N; Saif, Linda J

    2014-02-07

    Vitamin A deficiency (VAD) is associated with increased childhood mortality and morbidity in impoverished Asian and African countries, but the impact of VAD on rotavirus (RV) vaccine or infection is poorly understood. We assessed effects of gestational and dietary induced pre- and post-natal VAD and vitamin A supplementation on immune responses to a pentavalent rotavirus vaccine, RotaTeq(®) in a neonatal gnotobiotic pig model. Vaccine efficacy was assessed against virulent G1P[8] human rotavirus (HRV) challenge. VAD and vitamin A sufficient (VAS) piglets were derived from dietary VAD and VAS sows, respectively. VAD piglets had significantly lower levels of hepatic vitamin A compared to that of VAS piglets. RotaTeq(®)-vaccinated VAD piglets had 350-fold higher fecal virus shedding titers compared to vaccinated VAS piglets post-challenge. Only 25% of vaccinated non-vitamin A supplemented VAD piglets were protected against diarrhea compared with 100% protection rate in vaccinated non-supplemented VAS piglets post-challenge. Intestinal HRV specific immune responses were compromised in VAD piglets. Vaccinated VAD piglets had significantly lower ileal HRV IgG antibody secreting cell (ASC) responses (pre-challenge) and duodenal HRV IgA ASC responses (post-challenge) compared to vaccinated VAS piglets. Also, intestinal HRV IgA antibody titers were 11-fold lower in vaccinated VAD compared to vaccinated VAS piglets post-challenge. Persistently elevated levels of IL-8, a pro-inflammatory mediator, and lower IL-10 responses (anti-inflammatory) in vaccinated VAD compared to VAS piglets suggest more severe inflammatory responses in VAD piglets post-challenge. Moreover higher IFN-γ responses pre-challenge were observed in VAD compared to VAS piglets. The impaired vaccine-specific intestinal antibody responses and decreased immunoregulatory cytokine responses coincided with reduced protective efficacy of the RV vaccine against virulent HRV challenge in VAD piglets. In

  7. Aggregation, impaired degradation and immunization targeting of amyloid-beta dimers in Alzheimer’s disease: a stochastic modelling approach

    Directory of Open Access Journals (Sweden)

    Proctor Carole J

    2012-07-01

    Full Text Available Abstract Background Alzheimer’s disease (AD is the most frequently diagnosed neurodegenerative disorder affecting humans, with advanced age being the most prominent risk factor for developing AD. Despite intense research efforts aimed at elucidating the precise molecular underpinnings of AD, a definitive answer is still lacking. In recent years, consensus has grown that dimerisation of the polypeptide amyloid-beta (Aß, particularly Aß42, plays a crucial role in the neuropathology that characterise AD-affected post-mortem brains, including the large-scale accumulation of fibrils, also referred to as senile plaques. This has led to the realistic hope that targeting Aß42 immunotherapeutically could drastically reduce plaque burden in the ageing brain, thus delaying AD onset or symptom progression. Stochastic modelling is a useful tool for increasing understanding of the processes underlying complex systems-affecting disorders such as AD, providing a rapid and inexpensive strategy for testing putative new therapies. In light of the tool’s utility, we developed computer simulation models to examine Aß42 turnover and its aggregation in detail and to test the effect of immunization against Aß dimers. Results Our model demonstrates for the first time that even a slight decrease in the clearance rate of Aß42 monomers is sufficient to increase the chance of dimers forming, which could act as instigators of protofibril and fibril formation, resulting in increased plaque levels. As the process is slow and levels of Aβ are normally low, stochastic effects are important. Our model predicts that reducing the rate of dimerisation leads to a significant reduction in plaque levels and delays onset of plaque formation. The model was used to test the effect of an antibody mediated immunological response. Our results showed that plaque levels were reduced compared to conditions where antibodies are not present. Conclusion Our model supports the current

  8. Clearance of 131I-labeled murine monoclonal antibody from patients' blood by intravenous human anti-murine immunoglobulin antibody

    International Nuclear Information System (INIS)

    Stewart, J.S.; Sivolapenko, G.B.; Hird, V.; Davies, K.A.; Walport, M.; Ritter, M.A.; Epenetos, A.A.

    1990-01-01

    Five patients treated with intraperitoneal 131I-labeled mouse monoclonal antibody for ovarian cancer also received i.v. exogenous polyclonal human anti-murine immunoglobulin antibody. The pharmacokinetics of 131I-labeled monoclonal antibody in these patients were compared with those of 28 other patients receiving i.p.-radiolabeled monoclonal antibody for the first time without exogenous human anti-murine immunoglobulin, and who had no preexisting endogenous human anti-murine immunoglobulin antibody. Patients receiving i.v. human anti-murine immunoglobulin antibody demonstrated a rapid clearance of 131I-labeled monoclonal antibody from their circulation. The (mean) maximum 131I blood content was 11.4% of the injected activity in patients receiving human anti-murine immunoglobulin antibody compared to 23.3% in patients not given human anti-murine immunoglobulin antibody. Intravenous human anti-murine immunoglobulin antibody decreased the radiation dose to bone marrow (from 131I-labeled monoclonal antibody in the vascular compartment) 4-fold. Following the injection of human anti-murine immunoglobulin antibody, 131I-monoclonal/human anti-murine immunoglobulin antibody immune complexes were rapidly transported to the liver. Antibody dehalogenation in the liver was rapid, with 87% of the injected 131I excreted in 5 days. Despite the efficient hepatic uptake of immune complexes, dehalogenation of monoclonal antibody was so rapid that the radiation dose to liver parenchyma from circulating 131I was decreased 4-fold rather than increased. All patients developed endogenous human anti-murine immunoglobulin antibody 2 to 3 weeks after treatment

  9. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Directory of Open Access Journals (Sweden)

    Paola Di Meglio

    2011-02-01

    Full Text Available IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A and common (G allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  10. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Science.gov (United States)

    Di Meglio, Paola; Di Cesare, Antonella; Laggner, Ute; Chu, Chung-Ching; Napolitano, Luca; Villanova, Federica; Tosi, Isabella; Capon, Francesca; Trembath, Richard C; Peris, Ketty; Nestle, Frank O

    2011-02-22

    IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A) and common (G) allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  11. HTLV-1 bZIP Factor Impairs Anti-viral Immunity by Inducing Co-inhibitory Molecule, T Cell Immunoglobulin and ITIM Domain (TIGIT.

    Directory of Open Access Journals (Sweden)

    Keiko Yasuma

    2016-01-01

    Full Text Available Human T-cell leukemia virus type 1 (HTLV-1 infects CD4+ T cells and induces proliferation of infected cells in vivo, which leads to the onset of adult T-cell leukemia (ATL in some infected individuals. The HTLV-1 bZIP factor (HBZ gene, which is encoded in the minus strand of HTLV-1, plays critical roles in pathogenesis. In this study, RNA-seq and ChIP-seq analyses using HBZ transduced T cells revealed that HBZ upregulates the expression and promoter acetylation levels of a co-inhibitory molecule, T cell immunoglobulin and ITIM domain (TIGIT, in addition to those of regulatory T cells related genes, Foxp3 and Ccr4. TIGIT was expressed on CD4+ T cells from HBZ-transgenic (HBZ-Tg mice, and on ATL cells and HTLV-1 infected CD4+ T cells of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP in vivo. Expression of Blimp1 and IL-10 was upregulated in TIGIT+CD4+ cells of HBZ-Tg mice compared with TIGIT-CD4+ T cells, suggesting the correlation between TIGIT expression and IL-10 production. When CD4+ T cells from HBZ-Tg mice were stimulated with TIGIT's ligand, CD155, their production of the inhibitory cytokine IL-10 was enhanced. Furthermore, dendritic cells from HBZ-Tg mice produced high levels of IL-10 after stimulation. These data suggest that HBZ alters immune system to suppressive state via TIGIT and IL-10. Importantly, TIGIT suppressed T-cell responses to another HTLV-1 virus protein, Tax, in vitro. Blocking of TIGIT and PD-1 slightly increased anti-Tax T-cell activity in some HAM/TSP patients. These results suggest that HBZ-induced TIGIT on HTLV-1 infected cells impairs T-cell responses to viral antigens. This study shows that HBZ-induced TIGIT plays a pivotal role in attenuating host immune responses and shaping a microenvironment favorable to HTLV-1.

  12. Protective antitumor activity induced by a fusion vaccine with murine ...

    African Journals Online (AJOL)

    Targeting angiogenesis is an effective strategy for anticancer therapy. The vascular endothelialcadherin (VE-cad) regulated angiogenesis is a potential target for anti-angiogenesis. Here, we develop a fusion vaccine plasmid DNA pSec-MBD2-VE-cad from VE-cad and murine beta defensin2 (MBD2) to induce immunity for ...

  13. Indoleamine 2,3-dioxygenase-expressing leukemic dendritic cells impair a leukemia-specific immune response by inducing potent T regulatory cells.

    Science.gov (United States)

    Curti, Antonio; Trabanelli, Sara; Onofri, Chiara; Aluigi, Michela; Salvestrini, Valentina; Ocadlikova, Darina; Evangelisti, Cecilia; Rutella, Sergio; De Cristofaro, Raimondo; Ottaviani, Emanuela; Baccarani, Michele; Lemoli, Roberto M

    2010-12-01

    The immunoregulatory enzyme indoleamine 2,3-dioxygenase, which catalyzes the conversion of tryptophan into kynurenine, is expressed in a significant subset of patients with acute myeloid leukemia, resulting in the inhibition of T-cell proliferation and the induction of regulatory T cells. Acute myeloid leukemia cells can be differentiated into dendritic cells, which have increased immunogenicity and have been proposed as vaccines against leukemia. Leukemic dendritic cells were generated from acute myeloid leukemia cells and used as stimulators in functional assays, including the induction of regulatory T cells. Indoleamine 2,3-dioxygenase expression in leukemic dendritic cells was evaluated at molecular, protein and enzymatic levels. We demonstrate that, after differentiation into dendritic cells, both indoleamine 2,3-dioxygenase-negative and indoleamine 2,3-dioxygenase-positive acute myeloid leukemia samples show induction and up-regulation of indoleamine 2,3-dioxygenase gene and protein, respectively. Indoleamine 2,3-dioxygenase-positive acute myeloid leukemia dendritic cells catabolize tryptophan into kynurenine metabolite and inhibit T-cell proliferation through an indoleamine 2,3-dioxygenase-dependent mechanism. Moreover, indoleamine 2,3-dioxygenase-positive leukemic dendritic cells increase the number of allogeneic and autologous CD4(+)CD25(+) Foxp3(+) T cells and this effect is completely abrogated by the indoleamine 2,3-dioxygenase-inhibitor, 1-methyl tryptophan. Purified CD4(+)CD25(+) T cells obtained from co-culture with indoleamine 2,3-dioxygenase-positive leukemic dendritic cells act as regulatory T cells as they inhibit naive T-cell proliferation and impair the complete maturation of normal dendritic cells. Importantly, leukemic dendritic cell-induced regulatory T cells are capable of in vitro suppression of a leukemia-specific T cell-mediated immune response, directed against the leukemia-associated antigen, Wilms' tumor protein. These data identify

  14. Nicotine Impairs Macrophage Control of Mycobacterium tuberculosis.

    Science.gov (United States)

    Bai, Xiyuan; Stitzel, Jerry A; Bai, An; Zambrano, Cristian A; Phillips, Matthew; Marrack, Philippa; Chan, Edward D

    2017-09-01

    Pure nicotine impairs macrophage killing of Mycobacterium tuberculosis (MTB), but it is not known whether the nicotine component in cigarette smoke (CS) plays a role. Moreover, the mechanisms by which nicotine impairs macrophage immunity against MTB have not been explored. To neutralize the effects of nicotine in CS extract, we used a competitive inhibitor to the nicotinic acetylcholine receptor (nAChR)-mecamylamine-as well as macrophages derived from mice with genetic disruption of specific subunits of nAChR. We also determined whether nicotine impaired macrophage autophagy and whether nicotine-exposed T regulatory cells (Tregs) could subvert macrophage anti-MTB immunity. Mecamylamine reduced the CS extract increase in MTB burden by 43%. CS extract increase in MTB was also significantly attenuated in macrophages from mice with genetic disruption of either the α7, β2, or β4 subunit of nAChR. Nicotine inhibited autophagosome formation in MTB-infected THP-1 cells and primary murine alveolar macrophages, as well as increased the intracellular MTB burden. Nicotine increased migration of THP-1 cells, consistent with the increased number of macrophages found in the lungs of smokers. Nicotine induced Tregs to produce transforming growth factor-β. Naive mouse macrophages co-cultured with nicotine-exposed Tregs had significantly greater numbers of viable MTB recovered with increased IL-10 production and urea production, but no difference in secreted nitric oxide as compared with macrophages cocultured with unexposed Tregs. We conclude that nicotine in CS plays an important role in subverting macrophage control of MTB infection.

  15. Potent and reversible lentiviral vector restriction in murine induced pluripotent stem cells.

    Science.gov (United States)

    Geis, Franziska K; Galla, Melanie; Hoffmann, Dirk; Kuehle, Johannes; Zychlinski, Daniela; Maetzig, Tobias; Schott, Juliane W; Schwarzer, Adrian; Goffinet, Christine; Goff, Stephen P; Schambach, Axel

    2017-05-31

    Retroviral vectors are derived from wild-type retroviruses, can be used to study retrovirus-host interactions and are effective tools in gene and cell therapy. However, numerous cell types are resistant or less permissive to retrovirus infection due to the presence of active defense mechanisms, or the absence of important cellular host co-factors. In contrast to multipotent stem cells, pluripotent stem cells (PSC) have potential to differentiate into all three germ layers. Much remains to be elucidated in the field of anti-viral immunity in stem cells, especially in PSC. In this study, we report that transduction with HIV-1-based, lentiviral vectors (LV) is impaired in murine PSC. Analyses of early retroviral events in induced pluripotent stem cells (iPSC) revealed that the restriction is independent of envelope choice and does not affect reverse transcription, but perturbs nuclear entry and proviral integration. Proteasomal inhibition by MG132 could not circumvent the restriction. However, prevention of cyclophilin A (CypA) binding to the HIV-1 capsid via use of either a CypA inhibitor (cyclosporine A) or CypA-independent capsid mutants improved transduction. In addition, application of higher vector doses also increased transduction. Our data revealed a CypA mediated restriction in iPSC, which was acquired during reprogramming, associated with pluripotency and relieved upon subsequent differentiation. We showed that murine PSC and iPSC are less susceptible to LV. The block observed in iPSC was CypA-dependent and resulted in reduced nuclear entry of viral DNA and proviral integration. Our study helps to improve transduction of murine pluripotent cells with HIV-1-based vectors and contributes to our understanding of retrovirus-host interactions in PSC.

  16. Regulation of intestinal homeostasis by innate immune cells.

    Science.gov (United States)

    Kayama, Hisako; Nishimura, Junichi; Takeda, Kiyoshi

    2013-12-01

    The intestinal immune system has an ability to distinguish between the microbiota and pathogenic bacteria, and then activate pro-inflammatory pathways against pathogens for host defense while remaining unresponsive to the microbiota and dietary antigens. In the intestine, abnormal activation of innate immunity causes development of several inflammatory disorders such as inflammatory bowel diseases (IBD). Thus, activity of innate immunity is finely regulated in the intestine. To date, multiple innate immune cells have been shown to maintain gut homeostasis by preventing inadequate adaptive immune responses in the murine intestine. Additionally, several innate immune subsets, which promote Th1 and Th17 responses and are implicated in the pathogenesis of IBD, have recently been identified in the human intestinal mucosa. The demonstration of both murine and human intestinal innate immune subsets contributing to regulation of adaptive immunity emphasizes the conserved innate immune functions across species and might promote development of the intestinal innate immunity-based clinical therapy.

  17. Strong and multi-antigen specific immunity by hepatitis B core antigen (HBcAg)-based vaccines in a murine model of chronic hepatitis B: HBcAg is a candidate for a therapeutic vaccine against hepatitis B virus.

    Science.gov (United States)

    Akbar, Sheikh Mohammad Fazle; Chen, Shiyi; Al-Mahtab, Mamun; Abe, Masanori; Hiasa, Yoichi; Onji, Morikazu

    2012-10-01

    Experimental evidence suggests that hepatitis B core antigen (HBcAg)-specific cytotoxic T lymphocytes (CTL) are essential for the control of hepatitis B virus (HBV) replication and prevention of liver damage in patients with chronic hepatitis B (CHB). However, most immune therapeutic approaches in CHB patients have been accomplished with hepatitis B surface antigen (HBsAg)-based prophylactic vaccines with unsatisfactory clinical outcomes. In this study, we prepared HBsAg-pulsed dendritic cells (DC) and HBcAg-pulsed DC by culturing spleen DC from HBV transgenic mice (HBV TM) and evaluated the immunomodulatory capabilities of these antigens, which may serve as a better therapy for CHB. The kinetics of HBsAg, antibody levels against HBsAg (anti-HBs), proliferation of HBsAg- and HBcAg-specific lymphocytes, production of antigen-specific CTL, and activation of endogenous DC were compared between HBV TM vaccinated with either HBsAg- or HBcAg-pulsed DC. Vaccination with HBsAg-pulsed DC induced HBsAg-specific immunity, but failed to induce HBcAg-specific immunity in HBV TM. However, immunization of HBV TM with HBcAg-pulsed DC resulted in: (1) HBsAg negativity, (2) production of anti-HBs, and (3) development of HBsAg- and HBcAg-specific T cells and CTL in the spleen and the liver. Additionally, significantly higher levels of activated endogenous DC were detected in HBV TM immunized with HBcAg-pulsed DC compared to HBsAg-pulsed DC (pdamage suggests that HBcAg should be an integral component of the therapeutic vaccine against CHB. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. The Fruiting Bodies, Submerged Culture Biomass, and Acidic Polysaccharide Glucuronoxylomannan of Yellow Brain Mushroom Tremella mesenterica Modulate the Immunity of Peripheral Blood Leukocytes and Splenocytes in Rats with Impaired Glucose Tolerance

    Directory of Open Access Journals (Sweden)

    Tai-Hao Hsu

    2014-01-01

    Full Text Available The prevalence of diabetes mellitus (DM, a chronic disease with hyperglycemia and impaired immune function, is increasing worldwide. Progression from impaired glucose tolerance (IGT to type 2 DM has recently become a target for early intervention. The fruiting bodies (FB and submerged culture mycelium (CM of Tremella mesenterica, an edible and medicinal mushroom, have been demonstrated to have antihyperglycemic and immunomodulatory activities in type 1 DM rats. Herein, we investigated the effects of acidic polysaccharide glucuronoxylomannan (GX extracted from CM on the immunocyte responses. Male Wistar rats were injected with streptozotocin (65 mg/kg plus nicotinamide (200 mg/kg for the induction of IGT, and gavaged daily with vehicle, FB, CM, or GX (1 g/kg/day. Rats injected with saline and gavaged vehicle were used as controls. Two weeks later, peripheral blood leukocytes (PBLs and splenocytes were collected. Ingestion of FB, CM, and GX significantly decreased blood glucose levels in the postprandial period and in oral glucose tolerance test, and partially reversed T-splenocytic proliferation in IGT rats. CM significantly decreased T-helper lymphocytes in the PBLs and B-splenocytes. In addition, FB, CM, and GX significantly reversed the IGT-induced decreases in tumor necrosis factor-α production; GX significantly increased interleukin-6 production in T-lymphocytes in the PBLs and splenocytes; and CM and GX significantly reversed IGT-induced decrease in interferon-γ production in T-lymphocytes in the spleen. In conclusion, FB, CM, and acidic polysaccharide GX of T. mesenterica may increase T-cell immunity via the elevation of proinflammatory and T-helper cytokine production in rats with impaired glucose tolerance.

  19. Oropharyngeal Candidiasis in HIV Infection: Analysis of Impaired Mucosal Immune Response to Candida albicans in Mice Expressing the HIV-1 Transgene

    Directory of Open Access Journals (Sweden)

    Louis de Repentigny

    2015-06-01

    Full Text Available IL-17-producing Th17 cells are of critical importance in host defense against oropharyngeal candidiasis (OPC. Speculation about defective Th17 responses to oral C. albicans infection in the context of HIV infection prompted an investigation of innate and adaptive immune responses to Candida albicans in transgenic mice expressing the genome of HIV-1 in immune cells and displaying an AIDS-like disease. Defective IL-17 and IL-22-dependent mucosal responses to C. albicans were found to determine susceptibility to OPC in these transgenic mice. Innate phagocytes were quantitatively and functionally intact, and individually dispensable for control of OPC and to prevent systemic dissemination of Candida to deep organs. CD8+ T-cells recruited to the oral mucosa of the transgenic mice limited the proliferation of C. albicans in these conditions of CD4+ T-cell deficiency. Therefore, the immunopathogenesis of OPC in the context of HIV infection involves defective T-cell-mediated immunity, failure of crosstalk with innate mucosal immune effector mechanisms, and compensatory cell responses, which limit Candida infection to the oral mucosa and prevent systemic dissemination.

  20. Altered Polarization, Morphology, and Impaired Innate Immunity Germane to Resident Peritoneal Macrophages in Mice with Long-Term Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Hui-Fang Liu

    2012-01-01

    Full Text Available Type 2 diabetes (T2D is associated with perturbed innate immunity. Macrophages, bridging innate immunity and metabolic disturbances, play important roles in controlling immune homeostasis. However, the effect of long-term diabetic milieu (DM on the functions and phenotypes of macrophages is still not clear. In this study, we used resident peritoneal macrophages (RPMs from 5-month-old db/db mice to investigate the changes of macrophages. It was found that RPMs in db/db mice significantly reduced phagocytosis and adhesion capacity. After standardization with body weight, the number of F4/80+ RPMs markedly reduced in db/db mice, and, furthermore, the macrophages skewed to M2-polarizated macrophages. The results of morphology found that the RPMs shape of db/db mice was nearly round, but the RPMs shape of control mice was spindle-shaped and irregular. In this study, we found the cell numbers, morphology, and innate immunity functions of RPMs in 5-month-old type 2 diabetic mice (db/db mice obtained by abdominal cavity lavage were significantly altered. Importantly, we also found the remarkably increased M2-RPMs in diabetic mice for the first time.

  1. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-01-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions

  2. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Ballestas, Mary E. [Department of Pediatrics Infectious Disease, Children' s of Alabama, School of Medicine, University of Alabama at Birmingham, AL (United States); Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Robbins, David J. [Department of Surgery, Molecular Oncology Program, Miller School of Medicine, University of Miami, Miami (United States); Matalon, Sadis [Department of Anesthesiology, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S. [Department of Medicine, Division of Pulmonary, Allergy and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Afaq, Farrukh [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Bickers, David R. [Department of Dermatology, Columbia University Medical Center, New York (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  3. Feline immunodeficiency virus (FIV) infection in the cat as a model for HIV infection in man: FIV induced impairment of immune function.

    NARCIS (Netherlands)

    C.H.J. Siebelink (Kees); I-H. Chu (I-Hai); G.F. Rimmelzwaan (Guus); K. Weijer (Kees); R. van Herwijnen (Rob); P. Knell (Peter); H.F. Egberink (Herman); M.L. Bosch (Marnix); A.D.M.E. Osterhaus (Albert)

    1990-01-01

    textabstractTo assess the value of feline immunodeficiency virus (FIV) infection as a model for human immunodeficiency virus (HIV) infection in man, we studied the impairment of certain immunological functions following natural or experimental FIV infection. Proliferative responses of peripheral

  4. Impaired trophoblast invasion and increased numbers of immune cells at day 18 of pregnancy in the mesometrial triangle of type 1 diabetic rats

    NARCIS (Netherlands)

    Groen, B.; Uuldriks, G. A.; de Vos, P.; Visser, J. T.; Links, T. P.; Faas, M. M.

    Introduction: Type 1 diabetes (T1D) is associated with adverse pregnancy outcome, usually attributed to hyperglycemia. Recently, we showed that pregnancy outcome in normoglycemic T1D rats was characterized by decreased fetal and placental weight, suggesting impaired placental development. In the

  5. Increased Nucleosomes and Neutrophil Activation Link to Disease Progression in Patients with Scrub Typhus but Not Murine Typhus in Laos.

    Science.gov (United States)

    Paris, Daniel H; Stephan, Femke; Bulder, Ingrid; Wouters, Diana; van der Poll, Tom; Newton, Paul N; Day, Nicholas P J; Zeerleder, Sacha

    2015-01-01

    Cell-mediated immunity is essential in protection against rickettsial illnesses, but the role of neutrophils in these intracellular vasculotropic infections remains unclear. This study analyzed the plasma levels of nucleosomes, FSAP-activation (nucleosome-releasing factor), and neutrophil activation, as evidenced by neutrophil-elastase (ELA) complexes, in sympatric Lao patients with scrub typhus and murine typhus. In acute scrub typhus elevated nucleosome levels correlated with lower GCS scores, raised respiratory rate, jaundice and impaired liver function, whereas neutrophil activation correlated with fibrinolysis and high IL-8 plasma levels, a recently identified predictor of severe disease and mortality. Nucleosome and ELA complex levels were associated with a 4.8-fold and 4-fold increased risk of developing severe scrub typhus, beyond cut off values of 1,040 U/ml for nucleosomes and 275 U/ml for ELA complexes respectively. In murine typhus, nucleosome levels associated with pro-inflammatory cytokines and the duration of illness, while ELA complexes correlated strongly with inflammation markers, jaundice and increased respiratory rates. This study found strong correlations between circulating nucleosomes and neutrophil activation in patients with scrub typhus, but not murine typhus, providing indirect evidence that nucleosomes could originate from neutrophil extracellular trap (NET) degradation. High circulating plasma nucleosomes and ELA complexes represent independent risk factors for developing severe complications in scrub typhus. As nucleosomes and histones exposed on NETs are highly cytotoxic to endothelial cells and are strongly pro-coagulant, neutrophil-derived nucleosomes could contribute to vascular damage, the pro-coagulant state and exacerbation of disease in scrub typhus, thus indicating a detrimental role of neutrophil activation. The data suggest that increased neutrophil activation relates to disease progression and severe complications, and

  6. Production of antibodies which recognize opiate receptors on murine leukocytes

    Energy Technology Data Exchange (ETDEWEB)

    Carr, D.J.J.; Bost, K.L.; Blalock, J.E.

    1988-01-01

    An antibody has been developed which recognizes opiate receptors on cells of the immune system. This antibody blocks specific binding of the radiolabeled opiate receptor ligand, /sup 3/H-dihydromorphine, to receptors on murine splenocytes. Additionally, the anti-receptor antibody competes with ..beta..-endorphin, meta-enkephalin, and naloxone for the same binding site on the leukocytes. Moreover, the anti-receptor antibody possesses agonist activity similar to ..beta..-endorphin in suppressing cAMP production by lymphocytes. These results suggest the development of an antibody which recognizes classical opiate receptors on cells of the immune system.

  7. Food-grade TiO2 impairs intestinal and systemic immune homeostasis, initiates preneoplastic lesions and promotes aberrant crypt development in the rat colon.

    Science.gov (United States)

    Bettini, Sarah; Boutet-Robinet, Elisa; Cartier, Christel; Coméra, Christine; Gaultier, Eric; Dupuy, Jacques; Naud, Nathalie; Taché, Sylviane; Grysan, Patrick; Reguer, Solenn; Thieriet, Nathalie; Réfrégiers, Matthieu; Thiaudière, Dominique; Cravedi, Jean-Pierre; Carrière, Marie; Audinot, Jean-Nicolas; Pierre, Fabrice H; Guzylack-Piriou, Laurence; Houdeau, Eric

    2017-01-20

    Food-grade titanium dioxide (TiO 2 ) containing a nanoscale particle fraction (TiO 2 -NPs) is approved as a white pigment (E171 in Europe) in common foodstuffs, including confectionary. There are growing concerns that daily oral TiO 2 -NP intake is associated with an increased risk of chronic intestinal inflammation and carcinogenesis. In rats orally exposed for one week to E171 at human relevant levels, titanium was detected in the immune cells of Peyer's patches (PP) as observed with the TiO 2 -NP model NM-105. Dendritic cell frequency increased in PP regardless of the TiO 2 treatment, while regulatory T cells involved in dampening inflammatory responses decreased with E171 only, an effect still observed after 100 days of treatment. In all TiO 2 -treated rats, stimulation of immune cells isolated from PP showed a decrease in Thelper (Th)-1 IFN-γ secretion, while splenic Th1/Th17 inflammatory responses sharply increased. E171 or NM-105 for one week did not initiate intestinal inflammation, while a 100-day E171 treatment promoted colon microinflammation and initiated preneoplastic lesions while also fostering the growth of aberrant crypt foci in a chemically induced carcinogenesis model. These data should be considered for risk assessments of the susceptibility to Th17-driven autoimmune diseases and to colorectal cancer in humans exposed to TiO 2 from dietary sources.

  8. Deficits in Endogenous Adenosine Formation by Ecto-5′-Nucleotidase/CD73 Impair Neuromuscular Transmission and Immune Competence in Experimental Autoimmune Myasthenia Gravis

    Directory of Open Access Journals (Sweden)

    Laura Oliveira

    2015-01-01

    Full Text Available AMP dephosphorylation via ecto-5′-nucleotidase/CD73 is the rate limiting step to generate extracellular adenosine (ADO from released adenine nucleotides. ADO, via A2A receptors (A2ARs, is a potent modulator of neuromuscular and immunological responses. The pivotal role of ecto-5′-nucleotidase/CD73, in controlling extracellular ADO formation, prompted us to investigate its role in a rat model of experimental autoimmune myasthenia gravis (EAMG. Results show that CD4+CD25+FoxP3+ regulatory T cells express lower amounts of ecto-5′-nucleotidase/CD73 as compared to controls. Reduction of endogenous ADO formation might explain why proliferation of CD4+ T cells failed upon blocking A2A receptors activation with ZM241385 or adenosine deaminase in EAMG animals. Deficits in ADO also contribute to neuromuscular transmission failure in EAMG rats. Rehabilitation of A2AR-mediated immune suppression and facilitation of transmitter release were observed by incubating the cells with the nucleoside precursor, AMP. These findings, together with the characteristic increase in serum adenosine deaminase activity of MG patients, strengthen our hypothesis that the adenosinergic pathway may be dysfunctional in EAMG. Given that endogenous ADO formation is balanced by ecto-5′-nucleotidase/CD73 activity and that A2ARs exert a dual role to restore use-dependent neurocompetence and immune suppression in myasthenics, we hypothesize that stimulation of the two mechanisms may have therapeutic potential in MG.

  9. Loss of PPAR gamma in immune cells impairs the ability of abscisic acid to improve insulin sensitivity by suppressing monocyte chemoattractant protein-1 expression and macrophage infiltration into white adipose tissue.

    Science.gov (United States)

    Guri, Amir J; Hontecillas, Raquel; Ferrer, Gerardo; Casagran, Oriol; Wankhade, Umesh; Noble, Alexis M; Eizirik, Decio L; Ortis, Fernanda; Cnop, Miriam; Liu, Dongmin; Si, Hongwei; Bassaganya-Riera, Josep

    2008-04-01

    Abscisic acid (ABA) is a natural phytohormone and peroxisome proliferator-activated receptor gamma (PPARgamma) agonist that significantly improves insulin sensitivity in db/db mice. Although it has become clear that obesity is associated with macrophage infiltration into white adipose tissue (WAT), the phenotype of adipose tissue macrophages (ATMs) and the mechanisms by which insulin-sensitizing compounds modulate their infiltration remain unknown. We used a loss-of-function approach to investigate whether ABA ameliorates insulin resistance through a mechanism dependent on immune cell PPARgamma. We characterized two phenotypically distinct ATM subsets in db/db mice based on their surface expression of F4/80. F4/80(hi) ATMs were more abundant and expressed greater concentrations of chemokine receptor (CCR) 2 and CCR5 when compared to F4/80(lo) ATMs. ABA significantly decreased CCR2(+) F4/80(hi) infiltration into WAT and suppressed monocyte chemoattractant protein-1 (MCP-1) expression in WAT and plasma. Furthermore, the deficiency of PPARgamma in immune cells, including macrophages, impaired the ability of ABA to suppress the infiltration of F4/80(hi) ATMs into WAT, to repress WAT MCP-1 expression and to improve glucose tolerance. We provide molecular evidence in vivo demonstrating that ABA improves insulin sensitivity and obesity-related inflammation by inhibiting MCP-1 expression and F4/80(hi) ATM infiltration through a PPARgamma-dependent mechanism.

  10. Beneficial Effects of Anti-Interleukin-6 Antibodies on Impaired Gastrointestinal Motility, Inflammation and Increased Colonic Permeability in a Murine Model of Sepsis Are Most Pronounced When Administered in a Preventive Setup.

    Directory of Open Access Journals (Sweden)

    Sara Nullens

    Full Text Available During sepsis, gastrointestinal ileus, mucosal barrier dysfunction and bacterial translocation are accepted to be important triggers that can maintain or exacerbate the septic state. In the caecal ligation and puncture animal model of sepsis, we demonstrated that systemic and colonic interleukin-6 levels are significantly increased coinciding with an impaired colonic barrier function. We therefore aimed to study the effect of therapeutic or curative administration of anti-IL6 antibodies on overall GI motility, colonic permeability and translocation of intestinal bacteria in blood and mesenteric lymph nodes in the mouse caecal ligation and puncture model.OF-1 mice were randomized to either the preventive or curative protocol, in which they received 1 mg/kg of antibodies to interleukin-6, or its IgG isotype control solution. They subsequently underwent either the caecal ligation and puncture procedure, or sham-surgery. GI motility was assessed 48 h following the procedure, as well as colonic permeability, serum and colon cytokines, colonic tight junction proteins at the mRNA level; cultures of blood and mesenteric lymph nodes were performed.Preventive administration of anti-interleukin-6 antibodies successfully counteracted the gastrointestinal motility disturbances and impaired colonic barrier function that could be observed in vehicle-treated septic animals. Serum and colonic levels of proinflammatory cytokines were significantly lower when animals were preventively treated with anti-interleukin-6 antibodies. A repetitive injection 24 h later resulted in the most pronounced effects. Curative treatment significantly lowered systemic and colonic inflammation markers while the effects on transit and permeability were unfortunately no longer significant.Caecal ligation and puncture resulted in septic ileus with an increased colonic permeability. Antibodies to interleukin-6 were able to ameliorate gastro-intestinal motility, suppress inflammation and

  11. Dietary low or excess levels of lipids reduced growth performance, and impaired immune function and structure of head kidney, spleen and skin in young grass carp (Ctenopharyngodon idella) under the infection of Aeromonas hydrophila.

    Science.gov (United States)

    Ni, Pei-Jun; Jiang, Wei-Dan; Wu, Pei; Liu, Yang; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu; Feng, Lin

    2016-08-01

    Our study explored the effect of dietary lipids on growth and immunity and structure (head kidney, spleen and skin) of young grass carp (Ctenopharyngodon idella). A total of 540 young grass carp with an average initial weight of 261.41 ± 0.53 g were fed diets containing six graded levels of lipids at 5.9-80.1 g/kg diet for 8 weeks. After that, a challenge trial was conducted by injection of Aeromonas hydrophila over 2 weeks. The results indicated that compared with optimal lipids supplementation, low and excess levels of lipids down-regulated the mRNA levels of antimicrobial peptides, anti-inflammatory cytokines, inhibitor of κBα (IκBα) and ribosomal p70S6 kinase (S6K1), and up-regulated pro-inflammatory cytokines, nuclear factor κB p65 (NF-κB p65), NF-κB c-Rel (not p52), IκB kinase α (IKKα), IKKβ, IKKγ, and eIF4E-binding protein (4EBP) mRNA levels in the head kidney and spleen of young grass carp (P lipids also increased reactive oxygen species (ROS) production and malondialdehyde (MDA) and protein carbonyl (PC) contents, reduced the activities of antioxidant enzymes (P lipids down-regulated the mRNA levels of B-cell lymphoma-2 (Bcl-2) and inhibitor of apoptosis protein (IAP) in the head kidney and spleen, whereas up-regulated the mRNA levels of apoptotic protease activating factor-1 (Apaf-1), caspase 3, 7, 8 and 9 mRNA levels in the head kidney and spleen and Fas ligand (FasL) mRNA levels in the spleen of young grass carp, suggesting that low or excess levels of lipids could decrease the head kidney and spleen immune function, induce oxidative damage and apoptosis and impair antioxidant system of young grass carp. At last, low or excess levels of lipids also impaired the immune function and structure in the skin of young grass carp. Based on the quadratic regression analysis for PWG, skin haemorrhage and lesions morbidity and IgM content, the dietary lipids requirements for young grass carp were estimated to be 43.7, 60.2, 55.0 and 52.1

  12. Effects of copper nanoparticle exposure on host defense in a murine pulmonary infection model

    Directory of Open Access Journals (Sweden)

    Grassian Vicki H

    2011-09-01

    Full Text Available Abstract Background Human exposure to nanoparticles (NPs and environmental bacteria can occur simultaneously. NPs induce inflammatory responses and oxidative stress but may also have immune-suppressive effects, impairing macrophage function and altering epithelial barrier functions. The purpose of this study was to assess the potential pulmonary effects of inhalation and instillation exposure to copper (Cu NPs using a model of lung inflammation and host defense. Methods We used Klebsiella pneumoniae (K.p. in a murine lung infection model to determine if pulmonary bacterial clearance is enhanced or impaired by Cu NP exposure. Two different exposure modes were tested: sub-acute inhalation (4 hr/day, 5 d/week for 2 weeks, 3.5 mg/m3 and intratracheal instillation (24 hr post-exposure, 3, 35, and 100 μg/mouse. Pulmonary responses were evaluated by lung histopathology plus measurement of differential cell counts, total protein, lactate dehydrogenase (LDH activity, and inflammatory cytokines in bronchoalveolar lavage (BAL fluid. Results Cu NP exposure induced inflammatory responses with increased recruitment of total cells and neutrophils to the lungs as well as increased total protein and LDH activity in BAL fluid. Both inhalation and instillation exposure to Cu NPs significantly decreased the pulmonary clearance of K.p.-exposed mice measured 24 hr after bacterial infection following Cu NP exposure versus sham-exposed mice also challenged with K.p (1.4 × 105 bacteria/mouse. Conclusions Cu NP exposure impaired host defense against bacterial lung infections and induced a dose-dependent decrease in bacterial clearance in which even our lowest dose demonstrated significantly lower clearance than observed in sham-exposed mice. Thus, exposure to Cu NPs may increase the risk of pulmonary infection.

  13. Cytotoxic effector functions of T cells are not required for protective immunity against fatal Rickettsia typhi infection in a murine model of infection: Role of TH1 and TH17 cytokines in protection and pathology.

    Directory of Open Access Journals (Sweden)

    Kristin Moderzynski

    2017-02-01

    Full Text Available Endemic typhus caused by Rickettsia (R. typhi is an emerging febrile disease that can be fatal due to multiple organ pathology. Here we analyzed the requirements for protection against R. typhi by T cells in the CB17 SCID model of infection. BALB/c wild-type mice generate CD4+ TH1 and cytotoxic CD8+ T cells both of which are sporadically reactivated in persistent infection. Either adoptively transferred CD8+ or CD4+ T cells protected R. typhi-infected CB17 SCID mice from death and provided long-term control. CD8+ T cells lacking either IFNγ or Perforin were still protective, demonstrating that the cytotoxic function of CD8+ T cells is not essential for protection. Immune wild-type CD4+ T cells produced high amounts of IFNγ, induced the release of nitric oxide in R. typhi-infected macrophages and inhibited bacterial growth in vitro via IFNγ and TNFα. However, adoptive transfer of CD4+IFNγ-/- T cells still protected 30-90% of R. typhi-infected CB17 SCID mice. These cells acquired a TH17 phenotype, producing high amounts of IL-17A and IL-22 in addition to TNFα, and inhibited bacterial growth in vitro. Surprisingly, the neutralization of either TNFα or IL-17A in CD4+IFNγ-/- T cell recipient mice did not alter bacterial elimination by these cells in vivo, led to faster recovery and enhanced survival compared to isotype-treated animals. Thus, collectively these data show that although CD4+ TH1 cells are clearly efficient in protection against R. typhi, CD4+ TH17 cells are similarly protective if the harmful effects of combined production of TNFα and IL-17A can be inhibited.

  14. A pan-inhibitor of DASH family enzymes induces immune-mediated regression of murine sarcoma and is a potent adjuvant to dendritic cell vaccination and adoptive T-cell therapy.

    Science.gov (United States)

    Duncan, Brynn B; Highfill, Steven L; Qin, Haiying; Bouchkouj, Najat; Larabee, Shannon; Zhao, Peng; Woznica, Iwona; Liu, Yuxin; Li, Youhua; Wu, Wengen; Lai, Jack H; Jones, Barry; Mackall, Crystal L; Bachovchin, William W; Fry, Terry J

    2013-10-01

    Multimodality therapy consisting of surgery, chemotherapy, and radiation will fail in approximately 40% of patients with pediatric sarcomas and result in substantial long-term morbidity in those who are cured. Immunotherapeutic regimens for the treatment of solid tumors typically generate antigen-specific responses too weak to overcome considerable tumor burden and tumor suppressive mechanisms and are in need of adjuvant assistance. Previous work suggests that inhibitors of DASH (dipeptidyl peptidase IV activity and/or structural homologs) enzymes can mediate tumor regression by immune-mediated mechanisms. Herein, we demonstrate that the DASH inhibitor, ARI-4175, can induce regression and eradication of well-established solid tumors, both as a single agent and as an adjuvant to a dendritic cell (DC) vaccine and adoptive cell therapy (ACT) in mice implanted with the M3-9-M rhabdomyosarcoma cell line. Treatment with effective doses of ARI-4175 correlated with recruitment of myeloid (CD11b) cells, particularly myeloid DCs, to secondary lymphoid tissues and with reduced frequency of intratumoral monocytic (CD11bLy6-CLy6-G) myeloid-derived suppressor cells. In immunocompetent mice, combining ARI-4175 with a DC vaccine or ACT with tumor-primed T cells produced significant improvements in tumor responses against well-established M3-9-M tumors. In M3-9-M-bearing immunodeficient (Rag1) mice, ACT combined with ARI-4175 produced greater tumor responses and significantly improved survival compared with either treatment alone. These studies warrant the clinical investigation of ARI-4175 for treatment of sarcomas and other malignancies, particularly as an adjuvant to tumor vaccines and ACT.

  15. Expression of biologically active murine interleukin-18 in Lactococcus lactis.

    Science.gov (United States)

    Feizollahzadeh, Sadegh; Khanahmad, Hossein; Rahimmanesh, Ilnaz; Ganjalikhani-Hakemi, Mazdak; Andalib, Alireza; Sanei, Mohammad Hossein; Rezaei, Abbas

    2016-11-01

    The food-grade bacterium Lactococcus lactis is increasingly used for heterologous protein expression in therapeutic and industrial applications. The ability of L. lactis to secrete biologically active cytokines may be used for the generation of therapeutic cytokines. Interleukin (IL)-18 enhances the immune response, especially on mucosal surfaces, emphasizing its therapeutic potential. However, it is produced as an inactive precursor and has to be enzymatically cleaved for maturation. We genetically manipulated L. lactis to secrete murine IL-18. The mature murine IL-18 gene was inserted downstream of a nisin promoter in pNZ8149 plasmid and the construct was used to transform L. lactis NZ3900. The transformants were selected on Elliker agar and confirmed by restriction enzyme digestion and sequencing. The expression and secretion of IL-18 protein was verified by SDS-PAGE, western blotting and ELISA. The biological activity of recombinant IL-18 was determined by its ability to induce interferon (IFN)-γ production in L. lactis co-cultured with murine splenic T cells. The amounts of IL-18 in bacterial lysates and supernatants were 3-4 μg mL -1 and 0.6-0.7 ng mL -1 , respectively. The successfully generated L. lactis strain that expressed biologically active murine IL-18 can be used to evaluate the possible therapeutic effects of IL-18 on mucosal surfaces. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Interleukin-2 treatment potentiates induction of oral tolerance in a murine model of autoimmunity.

    OpenAIRE

    Rizzo, L V; Miller-Rivero, N E; Chan, C C; Wiggert, B; Nussenblatt, R B; Caspi, R R

    1994-01-01

    The present study addresses the feasibility of potentiating oral tolerance by immunomanipulation, using the murine model of experimental autoimmune uveoretinitis (EAU) induced by immunization with the retinal antigen interphotoreceptor retinoid binding protein (IRBP). Three feedings of 0.2 mg IRBP every other day before immunization did not protect against EAU, whereas a similar regimen of five doses was protective. However, supplementing the nonprotective 3x regimen with as little as one inj...

  17. Inflammation-mediated memory dysfunction and effects of a ketogenic diet in a murine model of multiple sclerosis.

    Directory of Open Access Journals (Sweden)

    Do Young Kim

    Full Text Available A prominent clinical symptom in multiple sclerosis (MS, a progressive disorder of the central nervous system (CNS due to heightened neuro-inflammation, is learning and memory dysfunction. Here, we investigated the effects of a ketogenic diet (KD on memory impairment and CNS-inflammation in a murine model of experimental autoimmune encephalomyelitis (EAE, using electrophysiological, behavioral, biochemical and in vivo imaging approaches. Behavioral spatial learning deficits were associated with motor disability in EAE mice, and were observed concurrently with brain inflammation. The KD improved motor disability in the EAE model, as well as CA1 hippocampal synaptic plasticity (long-term potentiation and spatial learning and memory (assessed with the Morris Water Maze. Moreover, hippocampal atrophy and periventricular lesions in EAE mice were reversed in KD-treated EAE mice. Finally, we found that the increased expression of inflammatory cytokines and chemokines, as well as the production of reactive oxygen species (ROS, in our EAE model were both suppressed by the KD. Collectively, our findings indicate that brain inflammation in EAE mice is associated with impaired spatial learning and memory function, and that KD treatment can exert protective effects, likely via attenuation of the robust immune response and increased oxidative stress seen in these animals.

  18. Immune-Mediated Damage Completes the Parabola: Cryptococcus neoformans Pathogenesis Can Reflect the Outcome of a Weak or Strong Immune Response

    Directory of Open Access Journals (Sweden)

    Liise-anne Pirofski

    2017-12-01

    Full Text Available Cryptococcosis occurs most frequently in immunocompromised individuals. This has led to the prevailing view that this disease is the result of weak immune responses that cannot control the fungus. However, increasingly, clinical and experimental studies have revealed that the host immune response can contribute to cryptococcal pathogenesis, including the recent study of L. M. Neal et al. (mBio 8:e01415-17, 2017, https://doi.org/10.1128/mBio.01415-17 that reports that CD4+ T cells mediate tissue damage in experimental murine cryptococcosis. This finding has fundamental implications for our understanding of the pathogenesis of cryptococcal disease; it helps explain why immunotherapy has been largely unsuccessful in treatment and provides insight into the paradoxical observation that HIV-associated cryptococcosis may have a better prognosis than cryptococcosis in those with no known immune impairment. The demonstration that host-mediated damage can drive cryptococcal disease provides proof of concept that the parabola put forth in the damage-response framework has the flexibility to depict complex and changing outcomes of host-microbe interaction.

  19. High fat diet accelerates pathogenesis of murine Crohn's disease-like ileitis independently of obesity.

    Directory of Open Access Journals (Sweden)

    Lisa Gruber

    Full Text Available BACKGROUND: Obesity has been associated with a more severe disease course in inflammatory bowel disease (IBD and epidemiological data identified dietary fats but not obesity as risk factors for the development of IBD. Crohn's disease is one of the two major IBD phenotypes and mostly affects the terminal ileum. Despite recent observations that high fat diets (HFD impair intestinal barrier functions and drive pathobiont selection relevant for chronic inflammation in the colon, mechanisms of high fat diets in the pathogenesis of Crohn's disease are not known. The aim of this study was to characterize the effect of HFD on the development of chronic ileal inflammation in a murine model of Crohn's disease-like ileitis. METHODS: TNF(ΔARE/WT mice and wildtype C57BL/6 littermates were fed a HFD compared to control diet for different durations. Intestinal pathology and metabolic parameters (glucose tolerance, mesenteric tissue characteristics were assessed. Intestinal barrier integrity was characterized at different levels including polyethylene glycol (PEG translocation, endotoxin in portal vein plasma and cellular markers of barrier function. Inflammatory activation of epithelial cells as well as immune cell infiltration into ileal tissue were determined and related to luminal factors. RESULTS: HFD aggravated ileal inflammation but did not induce significant overweight or typical metabolic disorders in TNF(ΔARE/WT. Expression of the tight junction protein Occludin was markedly reduced in the ileal epithelium of HFD mice independently of inflammation, and translocation of endotoxin was increased. Epithelial cells showed enhanced expression of inflammation-related activation markers, along with enhanced luminal factors-driven recruitment of dendritic cells and Th17-biased lymphocyte infiltration into the lamina propria. CONCLUSIONS: HFD feeding, independently of obesity, accelerated disease onset of small intestinal inflammation in Crohn's disease

  20. P2X7 receptor activation induces cell death and microparticle release in murine erythroleukemia cells.

    NARCIS (Netherlands)

    Constantinescu, P.; Wang, B.; Kovacevic, K.; Jalilian, I.; Bosman, G.J.C.G.M.; Wiley, J.S.; Sluyter, R.

    2010-01-01

    Extracellular ATP induces cation fluxes in and impairs the growth of murine erythroleukemia (MEL) cells in a manner characteristic of the purinergic P2X7 receptor, however the presence of P2X7 in these cells is unknown. This study investigated whether MEL cells express functional P2X7. RT-PCR,

  1. Ecotropic murine leukemia virus-induced fusion of murine cells

    International Nuclear Information System (INIS)

    Pinter, A.; Chen, T.; Lowy, A.; Cortez, N.G.; Silagi, S.

    1986-01-01

    Extensive fusion occurs upon cocultivation of murine fibroblasts producing ecotropic murine leukemia viruses (MuLVs) with a large variety of murine cell lines in the presence of the polyene antibiotic amphotericin B, the active component of the antifungal agent Fungizone. The resulting polykaryocytes contain nuclei from both infected and uninfected cells, as evidenced by autoradiographic labeling experiments in which one or the other parent cell type was separately labeled with [ 3 H]thymidine and fused with an unlabeled parent. This cell fusion specifically requires the presence of an ecotropic MuLV-producing parent and is not observed for cells producing xenotropic, amphotropic, or dualtropic viruses. Mouse cells infected with nonecotropic viruses retain their sensitivity toward fusion, whereas infection with ecotropic viruses abrogates the fusion of these cells upon cocultivation with other ecotropic MuLV-producing cells. Nonmurine cells lacking the ecotropic gp70 receptor are not fused under similar conditions. Fusion is effectively inhibited by monospecific antisera to gp70, but not by antisera to p15(E), and studies with monoclonal antibodies identify distinct amino- and carboxy-terminal gp70 regions which play a role in the fusion reaction. The enhanced fusion which occurs in the presence of amphotericin B provides a rapid and sensitive assay for the expression of ecotropic MuLVs and should facilitate further mechanistic studies of MuLV-induced fusion of murine cells

  2. Collagen-Induced Arthritis: A model for Murine Autoimmune Arthritis

    OpenAIRE

    Pietrosimone, K. M.; Jin, M.; Poston, B.; Liu, P.

    2015-01-01

    Collagen-induced arthritis (CIA) is a common autoimmune animal model used to study rheumatoid arthritis (RA). The development of CIA involves infiltration of macrophages and neutrophils into the joint, as well as T and B cell responses to type II collagen. In murine CIA, genetically susceptible mice (DBA/1J) are immunized with a type II bovine collagen emulsion in complete Freund’s adjuvant (CFA), and receive a boost of type II bovine collagen in incomplete Freund’s adjuvant (IFA) 21 days aft...

  3. Childhood Immunization

    Science.gov (United States)

    ... lowest levels in history, thanks to years of immunization. Children must get at least some vaccines before ... child provide protection for many years, adults need immunizations too. Centers for Disease Control and Prevention

  4. Immunizations - diabetes

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000331.htm Immunizations - diabetes To use the sharing features on this page, please enable JavaScript. Immunizations (vaccines or vaccinations) help protect you from some ...

  5. Contemplating the murine test tube: lessons from natural killer cells and Cryptococcus neoformans.

    Science.gov (United States)

    Marr, Kaleb J; Jones, Gareth J; Mody, Christopher H

    2006-06-01

    Murine experimentation has provided many useful tools, including the ability to knockout or over-express genes and to perform experiments that are limited by ethical considerations. Over the past century, mice have imparted valuable insights into the biology of many systems, including human immunity. However, although there are many similarities between the immune response of humans and mice, there are also many differences; none is more prominent than when examining natural killer cell biology. These differences include tissue distribution, effector molecules, receptor repertoire, and cytokine responses, all of which have important implications when extrapolating the studies to the human immune responses to Cryptococcus neoformans.

  6. Immunization Coverage

    Science.gov (United States)

    ... room/fact-sheets/detail/immunization-coverage","@context":"http://schema.org","@type":"Article"}; العربية 中文 français русский español ... Plan Global Health Observatory (GHO) data - Immunization More information on vaccines and immunization News 1 in 10 ...

  7. Study of the immune response by antibodies against the Bothrops asper venom for the elaboration of a antiophidic vaccine for bovines

    International Nuclear Information System (INIS)

    Gonzalez Rojas, Katherine

    2014-01-01

    Active immunization has determined against Bothrops asper snake venom (tested in murine and bovine models) a induced response by antibody able to prevent in immunized animals. A coagulopathy or death is developed after of be administered with adequate doses of poison. The amount of B. asper venom has defined the poisoning induced in bovine and murine models. The plasmatic concentration of equine antibodies against B. asper venom is specified to prevent coagulopathy and lethality induced by this venom in murine and bovine models. Murine and bovine models have verified the active immunization reached in a concentration of antibodies against B. asper venom equal or greater to the maximum concentration achieved by intravenous administration of antivenoms from equine origin. The concentration of antibodies induced by the active immunization is evaluated against B. asper venom to prevent the development of coagulopathy and lethality induced by the venom in murine and bovine models [es

  8. Immunizing Children

    Directory of Open Access Journals (Sweden)

    Geraldine Jody Macdonald

    2014-11-01

    Full Text Available This article addresses the complex contexts within which Canadian health professionals engage in immunizing children and focuses on the Canadian practice guidelines and current scientific evidence that direct Canadian health professional competencies. The article begins by presenting two current global vaccine initiatives and links these to immunization in Canada. A selected literature review identifies current best immunization practices. With the purpose of promoting quality improvement, three key Canadian immunization competencies for health professional are highlighted: communication with parents, including those who are experiencing vaccine hesitancy; administration of immunizing agents; and documentation of immunizations. Health professionals are encouraged to reflect on immunization competencies and ensure evidence-based practices underpin vaccine delivery in their primary care settings.

  9. Application of murine monoclonal antibodies to the serodiagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Ivanyl, J.; Coates, A.R.M.; Krambovitis, E.

    1982-01-01

    The immune response during infectious diseases leads to a rise in antibody titre to the various different antigenic determinants of the causative organism. The response is further complicated by the fact that it is relatively unusual for one individual to respond to all antigenic components of an organism. Demonstration of the specific immune response of an infected host by serological tests is often hampered by the broad cross-reactivity between several bacterial antigens. The authors report on a serodiagnostic application of murine monoclonal antibodies (MAB), specific for a human pathogen, M. tuberculosis by a technique which is applicable in principle to the serodiagnosis of many other infectious diseases. The serum diagnostic test is based on the competitive inhibition by human sera of the binding of 125 I-labelled murine monoclonal antibodies to M. tuberculosis-coated polyvinyl plates. Five monoclonal antibodies binding to distinct antigenic determinants of the organism were used as structural probes which conferred their stringent combining site specificities to the polyclonal mixture of antibodies from patients' sera. When compared with healthy controls, increased titres of inhibitory antibodies were found in about 70% of patients with active tuberculosis. The diagnostic value of the individual monoclonal antibodies as well as the benefit from the use of multiple specificity probes has been qualified

  10. [Stress and auto-immunity].

    Science.gov (United States)

    Delévaux, I; Chamoux, A; Aumaître, O

    2013-08-01

    The etiology of auto-immune disorders is multifactorial. Stress is probably a participating factor. Indeed, a high proportion of patients with auto-immune diseases report uncommon stress before disease onset or disease flare. The biological consequences of stress are increasingly well understood. Glucocorticoids and catecholamines released by hypothalamic-pituitary-adrenal axis during stress will alter the balance Th1/Th2 and the balance Th17/Treg. Stress impairs cellular immunity, decreases immune tolerance and stimulates humoral immunity exposing individuals to autoimmune disease among others. The treatment for autoimmune disease should include stress management. Copyright © 2012 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  11. Antibody responses against xenotropic murine leukemia virus-related virus envelope in a murine model.

    Directory of Open Access Journals (Sweden)

    Natalia Makarova

    2011-04-01

    Full Text Available Xenotropic murine leukemia virus-related virus (XMRV was recently discovered to be the first human gammaretrovirus that is associated with chronic fatigue syndrome and prostate cancer (PC. Although a mechanism for XMRV carcinogenesis is yet to be established, this virus belongs to the family of gammaretroviruses well known for their ability to induce cancer in the infected hosts. Since its original identification XMRV has been detected in several independent investigations; however, at this time significant controversy remains regarding reports of XMRV detection/prevalence in other cohorts and cell type/tissue distribution. The potential risk of human infection, coupled with the lack of knowledge about the basic biology of XMRV, warrants further research, including investigation of adaptive immune responses. To study immunogenicity in vivo, we vaccinated mice with a combination of recombinant vectors expressing codon-optimized sequences of XMRV gag and env genes and virus-like particles (VLP that had the size and morphology of live infectious XMRV.Immunization elicited Env-specific binding and neutralizing antibodies (NAb against XMRV in mice. The peak titers for ELISA-binding antibodies and NAb were 1:1024 and 1:464, respectively; however, high ELISA-binding and NAb titers were not sustained and persisted for less than three weeks after immunizations.Vaccine-induced XMRV Env antibody titers were transiently high, but their duration was short. The relatively rapid diminution in antibody levels may in part explain the differing prevalences reported for XMRV in various prostate cancer and chronic fatigue syndrome cohorts. The low level of immunogenicity observed in the present study may be characteristic of a natural XMRV infection in humans.

  12. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  13. Neurological Disorders in a Murine Model of Chronic Renal Failure

    Directory of Open Access Journals (Sweden)

    Jean-Marc Chillon

    2014-01-01

    Full Text Available Cardiovascular disease is highly prevalent in patients with chronic renal failure (CRF. However, data on the impact of CRF on the cerebral circulatory system are scarce—despite the fact that stroke is the third most common cause of cardiovascular death in people with CRF. In the present study, we examined the impact of CRF on behavior (anxiety, recognition and ischemic stroke severity in a well-defined murine model of CRF. We did not observe any significant increases between CRF mice and non-CRF mice in terms of anxiety. In contrast, CRF mice showed lower levels of anxiety in some tests. Recognition was not impaired (vs. controls after 6 weeks of CRF but was impaired after 10 weeks of CRF. Chronic renal failure enhances the severity of ischemic stroke, as evaluated by the infarct volume size in CRF mice after 34 weeks of CRF. Furthermore, neurological test results in non-CRF mice tended to improve in the days following ischemic stroke, whereas the results in CRF mice tended to worsen. In conclusion, we showed that a murine model of CRF is suitable for evaluating uremic toxicity and the associated neurological disorders. Our data confirm the role of uremic toxicity in the genesis of neurological abnormalities (other than anxiety.

  14. Visual Impairment

    Science.gov (United States)

    ... site Sitio para adolescentes Body Mind Sexual Health Food & Fitness Diseases & Conditions Infections Drugs & Alcohol School & Jobs Sports Expert Answers (Q&A) Staying Safe Videos for Educators Search English Español Visual Impairment KidsHealth / For Teens / Visual Impairment What's in ...

  15. Collagen-Induced Arthritis: A model for Murine Autoimmune Arthritis.

    Science.gov (United States)

    Pietrosimone, K M; Jin, M; Poston, B; Liu, P

    2015-10-20

    Collagen-induced arthritis (CIA) is a common autoimmune animal model used to study rheumatoid arthritis (RA). The development of CIA involves infiltration of macrophages and neutrophils into the joint, as well as T and B cell responses to type II collagen. In murine CIA, genetically susceptible mice (DBA/1J) are immunized with a type II bovine collagen emulsion in complete Freund's adjuvant (CFA), and receive a boost of type II bovine collagen in incomplete Freund's adjuvant (IFA) 21 days after the first injection. These mice typically develop disease 26 to 35 days after the initial injection. C57BL/6J mice are resistant to arthritis induced by type II bovine collagen, but can develop arthritis when immunized with type II chicken collagen in CFA, and receive a boost of type II chicken collagen in IFA 21 days after the first injection. The concentration of heat-killed Mycobacterium tuberculosis H37RA (MT) in CFA also differs for each strain. DBA/1J mice develop arthritis with 1 mg/ml MT, while C57BL/6J mice require and 3-4 mg/ml MT in order to develop arthritis. CIA develops slowly in C57BL/6J mice and cases of arthritis are mild when compared to DBA/1J mice. This protocol describes immunization of DBA/1J mice with type II bovine collagen and the immunization of C57BL/6J mice with type II chicken collagen.

  16. Intrapulmonary Versus Nasal Transduction of Murine Airways With GP64-pseudotyped Viral Vectors

    Directory of Open Access Journals (Sweden)

    Mayumi Oakland

    2013-01-01

    Full Text Available Persistent viral vector-mediated transgene expression in the airways requires delivery to cells with progenitor capacity and avoidance of immune responses. Previously, we observed that GP64-pseudotyped feline immunodeficiency virus (FIV-mediated gene transfer was more efficient in the nasal airways than the large airways of the murine lung. We hypothesized that in vivo gene transfer was limited by immunological and physiological barriers in the murine intrapulmonary airways. Here, we systematically investigate multiple potential barriers to lentiviral gene transfer in the airways of mice. We show that GP64-FIV vector transduced primary cultures of well-differentiated murine nasal epithelia with greater efficiency than primary cultures of murine tracheal epithelia. We further demonstrate that neutrophils, type I interferon (IFN responses, as well as T and B lymphocytes are not the major factors limiting the transduction of murine conducting airways. In addition, we observed better transduction of GP64-pseudotyped vesicular stomatitis virus (VSV in the nasal epithelia compared with the intrapulmonary airways in mice. VSVG glycoprotein pseudotyped VSV transduced intrapulmonary epithelia with similar efficiency as nasal epithelia. Our results suggest that the differential transduction efficiency of nasal versus intrapulmonary airways by FIV vector is not a result of immunological barriers or surface area, but rather differential expression of cellular factors specific for FIV vector transduction.

  17. The influence of pregnancy on systemic immunity.

    Science.gov (United States)

    Pazos, Michael; Sperling, Rhoda S; Moran, Thomas M; Kraus, Thomas A

    2012-12-01

    Adaptations in maternal systemic immunity are presumed to be responsible for observed alterations in disease susceptibility and severity as pregnancy progresses. Epidemiological evidence as well as animal studies have shown that influenza infections are more severe during the second and third trimesters of pregnancy, resulting in greater morbidity and mortality, although the reason for this is still unclear. Our laboratory has taken advantage of 20 years of experience studying the murine immune response to respiratory viruses to address questions of altered immunity during pregnancy. With clinical studies and unique animal model systems, we are working to define the mechanisms responsible for altered immune responses to influenza infection during pregnancy and what roles hormones such as estrogen or progesterone play in these alterations.

  18. Impact on allergic immune response after treatment with vitamin A

    DEFF Research Database (Denmark)

    Matheu, Victor; Berggård, Karin; Barrios, Yvelise

    2009-01-01

    ABSTRACT: BACKGROUND: Vitamin A may have some influence on the immune system, but the role in allergy modulation is still unclear. OBJECTIVE: To clarify whether high levels of retinoic acid (RA) affects allergic response in vivo, we used a murine experimental model of airway allergic disease...

  19. Immune System

    Science.gov (United States)

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  20. Skin Immunization Obviates Alcohol-Related Immune Dysfunction

    Directory of Open Access Journals (Sweden)

    Rhonda M. Brand

    2015-11-01

    Full Text Available Alcoholics suffer from immune dysfunction that can impede vaccine efficacy. If ethanol (EtOH-induced immune impairment is in part a result of direct exposure of immune cells to EtOH, then reduced levels of exposure could result in less immune dysfunction. As alcohol ingestion results in lower alcohol levels in skin than blood, we hypothesized that the skin immune network may be relatively preserved, enabling skin-targeted immunizations to obviate the immune inhibitory effects of alcohol consumption on conventional vaccines. We employed the two most common chronic EtOH mouse feeding models, the liver-damaging Lieber-DeCarli (LD and liver-sparing Meadows-Cook (MC diets, to examine the roles of EtOH and/or EtOH-induced liver dysfunction on alcohol related immunosuppression. Pair-fed mice were immunized against the model antigen ovalbumin (OVA by DNA immunization or against flu by administering the protein-based influenza vaccine either systemically (IV, IM, directly to liver (hydrodynamic, or cutaneously (biolistic, ID. We measured resulting tissue EtOH levels, liver stress, regulatory T cell (Treg, and myeloid-derived suppressor cell (MDSC populations. We compared immune responsiveness by measuring delayed-type hypersensitivity (DTH, antigen-specific cytotoxic T lymphocyte (CTL, and antibody induction as a function of delivery route and feeding model. We found that, as expected, and independent of the feeding model, EtOH ingestion inhibits DTH, CTL lysis, and antigen-specific total IgG induced by traditional systemic vaccines. On the other hand, skin-targeted vaccines were equally immunogenic in alcohol-exposed and non-exposed subjects, suggesting that cutaneous immunization may result in more efficacious vaccination in alcohol-ingesting subjects.

  1. Imported rickettsioses : think of murine typhus

    NARCIS (Netherlands)

    van der Kleij, FGH; Gansevoort, RT; Kreeftenberg, HG

    Murine typhus is a disease still prevalent in many parts of the world. Because the incidence in the US and Europe has declined rapidly, physicians in these continents have become unfamiliar with the clinical picture. Murine typhus is associated with significant morbidity and fatalities do occur,

  2. Alcohol, aging, and innate immunity.

    Science.gov (United States)

    Boule, Lisbeth A; Kovacs, Elizabeth J

    2017-07-01

    The global population is aging: in 2010, 8% of the population was older than 65 y, and that is expected to double to 16% by 2050. With advanced age comes a heightened prevalence of chronic diseases. Moreover, elderly humans fair worse after acute diseases, namely infection, leading to higher rates of infection-mediated mortality. Advanced age alters many aspects of both the innate and adaptive immune systems, leading to impaired responses to primary infection and poor development of immunologic memory. An often overlooked, yet increasingly common, behavior in older individuals is alcohol consumption. In fact, it has been estimated that >40% of older adults consume alcohol, and evidence reveals that >10% of this group is drinking more than the recommended limit by the National Institute on Alcohol Abuse and Alcoholism. Alcohol consumption, at any level, alters host immune responses, including changes in the number, phenotype, and function of innate and adaptive immune cells. Thus, understanding the effect of alcohol ingestion on the immune system of older individuals, who are already less capable of combating infection, merits further study. However, there is currently almost nothing known about how drinking alters innate immunity in older subjects, despite innate immune cells being critical for host defense, resolution of inflammation, and maintenance of immune homeostasis. Here, we review the effects of aging and alcohol consumption on innate immune cells independently and highlight the few studies that have examined the effects of alcohol ingestion in aged individuals. © Society for Leukocyte Biology.

  3. Immunity booster

    International Nuclear Information System (INIS)

    Stefanescu, Ioan; Titescu, Gheorghe; Tamaian, Radu; Haulica, Ion; Bild, Walther

    2002-01-01

    The immunity booster is, according to its patent description, microbiologically pure water with an D/(D+H) isotopic concentration of 100 ppm, with physical-chemical characteristics similar to those of distilled water. It is obtained by sterilization of a mixture of deuterium depleted water, with a 25 ppm isotopic concentration, with distilled water in a volume ratio of 4:6. Unlike natural immunity boosters (bacterial agents as Bacillus Chalmette-Guerin, Corynebacterium parvum; lipopolysaccharides; human immunoglobulin) or synthetical products (levamysol; isoprinosyne with immunostimulating action), which cause hypersensitivity and shocks, thrill, fever, sickness and the immunity complex disease, the water of 100 ppm D/(D + H) isotopic concentration is a toxicity free product. The testing for immune reaction of the immunity booster led to the following results: - an increase of cell action capacity in the first immunity shielding stage (macrophages), as evidenced by stimulation of a number of essential characterizing parameters, as well as of the phagocytosis capacity, bactericide capacity, and opsonic capacity of serum; - an increase of the number of leucocyte particularly of the granulocyte in peripheral blood, produced especially when medullar toxic agents like caryolysine are used; - it hinders the effect of lowering the number of erythrocytes in peripheral blood produced by experimentally induced chronic inflammation; - an increase of nonspecific immunity defence capacity against specific bacterial aggression of both Gram-positive bacteria (Streptococcus pneumoniae 558 ) and of the Gram-negative ones (Klebsiella pneumoniae 507 ); - an increase of immunity - stimulating activity (proinflamatory), like that of levamisole as evidenced by the test of stimulation of experimentally induced inflammation by means of carrageenan. The following advantages of the immunity booster are stressed: - it is toxicity free and side effect free; - can be orally administrated as

  4. Distinct Roles for Intestinal Epithelial Cell-Specific Hdac1 and Hdac2 in the Regulation of Murine Intestinal Homeostasis.

    Science.gov (United States)

    Gonneaud, Alexis; Turgeon, Naomie; Boudreau, François; Perreault, Nathalie; Rivard, Nathalie; Asselin, Claude

    2016-02-01

    The intestinal epithelium responds to and transmits signals from the microbiota and the mucosal immune system to insure intestinal homeostasis. These interactions are in part conveyed by epigenetic modifications, which respond to environmental changes. Protein acetylation is an epigenetic signal regulated by histone deacetylases, including Hdac1 and Hdac2. We have previously shown that villin-Cre-inducible intestinal epithelial cell (IEC)-specific Hdac1 and Hdac2 deletions disturb intestinal homeostasis. To determine the role of Hdac1 and Hdac2 in the regulation of IEC function and the establishment of the dual knockout phenotype, we have generated villin-Cre murine models expressing one Hdac1 allele without Hdac2, or one Hdac2 allele without Hdac1. We have also investigated the effect of short-term deletion of both genes in naphtoflavone-inducible Ah-Cre and tamoxifen-inducible villin-Cre(ER) mice. Mice with one Hdac1 allele displayed normal tissue architecture, but increased sensitivity to DSS-induced colitis. In contrast, mice with one Hdac2 allele displayed intestinal architecture defects, increased proliferation, decreased goblet cell numbers as opposed to Paneth cells, increased immune cell infiltration associated with fibrosis, and increased sensitivity to DSS-induced colitis. In comparison to dual knockout mice, intermediary activation of Notch, mTOR, and Stat3 signaling pathways was observed. While villin-Cre(ER) Hdac1 and Hdac2 deletions led to an impaired epithelium and differentiation defects, Ah-Cre-mediated deletion resulted in blunted proliferation associated with the induction of a DNA damage response. Our results suggest that IEC determination and intestinal homeostasis are highly dependent on Hdac1 and Hdac2 activity levels, and that changes in the IEC acetylome may alter the mucosal environment. © 2015 Wiley Periodicals, Inc.

  5. Lymphoma: Immune Evasion Strategies

    International Nuclear Information System (INIS)

    Upadhyay, Ranjan; Hammerich, Linda; Peng, Paul; Brown, Brian; Merad, Miriam; Brody, Joshua D.

    2015-01-01

    While the cellular origin of lymphoma is often characterized by chromosomal translocations and other genetic aberrations, its growth and development into a malignant neoplasm is highly dependent upon its ability to escape natural host defenses. Neoplastic cells interact with a variety of non-malignant cells in the tumor milieu to create an immunosuppressive microenvironment. The resulting functional impairment and dysregulation of tumor-associated immune cells not only allows for passive growth of the malignancy but may even provide active growth signals upon which the tumor subsequently becomes dependent. In the past decade, the success of immune checkpoint blockade and adoptive cell transfer for relapsed or refractory lymphomas has validated immunotherapy as a possible treatment cornerstone. Here, we review the mechanisms by which lymphomas have been found to evade and even reprogram the immune system, including alterations in surface molecules, recruitment of immunosuppressive subpopulations, and secretion of anti-inflammatory factors. A fundamental understanding of the immune evasion strategies utilized by lymphomas may lead to better prognostic markers and guide the development of targeted interventions that are both safer and more effective than current standards of care

  6. Lymphoma: Immune Evasion Strategies

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyay, Ranjan; Hammerich, Linda; Peng, Paul [Division of Hematology and Medical Oncology, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Brown, Brian [Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Merad, Miriam [Department of Oncological Sciences, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Brody, Joshua D., E-mail: joshua.brody@mssm.edu [Division of Hematology and Medical Oncology, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States)

    2015-04-30

    While the cellular origin of lymphoma is often characterized by chromosomal translocations and other genetic aberrations, its growth and development into a malignant neoplasm is highly dependent upon its ability to escape natural host defenses. Neoplastic cells interact with a variety of non-malignant cells in the tumor milieu to create an immunosuppressive microenvironment. The resulting functional impairment and dysregulation of tumor-associated immune cells not only allows for passive growth of the malignancy but may even provide active growth signals upon which the tumor subsequently becomes dependent. In the past decade, the success of immune checkpoint blockade and adoptive cell transfer for relapsed or refractory lymphomas has validated immunotherapy as a possible treatment cornerstone. Here, we review the mechanisms by which lymphomas have been found to evade and even reprogram the immune system, including alterations in surface molecules, recruitment of immunosuppressive subpopulations, and secretion of anti-inflammatory factors. A fundamental understanding of the immune evasion strategies utilized by lymphomas may lead to better prognostic markers and guide the development of targeted interventions that are both safer and more effective than current standards of care.

  7. Impaired Driving

    Science.gov (United States)

    ... Get the Facts What Works: Strategies to Increase Car Seat and Booster Seat ... narcotics. 3 That’s one percent of the 111 million self-reported episodes of alcohol-impaired driving among U.S. ...

  8. Innate immunity

    African Journals Online (AJOL)

    Ronnie Anderson is Director of the Medical Research Council Unit for Inflammation and Immunity. ... field have included macrophage, T cell, cytokine and cytokine activated killer cell interactions .... monocytes, mast cells, lymphocytes, eccrine.

  9. Childhood immunization

    Science.gov (United States)

    Romain, Sandra; Schillaci, Michael A.

    2009-01-01

    ABSTRACT OBJECTIVE To examine childhood immunization levels relative to the number of family physicians, pediatricians, and public health nurses in Ontario. DESIGN Retrospective comparative analysis of publicly available data on immunization coverage levels and the relative number of family physicians, pediatricians, and public health nurses. SETTING Ontario. PARTICIPANTS Seven-year-old children, family physicians, pediatricians, and public health nurses in Ontario. MAIN OUTCOME MEASURES The association between immunization coverage levels and the relative number of family physicians, pediatricians, and public health nurses. RESULTS We found correlations between immunization coverage levels and the relative number (ie, per 1000 Ontario residents) of family physicians (ρ = 0.60) and pediatricians (ρ = 0.70) and a lower correlation with the relative number of public health nurses (ρ = 0.40), although none of these correlations was significant. A comparison of temporal trends illustrated that variation in the relative number of family physicians and pediatricians in Ontario was associated with similar variation in immunization coverage levels. CONCLUSION Increasing the number of family physicians and pediatricians might help to boost access to immunizations and perhaps other components of cost-saving childhood preventive care. PMID:19910599

  10. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients

    NARCIS (Netherlands)

    Wieten, R. W.; Goorhuis, A.; Jonker, E. F. F.; de Bree, G. J.; de Visser, A. W.; van Genderen, P. J. J.; Remmerswaal, E. B. M.; ten Berge, I. J. M.; Visser, L. G.; Grobusch, M. P.; van Leeuwen, E. M. M.

    2016-01-01

    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen

  11. [Evaluation of Fusarium spp. pathogenicity in plant and murine models].

    Science.gov (United States)

    Forero-Reyes, Consuelo M; Alvarado-Fernández, Angela M; Ceballos-Rojas, Ana M; González-Carmona, Lady C; Linares-Linares, Melva Y; Castañeda-Salazar, Rubiela; Pulido-Villamarín, Adriana; Góngora-Medina, Manuel E; Cortés-Vecino, Jesús A; Rodríguez-Bocanegra, María X

    The genus Fusarium is widely recognized for its phytopathogenic capacity. However, it has been reported as an opportunistic pathogen in immunocompetent and immunocompromised patients. Thus, it can be considered a microorganism of interest in pathogenicity studies on different hosts. Therefore, this work evaluated the pathogenicity of Fusarium spp. isolates from different origins in plants and animals (murine hosts). Twelve isolates of Fusarium spp. from plants, animal superficial mycoses, and human superficial and systemic mycoses were inoculated in tomato, passion fruit and carnation plants, and in immunocompetent and immunosuppressed BALB/c mice. Pathogenicity tests in plants did not show all the symptoms associated with vascular wilt in the three plant models; however, colonization and necrosis of the vascular bundles, regardless of the species and origin of the isolates, showed the infective potential of Fusarium spp. in different plant species. Moreover, the pathogenicity tests in the murine model revealed behavioral changes. It was noteworthy that only five isolates (different origin and species) caused mortality. Additionally, it was observed that all isolates infected and colonized different organs, regardless of the species and origin of the isolates or host immune status. In contrast, the superficial inoculation test showed no evidence of epidermal injury or colonization. The observed results in plant and murine models suggest the pathogenic potential of Fusarium spp. isolates in different types of hosts. However, further studies on pathogenicity are needed to confirm the multihost capacity of this genus. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  12. Experimental parameters differentially affect the humoral response of the cholera-toxin-based murine model of food allergy

    DEFF Research Database (Denmark)

    Kroghsbo, S.; Christensen, Hanne Risager; Frøkiær, Hanne

    2003-01-01

    Background: Recent studies have developed a murine model of IgE-mediated food allergy based on oral coadministration of antigen and cholera toxin (CT) to establish a maximal response for studying immunopathogenic mechanisms and immunotherapeutic strategies. However, for studying subtle...... interested in characterizing the individual effects of the parameters in the CT-based model: CT dose, antigen type and dose, and number of immunizations. Methods: BALB/c mice were orally sensitized weekly for 3 or 7 weeks with graded doses of CT and various food antigens (soy-trypsin inhibitor, ovalbumin...... of the antibody response depended on the type of antigen and number of immunizations. Conclusions: The critical parameters of the CT-based murine allergy model differentially control the intensity and kinetics of the developing immune response. Adjustment of these parameters could be a key tool for tailoring...

  13. Dose-effect relationship of apoptosis induced by fission-neutron in murine thymocytes

    International Nuclear Information System (INIS)

    Yuan Bin; Li Liang; Xue Wencheng; Sun Jianmin; Wang Baoqin

    2000-01-01

    Objective: To investigate the effectiveness of high LET fission-neutron to induce apoptosis in murine thymocytes and to compare it with that of low LET 60 Co γ-ray. Methods: Apoptosis induction was studied qualitatively by light and transmission electron microscopy and DNA gel electrophoresis,also quantitatively by flow cytometry(FCM) and diphenylamine (DPA)methods. Results: DNA ladders of murine thymocytes were detectable, the typical apoptosis of thymocytes could be observed morphologically by means of light and electron microscopy at 6 h after fission-neutron irradiation with doses ranging from 0.5 to 5.0 Gy, meanwhile the percentages of apoptosis increased with increasing doses. After exposure to γ-rays with doses ranging from 1.0 to 30 Gy, the experimental results were similar to those from neutron radiation. The incidence of apoptosis peaked at about 20 Gy, the percentages did not increase further when doses increased. Conclusion: Apoptosis of murine thymocytes can be induced when mice are exposed to either fission-neutron (0.5-5.0 Gy) or to γ-ray (1-30 Gy). Although the relationship between apoptosis and radiation doses is similar, the percentage of apoptosis induced by neutron irradiation is higher than that induced by γ-irradiation. The RBE values of fission-neutron for inducing apoptosis murine thymocytes are 2.09 (by FCM method) and 2.37 (by DPA method), respectively. These results also suggest that fission-neutron-induced murine immune tissue is more severe than that induced by γ-rays at several hours post-irradiation and this might be the basis for heavy damage to immune tissues induced by fission-neutron-irradiation in later period

  14. Effect of SPG (Sonifilan) immunotherapy and PDT on murine tumor

    International Nuclear Information System (INIS)

    Korbelik, M.; Krosl, G.; Dougherty, G.J.; Chaplin, D.J.

    1992-01-01

    PhotoDynamic Therapy of solid tumors is unique in eliciting a strong host immune response unparalleled in other cancer therapies. This immune response is manifested as an acute inflammatory reaction, and can be readily seen as redness and edema around the treated area. Destruction of typical solid tumor cannot be accomplished solely by direct phototoxic action. This was shown to be the case even with drugs more potent in this direct killing effect than Photofrin, the photosensitizer presently used in clinical PDT. Limiting factors seem to be regional insufficiencies in supply of molecular oxygen, needed for generation of phototoxic species. They can be ascribed to the existence of chronically and acute hypoxic tumor regions, oxygen consumption by the photodynamic process, and vascular shutdown induced during PDT. The remaining tumor mass is eradicated by an indirect effect, necrosis induced by destruction of tumor vasculature. Since most events in PDT treated tumor that lead to vascular collapse are, in fact, typical inflammatory manifestations, it was suggested that PDT-induced acute inflammatory reaction actually leads to vascular damage. In a related report characteristics are shown of cellular inflammatory infiltrate in PDT-treated murine tumor. This work examines the effect of combining PDT with immunotherapy, in an attempt to investigate a possibility of amplification of immune reaction to PDT and its direction towards more pervasive destruction of treated tumors. (authors). 6 refs

  15. Physical Impairment

    Science.gov (United States)

    Trewin, Shari

    Many health conditions can lead to physical impairments that impact computer and Web access. Musculoskeletal conditions such as arthritis and cumulative trauma disorders can make movement stiff and painful. Movement disorders such as tremor, Parkinsonism and dystonia affect the ability to control movement, or to prevent unwanted movements. Often, the same underlying health condition also has sensory or cognitive effects. People with dexterity impairments may use a standard keyboard and mouse, or any of a wide range of alternative input mechanisms. Examples are given of the diverse ways that specific dexterity impairments and input mechanisms affect the fundamental actions of Web browsing. As the Web becomes increasingly sophisticated, and physically demanding, new access features at the Web browser and page level will be necessary.

  16. Gene expression in IFN-g-activated murine macrophages

    Directory of Open Access Journals (Sweden)

    Pereira C.A.

    2004-01-01

    Full Text Available Macrophages are critical for natural immunity and play a central role in specific acquired immunity. The IFN-gamma activation of macrophages derived from A/J or BALB/c mice yielded two different patterns of antiviral state in murine hepatitis virus 3 infection, which were related to a down-regulation of the main virus receptor. Using cDNA hybridization to evaluate mRNA accumulation in the cells, we were able to identify several genes that are differently up- or down-regulated by IFN-gamma in A/J (267 and 266 genes, respectively, up- and down-regulated or BALB/c (297 and 58 genes, respectively, up- and down-regulated mouse macrophages. Macrophages from mice with different genetic backgrounds behave differently at the molecular level and comparison of the patterns of non-activated and IFN-gamma-activated A/J or BALB/c mouse macrophages revealed, for instance, an up-regulation and a down-regulation of genes coding for biological functions such as enzymatic reactions, nucleic acid synthesis and transport, protein synthesis, transport and metabolism, cytoskeleton arrangement and extracellular matrix, phagocytosis, resistance and susceptibility to infection and tumors, inflammation, and cell differentiation or activation. The present data are reported in order to facilitate future correlation of proteomic/transcriptomic findings as well as of results obtained from a classical approach for the understanding of biological phenomena. The possible implication of the role of some of the gene products relevant to macrophage biology can now be further scrutinized. In this respect, a down-regulation of the main murine hepatitis virus 3 receptor gene was detected only in IFN-gamma-activated macrophages of resistant mice.

  17. Cysteine protease antigens cleave CD123, the α subunit of murine IL-3 receptor, on basophils and suppress IL-3-mediated basophil expansion

    International Nuclear Information System (INIS)

    Nishikado, Hideto; Fujimura, Tsutomu; Taka, Hikari; Mineki, Reiko; Ogawa, Hideoki; Okumura, Ko; Takai, Toshiro

    2015-01-01

    Th2 type immune responses are essential for protective immunity against parasites and play crucial roles in allergic disorders. Helminth parasites secrete a variety of proteases for their infectious cycles including for host entry, tissue migration, and suppression of host immune effector cell function. Furthermore, a number of pathogen-derived antigens, as well as allergens such as papain, belong to the family of cysteine proteases. Although the link between protease activity and Th2 type immunity is well documented, the mechanisms by which proteases regulate host immune responses are largely unknown. Here, we demonstrate that the cysteine proteases papain and bromelain selectively cleave the α subunit of the IL-3 receptor (IL-3Rα/CD123) on the surface of murine basophils. The decrease in CD123 expression on the cell surface, and the degradation of the extracellular domain of recombinant CD123 were dependent on the protease activity of papain and bromelain. Pre-treatment of murine basophils with papain resulted in inhibition of IL-3-IL-3R signaling and suppressed IL-3- but not thymic stromal lymphopoietin-induced expansion of basophils in vitro. Our unexpected findings illuminate a novel mechanism for the regulation of basophil functions by protease antigens. Because IL-3 plays pivotal roles in the activation and proliferation of basophils and in protective immunity against helminth parasites, pathogen-derived proteases might contribute to the pathogenesis of infections by regulating IL-3-mediated functions in basophils. - Highlights: • We identified the murine IL3R as a novel target of papain-family cysteine proteases. • Papain-family cysteine proteases cleaved IL3Rα/CD123 on murine basophils. • Papain suppressed IL3- but not TSLP-induced expansion of murine basophils. • The inactivation of IL3R might be a strategy for pathogens to suppress host immunity

  18. Cysteine protease antigens cleave CD123, the α subunit of murine IL-3 receptor, on basophils and suppress IL-3-mediated basophil expansion

    Energy Technology Data Exchange (ETDEWEB)

    Nishikado, Hideto [Atopy (Allergy) Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan); Fujimura, Tsutomu; Taka, Hikari; Mineki, Reiko [Laboratory of Proteomics and Biomolecular Science, BioMedical Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan); Ogawa, Hideoki; Okumura, Ko [Atopy (Allergy) Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan); Takai, Toshiro, E-mail: t-takai@juntendo.ac.jp [Atopy (Allergy) Research Center, Juntendo University Graduate School of Medicine, Tokyo (Japan)

    2015-05-01

    Th2 type immune responses are essential for protective immunity against parasites and play crucial roles in allergic disorders. Helminth parasites secrete a variety of proteases for their infectious cycles including for host entry, tissue migration, and suppression of host immune effector cell function. Furthermore, a number of pathogen-derived antigens, as well as allergens such as papain, belong to the family of cysteine proteases. Although the link between protease activity and Th2 type immunity is well documented, the mechanisms by which proteases regulate host immune responses are largely unknown. Here, we demonstrate that the cysteine proteases papain and bromelain selectively cleave the α subunit of the IL-3 receptor (IL-3Rα/CD123) on the surface of murine basophils. The decrease in CD123 expression on the cell surface, and the degradation of the extracellular domain of recombinant CD123 were dependent on the protease activity of papain and bromelain. Pre-treatment of murine basophils with papain resulted in inhibition of IL-3-IL-3R signaling and suppressed IL-3- but not thymic stromal lymphopoietin-induced expansion of basophils in vitro. Our unexpected findings illuminate a novel mechanism for the regulation of basophil functions by protease antigens. Because IL-3 plays pivotal roles in the activation and proliferation of basophils and in protective immunity against helminth parasites, pathogen-derived proteases might contribute to the pathogenesis of infections by regulating IL-3-mediated functions in basophils. - Highlights: • We identified the murine IL3R as a novel target of papain-family cysteine proteases. • Papain-family cysteine proteases cleaved IL3Rα/CD123 on murine basophils. • Papain suppressed IL3- but not TSLP-induced expansion of murine basophils. • The inactivation of IL3R might be a strategy for pathogens to suppress host immunity.

  19. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  20. Immune System

    Science.gov (United States)

    ... of the Immune System Print en español El sistema inmunitario Whether you're stomping through the showers ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on TeensHealth® is for ...

  1. Immunizing Adults

    Centers for Disease Control (CDC) Podcasts

    Vaccines aren’t just for kids; adults also need to get immunized. Overall, far too many people 19 years and older aren’t getting the vaccines they need and remain unprotected. In this podcast, Dr. Walter Williams discuss the importance of adults being fully vaccinated.

  2. Innate immune memory: implications for development of pediatric immunomodulatory agents and adjuvanted vaccines

    NARCIS (Netherlands)

    Levy, O.; Netea, M.G.

    2014-01-01

    Unique features of immunity early in life include a distinct immune system particularly reliant on innate immunity, with weak T helper (Th)1-polarizing immune responses, and impaired responses to certain vaccines leading to a heightened susceptibility to infection. To these important aspects, we now

  3. Zinc and immunity: An essential interrelation.

    Science.gov (United States)

    Maares, Maria; Haase, Hajo

    2016-12-01

    The significance of the essential trace element zinc for immune function has been known for several decades. Zinc deficiency affects immune cells, resulting in altered host defense, increased risk of inflammation, and even death. The micronutrient zinc is important for maintenance and development of immune cells of both the innate and adaptive immune system. A disrupted zinc homeostasis affects these cells, leading to impaired formation, activation, and maturation of lymphocytes, disturbed intercellular communication via cytokines, and weakened innate host defense via phagocytosis and oxidative burst. This review outlines the connection between zinc and immunity by giving a survey on the major roles of zinc in immune cell function, and their potential consequences in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Vaccines (immunizations) - overview

    Science.gov (United States)

    Vaccinations; Immunizations; Immunize; Vaccine shots; Prevention - vaccine ... of the vaccine. VACCINE SCHEDULE The recommended vaccination (immunization) schedule is updated every 12 months by the ...

  5. Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.

    Directory of Open Access Journals (Sweden)

    Alejo Efeyan

    Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.

  6. Different Candida parapsilosis clinical isolates and lipase deficient strain trigger an altered cellular immune response

    Directory of Open Access Journals (Sweden)

    Renata eToth

    2015-10-01

    Full Text Available Numerous human diseases can be associated with fungal infections either as potential causative agents or as a result of changed immune status due to a primary disease. Fungal infections caused by Candida species can vary from mild to severe dependent upon the site of infection, length of exposure and past medical history. Patients with impaired immune status are at increased risk for chronic fungal infections. Recent epidemiologic studies have revealed the increasing incidence of candidiasis caused by non-albicans species such as C. parapsilosis. Due to its increasing relevance we chose two distinct C. parapsilosis strains, to describe the cellular innate immune response towards this species. In the first section of our study we compared the interaction of CLIB 214 and GA1 cells with murine and human macrophages. Both strains are commonly used to investigate C. parapsilosis virulence properties. CLIB 214 is a rapidly pseudohyphae-forming strain and GA1 is an isolate that mainly exists in a yeast form. Our results showed, that the phagocyte response was similar in terms of overall uptake, however differences were observed in macrophage migration and engulfment of fungal cells. As C. parapsilosis releases extracellular lipases in order to promote host invasion we further investigated the role of these secreted components during the distinct stages of the phagocytic process. Using a secreted lipase deficient mutant strain and the parental strain GA1 individually and simultaneously, we confirmed that fungal secreted lipases influence the fungi’s virulence by detecting altered innate cellular responses.In this study we report that two isolates of a single species can trigger markedly distinct host responses and that lipase secretion plays a role on the cellular level of host pathogen interactions.

  7. In vitro phenotypic, genomic and proteomic characterization of a cytokine-resistant murine β-TC3 cell line.

    Directory of Open Access Journals (Sweden)

    Antonina Coppola

    Full Text Available Type 1 diabetes mellitus (T1DM is caused by the selective destruction of insulin-producing β-cells. This process is mediated by cells of the immune system through release of nitric oxide, free radicals and pro-inflammatory cytokines, which induce a complex network of intracellular signalling cascades, eventually affecting the expression of genes involved in β-cell survival.The aim of our study was to investigate possible mechanisms of resistance to cytokine-induced β-cell death. To this purpose, we created a cytokine-resistant β-cell line (β-TC3R by chronically treating the β-TC3 murine insulinoma cell line with IL-1β + IFN-γ. β-TC3R cells exhibited higher proliferation rate and resistance to cytokine-mediated cell death in comparison to the parental line. Interestingly, they maintained expression of β-cell specific markers, such as PDX1, NKX6.1, GLUT2 and insulin. The analysis of the secretory function showed that β-TC3R cells have impaired glucose-induced c-peptide release, which however was only moderately reduced after incubation with KCl and tolbutamide. Gene expression analysis showed that β-TC3R cells were characterized by downregulation of IL-1β and IFN-γ receptors and upregulation of SOCS3, the classical negative regulator of cytokines signaling. Comparative proteomic analysis showed specific upregulation of 35 proteins, mainly involved in cell death, stress response and folding. Among them, SUMO4, a negative feedback regulator in NF-kB and JAK/STAT signaling pathways, resulted hyper-expressed. Silencing of SUMO4 was able to restore sensitivity to cytokine-induced cell death in β-TC3R cells, suggesting it may play a key role in acquired cytokine resistance by blocking JAK/STAT and NF-kB lethal signaling.In conclusion, our study represents the first extensive proteomic characterization of a murine cytokine-resistant β-cell line, which might represent a useful tool for studying the mechanisms involved in resistance to

  8. CMV immune evasion and manipulation of the immune system with aging.

    Science.gov (United States)

    Jackson, Sarah E; Redeker, Anke; Arens, Ramon; van Baarle, Debbie; van den Berg, Sara P H; Benedict, Chris A; Čičin-Šain, Luka; Hill, Ann B; Wills, Mark R

    2017-06-01

    Human cytomegalovirus (HCMV) encodes numerous proteins and microRNAs that function to evade the immune response and allow the virus to replicate and disseminate in the face of a competent innate and acquired immune system. The establishment of a latent infection by CMV, which if completely quiescent at the level of viral gene expression would represent an ultimate in immune evasion strategies, is not sufficient for lifelong persistence and dissemination of the virus. CMV needs to reactivate and replicate in a lytic cycle of infection in order to disseminate further, which occurs in the face of a fully primed secondary immune response. Without reactivation, latency itself would be redundant for the virus. It is also becoming clear that latency is not a totally quiescent state, but is characterized by limited viral gene expression. Therefore, the virus also needs immune evasion strategies during latency. An effective immune response to CMV is required or viral replication will cause morbidity and ultimately mortality in the host. There is clearly a complex balance between virus immune evasion and host immune recognition over a lifetime. This poses the important question of whether long-term evasion or manipulation of the immune response driven by CMV is detrimental to health. In this meeting report, three groups used the murine model of CMV (MCMV) to examine if the contribution of the virus to immune senescence is set by the (i) initial viral inoculum, (ii) inflation of T cell responses, (iii) or the balance between functionally distinct effector CD4+ T cells. The work of other groups studying the CMV response in humans is discussed. Their work asks whether the ability to make immune responses to new antigens is compromised by (i) age and HCMV carriage, (ii) long-term exposure to HCMV giving rise to an overall immunosuppressive environment and increased levels of latent virus, or (iii) adapted virus mutants (used as potential vaccines) that have the capacity to

  9. Adult Immunization

    Directory of Open Access Journals (Sweden)

    Omer Coskun

    2008-04-01

    Full Text Available Despite the many advances in modern medicine, each year thousands of people in the world die from diseases that are easily prevented by safe and effective vaccines. Few measures in preventive medicine are of such proven value and as easy to implement as routine immunization against infectious diseases. Prevention of infection by immunization is a lifelong process. There are a number of vaccines that all adults (¡I18 years require. There are also other vaccines that need to be tailored to meet individual variations in risk resulting from occupation, foreign travel, underlying illness, lifestyle and age. In this study, we tried to review this important subject. [TAF Prev Med Bull 2008; 7(2.000: 159-166

  10. Identification of murine T-cell epitopes in Ebola virus nucleoprotein

    International Nuclear Information System (INIS)

    Simmons, Graham; Lee, Anee; Rennekamp, Andrew J.; Fan Xin; Bates, Paul; Shen Hao

    2004-01-01

    CD8 T cells play an important role in controlling Ebola infection and in mediating vaccine-induced protective immunity, yet little is known about antigenic targets in Ebola that are recognized by CD8 T cells. Overlapping peptides were used to identify major histocompatibility complex class I-restricted epitopes in mice immunized with vectors encoding Ebola nucleoprotein (NP). CD8 T-cell responses were mapped to a H-2 d -restricted epitope (NP279-288) and two H-2 b -restricted epitopes (NP44-52 and NP288-296). The identification of these epitopes will facilitate studies of immune correlates of protection and the evaluation of vaccine strategies in murine models of Ebola infection

  11. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2011-11-11

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.

  12. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    International Nuclear Information System (INIS)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses

  13. Tofacitinib Ameliorates Murine Lupus and Its Associated Vascular Dysfunction.

    Science.gov (United States)

    Furumoto, Yasuko; Smith, Carolyne K; Blanco, Luz; Zhao, Wenpu; Brooks, Stephen R; Thacker, Seth G; Abdalrahman, Zarzour; Sciumè, Giuseppe; Tsai, Wanxia L; Trier, Anna M; Nunez, Leti; Mast, Laurel; Hoffmann, Victoria; Remaley, Alan T; O'Shea, John J; Kaplan, Mariana J; Gadina, Massimo

    2017-01-01

    Dysregulation of innate and adaptive immune responses contributes to the pathogenesis of systemic lupus erythematosus (SLE) and its associated premature vascular damage. No drug to date targets both systemic inflammatory disease and the cardiovascular complications of SLE. Tofacitinib is a JAK inhibitor that blocks signaling downstream of multiple cytokines implicated in lupus pathogenesis. While clinical trials have shown that tofacitinib exhibits significant clinical efficacy in various autoimmune diseases, its role in SLE and the associated vascular pathology remains to be characterized. MRL/lpr lupus-prone mice were administered tofacitinib or vehicle by gavage for 6 weeks (therapeutic arm) or 8 weeks (preventive arm). Nephritis, skin inflammation, serum levels of autoantibodies and cytokines, mononuclear cell phenotype and gene expression, neutrophil extracellular traps (NETs) release, endothelium-dependent vasorelaxation, and endothelial differentiation were compared in treated and untreated mice. Treatment with tofacitinib led to significant improvement in measures of disease activity, including nephritis, skin inflammation, and autoantibody production. In addition, tofacitinib treatment reduced serum levels of proinflammatory cytokines and interferon responses in splenocytes and kidney tissue. Tofacitinib also modulated the formation of NETs and significantly increased endothelium-dependent vasorelaxation and endothelial differentiation. The drug was effective in both preventive and therapeutic strategies. Tofacitinib modulates the innate and adaptive immune responses, ameliorates murine lupus, and improves vascular function. These results indicate that JAK inhibitors have the potential to be beneficial in SLE and its associated vascular damage. © 2016, American College of Rheumatology.

  14. Purification and characterization of recombinant full-length and protease domain of murine MMP-9 expressed in Drosophila S2 cells

    DEFF Research Database (Denmark)

    Rasch, Morten G; Lund, Ida K.; Illemann, Martin

    2010-01-01

    -length and truncated versions were 5 mg/l and 2 mg/l, respectively. The products were >95% pure after gelatin Sepharose chromatography and possessed proteolytic activity when analyzed by gelatin zymography. Using the purified full-length murine MMP-9 we raised polyclonal antibodies by immunizations of rabbits...

  15. Immunizations for Preterm Babies

    Science.gov (United States)

    ... Issues Health Issues Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases ... Children > Safety & Prevention > Immunizations > Immunizations For Preterm Babies Safety & ...

  16. Weakened Immune Systems

    Science.gov (United States)

    ... Issues Health Issues Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases ... Children > Safety & Prevention > Immunizations > Weakened Immune Systems Safety & Prevention ...

  17. Immunizations: Active vs. Passive

    Science.gov (United States)

    ... Issues Health Issues Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases ... Children > Safety & Prevention > Immunizations > Immunizations: Active vs. Passive Safety & ...

  18. EcoHIV infection of mice establishes latent viral reservoirs in T cells and active viral reservoirs in macrophages that are sufficient for induction of neurocognitive impairment.

    Science.gov (United States)

    Gu, Chao-Jiang; Borjabad, Alejandra; Hadas, Eran; Kelschenbach, Jennifer; Kim, Boe-Hyun; Chao, Wei; Arancio, Ottavio; Suh, Jin; Polsky, Bruce; McMillan, JoEllyn; Edagwa, Benson; Gendelman, Howard E; Potash, Mary Jane; Volsky, David J

    2018-06-01

    Suppression of HIV replication by antiretroviral therapy (ART) or host immunity can prevent AIDS but not other HIV-associated conditions including neurocognitive impairment (HIV-NCI). Pathogenesis in HIV-suppressed individuals has been attributed to reservoirs of latent-inducible virus in resting CD4+ T cells. Macrophages are persistently infected with HIV but their role as HIV reservoirs in vivo has not been fully explored. Here we show that infection of conventional mice with chimeric HIV, EcoHIV, reproduces physiological conditions for development of disease in people on ART including immunocompetence, stable suppression of HIV replication, persistence of integrated, replication-competent HIV in T cells and macrophages, and manifestation of learning and memory deficits in behavioral tests, termed here murine HIV-NCI. EcoHIV established latent reservoirs in CD4+ T lymphocytes in chronically-infected mice but could be induced by epigenetic modulators ex vivo and in mice. In contrast, macrophages expressed EcoHIV constitutively in mice for up to 16 months; murine leukemia virus (MLV), the donor of gp80 envelope in EcoHIV, did not infect macrophages. Both EcoHIV and MLV were found in brain tissue of infected mice but only EcoHIV induced NCI. Murine HIV-NCI was prevented by antiretroviral prophylaxis but once established neither persistent EcoHIV infection in mice nor NCI could be reversed by long-acting antiretroviral therapy. EcoHIV-infected, athymic mice were more permissive to virus replication in macrophages than were wild-type mice, suffered cognitive dysfunction, as well as increased numbers of monocytes and macrophages infiltrating the brain. Our results suggest an important role of HIV expressing macrophages in HIV neuropathogenesis in hosts with suppressed HIV replication.

  19. Assessment of carbon nanoparticle exposure on murine macrophage function

    Science.gov (United States)

    Suro-Maldonado, Raquel M.

    There is growing concern about the potential cytotoxicity of nanoparticles. Exposure to respirable ultrafine particles (2.5uM) can adversely affect human health and have been implicated with episodes of increased respiratory diseases such as asthma and allergies. Nanoparticles are of particular interest because of their ability to penetrate into the lung and potentially elicit health effects triggering immune responses. Nanoparticles are structures and devises with length scales in the 1 to 100-nanometer range. Black carbon (BC) nanoparticles have been observed to be products of combustion, especially flame combustion and multi-walled carbon nanotubes (MWCNT) have been shown to be found in both indoor and outdoor air. Furthermore, asbestos, which have been known to cause mesothelioma as well as lung cancer, have been shown to be structurally identical to MWCNTs. The aims of these studies were to examine the effects of carbon nanoparticles on murine macrophage function and clearance mechanisms. Macrophages are immune cells that function as the first line of defense against invading pathogens and are likely to be amongst the first cells affected by nanoparticles. Our research focused on two manufactured nanoparticles, MWCNT and BC. The two were tested against murine-derived macrophages in a chronic contact model. We hypothesized that long-term chronic exposure to carbon nanoparticles would decrease macrophages ability to effectively respond to immunological challenge. Production of nitric oxide (NO), tumor necrosis factor alpha (TNF-alpha), cell surface macrophage; activation markers, reactive oxygen species formation (ROS), and antigen processing and presentation were examined in response to lipopolysaccharide (LPS) following a 144hr exposure to the particulates. Data demonstrated an increase in TNF-alpha, and NO production; a decrease in phagocytosis and antigen processing and presentation; and a decrease in the expression levels of cell surface macrophage

  20. Immunogenic multistage recombinant protein vaccine confers partial protection against experimental toxoplasmosis mimicking natural infection in murine model

    Directory of Open Access Journals (Sweden)

    Yaprak Gedik

    2016-01-01

    To generate a protective vaccine against toxoplasmosis, multistage vaccines and usage of challenging models mimicking natural route of infection are critical cornerstones. In this study, we generated a BAG1 and GRA1 multistage vaccine that induced strong immune response in which the protection was not at anticipated level. In addition, the murine model was orally challenged with tissue cysts to mimic natural route of infection.

  1. Cyanotoxins at low doses induce apoptosis and inflammatory effects in murine brain cells: Potential implications for neurodegenerative diseases

    OpenAIRE

    Takser, Larissa; Benachour, Nora; Husk, Barry; Cabana, Hubert; Gris, Denis

    2016-01-01

    Cyanotoxins have been shown to be highly toxic for mammalian cells, including brain cells. However, little is known about their effect on inflammatory pathways. This study investigated whether mammalian brain and immune cells can be a target of certain cyanotoxins, at doses approximating those in the guideline levels for drinking water, either alone or in mixtures. We examined the effects on cellular viability, apoptosis and inflammation signalling of several toxins on murine macrophage-like ...

  2. Maximizing Tumor Immunity With Fractionated Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Schaue, Doerthe, E-mail: dschaue@mednet.ucla.edu [Department of Radiation Oncology, David Geffen School of Medicine at UCLA, Los Angeles, CA (United States); Ratikan, Josephine A.; Iwamoto, Keisuke S.; McBride, William H. [Department of Radiation Oncology, David Geffen School of Medicine at UCLA, Los Angeles, CA (United States)

    2012-07-15

    Purpose: Technologic advances have led to increased clinical use of higher-sized fractions of radiation dose and higher total doses. How these modify the pathways involved in tumor cell death, normal tissue response, and signaling to the immune system has been inadequately explored. Here we ask how radiation dose and fraction size affect antitumor immunity, the suppression thereof, and how this might relate to tumor control. Methods and Materials: Mice bearing B16-OVA murine melanoma were treated with up to 15 Gy radiation given in various-size fractions, and tumor growth followed. The tumor-specific immune response in the spleen was assessed by interferon-{gamma} enzyme-linked immunospot (ELISPOT) assay with ovalbumin (OVA) as the surrogate tumor antigen and the contribution of regulatory T cells (Tregs) determined by the proportion of CD4{sup +}CD25{sup hi}Foxp3{sup +} T cells. Results: After single doses, tumor control increased with the size of radiation dose, as did the number of tumor-reactive T cells. This was offset at the highest dose by an increase in Treg representation. Fractionated treatment with medium-size radiation doses of 7.5 Gy/fraction gave the best tumor control and tumor immunity while maintaining low Treg numbers. Conclusions: Radiation can be an immune adjuvant, but the response varies with the size of dose per fraction. The ultimate challenge is to optimally integrate cancer immunotherapy into radiation therapy.

  3. Maximizing Tumor Immunity With Fractionated Radiation

    International Nuclear Information System (INIS)

    Schaue, Dörthe; Ratikan, Josephine A.; Iwamoto, Keisuke S.; McBride, William H.

    2012-01-01

    Purpose: Technologic advances have led to increased clinical use of higher-sized fractions of radiation dose and higher total doses. How these modify the pathways involved in tumor cell death, normal tissue response, and signaling to the immune system has been inadequately explored. Here we ask how radiation dose and fraction size affect antitumor immunity, the suppression thereof, and how this might relate to tumor control. Methods and Materials: Mice bearing B16-OVA murine melanoma were treated with up to 15 Gy radiation given in various-size fractions, and tumor growth followed. The tumor-specific immune response in the spleen was assessed by interferon-γ enzyme-linked immunospot (ELISPOT) assay with ovalbumin (OVA) as the surrogate tumor antigen and the contribution of regulatory T cells (Tregs) determined by the proportion of CD4 + CD25 hi Foxp3 + T cells. Results: After single doses, tumor control increased with the size of radiation dose, as did the number of tumor-reactive T cells. This was offset at the highest dose by an increase in Treg representation. Fractionated treatment with medium-size radiation doses of 7.5 Gy/fraction gave the best tumor control and tumor immunity while maintaining low Treg numbers. Conclusions: Radiation can be an immune adjuvant, but the response varies with the size of dose per fraction. The ultimate challenge is to optimally integrate cancer immunotherapy into radiation therapy.

  4. Newly Characterized Murine Undifferentiated Sarcoma Models Sensitive to Virotherapy with Oncolytic HSV-1 M002

    Directory of Open Access Journals (Sweden)

    Eric K. Ring

    2017-12-01

    Full Text Available Despite advances in conventional chemotherapy, surgical techniques, and radiation, outcomes for patients with relapsed, refractory, or metastatic soft tissue sarcomas are dismal. Survivors often suffer from lasting morbidity from current treatments. New targeted therapies with less toxicity, such as those that harness the immune system, and immunocompetent murine sarcoma models to test these therapies are greatly needed. We characterized two new serendipitous murine models of undifferentiated sarcoma (SARC-28 and SARC-45 and tested their sensitivity to virotherapy with oncolytic herpes simplex virus 1 (HSV-1. Both models expressed high levels of the primary HSV entry molecule nectin-1 (CD111 and were susceptible to killing by interleukin-12 (IL-12 producing HSV-1 M002 in vitro and in vivo. M002 resulted in a significant intratumoral increase in effector CD4+ and CD8+ T cells and activated monocytes, and a decrease in myeloid-derived suppressor cells (MDSCs in immunocompetent mice. Compared to parent virus R3659 (no IL-12 production, M002 resulted in higher CD8:MDSC and CD8:T regulatory cell (Treg ratios, suggesting that M002 creates a more favorable immune tumor microenvironment. These data provide support for clinical trials targeting sarcomas with oncolytic HSV-1. These models provide an exciting opportunity to explore combination therapies for soft tissue sarcomas that rely on an intact immune system to reach full therapeutic potential.

  5. Immunotoxicity and allergic potential induced by topical application of dimethyl carbonate (DMC) in a murine model

    Science.gov (United States)

    Anderson, Stacey E.; Franko, Jennifer; Anderson, Katie L.; Munson, Albert E.; Lukomska, Ewa; Meade, B. Jean

    2015-01-01

    Dimethyl carbonate (DMC) is an industrial chemical, used as a paint and adhesive solvent, with the potential for significant increases in production. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of DMC following dermal exposure using a murine model. Following a 28-day exposure, DMC produced a significant decrease in thymus weight at concentrations of 75% and greater. No effects on body weight, hematological parameters (erythrocytes, leukocytes, and their differentials), or immune cell phenotyping (B-cells, T-cells, and T-cell sub-sets) were identified. The IgM antibody response to sheep red blood cell (SRBC) was significantly reduced in the spleen but not the serum. DMC was not identified to be an irritant and evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50–100%, did not identify increases in lymphocyte proliferation. These results demonstrate that dermal exposure to DMC induces immune suppression in a murine model and raise concern about potential human exposure and the need for occupational exposure regulations. PMID:22953780

  6. Nanoliposomal artemisinin for the treatment of murine visceral leishmaniasis

    Directory of Open Access Journals (Sweden)

    Want MY

    2017-03-01

    Full Text Available Muzamil Y Want,1 Mohammad Islammudin,1 Garima Chouhan,1 Hani A Ozbak,2 Hassan A Hemeg,2 Asoke P Chattopadhyay,3 Farhat Afrin2 1Parasite Immunology Laboratory, Department of Biotechnology, Jamia Hamdard, Hamdard University, New Delhi, India; 2Department of Clinical Laboratory Sciences, Faculty of Applied Medical Sciences, Taibah University, Medina, Saudi Arabia; 3Department of Chemistry, University of Kalyani, Kalyani, India Abstract: Visceral leishmaniasis (VL is a fatal, vector-borne disease caused by the intracellular protozoa of the genus Leishmania. Most of the therapeutics for VL are toxic, expensive, or ineffective. Sesquiterpenes are a new class of drugs with proven antimicrobial and antiviral activities. Artemisinin is a sesquiterpene lactone with potent antileishmanial activity, but with limited access to infected cells, being a highly lipophilic molecule. Association of artemisinin with liposome is a desirable strategy to circumvent the problem of poor accessibility, thereby improving its efficacy, as demonstrated in a murine model of experimental VL. Nanoliposomal artemisinin (NLA was prepared by thin-film hydration method and optimized using Box–Behnken design with a mean particle diameter of 83±16 nm, polydispersity index of 0.2±0.03, zeta potential of -27.4±5.7 mV, and drug loading of 33.2%±2.1%. Morphological study of these nanoliposomes by microscopy showed a smooth and spherical surface. The mechanism of release of artemisinin from the liposomes followed the Higuchi model in vitro. NLA was free from concomitant signs of toxicity, both ex vivo in murine macrophages and in vivo in healthy BALB/c mice. NLA significantly denigrated the intracellular infection of Leishmania donovani amastigotes and the number of infected macrophages ex vivo with an IC50 of 6.0±1.4 µg/mL and 5.1±0.9 µg/mL, respectively. Following treatment in a murine model of VL, NLA demonstrated superior efficacy compared to artemisinin with a

  7. Selective silencing of full-length CD80 but not IgV-CD80 leads to impaired clonal deletion of self-reactive T cells and altered regulation of immune responses.

    Science.gov (United States)

    Bugeon, L; Hargreaves, R E; Crompton, T; Outram, S; Rahemtulla, A; Porter, A C; Dallman, M J

    2001-01-01

    Co-stimulation provided by the B7 family of proteins underpins the development of protective immunity. There are three identified members of this family: CD80, its splice variant IgV-CD80 and CD86. It has hitherto been difficult to analyze the expression and function of IgV-CD80 since there are no appropriate reagents capable of distinguishing it from CD80. We have generated mice, by gene targeting, the lack CD80 whilst maintaining expression of IgV-CD80. Mutant animals did not delete T cells bearing mammary tumor virus-reactive TCR as efficiently as wild-type animals. We also demonstrate the importance of IgV-CD80 in the responses of recently activated cells and reveal a role for CD80 in sustaining T cell responses. CD86, whilst critical to primary T cell activation, made only a minor contribution to re-activation of normal cells.

  8. Integrated Circuit Immunity

    Science.gov (United States)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  9. Murine polyomavirus virus-like particles carrying full-length human PSA protect BALB/c mice from outgrowth of a PSA expressing tumor.

    Directory of Open Access Journals (Sweden)

    Mathilda Eriksson

    Full Text Available Virus-like particles (VLPs consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV VLPs carrying the entire human Prostate Specific Antigen (PSA (PSA-MPyVLPs for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs. Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4(+ and CD8(+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4(+ and CD8(+ cells with a low induction of anti-VLP antibodies.

  10. Murine Polyomavirus Virus-Like Particles Carrying Full-Length Human PSA Protect BALB/c Mice from Outgrowth of a PSA Expressing Tumor

    Science.gov (United States)

    Eriksson, Mathilda; Andreasson, Kalle; Weidmann, Joachim; Lundberg, Kajsa; Tegerstedt, Karin

    2011-01-01

    Virus-like particles (VLPs) consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV) VLPs carrying the entire human Prostate Specific Antigen (PSA) (PSA-MPyVLPs) for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs). Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4+ and CD8+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4+ and CD8+ cells with a low induction of anti-VLP antibodies. PMID:21858228

  11. Bifidobacterium bifidum Actively Changes the Gene Expression Profile Induced by Lactobacillus acidophilus in Murine Dendritic Cells

    DEFF Research Database (Denmark)

    Weiss, Gudrun Margarethe; Rasmussen, Simon; Fink, Lisbeth Nielsen

    2010-01-01

    Dendritic cells (DC) play a pivotal regulatory role in activation of both the innate as well as the adaptive immune system by responding to environmental microorganisms. We have previously shown that Lactobacillus acidophilus induces a strong production of the pro-inflammatory and Th1 polarizing...... cytokine IL-12 in DC, whereas bifidobacteria do not induce IL-12 but inhibit the IL-12 production induced by lactobacilli. In the present study, genome-wide microarrays were used to investigate the gene expression pattern of murine DC stimulated with Lactobacillus acidophilus NCFM and Bifidobacterium...

  12. Exposure to electronic cigarettes impairs pulmonary anti-bacterial and anti-viral defenses in a mouse model.

    Directory of Open Access Journals (Sweden)

    Thomas E Sussan

    Full Text Available Electronic cigarettes (E-cigs have experienced sharp increases in popularity over the past five years due to many factors, including aggressive marketing, increased restrictions on conventional cigarettes, and a perception that E-cigs are healthy alternatives to cigarettes. Despite this perception, studies on health effects in humans are extremely limited and in vivo animal models have not been generated. Presently, we determined that E-cig vapor contains 7 x 10(11 free radicals per puff. To determine whether E-cig exposure impacts pulmonary responses in mice, we developed an inhalation chamber for E-cig exposure. Mice that were exposed to E-cig vapor contained serum cotinine concentrations that are comparable to human E-cig users. E-cig exposure for 2 weeks produced a significant increase in oxidative stress and moderate macrophage-mediated inflammation. Since, COPD patients are susceptible to bacterial and viral infections, we tested effects of E-cigs on immune response. Mice that were exposed to E-cig vapor showed significantly impaired pulmonary bacterial clearance, compared to air-exposed mice, following an intranasal infection with Streptococcus pneumonia. This defective bacterial clearance was partially due to reduced phagocytosis by alveolar macrophages from E-cig exposed mice. In response to Influenza A virus infection, E-cig exposed mice displayed increased lung viral titers and enhanced virus-induced illness and mortality. In summary, this study reports a murine model of E-cig exposure and demonstrates that E-cig exposure elicits impaired pulmonary anti-microbial defenses. Hence, E-cig exposure as an alternative to cigarette smoking must be rigorously tested in users for their effects on immune response and susceptibility to bacterial and viral infections.

  13. Immune response to uv-induced tumors: transplantation immunity and lymphocyte populations exhibiting anti-tumor activity

    International Nuclear Information System (INIS)

    Streeter, P.R.

    1985-01-01

    Ultraviolet light-induced murine skin tumors were analyzed for their ability to induce tumor-specific and cross-protective transplantation immunity in immunocompetent syngeneic mice. These studies revealed that progressor UV-tumors, like regressor UV-tumors, possess tumor-specific transplantation antigens. Cross-protective transplantation immunity to UV-tumors, however, was associated with sensitization to the serum used to culture the tumor lines rather than to cross-reactive or common determinants on UV-tumors. An analysis of the cytolytic activity of lymphocytes from the spleens of mice immunized with either regressor or progressor UV-tumors revealed a striking difference between the two immune splenocyte populations. From regressor tumor-immune animals, cytolytic T (Tc) lymphocytes with specificity for the immunizing tumor were found. However, the analysis of splenic lymphocytes from progressor tumor immune animals revealed no such effector cells. To more effectively examine those lymphocytes exhibiting cytolytic activity in vitro, T lymphocyte cloning technology was used as a means of isolating homogeneous lymphocyte populations with the effector activities described above. The mechanisms where NK cells and other nonspecific effector cells could be induced in tumor-immune animals are discussed in the context of class II restricted immune responses

  14. CLINICAL IMMUNE RESTORATION IN THE CONTEXT OF HAART

    African Journals Online (AJOL)

    Enrique

    immune system is related to the kinetics of viral replication. In most cases increased ... The restoration of an impaired immune system is assessed by clinical parameters, immunological changes which can be measured in the ..... Levy JA, Mackeviez CE, Barker E. Controlling HIV pathogenesis: the role of the noncytotoxic ...

  15. Immune restoration in the context of HAART | Martin | Southern ...

    African Journals Online (AJOL)

    HAART induces a sustained effective suppression of HIV replication in most patients and leads to a preservation or restoration of immune function. The restoration of an impaired immune system is assessed by clinical parameters, immunological changes which can be measured in the laboratory and a marked reduction in ...

  16. Low-level radiation effects on immune cells

    International Nuclear Information System (INIS)

    Makinodan, T.

    1995-01-01

    The purpose of this study was to characterize the effects of chronic low-dose ionizing radiation (LDR) on murine immune cells. Previously, it had been reported that LDR enhances the proliferative activity of T cells in vitro and delays the growth of transplantable immunogenic tumors in vivo. This suggests that LDR eliminates immune suppressor cells, which downregulates immune response and/or adoptively upregulates the responsiveness of immune effector cells. It had also been reported that human lymphocytes become refractive to high dose radiation-induced chromosomal aberrations by pretreating mitotically active lymphocytes in vitro with very low doses of ionizing radiation, and the adaptive effect can be abrogated by cycloheximide. This suggests that protein synthesis is required for lymphocytes to respond adoptively to LDR

  17. Reemergence of Murine Typhus in the US

    Centers for Disease Control (CDC) Podcasts

    2015-04-21

    Dr. Lucas Blanton discusses the Reemergence of Murine Typhus in Galveston Texas in 2013.  Created: 4/21/2015 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 4/27/2015.

  18. Forced recombination of psi-modified murine leukaemia virus-based vectors with murine leukaemia-like and VL30 murine endogenous retroviruses

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Duch, M

    1999-01-01

    Co-encapsidation of retroviral RNAs into virus particles allows for the generation of recombinant proviruses through events of template switching during reverse transcription. By use of a forced recombination system based on recombinational rescue of replication- defective primer binding site-imp....... We note that recombination-based rescue of primer binding site knock-out retroviral vectors may constitute a sensitive assay to register putative genetic interactions involving endogenous retroviral RNAs present in cells of various species.......-impaired Akv-MLV-derived vectors, we here examine putative genetic interactions between vector RNAs and copackaged endogenous retroviral RNAs of the murine leukaemia virus (MLV) and VL30 retroelement families. We show (i) that MLV recombination is not blocked by nonhomology within the 5' untranslated region...... harbouring the supposed RNA dimer-forming cis -elements and (ii) that copackaged retroviral RNAs can recombine despite pronounced sequence dissimilarity at the cross-over site(s) and within parts of the genome involved in RNA dimerization, encapsidation and strand transferring during reverse transcription...

  19. Pathogenesis of Candida albicans infections in the alternative chorio-allantoic membrane chicken embryo model resembles systemic murine infections.

    Directory of Open Access Journals (Sweden)

    Ilse D Jacobsen

    Full Text Available Alternative models of microbial infections are increasingly used to screen virulence determinants of pathogens. In this study, we investigated the pathogenesis of Candida albicans and C. glabrata infections in chicken embryos infected via the chorio-allantoic membrane (CAM and analyzed the virulence of deletion mutants. The developing immune system of the host significantly influenced susceptibility: With increasing age, embryos became more resistant and mounted a more balanced immune response, characterized by lower induction of proinflammatory cytokines and increased transcription of regulatory cytokines, suggesting that immunopathology contributes to pathogenesis. While many aspects of the chicken embryo response resembled murine infections, we also observed significant differences: In contrast to systemic infections in mice, IL-10 had a beneficial effect in chicken embryos. IL-22 and IL-17A were only upregulated after the peak mortality in the chicken embryo model occurred; thus, the role of the Th17 response in this model remains unclear. Abscess formation occurs frequently in murine models, whereas the avian response was dominated by granuloma formation. Pathogenicity of the majority of 15 tested C. albicans deletion strains was comparable to the virulence in mouse models and reduced virulence was associated with significantly lower transcription of proinflammatory cytokines. However, fungal burden did not correlate with virulence and for few mutants like bcr1Δ and tec1Δ different outcomes in survival compared to murine infections were observed. C. albicans strains locked in the yeast stage disseminated significantly more often from the CAM into the embryo, supporting the hypothesis that the yeast morphology is responsible for dissemination in systemic infections. These data suggest that the pathogenesis of C. albicans infections in the chicken embryo model resembles systemic murine infections but also differs in some aspects. Despite

  20. Diabetes mellitus and impairment of intestinal barier function

    OpenAIRE

    Hoffmanová, Iva

    2015-01-01

    Introduction: Impairment of intestinal barrier function is involved in pathogenesis of immune mediated diseases (such as type 1 diabetes mellitus or celiac disease) and metabolic diseases (such as type 2 diabetes mellitus). Aims of study: The first aim was to analyze impairment of mucosal part of intestinal barrier in both type of diabetes and to describe differences when compared to celiac disease, which is a typical condition associated with impairment of intestinal barrier function. The se...

  1. 1.8 Å structure of murine GITR ligand dimer expressed in Drosophila melanogaster S2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Kausik [Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Ramagopal, Udupi A. [Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Nathenson, Stanley G., E-mail: nathenso@aecom.yu.edu [Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Cell Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Almo, Steven C., E-mail: nathenso@aecom.yu.edu [Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States)

    2009-05-01

    1.8 Å X-ray crystal structure of mouse GITRL expressed in D. melanogaster S2 cells shows an identical ‘strand-exchanged’ dimeric assembly similar to that observed previously for the E. coli-expressed protein. Glucocorticoid-induced TNF receptor ligand (GITRL), a prominent member of the TNF superfamily, activates its receptor on both effector and regulatory T cells to generate critical costimulatory signals that have been implicated in a wide range of T-cell immune functions. The crystal structures of murine and human orthologs of GITRL recombinantly expressed in Escherichia coli have previously been determined. In contrast to all classical TNF structures, including the human GITRL structure, murine GITRL demonstrated a unique ‘strand-exchanged’ dimeric organization. Such a novel assembly behavior indicated a dramatic impact on receptor activation as well as on the signaling mechanism associated with the murine GITRL costimulatory system. In this present work, the 1.8 Å resolution crystal structure of murine GITRL expressed in Drosophila melanogaster S2 cells is reported. The eukaryotic protein-expression system allows transport of the recombinant protein into the extracellular culture medium, thus maximizing the possibility of obtaining correctly folded material devoid of any folding/assembly artifacts that are often suspected with E. coli-expressed proteins. The S2 cell-expressed murine GITRL adopts an identical ‘strand-exchanged’ dimeric structure to that observed for the E. coli-expressed protein, thus conclusively demonstrating the novel quaternary structure assembly behavior of murine GITRL.

  2. Antigen-specific murine T cell clones produce soluble interleukin 2 receptor on stimulation with specific antigens

    International Nuclear Information System (INIS)

    Wagner, D.K.; York-Jolley, J.; Malek, T.R.; Berzofsky, J.A.; Nelson, D.L.

    1986-01-01

    In this study, monoclonal antibodies were used to the murine IL 2 receptor (IL 2R) termed 3C7 and 7D4, which bind to different epitopes on the murine IL 2R, to develop an ELISA to measure soluble murine IL 2R. Surprisingly, stimulated murine spleen cells not only expressed cell-associated IL 2R, but also produced a considerable level of cellfree IL 2R in the culture supernatant fluid. To assess the fine specificity of this response, myoglobin-immune murine T cell clones were stimulated with appropriate or inappropriate antigen and syngeneic or allogeneic presenting cells. Proliferation, measured by [ 3 H] thymidine incorporation, and levels of soluble IL 2R were determined at day 4. The production of soluble IL2R displayed the same epitope fine specificity, genetic restriction, and antigen dose-response as the proliferative response. Indeed, in some cases there was sharper discrimination of epitope specificity and genetic restriction with the soluble IL 2R levels. There was also reproducible clone-to-clone variation in the amount of soluble receptor produced in response to antigen among 12 T cell clones and lines tested. In time course experiments, proliferation was greatest at day 3, whereas soluble IL 2R levels continued to rise in subsequent days. To the authors' knowledge, this is the first demonstration of release of secretion of soluble IL 2R by murine T cells, and the first demonstration of the fine specificity and genetic restriction of the induction of soluble IL 2R by specific antigen

  3. 1.8 Å structure of murine GITR ligand dimer expressed in Drosophila melanogaster S2 cells

    International Nuclear Information System (INIS)

    Chattopadhyay, Kausik; Ramagopal, Udupi A.; Nathenson, Stanley G.; Almo, Steven C.

    2009-01-01

    1.8 Å X-ray crystal structure of mouse GITRL expressed in D. melanogaster S2 cells shows an identical ‘strand-exchanged’ dimeric assembly similar to that observed previously for the E. coli-expressed protein. Glucocorticoid-induced TNF receptor ligand (GITRL), a prominent member of the TNF superfamily, activates its receptor on both effector and regulatory T cells to generate critical costimulatory signals that have been implicated in a wide range of T-cell immune functions. The crystal structures of murine and human orthologs of GITRL recombinantly expressed in Escherichia coli have previously been determined. In contrast to all classical TNF structures, including the human GITRL structure, murine GITRL demonstrated a unique ‘strand-exchanged’ dimeric organization. Such a novel assembly behavior indicated a dramatic impact on receptor activation as well as on the signaling mechanism associated with the murine GITRL costimulatory system. In this present work, the 1.8 Å resolution crystal structure of murine GITRL expressed in Drosophila melanogaster S2 cells is reported. The eukaryotic protein-expression system allows transport of the recombinant protein into the extracellular culture medium, thus maximizing the possibility of obtaining correctly folded material devoid of any folding/assembly artifacts that are often suspected with E. coli-expressed proteins. The S2 cell-expressed murine GITRL adopts an identical ‘strand-exchanged’ dimeric structure to that observed for the E. coli-expressed protein, thus conclusively demonstrating the novel quaternary structure assembly behavior of murine GITRL

  4. Infection and cellular defense dynamics in a novel 17β-estradiol murine model of chronic human group B streptococcus genital tract colonization reveal a role for hemolysin in persistence and neutrophil accumulation.

    Science.gov (United States)

    Carey, Alison J; Tan, Chee Keong; Mirza, Shaper; Irving-Rodgers, Helen; Webb, Richard I; Lam, Alfred; Ulett, Glen C

    2014-02-15

    Genital tract carriage of group B streptococcus (GBS) is prevalent among adult women; however, the dynamics of chronic GBS genital tract carriage, including how GBS persists in this immunologically active host niche long term, are not well defined. To our knowledge, in this study, we report the first animal model of chronic GBS genital tract colonization using female mice synchronized into estrus by delivery of 17β-estradiol prior to intravaginal challenge with wild-type GBS 874391. Cervicovaginal swabs, which were used to measure bacterial persistence, showed that GBS colonized the vaginal mucosa of mice at high numbers (10(6)-10(7) CFU/swab) for at least 90 d. Cellular and histological analyses showed that chronic GBS colonization of the murine genital tract caused significant lymphocyte and PMN cell infiltrates, which were localized to the vaginal mucosal surface. Long-term colonization was independent of regular hormone cycling. Immunological analyses of 23 soluble proteins related to chemotaxis and inflammation showed that the host response to GBS in the genital tract comprised markers of innate immune activation including cytokines such as GM-CSF and TNF-α. A nonhemolytic isogenic mutant of GBS 874391, Δcyle9, was impaired for colonization and was associated with amplified local PMN responses. Induction of DNA neutrophil extracellular traps, which was observed in GBS-infected human PMNs in vitro in a hemolysin-dependent manner, appeared to be part of this response. Overall, this study defines key infection dynamics in a novel murine model of chronic GBS genital tract colonization and establishes previously unknown cellular and soluble defense responses to GBS in the female genital tract.

  5. Impaired sleep and allostatic load

    DEFF Research Database (Denmark)

    Clark, Alice Jessie; Dich, Nadya; Lange, Theis

    2014-01-01

    Objective: Understanding the mechanisms linking sleep impairment to morbidity and mortality is important for future prevention, but these mechanisms are far from elucidated. We aimed to determine the relation between impaired sleep, both in terms of duration and disturbed sleep, and allostatic load...... Biobank with comprehensive information on sleep duration, disturbed sleep, objective measures of an extensive range of biological risk markers, and physical conditions. Results: Long sleep (mean difference 0.23; 95% confidence interval, 0.13, 0.32) and disturbed sleep (0.14; 0.06, 0.22) were associated...... with higher AL as well as with high-risk levels of risk markers from the anthropometric, metabolic, and immune system. Sub-analyses suggested that the association between disturbed sleep and AL might be explained by underlying disorders. Whereas there was no association between short sleep and AL...

  6. Establishment of a method of murine obestatin RIA and its primary application

    International Nuclear Information System (INIS)

    Yan Guangtao Lin Ji; Hao Xiuhua; Xue Hui; Den Zihui; Di Dongdong

    2009-01-01

    Objective: To develop a method of murine obestatin RIA and study the role obestatin played in traumatic stress responses. Methods: New Zealand white rabbits were immunized with synthetic murine obestatin to obtain anti-serum, while chloramines-T method was used to iodinate obestatin antigen and a method of RIA for obestatin was established. A mouse sepsis model made with cecal ligation and puncture was established. Serum obestatin levels in the sacrificed models were determined with this method of RIA at 3h, 6h, 9h after the cecum puncture respectively (5 animals each time) as well as in 5 animals after sham operation. Results: Both the shape of standard curve and metrical results of the obestatin RIA were satisfactory. Serum obstatin levels at 6h after injury were significantly higher than those in animals with sham operation out the levels at 3h and 9h were not much different from those in sham operation animals. Meanwhile, the levels at 6h after injury expressed a trend to be significantly higher than that at 3h or 9h after injury. Conclusion: The established method for murine obestatin RIA is highly sensitive, simple and reliable, and it can be used to detect samples from rats and mice. Obestatin may be a traumatic stress factor participating in the modulation of homeostasis after sepsis. (authors)

  7. Development and characterization of antiserum to murine granulocyte-macrophage colony-stimulating factor

    International Nuclear Information System (INIS)

    Mochizuki, D.Y.; Eisenman, J.R.; Conlon, P.J.; Park, L.S.; Urdal, D.L.

    1986-01-01

    The expression in yeast of a cDNA clone encoding murine granulocyte-macrophage colony-stimulating factor (GM-CSF) has made possible the purification of large quantities of this recombinant protein. Rabbits immunized with pure recombinant GM-CSF generated antibodies that were shown to be specific for both recombinant GM-CSF and GM-CSF isolated from natural sources. Other lymphokines, including IL 1β, IL 2, IL 3, and recombinant human GM-CSF did not react with the antiserum. The antiserum together with recombinant GM-CSF that had been radiolabeled with 125 I to high specific activity, formed the foundation for a rapid, sensitive, and quantitative radioimmunoassay specific for murine GM-CSF. Furthermore, the antiserum was found to inhibit the biologic activities of GM-CSF as measured in both a bone marrow proliferation assay and a colony assay, and thus should prove to be a useful reagent for dissecting the complex growth factor activities involved in murine hematopoiesis

  8. Vascular cognitive impairment in Pemphigus vulgaris: a case report

    Directory of Open Access Journals (Sweden)

    José Ibiapina Siqueira- Neto

    Full Text Available ABSTRACT Pemphigus vulgaris is a systemic auto-immune medical condition that mainly manifests with changes in skin and vasculopathy. This is a case report of a 69-year-old male with confirmed histopathologic diagnosis of Pemphigus vulgaris presenting ulterior Cognitive Impairment, mostly in executive function. The patient was treated using steroids, immunomodulatory therapy, fluoxetine and galantamine. Neuropsychological testing and magnetic resonance (MRI were performed. This is the first report of correlational cognitive impairment with Pemphigus vulgaris in the literature. Physicians should be aware of vascular causes for cognitive impairment in patients presenting auto-immune conditions.

  9. Immune System Quiz

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Quiz: Immune System KidsHealth / For Kids / Quiz: Immune System Print How much do you know about your immune system? Find out by taking this quiz! About Us ...

  10. Immunization Schedules for Adults

    Science.gov (United States)

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedule for Adults (19 Years of Age and ... diseases that can be prevented by vaccines . 2018 Immunization Schedule Recommended Vaccinations for Adults by Age and ...

  11. Immunizations and African Americans

    Science.gov (United States)

    ... Data > Minority Population Profiles > Black/African American > Immunizations Immunizations and African Americans African American adults are less ... 19 to 35 months had comparable rates of immunization. African American women are as likely to have ...

  12. Instant Childhood Immunization Schedule

    Science.gov (United States)

    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  13. T cell immunity

    OpenAIRE

    Emel Bülbül Başkan

    2013-01-01

    Since birth, our immune system is constantly bombarded with self-antigens and foreign pathogens. To stay healthy, complex immune strategies have evolved in our immune system to maintain self-tolerance and to defend against foreign pathogens. Effector T cells are the key players in steering the immune responses to execute immune functions. While effector T cells were initially identified to be immune promoting, recent studies unraveled negative regulatory functions of effector T cells...

  14. Complement anaphylatoxins as immune regulators in cancer.

    Science.gov (United States)

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-08-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  15. Transcriptome analysis of the ependymal barrier during murine neurocysticercosis

    Directory of Open Access Journals (Sweden)

    Mishra Pramod

    2012-06-01

    to be upregulated at the protein level using immunofluorescence microcopy. This is important, because these molecules are members of the most significant pathways by IPA analyses. Conclusion Thus, our study indicates that ependymal cells actively express immune mediators and likely contribute to the observed immunopathogenesis during infection. Of particular interest is the major upregulation of antigen presentation pathway-related genes and chemokines/cytokines. This could explain how the ependyma is a prominent source of leukocyte infiltration into ventricles through the disrupted ependymal lining by way of pial vessels present in the internal leptomeninges in murine NCC.

  16. Immunization Action Coalition

    Science.gov (United States)

    ... IAC | Contact | A-Z Index | Donate | Shop | SUBSCRIBE Immunization Action Coalition Favorites ACIP Recommendations Package Inserts Additional Immunization Resources Photos Adult Vaccination Screening Checklists Ask the ...

  17. Puerarin Facilitates T-Tubule Development of Murine Embryonic Stem Cell-Derived Cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Lu Wang

    2014-07-01

    Full Text Available Aims: The embryonic stem cell-derived cardiomyocytes (ES-CM is one of the promising cell sources for repopulation of damaged myocardium. However, ES-CMs present immature structure, which impairs their integration with host tissue and functional regeneration. This study used murine ES-CMs as an in vitro model of cardiomyogenesis to elucidate the effect of puerarin, the main compound found in the traditional Chinese medicine the herb Radix puerariae, on t-tubule development of murine ES-CMs. Methods: Electron microscope was employed to examine the ultrastructure. The investigation of transverse-tubules (t-tubules was performed by Di-8-ANEPPS staining. Quantitative real-time PCR was utilized to study the transcript level of genes related to t-tubule development. Results: We found that long-term application of puerarin throughout cardiac differentiation improved myofibril array and sarcomeres formation, and significantly facilitated t-tubules development of ES-CMs. The transcript levels of caveolin-3, amphiphysin-2 and junctophinlin-2, which are crucial for the formation and development of t-tubules, were significantly upregulated by puerarin treatment. Furthermore, puerarin repressed the expression of miR-22, which targets to caveolin-3. Conclusion: Our data showed that puerarin facilitates t-tubule development of murine ES-CMs. This might be related to the repression of miR-22 by puerarin and upregulation of Cav3, Bin1 and JP2 transcripts.

  18. Endogenous murine tau promotes neurofibrillary tangles in 3xTg-AD mice without affecting cognition.

    Science.gov (United States)

    Baglietto-Vargas, David; Kitazawa, Masashi; Le, Elaine J; Estrada-Hernandez, Tatiana; Rodriguez-Ortiz, Carlos J; Medeiros, Rodrigo; Green, Kim N; LaFerla, Frank M

    2014-02-01

    Recent studies on tauopathy animal models suggest that the concomitant expression of the endogenous murine tau delays the pathological accumulation of human tau, and interferes with the disease progression. To elucidate the role of endogenous murine tau in a model with both plaques and tangles, we developed a novel transgenic mouse model by crossing 3xTg-AD with mtauKO mice (referred to as 3xTg-AD/mtauKO mice). Therefore, this new model allows us to determine the pathological consequences of the murine tau. Here, we show that 3xTg-AD/mtauKO mice have lower tau loads in both soluble and insoluble fractions, and lower tau hyperphosphorylation level in the soluble fraction relative to 3xTg-AD mice. In the 3xTg-AD model endogenous mouse tau is hyperphosphorylated and significantly co-aggregates with human tau. Despite the deletion of the endogenous tau gene in 3xTg-AD/mtauKO mice, cognitive dysfunction was equivalent to 3xTg-AD mice, as there was no additional impairment on a spatial memory task, and thus despite increased tau phosphorylation, accumulation and NFTs in 3xTg-AD mice no further effects on cognition are seen. These findings provide better understanding about the role of endogenous tau to Alzheimer's disease (AD) pathology and for developing new AD models. © 2013.

  19. The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires' disease in humans.

    Directory of Open Access Journals (Sweden)

    Juan S Ruiz-Moreno

    2018-01-01

    Full Text Available The cyclic GMP-AMP synthase (cGAS-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs. In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires' disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires' disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection.ClinicalTrials.gov DRKS00005274, German Clinical Trials Register.

  20. The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires' disease in humans.

    Science.gov (United States)

    Ruiz-Moreno, Juan S; Hamann, Lutz; Shah, Javeed A; Verbon, Annelies; Mockenhaupt, Frank P; Puzianowska-Kuznicka, Monika; Naujoks, Jan; Sander, Leif E; Witzenrath, Martin; Cambier, John C; Suttorp, Norbert; Schumann, Ralf R; Jin, Lei; Hawn, Thomas R; Opitz, Bastian

    2018-01-01

    The cyclic GMP-AMP synthase (cGAS)-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs). In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires' disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires' disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection. ClinicalTrials.gov DRKS00005274, German Clinical Trials Register.

  1. The common HAQ STING variant impairs cGAS-dependent antibacterial responses and is associated with susceptibility to Legionnaires’ disease in humans

    Science.gov (United States)

    Hamann, Lutz; Verbon, Annelies; Mockenhaupt, Frank P.; Puzianowska-Kuznicka, Monika; Naujoks, Jan; Sander, Leif E.; Witzenrath, Martin; Schumann, Ralf R.; Hawn, Thomas R.

    2018-01-01

    The cyclic GMP-AMP synthase (cGAS)-STING pathway is central for innate immune sensing of various bacterial, viral and protozoal infections. Recent studies identified the common HAQ and R232H alleles of TMEM173/STING, but the functional consequences of these variants for primary infections are unknown. Here we demonstrate that cGAS- and STING-deficient murine macrophages as well as human cells of individuals carrying HAQ TMEM173/STING were severely impaired in producing type I IFNs and pro-inflammatory cytokines in response to Legionella pneumophila, bacterial DNA or cyclic dinucleotides (CDNs). In contrast, R232H attenuated cytokine production only following stimulation with bacterial CDN, but not in response to L. pneumophila or DNA. In a mouse model of Legionnaires’ disease, cGAS- and STING-deficient animals exhibited higher bacterial loads as compared to wild-type mice. Moreover, the haplotype frequency of HAQ TMEM173/STING, but not of R232H TMEM173/STING, was increased in two independent cohorts of human Legionnaires’ disease patients as compared to healthy controls. Our study reveals that the cGAS-STING cascade contributes to antibacterial defense against L. pneumophila in mice and men, and provides important insight into how the common HAQ TMEM173/STING variant affects antimicrobial immune responses and susceptibility to infection. Trial registration ClinicalTrials.gov DRKS00005274, German Clinical Trials Register PMID:29298342

  2. Strain-related effects of fenbendazole treatment on murine experimental autoimmune encephalomyelitis.

    Science.gov (United States)

    Ramp, A A; Hall, C; Orian, J M

    2010-07-01

    Parasitic infections are a concern in animal facilities, in view of their influence on physiological processes and the immune status of animals. Pinworms are effectively controlled with the anthelminthic fenbendazole (FBZ, [5-(phenylthio)-1H-benzamidazol-2-yl]carbamic acid methyl ester; C(15)H(13)N(3)O(2)S); however, questions remain as to whether prolonged FBZ exposure alters the disease course in specific experimental models, such as those pertaining to the immune system. We report that a three-month regimen of FBZ-medicated feed severely affected the onset and disease severity of murine experimental autoimmune encephalomyelitis (EAE), a disease that mimics multiple sclerosis. Differences were recorded between mouse strains used. Our data suggest that where the use of FBZ is mandatory, its full effect should be verified on the particular EAE variant adopted by the laboratory.

  3. Isolation of Eosinophils from the Lamina Propria of the Murine Small Intestine.

    Science.gov (United States)

    Berek, Claudia; Beller, Alexander; Chu, Van Trung

    2016-01-01

    Only recently has it become apparent that eosinophils play a crucial role in mucosal immune homeostasis. Although eosinophils are the main cellular component of the lamina propria of the gastrointestinal tract, they have often been overlooked because they express numerous markers, which are normally used to characterize macrophages and/or dendritic cells. To study their function in mucosal immunity, it is important to isolate them with high purity and viability. Here, we describe a protocol to purify eosinophils from the lamina propria of the murine small intestine. The method involves preparation of the small intestine, removal of epithelial cells and digestion of the lamina propria to release eosinophils. A protocol to sort eosinophils is included.

  4. Developing injectable immunoglobulins to treat cognitive impairment in Alzheimer's disease.

    Science.gov (United States)

    Steinitz, Michael

    2008-05-01

    Alzheimer's disease is a devastating disorder, clinically characterized by a comprehensive cognitive decline. The novel strategy of anti-amyloid-beta immunotherapy has been suggested following encouraging results obtained in murine models of Alzheimer's disease, in non-human primates, and in small-scale clinical trials. To examine the choice between active or passive anti-amyloid-beta immunization and the choice of the molecule to which the immune machinery should be targeted, which are central issues in future immune therapy of Alzheimer's disease. Research into the new area of Alzheimer's disease immune therapy is primarily based on in vivo and in vitro studies of murine models of Alzheimer's disease. The studies are hence limited to defined genetic deficiencies. In humans, infusion of anti-amyloid-beta antibodies is considered a safer approach than active anti-amyloid-beta vaccination. Alzheimer's-disease-protective anti-amyloid-beta monoclonal antibodies should target specific epitopes within the amyloid beta(1 42) peptide, avoiding possibly harmful binding to the ubiquitous normal amyloid precursor protein. Since Alzheimer's disease immunotherapy requires repeated infusion of antibodies over a prolonged period of time, Alzheimer's disease patients will tolerate such antibodies provided the latter are exclusively of human origin. Human monoclonal antibodies that correspond to ubiquitous anti-amyloid-beta, present in all healthy humans, might bear important protective characteristics.

  5. Critical transition in tissue homeostasis accompanies murine lung senescence.

    Directory of Open Access Journals (Sweden)

    Carla L Calvi

    Full Text Available BACKGROUND: Respiratory dysfunction is a major contributor to morbidity and mortality in aged populations. The susceptibility to pulmonary insults is attributed to "low pulmonary reserve", ostensibly reflecting a combination of age-related musculoskeletal, immunologic and intrinsic pulmonary dysfunction. METHODS/PRINCIPAL FINDINGS: Using a murine model of the aging lung, senescent DBA/2 mice, we correlated a longitudinal survey of airspace size and injury measures with a transcriptome from the aging lung at 2, 4, 8, 12, 16 and 20 months of age. Morphometric analysis demonstrated a nonlinear pattern of airspace caliber enlargement with a critical transition occurring between 8 and 12 months of age marked by an initial increase in oxidative stress, cell death and elastase activation which is soon followed by inflammatory cell infiltration, immune complex deposition and the onset of airspace enlargement. The temporally correlative transcriptome showed exuberant induction of immunoglobulin genes coincident with airspace enlargement. Immunohistochemistry, ELISA analysis and flow cytometry demonstrated increased immunoglobulin deposition in the lung associated with a contemporaneous increase in activated B-cells expressing high levels of TLR4 (toll receptor 4 and CD86 and macrophages during midlife. These midlife changes culminate in progressive airspace enlargement during late life stages. CONCLUSION/SIGNIFICANCE: Our findings establish that a tissue-specific aging program is evident during a presenescent interval which involves early oxidative stress, cell death and elastase activation, followed by B lymphocyte and macrophage expansion/activation. This sequence heralds the progression to overt airspace enlargement in the aged lung. These signature events, during middle age, indicate that early stages of the aging immune system may have important correlates in the maintenance of tissue morphology. We further show that time-course analyses of aging

  6. Noncanonical microRNAs and endogenous siRNAs in lytic infection of murine gammaherpesvirus.

    Directory of Open Access Journals (Sweden)

    Jing Xia

    Full Text Available MicroRNA (miRNA and endogenous small interfering RNA (endo-siRNA are two essential classes of small noncoding RNAs (sncRNAs in eukaryotes. The class of miRNA is diverse and there exist noncanonical miRNAs that bypass the canonical miRNA biogenesis pathway. In order to identify noncanonical miRNAs and endo-siRNAs responding to virus infection and study their potential function, we sequenced small-RNA species from cells lytically infected with murine gammaherpesvirus 68 (MHV68. In addition to three novel canonical miRNAs in mouse, two antisense miRNAs in virus and 25 novel noncanonical miRNAs, including miRNAs derived from transfer RNAs, small nucleolar RNAs and introns, in the host were identified. These noncanonical miRNAs exhibited features distinct from that of canonical miRNAs in lengths of hairpins, base pairings and first nucleotide preference. Many of the novel miRNAs are conserved in mammals. Besides several known murine endo-siRNAs detected by the sequencing profiling, a novel locus in the mouse genome was identified to produce endo-siRNAs. This novel endo-siRNA locus is comprised of two tandem inverted B4 short interspersed nuclear elements (SINEs. Unexpectedly, the SINE-derived endo-siRNAs were found in a variety of sequencing data and virus-infected cells. Moreover, a murine miRNA was up-regulated more than 35 fold in infected than in mock-treated cells. The putative targets of the viral and the up-regulated murine miRNAs were potentially involved in processes of gene transcription and protein phosphorylation, and localized to membranes, suggesting their potential role in manipulating the host basal immune system during lytic infection. Our results extended the number of noncanonical miRNAs in mammals and shed new light on their potential functions of lytic infection of MHV68.

  7. Assessment of Antibody-based Drugs Effects on Murine Bone Marrow and Peritoneal Macrophage Activation.

    Science.gov (United States)

    Kozicky, Lisa; Sly, Laura M

    2017-12-26

    Macrophages are phagocytic innate immune cells, which initiate immune responses to pathogens and contribute to healing and tissue restitution. Macrophages are equally important in turning off inflammatory responses. We have shown that macrophages stimulated with intravenous immunoglobulin (IVIg) can produce high amounts of the anti-inflammatory cytokine, interleukin 10 (IL-10), and low levels of pro-inflammatory cytokines in response to bacterial lipopolysaccharides (LPS). IVIg is a polyvalent antibody, primarily immunoglobulin Gs (IgGs), pooled from the plasma of more than 1,000 blood donors. It is used to supplement antibodies in patients with immune deficiencies or to suppress immune responses in patients with autoimmune or inflammatory conditions. Infliximab, a therapeutic anti-tumor necrosis factor alpha (TNFα) antibody, has also been shown to activate macrophages to produce IL-10 in response to inflammatory stimuli. IVIg and other antibody-based biologics can be tested to determine their effects on macrophage activation. This paper describes methods for derivation, stimulation, and assessment of murine bone marrow macrophages activated by antibodies in vitro and murine peritoneal macrophages activated with antibodies in vivo. Finally, we demonstrate the use of western blotting to determine the contribution of specific cell signaling pathways to anti-inflammatory macrophage activity. These protocols can be used with genetically modified mice, to determine the effect of a specific protein(s) on anti-inflammatory macrophage activation. These techniques can also be used to assess whether specific biologics may act by changing macrophages to an IL-10-producing anti-inflammatory activation state that reduces inflammatory responses in vivo. This can provide information on the role of macrophage activation in the efficacy of biologics during disease models in mice, and provide insight into a potential new mechanism of action in people. Conversely, this may caution

  8. Responses of murine and human macrophages to leptospiral infection: a study using comparative array analysis.

    Directory of Open Access Journals (Sweden)

    Feng Xue

    Full Text Available Leptospirosis is a re-emerging tropical infectious disease caused by pathogenic Leptospira spp. The different host innate immune responses are partially related to the different severities of leptospirosis. In this study, we employed transcriptomics and cytokine arrays to comparatively calculate the responses of murine peritoneal macrophages (MPMs and human peripheral blood monocytes (HBMs to leptospiral infection. We uncovered a series of different expression profiles of these two immune cells. The percentages of regulated genes in several biological processes of MPMs, such as antigen processing and presentation, membrane potential regulation, and the innate immune response, etc., were much greater than those of HBMs (>2-fold. In MPMs and HBMs, the caspase-8 and Fas-associated protein with death domain (FADD-like apoptosis regulator genes were significantly up-regulated, which supported previous results that the caspase-8 and caspase-3 pathways play an important role in macrophage apoptosis during leptospiral infection. In addition, the key component of the complement pathway, C3, was only up-regulated in MPMs. Furthermore, several cytokines, e.g. interleukin 10 (IL-10 and tumor necrosis factor alpha (TNF-alpha, were differentially expressed at both mRNA and protein levels in MPMs and HBMs. Some of the differential expressions were proved to be pathogenic Leptospira-specific regulations at mRNA level or protein level. Though it is still unclear why some animals are resistant and others are susceptible to leptospiral infection, this comparative study based on transcriptomics and cytokine arrays partially uncovered the differences of murine resistance and human susceptibility to leptospirosis. Taken together, these findings will facilitate further molecular studies on the innate immune response to leptospiral infection.

  9. Responses of Murine and Human Macrophages to Leptospiral Infection: A Study Using Comparative Array Analysis

    Science.gov (United States)

    Yang, Yingchao; Zhao, Jinping; Yang, Yutao; Cao, Yongguo; Hong, Cailing; Liu, Yuan; Sun, Lan; Huang, Minjun; Gu, Junchao

    2013-01-01

    Leptospirosis is a re-emerging tropical infectious disease caused by pathogenic Leptospira spp. The different host innate immune responses are partially related to the different severities of leptospirosis. In this study, we employed transcriptomics and cytokine arrays to comparatively calculate the responses of murine peritoneal macrophages (MPMs) and human peripheral blood monocytes (HBMs) to leptospiral infection. We uncovered a series of different expression profiles of these two immune cells. The percentages of regulated genes in several biological processes of MPMs, such as antigen processing and presentation, membrane potential regulation, and the innate immune response, etc., were much greater than those of HBMs (>2-fold). In MPMs and HBMs, the caspase-8 and Fas-associated protein with death domain (FADD)-like apoptosis regulator genes were significantly up-regulated, which supported previous results that the caspase-8 and caspase-3 pathways play an important role in macrophage apoptosis during leptospiral infection. In addition, the key component of the complement pathway, C3, was only up-regulated in MPMs. Furthermore, several cytokines, e.g. interleukin 10 (IL-10) and tumor necrosis factor alpha (TNF-alpha), were differentially expressed at both mRNA and protein levels in MPMs and HBMs. Some of the differential expressions were proved to be pathogenic Leptospira-specific regulations at mRNA level or protein level. Though it is still unclear why some animals are resistant and others are susceptible to leptospiral infection, this comparative study based on transcriptomics and cytokine arrays partially uncovered the differences of murine resistance and human susceptibility to leptospirosis. Taken together, these findings will facilitate further molecular studies on the innate immune response to leptospiral infection. PMID:24130911

  10. A novel murine model for evaluating bovine papillomavirus prophylactics/therapeutics for equine sarcoid-like tumours.

    Science.gov (United States)

    Bogaert, Lies; Woodham, Andrew W; Da Silva, Diane M; Martens, Ann; Meyer, Evelyne; Kast, W Martin

    2015-09-01

    Equine sarcoids are highly recurrent bovine papillomavirus (BPV)-induced fibroblastic neoplasms that are the most common skin tumours in horses. In order to facilitate the study of potential equine sarcoid prophylactics or therapeutics, which can be a slow and costly process in equines, a murine model for BPV-1 protein-expressing equine sarcoid-like tumours was developed in mice through stable transfection of BPV-1 E5 and E6 in a murine fibroblast tumour cell line (K-BALB). Like equine sarcoids, these murine tumour cells (BPV-KB) were of fibroblast origin, were tumorigenic and expressed BPV-1 proteins. As an initial investigation of the preclinical potential of this tumour model for equine sarcoids prophylactics, mice were immunized with BPV-1 E5E6 Venezuelan equine encephalitis virus replicon particles, prior to BPV-KB challenge, which resulted in an increased tumour-free period compared with controls, indicating that the BPV-KB murine model may be a valuable preclinical alternative to equine clinical trials.

  11. Aging of immune system: Immune signature from peripheral blood lymphocyte subsets in 1068 healthy adults.

    Science.gov (United States)

    Qin, Ling; Jing, Xie; Qiu, Zhifeng; Cao, Wei; Jiao, Yang; Routy, Jean-Pierre; Li, Taisheng

    2016-05-01

    Aging is a major risk factor for several conditions including neurodegenerative, cardiovascular diseases and cancer. Functional impairments in cellular pathways controlling genomic stability, and immune control have been identified. Biomarker of immune senescence is needed to improve vaccine response and to develop therapy to improve immune control. To identify phenotypic signature of circulating immune cells with aging, we enrolled 1068 Chinese healthy volunteers ranging from 18 to 80 years old. The decreased naïve CD4+ and CD8+ T cells, increased memory CD4+ or CD8+ T cells, loss of CD28 expression on T cells and reverse trend of CD38 and HLA-DR, were significant for aging of immune system. Conversely, the absolute counts and percentage of NK cells and CD19+B cells maintained stable in aging individuals. The Chinese reference ranges of absolute counts and percentage of peripheral lymphocyte in this study might be useful for future clinical evaluation.

  12. Dendritic cell-based vaccination in cancer: therapeutic implications emerging from murine models

    Directory of Open Access Journals (Sweden)

    Soledad eMac Keon

    2015-05-01

    Full Text Available Dendritic cells (DCs play a pivotal role in the orchestration of immune responses, and are thus key targets in cancer vaccine design. Since the 2010 FDA approval of the first cancer DC-based vaccine (Sipuleucel T there has been a surge of interest in exploiting these cells as a therapeutic option for the treatment of tumors of diverse origin. In spite of the encouraging results obtained in the clinic, many elements of DC-based vaccination strategies need to be optimized. In this context, the use of experimental cancer models can help direct efforts towards an effective vaccine design. This paper reviews recent findings in murine models regarding the antitumoral mechanisms of DC-based vaccination, covering issues related to antigen sources, the use of adjuvants and maturing agents, and the role of DC subsets and their interaction in the initiation of antitumoral immune responses. The summary of such diverse aspects will highlight advantages and drawbacks in the use of murine models, and contribute to the design of successful DC-based translational approaches for cancer treatment.

  13. Decay-accelerating factor 1 deficiency exacerbates Trypanosoma cruzi-induced murine chronic myositis.

    Science.gov (United States)

    Solana, María E; Ferrer, María F; Novoa, María Mercedes; Song, Wen-Chao; Gómez, Ricardo M

    2012-10-01

    Murine infection with Trypanosoma cruzi (Tc) has been used to study the role of T-cells in the pathogenesis of human inflammatory idiopathic myositis. Absence of decay-accelerating factor 1 (Daf1) has been shown to enhance murine T-cell responses and autoimmunity. To determine whether Daf1 deficiency can exacerbate Tc-induced myositis, C57BL/6 DAF(+/+) and DAF(-/-) mice were inoculated with 5 × 10(4) trypomastigotes, and their morbidity, parasitemia, parasite burden, histopathology, and T-cell expansion were studied in the acute and chronic stages. DAF(-/-) mice had lower parasitemia and parasite burden but higher morbidity, muscle histopathology, and increased number of CD44(+) (activated/memory phenotype) splenic CD4(+) and CD8(+) T-cells. An enhanced CD8(+) T-cell immune-specific response may explain the lower parasitemia and parasite burden levels and the increase in histopathological lesions. We propose that Tc-inoculated DAF(-/-) mice are a useful model to study T-cell mediated immunity in skeletal muscle tissues. Copyright © 2012 Wiley Periodicals, Inc.

  14. Purification and characterization of recombinant full-length and protease domain of murine MMP-9 expressed in Drosophila S2 cells

    DEFF Research Database (Denmark)

    Rasch, Morten G; Lund, Ida K; Illemann, Martin

    2010-01-01

    MMP-9. Constructs encoding zymogens of full-length murine MMP-9 and a version lacking the O-glycosylated linker region and hemopexin domains were therefore generated and expressed in stably transfected Drosophila S2 insect cells. After 7 days of induction the expression levels of the full......-length and truncated versions were 5 mg/l and 2 mg/l, respectively. The products were >95% pure after gelatin Sepharose chromatography and possessed proteolytic activity when analyzed by gelatin zymography. Using the purified full-length murine MMP-9 we raised polyclonal antibodies by immunizations of rabbits......Matrix metalloproteinase-9 (MMP-9) is a 92-kDa soluble pro-enzyme implicated in pathological events including cancer invasion. It is therefore an attractive target for therapeutic intervention studies in mouse models. Development of inhibitors requires sufficient amounts of correctly folded murine...

  15. Signaling pathways regulating murine pancreatic development

    DEFF Research Database (Denmark)

    Serup, Palle

    2012-01-01

    The recent decades have seen a huge expansion in our knowledge about pancreatic development. Numerous lineage-restricted transcription factor genes have been identified and much has been learned about their function. Similarly, numerous signaling pathways important for pancreas development have...... been identified and the specific roles have been investigated by genetic and cell biological methods. The present review presents an overview of the principal signaling pathways involved in regulating murine pancreatic growth, morphogenesis, and cell differentiation....

  16. Mutual Interference between Cytomegalovirus and Reconstitution of Protective Immunity after Hematopoietic Cell Transplantation

    Directory of Open Access Journals (Sweden)

    Matthias J. Reddehase

    2016-08-01

    Full Text Available Hematopoietic cell transplantation (HCT is a therapy option for aggressive forms of hematopoietic malignancies that are resistant to standard antitumoral therapies. Hematoablative treatment preceding HCT, however, opens a ‘window of opportunity’ for latent cytomegalovirus (CMV by releasing it from immune control with the consequence of reactivation of productive viral gene expression and recurrence of infectious virus. A ‘window of opportunity’ for the virus represents a ‘window of risk’ for the patient. In the interim between HCT and reconstitution of antiviral immunity, primarily mediated by CD8+ T cells, initially low amounts of reactivated virus can expand exponentially, disseminate to essentially all organs, and cause multiple organ CMV disease, with interstitial pneumonia (CMV-IP representing the most severe clinical manifestation. Here I will review predictions originally made in the mouse model of experimental HCT and murine CMV infection, some of which have already paved the way to translational preclinical research and promising clinical trials of a pre-emptive cytoimmunotherapy of human CMV disease. Specifically, the mouse model has been pivotal in providing ‘proof of concept’ for preventing CMV disease after HCT by adoptive transfer of preselected, virus epitope-specific effector and memory CD8+ T cells bridging the critical interim. CMV, however, is not a ‘passive antigen’ but is a pathogen that actively interferes with the reconstitution of protective immunity by infecting bone marrow stromal cells that otherwise form niches for hematopoiesis by providing the structural microenvironment and by producing hematopoietically active cytokines, the hemopoietins. Depending on the precise conditions of HCT, reduced homing of transplanted hematopoietic stem- and progenitor cells to infected bone marrow stroma and impaired colony growth and lineage differentiation can lead to ‘graft failure’. In consequence

  17. Altered tumor growth in vivo after immunization of mice with antitumor antibodies

    International Nuclear Information System (INIS)

    Gorczynski, R.M.; Kennedy, M.; Polidoulis, I.; Price, G.B.

    1984-01-01

    A comparison has been made between the growth patterns of two spontaneously appearing mammary adenocarcinomas in murine bone marrow radiation chimeras and in mice preimmunized with monoclonal antibodies (MAb) detecting embryo-associated antigenic determinants. A correlation was seen between the ability of the embryo-immunized chimeras to produce cytotoxic antibody to the tumors, as assessed by an antibody-dependent cellular cytotoxic assay, and the permissiveness of the mice for growth of a tumor transplant. In addition, mice deliberately preimmunized with cytotoxic MAb (antibody-dependent cellular cytotoxic assay) allowed more rapid growth specifically of that tumor earlier found to be most sensitive to the MAb used for immunization. By comparing the changing antigenic phenotype of tumor cells serially passaged through different immunized, nonimmunized mice, evidence was found suggesting that immunization could cause either antigen modulation of transferred tumor cells or a (transient) selective advantage to antigenically discrete subpopulations within the heterogeneous tumor population. Finally, a study has been made of the growth pattern of tumor cells transplanted into mice immunized with rabbit antibodies directed against the murine MAb. In this case, tumor growth was slowed preferentially for the tumor reactive with the specific MAb, and again, predictable changes in the antigenic spectrum of tumor cells harvested from these animals were observed. Our overall findings are interpreted in terms of the involvement of networks of antibodies reacting with embryo-associated antigens in the regulation of growth of the murine mammary adenocarcinomas studied

  18. Our Immune System

    Science.gov (United States)

    Our Immune System A story for children with primary immunodeficiency diseases Written by Sara LeBien IMMUNE DEFICIENCY FOUNDATION A note ... who are immune deficient to better understand their immune system. What is a “ B-cell, ” a “ T-cell, ” ...

  19. Interleukin-6 promotes systemic lupus erythematosus progression with Treg suppression approach in a murine systemic lupus erythematosus model.

    Science.gov (United States)

    Mao, Xiaoli; Wu, Yunyun; Diao, Huitian; Hao, Jianlei; Tian, Gaofei; Jia, Zhenghu; Li, Zheng; Xiong, Sidong; Wu, Zhenzhou; Wang, Puyue; Zhao, Liqing; Yin, Zhinan

    2014-11-01

    Our aim is to reveal the role of interleukin 6 (IL-6) in the pathogenesis of systemic lupus erythematosus (SLE) in a murine model of SLE. Normal female C57BL/6 mice were immunized with syngeneic-activated lymphocyte-derived DNA (ALD-DNA) to induce SLE. Non-immunized mice were used as control. SLE-associated markers, including anti-double-stranded DNA (anti-dsDNA) Abs, urine protein, and kidney histopathology, were assayed to ensure the induction of the disease. Compared with control mice, ALD-DNA immunized mice exhibited high levels of anti-dsDNA Abs, IL-6 expression in vivo and in vitro. We also found that IL-6 knockout (IL-6KO) mice were resistant to ALD-DNA-induced SLE. The activation of CD4(+) T cells in immunized IL-6KO mice was lower than in immunized wild-type (Wt) mice. Intracellular cytokine staining showed that Foxp3 expression in immunized IL-6KO mice was higher than in immunized Wt mice, which might be associated with the disease severity. We further discovered that ALD-DNA-stimulated dendritic cells supernatants could result in higher IL-6 and TNF-α expression and could suppress Foxp3 expression. In addition, blocking IL-6 could up-regulate Foxp3 expression. Therefore, our findings show that IL-6 promotes the progression of SLE via suppressing Treg differentiation.

  20. The role of retinoic acid in tolerance and immunity.

    Science.gov (United States)

    Hall, Jason A; Grainger, John R; Spencer, Sean P; Belkaid, Yasmine

    2011-07-22

    Vitamin A elicits a broad array of immune responses through its metabolite, retinoic acid (RA). Recent evidence indicates that loss of RA leads to impaired immunity, whereas excess RA can potentially promote inflammatory disorders. In this review, we discuss recent advances showcasing the crucial contributions of RA to both immunological tolerance and the elicitation of adaptive immune responses. Further, we provide a comprehensive overview of the cell types and factors that control the production of RA and discuss how host perturbations may affect the ability of this metabolite to control tolerance and immunity or to instigate pathology. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Human intestinal dendritic cells as controllers of mucosal immunity

    Directory of Open Access Journals (Sweden)

    David Bernardo

    2013-06-01

    Full Text Available Dendritic cells are the most potent, professional antigen-presenting cells in the body; following antigen presentation they control the type (proinflammatory/regulatory of immune response that will take place, as well as its location. Given their high plasticity and maturation ability in response to local danger signals derived from innate immunity, dendritic cells are key actors in the connection between innate immunity and adaptive immunity responses. In the gut dendritic cells control immune tolerance mechanisms against food and/or commensal flora antigens, and are also capable of initiating an active immune response in the presence of invading pathogens. Dendritic cells are thus highly efficient in controlling the delicate balance between tolerance and immunity in an environment so rich in antigens as the gut, and any factor involving these cells may impact their function, ultimately leading to the development of bowel conditions such as celiac disease or inflammatory bowel disease. In this review we shall summarize our understanding of human intestinal dendritic cells, their ability to express and induce migration markers, the various environmental factors modulating their properties, their subsets in the gut, and the problems entailed by their study, including identification strategies, differences between humans and murine models, and phenotypical variations along the gastrointestinal tract.

  2. Activation of farnesoid X receptor attenuates hepatic injury in a murine model of alcoholic liver disease

    International Nuclear Information System (INIS)

    Wu, Weibin; Zhu, Bo; Peng, Xiaomin; Zhou, Meiling; Jia, Dongwei; Gu, Jianxin

    2014-01-01

    Highlights: •FXR activity was impaired by chronic ethanol ingestion in a murine model of ALD. •Activation of FXR attenuated alcohol-induced liver injury and steatosis. •Activation of FXR attenuated cholestasis and oxidative stress in mouse liver. -- Abstract: Alcoholic liver disease (ALD) is a common cause of advanced liver disease, and considered as a major risk factor of morbidity and mortality worldwide. Hepatic cholestasis is a pathophysiological feature observed in all stages of ALD. The farnesoid X receptor (FXR) is a member of the nuclear hormone receptor superfamily, and plays an essential role in the regulation of bile acid, lipid and glucose homeostasis. However, the role of FXR in the pathogenesis and progression of ALD remains largely unknown. Mice were fed Lieber-DeCarli ethanol diet or an isocaloric control diet. We used a specific agonist of FXR WAY-362450 to study the effect of pharmacological activation of FXR in alcoholic liver disease. In this study, we demonstrated that FXR activity was impaired by chronic ethanol ingestion in a murine model of ALD. Activation of FXR by specific agonist WAY-362450 protected mice from the development of ALD. We also found that WAY-362450 treatment rescued FXR activity, suppressed ethanol-induced Cyp2e1 up-regulation and attenuated oxidative stress in liver. Our results highlight a key role of FXR in the modulation of ALD development, and propose specific FXR agonists for the treatment of ALD patients

  3. Activation of farnesoid X receptor attenuates hepatic injury in a murine model of alcoholic liver disease

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Weibin [Department of Biochemistry and Molecular Biology, Shanghai Medical College, Fudan University, Shanghai 200032 (China); Institutes of Biomedical Science, Fudan University, Shanghai 200032 (China); Zhu, Bo; Peng, Xiaomin [Department of Biochemistry and Molecular Biology, Shanghai Medical College, Fudan University, Shanghai 200032 (China); Zhou, Meiling, E-mail: meilingzhou2012@gmail.com [Department of Radiology, Zhongshan Hospital of Fudan University and Shanghai Institute of Medical Imaging, Shanghai 200032 (China); Jia, Dongwei, E-mail: jiadongwei@fudan.edu.cn [Department of Biochemistry and Molecular Biology, Shanghai Medical College, Fudan University, Shanghai 200032 (China); Gu, Jianxin [Department of Biochemistry and Molecular Biology, Shanghai Medical College, Fudan University, Shanghai 200032 (China); Institutes of Biomedical Science, Fudan University, Shanghai 200032 (China)

    2014-01-03

    Highlights: •FXR activity was impaired by chronic ethanol ingestion in a murine model of ALD. •Activation of FXR attenuated alcohol-induced liver injury and steatosis. •Activation of FXR attenuated cholestasis and oxidative stress in mouse liver. -- Abstract: Alcoholic liver disease (ALD) is a common cause of advanced liver disease, and considered as a major risk factor of morbidity and mortality worldwide. Hepatic cholestasis is a pathophysiological feature observed in all stages of ALD. The farnesoid X receptor (FXR) is a member of the nuclear hormone receptor superfamily, and plays an essential role in the regulation of bile acid, lipid and glucose homeostasis. However, the role of FXR in the pathogenesis and progression of ALD remains largely unknown. Mice were fed Lieber-DeCarli ethanol diet or an isocaloric control diet. We used a specific agonist of FXR WAY-362450 to study the effect of pharmacological activation of FXR in alcoholic liver disease. In this study, we demonstrated that FXR activity was impaired by chronic ethanol ingestion in a murine model of ALD. Activation of FXR by specific agonist WAY-362450 protected mice from the development of ALD. We also found that WAY-362450 treatment rescued FXR activity, suppressed ethanol-induced Cyp2e1 up-regulation and attenuated oxidative stress in liver. Our results highlight a key role of FXR in the modulation of ALD development, and propose specific FXR agonists for the treatment of ALD patients.

  4. Cortical visual impairment

    OpenAIRE

    Koželj, Urša

    2013-01-01

    In this thesis we discuss cortical visual impairment, diagnosis that is in the developed world in first place, since 20 percent of children with blindness or low vision are diagnosed with it. The objectives of the thesis are to define cortical visual impairment and the definition of characters suggestive of the cortical visual impairment as well as to search for causes that affect the growing diagnosis of cortical visual impairment. There are a lot of signs of cortical visual impairment. ...

  5. Effects of anti-schistosomal chemotherapy on immune responses, protection and immunity. II. Concomitant immunity and immunization with irradiated cercariae

    International Nuclear Information System (INIS)

    Tawfik, A.F.; Colley, D.G.

    1986-01-01

    Resistance of mice to challenge infections of Schistosoma mansoni was evaluated before and after elimination of their primary, established S. mansoni infections with the chemotherapeutic drug praziquantel. Mice treated after either 10 or 20 weeks of primary infection were challenged 6 or 10 weeks after treatment. Mice infected for for 10 weeks prior to treatment expressed progressively less resistance 6 and 10 weeks after treatment. By 10 weeks after treatment significant levels of protection were no longer observed. Resistance waned more slowly if mice were treated 20 weeks after infection, and there was still significant expression of resistance to challenge 10 weeks after treatment. A separate set of experiments evaluated the use of highly irradiated cercariae as a vaccine in mice that had been previously infected with S. mansoni and cured with praziquantel. It was observed that effective immunizations were possible in previously infected mice. These studies demonstrate that established resistance waned after treatment and the rate of loss of protection was dependent upon the duration of infection prior to treatment. Furthermore, the irradiated cercarial vaccine studies indicate that in the murine model induction of immunological resistance was feasible following chemotherapeutic treatment of infected populations

  6. DMPD: The actions of bacterial DNA on murine macrophages. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 10534106 The actions of bacterial DNA on murine macrophages. Sester DP, Stacey KJ, ... Show The actions of bacterial DNA on murine macrophages. PubmedID 10534106 Title The actions of bacterial DNA on murine macrophage

  7. Anti-amyloid beta protein antibody passage across the blood-brain barrier in the SAMP8 mouse model of Alzheimer's disease: an age-related selective uptake with reversal of learning impairment.

    Science.gov (United States)

    Banks, William A; Farr, Susan A; Morley, John E; Wolf, Kathy M; Geylis, Valeria; Steinitz, Michael

    2007-08-01

    Amyloid beta protein (Abeta) levels are elevated in the brain of Alzheimer's disease patients. Anti-Abeta antibodies can reverse the histologic and cognitive impairments in mice which overexpress Abeta. Passive immunization appears safer than vaccination and treatment of patients will likely require human rather than xenogenic antibodies. Effective treatment will likely require antibody to cross the blood-brain barrier (BBB). Unfortunately, antibodies typically cross the BBB very poorly and accumulate less well in brain than even albumin, a substance nearly totally excluded from the brain. We compared the ability of two anti-Abeta human monoclonal IgM antibodies, L11.3 and HyL5, to cross the BBB of young CD-1 mice to that of young and aged SAMP8 mice. The SAMP8 mouse has a spontaneous mutation that induces an age-related, Abeta-dependent cognitive deficit. There was preferential uptake of intravenously administered L11.3 in comparison to HyL5, albumin, and a control human monoclonal IgM (RF), especially by hippocampus and olfactory bulb in aged SAMP8 mice. Injection of L11.3 into the brains of aged SAMP8 mice reversed both learning and memory impairments in aged SAMP8 mice, whereas IgG and IgM controls were ineffective. Pharmacokinetic analysis predicted that an intravenous dose 1000 times higher than the brain injection dose would reverse cognitive impairments. This predicted intravenous dose reversed the impairment in learning, but not memory, in aged SAMP8 mice. In conclusion, an IgM antibody was produced that crosses the BBB to reverse cognitive impairment in a murine model of Alzheimer's disease.

  8. Host immune cellular reactions in corneal neovascularization

    Directory of Open Access Journals (Sweden)

    Nizar S. Abdelfattah

    2016-04-01

    Full Text Available Corneal neovascularization (CNV is a global important cause of visual impairment. The immune mechanisms leading to corneal heme- and lymphangiogenesis have been extensively studied over the past years as more attempts were made to develop better prophylactic and therapeutic measures. This article aims to discuss immune cells of particular relevance to CNV, with a focus on macrophages, Th17 cells, dendritic cells and the underlying immunology of common pathologies involving neovascularization of the cornea. Hopefully, a thorough understanding of these topics would propel the efforts to halt the detrimental effects of CNV.

  9. Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

    Science.gov (United States)

    Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

    2000-01-01

    The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

  10. Human glioblastoma-associated microglia/monocytes express a distinct RNA profile compared to human control and murine samples.

    Science.gov (United States)

    Szulzewsky, Frank; Arora, Sonali; de Witte, Lot; Ulas, Thomas; Markovic, Darko; Schultze, Joachim L; Holland, Eric C; Synowitz, Michael; Wolf, Susanne A; Kettenmann, Helmut

    2016-08-01

    Glioblastoma (GBM) is the most aggressive brain tumor in adults. It is strongly infiltrated by microglia and peripheral monocytes that support tumor growth. In the present study we used RNA sequencing to compare the expression profile of CD11b(+) human glioblastoma-associated microglia/monocytes (hGAMs) to CD11b(+) microglia isolated from non-tumor samples. Hierarchical clustering and principal component analysis showed a clear separation of the two sample groups and we identified 334 significantly regulated genes in hGAMs. In comparison to human control microglia hGAMs upregulated genes associated with mitotic cell cycle, cell migration, cell adhesion, and extracellular matrix organization. We validated the expression of several genes associated with extracellular matrix organization in samples of human control microglia, hGAMs, and the hGAMs-depleted fraction via qPCR. The comparison to murine GAMs (mGAMs) showed that both cell populations share a significant fraction of upregulated transcripts compared with their respective controls. These genes were mostly related to mitotic cell cycle. However, in contrast to murine cells, human GAMs did not upregulate genes associated to immune activation. Comparison of human and murine GAMs expression data to several data sets of in vitro-activated human macrophages and murine microglia showed that, in contrast to mGAMs, hGAMs share a smaller overlap to these data sets in general and in particular to cells activated by proinflammatory stimulation with LPS + INFγ or TNFα. Our findings provide new insights into the biology of human glioblastoma-associated microglia/monocytes and give detailed information about the validity of murine experimental models. GLIA 2016 GLIA 2016;64:1416-1436. © 2016 Wiley Periodicals, Inc.

  11. Chronic Binge Alcohol Administration Dysregulates Hippocampal Genes Involved in Immunity and Neurogenesis in Simian Immunodeficiency Virus-Infected Macaques

    Directory of Open Access Journals (Sweden)

    John K. Maxi

    2016-11-01

    Full Text Available Alcohol use disorders (AUD exacerbate neurocognitive dysfunction in Human Immunodeficiency Virus (HIV+ patients. We have shown that chronic binge alcohol (CBA administration (13–14 g EtOH/kg/wk prior to and during simian immunodeficiency virus (SIV infection in rhesus macaques unmasks learning deficits in operant learning and memory tasks. The underlying mechanisms of neurocognitive alterations due to alcohol and SIV are not known. This exploratory study examined the CBA-induced differential expression of hippocampal genes in SIV-infected (CBA/SIV+; n = 2 macaques in contrast to those of sucrose administered, SIV-infected (SUC/SIV+; n = 2 macaques. Transcriptomes of hippocampal samples dissected from brains obtained at necropsy (16 months post-SIV inoculation were analyzed to determine differentially expressed genes. MetaCore from Thomson Reuters revealed enrichment of genes involved in inflammation, immune responses, and neurodevelopment. Functional relevance of these alterations was examined in vitro by exposing murine neural progenitor cells (NPCs to ethanol (EtOH and HIV trans-activator of transcription (Tat protein. EtOH impaired NPC differentiation as indicated by decreased βIII tubulin expression. These findings suggest a role for neuroinflammation and neurogenesis in CBA/SIV neuropathogenesis and warrant further investigation of their potential contribution to CBA-mediated neurobehavioral deficits.

  12. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  13. Thrombin contributes to protective immunity in pneumonia-derived sepsis via fibrin polymerization and platelet-neutrophil interactions

    NARCIS (Netherlands)

    Claushuis, T. A. M.; de Stoppelaar, S. F.; Stroo, I.; Roelofs, J. J. T. H.; Ottenhoff, R.; van der Poll, T.; van't Veer, C.

    2017-01-01

    Essentials Immunity and coagulation are linked during sepsis but the role of thrombin is not fully elucidated. We investigated the effect of thrombin inhibition on murine Klebsiella pneumosepsis outcome. Thrombin is crucial for survival and limiting bacterial growth in pneumonia derived sepsis.

  14. Specific immune responses against airway epithelial cells in a transgenic mouse-trachea transplantation model for obliterative airway disease

    NARCIS (Netherlands)

    Qu, N; de Haan, A; Harmsen, MC; Kroese, FGM; de Leij, LFMH; Prop, J

    2003-01-01

    Background. Immune injury to airway epithelium is suggested to play a central role in the pathogenesis of obliterative bronchiolitis (OB) after clinical lung transplantation. In several studies, a rejection model of murine trachea transplants is used, resulting in obliterative airway disease (OAD)

  15. Novel quinazolinone MJ-29 triggers endoplasmic reticulum stress and intrinsic apoptosis in murine leukemia WEHI-3 cells and inhibits leukemic mice.

    Directory of Open Access Journals (Sweden)

    Chi-Cheng Lu

    Full Text Available The present study was to explore the biological responses of the newly compound, MJ-29 in murine myelomonocytic leukemia WEHI-3 cells in vitro and in vivo fates. We focused on the in vitro effects of MJ-29 on ER stress and mitochondria-dependent apoptotic death in WEHI-3 cells, and to hypothesize that MJ-29 might fully impair the orthotopic leukemic mice. Our results indicated that a concentration-dependent decrease of cell viability was shown in MJ-29-treated cells. DNA content was examined utilizing flow cytometry, whereas apoptotic populations were determined using annexin V/PI, DAPI staining and TUNEL assay. Increasing vital factors of mitochondrial dysfunction by MJ-29 were further investigated. Thus, MJ-29-provaked apoptosis of WEHI-3 cells is mediated through the intrinsic pathway. Importantly, intracellular Ca(2+ release and ER stress-associated signaling also contributed to MJ-29-triggered cell apoptosis. We found that MJ-29 stimulated the protein levels of calpain 1, CHOP and p-eIF2α pathways in WEHI-3 cells. In in vivo experiments, intraperitoneal administration of MJ-29 significantly improved the total survival rate, enhanced body weight and attenuated enlarged spleen and liver tissues in leukemic mice. The infiltration of immature myeloblastic cells into splenic red pulp was reduced in MJ-29-treated leukemic mice. Moreover, MJ-29 increased the differentiations of T and B cells but decreased that of macrophages and monocytes. Additionally, MJ-29-stimulated immune responses might be involved in anti-leukemic activity in vivo. Based on these observations, MJ-29 suppresses WEHI-3 cells in vitro and in vivo, and it is proposed that this potent and selective agent could be a new chemotherapeutic candidate for anti-leukemia in the future.

  16. Cancer as an immune-mediated disease

    Directory of Open Access Journals (Sweden)

    Shurin MR

    2012-06-01

    Full Text Available Michael R ShurinDepartments of Pathology and Immunology, University of Pittsburgh Medical Center, Pittsburgh, PA, USAAbstract: The link between oncology and immunology has a long history and its development is forced by the necessity to develop innovative and highly efficient modalities for immunological destruction of malignant cells. The limited efficacy of surgery, chemotherapy and radiation also exemplify these issues, as these treatments do not eliminate all cancerous cells, do not address the immunosuppressive nature of the disease and can further impair the patient's immune response weakening patient's resistance to the cancer. Multidisciplinary analysis of the interaction between the immune system and cancer in preclinical and clinical settings suggests that the immune system is closely intertwined with both cancer pathogenesis and treatment. On the one hand, cancer is a manifestation of malfunctions in immunity, as malignant cells manage to escape recognition and elimination by the immune system. Chronic infections and inflammation associated with limited or polarized immune responses also contribute to carcinogenesis and tumor progression. The tumor immunoenvironment represents specific conditions and elements that support cancerous cell survival, proliferation and spreading. On the other hand, the specificity and strength of antitumor immunity is a powerful and efficient tool that can be used to recognize and destroy neoplastic cells or their supporting microenvironment. Understanding the role of the immune system in controlling and supporting tumor initiation, formation, growth and progression has crucial implications for cancer therapy and will therefore guide the future development of cancer immunotherapy and its combination with conventional therapies to achieve optimal antitumor effects in patients with different types of cancer.Keywords: tumor immunology and immunotherapy, tumor immunoenvironment, cancer, immunosuppression

  17. Azithromycin prophylaxis and treatment of murine toxoplasmosis.

    Science.gov (United States)

    Tabbara, Khalid F; Hammouda, Ehab; Tawfik, Abdulkader; Al-Omar, Othman M; Abu El-Asrar, Ahmed M

    2005-03-01

    To evaluate the azithromycin effects alone and in combination with other agents in the prophylaxis and treatment of murine toxoplasmosis. A total of 280 BALB/c mice were included, and 2 x 103 Toxoplasma organisms of the RH strain Toxoplasma gondii strain ATCC50174 were given intraperitoneally to each mouse. In experiment one, 40 animals were given azithromycin 200 milligram/kilogram/daily for 3 days starting the day of inoculation, 40 mice were control. In experiment 2, the treatment was started 48 hours after inoculation and given daily for 3 days: one group received azithromycin 200 milligram/kilogram/day, the second group received pyrimethamine 25 milligram/kilogram/day, and the sulfadiazine 100 milligram/kilogram/day. The third group was control. In experiment 3, 7 groups of animals received one of the following (1) none, (2) azithromycin 200 milligram/kilogram/day, (3) pyrimethamine 25 milligram/kilogram/day and sulfadiazine 100 milligram/kilogram/day, (4) azithromycin and sulfadiazine, (5) azithromycin and pyrimethamine, (6) azithromycin with sulfadiazine and pyrimethamine, (7) sulfadiazine alone. Treatment was initiated 72 hours after inoculation for 3 days. The study was conducted at the Animal Care Facility of King Saud University, Riyadh, Kingdom of Saudi Arabia. Animals that received azithromycin simultaneously with inoculation survived, and all control animals died. All animals died in groups receiving single drug therapy. Animals treated with azithromycin and sulfadiazine showed a survival rate of 40%, sulfadiazine and pyrimethamine 40%, or azithromycin with sulfadiazine and pyrimethamine 95% (p<0.0001). Azithromycin alone was found to be effective in the prophylaxis of murine toxoplasmosis. Combination therapy was effective in the treatment of murine toxoplasmosis.

  18. Efficacy of posaconazole in murine experimental sporotrichosis.

    Science.gov (United States)

    Fernández-Silva, Fabiola; Capilla, Javier; Mayayo, Emilio; Guarro, Josep

    2012-05-01

    We developed a murine model of systemic sporotrichosis by using three strains of each of the two commonest species causing sporotrichosis, i.e., Sporothrix schenckii sensu stricto and Sporothrix brasiliensis, in order to evaluate the efficacy of posaconazole (PSC). The drug was administered at a dose of 2.5 or 5 mg/kg of body weight twice a day by gavage, and one group was treated with amphotericin B (AMB) as a control treatment. Posaconazole, especially at 5 mg/kg, showed good efficacy against all the strains tested, regardless of their MICs, as measured by prolonged survival, tissue burden reduction, and histopathology.

  19. Irradiation Design for an Experimental Murine Model

    International Nuclear Information System (INIS)

    Ballesteros-Zebadua, P.; Moreno-Jimenez, S.; Suarez-Campos, J. E.; Celis, M. A.; Larraga-Gutierrez, J. M.; Garcia-Garduno, O. A.; Rubio-Osornio, M. C.; Custodio-Ramirez, V.; Paz, C.

    2010-01-01

    In radiotherapy and stereotactic radiosurgery, small animal experimental models are frequently used, since there are still a lot of unsolved questions about the biological and biochemical effects of ionizing radiation. This work presents a method for small-animal brain radiotherapy compatible with a dedicated 6MV Linac. This rodent model is focused on the research of the inflammatory effects produced by ionizing radiation in the brain. In this work comparisons between Pencil Beam and Monte Carlo techniques, were used in order to evaluate accuracy of the calculated dose using a commercial planning system. Challenges in this murine model are discussed.

  20. Thrombopoietin inhibits murine mast cell differentiation

    Science.gov (United States)

    Martelli, Fabrizio; Ghinassi, Barbara; Lorenzini, Rodolfo; Vannucchi, Alessandro M; Rana, Rosa Alba; Nishikawa, Mitsuo; Partamian, Sandra; Migliaccio, Giovanni; Migliaccio, Anna Rita

    2009-01-01

    We have recently shown that Mpl, the thrombopoietin receptor, is expressed on murine mast cells and on their precursors and that targeted deletion of the Mpl gene increases mast cell differentiation in mice. Here we report that treatment of mice with thrombopoietin, or addition of this growth factor to bone marrow-derived mast cell cultures, severely hampers the generation of mature cells from their precursors by inducing apoptosis. Analysis of the expression profiling of mast cells obtained in the presence of thrombopoietin suggests that thrombopoietin induces apoptosis of mast cells by reducing expression of the transcription factor Mitf and its target anti-apoptotic gene Bcl2. PMID:18276801

  1. Imbalanced immune homeostasis in immune thrombocytopenia.

    Science.gov (United States)

    Yazdanbakhsh, Karina

    2016-04-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Growth versus immunity--a redirection of the cell cycle?

    Science.gov (United States)

    Eichmann, Ruth; Schäfer, Patrick

    2015-08-01

    Diseases caused by plant pathogens significantly reduce growth and yield in agricultural crop production. Raising immunity in crops is therefore a major aim in breeding programs. However, efforts to enhance immunity are challenged by the occurrence of growth inhibition triggered by immunity that can be as detrimental as diseases. In this review, we will propose molecular models to explain the inhibitory growth-immunity crosstalk. We will briefly discuss why the resource reallocation model might not represent the driving force for the observed growth-immunity trade-offs. We suggest a model in which immunity redirects and initiates hormone signalling activities that can impair plant growth by antagonising cell cycle regulation and meristem activities. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Investigations into the Immunotoxicity and Allergic Potential Induced by Topical Application of N-Butylbenzenesulfonamide (NBBS) in a Murine Model

    Science.gov (United States)

    Marrocco, Antonella; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.; Anderson, Stacey E.

    2015-01-01

    N-Butylbenzene sulfonamide (NBBS) is a commonly used plasticizer found in numerous products. Due to its extensive use, lack of adequate toxicological data, and suspicion of toxicity based on the presence of structural alerts, it was nominated to the National Toxicology Program for comprehensive toxicological testing. The purpose of this study was to evaluate the potential for hypersensitivity and immune suppression following dermal exposure to NBBS using a murine model. NBBS tested negative in a combined irritancy/local lymph node assay (LLNA), classifying it as nonirritating and nonsensitizing. To estimate the immunosuppressive potential of NBBS, assays that assessed immunotoxicity were performed, including the immumnoglobulin (Ig) M response to T-cell-dependent antigen sheep red blood cells (SRBC), using the plaque-forming cell (PFC) assay and immune cell phenotyping. After a 28-d treatment with NBBS, mice exposed to the lowest concentration (25% NBBS) showed a significant increase in IgM-producing B cells in the spleen. No marked changes were identified in immune cell markers in the lymph node. In contrast to body weight, a significant elevation in kidney and liver weight was observed following dermal exposure to all concentrations of NBBS. These results demonstrate that dermal exposure to NBBS, other than liver and kidney toxicity, did not apparently induce immunotoxicity in a murine model. PMID:26291892

  4. Immunotherapy of Alzheimer's disease (AD): from murine models to anti-amyloid beta (Abeta) human monoclonal antibodies.

    Science.gov (United States)

    Geylis, Valeria; Steinitz, Michael

    2006-01-01

    The deposition of amyloid beta (Abeta) protein is a key pathological feature in Alzheimer's disease (AD). In murine models of AD, both active and passive immunization against Abeta induce a marked reduction in amyloid brain burden and an improvement in cognitive functions. Preliminary results of a prematurely terminated clinical trial where AD patients were actively vaccinated with aggregated Abeta bear resemblance to those documented in murine models. Passive immunization of AD patients with anti-Abeta antibodies, in particular human antibodies, is a strategy that provides a more cautious management and control of any undesired side effects. Sera of all healthy adults contain anti-Abeta IgG autoimmune antibodies. Hence antigen-committed human B-cells are easily immortalized by Epstein-Barr virus (EBV) into anti-Abeta secreting cell lines. Two anti-Abeta human monoclonal antibodies which we recently prepared bind to the N-terminus of Abeta peptide and were shown to stain amyloid plaques in non-fixed brain sections from an AD patient. It is anticipated that specifically selected anti-Abeta human monoclonal antibodies could reduce and inhibit deposits of amyloid in brain while avoiding the cognitive decline that characterizes AD. In the future, this type of antibody may prove to be a promising immune therapy for the disease.

  5. Immune System (For Parents)

    Science.gov (United States)

    ... of the Immune System Print en español El sistema inmunitario The immune system, which is made up ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on KidsHealth® is for ...

  6. Immunity by equilibrium.

    Science.gov (United States)

    Eberl, Gérard

    2016-08-01

    The classical model of immunity posits that the immune system reacts to pathogens and injury and restores homeostasis. Indeed, a century of research has uncovered the means and mechanisms by which the immune system recognizes danger and regulates its own activity. However, this classical model does not fully explain complex phenomena, such as tolerance, allergy, the increased prevalence of inflammatory pathologies in industrialized nations and immunity to multiple infections. In this Essay, I propose a model of immunity that is based on equilibrium, in which the healthy immune system is always active and in a state of dynamic equilibrium between antagonistic types of response. This equilibrium is regulated both by the internal milieu and by the microbial environment. As a result, alteration of the internal milieu or microbial environment leads to immune disequilibrium, which determines tolerance, protective immunity and inflammatory pathology.

  7. Immunity's ancient arms

    OpenAIRE

    Litman, Gary W.; Cannon, John P.

    2009-01-01

    Diverse receptors on two types of cell mediate adaptive immunity in jawed vertebrates. In the lamprey, a jawless vertebrate, immunity is likewise compartmentalized but the molecular mechanics are very different.

  8. [Immune system and tumors].

    Science.gov (United States)

    Terme, Magali; Tanchot, Corinne

    2017-02-01

    Despite having been much debated, it is now well established that the immune system plays an essential role in the fight against cancer. In this article, we will highlight the implication of the immune system in the control of tumor growth and describe the major components of the immune system involved in the antitumoral immune response. The immune system, while exerting pressure on tumor cells, also will play a pro-tumoral role by sculpting the immunogenicity of tumors cells as they develop. Finally, we will illustrate the numerous mechanisms of immune suppression that take place within the tumoral microenvironment which allow tumor cells to escape control from the immune system. The increasingly precise knowledge of the brakes to an effective antitumor immune response allows the development of immunotherapy strategies more and more innovating and promising of hope. Copyright © 2016. Published by Elsevier Masson SAS.

  9. Immune System and Disorders

    Science.gov (United States)

    Your immune system is a complex network of cells, tissues, and organs that work together to defend against germs. It ... t, to find and destroy them. If your immune system cannot do its job, the results can be ...

  10. Aging changes in immunity

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/004008.htm Aging changes in immunity To use the sharing features ... cells and antibodies that destroy these harmful substances. AGING CHANGES AND THEIR EFFECTS ON THE IMMUNE SYSTEM ...

  11. Immunizations for adult women.

    Science.gov (United States)

    Faubion, Stephanie S; Larkin, Lisa C

    2016-12-01

    Immunizations protect individual persons and contribute to public health by reducing morbidity and mortality associated with common infectious diseases. In this Practice Pearl, we review guidelines for adult immunizations and recent and potential changes in vaccines.

  12. Mild Cognitive Impairment (MCI)

    Science.gov (United States)

    Mild cognitive impairment (MCI) Overview Mild cognitive impairment (MCI) is an intermediate stage between the expected cognitive decline of normal aging and the more-serious decline of dementia. It ...

  13. Measuring and managing cognitive impairment in HIV.

    Science.gov (United States)

    Nightingale, Sam; Winston, Alan

    2017-06-01

    : Cognitive impairment remains a frequently reported complaint in HIV-positive patients despite virologically suppressive antiretroviral therapy. Rates of cognitive impairment in antiretroviral treated HIV-positive cohorts vary and strongly depend on definitions utilized.The underlying pathogenesis is likely to be multifactorial and includes immune activation, neuroinflammation, antiretroviral neurotoxicity, the presence of noninfectious comorbidities such as vascular disease and depression and patient lifestyle factors such as recreational drug use.Contributing factors to cognitive impairment may change over time with ageing HIV-positive populations. Cerebrovascular disease and neurodegenerative causes of cognitive impairment may become more common with advancing age; how these factors interact with HIV-associated cognitive impairment is not yet known.Cerebrospinal fluid HIV RNA escape may occur in up to 10% of patients undergoing lumbar puncture clinically and can be associated with compartmentalized and resistant virus.Changes in antiretroviral therapy in patients with cognitive impairment should be based on current and historic resistance profiles of cerebrospinal fluid and plasma virus, or on potential antiretroviral drug neurotoxicity. Whether and how antiretroviral therapy should be changed in the absence of these factors is not known and requires study in adequately powered randomized trials in carefully selected clinical cohorts.

  14. Immune system simulation online

    DEFF Research Database (Denmark)

    Rapin, Nicolas; Lund, Ole; Castiglione, Filippo

    2011-01-01

    MOTIVATION: The recognition of antigenic peptides is a major event of an immune response. In current mesoscopic-scale simulators of the immune system, this crucial step has been modeled in a very approximated way. RESULTS: We have equipped an agent-based model of the immune system with immuno...

  15. The Immune System Game

    Science.gov (United States)

    Work, Kirsten A.; Gibbs, Melissa A.; Friedman, Erich J.

    2015-01-01

    We describe a card game that helps introductory biology students understand the basics of the immune response to pathogens. Students simulate the steps of the immune response with cards that represent the pathogens and the cells and molecules mobilized by the immune system. In the process, they learn the similarities and differences between the…

  16. Plant innate immunity

    Indian Academy of Sciences (India)

    Plants are invaded by an array of pathogens of which only a few succeed in causing disease. The attack by others is countered by a sophisticated immune system possessed by the plants. The plant immune system is broadly divided into two, viz. microbial-associated molecular-patterns-triggered immunity (MTI) and ...

  17. Modulation of phenotypic and functional maturation of murine dendritic cells (DCs) by purified Achyranthes bidentata polysaccharide (ABP).

    Science.gov (United States)

    Zou, Yaxuan; Meng, Jingjuan; Chen, Wenna; Liu, Jingling; Li, Xuan; Li, Weiwei; Lu, Changlong; Shan, Fengping

    2011-08-01

    There are a large number of interactions at molecular and cellular levels between the plant polysaccharides and immune system. Plant polysaccharides present an interesting effects as immunomodulators, particularly in the induction of the cells both in innate and adaptive immune systems. Activation of DCs could improve antitumoral responses usually diminished in cancer patients, and natural adjuvants provide a possibility of inducing this activation. ABP is a purified polysaccharide isolated from Achyranthes bidentata, a traditional Chinese medicine (TCM). The aim of this study is to investigate modulation of phenotypic and functional maturation of murine DCs by ABP. Both phenotypic and functional activities were assessed with use of conventional scanning electronic microscopy (SEM) for the morphology of the DC, transmitted electron microscopy (TEM) for intracellular lysosomes inside the DC, cellular immunohistochemistry for phagocytosis by the DCs, flow cytometry (FCM) for the changes in key surface molecules, bio-assay for the activity of acidic phosphatases (ACP), and ELISA for the production of pro-inflammatory cytokine IL-12. In fact, we found that purified ABP induced phenotypic maturation revealed by increased expression of CD86, CD40, and MHC II. Functional experiments showed the down-regulation of ACP inside DCs (which occurs when phagocytosis of DCs is decreased, and antigen presentation increased with maturation). Finally, ABP increased the production of IL-12. These data reveal that ABP promotes effective activation of murine DCs. This adjuvant-like activity may have therapeutic applications in clinical settings where immune responses need boosting. It is therefore concluded that ABP can exert positive modulation to murine DCs. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Adapting for Impaired Patrons.

    Science.gov (United States)

    Schuyler, Michael

    1999-01-01

    Describes how a library, with an MCI Corporation grant, approached the process of setting up computers for the visually impaired. Discusses preparations, which included hiring a visually-impaired user as a consultant and contacting the VIP (Visually Impaired Persons) group; equipment; problems with the graphical user interface; and training.…

  19. [Virulence of Sporothrix globosa in murine models].

    Science.gov (United States)

    Cruz Choappa, Rodrigo; Pérez Gaete, Salomón; Rodríguez Badilla, Valentina; Vieille Oyarzo, Peggy; Opazo Sanchez, Héctor

    The sporothricosis disease is an infection caused by species included in Sporothrix schenkii complex. Verify the virulence of a strain of S. globosa using two different concentrations of inoculum by intraperitoneally and subcutaneously, into a mouse model. Nonrandomized pilot study, in murine inoculated with a strain of S. globosa (CBS 14.076M) by intraperitoneally and subcutaneously with inoculum concentrations of 0.5 and 4 McFarland. For this purpose 18 rodents CF-1 (ISP, Santiago, Chile) were used. The studied strain did not induce illness or injury on animals, they all survived and neither the tissue culture nor the histopathological analysis showed fungal growth or suggestive infection by organ abnormalities. The S. globosa strain did not present any virulence enough to cause disease at 0.5 and 4.0 McFarland concentration inoculum when inoculated in both intraperitoneally and subcutaneously, in murine models. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Induction of antitumor immunity through xenoplacental immunization

    Directory of Open Access Journals (Sweden)

    Agadjanyan Michael G

    2006-05-01

    Full Text Available Abstract Historically cancer vaccines have yielded suboptimal clinical results. We have developed a novel strategy for eliciting antitumor immunity based upon homology between neoplastic tissue and the developing placenta. Placenta formation shares several key processes with neoplasia, namely: angiogenesis, activation of matrix metalloproteases, and active suppression of immune function. Immune responses against xenoantigens are well known to break self-tolerance. Utilizing xenogeneic placental protein extracts as a vaccine, we have successfully induced anti-tumor immunity against B16 melanoma in C57/BL6 mice, whereas control xenogeneic extracts and B16 tumor extracts where ineffective, or actually promoted tumor growth, respectively. Furthermore, dendritic cells were able to prime tumor immunity when pulsed with the placental xenoantigens. While vaccination-induced tumor regression was abolished in mice depleted of CD4 T cells, both CD4 and CD8 cells were needed to adoptively transfer immunity to naïve mice. Supporting the role of CD8 cells in controlling tumor growth are findings that only freshly isolated CD8 cells from immunized mice were capable of inducing tumor cell caspases-3 activation ex vivo. These data suggest feasibility of using xenogeneic placental preparations as a multivalent vaccine potently targeting not just tumor antigens, but processes that are essential for tumor maintenance of malignant potential.

  1. Ablation of the Leptin receptor in Myeloid Cells Impairs Pulmonary Clearance of Streptococcus Pneumoniae and Alveolar Macrophage Bactericidal Function.

    Science.gov (United States)

    Mancuso, Peter; Curtis, Jeffrey L; Freeman, Christine M; Peters-Golden, Marc; Weinberg, Jason B; Myers, Martin G

    2018-03-22

    Leptin is a pleiotropic hormone produced by white adipose tissue that regulates appetite and many physiologic functions including the immune response to infection. Genetic leptin deficiency in humans and mice impairs host defenses against respiratory tract infections. Since leptin deficiency is associated with obesity and other metabolic abnormalities, we generated mice that lack the leptin receptor (LepRb) in cells of the myeloid linage (LysM-LepRb-KO) to evaluate its impact in lean metabolically normal mice in a murine model of pneumococcal pneumonia. We observed higher lung and spleen bacterial burdens in LysM-LepRb-KO mice following an intratracheal challenge with S. pneumoniae. Although numbers of leukocytes recovered from bronchoalveolar lavage fluid did not differ between groups, we did observe higher levels of pulmonary IL-13 and TNFα in LysM-LepRb-KO mice 48 h post-infection. Phagocytosis and killing of ingested S. pneumoniae were also impaired in alveolar macrophages (AM)s from LysM-LepRb-KO mice in vitro, and was associated with reduced LTB4 and enhanced PGE2 synthesis in vitro. Pretreatment of AMs with LTB4 and the cyclooxygenase inhibitor, indomethacin, restored phagocytosis but not bacterial killing in vitro. These results, confirm our previous observations in leptin-deficient (ob/ob) and fasted mice, and demonstrate that decreased leptin action, as opposed to metabolic irregularities associated with obesity or starvation, are responsible for the defective host defense against pneumococcal pneumonia. They also provide novel targets for therapeutic intervention in humans with bacterial pneumonia.

  2. Critical role for thymic CD19+CD5+CD1dhiIL-10+ regulatory B cells in immune homeostasis.

    Science.gov (United States)

    Xing, Chen; Ma, Ning; Xiao, He; Wang, Xiaoqian; Zheng, Mingke; Han, Gencheng; Chen, Guojiang; Hou, Chunmei; Shen, Beifen; Li, Yan; Wang, Renxi

    2015-03-01

    This study tested the hypothesis that besides the spleen, LNs, peripheral blood, and thymus contain a regulatory IL-10-producing CD19(+)CD5(+)CD1d(high) B cell subset that may play a critical role in the maintenance of immune homeostasis. Indeed, this population was identified in the murine thymus, and furthermore, when cocultured with CD4(+) T cells, this population of B cells supported the maintenance of CD4(+)Foxp3(+) Tregs in vitro, in part, via the CD5-CD72 interaction. Mice homozygous for Cd19(Cre) (CD19(-/-)) express B cells with impaired signaling and humoral responses. Strikingly, CD19(-/-) mice produce fewer CD4(+)Foxp3(+) Tregs and a greater percentage of CD4(+)CD8(-) and CD4(-)CD8(+) T cells. Consistent with these results, transfer of thymic CD19(+)CD5(+)CD1d(hi) B cells into CD19(-/-) mice resulted in significantly up-regulated numbers of CD4(+)Foxp3(+) Tregs with a concomitant reduction in CD4(+)CD8(-) and CD4(-)CD8(+) T cell populations in the thymus, spleen, and LNs but not in the BM of recipient mice. In addition, thymic CD19(+)CD5(+)CD1d(hi) B cells significantly suppressed autoimmune responses in lupus-like mice via up-regulation of CD4(+)Foxp3(+) Tregs and IL-10-producing Bregs. This study suggests that thymic CD19(+)CD5(+)CD1d(hi)IL-10(+) Bregs play a critical role in the maintenance of immune homeostasis. © Society for Leukocyte Biology.

  3. Murine but not human basophil undergoes cell-specific proteolysis of a major endoplasmic reticulum chaperone.

    Directory of Open Access Journals (Sweden)

    Bei Liu

    Full Text Available Basophil has been implicated in anti-parasite defense, allergy and in polarizing T(H2 response. Mouse model has been commonly used to study basophil function although the difference between human and mouse basophils is underappreciated. As an essential chaperone for multiple Toll-like receptors and integrins in the endoplasmic reticulum, gp96 also participates in general protein homeostasis and in the ER unfolded protein response to ensure cell survival during stress. The roles of gp96 in basophil development are unknown.We genetically delete gp96 in mice and examined the expression of gp96 in basophils by Western blot and flow cytometry. We compared the expression pattern of gp96 between human and mouse basophils.We found that gp96 was dispensable for murine basophil development. Moreover, gp96 was cleaved by serine protease(s in murine but not human basophils leading to accumulation of a nun-functional N-terminal ∼50 kDa fragment and striking induction of the unfolded protein response. The alteration of gp96 was unique to basophils and was not observed in any other cell types including mast cells. We also demonstrated that the ectopic expression of a mouse-specific tryptase mMCP11 does not lead to gp96 cleavage in human basophils.Our study revealed a remarkable biochemical event of gp96 silencing in murine but not human basophils, highlighting the need for caution in using mouse models to infer the function of basophils in human immune response. Our study also reveals a novel mechanism of shutting down gp96 post-translationally in regulating its function.

  4. Murine but not human basophil undergoes cell-specific proteolysis of a major endoplasmic reticulum chaperone.

    Science.gov (United States)

    Liu, Bei; Staron, Matthew; Li, Zihai

    2012-01-01

    Basophil has been implicated in anti-parasite defense, allergy and in polarizing T(H)2 response. Mouse model has been commonly used to study basophil function although the difference between human and mouse basophils is underappreciated. As an essential chaperone for multiple Toll-like receptors and integrins in the endoplasmic reticulum, gp96 also participates in general protein homeostasis and in the ER unfolded protein response to ensure cell survival during stress. The roles of gp96 in basophil development are unknown. We genetically delete gp96 in mice and examined the expression of gp96 in basophils by Western blot and flow cytometry. We compared the expression pattern of gp96 between human and mouse basophils. We found that gp96 was dispensable for murine basophil development. Moreover, gp96 was cleaved by serine protease(s) in murine but not human basophils leading to accumulation of a nun-functional N-terminal ∼50 kDa fragment and striking induction of the unfolded protein response. The alteration of gp96 was unique to basophils and was not observed in any other cell types including mast cells. We also demonstrated that the ectopic expression of a mouse-specific tryptase mMCP11 does not lead to gp96 cleavage in human basophils. Our study revealed a remarkable biochemical event of gp96 silencing in murine but not human basophils, highlighting the need for caution in using mouse models to infer the function of basophils in human immune response. Our study also reveals a novel mechanism of shutting down gp96 post-translationally in regulating its function.

  5. Environmentally determined differences in the murine lung microbiota and their relation to alveolar architecture.

    Directory of Open Access Journals (Sweden)

    Yeojun Yun

    Full Text Available Commensal bacteria control the micro-ecology of metazoan epithelial surfaces with pivotal effect on tissue homeostasis and host defense. In contrast to the upper respiratory tract, the lower respiratory tract of healthy individuals has largely been considered free of microorganisms. To understand airway micro-ecology we studied microbiota of sterilely excised lungs from mice of different origin including outbred wild mice caught in the natural environment or kept under non-specific-pathogen-free (SPF conditions as well as inbred mice maintained in non-SPF, SPF or germ-free (GF facilities. High-throughput pyrosequencing of reverse transcribed 16S rRNA revealed metabolically active murine lung microbiota in all but GF mice. The overall composition across samples was similar at the phylum and family level. However, species richness was significantly different between lung microbiota from SPF and non-SPF mice. Non-cultivatable Betaproteobacteria such as Ralstonia spp. made up the major constituents and were also confirmed by 16S rRNA gene cloning analysis. Additionally, Pasteurellaceae, Enterobacteria and Firmicutes were isolated from lungs of non-SPF mice. Bacterial communities were detectable by fluorescent in situ hybridization (FISH at alveolar epithelia in the absence of inflammation. Notably, higher bacterial abundance in non-SPF mice correlated with more and smaller size alveolae, which was corroborated by transplanting Lactobacillus spp. lung isolates into GF mice. Our data indicate a common microbial composition of murine lungs, which is diversified through different environmental conditions and affects lung architecture. Identification of the microbiota of murine lungs will pave the path to study their influence on pulmonary immunity to infection and allergens using mouse models.

  6. Stress effect on humoral and cell mediated immune response: Indispensable part of corticosterone and cytokine in neutrophil function

    Directory of Open Access Journals (Sweden)

    Sakthivel Srinivasan

    2016-01-01

    Conclusion: This result further concludes that prior immunization of SRBC in animal’s act as a vaccination, which helps to prevent noise stress induced impairment in immune system. Orally administered I. tinctoria prevented noise altered immune system. These results also concluded that I. tinctoria supplementation could act as an immunomodulators and suggesting its therapeutic efficacy as an antistressor.

  7. Functional characterization of Foxp3-specific spontaneous immune responses

    DEFF Research Database (Denmark)

    Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann

    2013-01-01

    Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....

  8. Enhancement of syngeneic murine tumour transplantability by whole body irradiation

    International Nuclear Information System (INIS)

    Peters, L.J.

    1975-01-01

    Experiments were undertaken to test the general validity of the assumption that potentiation of tumour transplantability by sublethal whole body irradiation (WBI) implies some degree of immunological resistance in the intact host. A transplantable carcinoma of spontaneous origin in CBA mice which exhibits a large WBI effect was assayed quantitatively in mice which had been immunologically crippled in terms of allograft acceptance by depletion of thymus derived lymphocytes. The mean number of tumour cells required for 50% successful takes (TD 50 ) in these mice was found to be not significantly different from that in normal controls but highly significantly greater than in WBI mice. On the other hand, in mice which underwent laparotomy immediately before assay, the TD 50 was reduced significantly though not to the same extent as in WBI mice. It was concluded that WBI effect was not due to impaired host immunity but possibly to physiological changes resulting from acute stress. The hypothesis that hyperfibrinogenaemia which occurs after both WBI and laparotomy might increase tumour transplantability was rejected because of the lack of correlation between TD 50 and fibrinogen levels at different times after each procedure. From this and other work it is apparent that TD 50 data, in themselves, give no reliable indication of host immunity. (author)

  9. Brucella abortusΔcydCΔcydD and ΔcydCΔpurD double-mutants are highly attenuated and confer long-term protective immunity against virulent Brucella abortus.

    Science.gov (United States)

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Kim, Kiju; Hahn, Tae-Wook

    2016-01-04

    We constructed double deletion (ΔcydCΔcydD and ΔcydCΔpurD) mutants from virulent Brucella abortus biovar 1 field isolate (BA15) by deleting the genes encoding an ATP-binding cassette-type transporter (cydC and cydD genes) and a phosphoribosylamine-glycine ligase (purD). Both BA15ΔcydCΔcydD and BA15ΔcydCΔpurD double-mutants exhibited significant attenuation of virulence when assayed in murine macrophages or in BALB/c mice. Both double-mutants were readily cleared from spleens by 4 weeks post-inoculation even when inoculated at the dose of 10(8) CFU per mouse. Moreover, the inoculated mice showed no splenomegaly, which indicates that the mutants are highly attenuated. Importantly, the attenuation of in vitro and in vivo growth did not impair the ability of these mutants to confer long-term protective immunity in mice against challenge with B. abortus strain 2308. Vaccination of mice with either mutant induced humoral and cell-mediated immune responses, and provided significantly better protection than commercial B. abortus strain RB51 vaccine. These results suggest that highly attenuated BA15ΔcydCΔcydD and BA15ΔcydCΔpurD mutants can be used effectively as potential live vaccine candidates against bovine brucellosis. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Memory Impairment in Children with Language Impairment

    Science.gov (United States)

    Baird, Gillian; Dworzynski, Katharina; Slonims, Vicky; Simonoff, Emily

    2010-01-01

    Aim: The aim of this study was to assess whether any memory impairment co-occurring with language impairment is global, affecting both verbal and visual domains, or domain specific. Method: Visual and verbal memory, learning, and processing speed were assessed in children aged 6 years to 16 years 11 months (mean 9y 9m, SD 2y 6mo) with current,…

  11. Cytokine regulation of immune tolerance

    OpenAIRE

    Wu, Jie; Xie, Aini; Chen, Wenhao

    2014-01-01

    The immune system provides defenses against invading pathogens while maintaining immune tolerance to self-antigens. This immune homeostasis is harmonized by the direct interactions between immune cells and the cytokine environment in which immune cells develop and function. Herein, we discuss three non-redundant paradigms by which cytokines maintain or break immune tolerance. We firstly describe how anti-inflammatory cytokines exert direct inhibitory effects on immune cells to enforce immune ...

  12. Kidney and innate immunity.

    Science.gov (United States)

    Wang, Ying-Hui; Zhang, Yu-Gen

    2017-03-01

    Innate immune system is an important modulator of the inflammatory response during infection and tissue injury/repair. The kidney as a vital organ with high energy demand plays a key role in regulating the disease related metabolic process. Increasing research interest has focused on the immune pathogenesis of many kidney diseases. However, innate immune cells such as dendritic cells, macrophages, NK cells and a few innate lymphocytes, as well as the complement system are essential for renal immune homeostasis and ensure a coordinated balance between tissue injury and regeneration. The innate immune response provides the first line of host defense initiated by several classes of pattern recognition receptors (PRRs), such as membrane-bound Toll-like receptors (TLRs) and nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs), together with inflammasomes responsible for early innate immune response. Although the innate immune system is well studied, the research on the detailed relationship between innate immunity and kidney is still very limited. In this review, we will focus on the innate immune sensing system in renal immune homeostasis, as well as the corresponding pathogenesis of many kidney diseases. The pivotal roles of innate immunity in renal injury and regeneration with special emphasis on kidney disease related immunoregulatory mechanism are also discussed. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  13. Alternative Immune Systems

    Directory of Open Access Journals (Sweden)

    Luis Fernando Cadavid Gutierrez

    2011-09-01

    Full Text Available The immune system in animals is a complex network of molecules, cells and tissues that coordinately maintain the physiological and genetic integrity of the organism. Traditionally, two classes of immunity have been considered, the innate immunity and the adaptive immunity. The former is ancestral, with limited variability and low discrimination. The latter is highly variable, specific and limited to jawed vertebrates. Adaptive immunity is based on antigen receptors that rearrange somatically to generate a nearly unlimited diversity of molecules. Likely, this mechanism of somatic recombination arose as a consequence of a horizontal transfer of transposons and transposases from bacterial genomes in the ancestor of jawed vertebrates. The recent discovery in jawless vertebrates and invertebrates of alternative adaptive immune mechanisms, suggests during evolution different animal groups have found alternative solutions to the problem of immune recognition.

  14. The effects of early life adversity on the immune system.

    Science.gov (United States)

    Elwenspoek, Martha M C; Kuehn, Annette; Muller, Claude P; Turner, Jonathan D

    2017-08-01

    Early life adversity (ELA) is associated with a higher risk for diseases in adulthood. Although the pathophysiological effects of ELA are varied, there may be a unifying role for the immune system in all of the long-term pathologies such as chronic inflammatory disorders (autoimmune diseases, allergy, and asthma). Recently, significant efforts have been made to elucidate the long-term effects ELA has on immune function, as well as the mechanisms underlying these immune changes. In this review, we focus on data from human studies investigating immune parameters in relation to post-natal adverse experiences. We describe the current understanding of the 'ELA immune phenotype', characterized by inflammation, impairment of the cellular immune system, and immunosenescence. However, at present, data addressing specific immune functions are limited and there is a need for high-quality, well powered, longitudinal studies to unravel cause from effect. Besides the immune system, also the stress system and health behaviors are altered in ELA. We discuss probable underlying mechanisms based on epigenetic programming that could explain the ELA immune phenotype and whether this is a direct effect of immune programming or an indirect consequence of changes in behavior or stress reactivity. Understanding the underlying mechanisms will help define effective strategies to prevent or counteract negative ELA-associated outcomes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. A Leishmania murine model to evaluate the immunomodulatory properties of Pythium insidiosum proteins

    Directory of Open Access Journals (Sweden)

    Tatiana Maria Inêz-Ferreira

    2017-03-01

    Full Text Available Pythium insidiosum immunomodulatory vaccine (PiV has been tested in clinical and experimental pythiosis. Previous data showed that P. insidiosum immunogens have the ability to switch the Th2 immune response, normally in place during pythiosis, to a curative Th1 response. Pythiosis cannot be reproduced in experimental rodents with the exception of rabbits, and thus thorough evaluation of PiV´s immunomodulatory properties has been limited by the lack of a compatible inbred mouse model. In this study, we took advantage of the murine BALB/c Leishmania infection model, where infected mice produce a Th2 response, to evaluate the PiV Th2 to Th1 immunomodulatory potential. Twenty-one days following challenge with L. major, large cutaneous granulomas developed in control mice, consistent with the expected Th2 response. In contrast, Leishmania-induced cutaneous lesions in PiV-immunized mice were minimal or absent. Flow cytometry analysis of spleen cells from mice immunized with PiV and subsequently challenged with L. major displayed more CD4+ and CD8+ cells than the control group. Moreover, spleen cells from mice that were immunized with PiV then challenged with L. major secreted high levels of IFN-γ, with a moderate IL-2, IL-4, and IL-10 mixed cytokine profile upon in vitro re-stimulation with PiV. Anti-P. insidiosum IgG1 in immunized animals was present at low titers suggesting a minor immunological role for this Ig isotype in this model. Our preliminary data showed that BALB/c mice challenged with L. major represent an attractive model in which to study PiV´s immunomodulatory properties.

  16. A murine model of type 2 autoimmune hepatitis: Xenoimmunization with human antigens.

    Science.gov (United States)

    Lapierre, Pascal; Djilali-Saiah, Idriss; Vitozzi, Susana; Alvarez, Fernando

    2004-04-01

    Autoimmune hepatitis (AIH) is characterized by an immune-mediated injury of the hepatic parenchyma of unknown pathogenesis. Type 2 AIH is identified by the presence of anti-liver-kidney microsomes type 1 (anti-LKM1) and anti-liver cytosol type 1 (anti-LC1) autoantibodies. The current study shows that a murine model of AIH can be generated by DNA immunization against type 2 AIH self-antigens (P450 2D6 and formiminotransferase-cyclodeaminase). A pCMV plasmid containing the N-terminal region of mouse CTLA-4 and the antigenic region of human CYP2D6 (672-1,377 bp) and human formiminotransferase cyclodeaminase (FTCD; 1,232-1,668 bp) was used for DNA immunization of C57BL/6 female mice. Immunized mice showed elevated levels of alanine aminotransferase (ALT), with peaks at 4 and 7 months postinjection. Periportal, portal, and intralobular liver inflammatory infiltrates were observed at histology. Mainly CD4+ lymphocytes, but also CD8+ and B lymphocytes, were found in the liver. Cytotoxic-specific T cells were found in both the liver and spleen of these animals. Mice developed anti-LKM1 and anti-LC1 antibodies of immunoglobulin G2 (IgG2) subclass, against specific mouse autoantigens. The ALT levels correlated with both the presence of anti-LKM1/anti-LC1 antibodies and the presence of liver necroinflammation. In conclusion, in mice, DNA immunization against human autoantigens breaks tolerance and induces an autoimmune liver disease. Molecular mimicry between foreign and self-antigens explains the liver injury. This model of AIH resembles human type 2 AIH and will be helpful for the study of its pathogenesis.

  17. Hepatitis C, innate immunity and alcohol: friends or foes?

    Science.gov (United States)

    Osna, Natalia A; Ganesan, Murali; Kharbanda, Kusum K

    2015-02-05

    Hepatitis C and alcohol are the most widespread causes of liver disease worldwide. Approximately 80% of patients with a history of hepatitis C and alcohol abuse develop chronic liver injury. Alcohol consumption in hepatitis C virus (HCV)-infected patients exacerbates liver disease leading to rapid progression of fibrosis, cirrhosis and even hepatocellular carcinoma. Hepatocytes are the main sites of HCV-infection and ethanol metabolism, both of which generate oxidative stress. Oxidative stress levels affect HCV replication and innate immunity, resulting in a greater susceptibility for HCV-infection and virus spread in the alcoholic patients. In this review paper, we analyze the effects of ethanol metabolism and other factors on HCV replication. In addition, we illustrate the mechanisms of how HCV hijacks innate immunity and how ethanol exposure regulates this process. We also clarify the effects of HCV and ethanol metabolism on interferon signaling-a crucial point for activation of anti-viral genes to protect cells from virus-and the role that HCV- and ethanol-induced impairments play in adaptive immunity which is necessary for recognition of virally-infected hepatocytes. In conclusion, ethanol exposure potentiates the suppressive effects of HCV on innate immunity, which activates viral spread in the liver and finally, leads to impairments in adaptive immunity. The dysregulation of immune response results in impaired elimination of HCV-infected cells, viral persistence, progressive liver damage and establishment of chronic infection that worsens the outcomes of chronic hepatitis C in alcoholic patients.

  18. Hepatitis C, Innate Immunity and Alcohol: Friends or Foes?

    Directory of Open Access Journals (Sweden)

    Natalia A. Osna

    2015-02-01

    Full Text Available Hepatitis C and alcohol are the most widespread causes of liver disease worldwide. Approximately 80% of patients with a history of hepatitis C and alcohol abuse develop chronic liver injury. Alcohol consumption in hepatitis C virus (HCV-infected patients exacerbates liver disease leading to rapid progression of fibrosis, cirrhosis and even hepatocellular carcinoma. Hepatocytes are the main sites of HCV-infection and ethanol metabolism, both of which generate oxidative stress. Oxidative stress levels affect HCV replication and innate immunity, resulting in a greater susceptibility for HCV-infection and virus spread in the alcoholic patients. In this review paper, we analyze the effects of ethanol metabolism and other factors on HCV replication. In addition, we illustrate the mechanisms of how HCV hijacks innate immunity and how ethanol exposure regulates this process. We also clarify the effects of HCV and ethanol metabolism on interferon signaling—a crucial point for activation of anti-viral genes to protect cells from virus—and the role that HCV- and ethanol-induced impairments play in adaptive immunity which is necessary for recognition of virally-infected hepatocytes. In conclusion, ethanol exposure potentiates the suppressive effects of HCV on innate immunity, which activates viral spread in the liver and finally, leads to impairments in adaptive immunity. The dysregulation of immune response results in impaired elimination of HCV-infected cells, viral persistence, progressive liver damage and establishment of chronic infection that worsens the outcomes of chronic hepatitis C in alcoholic patients.

  19. Measuring polio immunity to plan immunization activities.

    Science.gov (United States)

    Voorman, Arend; Lyons, Hil M

    2016-11-21

    The Global Polio Eradication Initiative is closer than ever to achieving a polio-free world. Immunization activities must still be carried out in non-endemic countries to maintain population immunity at levels which will stop poliovirus from spreading if it is re-introduced from still-infected areas. In areas where there is no active transmission of poliovirus, programs must rely on surrogate indicators of population immunity to determine the appropriate immunization activities, typically caregiver-reported vaccination history obtained from non-polio acute flaccid paralysis patients identified through polio surveillance. We used regression models to examine the relationship between polio vaccination campaigns and caregiver-reported polio vaccination history. We find that in many countries, vaccination campaigns have a surprisingly weak impact on these commonly used indicators. We conclude that alternative criteria and data, such as routine immunization indicators from vaccination records or household surveys, should be considered for planning polio vaccination campaigns, and that validation of such surrogate indicators is necessary if they are to be used as the basis for program planning and risk assessment. We recommend that the GPEI and similar organizations consider or continue devoting additional resources to rigorously study population immunity and campaign effectiveness in at-risk countries. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Effects of murine and human bone marrow-derived mesenchymal stem cells on cuprizone induced demyelination.

    Directory of Open Access Journals (Sweden)

    Jasmin Nessler

    Full Text Available For the treatment of patients with multiple sclerosis there are no regenerative approaches to enhance remyelination. Mesenchymal stem cells (MSC have been proposed to exert such regenerative functions. Intravenous administration of human MSC reduced the clinical severity of experimental autoimmune encephalomyelitis (EAE, an animal model mimicking some aspects of multiple sclerosis. However, it is not clear if this effect was achieved by systemic immunomodulation or if there is an active neuroregeneration in the central nervous system (CNS. In order to investigate remyelination and regeneration in the CNS we analysed the effects of intravenously and intranasally applied murine and human bone marrow-derived MSC on cuprizone induced demyelination, a toxic animal model which allows analysis of remyelination without the influence of the peripheral immune system. In contrast to EAE no effects of MSC on de- and remyelination and glial cell reactions were found. In addition, neither murine nor human MSC entered the lesions in the CNS in this toxic model. In conclusion, MSC are not directed into CNS lesions in the cuprizone model where the blood-brain-barrier is intact and thus cannot provide support for regenerative processes.

  1. A novel method for murine intrahepatic islet transplantation via cecal vein.

    Science.gov (United States)

    Byun, Nari; Kim, Hyun-Je; Min, Byoung-Hoon; Shin, Jun-Seop; Yoon, Il-Hee; Kim, Jong-Min; Kim, Yong-Hee; Park, Chung-Gyu

    2015-12-01

    Islet transplantation is one of the most beneficial treatment modality to treat type 1 diabetic patients with frequent hypoglycemic unawareness. In clinical setting, human islets are infused via portal vein and are settled in the end-portal venules in the liver. However, mouse islets are transplanted into kidney subcapsule or liver through direct portal vein. These conventional transplantation methods have several drawbacks such as different physiological environments around the transplanted islets in kidney subcapsule from the liver and high mortality rate in direct portal vein approach. In this study, we introduced murine intrahepatic islet transplantation method via cecal vein to have the same surgical operation route in humans as well as guaranteeing low mortality rate after islet transplantation. With this protocol, consistent normoglycemia can be obtained in diabetic mice, while keeping operation-related mortality extremely low. This approach with easier accessibility and low mortality will make murine intrahepatic islet transplantation a useful model for studying immunological mechanisms such as strong innate and adaptive immune responses that occur in human islet transplantation. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Accumulation of murine amyloid-β mimics early Alzheimer's disease.

    Science.gov (United States)

    Krohn, Markus; Bracke, Alexander; Avchalumov, Yosef; Schumacher, Toni; Hofrichter, Jacqueline; Paarmann, Kristin; Fröhlich, Christina; Lange, Cathleen; Brüning, Thomas; von Bohlen Und Halbach, Oliver; Pahnke, Jens

    2015-08-01

    Amyloidosis mouse models of Alzheimer's disease are generally established by transgenic approaches leading to an overexpression of mutated human genes that are known to be involved in the generation of amyloid-β in Alzheimer's families. Although these models made substantial contributions to the current knowledge about the 'amyloid hypothesis' of Alzheimer's disease, the overproduction of amyloid-β peptides mimics only inherited (familiar) Alzheimer's disease, which accounts for patients with Alzheimer's disease. The inherited form is even regarded a 'rare' disease according to the regulations for funding of the European Union (www.erare.eu). Here, we show that mice that are double-deficient for neprilysin (encoded by Mme), one major amyloid-β-degrading enzyme, and the ABC transporter ABCC1, a major contributor to amyloid-β clearance from the brain, develop various aspects of sporadic Alzheimer's disease mimicking the clinical stage of mild cognitive impairment. Using behavioural tests, electrophysiology and morphological analyses, we compared different ABC transporter-deficient animals and found that alterations are most prominent in neprilysin × ABCC1 double-deficient mice. We show that these mice have a reduced probability to survive, show increased anxiety in new environments, and have a reduced working memory performance. Furthermore, we detected morphological changes in the hippocampus and amygdala, e.g. astrogliosis and reduced numbers of synapses, leading to defective long-term potentiation in functional measurements. Compared to human, murine amyloid-β is poorly aggregating, due to changes in three amino acids at N-terminal positions 5, 10, and 13. Interestingly, our findings account for the action of early occurring amyloid-β species/aggregates, i.e. monomers and small amyloid-β oligomers. Thus, neprilysin × ABCC1 double-deficient mice present a new model for early effects of amyloid-β-related mild cognitive impairment that allows investigations

  3. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    Science.gov (United States)

    2006-07-06

    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  4. Immune senescence: relative contributions of age and cytomegalovirus infection.

    Directory of Open Access Journals (Sweden)

    Andrea Mekker

    Full Text Available Immune senescence, defined as the age-associated dysregulation and dysfunction of the immune system, is characterised by impaired protective immunity and decreased efficacy of vaccines. Recent clinical, epidemiological and immunological studies suggest that Cytomegalovirus (CMV infection may be associated with accelerated immune senescence, possibly by restricting the naïve T cell repertoire. However, direct evidence whether and how CMV-infection is implicated in immune senescence is still lacking. In this study, we have investigated whether latent mouse CMV (MCMV infection with or without thymectomy (Tx alters antiviral immunity of young and aged mice. After infection with lymphocytic choriomeningitis virus (LCMV or Vaccinia virus, specific antiviral T cell responses were significantly reduced in old, old MCMV-infected and/or Tx mice compared to young mice. Importantly, control of LCMV replication was more profoundly impaired in aged MCMV-infected mice compared to age-matched MCMV-naïve or young mice. In addition, latent MCMV infection was associated with slightly reduced vaccination efficacy in old Tx mice. In contrast to the prevailing hypothesis of a CMV-mediated restriction of the naïve T cell repertoire, we found similar naïve T cell numbers in MCMV-infected and non-infected mice, whereas ageing and Tx clearly reduced the naïve T cell pool. Instead, MCMV-infection expanded the total CD8(+ T cell pool by a massive accumulation of effector memory T cells. Based on these results, we propose a new model of increased competition between CMV-specific memory T cells and any 'de novo' immune response in aged individuals. In summary, our results directly demonstrate in a mouse model that latent CMV-infection impairs immunity in old age and propagates immune senescence.

  5. Anatomy and Histology of the Human and Murine Prostate.

    Science.gov (United States)

    Ittmann, Michael

    2018-05-01

    The human and murine prostate glands have similar functional roles in the generation of seminal fluid to assist in reproduction. There are significant differences in the anatomy and histology of murine and human prostate and knowledge of the normal anatomy and histology of the murine prostate is essential to interpreting changes in genetically engineered mouse models. In this review, the normal anatomy and histology of both human and mouse prostate will be described. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

  6. Effect of cytokine-encoding plasmid delivery on immune response to Japanese encephalitis virus DNA vaccine in mice.

    Science.gov (United States)

    Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu

    2005-01-01

    We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.

  7. Anti-Pseudomonas aeruginosa IgY antibodies augment bacterial clearance in a murine pneumonia model

    DEFF Research Database (Denmark)

    Thomsen, K.; Christophersen, L.; Bjarnsholt, T.

    2016-01-01

    Background: Oral prophylactic therapy by gargling with pathogen-specific egg yolk immunoglobulins (IgY) may reduce the initial airway colonization with Pseudomonas aeruginosa in cystic fibrosis (CF) patients. IgY antibodies impart passive immunization and we investigated the effects of anti......-P. aeruginosa IgY antibodies on bacterial eradication in a murine pneumonia model. Methods: P. aeruginosa pneumonia was established in Balb/c mice and the effects of prophylactic IgY administration on lung bacteriology, clinical parameters and subsequent inflammation were compared to controls. Results......: Prophylactic administration of IgY antibodies targeting P. aeruginosa significantly reduced the bacterial burden by 2-log 24 h post-infection compared to controls and was accompanied by significantly reduced clinical symptom scores and successive inflammatory cytokine profile indicative of diminished lung...

  8. In vitro biosynthesis of globular proteins by murine splenic lymphocytes: effect of serum components as supplement

    International Nuclear Information System (INIS)

    Tandon, H.K.L.; Pandey, A.K.; Singh, L.N.

    1991-01-01

    Studies on replacement of foetal calf serum (FCS) with precipitable protein, non precipitable protein, dialysable and non dialysable components of the FCS in media for the growth and proliferation of murine splenic rat lymphocytes have revealed that the whole serum could be completely replaced by either of the components without any appreciable deleterious effect on the mitogenic response but none of these components could offer optimum immune response. These findings establish a covalent association of whole FCS for synthesis and secretion of immunologically important pulsed proteins in terms of turnover rate and quantification by FPLC and suggest an important and yet undefined role of FCS in the process of immunoglobulin synthesis. (author). 10 refs., 2 figs., 1 tab

  9. Salivary gland extracts of Culicoides sonorensis inhibit murine lymphocyte proliferation and no production by macrophages.

    Science.gov (United States)

    Bishop, Jeanette V; Mejia, J Santiago; Pérez de León, Adalberto A; Tabachnick, Walter J; Titus, Richard G

    2006-09-01

    Culicoides biting midges serve as vectors of pathogens affecting humans and domestic animals. Culicoides sonorensis is a vector of several arboviruses in North American that cause substantial economic losses to the US livestock industry. Previous studies showed that C. sonorensis saliva, like the saliva of many hematophagous arthropods, contains numerous pharmacological agents that affect hemostasis and early events in the inflammatory response, which may enhance the infectivity of Culicoides-borne pathogens. This paper reports on the immunomodulatory properties of C. sonorensis salivary gland extracts on murine immune cells and discusses the possible immunomodulatory role of C. sonorensis saliva in vesicular stomatitis virus infection of vertebrate hosts. Splenocytes treated with C. sonorensis mitogens were significantly affected in their proliferative response, and peritoneal macrophages secreted significantly less NO. A 66-kDa glycoprotein was purified from C. sonorensis salivary gland extract, which may be in part responsible for these observations and may be considered as a vaccine candidate.

  10. Hyphal growth of phagocytosed Fusarium oxysporum causes cell lysis and death of murine macrophages.

    Directory of Open Access Journals (Sweden)

    Katja Schäfer

    Full Text Available Fusarium oxysporum is an important plant pathogen and an opportunistic pathogen of humans. Here we investigated phagocytosis of F. oxysporum by J774.1 murine cell line macrophages using live cell video microscopy. Macrophages avidly migrated towards F. oxysporum germlings and were rapidly engulfed after cell-cell contact was established. F. oxysporum germlings continued hyphal growth after engulfment by macrophages, leading to associated macrophage lysis and escape. Macrophage killing depended on the multiplicity of infection. After engulfment, F. oxysporum inhibited macrophages from completing mitosis, resulting in large daughter cells fused together by means of a F. oxysporum hypha. These results shed new light on the initial stages of Fusarium infection and the innate immune response of the mammalian host.

  11. Methamphetamine Administration Modifies Leukocyte Proliferation and Cytokine Production in Murine Tissues

    Science.gov (United States)

    Peerzada, Habibullah; Ghandi, Jay A.; Guimaraes, Allan J.; Nosanchuk, Joshua D.; Martinez, Luis R.

    2013-01-01

    Methamphetamine (METH) is a potent and highly addictive central nervous system (CNS) stimulant. Additionally, METH adversely impacts immunological responses, which might contribute to the higher rate and more rapid progression of certain infections in drug abusers. However no studies have shown the impact of METH on inflammation within specific organs, cellular participation and cytokine production. Using a murine model of METH administration, we demonstrated that METH modifies, with variable degrees, leukocyte recruitment and alters cellular mediators in the lungs, liver, spleen and kidneys of mice. Our findings demonstrate the pleotropic effects of METH on the immune response within diverse tissues. These alterations have profound implications on tissue homeostasis and the capacity of the host to respond to diverse insults, including invading pathogens. PMID:23518444

  12. Hyphal growth of phagocytosed Fusarium oxysporum causes cell lysis and death of murine macrophages.

    Science.gov (United States)

    Schäfer, Katja; Bain, Judith M; Di Pietro, Antonio; Gow, Neil A R; Erwig, Lars P

    2014-01-01

    Fusarium oxysporum is an important plant pathogen and an opportunistic pathogen of humans. Here we investigated phagocytosis of F. oxysporum by J774.1 murine cell line macrophages using live cell video microscopy. Macrophages avidly migrated towards F. oxysporum germlings and were rapidly engulfed after cell-cell contact was established. F. oxysporum germlings continued hyphal growth after engulfment by macrophages, leading to associated macrophage lysis and escape. Macrophage killing depended on the multiplicity of infection. After engulfment, F. oxysporum inhibited macrophages from completing mitosis, resulting in large daughter cells fused together by means of a F. oxysporum hypha. These results shed new light on the initial stages of Fusarium infection and the innate immune response of the mammalian host.

  13. Murine Norovirus 4 (MNV-4 Infections Trigger Various Effects on Atherosclerosis Development

    Directory of Open Access Journals (Sweden)

    Rafeezul Mohamed

    2018-05-01

    Full Text Available Murine norovirus (MNV infection can cause morbidity and mortality to immune compromised mice, especially colonies in research laboratory. MNV also can infect and propagates in macrophages and dendritic cells which trigger atherosclerosis development through the accumulation of these cells followed by the formation of foam cells. Recently, MNV-4 infection was associated with an increase in aortic sinus lesion size in LDLR (low-density lipoprotein receptor and ApoE (Apolipoprotein E deficient mice, both are well established mouse models for atherosclerosis research. Therefore, this review is intended to summarize the impacts of MNV infection in these two mouse models of atherosclerosis. The findings from all the related studies are important in understanding the fundamental effect of MNV infection on atherosclerosis development. In addition, this information could provide insight to researchers on the evaluation to eliminate MNV infection in research facility to avoid any unintended effect in their research, particularly in-vivo studies involving mice.

  14. The effect of medium composition on interleukin-2 production by murine EL-4 thymoma cells

    Directory of Open Access Journals (Sweden)

    Galesi A. L. L.

    2004-01-01

    Full Text Available Due to the role of interleukin-2 (IL-2 in the mediation of immune response, this cytokine has been used in the treatment of some types of cancer and infectious diseases. However, relatively high levels of this cytokine are required to achieve significant activity. The aim of this work was to study a culture medium composition designed to increase the production of IL-2 by suspended murine EL-4 cells. The cultivations were carried out aiming at producing IL-2 in stirred bioreactors. The effects of concentration of glutamine, phorbol-12-myristate-13-acetate (PMA, concanavalin A (Con A, Pluronic F68, and fetal calf serum (FCS on cell viability and IL-2 production were evaluated. PMA alone was more efficient in IL-2 production than it was in association with Con A. The maximum IL-2 production was around 162 ng/mL with 856 ng/mL PMA and 1.45% (v/v FCS.

  15. Murine leukemia viruses: objects and organisms.

    Science.gov (United States)

    Rein, Alan

    2011-01-01

    Murine leukemia viruses (MLVs) are among the simplest retroviruses. Prototypical gammaretroviruses encode only the three polyproteins that will be used in the assembly of progeny virus particles. These are the Gag polyprotein, which is the structural protein of a retrovirus particle, the Pol protein, comprising the three retroviral enzymes-protease, which catalyzes the maturation of the particle, reverse transcriptase, which copies the viral RNA into DNA upon infection of a new host cell, and integrase, which inserts the DNA into the chromosomal DNA of the host cell, and the Env polyprotein, which induces the fusion of the viral membrane with that of the new host cell, initiating infection. In general, a productive MLV infection has no obvious effect upon host cells. Although gammaretroviral structure and replication follow the same broad outlines as those of other retroviruses, we point out a number of significant differences between different retroviral genera.

  16. Proliferative capacity of murine hematopoietic stem cells

    International Nuclear Information System (INIS)

    Hellman, S.; Botnick, L.E.; Hannon, E.C.; Vigneulle, R.M.

    1978-01-01

    The present study demonstrates a decrease in self-renewal capacity with serial transfer of murine hematopoietic stem cells. Production of differentiated cell progeny is maintained longer than stem cell self-renewal. In normal animals the capacity for self-renewal is not decreased with increasing donor age. The stem cell compartment in normal animals, both young and old, appears to be proliferatively quiescent. After apparent recovery from the alkylating agent busulfan, the probability of stem cell self-renewal is decreased, there is a permanent defect in the capacity of the bone marrow for serial transplantation, and the stem cells are proliferatively active. These findings support a model of the hematopoietic stem cell compartment as a continuum of cells with decreasing capacities for self-renewal, increasing likelihood for differentiation, and increasing proliferative activity. Cells progress in the continuum in one direction and such progression is not reversible

  17. Murine model of long term obstructive jaundice

    Science.gov (United States)

    Aoki, Hiroaki; Aoki, Masayo; Yang, Jing; Katsuta, Eriko; Mukhopadhyay, Partha; Ramanathan, Rajesh; Woelfel, Ingrid A.; Wang, Xuan; Spiegel, Sarah; Zhou, Huiping; Takabe, Kazuaki

    2016-01-01

    Background With the recent emergence of conjugated bile acids as signaling molecules in cancer, a murine model of obstructive jaundice by cholestasis with long-term survival is in need. Here, we investigated the characteristics of 3 murine models of obstructive jaundice. Methods C57BL/6J mice were used for total ligation of the common bile duct (tCL), partial common bile duct ligation (pCL), and ligation of left and median hepatic bile duct with gallbladder removal (LMHL) models. Survival was assessed by Kaplan-Meier method. Fibrotic change was determined by Masson-Trichrome staining and Collagen expression. Results 70% (7/10) of tCL mice died by Day 7, whereas majority 67% (10/15) of pCL mice survived with loss of jaundice. 19% (3/16) of LMHL mice died; however, jaundice continued beyond Day 14, with survival of more than a month. Compensatory enlargement of the right lobe was observed in both pCL and LMHL models. The pCL model demonstrated acute inflammation due to obstructive jaundice 3 days after ligation but jaundice rapidly decreased by Day 7. The LHML group developed portal hypertension as well as severe fibrosis by Day 14 in addition to prolonged jaundice. Conclusion The standard tCL model is too unstable with high mortality for long-term studies. pCL may be an appropriate model for acute inflammation with obstructive jaundice but long term survivors are no longer jaundiced. The LHML model was identified to be the most feasible model to study the effect of long-term obstructive jaundice. PMID:27916350

  18. Formation and maturation of the murine meniscus.

    Science.gov (United States)

    Gamer, Laura W; Xiang, Lin; Rosen, Vicki

    2017-08-01

    Meniscal injuries are commonplace, but current surgical repair procedures do not prevent degenerative joint changes that occur after meniscal injury and often lead to osteoarthritis. Successful tissue regeneration in adults often recapitulates events that occur during embryogenesis, suggesting that understanding the regulatory pathways controlling these early processes may provide clues for developing strategies for tissue repair. While the mouse is now widely used to study joint diseases, detailed knowledge of the basic biology of murine meniscus is not readily available. Here, we examine meniscal morphogenesis in mice from embryonic day 13.5 (E13.5) to 6 months of age using histology, in situ hybridization, and immunohistochemistry. We find that the meniscus is a morphologically distinct structure at E16 when it begins to regionalize. At birth, the meniscus has a distinguishable inner, avascular, round chondrocyte cell region, an outer, vascularized, fibroblast cell region, and a surface superficial zone. Maturation begins at 2 weeks of age when the meniscus expresses type I collagen, type II collagen, type X collagen, and MMP-13 in specific patterns. By 4 weeks of age, small areas of ossification are detected in the anterior meniscal horn, a common feature seen in rodents. Maturation appears complete at 8 weeks of age, when the meniscus resembles the adult structure complete with ossifying tissue that contains bone marrow like areas. Our results provide, the first systematic study of mouse meniscal development and will be a valuable tool for analyzing murine models of knee joint formation and disease. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1683-1689, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  19. Effectiveness of the immunomodulatory extract of Kalanchoe pinnata against murine visceral leishmaniasis.

    Science.gov (United States)

    Gomes, D C O; Muzitano, M F; Costa, S S; Rossi-Bergmann, B

    2010-04-01

    Previously, we described the protective action of the immunomodulatory extract of Kalanchoe pinnata (Kp) in murine and human cutaneous leishmaniasis. In the present study, we investigated the effectiveness of Kp against visceral leishmaniasis, using the BALB/c mouse model of infection with Leishmania chagasi. Mice receiving oral daily doses of Kp (400 mg/kg) for 30 days displayed significantly reduced hepatic and splenic parasite burden, when compared with untreated animals. Protectiveness was accompanied by a reduction in parasite-specific IgG serum levels, and impaired capacity of spleen cells to produce IL-4, but not IFN-gamma and nitric oxide upon antigen recall in vitro. The reference drug Pentostam (72 mg/kg) given by the intra-peritoneal route on alternate days produced an anti-leishmanial effect similar to oral Kp. Our findings show that the oral efficacy of Kp, seen previously in murine cutaneous leishmaniasis, extends also to visceral leishmaniasis caused by L. chagasi, a difficult to treat and lethal disease of man.

  20. 4T1 Murine Mammary Carcinoma Cells Enhance Macrophage-Mediated Innate Inflammatory Responses.

    Directory of Open Access Journals (Sweden)

    Laurence Madera

    Full Text Available Tumor progression and the immune response are intricately linked. While it is known that cancers alter macrophage inflammatory responses to promote tumor progression, little is known regarding how cancers affect macrophage-dependent innate host defense. In this study, murine bone-marrow-derived macrophages (BMDM were exposed to murine carcinoma-conditioned media prior to assessment of the macrophage inflammatory response. BMDMs exposed to 4T1 mammary carcinoma-conditioned medium demonstrated enhanced production of pro-inflammatory cytokines tumor necrosis factor α, interleukin-6, and CCL2 in response to lipopolysaccharide (LPS while production of interleukin-10 remained unchanged. The increased LPS-induced production of pro-inflammatory cytokines was transient and correlated with enhanced cytokine production in response to other Toll-like receptor agonists, including peptidoglycan and flagellin. In addition, 4T1-conditioned BMDMs exhibited strengthened LPS-induced nitric oxide production and enhanced phagocytosis of Escherichia coli. 4T1-mediated augmentation of macrophage responses to LPS was partially dependent on the NFκB pathway, macrophage-colony stimulating factor, and actin polymerization, as well as the presence of 4T1-secreted extracellular vesicles. Furthermore, peritoneal macrophages obtained from 4T1 tumor-bearing mice displayed enhanced pro-inflammatory cytokine production in response to LPS. These results suggest that uptake of 4T1-secreted factors and actin-mediated ingestion of 4T1-secreted exosomes by macrophages cause a transient enhancement of innate inflammatory responses. Mammary carcinoma-mediated regulation of innate immunity may have significant implications for our understanding of host defense and cancer progression.

  1. Role of the Immune System in Hypertension.

    Science.gov (United States)

    Rodriguez-Iturbe, Bernardo; Pons, Hector; Johnson, Richard J

    2017-07-01

    High blood pressure is present in more than one billion adults worldwide and is the most important modifiable risk factor of death resulting from cardiovascular disease. While many factors contribute to the pathogenesis of hypertension, a role of the immune system has been firmly established by a large number of investigations from many laboratories around the world. Immunosuppressive drugs and inhibition of individual cytokines prevent or ameliorate experimental hypertension, and studies in genetically-modified mouse strains have demonstrated that lymphocytes are necessary participants in the development of hypertension and in hypertensive organ injury. Furthermore, immune reactivity may be the driving force of hypertension in autoimmune diseases. Infiltration of immune cells, oxidative stress, and stimulation of the intrarenal angiotensin system are induced by activation of the innate and adaptive immunity. High blood pressure results from the combined effects of inflammation-induced impairment in the pressure natriuresis relationship, dysfunctional vascular relaxation, and overactivity of the sympathetic nervous system. Imbalances between proinflammatory effector responses and anti-inflammatory responses of regulatory T cells to a large extent determine the severity of inflammation. Experimental and human studies have uncovered autoantigens (isoketal-modified proteins and heat shock protein 70) of potential clinical relevance. Further investigations on the immune reactivity in hypertension may result in the identification of new strategies for the treatment of the disease. Copyright © 2017 the American Physiological Society.

  2. Altered Immune Regulation in Type 1 Diabetes

    Science.gov (United States)

    Zóka, András; Műzes, Györgyi; Somogyi, Anikó; Varga, Tímea; Szémán, Barbara; Al-Aissa, Zahra; Hadarits, Orsolya; Firneisz, Gábor

    2013-01-01

    Research in genetics and immunology was going on separate strands for a long time. Type 1 diabetes mellitus might not be characterized with a single pathogenetic factor. It develops when a susceptible individual is exposed to potential triggers in a given sequence and timeframe that eventually disarranges the fine-tuned immune mechanisms that keep autoimmunity under control in health. Genomewide association studies have helped to understand the congenital susceptibility, and hand-in-hand with the immunological research novel paths of immune dysregulation were described in central tolerance, apoptotic pathways, or peripheral tolerance mediated by regulatory T-cells. Epigenetic factors are contributing to the immune dysregulation. The interplay between genetic susceptibility and potential triggers is likely to play a role at a very early age and gradually results in the loss of balanced autotolerance and subsequently in the development of the clinical disease. Genetic susceptibility, the impaired elimination of apoptotic β-cell remnants, altered immune regulatory functions, and environmental factors such as viral infections determine the outcome. Autoreactivity might exist under physiologic conditions and when the integrity of the complex regulatory process is damaged the disease might develop. We summarized the immune regulatory mechanisms that might have a crucial role in disease pathology and development. PMID:24285974

  3. Altered Immune Regulation in Type 1 Diabetes

    Directory of Open Access Journals (Sweden)

    András Zóka

    2013-01-01

    Full Text Available Research in genetics and immunology was going on separate strands for a long time. Type 1 diabetes mellitus might not be characterized with a single pathogenetic factor. It develops when a susceptible individual is exposed to potential triggers in a given sequence and timeframe that eventually disarranges the fine-tuned immune mechanisms that keep autoimmunity under control in health. Genomewide association studies have helped to understand the congenital susceptibility, and hand-in-hand with the immunological research novel paths of immune dysregulation were described in central tolerance, apoptotic pathways, or peripheral tolerance mediated by regulatory T-cells. Epigenetic factors are contributing to the immune dysregulation. The interplay between genetic susceptibility and potential triggers is likely to play a role at a very early age and gradually results in the loss of balanced autotolerance and subsequently in the development of the clinical disease. Genetic susceptibility, the impaired elimination of apoptotic β-cell remnants, altered immune regulatory functions, and environmental factors such as viral infections determine the outcome. Autoreactivity might exist under physiologic conditions and when the integrity of the complex regulatory process is damaged the disease might develop. We summarized the immune regulatory mechanisms that might have a crucial role in disease pathology and development.

  4. Origins of adaptive immunity.

    Science.gov (United States)

    Liongue, Clifford; John, Liza B; Ward, Alister

    2011-01-01

    Adaptive immunity, involving distinctive antibody- and cell-mediated responses to specific antigens based on "memory" of previous exposure, is a hallmark of higher vertebrates. It has been argued that adaptive immunity arose rapidly, as articulated in the "big bang theory" surrounding its origins, which stresses the importance of coincident whole-genome duplications. Through a close examination of the key molecules and molecular processes underpinning adaptive immunity, this review suggests a less-extreme model, in which adaptive immunity emerged as part of longer evolutionary journey. Clearly, whole-genome duplications provided additional raw genetic materials that were vital to the emergence of adaptive immunity, but a variety of other genetic events were also required to generate some of the key molecules, whereas others were preexisting and simply co-opted into adaptive immunity.

  5. The immune system and the impact of zinc during aging

    Directory of Open Access Journals (Sweden)

    Haase Hajo

    2009-06-01

    Full Text Available Abstract The trace element zinc is essential for the immune system, and zinc deficiency affects multiple aspects of innate and adaptive immunity. There are remarkable parallels in the immunological changes during aging and zinc deficiency, including a reduction in the activity of the thymus and thymic hormones, a shift of the T helper cell balance toward T helper type 2 cells, decreased response to vaccination, and impaired functions of innate immune cells. Many studies confirm a decline of zinc levels with age. Most of these studies do not classify the majority of elderly as zinc deficient, but even marginal zinc deprivation can affect immune function. Consequently, oral zinc supplementation demonstrates the potential to improve immunity and efficiently downregulates chronic inflammatory responses in the elderly. These data indicate that a wide prevalence of marginal zinc deficiency in elderly people may contribute to immunosenescence.

  6. Vitamin C and Immune Function

    Directory of Open Access Journals (Sweden)

    Anitra C. Carr

    2017-11-01

    Full Text Available Vitamin C is an essential micronutrient for humans, with pleiotropic functions related to its ability to donate electrons. It is a potent antioxidant and a cofactor for a family of biosynthetic and gene regulatory enzymes. Vitamin C contributes to immune defense by supporting various cellular functions of both the innate and adaptive immune system. Vitamin C supports epithelial barrier function against pathogens and promotes the oxidant scavenging activity of the skin, thereby potentially protecting against environmental oxidative stress. Vitamin C accumulates in phagocytic cells, such as neutrophils, and can enhance chemotaxis, phagocytosis, generation of reactive oxygen species, and ultimately microbial killing. It is also needed for apoptosis and clearance of the spent neutrophils from sites of infection by macrophages, thereby decreasing necrosis/NETosis and potential tissue damage. The role of vitamin C in lymphocytes is less clear, but it has been shown to enhance differentiation and proliferation of B- and T-cells, likely due to its gene regulating effects. Vitamin C deficiency results in impaired immunity and higher susceptibility to infections. In turn, infections significantly impact on vitamin C levels due to enhanced inflammation and metabolic requirements. Furthermore, supplementation with vitamin C appears to be able to both prevent and treat respiratory and systemic infections. Prophylactic prevention of infection requires dietary vitamin C intakes that provide at least adequate, if not saturating plasma levels (i.e., 100–200 mg/day, which optimize cell and tissue levels. In contrast, treatment of established infections requires significantly higher (gram doses of the vitamin to compensate for the increased inflammatory response and metabolic demand.

  7. Adaptive immunity in autoimmune hepatitis.

    Science.gov (United States)

    Longhi, Maria Serena; Ma, Yun; Mieli-Vergani, Giorgina; Vergani, Diego

    2010-01-01

    The histological lesion of interface hepatitis, with its dense portal cell infiltrate consisting of lymphocytes, monocytes/macrophages and plasma cells, was the first to suggest an autoaggressive cellular immune attack in the pathogenesis of autoimmune hepatitis (AIH). Immunohistochemical studies, focused on the phenotype of inflammatory cells infiltrating the liver parenchyma, have shown a predominance of alphabeta-T cells. Amongst these cells, the majority have been CD4 helper/inducers, while a sizeable minority have consisted of CD8 cytotoxic/suppressors. Lymphocytes on non-T cell lineage included natural killer cells, monocytes/macrophages and B lymphocytes. For autoimmunity to arise, the self-antigenic peptide, embraced by an human leukocyte antigen (HLA) class II molecule, must be presented to an uncommitted T helper (T(H)0) lymphocyte by professional antigen-presenting cells. Once activated and according to the presence in the milieu of interleukin 12 (IL-12) or IL-4, T(H)0 lymphocytes can differentiate into T(H)1 cells, which are pivotal to macrophage activation; enhance HLA class I expression, rendering liver cells vulnerable to CD8 T-cell attack; and induce HLA class II expression on hepatocytes; or they can differentiate into T(H)2 cells, which produce IL-4, IL-10 and IL-13, cytokines favouring autoantibody production by B lymphocytes. Autoantigen recognition is tightly controlled by regulatory mechanisms, such as those exerted by CD4+CD25(high) regulatory T cells. Numerical and functional regulatory T cell impairment characterises AIH and permits the perpetuation of effector immune responses with ensuing persistent liver destruction. Advances in the study of autoreactive T cells stem mostly from AIH type 2, where the main autoantigen, cytochrome P450IID6 (CYP2D6), is known to enable characterisation of antigen-specific immune responses. Copyright 2010 S. Karger AG, Basel.

  8. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  9. IL-10 down-regulates the expression of survival associated gene hspX of Mycobacterium tuberculosis in murine macrophage

    Directory of Open Access Journals (Sweden)

    Babban Jee

    2017-07-01

    Full Text Available Mycobacterium tuberculosis (MTB adopts a special survival strategy to overcome the killing mechanism(s of host immune system. Amongst the many known factors, small heat shock protein 16.3 (sHSP16.3 of MTB encoded by gene hspX has been reported to be critical for the survival of MTB. In the present study, the effect of recombinant murine interferon-gamma (rmIFN-γ and recombinant murine interleukin-10 (rmIL-10 on the expression of gene hspX of MTB in murine macrophage RAW264.7 has been investigated. By real-time RT-PCR, it was observed that three increasing concentrations (5, 25 and 50 ng/ml of rmIFN-γ significantly up-regulated the expression of hspX whereas similar concentrations of rmIL-10 (5, 25 and 50 ng/ml significantly down-regulated the hspX expression. This effect was not only dependent on the concentration of the stimulus but this was time-dependent as well. A contrasting pattern of hspX expression was observed against combinations of two different concentrations of rmIFN-γ and rmIL-10. The study results suggest that rIL-10 mediated down-regulation of hspX expression, in the presence of low concentration of rIFN-γ, could be used as an important strategy to decrease the dormancy of MTB in its host and thus making MTB susceptible to the standard anti-mycobacterial therapy used for treating tuberculosis. However, as these are only preliminary results in the murine cell line model, this hypothesis needs to be first validated in human cell lines and subsequently in animal models mimicking the latent infection using clinical isolates of MTB before considering the development of modified regimens for humans.

  10. Perceived Immune Status and Sleep: A Survey among Dutch Students

    Directory of Open Access Journals (Sweden)

    Anouk A. M. T. Donners

    2015-01-01

    Full Text Available Reduced immune functioning may have a negative impact on sleep and health, and vice versa. A survey among Dutch young adults (18–35 years old was administered to collect information on perception of reduced immunity and its relationship to sleep disorders, sleep duration, and quality. Sleep disorders were assessed with the SLEEP-50 questionnaire subscales of sleep apnea, insomnia, circadian rhythm disorder, and daily functioning. Dutch young adults (N = 574 completed the survey. Among them, subjects (N = 209; 36.4% reported perceived reduced immunity. Relative to those with a normal immune status, subjects reporting reduced immunity had significantly higher scores (p=0.0001 on sleep apnea (2.6 versus 3.6, insomnia (5.1 versus 6.8, and circadian rhythm disorder (2.1 versus 2.7. Subjects reporting reduced immunity also had significantly poorer daily functioning scores (5.4 versus 7.6, p=0.0001. No differences were observed in total sleep time, but those reporting reduced immunity had significantly poorer ratings of sleep quality (6.8 versus 7.2, p=0.0001. Our findings suggest that perceived reduced immunity is associated with sleep disturbances, impaired daily functioning, and a poorer sleep quality. Experimental studies including the assessment of immune biomarkers and objective measures of sleep (polysomnography should confirm the current observations.

  11. Early Impairment of Lung Mechanics in a Murine Model of Marfan Syndrome

    Science.gov (United States)

    Uriarte, Juan J.; Meirelles, Thayna; Gorbenko del Blanco, Darya; Nonaka, Paula N.; Campillo, Noelia; Sarri, Elisabet; Navajas, Daniel; Egea, Gustavo; Farré, Ramon

    2016-01-01

    Early morbidity and mortality in patients with Marfan syndrome (MFS) -a connective tissue disease caused by mutations in fibrillin-1 gene- are mainly caused by aorta aneurysm and rupture. However, the increase in the life expectancy of MFS patients recently achieved by reparatory surgery promotes clinical manifestations in other organs. Although some studies have reported respiratory alterations in MFS, our knowledge of how this connective tissue disease modifies lung mechanics is scarce. Hence, we assessed whether the stiffness of the whole lung and of its extracellular matrix (ECM) is affected in a well-characterized MFS mouse model (FBN1C1039G/+). The stiffness of the whole lung and of its ECM were measured by conventional mechanical ventilation and atomic force microscopy, respectively. We studied 5-week and 9-month old mice, whose ages are representative of early and late stages of the disease. At both ages, the lungs of MFS mice were significantly more compliant than in wild type (WT) mice. By contrast, no significant differences were found in local lung ECM stiffness. Moreover, histopathological lung evaluation showed a clear emphysematous-like pattern in MFS mice since alveolar space enlargement was significantly increased compared with WT mice. These data suggest that the mechanism explaining the increased lung compliance in MFS is not a direct consequence of reduced ECM stiffness, but an emphysema-like alteration in the 3D structural organization of the lung. Since lung alterations in MFS are almost fully manifested at an early age, it is suggested that respiratory monitoring could provide early biomarkers for diagnosis and/or follow-up of patients with the Marfan syndrome. PMID:27003297

  12. Focal Solute Trapping and Global Glymphatic Pathway Impairment in a Murine Model of Multiple Microinfarcts

    DEFF Research Database (Denmark)

    Wang, Minghuan; Ding, Fengfei; Deng, SaiYue

    2017-01-01

    for Alzheimer's disease is unclear. The glymphatic system, which is a brain-wide perivascular network that supports the recirculation of CSF through the brain parenchyma, facilitates the clearance of interstitial solutes including amyloid β and tau. We investigated whether glymphatic pathway function.......SIGNIFICANCE STATEMENT Microinfarcts, small (glymphatic system is a brain-wide network of channels surrounding brain...

  13. Protease-activated receptor-1 impairs host defense in murine pneumococcal pneumonia: a controlled laboratory study

    NARCIS (Netherlands)

    Schouten, Marcel; van't Veer, Cornelis; Roelofs, Joris J. T. H.; Levi, Marcel; van der Poll, Tom

    2012-01-01

    Streptococcus pneumoniae is the most common causative pathogen in community-acquired pneumonia. Protease-activated receptor-1 (PAR-1) is expressed by multiple cell types present in the lungs and can be activated by various proteases generated during acute inflammation. The cellular effect of PAR-1

  14. Role of Innate Immunity in a Model of Histidyl-tRNA Synthetase (Jo-1)-mediated Myositis

    Science.gov (United States)

    Soejima, Makoto; Kang, Eun Ha; Gu, Xinyan; Katsumata, Yasuhiro; Clemens, Paula R.; Ascherman, Dana P.

    2010-01-01

    Objectives Previous work in humans and in animal models supports a key role for histidyl-tRNA synthetase (HRS=Jo-1) in the pathogenesis of idiopathic inflammatory myopathy. While most investigations have focused on the ability of HRS to trigger adaptive immune responses, in vitro studies clearly indicate that HRS possesses intrinsic chemokine-like properties capable of activating the innate immune system. The purpose of this study was therefore to examine the ability of HRS to direct innate immune responses in a murine model of myositis. Methods Following intramuscular immunization with soluble HRS in the absence of exogenous adjuvant, selected strains of mice were evaluated at different time points for histopathologic evidence of myositis. ELISA-based assessment of autoantibody formation and CFSE proliferation studies provided complementary measures of B and T cell responses triggered by HRS immunization. Results Compared to appropriate control proteins, a murine HRS fusion protein induced robust, statistically significant muscle inflammation in multiple congenic strains of C57BL/6 and NOD mice. Time course experiments revealed that this inflammatory response occurred as early as 7 days post immunization and persisted for up to 7 weeks. Parallel immunization strategies in DO11.10/Rag2−/− and C3H/HeJ (TLR4−/−) mice indicated that the ability of murine HRS to drive muscle inflammation was not dependent on B cell receptor or T cell receptor recognition and did not require TLR4 signaling. Conclusion Collectively, these experiments support a model in which HRS can trigger both innate and adaptive immune responses which culminate in severe muscle inflammation that is the hallmark of idiopathic inflammatory myopathy. PMID:21280002

  15. Tyrosine 129 of the murine gammaherpesvirus M2 protein is critical for M2 function in vivo.

    Science.gov (United States)

    Rangaswamy, Udaya S; O'Flaherty, Brigid M; Speck, Samuel H

    2014-01-01

    A common strategy shared by all known gammaherpesviruses is their ability to establish a latent infection in lymphocytes--predominantly in B cells. In immunocompromised patients, such as transplant recipients or AIDS patients, gammaherpesvirus infections can lead to the development of lymphoproliferative disease and lymphoid malignancies. The human gamma-herpesviruses, EBV and KSHV, encode proteins that are capable of modulating the host immune signaling machinery, thereby subverting host immune responses. Murine gamma-herpesvirus 68 (MHV68) infection of laboratory strains of mice has proven to be useful small-animal model that shares important pathogenic strategies with the human gamma-herpesviruses. The MHV68 M2 protein is known to manipulate B cell signaling and, dependent on route and dose of virus inoculation, plays a role in both the establishment of latency and virus reactivation. M2 contains two tyrosines that are targets for phosphorylation, and have been shown to interact with the B cell signaling machinery. Here we describe in vitro and in vivo studies of M2 mutants which reveals that while both tyrosines Y120 and Y129 are required for M2 induction of IL-10 expression from primary murine B cells in vitro, only Y129 is critical for reactivation from latency and plasma cell differentiation in vivo.

  16. Tyrosine 129 of the murine gammaherpesvirus M2 protein is critical for M2 function in vivo.

    Directory of Open Access Journals (Sweden)

    Udaya S Rangaswamy

    Full Text Available A common strategy shared by all known gammaherpesviruses is their ability to establish a latent infection in lymphocytes--predominantly in B cells. In immunocompromised patients, such as transplant recipients or AIDS patients, gammaherpesvirus infections can lead to the development of lymphoproliferative disease and lymphoid malignancies. The human gamma-herpesviruses, EBV and KSHV, encode proteins that are capable of modulating the host immune signaling machinery, thereby subverting host immune responses. Murine gamma-herpesvirus 68 (MHV68 infection of laboratory strains of mice has proven to be useful small-animal model that shares important pathogenic strategies with the human gamma-herpesviruses. The MHV68 M2 protein is known to manipulate B cell signaling and, dependent on route and dose of virus inoculation, plays a role in both the establishment of latency and virus reactivation. M2 contains two tyrosines that are targets for phosphorylation, and have been shown to interact with the B cell signaling machinery. Here we describe in vitro and in vivo studies of M2 mutants which reveals that while both tyrosines Y120 and Y129 are required for M2 induction of IL-10 expression from primary murine B cells in vitro, only Y129 is critical for reactivation from latency and plasma cell differentiation in vivo.

  17. Integrated analysis of genetic, behavioral, and biochemical data implicates neural stem cell-induced changes in immunity, neurotransmission and mitochondrial function in Dementia with Lewy Body mice.

    Science.gov (United States)

    Lakatos, Anita; Goldberg, Natalie R S; Blurton-Jones, Mathew

    2017-03-10

    We previously demonstrated that transplantation of murine neural stem cells (NSCs) can improve motor and cognitive function in a transgenic model of Dementia with Lewy Bodies (DLB). These benefits occurred without changes in human α-synuclein pathology and were mediated in part by stem cell-induced elevation of brain-derived neurotrophic factor (BDNF). However, instrastriatal NSC transplantation likely alters the brain microenvironment via multiple mechanisms that may synergize to promote cognitive and motor recovery. The underlying neurobiology that mediates such restoration no doubt involves numerous genes acting in concert to modulate signaling within and between host brain cells and transplanted NSCs. In order to identify functionally connected gene networks and additional mechanisms that may contribute to stem cell-induced benefits, we performed weighted gene co-expression network analysis (WGCNA) on striatal tissue isolated from NSC- and vehicle-injected wild-type and DLB mice. Combining continuous behavioral and biochemical data with genome wide expression via network analysis proved to be a powerful approach; revealing significant alterations in immune response, neurotransmission, and mitochondria function. Taken together, these data shed further light on the gene network and biological processes that underlie the therapeutic effects of NSC transplantation on α-synuclein induced cognitive and motor impairments, thereby highlighting additional therapeutic targets for synucleinopathies.

  18. Growth hormone treatment in cartilage-hair hypoplasia: effects on growth and the immune system.

    NARCIS (Netherlands)

    Bocca, G.; Weemaes, C.M.R.; Burgt, C.J.A.M. van der; Otten, B.J.

    2004-01-01

    Cartilage-hair hypoplasia (CHH) is a rare autosomal recessive disorder characterized by metaphyseal chondrodysplasia with severe growth retardation and impaired immunity. We studied the effects of growth hormone treatment on growth parameters and the immune system in four children with CHH. The

  19. Effects of alcohol consumption on the allergen-specific immune response in mice

    DEFF Research Database (Denmark)

    Linneberg, Allan; Roursgaard, Martin; Hersoug, Lars-Georg

    2008-01-01

    There is evidence that chronic alcohol consumption impairs the T-helper 1 (Th1) lymphocyte-regulated cell-mediated immune response possibly favoring a Th2 deviation of the immune response. Moreover, a few epidemiological studies have linked alcohol consumption to allergen-specific IgE sensitization....

  20. Criteria for driver impairment

    NARCIS (Netherlands)

    Brookhuis, K.A.; De Waard, D.; Fairclough, S.H

    2003-01-01

    Most traffic accidents can be attributed to driver impairment, e.g. inattention, fatigue, intoxication, etc. It is now technically feasible to monitor and diagnose driver behaviour with respect to impairment with the aid of a limited number of in-vehicle sensors. However, a valid framework for the

  1. Murine HPV16 E7-expressing transgenic skin effectively emulates the cellular and molecular features of human high-grade squamous intraepithelial lesions

    Directory of Open Access Journals (Sweden)

    Z.K. Tuong

    2018-06-01

    Full Text Available Currently available vaccines prevent HPV infection and development of HPV-associated malignancies, but do not cure existing HPV infections and dysplastic lesions. Persistence of infection(s in immunocompetent patients may reflect induction of local immunosuppressive mechanisms by HPV, providing a target for therapeutic intervention. We have proposed that a mouse, expressing HPV16 E7 oncoprotein under a Keratin 14 promoter (K14E7 mice, and which develops epithelial hyperplasia, may assist with understanding local immune suppression mechanisms that support persistence of HPV oncogene-induced epithelial hyperplasia. K14E7 skin grafts recruit immune cells from immunocompetent hosts, but consistently fail to be rejected. Here, we review the literature on HPV-associated local immunoregulation, and compare the findings with published observations on the K14E7 transgenic murine model, including comparison of the transcriptome of human HPV-infected pre-malignancies with that of murine K14E7 transgenic skin. We argue from the similarity of i the literature findings and ii the transcriptome profiles that murine K14E7 transgenic skin recapitulates the cellular and secreted protein profiles of high-grade HPV-associated lesions in human subjects. We propose that the K14E7 mouse may be an appropriate model to further study the immunoregulatory effects of HPV E7 expression, and can facilitate development and testing of therapeutic vaccines.

  2. MHC class II expression through a hitherto unknown pathway supports T helper cell-dependent immune responses: implications for MHC class II deficiency

    NARCIS (Netherlands)

    Buch, Thorsten; Polic, Bojan; Clausen, Björn E.; Weiss, Susanne; Akilli-Ozturk, Ozlem; Chang, Cheong-Hee; Flavell, Richard; Schulz, Ansgar; Jonjic, Stipan; Waisman, Ari; Förster, Irmgard

    2006-01-01

    MHC class II (MHCII) deficiency or bare lymphocyte syndrome (BLS) is a severe immunodeficiency characterized by deficient T helper (Th)-cell-dependent immunity. The disease is caused by defects of the MHCII promoter complex resulting in low or absent MHCII expression. We demonstrate in a murine

  3. Reinfection immunity in schistosomiasis

    International Nuclear Information System (INIS)

    Kamiya, Haruo

    1987-01-01

    Schistosomiasis is one of the most important parasitic diseases in the world, especially in endemic areas of developing countries. This situation has prompted parasitologist to attempt intensive researches on immune mechanisms, especially those of reinfection immunity associated with eliminating challenge infection. The current knowledge of reinfection immunity against Schistosoma spp. infection was therefore reviewed briefly and discussed with special reference to our data on protective immune responses induced by radiation-attenuated cercarial infection. A recently developed technique of compressed organ autoradiography (COA) has contributed to assessing parasite attrition in immune animals following challenge infection. Our study using COA has demonstrated that major attrition of schistosomula from challenge infection occurs in the skin of CBA/Ca mice vaccinated with 20 Krad gamma radiation-attenuated cercariae of S. mansoni, while in both lungs and liver of similarly vaccinated guinea pig model. Furthermore, gamma-irradiation to cercariae affected their migration potential and surface-antigen profiles. The immunizing stimuli of gamma radiation-attenuated cercariae profoundly affected the expression of responsiveness in vaccinated animals. The change in antigenic profiles and migration potential of those vaccinating population was discussed in relation to the kinetics of reinfection immunity induced in vaccinated amimal models. These works might provide a base line data to develop a practical vaccine for schistosomiasis using defined antigens. It must be emphasized that these vaccines could serve as a practical prophylactic measure for schistosomiasis in the endemic areas, even if the vaccines fail to induce sterilizing immunity. (author). 141 refs

  4. Ethics of Immunization

    NARCIS (Netherlands)

    Verweij, M.F.; Quah, S.R.; Cockerham, W.C.

    2017-01-01

    Collective immunization can be highly effective in protecting societies against infectious diseases, but policy decisions about both the character and the content of immunization policies require ethical justification. This article offers an overview of ethical aspects that should be taken into

  5. Immunity and skin cancer

    International Nuclear Information System (INIS)

    Smith, E.B.; Brysk, M.M.

    1981-01-01

    Observations in humans and animal studies support the theory that immunologic surveillance plays an important role in limiting the development of skin malignancies. These immune responses undergo progressive diminution with age. In addition, other factors, such as bereavement, poor nutrition, and acute and chronic exposure to ultraviolet light, can further diminish immune mechanisms

  6. Immunizations. Position Statement. Revised

    Science.gov (United States)

    Bobo, Nichole; Garrett, Jennifer; Teskey, Carmen; Duncan, Kay; Strasser, Kathy; Burrows-Mezu, Alicia L.

    2015-01-01

    It is the position of the National Association of School Nurses (NASN) that immunizations are essential to primary prevention of disease from infancy through adulthood. Promotion of immunizations by the registered professional school nurse (hereinafter referred to as school nurse) is central to the public health focus of school nursing practice…

  7. Disparity in childhood immunizations

    NARCIS (Netherlands)

    Lemstra, Mark; Neudorf, Cory; Opondo, Johnmark; Toye, Jennifer; Kurji, Ayisha; Kunst, Anton; Tournier, Ceal

    2007-01-01

    BACKGROUND: Incomplete immunization coverage is common in low-income families and Aboriginal children in Canada. OBJECTIVE: To determine whether child immunization coverage rates at two years of age were lower in low-income neighbourhoods of Saskatoon, Saskatchewan. METHODS: Parents who were and

  8. Deficiency of adaptive immunity does not interfere with Wallerian degeneration.

    Directory of Open Access Journals (Sweden)

    Christopher R Cashman

    Full Text Available Following injury, distal axons undergo the process of Wallerian degeneration, and then cell debris is cleared to create a permissive environment for axon regeneration. The innate and adaptive immune systems are believed to be critical for facilitating the clearance of myelin and axonal debris during this process. However, immunodeficient animal models are regularly used in transplantation studies investigating cell therapies to modulate the degenerative/regenerative response. Given the importance of the immune system in preparing a permissive environment for regeneration by clearing debris, animals lacking, in part or in full, a functional immune system may have an impaired ability to regenerate due to poor myelin clearance, and may, thus, be poor hosts to study modulators of regeneration and degeneration. To study this hypothesis, three different mouse models with impaired adaptive immunity were compared to wild type animals in their ability to degenerate axons and clear myelin debris one week following sciatic nerve transection. Immunofluorescent staining for axons and quantitation of axon density with nerve histomorphometry of the distal stump showed no consistent discrepancy between immunodeficient and wild type animals, suggesting axons tended to degenerate equally between the two groups. Debris clearance was assessed by macrophage density and relative myelin basic protein expression within the denervated nerve stump, and no consistent impairment of debris clearance was found. These data suggested deficiency of the adaptive immune system does not have a substantial effect on axon degeneration one week following axonal injury.

  9. Efficacy of screening immune system function in at-risk newborns

    OpenAIRE

    Pavlovski, Christopher J

    2014-01-01

    This paper explores the introduction of a screening test to highlight impaired immune system status for newborn infants and its efficacy as a preventative clinical measure. Moreover, it is suggested that screening of the infantile immune system has the potential to highlight susceptibility to a range of infant and childhood diseases, bestowing an opportunity to introduce early intervention to reduce the incidence of these diseases. Development of the neonatal immune system is an important hea...

  10. Parental Exposure to Dim Light at Night Prior to Mating Alters Offspring Adaptive Immunity

    OpenAIRE

    Ciss?, Yasmine M.; Russart, Kathryn L.G.; Nelson, Randy J.

    2017-01-01

    Exposure to dim light at night (dLAN) disrupts natural light/dark cycles and impairs endogenous circadian rhythms necessary to maintain optimal biological function, including the endocrine and immune systems. We have previously demonstrated that white dLAN compromises innate and cell mediated immune responses in adult Siberian hamsters (Phodopus sungorus). We hypothesized that dLAN has transgenerational influences on immune function. Adult male and female Siberian hamsters were exposed to eit...

  11. Trade-offs between sexual advertisement and immune function in the pied flycatcher (Ficedula hypoleuca).

    OpenAIRE

    Kilpimaa, Janne; Alatalo, Rauno V.; Siitari, Heli

    2004-01-01

    Good genes models of sexual selection assume that sexual advertisement is costly and thus the level of advertisement honestly reveals heritable viability. Recently it has been suggested that an important cost of sexual advertisement might be impairment of the functioning of the immune system. In this field experiment we investigated the possible trade-offs between immune function and sexual advertisement by manipulating both mating effort and activity of immune defence in male pied flycatcher...

  12. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    Science.gov (United States)

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  13. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    Directory of Open Access Journals (Sweden)

    Oana Marcu

    2011-01-01

    Full Text Available Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  14. Gut microbiota in experimental murine model of Graves' orbitopathy established in different environments may modulate clinical presentation of disease.

    Science.gov (United States)

    Masetti, Giulia; Moshkelgosha, Sajad; Köhling, Hedda-Luise; Covelli, Danila; Banga, Jasvinder Paul; Berchner-Pfannschmidt, Utta; Horstmann, Mareike; Diaz-Cano, Salvador; Goertz, Gina-Eva; Plummer, Sue; Eckstein, Anja; Ludgate, Marian; Biscarini, Filippo; Marchesi, Julian Roberto

    2018-05-25

    Variation in induced models of autoimmunity has been attributed to the housing environment and its effect on the gut microbiota. In Graves' disease (GD), autoantibodies to the thyrotropin receptor (TSHR) cause autoimmune hyperthyroidism. Many GD patients develop Graves' orbitopathy or ophthalmopathy (GO) characterized by orbital tissue remodeling including adipogenesis. Murine models of GD/GO would help delineate pathogenetic mechanisms, and although several have been reported, most lack reproducibility. A model comprising immunization of female BALBc mice with a TSHR expression plasmid using in vivo electroporation was reproduced in two independent laboratories. Similar orbital disease was induced in both centers, but differences were apparent (e.g., hyperthyroidism in Center 1 but not Center 2). We hypothesized a role for the gut microbiota influencing the outcome and reproducibility of induced GO. We combined metataxonomics (16S rRNA gene sequencing) and traditional microbial culture of the intestinal contents from the GO murine model, to analyze the gut microbiota in the two centers. We observed significant differences in alpha and beta diversity and in the taxonomic profiles, e.g., operational taxonomic units (OTUs) from the genus Lactobacillus were more abundant in Center 2, and Bacteroides and Bifidobacterium counts were more abundant in Center 1 where we also observed a negative correlation between the OTUs of the genus Intestinimonas and TSHR autoantibodies. Traditional microbiology largely confirmed the metataxonomics data and indicated significantly higher yeast counts in Center 1 TSHR-immunized mice. We also compared the gut microbiota between immunization groups within Center 2, comprising the TSHR- or βgal control-immunized mice and naïve untreated mice. We observed a shift of the TSHR-immunized mice bacterial communities described by the beta diversity weighted Unifrac. Furthermore, we observed a significant positive correlation between the

  15. Neural circuitry and immunity

    Science.gov (United States)

    Pavlov, Valentin A.; Tracey, Kevin J.

    2015-01-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuroimmune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases defines the emerging field of Bioelectronic Medicine. PMID:26512000

  16. Murine Ileocolic Bowel Resection with Primary Anastomosis

    Science.gov (United States)

    Perry, Troy; Borowiec, Anna; Dicken, Bryan; Fedorak, Richard; Madsen, Karen

    2014-01-01

    Intestinal resections are frequently required for treatment of diseases involving the gastrointestinal tract, with Crohn’s disease and colon cancer being two common examples. Despite the frequency of these procedures, a significant knowledge gap remains in describing the inherent effects of intestinal resection on host physiology and disease pathophysiology. This article provides detailed instructions for an ileocolic resection with primary end-to-end anastomosis in mice, as well as essential aspects of peri-operative care to maximize post-operative success. When followed closely, this procedure yields a 95% long-term survival rate, no failure to thrive, and minimizes post-operative complications of bowel obstruction and anastomotic leak. The technical challenges of performing the procedure in mice are a barrier to its wide spread use in research. The skills described in this article can be acquired without previous surgical experience. Once mastered, the murine ileocolic resection procedure will provide a reproducible tool for studying the effects of intestinal resection in models of human disease. PMID:25406841

  17. Glycosaminoglycan interactions in murine gammaherpesvirus-68 infection.

    Directory of Open Access Journals (Sweden)

    Laurent Gillet

    2007-04-01

    Full Text Available Glycosaminoglycans (GAGs commonly participate in herpesvirus entry. They are thought to provide a reversible attachment to cells that promotes subsequent receptor binding. Murine gamma-herpesvirus-68 (MHV-68 infection of fibroblasts and epithelial cells is highly GAG-dependent. This is a function of the viral gp150, in that gp150-deficient mutants are much less GAG-dependent than wild-type. Here we show that the major MHV-68 GAG-binding protein is not gp150 but gp70, a product of ORF4. Surprisingly, ORF4-deficient MHV-68 showed normal cell binding and was more sensitive than wild-type to inhibition by soluble heparin rather than less. Thus, the most obvious viral GAG interaction made little direct contribution to infection. Indeed, a large fraction of the virion gp70 had its GAG-binding domain removed by post-translational cleavage. ORF4 may therefore act mainly to absorb soluble GAGs and prevent them from engaging gp150 prematurely. In contrast to gp70, gp150 bound poorly to GAGs, implying that it provides little in the way of adhesion. We hypothesize that it acts instead as a GAG-sensitive switch that selectively activates MHV-68 entry at cell surfaces.

  18. A cannabigerol derivative suppresses immune responses and protects mice from experimental autoimmune encephalomyelitis.

    Science.gov (United States)

    Carrillo-Salinas, Francisco J; Navarrete, Carmen; Mecha, Miriam; Feliú, Ana; Collado, Juan A; Cantarero, Irene; Bellido, María L; Muñoz, Eduardo; Guaza, Carmen

    2014-01-01

    Phytocannabinoids that do not produce psychotropic effects are considered of special interest as novel therapeutic agents in CNS diseases. A cannabigerol quinone, the compound VCE-003, has been shown to alleviate symptoms in a viral model of multiple sclerosis (MS). Hence, we studied T cells and macrophages as targets for VCE-003 and its efficacy in an autoimmune model of MS. Proliferation, cell cycle, expression of activation markers was assessed by FACs in human primary T cells, and cytokine and chemokine production was evaluated. Transcription was studied in Jurkat cells and RAW264.7 cells were used to study the effects of VCE-003 on IL-17-induced macrophage polarization to a M1 phenotype. Experimental autoimmune encephalomyelitis (EAE) was induced by myelin oligodendrocyte glycoprotein (MOG₃₅₋₅₅) immunization and spinal cord pathology was assessed by immunohistochemistry. Neurological impairment was evaluated using disease scores. We show here that VCE-003 inhibits CD3/CD28-induced proliferation, cell cycle progression and the expression of the IL-2Rα and ICAM-1 activation markers in human primary T cells. VCE-003 inhibits the secretion of Th1/Th17 cytokines and chemokines in primary murine T cells, and it reduces the transcriptional activity of the IL-2, IL-17 and TNFα promoters induced by CD3/CD28. In addition, VCE-003 and JWH-133, a selective CB2 agonist, dampened the IL-17-induced polarization of macrophages to a pro-inflammatory M1 profile. VCE-003 also prevented LPS-induced iNOS expression in microglia. VCE-003 ameliorates the neurological defects and the severity of MOG-induced EAE in mice through CB2 and PPARγ receptor activation. A reduction in cell infiltrates, mainly CD4+ T cells, was observed, and Th1 and Th17 responses were inhibited in the spinal cord of VCE-003-treated mice, accompanied by weaker microglial activation, structural preservation of myelin sheets and reduced axonal damage. This study highlights the therapeutic potential

  19. A cannabigerol derivative suppresses immune responses and protects mice from experimental autoimmune encephalomyelitis.

    Directory of Open Access Journals (Sweden)

    Francisco J Carrillo-Salinas

    Full Text Available Phytocannabinoids that do not produce psychotropic effects are considered of special interest as novel therapeutic agents in CNS diseases. A cannabigerol quinone, the compound VCE-003, has been shown to alleviate symptoms in a viral model of multiple sclerosis (MS. Hence, we studied T cells and macrophages as targets for VCE-003 and its efficacy in an autoimmune model of MS. Proliferation, cell cycle, expression of activation markers was assessed by FACs in human primary T cells, and cytokine and chemokine production was evaluated. Transcription was studied in Jurkat cells and RAW264.7 cells were used to study the effects of VCE-003 on IL-17-induced macrophage polarization to a M1 phenotype. Experimental autoimmune encephalomyelitis (EAE was induced by myelin oligodendrocyte glycoprotein (MOG₃₅₋₅₅ immunization and spinal cord pathology was assessed by immunohistochemistry. Neurological impairment was evaluated using disease scores. We show here that VCE-003 inhibits CD3/CD28-induced proliferation, cell cycle progression and the expression of the IL-2Rα and ICAM-1 activation markers in human primary T cells. VCE-003 inhibits the secretion of Th1/Th17 cytokines and chemokines in primary murine T cells, and it reduces the transcriptional activity of the IL-2, IL-17 and TNFα promoters induced by CD3/CD28. In addition, VCE-003 and JWH-133, a selective CB2 agonist, dampened the IL-17-induced polarization of macrophages to a pro-inflammatory M1 profile. VCE-003 also prevented LPS-induced iNOS expression in microglia. VCE-003 ameliorates the neurological defects and the severity of MOG-induced EAE in mice through CB2 and PPARγ receptor activation. A reduction in cell infiltrates, mainly CD4+ T cells, was observed, and Th1 and Th17 responses were inhibited in the spinal cord of VCE-003-treated mice, accompanied by weaker microglial activation, structural preservation of myelin sheets and reduced axonal damage. This study highlights the

  20. Immune hierarchy among HIV-1 CD8+ T cell epitopes delivered by dendritic cells depends on MHC-I binding irrespective of mode of loading and immunization in HLA-A*0201 mice

    DEFF Research Database (Denmark)

    Kloverpris, Henrik N; Karlsson, Ingrid; Thorn, Mette

    2009-01-01

    Recent human immunodeficiency virus type 1 (HIV-1) vaccination strategies aim at targeting a broad range of cytotoxic T lymphocyte (CTL) epitopes from different HIV-1 proteins by immunization with multiple CTL epitopes simultaneously. However, this may establish an immune hierarchical response......, where the immune system responds to only a small number of the epitopes administered. To evaluate the feasibility of such vaccine strategies, we used the human leukocyte antigen (HLA)-A*0201 transgenic (tg) HHD murine in vivo model and immunized with dendritic cells pulsed with seven HIV-1-derived HLA......-gamma)-producing CD8(+) T cells, mainly focused on two of seven administered epitopes. The magnitude of individual T-cell responses induced by immunization with multiple peptides correlated with their individual immunogenicity that depended on major histocompatibility class I binding and was not influenced by mode...

  1. On Modelling an Immune System

    OpenAIRE

    Monroy, Raúl; Saab, Rosa; Godínez, Fernando

    2004-01-01

    Immune systems of live forms have been an abundant source of inspiration to contemporary computer scientists. Problem solving strategies, stemming from known immune system phenomena, have been successfully applied to challenging problems of modern computing. However, research in artificial immune systems has overlooked establishing a coherent model of known immune system behaviour. This paper aims reports on an preliminary computer model of an immune system, where each immune system component...

  2. Rebuilding immunity with Remune.

    Science.gov (United States)

    Whitfield, L

    1998-01-01

    Remune, an immune response therapy composed of inactivated HIV, is designed to enhance the immune system's ability to recognize and kill HIV proteins. Developed by Dr. Jonas Salk, researchers hope Remune's actions can alter the course of HIV infection and slow disease progression. Remune has gained Food and Drug Administration (FDA) approval to enter the critical Phase III trial stage. Two clinical trials are tracking Remune's immunogenicity (ability to provoke an immune response), its immunogenicity relative to dose level, and its effect on viral load. An ongoing trial, approved in February of 1996, enrolled 2,500 patients at 74 sites. The manufacturer, Immune Response Corporation (IRC), announced earlier this year that treatment with Remune induces an immune response to HIV that cross-reacts with different strains of the virus. This immune response is crucial for developing an effective worldwide treatment. Remune decreases levels of tumor necrosis factor alpha (TNF-a). IRC recently began a Phase I clinical trial in Great Britain that combines Remune with a protease inhibitor, two antiviral nucleoside analogues, and Interleukin-2. The trial is designed to determine the role that the drug may play in restoring immune response.

  3. Regulatory immune cells and functions in autoimmunity and transplantation immunology.

    Science.gov (United States)

    Papp, Gabor; Boros, Peter; Nakken, Britt; Szodoray, Peter; Zeher, Margit

    2017-05-01

    In physiological circumstances, various tolerogenic mechanisms support the protection of self-structures during immune responses. However, quantitative and/or qualitative changes in regulatory immune cells and mediators can evoke auto-reactive immune responses, and upon susceptible genetic background, along with the presence of other concomitant etiological factors, autoimmune disease may develop. In transplant immunology, tolerogenic mechanisms are also critical, since the balance between of alloantigen-reactive effector cells and the regulatory immune cells will ultimately determine whether a graft is accepted or rejected. Better understanding of the immunological tolerance and the potential modulations of immune regulatory processes are crucial for developing effective therapies in autoimmune diseases as well as in organ transplantation. In this review, we focus on the novel insights regarding the impaired immune regulation and other relevant factors contributing to the development of auto-reactive and graft-reactive immune responses in autoimmune diseases and transplant rejection, respectively. We also address some promising approaches for modification of immune-regulatory processes and tolerogenic mechanisms in autoimmunity and solid organ transplantation, which may be beneficial in future therapeutic strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The Bidirectional Relationship between Sleep and Immunity against Infections

    Directory of Open Access Journals (Sweden)

    Elizabeth G. Ibarra-Coronado

    2015-01-01

    Full Text Available Sleep is considered an important modulator of the immune response. Thus, a lack of sleep can weaken immunity, increasing organism susceptibility to infection. For instance, shorter sleep durations are associated with a rise in suffering from the common cold. The function of sleep in altering immune responses must be determined to understand how sleep deprivation increases the susceptibility to viral, bacterial, and parasitic infections. There are several explanations for greater susceptibility to infections after reduced sleep, such as impaired mitogenic proliferation of lymphocytes, decreased HLA-DR expression, the upregulation of CD14+, and variations in CD4+ and CD8+ T lymphocytes, which have been observed during partial sleep deprivation. Also, steroid hormones, in addition to regulating sexual behavior, influence sleep. Thus, we hypothesize that sleep and the immune-endocrine system have a bidirectional relationship in governing various physiological processes, including immunity to infections. This review discusses the evidence on the bidirectional effects of the immune response against viral, bacterial, and parasitic infections on sleep patterns and how the lack of sleep affects the immune response against such agents. Because sleep is essential in the maintenance of homeostasis, these situations must be adapted to elicit changes in sleep patterns and other physiological parameters during the immune response to infections to which the organism is continuously exposed.

  5. Congenital hearing impairment

    Energy Technology Data Exchange (ETDEWEB)

    Robson, Caroline D. [Children' s Hospital and Harvard Medical School, Division of Neuroradiology, Department of Radiology, Boston, MA (United States)

    2006-04-15

    Establishing the etiology of congenital hearing impairment can significantly improve treatment for certain causes of hearing loss and facilitates genetic counseling. High-resolution CT and MRI have contributed to the evaluation and management of hearing impairment. In addition, with the identification of innumerable genetic loci and genetic defects involved in hearing loss, genetic testing has emerged as an invaluable tool in the assessment of hearing impairment. Some of the common forms of congenital hearing loss are reviewed and their imaging features illustrated. (orig.)

  6. Congenital hearing impairment

    International Nuclear Information System (INIS)

    Robson, Caroline D.

    2006-01-01

    Establishing the etiology of congenital hearing impairment can significantly improve treatment for certain causes of hearing loss and facilitates genetic counseling. High-resolution CT and MRI have contributed to the evaluation and management of hearing impairment. In addition, with the identification of innumerable genetic loci and genetic defects involved in hearing loss, genetic testing has emerged as an invaluable tool in the assessment of hearing impairment. Some of the common forms of congenital hearing loss are reviewed and their imaging features illustrated. (orig.)

  7. Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashley M. Sherrid

    2013-01-01

    Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

  8. Murine Th9 cells promote the survival of myeloid dendritic cells in cancer immunotherapy.

    Science.gov (United States)

    Park, Jungsun; Li, Haiyan; Zhang, Mingjun; Lu, Yong; Hong, Bangxing; Zheng, Yuhuan; He, Jin; Yang, Jing; Qian, Jianfei; Yi, Qing

    2014-08-01

    Dendritic cells (DCs) are professional antigen-presenting cells to initiate immune responses, and DC survival time is important for affecting the strength of T-cell responses. Interleukin (IL)-9-producing T-helper (Th)-9 cells play an important role in anti-tumor immunity. However, it is unclear how Th9 cells communicate with DCs. In this study, we investigated whether murine Th9 cells affected the survival of myeloid DCs. DCs derived from bone marrow of C57BL/6 mice were cocultured with Th9 cells from OT-II mice using transwell, and the survival of DCs was examined. DCs cocultured with Th9 cells had longer survival and fewer apoptotic cells than DCs cultured alone in vitro. In melanoma B16-OVA tumor-bearing mice, DCs conditioned by Th9 cells lived longer and induced stronger anti-tumor response than control DCs did in vivo. Mechanistic studies revealed that IL-3 but not IL-9 secreted by Th9 cells was responsible for the prolonged survival of DCs. IL-3 upregulated the expression of anti-apoptotic protein Bcl-xL and activated p38, ERK and STAT5 signaling pathways in DCs. Taken together, our data provide the first evidence that Th9 cells can promote the survival of DCs through IL-3, and will be helpful for designing Th9 cell immunotherapy and more effective DC vaccine for human cancers.

  9. Cryptococcus neoformans hyperfilamentous strain is hypervirulent in a murine model of cryptococcal meningoencephalitis.

    Directory of Open Access Journals (Sweden)

    Marianna Feretzaki

    Full Text Available Cryptococcus neoformans is a human fungal pathogen that causes lethal infections of the lung and central nervous system in immunocompromised individuals. C. neoformans has a defined bipolar sexual life cycle with a and α mating types. During the sexual cycle, which can occur between cells of opposite mating types (bisexual reproduction or cells of one mating type (unisexual reproduction, a dimorphic transition from yeast to hyphal growth occurs. Hyphal development and meiosis generate abundant spores that, following inhalation, penetrate deep into the lung to enter the alveoli, germinate, and establish a pulmonary infection growing as budding yeast cells. Unisexual reproduction has been directly observed only in the Cryptococcus var. neoformans (serotype D lineage under laboratory conditions. However, hyphal development has been previously associated with reduced virulence and the serotype D lineage exhibits limited pathogenicity in the murine model. In this study we show that the serotype D hyperfilamentous strain XL280α is hypervirulent in an animal model. It can grow inside the lung of the host, establish a pulmonary infection, and then disseminate to the brain to cause cryptococcal meningoencephalitis. Surprisingly, this hyperfilamentous strain triggers an immune response polarized towards Th2-type immunity, which is usually observed in the highly virulent sibling species C. gattii, responsible for the Pacific Northwest outbreak. These studies provide a technological advance that will facilitate analysis of virulence genes and attributes in C. neoformans var. neoformans, and reveal the virulence potential of serotype D as broader and more dynamic than previously appreciated.

  10. Detection of antibodies against Theiler's murine encephalomyelitis virus GDVII strain in experimental guinea pigs.

    Science.gov (United States)

    Häger, C; Glage, S; Held, N; Bleich, E M; Burghard, A; Mähler, M; Bleich, André

    2016-10-01

    A disease affecting guinea pigs called 'guinea pig lameness' characterized by clinical signs of depression, lameness of limbs, flaccid paralysis, weight loss and death within a few weeks was first described by Römer in 1911. After a research group in our facility kept laboratory guinea pigs from two different origins together in one room, lameness was observed in two animals. Further investigations revealed a serological immune response against Theiler's murine encephalomyelitis virus (TMEV; GDVII strain) in these animals. Histopathology of the lumbar spinal cord of these animals showed mononuclear cell infiltration and necrotic neurons in the anterior horn. Therefore, all guinea pigs from this contaminated animal unit, from other units in our facility, as well as from different European institutions and breeding centres were screened for antibodies directed against GDVII. Our investigations showed that approximately 80% of all guinea pigs from the contaminated animal unit were seropositive for GDVII, whereas animals from other separate units were completely negative. In addition, 43% of tested sera from the different European institutions and breeding centres contained antibodies against GDVII. The present data confirm that an unknown viral infection causes an immune response in experimental guinea pigs leading to seroconversion against GDVII and that guinea pigs from a commercial breeder are the source of the infection. © The Author(s) 2015.

  11. National Network for Immunization Information

    Science.gov (United States)

    ... American College of Obstetricians and Gynecologists . © Copyright National Network for Immunization Information. The information contained in the National Network for Immunization Information Web site should not be ...

  12. Frontline Science: ATF3 is responsible for the inhibition of TNF-α release and the impaired migration of acute ethanol-exposed monocytes and macrophages.

    Science.gov (United States)

    Hu, Chaojie; Meng, Xiaoming; Huang, Cheng; Shen, Chenlin; Li, Jun

    2017-03-01

    Binge drinking represses host innate immunity and leads to a high risk of infection. Acute EtOH-pretreated macrophages exhibit a decreased production of proinflammatory mediators in response to LPS. ATF3 is induced and counter-regulates the LPS/TLR4 inflammatory cascade. Here, we investigated the potential role of ATF3 in LPS tolerance in acute ethanol-pretreated macrophages. We found that there was an inverse correlation between ATF3 and LPS-induced TNF-α production in acute ethanol-pretreated murine monocytes and macrophages. The knockdown of ATF3 attenuated the inhibitory effects of acute ethanol treatment on LPS-induced TNF-α production. Furthermore, ChIP assays and co-IP demonstrated that ATF3, together with HDAC1, negatively modulated the transcription of TNF-α. In binge-drinking mice challenged with LPS, an up-regulation of ATF3 and HDAC1 and a concomitant decrease in TNF-α were observed. Given that HDAC1 was concomitantly induced in acute ethanol-exposed monocytes and macrophages, we used the HDACi TSA or silenced HDAC1 to explore the role of HDAC1 in acute ethanol-treated macrophages. Our results revealed that TSA treatment and HDAC1 knockdown prevented acute ethanol-induced ATF3 expression and the inhibition of TNF-α transcription. These data indicated a dual role for HDAC1 in acute ethanol-induced LPS tolerance. Furthermore, we showed that the induction of ATF3 led to the impaired migration of BM monocytes and macrophages. Overall, we present a novel role for ATF3 in the inhibition of LPS-induced TNF-α and in the impairment of monocyte and macrophage migration. © Society for Leukocyte Biology.

  13. The role of selenium in inflammation and immunity: from molecular mechanisms to therapeutic opportunities.

    Science.gov (United States)

    Huang, Zhi; Rose, Aaron H; Hoffmann, Peter R

    2012-04-01

    Dietary selenium (]Se), mainly through its incorporation into selenoproteins, plays an important role in inflammation and immunity. Adequate levels of Se are important for initiating immunity, but they are also involved in regulating excessive immune responses and chronic inflammation. Evidence has emerged regarding roles for individual selenoproteins in regulating inflammation and immunity, and this has provided important insight into mechanisms by which Se influences these processes. Se deficiency has long been recognized to negatively impact immune cells during activation, differentiation, and proliferation. This is related to increased oxidative stress, but additional functions such as protein folding and calcium flux may also be impaired in immune cells under Se deficient conditions. Supplementing diets with above-adequate levels of Se can also impinge on immune cell function, with some types of inflammation and immunity particularly affected and sexually dimorphic effects of Se levels in some cases. In this comprehensive article, the roles of Se and individual selenoproteins in regulating immune cell signaling and function are discussed. Particular emphasis is given to how Se and selenoproteins are linked to redox signaling, oxidative burst, calcium flux, and the subsequent effector functions of immune cells. Data obtained from cell culture and animal models are reviewed and compared with those involving human physiology and pathophysiology, including the effects of Se levels on inflammatory or immune-related diseases including anti-viral immunity, autoimmunity, sepsis, allergic asthma, and chronic inflammatory disorders. Finally, the benefits and potential adverse effects of intervention with Se supplementation for various inflammatory or immune disorders are discussed.

  14. Impairments to Vision

    Science.gov (United States)

    ... an external Non-Government web site. Impairments to Vision Normal Vision Diabetic Retinopathy Age-related Macular Degeneration In this ... pictures, fixate on the nose to simulate the vision loss. In diabetic retinopathy, the blood vessels in ...

  15. Stormwater Impaired Watersheds

    Data.gov (United States)

    Vermont Center for Geographic Information — Stormwater impaired watersheds occuring on both the Priority Waters (Part D - Completed TMDL) and 303(d) list of waters (Part A - need TMDL) The Vermont State...

  16. Immunity: Insect Immune Memory Goes Viral.

    Science.gov (United States)

    Ligoxygakis, Petros

    2017-11-20

    Adaptive memory in insect immunity has been controversial. In this issue, Andino and co-workers propose that acquisition of viral sequences in the host genome gives rise to anti-sense, anti-viral piRNAs. Such sequences can be regarded as both a genomic archive of past infections and as an armour of potential heritable memory. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Analysis of cardiomyocyte movement in the developing murine heart

    Energy Technology Data Exchange (ETDEWEB)

    Hashimoto, Hisayuki [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan); Yuasa, Shinsuke, E-mail: yuasa@a8.keio.jp [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan); Tabata, Hidenori [Department of Anatomy, Keio University School of Medicine, Tokyo (Japan); Tohyama, Shugo; Seki, Tomohisa; Egashira, Toru; Hayashiji, Nozomi; Hattori, Fumiyuki; Kusumoto, Dai; Kunitomi, Akira; Takei, Makoto; Kashimura, Shin; Yozu, Gakuto; Shimojima, Masaya; Motoda, Chikaaki; Muraoka, Naoto [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan); Nakajima, Kazunori [Department of Anatomy, Keio University School of Medicine, Tokyo (Japan); Sakaue-Sawano, Asako; Miyawaki, Atsushi [Life Function and Dynamics, ERATO, JST, 2-1 Hirosawa, Wako-city, Saitama 351-0198 (Japan); Laboratory for Cell Function and Dynamics, Advanced Technology Development Group, Brain Science Institute, RIKEN, 2-1 Hirosawa, Wako-city, Saitama 351-0198 (Japan); Fukuda, Keiichi [Department of Cardiology, Keio University School of Medicine, Tokyo (Japan)

    2015-09-04

    The precise assemblage of several types of cardiac precursors controls heart organogenesis. The cardiac precursors show dynamic movement during early development and then form the complicated heart structure. However, cardiomyocyte movements inside the newly organized mammalian heart remain unclear. We previously established the method of ex vivo time-lapse imaging of the murine heart to study cardiomyocyte behavior by using the Fucci (fluorescent ubiquitination-based cell cycle indicator) system, which can effectively label individual G1, S/G2/M, and G1/S-transition phase nuclei in living cardiomyocytes as red, green, and yellow, respectively. Global analysis of gene expression in Fucci green positive ventricular cardiomyocytes confirmed that cell cycle regulatory genes expressed in G1/S, S, G2/M, and M phase transitions were upregulated. Interestingly, pathway analysis revealed that many genes related to the cell cycle were significantly upregulated in the Fucci green positive ventricular cardiomyocytes, while only a small number of genes related to cell motility were upregulated. Time-lapse imaging showed that murine proliferating cardiomyocytes did not exhibit dynamic movement inside the heart, but stayed on site after entering the cell cycle. - Highlights: • We directly visualized cardiomyocyte movement inside the developing murine heart. • Cell cycle related genes were upregulated in the proliferating cardiomyocytes. • Time-lapse imaging revealed that proliferating murine cardiomyocytes stayed in place. • Murine ventricular cardiomyocytes proliferate on site during development.

  18. Murine Typhus: An Important Consideration for the Nonspecific Febrile Illness

    Directory of Open Access Journals (Sweden)

    Gurjot Basra

    2012-01-01

    Full Text Available Murine typhus is a widely distributed flea-borne infection caused by Rickettsia typhi. Symptoms of murine typhus are nonspecific and mimic a variety of other infectious diseases. We herein report a case of murine typhus in an area where the broad use of DDT in the mid-20th century has now made it a rare disease. The patient described presented with headache, fever, and a faint macular rash. Initial laboratory studies revealed a slight transaminase elevation. Further questioning revealed exposure to opossums, prompting the consideration of murine typhus as a diagnosis. Although typhus group antibodies were not present during the patient’s acute illness, empiric therapy with doxycycline was initiated, and the patient defervesced. One month after convalescence, the patient returned to clinic with serum that contained typhus group antibodies with an IgG titer of 1 : 1024. Murine typhus is an important consideration during the workup of a patient with a nonspecific febrile illness. Exposure to reservoir hosts and the flea vector place humans at risk for this disease. Clinician recognition of this entity is required for diagnosis and effective therapy.

  19. HIV and Immunizations

    Science.gov (United States)

    ... AIDS Drugs Clinical Trials Apps skip to content HIV Treatment Home Understanding HIV/AIDS Fact Sheets HIV ... 4 p.m. ET) Send us an email HIV and Immunizations Last Reviewed: February 6, 2018 Key ...

  20. Immunity to parasitic infection

    National Research Council Canada - National Science Library

    Lamb, Tracey J

    2012-01-01

    .... Often endemic in developing countries many parasitic diseases are neglected in terms of research funding and much remains to be understood about parasites and the interactions they have with the immune system...

  1. Exercise and immunity

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/007165.htm Exercise and immunity To use the sharing features on ... take a daily walk or follow a simple exercise routine a few times a week. Exercise helps ...

  2. Adults Need Immunizations, Too!

    Centers for Disease Control (CDC) Podcasts

    In this podcast, Dr. Andrew Kroger from CDC’s National Center for Immunization and Respiratory Diseases discusses simple, safe, and effective ways adults can help protect themselves, their family, and their community from serious and deadly diseases.