WorldWideScience

Sample records for impaired immune system

  1. Candesartan ameliorates impaired fear extinction induced by innate immune activation.

    Science.gov (United States)

    Quiñones, María M; Maldonado, Lizette; Velazquez, Bethzaly; Porter, James T

    2016-02-01

    Patients with post-traumatic stress disorder (PTSD) tend to show signs of a relatively increased inflammatory state suggesting that activation of the immune system may contribute to the development of PTSD. In the present study, we tested whether activation of the innate immune system can disrupt acquisition or recall of auditory fear extinction using an animal model of PTSD. Male adolescent rats received auditory fear conditioning in context A. The next day, an intraperitoneal injection of lipopolysaccharide (LPS; 100 μg/kg) prior to auditory fear extinction in context B impaired acquisition and recall of extinction. LPS (100 μg/kg) given after extinction training did not impair extinction recall suggesting that LPS did not affect consolidation of extinction. In contrast to cued fear extinction, contextual fear extinction was not affected by prior injection of LPS (100 μg/kg). Although LPS also reduced locomotion, we could dissociate the effects of LPS on extinction and locomotion by using a lower dose of LPS (50 μg/kg) which impaired locomotion without affecting extinction. In addition, 15 h after an injection of 250 μg/kg LPS in adult rats, extinction learning and recall were impaired without affecting locomotion. A sub-chronic treatment with candesartan, an angiotensin II type 1 receptor blocker, prevented the LPS-induced impairment of extinction in adult rats. Our results demonstrate that activation of the innate immune system can disrupt auditory fear extinction in adolescent and adult animals. These findings also provide direction for clinical studies of novel treatments that modulate the innate immune system for stress-related disorders like PTSD. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Transient immune impairment after a simulated long-haul flight.

    Science.gov (United States)

    Wilder-Smith, Annelies; Mustafa, Fatima B; Peng, Chung Mien; Earnest, Arul; Koh, David; Lin, Gen; Hossain, Iqbal; MacAry, Paul A

    2012-04-01

    Almost 2 billion people travel aboard commercial airlines every year, with about 20% developing symptoms of the common cold within 1 wk after air travel. We hypothesize that hypobaric hypoxic conditions associated with air travel may contribute to immune impairment. We studied the effects of hypobaric hypoxic conditions during a simulated flight at 8000 ft (2438 m) cruising altitude on immune and stress markers in 52 healthy volunteers (mean age 31) before and on days 1, 4, and 7 after the flight. We did a cohort study using a generalized estimating equation to examine the differences in the repeated measures. Our findings show that the hypobaric hypoxic conditions of a 10-h overnight simulation flight are not associated with severe immune impairment or abnormal IgA or cortisol levels, but with transient impairment in some parameters: we observed a transient decrease in lymphocyte proliferative responses combined with an upregulation in CD69 and CD14 cells and a decrease in HLA-DR in the immediate days following the simulated flight that normalized by day 7 in most instances. These transient immune changes may contribute to an increased susceptibility to respiratory infections commonly seen after long-haul flights.

  3. Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses.

    Science.gov (United States)

    Mahanty, Siddhartha; Hutchinson, Karen; Agarwal, Sudhanshu; McRae, Michael; Rollin, Pierre E; Pulendran, Bali

    2003-03-15

    Acute infection of humans with Ebola and Lassa viruses, two principal etiologic agents of hemorrhagic fevers, often results in a paradoxical pattern of immune responses: early infection, characterized by an outpouring of inflammatory mediators such as TNF-alpha, IL-1 beta, and IL-6, vs late stage infections, which are associated with poor immune responses. The mechanisms underlying these diverse outcomes are poorly understood. In particular, the role played by cells of the innate immune system, such as dendritic cells (DC), is not known. In this study, we show that Ebola and Lassa viruses infect human monocyte-derived DC and impair their function. Monocyte-derived DC exposed to either virus fail to secrete proinflammatory cytokines, do not up-regulate costimulatory molecules, and are poor stimulators of T cells. These data represent the first evidence for a mechanism by which Ebola and Lassa viruses target DC to impair adaptive immunity.

  4. Childhood exposure to ambient polycyclic aromatic hydrocarbons is linked to epigenetic modifications and impaired systemic immunity in T cells

    Science.gov (United States)

    Hew, K. M.; Walker, A. I.; Kohli, A.; Garcia, M.; Syed, A.; McDonald-Hyman, C.; Noth, E. M.; Mann, J. K.; Pratt, B.; Balmes, J.; Hammond, S. Katharine; Eisen, E. A.; Nadeau, K. C.

    2015-01-01

    Summary Background Evidence suggests that exposure to polycyclic aromatic hydrocarbons (PAHs) increases atopy; it is unclear how PAH exposure is linked to increased severity of atopic diseases. Objective We hypothesized that ambient PAH exposure is linked to impairment of immunity in atopic children (defined as children with asthma and/or allergic rhinitis) from Fresno, California, an area with elevated ambient PAHs. Methods We recruited 256 subjects from Fresno, CA. Ambient PAH concentrations (ng/m3) were measured using a spatial-temporal regression model over multiple time periods. Asthma diagnosis was determined by current NHLBI criteria. Phenotyping and functional immune measurements were performed from isolated cells. For epigenetic measurements, DNA was isolated and pyrosequenced. Results We show that higher average PAH exposure was significantly associated with impaired Treg function and increased methylation in the forkhead box protein 3 (FOXP3) locus (P < 0.05), conditional on atopic status. These epigenetic modifications were significantly linked to differential protein expression of FOXP3 (P < 0.001). Methylation was associated with cellular functional changes, specifically Treg dysfunction, and an increase in total plasma IgE levels. Protein expression of IL-10 decreased and IFN-γ increased as the extent of PAH exposure increased. The strength of the associations generally increased as the time window for average PAH exposure increased from 24 hr to 1 year, suggesting more of a chronic response. Significant associations with chronic PAH exposure and immune outcomes were also observed in subjects with allergic rhinitis. Conclusions and Clinical Relevance Collectively, these results demonstrate that increased ambient PAH exposure is associated with impaired systemic immunity and epigenetic modifications in a key locus involved in atopy: FOXP3, with a higher impact on atopic children. The results suggest that increased atopic clinical symptoms in children

  5. Intrauterine Growth Restriction Impairs Small Intestinal Mucosal Immunity in Neonatal Piglets

    Science.gov (United States)

    Dong, Li; Zhong, Xiang; Ahmad, Hussain; Li, Wei; Wang, Yuanxiao; Zhang, Lili

    2014-01-01

    Intrauterine growth restriction (IUGR) is a very common problem in both piglet and human neonate populations. We hypothesized that IUGR neonates have impaired intestinal mucosal immunity from birth. Using neonatal piglets as IUGR models, immune organ weights, the weight and length of the small intestine (SI), intestinal morphology, intraepithelial immune cell numbers, levels of cytokines and immunoglobulins, and the relative gene expression of cytokines in the SI were investigated. IUGR neonatal piglets were observed to have lower absolute immune organ weight and SI length, decreased relative weights of the thymus, spleen, mesenteric lymph node, and thinner but longer SIs. Damaged and jagged villi, shorter microvilli, presence of autophagosomes, swelled mitochondria, and decreased villus surface areas were also found in the SIs of IUGR neonatal piglets. We also found a smaller number of epithelial goblet cells and lymphocytes in the SIs of IUGR neonates. In addition, we detected reduced levels of the cytokines TNF-α and IFN-γ and decreased gene expression of cytokines in IUGR neonates. In conclusion, IUGR was shown to impair the mucosal immunity of the SI in neonatal piglets, and the ileum was the major site of impairment. PMID:24710659

  6. Antiretroviral therapy, immune suppression and renal impairment in HIV-positive persons

    DEFF Research Database (Denmark)

    Nielsen, Lene Ryom; Mocroft, Amanda; Lundgren, Jens D

    2014-01-01

    The purpose of this article is to review recent literature on antiretroviral treatment (ART) and immune suppression as risk factors for renal impairment in HIV-positive persons, and to discuss pending research questions within this field.......The purpose of this article is to review recent literature on antiretroviral treatment (ART) and immune suppression as risk factors for renal impairment in HIV-positive persons, and to discuss pending research questions within this field....

  7. Efficacy of screening immune system function in at-risk newborns

    OpenAIRE

    Pavlovski, Christopher J

    2014-01-01

    This paper explores the introduction of a screening test to highlight impaired immune system status for newborn infants and its efficacy as a preventative clinical measure. Moreover, it is suggested that screening of the infantile immune system has the potential to highlight susceptibility to a range of infant and childhood diseases, bestowing an opportunity to introduce early intervention to reduce the incidence of these diseases. Development of the neonatal immune system is an important hea...

  8. Ageing and the immune system: focus on macrophages.

    Science.gov (United States)

    Linehan, E; Fitzgerald, D C

    2015-03-01

    A fully functioning immune system is essential in order to maintain good health. However, the immune system deteriorates with advancing age, and this contributes to increased susceptibility to infection, autoimmunity, and cancer in the older population. Progress has been made in identifying age-related defects in the adaptive immune system. In contrast, relatively little research has been carried out on the impact of ageing on the innate immune response. This area requires further research as the innate immune system plays a crucial role in protection against infection and represents a first line of defence. Macrophages are central effector cells of the innate immune system and have many diverse functions. As a result, age-related impairments in macrophage function are likely to have important consequences for the health of the older population. It has been reported that ageing in macrophages impacts on many processes including toll-like receptor signalling, polarisation, phagocytosis, and wound repair. A detailed understanding of the impact of ageing on macrophages is required in order to develop therapeutics that will boost immune responses in the older population.

  9. Neuroblastoma arginase activity creates an immunosuppressive microenvironment that impairs autologous and engineered immunity

    Science.gov (United States)

    Mussai, Francis; Egan, Sharon; Hunter, Stuart; Webber, Hannah; Fisher, Jonathan; Wheat, Rachel; McConville, Carmel; Sbirkov, Yordan; Wheeler, Kate; Bendle, Gavin; Petrie, Kevin; Anderson, John; Chesler, Louis; De Santo, Carmela

    2015-01-01

    Neuroblastoma is the most common extra cranial solid tumour of childhood, and survival remains poor for patients with advanced disease. Novel immune therapies are currently in development, but clinical outcomes have not matched preclinical results. Here, we describe key mechanisms in which neuroblastoma inhibits the immune response. We show that murine and human neuroblastoma tumour cells suppress T cell proliferation, through increased arginase activity. Arginase II is the predominant isoform expressed and creates an arginine deplete local and systemic microenvironment. Neuroblastoma arginase activity results in inhibition of myeloid cell activation and suppression of bone marrow CD34+ progenitor proliferation. Finally we demonstrate that the arginase activity of neuroblastoma impairs NY-ESO-1 specific TCR and GD2-specific CAR engineered T cell proliferation and cytotoxicity. High arginase II expression correlates with poor survival for neuroblastoma patients. The results support the hypothesis that neuroblastoma creates an arginase-dependent immunosuppressive microenvironment in both the tumour and blood that leads to impaired immune surveillance and sub-optimal efficacy of immunotherapeutic approaches. PMID:26054597

  10. How (and why) the immune system makes us sleep.

    Science.gov (United States)

    Imeri, Luca; Opp, Mark R

    2009-03-01

    Good sleep is necessary for physical and mental health. For example, sleep loss impairs immune function, and sleep is altered during infection. Immune signalling molecules are present in the healthy brain, where they interact with neurochemical systems to contribute to the regulation of normal sleep. Animal studies have shown that interactions between immune signalling molecules (such as the cytokine interleukin 1) and brain neurochemical systems (such as the serotonin system) are amplified during infection, indicating that these interactions might underlie the changes in sleep that occur during infection. Why should the immune system cause us to sleep differently when we are sick? We propose that the alterations in sleep architecture during infection are exquisitely tailored to support the generation of fever, which in turn imparts survival value.

  11. The Immune System, Cytokines, and Biomarkers in Autism Spectrum Disorder

    Institute of Scientific and Technical Information of China (English)

    Anne Masi; Nicholas Glozier; Russell Dale; Adam J.Guastella

    2017-01-01

    Autism Spectrum Disorder (ASD) is a pervasive neurodevelopmental condition characterized by variable impairments in communication and social interaction as well as restricted interests and repetitive behaviors.Heterogeneity of presentation is a hallmark.Investigations of immune system problems in ASD,including aberrations in cytokine profiles and signaling,have been increasing in recent times and are the subject of ongoing interest.With the aim of establishing whether cytokines have utility as potential biomarkers that may define a subgroup of ASD,or function as an objective measure of response to treatment,this review summarizes the role of the immune system,discusses the relationship between the immune system,the brain,and behavior,and presents previouslyidentified immune system abnormalities in ASD,specifically addressing the role of cytokines in these aberrations.The roles and identification of biomarkers are also addressed,particularly with respect to cytokine profiles in ASD.

  12. The Immune System, Cytokines, and Biomarkers in Autism Spectrum Disorder.

    Science.gov (United States)

    Masi, Anne; Glozier, Nicholas; Dale, Russell; Guastella, Adam J

    2017-04-01

    Autism Spectrum Disorder (ASD) is a pervasive neurodevelopmental condition characterized by variable impairments in communication and social interaction as well as restricted interests and repetitive behaviors. Heterogeneity of presentation is a hallmark. Investigations of immune system problems in ASD, including aberrations in cytokine profiles and signaling, have been increasing in recent times and are the subject of ongoing interest. With the aim of establishing whether cytokines have utility as potential biomarkers that may define a subgroup of ASD, or function as an objective measure of response to treatment, this review summarizes the role of the immune system, discusses the relationship between the immune system, the brain, and behavior, and presents previously-identified immune system abnormalities in ASD, specifically addressing the role of cytokines in these aberrations. The roles and identification of biomarkers are also addressed, particularly with respect to cytokine profiles in ASD.

  13. The Immune System of HIV-Exposed Uninfected Infants.

    Science.gov (United States)

    Abu-Raya, Bahaa; Kollmann, Tobias R; Marchant, Arnaud; MacGillivray, Duncan M

    2016-01-01

    Infants born to human immunodeficiency virus (HIV) infected women are HIV-exposed but the majority remains uninfected [i.e., HIV-exposed uninfected (HEU)]. HEU infants suffer greater morbidity and mortality from infections compared to HIV-unexposed (HU) peers. The reason(s) for these worse outcomes are uncertain, but could be related to an altered immune system state. This review comprehensively summarizes the current literature investigating the adaptive and innate immune system of HEU infants. HEU infants have altered cell-mediated immunity, including impaired T-cell maturation with documented hypo- as well as hyper-responsiveness to T-cell activation. And although prevaccination vaccine-specific antibody levels are often lower in HEU than HU, most HEU infants mount adequate humoral immune response following primary vaccination with diphtheria toxoid, haemophilus influenzae type b, whole cell pertussis, measles, hepatitis B, tetanus toxoid, and pneumococcal conjugate vaccines. However, HEU infants are often found to have lower absolute neutrophil counts as compared to HU infants. On the other hand, an increase of innate immune cytokine production and expression of co-stimulatory markers has been noted in HEU infants, but this increase appears to be restricted to the first few weeks of life. The immune system of HEU children beyond infancy remains largely unexplored.

  14. Oral immune therapy: targeting the systemic immune system via the gut immune system for the treatment of inflammatory bowel disease.

    Science.gov (United States)

    Ilan, Yaron

    2016-01-01

    Inflammatory bowel diseases (IBD) are associated with an altered systemic immune response leading to inflammation-mediated damage to the gut and other organs. Oral immune therapy is a method of systemic immune modulation via alteration of the gut immune system. It uses the inherit ability of the innate system of the gut to redirect the systemic innate and adaptive immune responses. Oral immune therapy is an attractive clinical approach to treat autoimmune and inflammatory disorders. It can induce immune modulation without immune suppression, has minimal toxicity and is easily administered. Targeting the systemic immune system via the gut immune system can serve as an attractive novel therapeutic method for IBD. This review summarizes the current data and discusses several examples of oral immune therapeutic methods for using the gut immune system to generate signals to reset systemic immunity as a treatment for IBD.

  15. The effects of early life adversity on the immune system.

    Science.gov (United States)

    Elwenspoek, Martha M C; Kuehn, Annette; Muller, Claude P; Turner, Jonathan D

    2017-08-01

    Early life adversity (ELA) is associated with a higher risk for diseases in adulthood. Although the pathophysiological effects of ELA are varied, there may be a unifying role for the immune system in all of the long-term pathologies such as chronic inflammatory disorders (autoimmune diseases, allergy, and asthma). Recently, significant efforts have been made to elucidate the long-term effects ELA has on immune function, as well as the mechanisms underlying these immune changes. In this review, we focus on data from human studies investigating immune parameters in relation to post-natal adverse experiences. We describe the current understanding of the 'ELA immune phenotype', characterized by inflammation, impairment of the cellular immune system, and immunosenescence. However, at present, data addressing specific immune functions are limited and there is a need for high-quality, well powered, longitudinal studies to unravel cause from effect. Besides the immune system, also the stress system and health behaviors are altered in ELA. We discuss probable underlying mechanisms based on epigenetic programming that could explain the ELA immune phenotype and whether this is a direct effect of immune programming or an indirect consequence of changes in behavior or stress reactivity. Understanding the underlying mechanisms will help define effective strategies to prevent or counteract negative ELA-associated outcomes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Role of the Immune System in Hypertension.

    Science.gov (United States)

    Rodriguez-Iturbe, Bernardo; Pons, Hector; Johnson, Richard J

    2017-07-01

    High blood pressure is present in more than one billion adults worldwide and is the most important modifiable risk factor of death resulting from cardiovascular disease. While many factors contribute to the pathogenesis of hypertension, a role of the immune system has been firmly established by a large number of investigations from many laboratories around the world. Immunosuppressive drugs and inhibition of individual cytokines prevent or ameliorate experimental hypertension, and studies in genetically-modified mouse strains have demonstrated that lymphocytes are necessary participants in the development of hypertension and in hypertensive organ injury. Furthermore, immune reactivity may be the driving force of hypertension in autoimmune diseases. Infiltration of immune cells, oxidative stress, and stimulation of the intrarenal angiotensin system are induced by activation of the innate and adaptive immunity. High blood pressure results from the combined effects of inflammation-induced impairment in the pressure natriuresis relationship, dysfunctional vascular relaxation, and overactivity of the sympathetic nervous system. Imbalances between proinflammatory effector responses and anti-inflammatory responses of regulatory T cells to a large extent determine the severity of inflammation. Experimental and human studies have uncovered autoantigens (isoketal-modified proteins and heat shock protein 70) of potential clinical relevance. Further investigations on the immune reactivity in hypertension may result in the identification of new strategies for the treatment of the disease. Copyright © 2017 the American Physiological Society.

  17. Growth hormone treatment in cartilage-hair hypoplasia: effects on growth and the immune system.

    NARCIS (Netherlands)

    Bocca, G.; Weemaes, C.M.R.; Burgt, C.J.A.M. van der; Otten, B.J.

    2004-01-01

    Cartilage-hair hypoplasia (CHH) is a rare autosomal recessive disorder characterized by metaphyseal chondrodysplasia with severe growth retardation and impaired immunity. We studied the effects of growth hormone treatment on growth parameters and the immune system in four children with CHH. The

  18. Maintenance of systemic immune functions prevents accelerated presbycusis.

    Science.gov (United States)

    Iwai, Hiroshi; Baba, Susumu; Omae, Mariko; Lee, Shinryu; Yamashita, Toshio; Ikehara, Susumu

    2008-05-07

    There is no effective therapy for progressive hearing loss such as presbycusis, the causes of which remain poorly understood because of the difficulty of separating genetic and environmental contributions. In the present study, we show that the age-related dysfunctions of the systemic immune system in an animal model of accelerated presbycusis (SAMP1, senescence-accelerated mouse P1) can be corrected by allogeneic bone marrow transplantation (BMT). We also demonstrate that this presbycusis can be prevented; BMT protects the recipients from age-related hearing impairment and the degeneration of spiral ganglion cells (SGCs) as well as the dysfunctions of T lymphocytes, which have a close relation to immune senescence. No donor cells are infiltrated to the spiral ganglia, confirming that this experimental system using BMT is connected to the systemic immune system and does not contribute to transdifferentiation or fusion by donor hematopoietic stem cells (HSCs), or to the direct maintenance of ganglion cells by locally infiltrated donor immunocompetent cells. Therefore, another procedure which attempts to prevent the age-related dysfunctions of the recipient immune system is the inoculation of syngeneic splenocytes from young donors. These mice show no development of hearing loss, compared with the recipient mice with inoculation of saline or splenocytes from old donors. Our studies on the relationship between age-related systemic immune dysfunctions and neurodegeneration mechanisms open up new avenues of treatment for presbycusis, for which there is no effective therapy.

  19. Aging of immune system: Immune signature from peripheral blood lymphocyte subsets in 1068 healthy adults.

    Science.gov (United States)

    Qin, Ling; Jing, Xie; Qiu, Zhifeng; Cao, Wei; Jiao, Yang; Routy, Jean-Pierre; Li, Taisheng

    2016-05-01

    Aging is a major risk factor for several conditions including neurodegenerative, cardiovascular diseases and cancer. Functional impairments in cellular pathways controlling genomic stability, and immune control have been identified. Biomarker of immune senescence is needed to improve vaccine response and to develop therapy to improve immune control. To identify phenotypic signature of circulating immune cells with aging, we enrolled 1068 Chinese healthy volunteers ranging from 18 to 80 years old. The decreased naïve CD4+ and CD8+ T cells, increased memory CD4+ or CD8+ T cells, loss of CD28 expression on T cells and reverse trend of CD38 and HLA-DR, were significant for aging of immune system. Conversely, the absolute counts and percentage of NK cells and CD19+B cells maintained stable in aging individuals. The Chinese reference ranges of absolute counts and percentage of peripheral lymphocyte in this study might be useful for future clinical evaluation.

  20. Immune regulation of systemic hypertension, pulmonary arterial hypertension, and preeclampsia: shared disease mechanisms and translational opportunities.

    Science.gov (United States)

    Jafri, Salema; Ormiston, Mark L

    2017-12-01

    Systemic hypertension, preeclampsia, and pulmonary arterial hypertension (PAH) are diseases of high blood pressure in the systemic or pulmonary circulation. Beyond the well-defined contribution of more traditional pathophysiological mechanisms, such as changes in the renin-angiotensin-aldosterone system, to the development of these hypertensive disorders, there is substantial clinical evidence supporting an important role for inflammation and immunity in the pathogenesis of each of these three conditions. Over the last decade, work in small animal models, bearing targeted deficiencies in specific cytokines or immune cell subsets, has begun to clarify the immune-mediated mechanisms that drive changes in vascular structure and tone in hypertensive disease. By summarizing the clinical and experimental evidence supporting a contribution of the immune system to systemic hypertension, preeclampsia, and PAH, the current review highlights the cellular and molecular pathways that are common to all three hypertensive disorders. These mechanisms are centered on an imbalance in CD4 + helper T cell populations, defined by excessive Th17 responses and impaired T reg activity, as well as the excessive activation or impairment of additional immune cell types, including macrophages, dendritic cells, CD8 + T cells, B cells, and natural killer cells. The identification of common immune mechanisms in systemic hypertension, preeclampsia, and PAH raises the possibility of new therapeutic strategies that target the immune component of hypertension across multiple disorders. Copyright © 2017 the American Physiological Society.

  1. Immune system modulation in the central nervous system: A possible role for endocannabinoids

    International Nuclear Information System (INIS)

    Abd-Allah, Adel R.A.

    2007-01-01

    The immune system is designed to protect the body from infection and tumor formation. To perform this function, cells of the immune system can be dangerous for the survival and function of the neuronal network in the brain under the influence of infection or immune imbalance. An attack of immune cells inside the brain includes the potential for severe neuronal damage or cell death and therefore impairment of the CNS function. To avoid such undesirable action of the immune system, the CNS performs a cascade of cellular and molecular mechanisms enabling strict control of immune reactions i mmune privilege . Under inflammatory and patholological conditions, uncontrolled immune system results in the activation of neuronal damage that is frequently associated with neurological diseases. On the other hand, processes of neuroprotection and neurorepair after neuronal damage depend on a steady and tightly controlled immunesurvelliance. Many immunoprotectants play a role to imbalance the immune reactions in the CNS and other organs which presents an important therapeutic target. It has been reported recently that endocannabinoids are secreted in abundance in the CNS following neuronal insult, probably for its protection. There are at least two types of cannabinoid receptors, CB1 and CB2. Both are coupled to G proteins. CB1 receptors exist primarily on central and peripheral neurons. CB2 receptors are present mainly on immune cells. Endogenous agonists for cannabinoid receptors (endocannabinoids), have been discovered, the most important being arachidonoyl ethanolamide (anandamide), 2-arachidonoyl glycerol (2AG), and 2-archidonyl glyceryl ether. Following their release, endocannabinoids are removed from the extracellular space and then degraded by intracellular enzymic hydrolysis. Therapeutic uses of cannabinoid receptor agonists/antagonists include the management of many disease conditions. They are also involved in immune system suppression and in cell to cell communication

  2. Impairment of innate immune responses in cirrhotic patients and treatment by branched-chain amino acids

    Science.gov (United States)

    Nakamura, Ikuo

    2014-01-01

    It has been reported that host defense responses, such as phagocytic function of neutrophils and natural killer (NK) cell activity of lymphocytes, are impaired in cirrhotic patients. This review will concentrate on the impairment of innate immune responses in decompensated cirrhotic patients and the effect of the treatment by branched-chain amino acids (BCAA) on innate immune responses. We already reported that phagocytic function of neutrophils was significantly improved by 3-mo BCAA supplementation. In addition, the changes of NK activity were also significant at 3 mo of supplementation compared with before supplementation. Also, Fisher’s ratios were reported to be significantly increased at 3 mo of BCAA supplementation compared with those before oral supplementation. Therefore, administration of BCAA could reduce the risk of bacterial and viral infection in patients with decompensated cirrhosis by restoring impaired innate immune responses of the host. In addition, it was also revealed that BCAA oral supplementation could reduce the risk of development of hepatocellular carcinoma in cirrhotic patients. The mechanisms of the effects will also be discussed in this review article. PMID:24966600

  3. Our Immune System

    Science.gov (United States)

    Our Immune System A story for children with primary immunodeficiency diseases Written by Sara LeBien IMMUNE DEFICIENCY FOUNDATION A note ... who are immune deficient to better understand their immune system. What is a “ B-cell, ” a “ T-cell, ” ...

  4. Immune System Quiz

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Quiz: Immune System KidsHealth / For Kids / Quiz: Immune System Print How much do you know about your immune system? Find out by taking this quiz! About Us ...

  5. The immune system and the impact of zinc during aging

    Directory of Open Access Journals (Sweden)

    Haase Hajo

    2009-06-01

    Full Text Available Abstract The trace element zinc is essential for the immune system, and zinc deficiency affects multiple aspects of innate and adaptive immunity. There are remarkable parallels in the immunological changes during aging and zinc deficiency, including a reduction in the activity of the thymus and thymic hormones, a shift of the T helper cell balance toward T helper type 2 cells, decreased response to vaccination, and impaired functions of innate immune cells. Many studies confirm a decline of zinc levels with age. Most of these studies do not classify the majority of elderly as zinc deficient, but even marginal zinc deprivation can affect immune function. Consequently, oral zinc supplementation demonstrates the potential to improve immunity and efficiently downregulates chronic inflammatory responses in the elderly. These data indicate that a wide prevalence of marginal zinc deficiency in elderly people may contribute to immunosenescence.

  6. [Immune system and tumors].

    Science.gov (United States)

    Terme, Magali; Tanchot, Corinne

    2017-02-01

    Despite having been much debated, it is now well established that the immune system plays an essential role in the fight against cancer. In this article, we will highlight the implication of the immune system in the control of tumor growth and describe the major components of the immune system involved in the antitumoral immune response. The immune system, while exerting pressure on tumor cells, also will play a pro-tumoral role by sculpting the immunogenicity of tumors cells as they develop. Finally, we will illustrate the numerous mechanisms of immune suppression that take place within the tumoral microenvironment which allow tumor cells to escape control from the immune system. The increasingly precise knowledge of the brakes to an effective antitumor immune response allows the development of immunotherapy strategies more and more innovating and promising of hope. Copyright © 2016. Published by Elsevier Masson SAS.

  7. On Modelling an Immune System

    OpenAIRE

    Monroy, Raúl; Saab, Rosa; Godínez, Fernando

    2004-01-01

    Immune systems of live forms have been an abundant source of inspiration to contemporary computer scientists. Problem solving strategies, stemming from known immune system phenomena, have been successfully applied to challenging problems of modern computing. However, research in artificial immune systems has overlooked establishing a coherent model of known immune system behaviour. This paper aims reports on an preliminary computer model of an immune system, where each immune system component...

  8. Accelerated aging versus rejuvenation of the immune system in heterochronic parabiosis.

    Science.gov (United States)

    Pishel, Iryna; Shytikov, Dmytro; Orlova, Tatiana; Peregudov, Alex; Artyuhov, Igor; Butenko, Gennadij

    2012-04-01

    The emergence of immune disorders in aging is explained by many factors, including thymus dysfunction, decrease in the proportion and function of naïve T cells, and so forth. There are several approaches to preventing these changes, such as thymus rejuvenation, stem cells recovery, modulation of hormone production, and others. Our investigations of heterochronic parabiosis have shown that benefits of a young immune system, e.g., actively working thymus and regular migration of young hematopoietic stem cells between parabiotic partners, appeared unable to restore the immune system of the old partner. At the same time, we have established a progressive immune impairment in the young heterochronic partners. The mechanism of age changes in the immune system in this model, which may lead to reduced life expectancy, has not been fully understood. The first age-related manifestation in the young partners observed 3 weeks after the surgery was a dramatic increase of CD8(+)44(+) cells population in the spleen. A detailed analysis of further changes revealed a progressive decline of most immunological functions observable for up to 3 months after the surgery. This article reviews possible mechanisms of induction of age-related changes in the immune system of young heterochronic partners. The data obtained suggest the existence of certain factors in the old organisms that trigger aging, thus preventing the rejuvenation process.

  9. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  10. Impaired Cytokine Responses to Epstein-Barr Virus Antigens in Systemic Lupus Erythematosus Patients

    DEFF Research Database (Denmark)

    Draborg, Anette Holck; Sandhu, Noreen; Larsen, Nanna

    2016-01-01

    We analyzed cytokine responses against latent and lytic Epstein-Barr virus (EBV) antigens in systemic lupus erythematosus (SLE) patients and healthy controls (HCs) to obtain an overview of the distinctive immune regulatory response in SLE patients and to expand the previously determined impaired...

  11. Yulangsan polysaccharide improves redox homeostasis and immune impairment in D-galactose-induced mimetic aging.

    Science.gov (United States)

    Doan, Van Minh; Chen, Chunxia; Lin, Xing; Nguyen, Van Phuc; Nong, Zhihuan; Li, Weisi; Chen, Qingquan; Ming, Jianjun; Xie, Qiuqiao; Huang, Renbin

    2015-05-01

    Yulangsan polysaccharide (YLSP) is a traditional Chinese medicine used in long-term treatment as a modulator of brain dysfunction and immunity. In this study, we evaluated the protective effect of YLSP against D-galactose-induced impairment of oxidative stress and the immune system and evaluated its possible mechanism of action. D-galactose was subcutaneously injected into the dorsal neck of mice daily for 8 weeks to establish the aging model. YLSP was simultaneously administered once daily. The results indicate that YLSP significantly improves the general appearance of the aging mice. YLSP significantly increased the levels of antioxidant enzymes, such as super oxide dismutase, glutathione peroxidase, catalase and total anti-oxidation capability, while decreasing the content of malondialdehyde in different tissues, including the liver, brain, and serum. YLSP also increased the interleukin-2 level while decreasing the interleukin-6 level. Moreover, YLSP significantly inhibited advanced glycation end product formation. Furthermore, YLSP decreased p21 and p53 gene expressions in the liver and brain of D-galactose-treated mice. These results suggest that YLSP may have a protective effect suppressing the aging process by enhancing antioxidant activity and immunity, as well as modulating aging-related gene expression.

  12. Impacts of Low Temperature on the Teleost Immune System

    Directory of Open Access Journals (Sweden)

    Quinn H. Abram

    2017-11-01

    Full Text Available As poikilothermic vertebrates, fish can experience changes in water temperature, and hence body temperature, as a result of seasonal changes, migration, or efflux of large quantities of effluent into a body of water. Temperature shifts outside of the optimal temperature range for an individual fish species can have negative impacts on the physiology of the animal, including the immune system. As a result, acute or chronic exposure to suboptimal temperatures can impair an organisms’ ability to defend against pathogens and thus compromise the overall health of the animal. This review focuses on the advances made towards understanding the impacts of suboptimal temperature on the soluble and cellular mediators of the innate and adaptive immune systems of fishes. Although cold stress can result in varying effects in different fish species, acute and chronic suboptimal temperature exposure generally yield suppressive effects, particularly on adaptive immunity. Knowledge of the effects of environmental temperature on fish species is critical for both the optimal management of wild species and the best management practices for aquaculture species.

  13. Validating the pivotal role of the immune system in low-dose radiation-induced tumor inhibition in Lewis lung cancer-bearing mice.

    Science.gov (United States)

    Zhou, Lei; Zhang, Xiaoying; Li, Hui; Niu, Chao; Yu, Dehai; Yang, Guozi; Liang, Xinyue; Wen, Xue; Li, Min; Cui, Jiuwei

    2018-04-01

    Although low-dose radiation (LDR) possesses the two distinct functions of inducing hormesis and adaptive responses, which result in immune enhancement and tumor inhibition, its clinical applications have not yet been elucidated. The major obstacle that hinders the application of LDR in the clinical setting is that the mechanisms underlying induction of tumor inhibition are unclear, and the risks associated with LDR are still unknown. Thus, to overcome this obstacle and elucidate the mechanisms mediating the antitumor effects of LDR, in this study, we established an in vivo lung cancer model to investigate the participation of the immune system in LDR-induced tumor inhibition and validated the pivotal role of the immune system by impairing immunity with high-dose radiation (HDR) of 1 Gy. Additionally, the LDR-induced adaptive response of the immune system was also observed by sequential HDR treatment in this mouse model. We found that LDR-activated T cells and natural killer cells and increased the cytotoxicity of splenocytes and the infiltration of T cells in the tumor tissues. In contrast, when immune function was impaired by HDR pretreatment, LDR could not induce tumor inhibition. However, when LDR was administered before HDR, the immunity could be protected from impairment, and tumor growth could be inhibited to some extent, indicating the induction of the immune adaptive response by LDR. Therefore, we demonstrated that immune enhancement played a key role in LDR-induced tumor inhibition. These findings emphasized the importance of the immune response in tumor radiotherapy and may help promote the application of LDR as a novel approach in clinical practice. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  14. Adaptation in the innate immune system and heterologous innate immunity.

    Science.gov (United States)

    Martin, Stefan F

    2014-11-01

    The innate immune system recognizes deviation from homeostasis caused by infectious or non-infectious assaults. The threshold for its activation seems to be established by a calibration process that includes sensing of microbial molecular patterns from commensal bacteria and of endogenous signals. It is becoming increasingly clear that adaptive features, a hallmark of the adaptive immune system, can also be identified in the innate immune system. Such adaptations can result in the manifestation of a primed state of immune and tissue cells with a decreased activation threshold. This keeps the system poised to react quickly. Moreover, the fact that the innate immune system recognizes a wide variety of danger signals via pattern recognition receptors that often activate the same signaling pathways allows for heterologous innate immune stimulation. This implies that, for example, the innate immune response to an infection can be modified by co-infections or other innate stimuli. This "design feature" of the innate immune system has many implications for our understanding of individual susceptibility to diseases or responsiveness to therapies and vaccinations. In this article, adaptive features of the innate immune system as well as heterologous innate immunity and their implications are discussed.

  15. Protein malnutrition impairs the immune response and influences the severity of infection in a hamster model of chronic visceral leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Eugenia Carrillo

    Full Text Available Leishmaniasis remains one of the world's most devastating neglected tropical diseases. It mainly affects developing countries, where it often co-exists with chronic malnutrition, one of the main risk factors for developing the disease. Few studies have been published, however, on the relationship between leishmaniasis progression and malnutrition. The present paper reports the influence of protein malnutrition on the immune response and visceral disease development in adult hamsters infected with Leishmania infantum fed either standard or low protein diets. The low protein diet induced severe malnutrition in these animals, and upon infection with L. infantum 33% had severe visceral leishmaniasis compared to only 8% of animals fed the standard diet. The infected, malnourished animals showed notable leukocyte depletion, mild specific antibody responses, impairment of lymphoproliferation, presence of parasites in blood (16.67% of the hamsters and significant increase of the splenic parasite burden. Animals fed standard diet suffered agranulocytosis and monocytopenia, but showed stronger specific immune responses and had lower parasite loads than their malnourished counterparts. The present results show that protein malnutrition promotes visceral leishmaniasis and provide clues regarding the mechanisms underlying the impairment of the immune system.

  16. Immune System

    Science.gov (United States)

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  17. Weakened Immune Systems

    Science.gov (United States)

    ... Issues Health Issues Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases ... Children > Safety & Prevention > Immunizations > Weakened Immune Systems Safety & Prevention ...

  18. The entomopathogenic fungus Nomuraea rileyi impairs cellular immunity of its host Helicoverpa armigera.

    Science.gov (United States)

    Zhong, Ke; Liu, Zhan-Chi; Wang, Jia-Lin; Liu, Xu-Sheng

    2017-09-01

    In this study, we investigated the effect of the entomopathogenic fungus Nomuraea rileyi on Helicoverpa armigera cellular immune responses. Nomuraea rileyi infection had no effect on total hemocyte count (THC), but impaired hemocyte-mediated phagocytosis, nodulation, and encapsulation responses. Nomuraea rileyi infection led to a significant reduction in hemocyte spreading. An in vitro assay revealed that plasma from N. rileyi infected H. armigera larvae suppressed the spreading ability of hemocytes from naïve larvae. We infer that N. rileyi suppresses the cellular immune response of its host, possibly by secreting exogenous, cytotoxic compounds into the host's hemolymph. © 2017 Wiley Periodicals, Inc.

  19. Selfish brain and selfish immune system interplay: A theoretical framework for metabolic comorbidities of mood disorders.

    Science.gov (United States)

    Yamagata, Ana Sayuri; Mansur, Rodrigo Barbachan; Rizzo, Lucas Bortolotto; Rosenstock, Tatiana; McIntyre, Roger S; Brietzke, Elisa

    2017-01-01

    According to the "selfish brain" theory, the brain regulates its own energy supply influencing the peripheral metabolism and food intake according to its needs. The immune system has been likewise "selfish" due to independent energy consumption; and it may compete with the brain (another high energy-consumer) for glucose. In mood disorders, stress in mood episodes or physiological stress activate homeostasis mechanisms from the brain and the immune system to solve the imbalance. The interaction between the selfish brain and the selfish immune system may explain various conditions of medical impairment in mood disorders, such as Metabolic Syndrome (MetS), obesity, type 2 diabetes mellitus (T2DM) and immune dysregulation. The objective of this study is to comprehensively review the literature regarding the competition between the brain and the immune system for energy substrate. Targeting the energetic regulation of the brain and the immune system and their cross-talk open alternative treatments and a different approach in the study of general medical comorbidities in mood disorders, although more investigation is needed. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. PERINATAL MALNUTRITION AND THE PROTECTIVE ROLE OF THE PHYSICAL TRAINING ON THE IMMUNE SYSTEM.

    Science.gov (United States)

    Moreno Senna, Sueli; Ferraz, José Cândido; Leandro, Carol Góis

    2015-09-01

    Developing organisms have the ability to cope with environmental demands through physiologic and morphologic adaptations. Early life malnutrition has been recognized as an environmental stimulus that is related with down-regulation of immune responses. Some of these effects are explained by the epigenetics and the programming of hormones and cytokines impairing the modulation of the immune cells in response to environmental stimuli. Recently, it has been demonstrated that these effects are not deterministic and current environment, such as physical activity, can positively influence the immune system. Here, we discuss the effects of perinatal malnutrition on the immune system and how it can be modulated by physical training. The mechanism includes the normalization of some hormones concentrations related to growth and metabolism such as leptin, IGF-1 and glucocorticoids. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  1. Immune system simulation online

    DEFF Research Database (Denmark)

    Rapin, Nicolas; Lund, Ole; Castiglione, Filippo

    2011-01-01

    MOTIVATION: The recognition of antigenic peptides is a major event of an immune response. In current mesoscopic-scale simulators of the immune system, this crucial step has been modeled in a very approximated way. RESULTS: We have equipped an agent-based model of the immune system with immuno...

  2. Immunization Information System and Informatics to Promote Immunizations: Perspective From Minnesota Immunization Information Connection.

    Science.gov (United States)

    Muscoplat, Miriam Halstead; Rajamani, Sripriya

    2017-01-01

    The vision for management of immunization information is availability of real-time consolidated data and services for all ages, to clinical, public health, and other stakeholders. This is being executed through Immunization Information Systems (IISs), which are population-based and confidential computerized systems present in most US states and territories. Immunization Information Systems offer many functionalities, such as immunization assessment reports, client follow-up, reminder/recall feature, vaccine management tools, state-supplied vaccine ordering, comprehensive immunization history, clinical decision support/vaccine forecasting and recommendations, data processing, and data exchange. This perspective article will present various informatics tools in an IIS, in the context of the Minnesota Immunization Information Connection.

  3. Sleeping to fuel the immune system: mammalian sleep and resistance to parasites

    Directory of Open Access Journals (Sweden)

    Opp Mark R

    2009-01-01

    Full Text Available Abstract Sleep is an enigma. Why animals forgo eating and reproducing, while potentially increasing their risk of predation remains unknown. Although some may question whether all animals sleep, it is clear that all living organisms possess defenses against attack by pathogens. Immune responses of humans and animals are impaired by sleep loss, and responses to immune challenge include altered sleep. Thus, sleep is hypothesized to be a component of the acute phase response to infection and to function in host defense. Examining phylogenetic relationships among sleep parameters, components of the mammalian immune system and resistance to infection may provide insight into the evolution of sleep and lead to a greater appreciation for the role of sleep in host defense.

  4. Impairment of Several Immune Functions and Redox State in Blood Cells of Alzheimer’s Disease Patients. Relevant Role of Neutrophils in Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Carmen Vida

    2018-01-01

    Full Text Available Since aging is considered the most risk factor for sporadic Alzheimer’s Disease (AD, the age-related impairment of the immune system (immunosenescence, based on a chronic oxidative-inflammatory stress situation, could play a key role in the development and progression of AD. Although AD is accompanied by systemic disturbance, reflecting the damage in the brain, the changes in immune response and redox-state in different types of blood cells in AD patients have been scarcely studied. The aim was to analyze the variations in several immune functions and oxidative-inflammatory stress and damage parameters in both isolated peripheral neutrophils and mononuclear blood cells, as well as in whole blood cells, from patients diagnosed with mild (mAD and severe AD, and of age-matched controls (elderly healthy subjects as well as of adult controls. The cognitive decline of all subjects was determined by Mini-Mental State Examination (MMSE test (mAD stage was established at 20 ≤ MMSE ≤ 23 score; AD stage at <18 MMSE; elderly subjects >27 MMSE. The results showed an impairment of the immune functions of human peripheral blood neutrophils and mononuclear cells of mAD and AD patients in relation to healthy elderly subjects, who showed the typical immunosenescence in comparison with the adult individuals. However, several alterations were only observed in severe AD patients (lower chemotaxis, lipopolysaccharide lymphoproliferation, and interleukin (IL-10 release; higher basal proliferation, tumor necrosis factor (TNF-α release, and IL-10/TNF-α ratio, others only in mAD subjects (higher adherence, meanwhile others appeared in both mAD and AD patients (lower phytohemaglutinin lymphoproliferation and higher IL-6 release. This impairment of immune functions could be mediated by: (1 the higher oxidative stress and damage also observed in blood cells from mAD and AD patients and in isolated neutrophils [lower glutathione (GSH levels, high oxidized

  5. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    Science.gov (United States)

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  6. Alternative Immune Systems

    Directory of Open Access Journals (Sweden)

    Luis Fernando Cadavid Gutierrez

    2011-09-01

    Full Text Available The immune system in animals is a complex network of molecules, cells and tissues that coordinately maintain the physiological and genetic integrity of the organism. Traditionally, two classes of immunity have been considered, the innate immunity and the adaptive immunity. The former is ancestral, with limited variability and low discrimination. The latter is highly variable, specific and limited to jawed vertebrates. Adaptive immunity is based on antigen receptors that rearrange somatically to generate a nearly unlimited diversity of molecules. Likely, this mechanism of somatic recombination arose as a consequence of a horizontal transfer of transposons and transposases from bacterial genomes in the ancestor of jawed vertebrates. The recent discovery in jawless vertebrates and invertebrates of alternative adaptive immune mechanisms, suggests during evolution different animal groups have found alternative solutions to the problem of immune recognition.

  7. The twilight of immunity: emerging concepts in aging of the immune system.

    Science.gov (United States)

    Nikolich-Žugich, Janko

    2018-01-01

    Immunosenescence is a series of age-related changes that affect the immune system and, with time, lead to increased vulnerability to infectious diseases. This Review addresses recent developments in the understanding of age-related changes that affect key components of immunity, including the effect of aging on cells of the (mostly adaptive) immune system, on soluble molecules that guide the maintenance and function of the immune system and on lymphoid organs that coordinate both the maintenance of lymphocytes and the initiation of immune responses. I further address the effect of the metagenome and exposome as key modifiers of immune-system aging and discuss a conceptual framework in which age-related changes in immunity might also affect the basic rules by which the immune system operates.

  8. Immune System (For Parents)

    Science.gov (United States)

    ... of the Immune System Print en español El sistema inmunitario The immune system, which is made up ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on KidsHealth® is for ...

  9. Immune System and Disorders

    Science.gov (United States)

    Your immune system is a complex network of cells, tissues, and organs that work together to defend against germs. It ... t, to find and destroy them. If your immune system cannot do its job, the results can be ...

  10. Immune System Dysfunction in the Elderly.

    Science.gov (United States)

    Fuentes, Eduardo; Fuentes, Manuel; Alarcón, Marcelo; Palomo, Iván

    2017-01-01

    Human aging is characterized by both physical and physiological frailty that profoundly affects the immune system. In this context aging is associated with declines in adaptive and innate immunity established as immunosenescence. Immunosenescence is a new concept that reflects the age-associated restructuring changes of innate and adaptive immune functions. Thus elderly individuals usually present chronic low-level inflammation, higher infection rates and chronic diseases. A study of alterations in the immune system during aging could provide a potentially useful biomarker for the evaluation of immune senescence treatment. The immune system is the result of the interplay between innate and adaptive immunity, yet the impact of aging on this function is unclear. In this article the function of the immune system during aging is explored.

  11. Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

    Energy Technology Data Exchange (ETDEWEB)

    Ross, P.S. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Swart, R.L. de [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands); Timmerman, H.H.; Loveren, H. van [National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Osterhaus, A.D.M.E. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands)

    1995-12-31

    Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoid organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.

  12. CLINICAL IMMUNE RESTORATION IN THE CONTEXT OF HAART

    African Journals Online (AJOL)

    Enrique

    immune system is related to the kinetics of viral replication. In most cases increased ... The restoration of an impaired immune system is assessed by clinical parameters, immunological changes which can be measured in the ..... Levy JA, Mackeviez CE, Barker E. Controlling HIV pathogenesis: the role of the noncytotoxic ...

  13. Immunization with DAT fragments is associated with long-term striatal impairment, hyperactivity and reduced cognitive flexibility in mice

    Directory of Open Access Journals (Sweden)

    Adriani Walter

    2012-11-01

    Full Text Available Abstract Background Possible interactions between nervous and immune systems in neuro-psychiatric disorders remain elusive. Levels of brain dopamine transporter (DAT have been implicated in several impulse-control disorders, like attention deficit / hyperactivity disorder (ADHD and obsessive-compulsive disorder (OCD. Here, we assessed the interplay between DAT auto-immunity and behavioural / neurochemical phenotype. Methods Male CD-1 mice were immunized with DAT peptide fragments (DAT-i, or vehicle alone (VEH, to generate elevated circulating levels of DAT auto-antibodies (aAbs. Using an operant delay-of-reward task (20 min daily sessions; timeout 25 sec, mice had a choice between either an immediate small amount of food (SS, or a larger amount of food after a delay (LL, which increased progressively across sessions (from 0 to 150 sec. Results DAT-i mice exhibited spontaneous hyperactivity (2 h-longer wake-up peak; a wake-up attempt during rest. Two sub-populations differing in behavioural flexibility were identified in the VEH control group: they showed either a clear-cut decision to select LL or clear-cut shifting towards SS, as expected. Compared to VEH controls, choice-behaviour profile of DAT-i mice was markedly disturbed, together with long-lasting alterations of the striatal monoamines. Enhanced levels of DA metabolite HVA in DAT-i mice came along with slower acquisition of basal preferences and with impaired shifting; elevation also in DOPAC levels was associated with incapacity to change a rigid selection strategy. This scarce flexibility of performance is indicative of a poor adaptation to task contingencies. Conclusions Hyperactivity and reduced cognitive flexibility are patterns of behaviour consistent with enduring functional impairment of striatal regions. It is yet unclear how anti-DAT antibodies could enter or otherwise affect these brain areas, and which alterations in DAT activity exactly occurred after immunization

  14. Conceptual Spaces of the Immune System.

    Science.gov (United States)

    Fierz, Walter

    2016-01-01

    The immune system can be looked at as a cognitive system. This is often done in analogy to the neuro-psychological system. Here, it is demonstrated that the cognitive functions of the immune system can be properly described within a new theory of cognitive science. Gärdenfors' geometrical framework of conceptual spaces is applied to immune cognition. Basic notions, like quality dimensions, natural properties and concepts, similarities, prototypes, saliences, etc., are related to cognitive phenomena of the immune system. Constraints derived from treating the immune system within a cognitive theory, like Gärdenfors' conceptual spaces, might well prove to be instrumental for the design of vaccines, immunological diagnostic tests, and immunotherapy.

  15. Immune System and Kidney Transplantation.

    Science.gov (United States)

    Shrestha, Badri Man

    2017-01-01

    The immune system recognises a transplanted kidney as foreign body and mounts immune response through cellular and humoral mechanisms leading to acute or chronic rejection, which ultimately results in graft loss. Over the last five decades, there have been significant advances in the understanding of the immune responses to transplanted organs in both experimental and clinical transplant settings. Modulation of the immune response by using immunosuppressive agents has led to successful outcomes after kidney transplantation. The paper provides an overview of the general organisation and function of human immune system, immune response to kidney transplantation, and the current practice of immunosuppressive therapy in kidney transplantation in the United Kingdom.

  16. Dynamics of immune system vulnerabilities

    Science.gov (United States)

    Stromberg, Sean P.

    The adaptive immune system can be viewed as a complex system, which adapts, over time, to reflect the history of infections experienced by the organism. Understanding its operation requires viewing it in terms of tradeoffs under constraints and evolutionary history. It typically displays "robust, yet fragile" behavior, meaning common tasks are robust to small changes but novel threats or changes in environment can have dire consequences. In this dissertation we use mechanistic models to study several biological processes: the immune response, the homeostasis of cells in the lymphatic system, and the process that normally prevents autoreactive cells from entering the lymphatic system. Using these models we then study the effects of these processes interacting. We show that the mechanisms that regulate the numbers of cells in the immune system, in conjunction with the immune response, can act to suppress autoreactive cells from proliferating, thus showing quantitatively how pathogenic infections can suppress autoimmune disease. We also show that over long periods of time this same effect can thin the repertoire of cells that defend against novel threats, leading to an age correlated vulnerability. This vulnerability is shown to be a consequence of system dynamics, not due to degradation of immune system components with age. Finally, modeling a specific tolerance mechanism that normally prevents autoimmune disease, in conjunction with models of the immune response and homeostasis we look at the consequences of the immune system mistakenly incorporating pathogenic molecules into its tolerizing mechanisms. The signature of this dynamic matches closely that of the dengue virus system.

  17. The Immune System: Basis of so much Health and Disease: 3. Adaptive Immunity.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-04-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system; this article covers adaptive immunity. Clinical relevance: Dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  18. Cyanohepatotoxins influence on the neuroendocrine and immune systems in fish - a short review.

    Science.gov (United States)

    Sieroslawska, Anna; Rymuszka, Anna

    2009-01-01

    Cyanotoxins are the metabolites of cyanobacteria, belonging to different chemical groups and of diverse mechanisms of toxicity. Generally, they are divided into hepatotoxins, neurotoxins and dermatotoxins/irritant toxins. There is a growing evidence, that besides the above mentioned toxicity, exposure to cyanotoxins may also induce other effects, among others the disruption of neuroendocrine and immune systems. The purpose of that paper is to sum up the current information obtained from the literature and from our own studies about the influence of cyanohepatotoxins on neuroendocrine and immune systems of fish. From the presented data it appears, that microcystins, nodularin and cylindrospermopsin, except for their hepatotoxic activity, are potent to exert such effects as HPI axis activation resulting in physiological and behavioural changes, disturbances in thyroid hormones release/metabolism, as well as impairment of immune responses in fish. However the studies in that area are still incomplete and many questions remain to be answered, especially what consequences for fish population health status it brings.

  19. The Immune System Game

    Science.gov (United States)

    Work, Kirsten A.; Gibbs, Melissa A.; Friedman, Erich J.

    2015-01-01

    We describe a card game that helps introductory biology students understand the basics of the immune response to pathogens. Students simulate the steps of the immune response with cards that represent the pathogens and the cells and molecules mobilized by the immune system. In the process, they learn the similarities and differences between the…

  20. UVB-induced decreased resistance to Trichinella spiralis in the rat is related to impaired cellular immunity

    International Nuclear Information System (INIS)

    Goettsch, W.; Garssen, J.; Loveren, H. van; Gruijl, F.R. de

    1996-01-01

    Our laboratory has demonstrated in preliminary experiments that UVB exposure using the Kromayer lamp can induce increased numbers of Trichinella spiralis larvae in carcasses of infected Wistar rats, without affecting specific antibody titers to this parasite. In this study, orally T.spiralis-infected Wistar rats were exposed to subery-thermal doses of UVB radiation using FS40 lamps during different time periods before or after infection. A significant increase in the number of T. spiralis larvae was found in the carcasses of rats that were UVB irradiated daily for 7 consecutive days in the second week after infection. Additionally, increased numbers of larvae were also detected histologically in the tongue of rats that were exposed the first and the second week after infection. Lymphocyte stimulation assays using mesenteral lymph node cells indicated that UVB exposure also impaired the specific lymphocyte response to T. spiralis. Moreover, DTH responses to T. spiralis were severely impaired in rats that were UVB irradiated daily for 7 consecutive days in the second week after infection. Thus, these data combined with the data of the Kromayer study indicate that exposure of rats to FS40 irradiation following oral infection with T. spiralis leads to increased numbers of larvae in systemic sites and impaired T-cell immunity to the parasite. (Author)

  1. Immune regulation in gut and cord : opportunities for directing the immune system

    NARCIS (Netherlands)

    de Roock, S.

    2012-01-01

    The gut is an important organ for the immune system. Microbes and immune cells interact directly or via epithelial cells. Both TH17 and Treg cells mature in this environment. The composition of the microbiota has an important influence on the immune homeostasis. Influencing the immune system via the

  2. Local and systemic tumor immune dynamics

    Science.gov (United States)

    Enderling, Heiko

    Tumor-associated antigens, stress proteins, and danger-associated molecular patterns are endogenous immune adjuvants that can both initiate and continually stimulate an immune response against a tumor. In retaliation, tumors can hijack intrinsic immune regulatory programs that are intended to prevent autoimmune disease, thereby facilitating continued growth despite the activated antitumor immune response. In metastatic disease, this ongoing tumor-immune battle occurs at each site. Adding an additional layer of complexity, T cells activated at one tumor site can cycle through the blood circulation system and extravasate in a different anatomic location to surveil a distant metastasis. We propose a mathematical modeling framework that incorporates the trafficking of activated T cells between metastatic sites. We extend an ordinary differential equation model of tumor-immune system interactions to multiple metastatic sites. Immune cells are activated in response to tumor burden and tumor cell death, and are recruited from tumor sites elsewhere in the body. A model of T cell trafficking throughout the circulatory system can inform the tumor-immune interaction model about the systemic distribution and arrival of T cells at specific tumor sites. Model simulations suggest that metastases not only contribute to immune surveillance, but also that this contribution varies between metastatic sites. Such information may ultimately help harness the synergy of focal therapy with the immune system to control metastatic disease.

  3. Skin Immunization Obviates Alcohol-Related Immune Dysfunction

    Directory of Open Access Journals (Sweden)

    Rhonda M. Brand

    2015-11-01

    Full Text Available Alcoholics suffer from immune dysfunction that can impede vaccine efficacy. If ethanol (EtOH-induced immune impairment is in part a result of direct exposure of immune cells to EtOH, then reduced levels of exposure could result in less immune dysfunction. As alcohol ingestion results in lower alcohol levels in skin than blood, we hypothesized that the skin immune network may be relatively preserved, enabling skin-targeted immunizations to obviate the immune inhibitory effects of alcohol consumption on conventional vaccines. We employed the two most common chronic EtOH mouse feeding models, the liver-damaging Lieber-DeCarli (LD and liver-sparing Meadows-Cook (MC diets, to examine the roles of EtOH and/or EtOH-induced liver dysfunction on alcohol related immunosuppression. Pair-fed mice were immunized against the model antigen ovalbumin (OVA by DNA immunization or against flu by administering the protein-based influenza vaccine either systemically (IV, IM, directly to liver (hydrodynamic, or cutaneously (biolistic, ID. We measured resulting tissue EtOH levels, liver stress, regulatory T cell (Treg, and myeloid-derived suppressor cell (MDSC populations. We compared immune responsiveness by measuring delayed-type hypersensitivity (DTH, antigen-specific cytotoxic T lymphocyte (CTL, and antibody induction as a function of delivery route and feeding model. We found that, as expected, and independent of the feeding model, EtOH ingestion inhibits DTH, CTL lysis, and antigen-specific total IgG induced by traditional systemic vaccines. On the other hand, skin-targeted vaccines were equally immunogenic in alcohol-exposed and non-exposed subjects, suggesting that cutaneous immunization may result in more efficacious vaccination in alcohol-ingesting subjects.

  4. IMMUNITY AND INFECTION IN WOMEN WITH HYPERPLASTIC STATES OF IMMUNE SYSTEM

    Directory of Open Access Journals (Sweden)

    A. A. Lukach

    2008-01-01

    Full Text Available Abstract. One hundred and ninety-nine patients with hyperplastic processes of reproductive system were examined, and 131 (66.16% of them were found to be infected with Chlamydia or Ureaplasma. The mean age of female patients was 42,7±1,35 years. Different infectious agents (e.g. Chlamydia trachomatis, Ureaplasma urealiticum, Mycoplasma hominis were identified in cervical canal of uterine cervix and surgical specimens (biopsy samples of excised myoma, adenomyosis or endometrial hyperplasia. The infected patients were found to have decreased monocytes and neutrophils in blood counts, lower phagocytic activity of monocytes and neutrophils, and decreased bactericidal activity of leukocytes. Other findings included lower CD20+, CD8+ and rFAS CD 95 lymphocytes. Assessment of cytokine-synthesizing activity of CD3+ lymphocytes showed a decrease in both spontaneous and stimulated response (р < 0,001. A weakest spontaneous and stimulated response was found in CD3+/IL-4+ lymphocytes. Analysis of results obtained shows systemic immune disorders and impaired cytokine-synthesizing activity of CD3+ lymphocytes correlating with infection factors in the women with hyperplastic processes of reproductive system. (Med. Immunol., 2008, vol. 10, N 2-3, pp 223-228.

  5. MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

    Science.gov (United States)

    Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

    2016-01-01

    Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.

  6. Technique Selectively Represses Immune System

    Science.gov (United States)

    ... Research Matters December 3, 2012 Technique Selectively Represses Immune System Myelin (green) encases and protects nerve fibers (brown). A new technique prevents the immune system from attacking myelin in a mouse model of ...

  7. Play the Immune System Defender Game

    Science.gov (United States)

    ... Questionnaire The Immune System Play the Immune System Game About the game Granulocytes, macrophages and dendritic cells are immune cells ... last will in Paris. Play the Blood Typing Game Try to save some patients and learn about ...

  8. Vascular cognitive impairment in Pemphigus vulgaris: a case report

    Directory of Open Access Journals (Sweden)

    José Ibiapina Siqueira- Neto

    Full Text Available ABSTRACT Pemphigus vulgaris is a systemic auto-immune medical condition that mainly manifests with changes in skin and vasculopathy. This is a case report of a 69-year-old male with confirmed histopathologic diagnosis of Pemphigus vulgaris presenting ulterior Cognitive Impairment, mostly in executive function. The patient was treated using steroids, immunomodulatory therapy, fluoxetine and galantamine. Neuropsychological testing and magnetic resonance (MRI were performed. This is the first report of correlational cognitive impairment with Pemphigus vulgaris in the literature. Physicians should be aware of vascular causes for cognitive impairment in patients presenting auto-immune conditions.

  9. Immune Evasion, Immunopathology and the Regulation of the Immune System

    Directory of Open Access Journals (Sweden)

    Bruno Faivre

    2013-02-01

    Full Text Available Costs and benefits of the immune response have attracted considerable attention in the last years among evolutionary biologists. Given the cost of parasitism, natural selection should favor individuals with the most effective immune defenses. Nevertheless, there exists huge variation in the expression of immune effectors among individuals. To explain this apparent paradox, it has been suggested that an over-reactive immune system might be too costly, both in terms of metabolic resources and risks of immune-mediated diseases, setting a limit to the investment into immune defenses. Here, we argue that this view neglects one important aspect of the interaction: the role played by evolving pathogens. We suggest that taking into account the co-evolutionary interactions between the host immune system and the parasitic strategies to overcome the immune response might provide a better picture of the selective pressures that shape the evolution of immune functioning. Integrating parasitic strategies of host exploitation can also contribute to understand the seemingly contradictory results that infection can enhance, but also protect from, autoimmune diseases. In the last decades, the incidence of autoimmune disorders has dramatically increased in wealthy countries of the northern hemisphere with a concomitant decrease of most parasitic infections. Experimental work on model organisms has shown that this pattern may be due to the protective role of certain parasites (i.e., helminths that rely on the immunosuppression of hosts for their persistence. Interestingly, although parasite-induced immunosuppression can protect against autoimmunity, it can obviously favor the spread of other infections. Therefore, we need to think about the evolution of the immune system using a multidimensional trade-off involving immunoprotection, immunopathology and the parasitic strategies to escape the immune response.

  10. CRISPR-based immune systems of the Sulfolobales: complexity and diversity

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Shah, Shiraz Ali; Vestergaard, Gisle Alberg

    2011-01-01

    CRISPR (cluster of regularly interspaced palindromic repeats)/Cas and CRISPR/Cmr systems of Sulfolobus, targeting DNA and RNA respectively of invading viruses or plasmids are complex and diverse. We address their classification and functional diversity, and the wide sequence diversity of RAMP...... (repeat-associated mysterious protein)-motif containing proteins encoded in Cmr modules. Factors influencing maintenance of partially impaired CRISPR-based systems are discussed. The capacity for whole CRISPR transcripts to be generated despite the uptake of transcription signals within spacer sequences...... is considered. Targeting of protospacer regions of invading elements by Cas protein-crRNA (CRISPR RNA) complexes exhibit relatively low sequence stringency, but the integrity of protospacer-associated motifs appears to be important. Different mechanisms for circumventing or inactivating the immune systems...

  11. Microbial-immune cross-talk and regulation of the immune system.

    Science.gov (United States)

    Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

    2013-01-01

    We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  12. In immune defense: redefining the role of the immune system in chronic disease.

    Science.gov (United States)

    Rubinow, Katya B; Rubinow, David R

    2017-03-01

    The recognition of altered immune system function in many chronic disease states has proven to be a pivotal advance in biomedical research over the past decade. For many metabolic and mood disorders, this altered immune activity has been characterized as inflammation, with the attendant assumption that the immune response is aberrant. However, accumulating evidence challenges this assumption and suggests that the immune system may be mounting adaptive responses to chronic stressors. Further, the inordinate complexity of immune function renders a simplistic, binary model incapable of capturing critical mechanistic insights. In this perspective article, we propose alternative paradigms for understanding the role of the immune system in chronic disease. By invoking allostasis or systems biology rather than inflammation, we can ascribe greater functional significance to immune mediators, gain newfound appreciation of the adaptive facets of altered immune activity, and better avoid the potentially disastrous effects of translating erroneous assumptions into novel therapeutic strategies.

  13. Innate immune memory: implications for development of pediatric immunomodulatory agents and adjuvanted vaccines

    NARCIS (Netherlands)

    Levy, O.; Netea, M.G.

    2014-01-01

    Unique features of immunity early in life include a distinct immune system particularly reliant on innate immunity, with weak T helper (Th)1-polarizing immune responses, and impaired responses to certain vaccines leading to a heightened susceptibility to infection. To these important aspects, we now

  14. Impaired B cell immunity in acute myeloid leukemia patients after chemotherapy.

    Science.gov (United States)

    Goswami, Meghali; Prince, Gabrielle; Biancotto, Angelique; Moir, Susan; Kardava, Lela; Santich, Brian H; Cheung, Foo; Kotliarov, Yuri; Chen, Jinguo; Shi, Rongye; Zhou, Huizhi; Golding, Hana; Manischewitz, Jody; King, Lisa; Kunz, Lauren M; Noonan, Kimberly; Borrello, Ivan M; Smith, B Douglas; Hourigan, Christopher S

    2017-07-10

    Changes in adaptive immune cells after chemotherapy in adult acute myeloid leukemia (AML) may have implications for the success of immunotherapy. This study was designed to determine the functional capacity of the immune system in adult patients with AML who have completed chemotherapy and are potential candidates for immunotherapy. We used the response to seasonal influenza vaccination as a surrogate for the robustness of the immune system in 10 AML patients in a complete remission post-chemotherapy and performed genetic, phenotypic, and functional characterization of adaptive immune cell subsets. Only 2 patients generated protective titers in response to vaccination, and a majority of patients had abnormal frequencies of transitional and memory B-cells. B-cell receptor sequencing showed a B-cell repertoire with little evidence of somatic hypermutation in most patients. Conversely, frequencies of T-cell populations were similar to those seen in healthy controls, and cytotoxic T-cells demonstrated antigen-specific activity after vaccination. Effector T-cells had increased PD-1 expression in AML patients least removed from chemotherapy. Our results suggest that while some aspects of cellular immunity recover quickly, humoral immunity is incompletely reconstituted in the year following intensive cytotoxic chemotherapy for AML. The observed B-cell abnormalities may explain the poor response to vaccination often seen in AML patients after chemotherapy. Furthermore, the uncoupled recovery of B-cell and T-cell immunity and increased PD-1 expression shortly after chemotherapy might have implications for the success of several modalities of immunotherapy.

  15. Nutritional modulation of age-related changes in the immune system and risk of infection.

    Science.gov (United States)

    Pae, Munkyong; Wu, Dayong

    2017-05-01

    The immune system undergoes some adverse alterations during aging, many of which have been implicated in the increased morbidity and mortality associated with infection in the elderly. In addition to intrinsic changes to the immune system with aging, the elderly are more likely to have poor nutritional status, which further impacts the already impaired immune function. Although the elderly often have low zinc serum levels, several manifestations commonly observed during zinc deficiency are similar to the changes in immune function with aging. In the case of vitamin E, although its deficiency is rare, the intake above recommended levels is shown to enhance immune functions in the elderly and to reduce the risk of acquiring upper respiratory infections in nursing home residents. Vitamin D is a critical vitamin in bone metabolism, and its deficiency is far more common, which has been linked to increased risk of infection as demonstrated in a number of observational studies including those in the elderly. In this review, we focus on zinc, vitamin E, and vitamin D, the 3 nutrients which are relatively well documented for their roles in impacting immune function and infection in the elderly, to discuss the findings in this context reported in both the observational studies and interventional clinical trials. A perspective will be provided based on the analysis of information under review. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Deficiency of adaptive immunity does not interfere with Wallerian degeneration.

    Directory of Open Access Journals (Sweden)

    Christopher R Cashman

    Full Text Available Following injury, distal axons undergo the process of Wallerian degeneration, and then cell debris is cleared to create a permissive environment for axon regeneration. The innate and adaptive immune systems are believed to be critical for facilitating the clearance of myelin and axonal debris during this process. However, immunodeficient animal models are regularly used in transplantation studies investigating cell therapies to modulate the degenerative/regenerative response. Given the importance of the immune system in preparing a permissive environment for regeneration by clearing debris, animals lacking, in part or in full, a functional immune system may have an impaired ability to regenerate due to poor myelin clearance, and may, thus, be poor hosts to study modulators of regeneration and degeneration. To study this hypothesis, three different mouse models with impaired adaptive immunity were compared to wild type animals in their ability to degenerate axons and clear myelin debris one week following sciatic nerve transection. Immunofluorescent staining for axons and quantitation of axon density with nerve histomorphometry of the distal stump showed no consistent discrepancy between immunodeficient and wild type animals, suggesting axons tended to degenerate equally between the two groups. Debris clearance was assessed by macrophage density and relative myelin basic protein expression within the denervated nerve stump, and no consistent impairment of debris clearance was found. These data suggested deficiency of the adaptive immune system does not have a substantial effect on axon degeneration one week following axonal injury.

  17. Immune System

    Science.gov (United States)

    ... of the Immune System Print en español El sistema inmunitario Whether you're stomping through the showers ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on TeensHealth® is for ...

  18. Maternal immune activation in rats produces temporal perception impairments in adult offspring analogous to those observed in schizophrenia.

    Directory of Open Access Journals (Sweden)

    Ashley R Deane

    Full Text Available The neurophysiology underlying temporal perception significantly overlaps with areas of dysfunction identified in schizophrenia. Patients commonly exhibit distorted temporal perception, which likely contributes to functional impairments. Thus, study of temporal perception in animal models of the disease may help to understand both cognitive and neurobiological factors involved in functional impairments in patients. As maternal immune activation (MIA has been shown to be a significant etiological risk factor in development of schizophrenia and other developmental psychiatric diseases, we tested interval timing in a rat model of MIA that has previously been shown to recapitulate several behavioural and neurophysiological impairments observed in the disease. Rats were tested on a temporal-bisection task, in which temporal duration stimuli were categorized as either "short" or "long" by responding to a corresponding lever. Data from this task were modeled to provide estimates of accuracy and sensitivity of temporal perception. Parameter estimates derived from the model fitting showed that MIA rats significantly overestimated the passage of time compared to controls. These results indicate that the MIA rat paradigm recapitulates timing distortions that are phenotypical of schizophrenia. These findings lend further support to the epidemiological validity of this MIA rat model, supporting its relevance for future research into the role of maternal immune activation in producing neurobiological and behavioural impairments in schizophrenia.

  19. Approaches Mediating Oxytocin Regulation of the Immune System.

    Science.gov (United States)

    Li, Tong; Wang, Ping; Wang, Stephani C; Wang, Yu-Feng

    2016-01-01

    The hypothalamic neuroendocrine system is mainly composed of the neural structures regulating hormone secretion from the pituitary gland and has been considered as the higher regulatory center of the immune system. Recently, the hypothalamo-neurohypophysial system (HNS) emerged as an important component of neuroendocrine-immune network, wherein the oxytocin (OT)-secreting system (OSS) plays an essential role. The OSS, consisting of OT neurons in the supraoptic nucleus, paraventricular nucleus, their several accessory nuclei and associated structures, can integrate neural, endocrine, metabolic, and immune information and plays a pivotal role in the development and functions of the immune system. The OSS can promote the development of thymus and bone marrow, perform immune surveillance, strengthen immune defense, and maintain immune homeostasis. Correspondingly, OT can inhibit inflammation, exert antibiotic-like effect, promote wound healing and regeneration, and suppress stress-associated immune disorders. In this process, the OSS can release OT to act on immune system directly by activating OT receptors or through modulating activities of other hypothalamic-pituitary-immune axes and autonomic nervous system indirectly. However, our understandings of the role of the OSS in neuroendocrine regulation of immune system are largely incomplete, particularly its relationship with other hypothalamic-pituitary-immune axes and the vasopressin-secreting system that coexists with the OSS in the HNS. In addition, it remains unclear about the relationship between the OSS and peripherally produced OT in immune regulation, particularly intrathymic OT that is known to elicit central immunological self-tolerance of T-cells to hypophysial hormones. In this work, we provide a brief review of current knowledge of the features of OSS regulation of the immune system and of potential approaches that mediate OSS coordination of the activities of entire neuroendocrine-immune network.

  20. Immune System Toxicity and Immunotoxicity Hazard Identification

    Science.gov (United States)

    Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

  1. The immune system in children with malnutrition - a systematic review

    DEFF Research Database (Denmark)

    Rytter, Maren Johanne Heilskov; Kolte, Lilian; Briend, André

    2014-01-01

    BACKGROUND: Malnourished children have increased risk of dying, with most deaths caused by infectious diseases. One mechanism behind this may be impaired immune function. However, this immune deficiency of malnutrition has not previously been systematically reviewed. OBJECTIVES: To review...... the scientific literature about immune function in children with malnutrition. METHODS: A systematic literature search was done in PubMed, and additional articles identified in reference lists and by correspondence with experts in the field. The inclusion criteria were studies investigating immune parameters...... in children aged 1-60 months, in relation to malnutrition, defined as wasting, underweight, stunting, or oedematous malnutrition. RESULTS: The literature search yielded 3402 articles, of which 245 met the inclusion criteria. Most were published between 1970 and 1990, and only 33 after 2003. Malnutrition...

  2. Neurofibromin 1 Impairs Natural Killer T-Cell-Dependent Antitumor Immunity against a T-Cell Lymphoma

    Directory of Open Access Journals (Sweden)

    Jianyun Liu

    2018-01-01

    Full Text Available Neurofibromin 1 (NF1 is a tumor suppressor gene encoding a Ras GTPase that negatively regulates Ras signaling pathways. Mutations in NF1 are linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. In terms of antitumor immunity, CD1d-dependent natural killer T (NKT cells play an important role in the innate antitumor immune response. Generally, Type-I NKT cells protect (and Type-II NKT cells impair host antitumor immunity. We have previously shown that CD1d-mediated antigen presentation to NKT cells is regulated by cell signaling pathways. To study whether a haploinsufficiency in NF1 would affect CD1d-dependent activation of NKT cells, we analyzed the NKT-cell population as well as the functional expression of CD1d in Nf1+/− mice. Nf1+/− mice were found to have similar levels of NKT cells as wildtype (WT littermates. Interestingly, however, reduced CD1d expression was observed in Nf1+/− mice compared with their WT littermates. When inoculated with a T-cell lymphoma in vivo, Nf1+/− mice survived longer than their WT littermates. Furthermore, blocking CD1d in vivo significantly enhanced antitumor activity in WT, but not in Nf1+/− mice. In contrast, a deficiency in Type-I NKT cells increased antitumor activity in Nf1+/− mice, but not in WT littermates. Therefore, these data suggest that normal NF1 expression impairs CD1d-mediated NKT-cell activation and antitumor activity against a T-cell lymphoma.

  3. Immune system and melanoma biology: a balance between immunosurveillance and immune escape.

    Science.gov (United States)

    Passarelli, Anna; Mannavola, Francesco; Stucci, Luigia Stefania; Tucci, Marco; Silvestris, Francesco

    2017-12-01

    Melanoma is one of the most immunogenic tumors and its relationship with host immune system is currently under investigation. Many immunomodulatory mechanisms, favoring melanomagenesis and progression, have been described to interfere with the disablement of melanoma recognition and attack by immune cells resulting in immune resistance and immunosuppression. This knowledge produced therapeutic advantages, such as immunotherapy, aiming to overcome the immune evasion. Here, we review the current advances in cancer immunoediting and focus on melanoma immunology, which involves a dynamic interplay between melanoma and immune system, as well as on effects of "targeted therapies" on tumor microenvironment for combination strategies.

  4. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    Science.gov (United States)

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  5. Immune restoration in the context of HAART | Martin | Southern ...

    African Journals Online (AJOL)

    HAART induces a sustained effective suppression of HIV replication in most patients and leads to a preservation or restoration of immune function. The restoration of an impaired immune system is assessed by clinical parameters, immunological changes which can be measured in the laboratory and a marked reduction in ...

  6. Zinc and immunity: An essential interrelation.

    Science.gov (United States)

    Maares, Maria; Haase, Hajo

    2016-12-01

    The significance of the essential trace element zinc for immune function has been known for several decades. Zinc deficiency affects immune cells, resulting in altered host defense, increased risk of inflammation, and even death. The micronutrient zinc is important for maintenance and development of immune cells of both the innate and adaptive immune system. A disrupted zinc homeostasis affects these cells, leading to impaired formation, activation, and maturation of lymphocytes, disturbed intercellular communication via cytokines, and weakened innate host defense via phagocytosis and oxidative burst. This review outlines the connection between zinc and immunity by giving a survey on the major roles of zinc in immune cell function, and their potential consequences in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Feeding Our Immune System: Impact on Metabolism

    Directory of Open Access Journals (Sweden)

    Isabelle Wolowczuk

    2008-01-01

    Full Text Available Endogenous intestinal microflora and environmental factors, such as diet, play a central role in immune homeostasis and reactivity. In addition, microflora and diet both influence body weight and insulin-resistance, notably through an action on adipose cells. Moreover, it is known since a long time that any disturbance in metabolism, like obesity, is associated with immune alteration, for example, inflammation. The purpose of this review is to provide an update on how nutrients-derived factors (mostly focusing on fatty acids and glucose impact the innate and acquired immune systems, including the gut immune system and its associated bacterial flora. We will try to show the reader how the highly energy-demanding immune cells use glucose as a main source of fuel in a way similar to that of insulin-responsive adipose tissue and how Toll-like receptors (TLRs of the innate immune system, which are found on immune cells, intestinal cells, and adipocytes, are presently viewed as essential actors in the complex balance ensuring bodily immune and metabolic health. Understanding more about these links will surely help to study and understand in a more fundamental way the common observation that eating healthy will keep you and your immune system healthy.

  8. Weakened Immune System and Adult Vaccination

    Science.gov (United States)

    ... Basics Adult Vaccination Resources for Healthcare Professionals Weakened Immune System and Adult Vaccination Recommend on Facebook Tweet Share ... people with health conditions such as a weakened immune system. If you have cancer or other immunocompromising conditions, ...

  9. Recent Advances in Aptamers Targeting Immune System.

    Science.gov (United States)

    Hu, Piao-Ping

    2017-02-01

    The immune system plays important role in protecting the organism by recognizing non-self molecules from pathogen such as bacteria, parasitic worms, and viruses. When the balance of the host defense system is disturbed, immunodeficiency, autoimmunity, and inflammation occur. Nucleic acid aptamers are short single-stranded DNA (ssDNA) or RNA ligands that interact with complementary molecules with high specificity and affinity. Aptamers that target the molecules involved in immune system to modulate their function have great potential to be explored as new diagnostic and therapeutic agents for immune disorders. This review summarizes recent advances in the development of aptamers targeting immune system. The selection of aptamers with superior chemical and biological characteristics will facilitate their application in the diagnosis and treatment of immune disorders.

  10. Transport modeling: An artificial immune system approach

    Directory of Open Access Journals (Sweden)

    Teodorović Dušan

    2006-01-01

    Full Text Available This paper describes an artificial immune system approach (AIS to modeling time-dependent (dynamic, real time transportation phenomenon characterized by uncertainty. The basic idea behind this research is to develop the Artificial Immune System, which generates a set of antibodies (decisions, control actions that altogether can successfully cover a wide range of potential situations. The proposed artificial immune system develops antibodies (the best control strategies for different antigens (different traffic "scenarios". This task is performed using some of the optimization or heuristics techniques. Then a set of antibodies is combined to create Artificial Immune System. The developed Artificial Immune transportation systems are able to generalize, adapt, and learn based on new knowledge and new information. Applications of the systems are considered for airline yield management, the stochastic vehicle routing, and real-time traffic control at the isolated intersection. The preliminary research results are very promising.

  11. Impaired intrinsic immunity to HSV-1 in human iPSC-derived TLR3-deficient CNS cells

    Science.gov (United States)

    Lafaille, Fabien G; Pessach, Itai M.; Zhang, Shen-Ying; Ciancanelli, Michael J.; Herman, Melina; Abhyankar, Avinash; Ying, Shui-Wang; Keros, Sotirios; Goldstein, Peter A.; Mostoslavsky, Gustavo; Ordovas-Montanes, Jose; Jouanguy, Emmanuelle; Plancoulaine, Sabine; Tu, Edmund; Elkabetz, Yechiel; Al-Muhsen, Saleh; Tardieu, Marc; Schlaeger, Thorsten M.; Daley, George Q.; Abel, Laurent; Casanova, Jean-Laurent; Studer, Lorenz; Notarangelo, Luigi D.

    2012-01-01

    In the course of primary infection with herpes simplex virus 1 (HSV-1), children with inborn errors of TLR3 immunity are prone to HSV-1 encephalitis (HSE) 1–3. We tested the hypothesis that the pathogenesis of HSE involves non hematopoietic central nervous system (CNS)-resident cells. We derived induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of TLR3- and UNC-93B-deficient patients and from controls. These iPSCs were differentiated into highly purified populations of neural stem cells (NSCs), neurons, astrocytes and oligodendrocytes. The induction of IFN-β and/or IFN-γ1 in response to poly(I:C) stimulation was dependent on TLR3 and UNC-93B in all cells tested. However, the induction of IFN-β and IFN-γ1 in response to HSV-1 infection was impaired selectively in UNC-93B-deficient neurons and oligodendrocytes. These cells were also much more susceptible to HSV-1 infection than control cells, whereas UNC-93B-deficient NSCs and astrocytes were not. TLR3-deficient neurons were also found to be susceptible to HSV-1 infection. The rescue of UNC-93B- and TLR3-deficient cells with the corresponding wild-type allele demonstrated that the genetic defect was the cause of the poly(I:C) and HSV-1 phenotypes. The viral infection phenotype was further rescued by treatment with exogenous IFN-α/β, but not IFN-γ1.Thus, impaired TLR3- and UNC-93B-dependent IFN-α/β intrinsic immunity to HSV-1 in the CNS, in neurons and oligodendrocytes in particular, may underlie the pathogenesis of HSE in children with TLR3 pathway deficiencies. PMID:23103873

  12. Melatonin: Buffering the Immune System

    Directory of Open Access Journals (Sweden)

    Juan M. Guerrero

    2013-04-01

    Full Text Available Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed.

  13. Melatonin: Buffering the Immune System

    Science.gov (United States)

    Carrillo-Vico, Antonio; Lardone, Patricia J.; Álvarez-Sánchez, Nuria; Rodríguez-Rodríguez, Ana; Guerrero, Juan M.

    2013-01-01

    Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed. PMID:23609496

  14. The immune system, adaptation, and machine learning

    Science.gov (United States)

    Farmer, J. Doyne; Packard, Norman H.; Perelson, Alan S.

    1986-10-01

    The immune system is capable of learning, memory, and pattern recognition. By employing genetic operators on a time scale fast enough to observe experimentally, the immune system is able to recognize novel shapes without preprogramming. Here we describe a dynamical model for the immune system that is based on the network hypothesis of Jerne, and is simple enough to simulate on a computer. This model has a strong similarity to an approach to learning and artificial intelligence introduced by Holland, called the classifier system. We demonstrate that simple versions of the classifier system can be cast as a nonlinear dynamical system, and explore the analogy between the immune and classifier systems in detail. Through this comparison we hope to gain insight into the way they perform specific tasks, and to suggest new approaches that might be of value in learning systems.

  15. The Immune System and Bodily Defence

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 2. The Immune System and Bodily Defence How Do Parasites and the Immune System Choose their Dances? Vineeta Bal Satyajit Rath. Series Article Volume 2 Issue 2 February 1997 pp 17-24 ...

  16. The Immune System and Bodily Defence

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 9. The Immune System and Bodily Defence How Does the Immune System Recognize Everything Under the Sun? Vineeta Bal Satyajit Rath. Series Article Volume 2 Issue 9 September 1997 pp 6-10 ...

  17. The S(c)ensory Immune System Theory.

    Science.gov (United States)

    Veiga-Fernandes, Henrique; Freitas, António A

    2017-10-01

    Viewpoints on the immune system have evolved across different paradigms, including the clonal selection theory, the idiotypic network, and the danger and tolerance models. Herein, we propose that in multicellular organisms, where panoplies of cells from different germ layers interact and immune cells are constantly generated, the behavior of the immune system is defined by the rules governing cell survival, systems physiology and organismic homeostasis. Initially, these rules were imprinted at the single cell-protist level, but supervened modifications in the transition to multicellular organisms. This context determined the emergence of the 'sensory immune system', which operates in a s(c)ensor mode to ensure systems physiology, organismic homeostasis, and perpetuation of its replicating molecules. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Immune genes undergo more adaptive evolution than non-immune system genes in Daphnia pulex

    Directory of Open Access Journals (Sweden)

    McTaggart Seanna J

    2012-05-01

    Full Text Available Abstract Background Understanding which parts of the genome have been most influenced by adaptive evolution remains an unsolved puzzle. Some evidence suggests that selection has the greatest impact on regions of the genome that interact with other evolving genomes, including loci that are involved in host-parasite co-evolutionary processes. In this study, we used a population genetic approach to test this hypothesis by comparing DNA sequences of 30 putative immune system genes in the crustacean Daphnia pulex with 24 non-immune system genes. Results In support of the hypothesis, results from a multilocus extension of the McDonald-Kreitman (MK test indicate that immune system genes as a class have experienced more adaptive evolution than non-immune system genes. However, not all immune system genes show evidence of adaptive evolution. Additionally, we apply single locus MK tests and calculate population genetic parameters at all loci in order to characterize the mode of selection (directional versus balancing in the genes that show the greatest deviation from neutral evolution. Conclusions Our data are consistent with the hypothesis that immune system genes undergo more adaptive evolution than non-immune system genes, possibly as a result of host-parasite arms races. The results of these analyses highlight several candidate loci undergoing adaptive evolution that could be targeted in future studies.

  19. Unique aspects of the perinatal immune system.

    Science.gov (United States)

    Zhang, Xiaoming; Zhivaki, Dania; Lo-Man, Richard

    2017-08-01

    The early stages of life are associated with increased susceptibility to infection, which is in part due to an ineffective immune system. In the context of infection, the immune system must be stimulated to provide efficient protection while avoiding insufficient or excessive activation. Yet, in early life, age-dependent immune regulation at molecular and cellular levels contributes to a reduced immunological fitness in terms of pathogen clearance and response to vaccines. To enable microbial colonization to be tolerated at birth, epigenetic immune cell programming and early life-specific immune regulatory and effector mechanisms ensure that vital functions and organ development are supported and that tissue damage is avoided. Advancement in our understanding of age-related remodelling of immune networks and the consequent tuning of immune responsiveness will open up new possibilities for immune intervention and vaccine strategies that are designed specifically for early life.

  20. Prenatal Alcohol Exposure and the Developing Immune System.

    Science.gov (United States)

    Gauthier, Theresa W

    2015-01-01

    Evidence from research in humans and animals suggest that ingesting alcohol during pregnancy can disrupt the fetal immune system and result in an increased risk of infections and disease in newborns that may persist throughout life. Alcohol may have indirect effects on the immune system by increasing the risk of premature birth, which itself is a risk factor for immune-related problems. Animal studies suggest that alcohol exposure directly disrupts the developing immune system. A comprehensive knowledge of the mechanisms underlying alcohol's effects on the developing immune system only will become clear once researchers establish improved methods for identifying newborns exposed to alcohol in utero.

  1. Review of the systems biology of the immune system using agent-based models.

    Science.gov (United States)

    Shinde, Snehal B; Kurhekar, Manish P

    2018-06-01

    The immune system is an inherent protection system in vertebrate animals including human beings that exhibit properties such as self-organisation, self-adaptation, learning, and recognition. It interacts with the other allied systems such as the gut and lymph nodes. There is a need for immune system modelling to know about its complex internal mechanism, to understand how it maintains the homoeostasis, and how it interacts with the other systems. There are two types of modelling techniques used for the simulation of features of the immune system: equation-based modelling (EBM) and agent-based modelling. Owing to certain shortcomings of the EBM, agent-based modelling techniques are being widely used. This technique provides various predictions for disease causes and treatments; it also helps in hypothesis verification. This study presents a review of agent-based modelling of the immune system and its interactions with the gut and lymph nodes. The authors also review the modelling of immune system interactions during tuberculosis and cancer. In addition, they also outline the future research directions for the immune system simulation through agent-based techniques such as the effects of stress on the immune system, evolution of the immune system, and identification of the parameters for a healthy immune system.

  2. Role of the immune system in pancreatic cancer progression and immune modulating treatment strategies.

    Science.gov (United States)

    Sideras, K; Braat, H; Kwekkeboom, J; van Eijck, C H; Peppelenbosch, M P; Sleijfer, S; Bruno, M

    2014-05-01

    Traditional chemotherapeutics have largely failed to date to produce significant improvements in pancreatic cancer survival. One of the reasons for the resilience of pancreatic cancer towards intensive treatment is that the cancer is capable of high jacking the immune system: during disease progression the immune system is converted from a system that attacks tumor cells into a support structure for the cancer, exerting trophic actions on the cancer cells. This turn-around of immune system action is achieved through mobilization and activation of regulatory T cells, myeloid derived suppressor cells, tumor-associated macrophages and fibroblasts, all of which suppress CD8 T cells and NK cells. This immune suppression occurs both through the expression of tolerance-inducing cell surface molecules, such as PD-L1, as well as through the production of "tolerogenic" cytokines, such as IL-10 and TGF-β. Based on the accumulating insight into the importance of the immune system for the outcome of pancreatic cancer patients multiple new immunotherapeutic approaches against pancreatic cancer are being currently tested in clinical trials. In this review we give an overview of both the immune escaping mechanisms of pancreatic cancer as well as the new immune related therapeutic strategies currently being tested in pancreatic cancer clinical trials. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. The Immune System and Bodily Defence

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 6. The Immune System and Bodily Defence How Does the Immune System Organize Itself so as to Connect Target Recognition to Expected Functions? Vineeta Bal Satyajit Rath. Series Article Volume 2 Issue 6 June 1997 pp 25-38 ...

  4. Loss of vagal tone aggravates systemic inflammation and cardiac impairment in endotoxemic rats.

    Science.gov (United States)

    Schulte, Astrid; Lichtenstern, Christoph; Henrich, Michael; Weigand, Markus A; Uhle, Florian

    2014-05-15

    During the course of sepsis, often myocardial depression with hemodynamic impairment occurs. Acetylcholine, the main transmitter of the parasympathetic Nervus vagus, has been shown to be of importance for the transmission of signals within the immune system and also for a variety of other functions throughout the organism. Hypothesizing a potential correlation between this dysfunction and hemodynamic impairment, we wanted to assess the impact of vagal stimulation on myocardial inflammation and function in a rat model of lipopolysaccharide (LPS)-induced septic shock. As the myocardial tissue is (sparsely) innervated by the N. vagus, there might be an important anti-inflammatory effect in the heart, inhibiting proinflammatory gene expression in cardiomyocytes and improving cardiac function. We performed stimulation of the right cervical branch of the N. vagus in vagotomized, endotoxemic (1 mg/kg body weight LPS, intravenously) rats. Hemodynamic parameters were assessed over time using a left ventricular pressure-volume catheter. After the experiments, hearts and blood plasma were collected, and the expression of proinflammatory cytokines was measured using quantitative reverse transcription polymerase chain reaction and enzyme-linked immunosorbent assay. After vagotomy, the inflammatory response was aggravated, measurable by elevated cytokine levels in plasma and ventricular tissue. In concordance, cardiac impairment during septic shock was pronounced in these animals. To reverse both hemodynamic and immunologic effects of diminished vagal tone, even a brief stimulation of the N. vagus was enough during initial LPS infusion. Overall, the N. vagus might play a major role in maintaining hemodynamic stability and cardiac immune homeostasis during septic shock. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Investigating immune system aging: system dynamics and agent-based modeling

    OpenAIRE

    Figueredo, Grazziela; Aickelin, Uwe

    2010-01-01

    System dynamics and agent based simulation models can\\ud both be used to model and understand interactions of entities within a population. Our modeling work presented here is concerned with understanding the suitability of the different types of simulation for the immune system aging problems and comparing their results. We are trying to answer questions such as: How fit is the immune system given a certain age? Would an immune boost be of therapeutic value, e.g. to improve the effectiveness...

  6. Aberrant innate immune activation following tissue injury impairs pancreatic regeneration.

    Directory of Open Access Journals (Sweden)

    Alexandra E Folias

    Full Text Available Normal tissue architecture is disrupted following injury, as resident tissue cells become damaged and immune cells are recruited to the site of injury. While injury and inflammation are critical to tissue remodeling, the inability to resolve this response can lead to the destructive complications of chronic inflammation. In the pancreas, acinar cells of the exocrine compartment respond to injury by transiently adopting characteristics of progenitor cells present during embryonic development. This process of de-differentiation creates a window where a mature and stable cell gains flexibility and is potentially permissive to changes in cellular fate. How de-differentiation can turn an acinar cell into another cell type (such as a pancreatic β-cell, or a cell with cancerous potential (as in cases of deregulated Kras activity is of interest to both the regenerative medicine and cancer communities. While it is known that inflammation and acinar de-differentiation increase following pancreatic injury, it remains unclear which immune cells are involved in this process. We used a combination of genetically modified mice, immunological blockade and cellular characterization to identify the immune cells that impact pancreatic regeneration in an in vivo model of pancreatitis. We identified the innate inflammatory response of macrophages and neutrophils as regulators of pancreatic regeneration. Under normal conditions, mild innate inflammation prompts a transient de-differentiation of acinar cells that readily dissipates to allow normal regeneration. However, non-resolving inflammation developed when elevated pancreatic levels of neutrophils producing interferon-γ increased iNOS levels and the pro-inflammatory response of macrophages. Pancreatic injury improved following in vivo macrophage depletion, iNOS inhibition as well as suppression of iNOS levels in macrophages via interferon-γ blockade, supporting the impairment in regeneration and the

  7. Prenatal Alcohol Exposure and the Developing Immune System

    OpenAIRE

    Gauthier, Theresa W.

    2015-01-01

    Evidence from research in humans and animals suggest that ingesting alcohol during pregnancy can disrupt the fetal immune system and result in an increased risk of infections and disease in newborns that may persist throughout life. Alcohol may have indirect effects on the immune system by increasing the risk of premature birth, which itself is a risk factor for immune-related problems. Animal studies suggest that alcohol exposure directly disrupts the developing immune system. A comprehensiv...

  8. The immune system in children with malnutrition--a systematic review.

    Science.gov (United States)

    Rytter, Maren Johanne Heilskov; Kolte, Lilian; Briend, André; Friis, Henrik; Christensen, Vibeke Brix

    2014-01-01

    Malnourished children have increased risk of dying, with most deaths caused by infectious diseases. One mechanism behind this may be impaired immune function. However, this immune deficiency of malnutrition has not previously been systematically reviewed. To review the scientific literature about immune function in children with malnutrition. A systematic literature search was done in PubMed, and additional articles identified in reference lists and by correspondence with experts in the field. The inclusion criteria were studies investigating immune parameters in children aged 1-60 months, in relation to malnutrition, defined as wasting, underweight, stunting, or oedematous malnutrition. The literature search yielded 3402 articles, of which 245 met the inclusion criteria. Most were published between 1970 and 1990, and only 33 after 2003. Malnutrition is associated with impaired gut-barrier function, reduced exocrine secretion of protective substances, and low levels of plasma complement. Lymphatic tissue, particularly the thymus, undergoes atrophy, and delayed-type hypersensitivity responses are reduced. Levels of antibodies produced after vaccination are reduced in severely malnourished children, but intact in moderate malnutrition. Cytokine patterns are skewed towards a Th2-response. Other immune parameters seem intact or elevated: leukocyte and lymphocyte counts are unaffected, and levels of immunoglobulins, particularly immunoglobulin A, are high. The acute phase response appears intact, and sometimes present in the absence of clinical infection. Limitations to the studies include their observational and often cross-sectional design and frequent confounding by infections in the children studied. The immunological alterations associated with malnutrition in children may contribute to increased mortality. However, the underlying mechanisms are still inadequately understood, as well as why different types of malnutrition are associated with different immunological

  9. The Immune System in Children with Malnutrition—A Systematic Review

    Science.gov (United States)

    Rytter, Maren Johanne Heilskov; Kolte, Lilian; Briend, André; Friis, Henrik; Christensen, Vibeke Brix

    2014-01-01

    Background Malnourished children have increased risk of dying, with most deaths caused by infectious diseases. One mechanism behind this may be impaired immune function. However, this immune deficiency of malnutrition has not previously been systematically reviewed. Objectives To review the scientific literature about immune function in children with malnutrition. Methods A systematic literature search was done in PubMed, and additional articles identified in reference lists and by correspondence with experts in the field. The inclusion criteria were studies investigating immune parameters in children aged 1–60 months, in relation to malnutrition, defined as wasting, underweight, stunting, or oedematous malnutrition. Results The literature search yielded 3402 articles, of which 245 met the inclusion criteria. Most were published between 1970 and 1990, and only 33 after 2003. Malnutrition is associated with impaired gut-barrier function, reduced exocrine secretion of protective substances, and low levels of plasma complement. Lymphatic tissue, particularly the thymus, undergoes atrophy, and delayed-type hypersensitivity responses are reduced. Levels of antibodies produced after vaccination are reduced in severely malnourished children, but intact in moderate malnutrition. Cytokine patterns are skewed towards a Th2-response. Other immune parameters seem intact or elevated: leukocyte and lymphocyte counts are unaffected, and levels of immunoglobulins, particularly immunoglobulin A, are high. The acute phase response appears intact, and sometimes present in the absence of clinical infection. Limitations to the studies include their observational and often cross-sectional design and frequent confounding by infections in the children studied. Conclusion The immunological alterations associated with malnutrition in children may contribute to increased mortality. However, the underlying mechanisms are still inadequately understood, as well as why different types of

  10. Nutritional components regulate the gut immune system and its association with intestinal immune disease development.

    Science.gov (United States)

    Lamichhane, Aayam; Kiyono, Hiroshi; Kunisawa, Jun

    2013-12-01

    The gut is equipped with a unique immune system for maintaining immunological homeostasis, and its functional immune disruption can result in the development of immune diseases such as food allergy and intestinal inflammation. Accumulating evidence has demonstrated that nutritional components play an important role in the regulation of gut immune responses and also in the development of intestinal immune diseases. In this review, we focus on the immunological functions of lipids, vitamins, and nucleotides in the regulation of the intestinal immune system and as potential targets for the control of intestinal immune diseases. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  11. The association of fatigue, pain, depression and anxiety with work and activity impairment in immune mediated inflammatory diseases.

    Directory of Open Access Journals (Sweden)

    Murray W Enns

    Full Text Available Impairment in work function is a frequent outcome in patients with chronic conditions such as immune-mediated inflammatory diseases (IMID, depression and anxiety disorders. The personal and economic costs of work impairment in these disorders are immense. Symptoms of pain, fatigue, depression and anxiety are potentially remediable forms of distress that may contribute to work impairment in chronic health conditions such as IMID. The present study evaluated the association between pain [Medical Outcomes Study Pain Effects Scale], fatigue [Daily Fatigue Impact Scale], depression and anxiety [Hospital Anxiety and Depression Scale] and work impairment [Work Productivity and Activity Impairment Scale] in four patient populations: multiple sclerosis (n = 255, inflammatory bowel disease (n = 248, rheumatoid arthritis (n = 154 and a depression and anxiety group (n = 307, using quantile regression, controlling for the effects of sociodemographic factors, physical disability, and cognitive deficits. Each of pain, depression symptoms, anxiety symptoms, and fatigue individually showed significant associations with work absenteeism, presenteeism, and general activity impairment (quantile regression standardized estimates ranging from 0.3 to 1.0. When the distress variables were entered concurrently into the regression models, fatigue was a significant predictor of work and activity impairment in all models (quantile regression standardized estimates ranging from 0.2 to 0.5. These findings have important clinical implications for understanding the determinants of work impairment and for improving work-related outcomes in chronic disease.

  12. Viral subversion of the immune system

    International Nuclear Information System (INIS)

    Gillet, L.; Vanderplasschen, A.

    2005-01-01

    The continuous interactions between host and viruses during their co-evolution have shaped not only the immune system but also the countermeasures used by viruses. Studies in the last decade have described the diverse arrays of pathways and molecular targets that are used by viruses to elude immune detection or destruction, or both. These include targeting of pathways for major histocompatibility complex class I and class II antigen presentation, natural killer cell recognition, apoptosis, cytokine signalling, and complement activation. This paper provides an overview of the viral immune-evasion mechanisms described to date. It highlights the contribution of this field to our understanding of the immune system, and the importance of understanding this aspect of the biology of viral infection to develop efficacious and safe vaccines. (author)

  13. Learning and Memory... and the Immune System

    Science.gov (United States)

    Marin, Ioana; Kipnis, Jonathan

    2013-01-01

    The nervous system and the immune system are two main regulators of homeostasis in the body. Communication between them ensures normal functioning of the organism. Immune cells and molecules are required for sculpting the circuitry and determining the activity of the nervous system. Within the parenchyma of the central nervous system (CNS),…

  14. Physical Activities, Exercises, and Their Effects to the Immune System

    OpenAIRE

    Nurmasitoh, Titis

    2015-01-01

    Every systems in human body correlate to maintain homeostasis. One of those systems which contribute to maintain homeostasis is the immune system. The immune system defends physiological functions against foreign substances and cancer cells through a complex and multilayered mechanism. The ability to defend against foreign substances and abnormal cells is done by two types of immune system, which are Innate immune system and adaptive/acquired immune system. There are also certain factors that...

  15. Diffuse endocrine system, neuroendocrine tumors and immunity: what's new?

    Science.gov (United States)

    Ameri, Pietro; Ferone, Diego

    2012-01-01

    During the last two decades, research into the modulation of immunity by the neuroendocrine system has flourished, unravelling significant effects of several neuropeptides, including somatostatin (SRIH), and especially cortistatin (CST), on immune cells. Scientists have learnt that the diffuse neuroendocrine system can regulate the immune system at all its levels: innate immunity, adaptive immunity, and maintenance of immune tolerance. Compelling studies with animal models have demonstrated that some neuropeptides may be effective in treating inflammatory disorders, such as sepsis, and T helper 1-driven autoimmune diseases, like Crohn's disease and rheumatoid arthritis. Here, the latest findings concerning the neuroendocrine control of the immune system are discussed, with emphasis on SRIH and CST. The second part of the review deals with the immune response to neuroendocrine tumors (NETs). The anti-NET immune response has been described in the last years and it is still being characterized, similarly to what is happening for several other types of cancer. In parallel with investigations addressing the mechanisms by which the immune system contrasts NET growth and spreading, ground-breaking clinical trials of dendritic cell vaccination as immunotherapy for metastatic NETs have shown in principle that the immune reaction to NETs can be exploited for treatment. Copyright © 2012 S. Karger AG, Basel.

  16. IgG4 subclass antibodies impair antitumor immunity in melanoma

    Science.gov (United States)

    Karagiannis, Panagiotis; Gilbert, Amy E.; Josephs, Debra H.; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L.C.; Healy, Ciaran; Harries, Mark; Acland, Katharine M.; Blower, Philip J.; Mitchell, Tracey; Fear, David J.; Spicer, James F.; Lacy, Katie E.; Nestle, Frank O.; Karagiannis, Sophia N.

    2013-01-01

    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10–driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4+-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell–mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches. PMID:23454746

  17. Promoting tissue regeneration by modulating the immune system.

    Science.gov (United States)

    Julier, Ziad; Park, Anthony J; Briquez, Priscilla S; Martino, Mikaël M

    2017-04-15

    The immune system plays a central role in tissue repair and regeneration. Indeed, the immune response to tissue injury is crucial in determining the speed and the outcome of the healing process, including the extent of scarring and the restoration of organ function. Therefore, controlling immune components via biomaterials and drug delivery systems is becoming an attractive approach in regenerative medicine, since therapies based on stem cells and growth factors have not yet proven to be broadly effective in the clinic. To integrate the immune system into regenerative strategies, one of the first challenges is to understand the precise functions of the different immune components during the tissue healing process. While remarkable progress has been made, the immune mechanisms involved are still elusive, and there is indication for both negative and positive roles depending on the tissue type or organ and life stage. It is well recognized that the innate immune response comprising danger signals, neutrophils and macrophages modulates tissue healing. In addition, it is becoming evident that the adaptive immune response, in particular T cell subset activities, plays a critical role. In this review, we first present an overview of the basic immune mechanisms involved in tissue repair and regeneration. Then, we highlight various approaches based on biomaterials and drug delivery systems that aim at modulating these mechanisms to limit fibrosis and promote regeneration. We propose that the next generation of regenerative therapies may evolve from typical biomaterial-, stem cell-, or growth factor-centric approaches to an immune-centric approach. Most regenerative strategies have not yet proven to be safe or reasonably efficient in the clinic. In addition to stem cells and growth factors, the immune system plays a crucial role in the tissue healing process. Here, we propose that controlling the immune-mediated mechanisms of tissue repair and regeneration may support

  18. Measuring the immune system: a comprehensive approach for the analysis of immune functions in humans.

    Science.gov (United States)

    Claus, Maren; Dychus, Nicole; Ebel, Melanie; Damaschke, Jürgen; Maydych, Viktoriya; Wolf, Oliver T; Kleinsorge, Thomas; Watzl, Carsten

    2016-10-01

    The immune system is essential to provide protection from infections and cancer. Disturbances in immune function can therefore directly affect the health of the affected individual. Many extrinsic and intrinsic factors such as exposure to chemicals, stress, nutrition and age have been reported to influence the immune system. These influences can affect various components of the immune system, and we are just beginning to understand the causalities of these changes. To investigate such disturbances, it is therefore essential to analyze the different components of the immune system in a comprehensive fashion. Here, we demonstrate such an approach which provides information about total number of leukocytes, detailed quantitative and qualitative changes in the composition of lymphocyte subsets, cytokine levels in serum and functional properties of T cells, NK cells and monocytes. Using samples from a cohort of 24 healthy volunteers, we demonstrate the feasibility of our approach to detect changes in immune functions.

  19. The Immune System in Irritable Bowel Syndrome

    Science.gov (United States)

    Cremon, Cesare; Carini, Giovanni; Bellacosa, Lara; Zecchi, Lisa; De Giorgio, Roberto; Corinaldesi, Roberto; Stanghellini, Vincenzo

    2011-01-01

    The potential relevance of systemic and gastrointestinal immune activation in the pathophysiology and symptom generation in the irritable bowel syndrome (IBS) is supported by a number of observations. Infectious gastroenteritis is the strongest risk factor for the development of IBS and increased rates of IBS-like symptoms have been detected in patients with inflammatory bowel disease in remission or in celiac disease patients on a gluten free diet. The number of T cells and mast cells in the small and large intestine of patients with IBS is increased in a large proportion of patients with IBS over healthy controls. Mediators released by immune cells and likely from other non-immune competent cells impact on the function of enteric and sensory afferent nerves as well as on epithelial tight junctions controlling mucosal barrier of recipient animals, isolated human gut tissues or cell culture systems. Antibodies against microbiota antigens (bacterial flagellin), and increased levels of cytokines have been detected systemically in the peripheral blood advocating the existence of abnormal host-microbial interactions and systemic immune responses. Nonetheless, there is wide overlap of data obtained in healthy controls; in addition, the subsets of patients showing immune activation have yet to be clearly identified. Gender, age, geographic differences, genetic predisposition, diet and differences in the intestinal microbiota likely play a role and further research has to be done to clarify their relevance as potential mechanisms in the described immune system dysregulation. Immune activation has stimulated interest for the potential identification of biomarkers useful for clinical and research purposes and the development of novel therapeutic approaches. PMID:22148103

  20. Natural evolution, disease, and localization in the immune system

    Science.gov (United States)

    Deem, Michael

    2004-03-01

    Adaptive vertebrate immune system is a wonder of modern evolution. Under most circumstances, the dynamics of the immune system is well-matched to the dynamics of pathogen growth during a typical infection. Some pathogens, however, have evolved escape mechanisms that interact in subtle ways with the immune system dynamics. In addition, negative interactions the immune system, which has evolved over 400 000 000 years, and vaccination,which has been practiced for only 200 years, are possible. For example,vaccination against the flu can actually increase susceptibility to the flu in the next year. As another example, vaccination against one of the four strains of dengue fever typically increases susceptibility against the other three strains. Immunodominance also arises in the immune system control of nascent tumors--the immune system recognizes only a small subset of the tumor specific antigens, and the rest are free to grow and cause tumor growth. In this talk, I present a physical theory of original antigenic sin and immunodominance. How localization in the immune system leads to the observed phenomena is discussed. 1) M. W. Deem and H. Y. Lee, ``Sequence Space Localization in the Immune System Response to Vaccination and Disease,'' Phys. Rev. Lett. 91 (2003) 068101

  1. Immune response induction in the central nervous system

    DEFF Research Database (Denmark)

    Owens, Trevor; Babcock, Alicia

    2002-01-01

    The primary function of the immune response is protection of the host against infection with pathogens, including viruses. Since viruses can infect any tissue of the body, including the central nervous system (CNS), it is logical that cells of the immune system should equally have access to all...... tissues. Nevertheless, the brain and spinal cord are noted for their lack of immune presence. Relative to other organ systems, the CNS appears immunologically privileged. Furthermore, when immune responses do occur in the CNS, they are frequently associated with deleterious effects such as inflammatory...

  2. Cancer exosomes and NKG2D receptor-ligand interactions: impairing NKG2D-mediated cytotoxicity and anti-tumour immune surveillance.

    Science.gov (United States)

    Mincheva-Nilsson, Lucia; Baranov, Vladimir

    2014-10-01

    Human cancers constitutively produce and release endosome-derived nanometer-sized vesicles called exosomes that carry biologically active proteins, messenger and micro RNAs and serve as vehicles of intercellular communication. The tumour exosomes are present in the blood, urine and various malignant effusions such as peritoneal and pleural fluid of cancer patients and can modulate immune cells and responses thus deranging the immune system of cancer patients and giving advantage to the cancer to establish and spread itself. Here, the role of exosomes in the NKG2D receptor-ligand system's interactions is discussed. The activating NK cell receptor NKG2D and its multiple ligands, the MHC class I-related chain (MIC) A/B and the retinoic acid transcript-1/UL-16 binding proteins (RAET1/ULBP) 1-6 comprise a powerful stress-inducible danger detector system that targets infected, inflamed and malignantly transformed cells and plays a decisive role in anti-tumour immune surveillance. Mounting evidence reveals that the MIC- and RAET1/ULBP ligand family members are enriched in the endosomal compartment of various tumour cells and expressed and released into the intercellular space and bodily fluids on exosomes thus preserving their entire molecule, three-dimensional protein structure and biologic activity. The NKG2D ligand-expressing exosomes serve as decoys with a powerful ability to down regulate the cognate receptor and impair the cytotoxic function of NK-, NKT-, gamma/delta- and cytotoxic T cells. This review summarizes recent findings concerning the role of NKG2D receptor-ligand system in cancer with emphasis on regulation of NKG2D ligand expression and the immunosuppressive role of exosomally expressed NKG2D ligands. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. The role of the immune system in kidney disease.

    Science.gov (United States)

    Tecklenborg, J; Clayton, D; Siebert, S; Coley, S M

    2018-05-01

    The immune system and the kidneys are closely linked. In health the kidneys contribute to immune homeostasis, while components of the immune system mediate many acute forms of renal disease and play a central role in progression of chronic kidney disease. A dysregulated immune system can have either direct or indirect renal effects. Direct immune-mediated kidney diseases are usually a consequence of autoantibodies directed against a constituent renal antigen, such as collagen IV in anti-glomerular basement membrane disease. Indirect immune-mediated renal disease often follows systemic autoimmunity with immune complex formation, but can also be due to uncontrolled activation of the complement pathways. Although the range of mechanisms of immune dysregulation leading to renal disease is broad, the pathways leading to injury are similar. Loss of immune homeostasis in renal disease results in perpetual immune cell recruitment and worsening damage to the kidney. Uncoordinated attempts at tissue repair, after immune-mediated disease or non-immune mediated injury, result in fibrosis of structures important for renal function, leading eventually to kidney failure. As renal disease often manifests clinically only when substantial damage has already occurred, new diagnostic methods and indeed treatments must be identified to inhibit further progression and promote appropriate tissue repair. Studying cases in which immune homeostasis is re-established may reveal new treatment possibilities. © 2018 British Society for Immunology.

  4. Nutritional support for the infant's immune system

    NARCIS (Netherlands)

    Niers, L.; Stasse-Wolthuis, M.; Rombouts, F.M.; Rijkers, G.T.

    2007-01-01

    Newborn babies possess a functional but immature immune system as a defense against a world teeming with microorganisms. Breast milk contains a number of biological, active compounds that support the infant's immune system. These include secretory immunoglobulin A (IgA), which confers specific

  5. Immune senescence: relative contributions of age and cytomegalovirus infection.

    Directory of Open Access Journals (Sweden)

    Andrea Mekker

    Full Text Available Immune senescence, defined as the age-associated dysregulation and dysfunction of the immune system, is characterised by impaired protective immunity and decreased efficacy of vaccines. Recent clinical, epidemiological and immunological studies suggest that Cytomegalovirus (CMV infection may be associated with accelerated immune senescence, possibly by restricting the naïve T cell repertoire. However, direct evidence whether and how CMV-infection is implicated in immune senescence is still lacking. In this study, we have investigated whether latent mouse CMV (MCMV infection with or without thymectomy (Tx alters antiviral immunity of young and aged mice. After infection with lymphocytic choriomeningitis virus (LCMV or Vaccinia virus, specific antiviral T cell responses were significantly reduced in old, old MCMV-infected and/or Tx mice compared to young mice. Importantly, control of LCMV replication was more profoundly impaired in aged MCMV-infected mice compared to age-matched MCMV-naïve or young mice. In addition, latent MCMV infection was associated with slightly reduced vaccination efficacy in old Tx mice. In contrast to the prevailing hypothesis of a CMV-mediated restriction of the naïve T cell repertoire, we found similar naïve T cell numbers in MCMV-infected and non-infected mice, whereas ageing and Tx clearly reduced the naïve T cell pool. Instead, MCMV-infection expanded the total CD8(+ T cell pool by a massive accumulation of effector memory T cells. Based on these results, we propose a new model of increased competition between CMV-specific memory T cells and any 'de novo' immune response in aged individuals. In summary, our results directly demonstrate in a mouse model that latent CMV-infection impairs immunity in old age and propagates immune senescence.

  6. Evaluation of mucosal and systemic immune responses elicited by GPI-0100- adjuvanted influenza vaccine delivered by different immunization strategies.

    Directory of Open Access Journals (Sweden)

    Heng Liu

    Full Text Available Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN or the intrapulmonary (IPL route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses.

  7. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    Science.gov (United States)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  8. Effects of engineered nanoparticles on the innate immune system.

    Science.gov (United States)

    Liu, Yuanchang; Hardie, Joseph; Zhang, Xianzhi; Rotello, Vincent M

    2017-12-01

    Engineered nanoparticles (NPs) have broad applications in industry and nanomedicine. When NPs enter the body, interactions with the immune system are unavoidable. The innate immune system, a non-specific first line of defense against potential threats to the host, immediately interacts with introduced NPs and generates complicated immune responses. Depending on their physicochemical properties, NPs can interact with cells and proteins to stimulate or suppress the innate immune response, and similarly activate or avoid the complement system. NPs size, shape, hydrophobicity and surface modification are the main factors that influence the interactions between NPs and the innate immune system. In this review, we will focus on recent reports about the relationship between the physicochemical properties of NPs and their innate immune response, and their applications in immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Stress effect on humoral and cell mediated immune response: Indispensable part of corticosterone and cytokine in neutrophil function

    Directory of Open Access Journals (Sweden)

    Sakthivel Srinivasan

    2016-01-01

    Conclusion: This result further concludes that prior immunization of SRBC in animal’s act as a vaccination, which helps to prevent noise stress induced impairment in immune system. Orally administered I. tinctoria prevented noise altered immune system. These results also concluded that I. tinctoria supplementation could act as an immunomodulators and suggesting its therapeutic efficacy as an antistressor.

  10. The hemochromatosis protein HFE 20 years later: An emerging role in antigen presentation and in the immune system.

    Science.gov (United States)

    Reuben, Alexandre; Chung, Jacqueline W; Lapointe, Réjean; Santos, Manuela M

    2017-09-01

    Since its discovery, the hemochromatosis protein HFE has been primarily defined by its role in iron metabolism and homeostasis, and its involvement in the genetic disease termed hereditary hemochromatosis (HH). While HH patients are typically afflicted by dysregulated iron levels, many are also affected by several immune defects and increased incidence of autoimmune diseases that have thereby implicated HFE in the immune response. Growing evidence has supported an immunological role for HFE with recent studies describing HFE specifically as it relates to MHC I antigen presentation. Here, we present a comprehensive overview of the relationship between iron metabolism, HFE, and the immune system to better understand the origin and cause of immune defects in HH patients. We further describe the role of HFE in MHC I antigen presentation and its potential to impair autoimmune responses in homeostatic conditions, a mechanism which may be exploited by tumors to evade immune surveillance. Overall, this increased understanding of the role of HFE in the immune response sets the stage for better treatment and management of HH and other iron-related diseases, as well as of the immune defects related to this condition. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  11. Trauma: the role of the innate immune system

    Directory of Open Access Journals (Sweden)

    Rijkers GT

    2006-05-01

    Full Text Available Abstract Immune dysfunction can provoke (multiple organ failure in severely injured patients. This dysfunction manifests in two forms, which follow a biphasic pattern. During the first phase, in addition to the injury by trauma, organ damage is caused by the immune system during a systemic inflammatory response. During the second phase the patient is more susceptible for sepsis due to host defence failure (immune paralysis. The pathophysiological model outlined in this review encompasses etiological factors and the contribution of the innate immune system in the end organ damage. The etiological factors can be divided into intrinsic (genetic predisposition and physiological status and extrinsic components (type of injury or "traumaload" and surgery or "intervention load". Of all the factors, the intervention load is the only one which, can be altered by the attending emergency physician. Adjustment of the therapeutic approach and choice of the most appropriate treatment strategy can minimize the damage caused by the immune response and prevent the development of immunological paralysis. This review provides a pathophysiological basis for the damage control concept, in which a staged approach of surgery and post-traumatic immunomonitoring have become important aspects of the treatment protocol. The innate immune system is the main objective of immunomonitoring as it has the most prominent role in organ failure after trauma. Polymorphonuclear phagocytes and monocytes are the main effector-cells of the innate immune system in the processes that lead to organ failure. These cells are controlled by cytokines, chemokines, complement factors and specific tissue signals. The contribution of tissue barrier integrity and its interaction with the innate immune system is further evaluated.

  12. Role of Osmolytes in Regulating Immune System.

    Science.gov (United States)

    Kumar, Tarun; Yadav, Manisha; Singh, Laishram Rajendrakumar

    2016-01-01

    The immune system has evolved to protect the host organism from diverse range of pathogenic microbes that are themselves constantly evolving. It is a complex network of cells, humoral factors, chemokines and cytokines. Dysregulation of immune system results in various kinds of immunological disorders. There are several external agents which govern the regulation of immune system. Recent studies have indicated the role of osmolytes in regulation of various immunological processes such as Ag-Ab interaction, Ig assembly, Ag presentation etc. In this present review, we have systematically discussed the role of osmolytes involved in regulation of several key immunological processes. Osmolytes are involved in the regulation of several key immunological processes such as immunoglobulin assembly and folding, immune cells proliferation, regulation of immune cells function, Ag-Ab interaction, antigen presentation, inflammatory response and protection against photo-immunosuppression. Hence, osmolytes and their transporters might be used as potential drug and drug targets respectively. This review is therefore designed to help clinicians in development of osmolyte based therapeutic strategies in the treatment of various immunological disorders. Appropriate future perspectives have also been included.

  13. Exploring the Homeostatic and Sensory Roles of the Immune System.

    Science.gov (United States)

    Marques, Rafael Elias; Marques, Pedro Elias; Guabiraba, Rodrigo; Teixeira, Mauro Martins

    2016-01-01

    Immunology developed under the notion of the immune system exists to fight pathogens. Recently, the discovery of interactions with commensal microbiota that are essential to human health initiated a change in this old paradigm. Here, we argue that the immune system has major physiological roles extending far beyond defending the host. Immune and inflammatory responses share the core property of sensing, defining the immune system also as a sensory system. The inference with the immune system collects, interprets, and stores information, while creating an identity of self, places it in close relationship to the nervous system, which suggests that these systems may have a profound evolutionary connection.

  14. Trauma equals danger—damage control by the immune system

    Science.gov (United States)

    Stoecklein, Veit M.; Osuka, Akinori; Lederer, James A.

    2012-01-01

    Traumatic injuries induce a complex host response that disrupts immune system homeostasis and predisposes patients to opportunistic infections and inflammatory complications. The response to injuries varies considerably by type and severity, as well as by individual variables, such as age, sex, and genetics. These variables make studying the impact of trauma on the immune system challenging. Nevertheless, advances have been made in understanding how injuries influence immune system function as well as the immune cells and pathways involved in regulating the response to injuries. This review provides an overview of current knowledge about how traumatic injuries affect immune system phenotype and function. We discuss the current ideas that traumatic injuries induce a unique type of a response that may be triggered by a combination of endogenous danger signals, including alarmins, DAMPs, self-antigens, and cytokines. Additionally, we review and propose strategies for redirecting injury responses to help restore immune system homeostasis. PMID:22654121

  15. Strengthening health system to improve immunization for migrants in China.

    Science.gov (United States)

    Fang, Hai; Yang, Li; Zhang, Huyang; Li, Chenyang; Wen, Liankui; Sun, Li; Hanson, Kara; Meng, Qingyue

    2017-07-01

    Immunization is the most cost-effective method to prevent and control vaccine-preventable diseases. Migrant population in China has been rising rapidly, and their immunization status is poor. China has tried various strategies to strengthen its health system, which has significantly improved immunization for migrants. This study applied a qualitative retrospective review method aiming to collect, analyze and synthesize health system strengthening experiences and practices about improving immunizations for migrants in China. A conceptual framework of Theory of Change was used to extract the searched literatures. 11 searched literatures and 4 national laws and policies related to immunizations for migrant children were carefully studied. China mainly employed 3 health system strengthening strategies to significantly improve immunization for migrant population: stop charging immunization fees or immunization insurance, manage immunization certificates well, and pay extra attentions on immunization for special children including migrant children. These health system strengthening strategies were very effective, and searched literatures show that up-to-date and age-appropriate immunization rates were significantly improved for migrant children. Economic development led to higher migrant population in China, but immunization for migrants, particularly migrant children, were poor. Fortunately various health system strengthening strategies were employed to improve immunization for migrants in China and they were rather successful. The experiences and lessons of immunization for migrant population in China might be helpful for other developing countries with a large number of migrant population.

  16. Crosstalk between cancer and the neuro-immune system.

    Science.gov (United States)

    Kuol, Nyanbol; Stojanovska, Lily; Apostolopoulos, Vasso; Nurgali, Kulmira

    2018-02-15

    In the last decade, understanding of cancer initiation and progression has been given much attention with studies mainly focusing on genetic abnormalities. Importantly, cancer cells can influence their microenvironment and bi-directionally communicate with other systems such as the immune system. The nervous system plays a fundamental role in regulating immune responses to a range of disease states including cancer. Its dysfunction influences the progression of cancer. The role of the immune system in tumor progression is of relevance to the nervous system since they can bi-directionally communicate via neurotransmitters and neuropeptides, common receptors, and, cytokines. However, cross-talk between these cells is highly complex in nature, and numerous variations are possible according to the type of cancer involved. The neuro-immune interaction is essential in influencing cancer development and progression. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Immune system alterations in amyotrophic lateral sclerosis

    DEFF Research Database (Denmark)

    Hovden, H; Frederiksen, J L; Pedersen, S W

    2013-01-01

    Amyotrophic lateral sclerosis is a disease of which the underlying cause and pathogenesis are unknown. Cumulatative data clearly indicates an active participation by the immune system in the disease. An increasingly recognized theory suggests a non-cell autonomous mechanism, meaning that multiple...... cells working together are necessary for the pathogenesis of the disease. Observed immune system alterations could indicate an active participation in this mechanism. Damaged motor neurons are able to activate microglia, astrocytes and the complement system, which further can influence each other...... and contribute to neurodegeneration. Infiltrating peripheral immune cells appears to correlate with disease progression, but their significance and composition is unclear. The deleterious effects of this collaborating system of cells appear to outweigh the protective aspects, and revealing this interplay might...

  18. Cancer as an immune-mediated disease

    Directory of Open Access Journals (Sweden)

    Shurin MR

    2012-06-01

    Full Text Available Michael R ShurinDepartments of Pathology and Immunology, University of Pittsburgh Medical Center, Pittsburgh, PA, USAAbstract: The link between oncology and immunology has a long history and its development is forced by the necessity to develop innovative and highly efficient modalities for immunological destruction of malignant cells. The limited efficacy of surgery, chemotherapy and radiation also exemplify these issues, as these treatments do not eliminate all cancerous cells, do not address the immunosuppressive nature of the disease and can further impair the patient's immune response weakening patient's resistance to the cancer. Multidisciplinary analysis of the interaction between the immune system and cancer in preclinical and clinical settings suggests that the immune system is closely intertwined with both cancer pathogenesis and treatment. On the one hand, cancer is a manifestation of malfunctions in immunity, as malignant cells manage to escape recognition and elimination by the immune system. Chronic infections and inflammation associated with limited or polarized immune responses also contribute to carcinogenesis and tumor progression. The tumor immunoenvironment represents specific conditions and elements that support cancerous cell survival, proliferation and spreading. On the other hand, the specificity and strength of antitumor immunity is a powerful and efficient tool that can be used to recognize and destroy neoplastic cells or their supporting microenvironment. Understanding the role of the immune system in controlling and supporting tumor initiation, formation, growth and progression has crucial implications for cancer therapy and will therefore guide the future development of cancer immunotherapy and its combination with conventional therapies to achieve optimal antitumor effects in patients with different types of cancer.Keywords: tumor immunology and immunotherapy, tumor immunoenvironment, cancer, immunosuppression

  19. Modeling evolution and immune system by cellular automata

    International Nuclear Information System (INIS)

    Bezzi, M.

    2001-01-01

    In this review the behavior of two different biological systems is investigated using cellular automata. Starting from this spatially extended approach it is also tried, in some cases, to reduce the complexity of the system introducing mean-field approximation, and solving (or trying to solve) these simplified systems. It is discussed the biological meaning of the results, the comparison with experimental data (if available) and the different features between spatially extended and mean-field versions. The biological systems considered in this review are the following: Darwinian evolution in simple ecosystems and immune system response. In the first section the main features of molecular evolution are introduced, giving a short survey of genetics for physicists and discussing some models for prebiotic systems and simple ecosystems. It is also introduced a cellular automaton model for studying a set of evolving individuals in a general fitness landscape, considering also the effects of co-evolution. In particular the process of species formation (speciation) is described in sect. 5. The second part deals with immune system modeling. The biological features of immune response are discussed, as well as it is introduced the concept of shape space and of idiotypic network. More detailed reviews which deal with immune system models (mainly focused on idiotypic network models) can be found. Other themes here discussed: the applications of CA to immune system modeling, two complex cellular automata for humoral and cellular immune response. Finally, it is discussed the biological data and the general conclusions are drawn in the last section

  20. Alcohol, aging, and innate immunity.

    Science.gov (United States)

    Boule, Lisbeth A; Kovacs, Elizabeth J

    2017-07-01

    The global population is aging: in 2010, 8% of the population was older than 65 y, and that is expected to double to 16% by 2050. With advanced age comes a heightened prevalence of chronic diseases. Moreover, elderly humans fair worse after acute diseases, namely infection, leading to higher rates of infection-mediated mortality. Advanced age alters many aspects of both the innate and adaptive immune systems, leading to impaired responses to primary infection and poor development of immunologic memory. An often overlooked, yet increasingly common, behavior in older individuals is alcohol consumption. In fact, it has been estimated that >40% of older adults consume alcohol, and evidence reveals that >10% of this group is drinking more than the recommended limit by the National Institute on Alcohol Abuse and Alcoholism. Alcohol consumption, at any level, alters host immune responses, including changes in the number, phenotype, and function of innate and adaptive immune cells. Thus, understanding the effect of alcohol ingestion on the immune system of older individuals, who are already less capable of combating infection, merits further study. However, there is currently almost nothing known about how drinking alters innate immunity in older subjects, despite innate immune cells being critical for host defense, resolution of inflammation, and maintenance of immune homeostasis. Here, we review the effects of aging and alcohol consumption on innate immune cells independently and highlight the few studies that have examined the effects of alcohol ingestion in aged individuals. © Society for Leukocyte Biology.

  1. A minimal model for multiple epidemics and immunity spreading.

    Science.gov (United States)

    Sneppen, Kim; Trusina, Ala; Jensen, Mogens H; Bornholdt, Stefan

    2010-10-18

    Pathogens and parasites are ubiquitous in the living world, being limited only by availability of suitable hosts. The ability to transmit a particular disease depends on competing infections as well as on the status of host immunity. Multiple diseases compete for the same resource and their fate is coupled to each other. Such couplings have many facets, for example cross-immunization between related influenza strains, mutual inhibition by killing the host, or possible even a mutual catalytic effect if host immunity is impaired. We here introduce a minimal model for an unlimited number of unrelated pathogens whose interaction is simplified to simple mutual exclusion. The model incorporates an ongoing development of host immunity to past diseases, while leaving the system open for emergence of new diseases. The model exhibits a rich dynamical behavior with interacting infection waves, leaving broad trails of immunization in the host population. This obtained immunization pattern depends only on the system size and on the mutation rate that initiates new diseases.

  2. The influence of pregnancy on systemic immunity.

    Science.gov (United States)

    Pazos, Michael; Sperling, Rhoda S; Moran, Thomas M; Kraus, Thomas A

    2012-12-01

    Adaptations in maternal systemic immunity are presumed to be responsible for observed alterations in disease susceptibility and severity as pregnancy progresses. Epidemiological evidence as well as animal studies have shown that influenza infections are more severe during the second and third trimesters of pregnancy, resulting in greater morbidity and mortality, although the reason for this is still unclear. Our laboratory has taken advantage of 20 years of experience studying the murine immune response to respiratory viruses to address questions of altered immunity during pregnancy. With clinical studies and unique animal model systems, we are working to define the mechanisms responsible for altered immune responses to influenza infection during pregnancy and what roles hormones such as estrogen or progesterone play in these alterations.

  3. State of immune system lesions eymeriozo turkey-invasions histomonoznoyu

    OpenAIRE

    CHARIV I.

    2011-01-01

    The immune system of animals and birds provides resistance against bacterial and viral infections. In the intestinal mucosa and eymeriyi histomonady produce metabolic products that are toxic to different systems and tissues of turkeys. They parasitizing in the intestine, suppress specific phase of immunity provided by antibodies (humoral type), reduce activity sensitized cells (cell type), slow phase of nonspecific immunity, which is represented by various immune cells.

  4. The Role of the Immune System Beyond the Fight Against Infection.

    Science.gov (United States)

    Sattler, Susanne

    2017-01-01

    The immune system was identified as a protective factor during infectious diseases over a century ago. Current definitions and textbook information are still largely influenced by these early observations, and the immune system is commonly presented as a defence machinery. However, host defence is only one manifestation of the immune system's overall function in the maintenance of tissue homeostasis and system integrity. In fact, the immune system is integral part of fundamental physiological processes such as development, reproduction and wound healing, and a close crosstalk between the immune system and other body systems such as metabolism, the central nervous system and the cardiovascular system is evident. Research and medical professionals in an expanding range of areas start to recognise the implications of the immune system in their respective fields.This chapter provides a brief historical perspective on how our understanding of the immune system has evolved from a defence system to an overarching surveillance machinery to maintain tissue integrity. Current perspectives on the non-defence functions of classical immune cells and factors will also be discussed.

  5. The role of intestinal microbiota and the immune system.

    Science.gov (United States)

    Purchiaroni, F; Tortora, A; Gabrielli, M; Bertucci, F; Gigante, G; Ianiro, G; Ojetti, V; Scarpellini, E; Gasbarrini, A

    2013-02-01

    The human gut is an ecosystem consisting of a great number of commensal bacteria living in symbiosis with the host. Several data confirm that gut microbiota is engaged in a dynamic interaction with the intestinal innate and adaptive immune system, affecting different aspects of its development and function. To review the immunological functions of gut microbiota and improve knowledge of its therapeutic implications for several intestinal and extra-intestinal diseases associated to dysregulation of the immune system. Significant articles were identified by literature search and selected based on content, including atopic diseases, inflammatory bowel diseases and treatment of these conditions with probiotics. Accumulating evidence indicates that intestinal microflora has protective, metabolic, trophic and immunological functions and is able to establish a "cross-talk" with the immune component of mucosal immunity, comprising cellular and soluble elements. When one or more steps in this fine interaction fail, autoimmune or auto-inflammatory diseases may occur. Furthermore, it results from the data that probiotics, used for the treatment of the diseases caused by the dysregulation of the immune system, can have a beneficial effect by different mechanisms. Gut microbiota interacts with both innate and adaptive immune system, playing a pivotal role in maintenance and disruption of gut immune quiescence. A cross talk between the mucosal immune system and endogenous microflora favours a mutual growth, survival and inflammatory control of the intestinal ecosystem. Based on these evidences, probiotics can be used as an ecological therapy in the treatment of immune diseases.  

  6. [The liver and the immune system].

    Science.gov (United States)

    Jakab, Lajos

    2015-07-26

    The liver is known to be the metabolic centre of the organism and is under the control of the central nervous system. It has a peculiar tissue structure and its anatomic localisation defines it as part of the immune system having an individual role in the defence of the organism. The determinant of its particular tissue build-up is the sinusoid system. In addition to hepatocytes, one cell row "endothelium", stellate cells close to the external surface, Kupffer cells tightly to its inner surface, as well as dendritic cells and other cell types (T and B lymphocytes, natural killer and natural killer T-cells, mast cells, granulocytes) are present. The multitudes and variety of cells make it possible to carry out the tasks according to the assignment of the organism. The liver is a member of the immune system having immune cells largely in an activated state. Its principal tasks are the assurance of the peripheral immune tolerance of the organism with the help of the haemopoetic cells and transforming growth factor-β. The liver takes part in the determination of the manner of the non-specific immune response of the organism. In addition to acute phase reaction of the organism, the liver has a role in the adaptive/specific immune response. These functions include retardation of the T and B lymphocytes and the defence against harmful pathogens. With the collaboration of transforming growth factor-β, immunoglobulins and their subclasses are inhibited just as the response of the T lymphocytes. The only exception is the undisturbed immunoglobulin A production. Particularly important is the intensive participation of the liver in the acute phase reaction of the organism, which is organised and guided by the coordinated functions of the cortico-hypothalamo-hypophysis-adrenal axis. Beside cellular elements, hormones, adhesion molecules, chemokines and cytokines are also involved in the cooperation with the organs. Acute phase reactants play a central role in these processes

  7. Nociception and role of immune system in pain.

    Science.gov (United States)

    Verma, Vivek; Sheikh, Zeeshan; Ahmed, Ahad S

    2015-09-01

    Both pain and inflammation are protective responses. However, these self-limiting conditions (with well-established negative feedback loops) become pathological if left uncontrolled. Both pain and inflammation can interact with each other in a multi-dimensional manner. These interactions are known to create an array of 'difficult to manage' pathologies. This review explains in detail the role of immune system and the related cells in peripheral sensitization and neurogenic inflammation. Various neuro-immune interactions are analyzed at peripheral, sensory and central nervous system levels. Innate immunity plays a critical role in central sensitization and in establishing acute pain as chronic condition. Moreover, inflammatory mediators also exhibit psychological effects, thus contributing towards the emotional elements associated with pain. However, there is also a considerable anti-inflammatory and analgesic role of immune system. This review also attempts to enlist various novel pharmacological approaches that exhibit their actions through modification of neuro-immune interface.

  8. Integration of the immune system: a complex adaptive supersystem

    Science.gov (United States)

    Crisman, Mark V.

    2001-10-01

    Immunity to pathogenic organisms is a complex process involving interacting factors within the immune system including circulating cells, tissues and soluble chemical mediators. Both the efficiency and adaptive responses of the immune system in a dynamic, often hostile, environment are essential for maintaining our health and homeostasis. This paper will present a brief review of one of nature's most elegant, complex adaptive systems.

  9. The deconvolution of complex spectra by artificial immune system

    Science.gov (United States)

    Galiakhmetova, D. I.; Sibgatullin, M. E.; Galimullin, D. Z.; Kamalova, D. I.

    2017-11-01

    An application of the artificial immune system method for decomposition of complex spectra is presented. The results of decomposition of the model contour consisting of three components, Gaussian contours, are demonstrated. The method of artificial immune system is an optimization method, which is based on the behaviour of the immune system and refers to modern methods of search for the engine optimization.

  10. Role of Cortistatin in the Stressed Immune System.

    Science.gov (United States)

    Delgado, Mario; Gonzalez-Rey, Elena

    2017-01-01

    The immune system is faced with the daunting job of defending the organism against invading pathogens, while at the same time preserving the body integrity and maintaining tolerance to its own tissues. Loss of self-tolerance compromises immune homeostasis and leads to the onset of autoimmune disorders. The identification of endogenous factors that control immune tolerance and inflammation is a key goal for immunologists. Evidences from the last decade indicate that the neuropeptide cortistatin is one of the endogenous factors. Cortistatin is produced by immune cells and through its binding to various receptors, it exerts potent anti-inflammatory actions and participates in the maintenance of immune tolerance at multiple levels, especially in immunological disorders. Cortistatin emerges as a key element in the bidirectional communication between the neuroendocrine and immune systems aimed at regulating body homeostasis. © 2017 S. Karger AG, Basel.

  11. Regulation of vitamin D homeostasis: implications for the immune system.

    Science.gov (United States)

    van Etten, Evelyne; Stoffels, Katinka; Gysemans, Conny; Mathieu, Chantal; Overbergh, Lut

    2008-10-01

    Vitamin D homeostasis in the immune system is the focus of this review. The production of both the activating (25- and 1alpha-hydroxylase) and the metabolizing (24-hydroxylase) enzymes by cells of the immune system itself, indicates that 1,25(OH)(2)D(3) can be produced locally in immune reaction sites. Moreover, the strict regulation of these enzymes by immune signals is highly suggestive for an autocrine/paracrine role in the immune system, and opens new treatment possibilities.

  12. Maternal immune activation during pregnancy in rats impairs working memory capacity of the offspring.

    Science.gov (United States)

    Murray, Brendan G; Davies, Don A; Molder, Joel J; Howland, John G

    2017-05-01

    Maternal immune activation during pregnancy is an environmental risk factor for psychiatric illnesses such as schizophrenia in the offspring. Patients with schizophrenia display an array of cognitive symptoms, including impaired working memory capacity. Rodent models have been developed to understand the relationship between maternal immune activation and the cognitive symptoms of schizophrenia. The present experiment was designed to test whether maternal immune activation with the viral mimetic polyinosinic:polycytidylic acid (polyI:C) during pregnancy affects working memory capacity of the offspring. Pregnant Long Evans rats were treated with either saline or polyI:C (4mg/kg; i.v.) on gestational day 15. Male offspring of the litters (2-3months of age) were subsequently trained on a nonmatching-to-sample task with odors. After a criterion was met, the rats were tested on the odor span task, which requires rats to remember an increasing span of different odors to receive food reward. Rats were tested using delays of approximately 40s during the acquisition of the task. Importantly, polyI:C- and saline-treated offspring did not differ in performance of the nonmatching-to-sample task suggesting that both groups could perform a relatively simple working memory task. In contrast, polyI:C-treated offspring had reduced span capacity in the middle and late phases of odor span task acquisition. After task acquisition, the rats were tested using the 40s delay and a 10min delay. Both groups showed a delay-dependent decrease in span, although the polyI:C-treated offspring had significantly lower spans regardless of delay. Our results support the validity of the maternal immune activation model for studying the cognitive symptoms of neurodevelopmental disorders such as schizophrenia. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Immune system investigations for radiation workers

    International Nuclear Information System (INIS)

    Obreja, Doina; Tulbure, Rodica; Marinescu, Irina

    2001-01-01

    During the last decade a great deal of attention has been paid to the research in the field of the immune system. Some important steps forward have been achieved in understanding the mechanisms of action and control of the immunologic responses. At the same time the concern for the possible health effects of exposure to ionizing radiation has considerably increased. On the purpose of the evaluation of the modifications induced by the ionizing radiation for radiation workers, we have applied the method of lymphocytic subpopulations, a method that evinces the proportions for the various subtypes of lymphocytes having different roles within the immune system. A number of 62 persons, employees of the Institute of Physics and Nuclear Engineering at Bucharest - Magurele were involved in this study. All radiation workers from 2 departments characterized by a high exposure to ionizing radiation were included, as follows: Group no. 1, consisting of 20 persons working at RWTS (Radioactive Waste Treating Station), thus presenting both external and internal irradiation; Group no. 2, consisting of 18 persons working at RPC (Radioactive Isotopes Preparing Center), a place where besides the radioactive contamination, the chemical risk was also present. The control group (consisting of 24 persons) was formed of employees from the same institute, with the difference that they were not radiation workers. For the statistical processing of the results the programs EPI INFO 6 and CIA were used. Significantly, when analyzing globally the lymphocytic modifications for TT and/or B lymphocytes (either increments or decrements when compared to the normal values), a noticeable statistical difference among the groups in terms of the frequency of the immune system modifications (Hi square test p=0.001) occurs. The results are in accordance to those in special literature mentioning age as a factor having a role in the appearance of the immune modifications. The obtained results indicate a

  14. Evidence for a common mucosal immune system in the pig.

    Science.gov (United States)

    Wilson, Heather L; Obradovic, Milan R

    2015-07-01

    The majority of lymphocytes activated at mucosal sites receive instructions to home back to the local mucosa, but a portion also seed distal mucosa sites. By seeding distal sites with antigen-specific effector or memory lymphocytes, the foundation is laid for the animal's mucosal immune system to respond with a secondary response should to this antigen be encountered at this site in the future. The common mucosal immune system has been studied quite extensively in rodent models but less so in large animal models such as the pig. Reasons for this paucity of reported induction of the common mucosal immune system in this species may be that distal mucosal sites were examined but no induction was observed and therefore it was not reported. However, we suspect that the majority of investigators simply did not sample distal mucosal sites and therefore there is little evidence of immune response induction in the literature. It is our hope that more pig immunologists and infectious disease experts who perform mucosal immunizations or inoculations on pigs will sample distal mucosal sites and report their findings, whether results are positive or negative. In this review, we highlight papers that show that immunization/inoculation using one route triggers mucosal immune system induction locally, systemically, and within at least one distal mucosal site. Only by understanding whether immunizations at one site triggers immunity throughout the common mucosal immune system can we rationally develop vaccines for the pig, and through these works we can gather evidence about the mucosal immune system that may be extrapolated to other livestock species or humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. The immune self: a selectionist theory of recognition, learning, and remembering within the immune system.

    Science.gov (United States)

    Kradin, R L

    1995-01-01

    In this paper, I have briefly explored metaphors shared by the immune and nervous systems and shown that this exercise can lead to the elucidation of common principles of organization, as well as to predictions concerning how the immune system functions. Metaphor itself undoubtedly reflects the way in which we categorize and retrieve information 44], so it is not surprising that the deep processes of language tend to sample information from related data categories. Although the nervous and immune systems are obviously not the same and metaphors are indeed just that, my primary goal has been to suggest that by virtue of their having evolved in parallel over millions of years, the nervous and immune systems currently use the same archetypal principles and strategies to address related challenges in information processing and retrieval. Ultimately, nature is conservative. One need only look at a tree, a river, the airways, or the vascular bed in order to see how a fractal pattern of repetitive dichotomous branching has been used by each, in order to optimize the transport of fluids over large distances [45]. While each system has had to adopt different materials in order to solve the problem, the shape of their solutions is remarkably alike. In the immune and nervous systems, the elements used to produce optimal functional responses are also quite different, but again the solutions have been achieved by comparable strategies. I am certain that these two great systems of information processing, each responding with vastly different kinetics, will prove to be far more integrally interdependent than has been previously recognized. For example, should a swift response by the immune system be required in an overwhelming invasion by microbial pathogens, the immune system may be able to cooperate with the rapidly reacting nervous system to rid the host of the invaders. In this regard, we have shown that the beta-adrenergic hormone epinephrine rapidly increases the traffic of

  16. The University Immune System: Overcoming Resistance to Change

    Science.gov (United States)

    Gilley, Ann; Godek, Marisha; Gilley, Jerry W.

    2009-01-01

    A university, similar to any other organization, has an immune system that erects a powerful barrier against change. This article discusses the university immune system and what can be done to counteract its negative effects and thereby allow change to occur.

  17. Pteromalus puparum venom impairs host cellular immune responses by decreasing expression of its scavenger receptor gene

    Science.gov (United States)

    Insect host/parasitoid interactions are co-evolved systems in which host defenses are balanced by parasitoid mechanisms to disable or hide from host immune effectors. Although there is a rich literature on these systems, parasitoid immune-disabling mechanisms have not been fully elucidated. Here we ...

  18. Functional aspects of the adaptive immune system in arthritis

    NARCIS (Netherlands)

    Jansen, D.T.S.L.

    2017-01-01

    The adaptive immune system is the part of the immune system that is highly specific and generates memory resulting in a fast and specific immune response upon a second infection with the same pathogen. However, when this response is specific for a part of the body itself instead of a pathogen,

  19. Bim: guardian of tissue homeostasis and critical regulator of the immune system, tumorigenesis and bone biology.

    Science.gov (United States)

    Akiyama, Toru; Tanaka, Sakae

    2011-08-01

    One of the most important roles of apoptosis is the maintenance of tissue homeostasis. Impairment of apoptosis leads to a number of pathological conditions. In response to apoptotic signals, various proteins are activated in a pathway and signal-specific manner. Recently, the pro-apoptotic molecule Bim has attracted increasing attention as a pivotal regulator of tissue homeostasis. The Bim expression level is strictly controlled in both transcriptional and post-transcriptional levels. This control is dependent on cell, tissue and apoptotic stimuli. The phenotype of Bim-deficient mice is a systemic lupus erythematosus-like autoimmune disease with an abnormal accumulation of hematopoietic cells. Bim is thus a critical regulator of hematopoietic cells and immune system. Further studies have revealed the critical roles of Bim in various normal and pathological conditions, including bone homeostasis and tumorigenesis. The current understanding of Bim signaling and roles in the maintenance of tissue homeostasis is reviewed in this paper, focusing on the immune system, bone biology and tumorigenesis to illustrate the diversified role of Bim.

  20. Autopolyreactivity Confers a Holistic Role in the Immune System.

    Science.gov (United States)

    Avrameas, S

    2016-04-01

    In this review, we summarize and discuss some key findings from the study of naturally occurring autoantibodies. The B-cell compartment of the immune system appears to recognize almost all endogenous and environmental antigens. This ability is accomplished principally through autopolyreactive humoral and cellular immune receptors. This extended autopolyreactivity (1) along immunoglobulin gene recombination contributes to the immune system's ability to recognize a very large number of self and non-self constituents; and (2) generates a vast immune network that creates communication channels between the organism's interior and exterior. Thus, the immune system continuously evolves depending on the internal and external stimuli it encounters. Furthermore, this far-reaching network's existence implies activities resembling those of classical biological factors or activities that modulate the function of other classical biological factors. A few such antibodies have already been found. Another important concept is that natural autoantibodies are highly dependent on the presence or absence of commensal microbes in the organism. These results are in line with past and recent findings showing the fundamental influence of the microbiota on proper immune system development, and necessitate the existence of a host-microbe homeostasis. This homeostasis requires that the participating humoral and cellular receptors are able to recognize self-antigens and commensal microbes without damaging them. Autopolyreactive immune receptors expressing low affinity for both types of antigens fulfil this role. The immune system appears to play a holistic role similar to that of the nervous system. © 2016 The Foundation for the Scandinavian Journal of Immunology.

  1. Impact of aging immune system on neurodegeneration and potential immunotherapies.

    Science.gov (United States)

    Liang, Zhanfeng; Zhao, Yang; Ruan, Linhui; Zhu, Linnan; Jin, Kunlin; Zhuge, Qichuan; Su, Dong-Ming; Zhao, Yong

    2017-10-01

    The interaction between the nervous and immune systems during aging is an area of avid interest, but many aspects remain unclear. This is due, not only to the complexity of the aging process, but also to a mutual dependency and reciprocal causation of alterations and diseases between both the nervous and immune systems. Aging of the brain drives whole body systemic aging, including aging-related changes of the immune system. In turn, the immune system aging, particularly immunosenescence and T cell aging initiated by thymic involution that are sources of chronic inflammation in the elderly (termed inflammaging), potentially induces brain aging and memory loss in a reciprocal manner. Therefore, immunotherapeutics including modulation of inflammation, vaccination, cellular immune therapies and "protective autoimmunity" provide promising approaches to rejuvenate neuroinflammatory disorders and repair brain injury. In this review, we summarize recent discoveries linking the aging immune system with the development of neurodegeneration. Additionally, we discuss potential rejuvenation strategies, focusing aimed at targeting the aging immune system in an effort to prevent acute brain injury and chronic neurodegeneration during aging. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Roles of microRNA in the immature immune system of neonates.

    Science.gov (United States)

    Yu, Hong-Ren; Huang, Lien-Hung; Li, Sung-Chou

    2018-06-13

    Neonates have an immature immune system; therefore, their immune activities are different from the activities of adult immune systems. Such differences between neonates and adults are reflected by cell population constitutions, immune responses, cytokine production, and the expression of cellular/humoral molecules, which contribute to the specific neonatal microbial susceptibility and atopic properties. MicroRNAs (miRNAs) have been discovered to modulate many aspects of immune responses. Herein, we summarize the distinct manifestations of the neonatal immune system, including cellular and non-cellular components. We also review the current findings on the modulatory effects of miRNAs on the neonatal immune system. These findings suggest that miRNAs have the potential to be useful therapeutic targets for certain infection or inflammatory conditions by modulating the neonatal immune system. In the future, we need a more comprehensive understanding in regard to miRNAs and how they modulate specific immune cells in neonates. Copyright © 2018. Published by Elsevier B.V.

  3. Effects of ionizing radiation on the immune system

    International Nuclear Information System (INIS)

    Dubois, J.B.

    1986-01-01

    After reviewing the different lymphoid organs and the essential phases of the immune response, we studied the morphological and functional effects of ionizing radiation on the immunological system. Histologic changes in the lymph nodes, spleen, thymus, and different lymphocyte subpopulations were studied in relation with the radiation dose and irradiated volume (whole body irradiation, localized irradiation). Functional changes in the immune system induced by ionizing radiation were also investigated by a study of humoral-mediated immunity (antibody formation) and cell-mediated immunity (behavior of macrophages, B-cells, T suppressor cells, T helper cells, T effector cells, and natural killer cells). A study into the mechanisms of action of ionizing radiation and the immune processes it interferes with suggests several likely hypotheses (direct action on the immune cells, on their precursors, on seric mediators or on cell mediators). The effects on cancer patients' immune reactions of low radiation doses delivered to the various lymphoid organs are discussed, as well as the relationships between the host and the evolution of the tumor [fr

  4. The role of the adaptive immune system in regulation of gut microbiota.

    Science.gov (United States)

    Kato, Lucia M; Kawamoto, Shimpei; Maruya, Mikako; Fagarasan, Sidonia

    2014-07-01

    The gut nourishes rich bacterial communities that affect profoundly the functions of the immune system. The relationship between gut microbiota and the immune system is one of reciprocity. The microbiota contributes to nutrient processing and the development, maturation, and function of the immune system. Conversely, the immune system, particularly the adaptive immune system, plays a key role in shaping the repertoire of gut microbiota. The fitness of host immune system is reflected in the gut microbiota, and deficiencies in either innate or adaptive immunity impact on diversity and structures of bacterial communities in the gut. Here, we discuss the mechanisms that underlie this reciprocity and emphasize how the adaptive immune system via immunoglobulins (i.e. IgA) contributes to diversification and balance of gut microbiota required for immune homeostasis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Obesity, Fat Mass and Immune System: Role for Leptin

    Directory of Open Access Journals (Sweden)

    Vera Francisco

    2018-06-01

    Full Text Available Obesity is an epidemic disease characterized by chronic low-grade inflammation associated with a dysfunctional fat mass. Adipose tissue is now considered an extremely active endocrine organ that secretes cytokine-like hormones, called adipokines, either pro- or anti-inflammatory factors bridging metabolism to the immune system. Leptin is historically one of most relevant adipokines, with important physiological roles in the central control of energy metabolism and in the regulation of metabolism-immune system interplay, being a cornerstone of the emerging field of immunometabolism. Indeed, leptin receptor is expressed throughout the immune system and leptin has been shown to regulate both innate and adaptive immune responses. This review discusses the latest data regarding the role of leptin as a mediator of immune system and metabolism, with particular emphasis on its effects on obesity-associated metabolic disorders and autoimmune and/or inflammatory rheumatic diseases.

  6. Mechanisms of alteration of the immune system by ionizing radiations: a basis for radiation protection

    Energy Technology Data Exchange (ETDEWEB)

    Bourguignon, M. [Direction Generale de la Surete Nucleaire et de la Radioprotection, 75 - Paris (France); Perez, M.; Dubner, D.; Michelin, S. [Autoridad Regulatoria Nuclear, Buenos Aires (Argentina); Carosella, E. [CEA, Service de Recherches en Hemato -Immunologie, 75 - Paris (France)

    2006-07-01

    the immunological response of the T cells. Immuno-proteasome activity is impaired following irradiation. 7- Immunosuppression and cancer. Malignant cells develop molecular mechanisms, e.g., HLA-G expression, to escape immune recognition. Higher cancer incidence in organ recipients may be attributable to their immunosuppressive treatment and to IR. 8- Autoimmune reactions. Ionizing radiation can break self-tolerance as observed in individuals exposed in Hiroshima and Nagasaki and in children with thyroid disease after Chernobyl accident. 9- Perturbation of immunological homeostasis. Both experimental and epidemiological data have demonstrated that IR disturbs T-cell homeostasis. Conclusion. The effects of IR on the immune system which combine immunosuppression and immuno-modulation, may be responsible for inadequate responses of the body to foreign aggressions allowing for the development of infections or cancers. More attention should be given to the immune system in the context of exposures to IR. (authors)

  7. Mechanisms of alteration of the immune system by ionizing radiations: a basis for radiation protection

    International Nuclear Information System (INIS)

    Bourguignon, M.; Perez, M.; Dubner, D.; Michelin, S.; Carosella, E.

    2006-01-01

    the immunological response of the T cells. Immuno-proteasome activity is impaired following irradiation. 7- Immunosuppression and cancer. Malignant cells develop molecular mechanisms, e.g., HLA-G expression, to escape immune recognition. Higher cancer incidence in organ recipients may be attributable to their immunosuppressive treatment and to IR. 8- Autoimmune reactions. Ionizing radiation can break self-tolerance as observed in individuals exposed in Hiroshima and Nagasaki and in children with thyroid disease after Chernobyl accident. 9- Perturbation of immunological homeostasis. Both experimental and epidemiological data have demonstrated that IR disturbs T-cell homeostasis. Conclusion. The effects of IR on the immune system which combine immunosuppression and immuno-modulation, may be responsible for inadequate responses of the body to foreign aggressions allowing for the development of infections or cancers. More attention should be given to the immune system in the context of exposures to IR. (authors)

  8. CMV immune evasion and manipulation of the immune system with aging.

    Science.gov (United States)

    Jackson, Sarah E; Redeker, Anke; Arens, Ramon; van Baarle, Debbie; van den Berg, Sara P H; Benedict, Chris A; Čičin-Šain, Luka; Hill, Ann B; Wills, Mark R

    2017-06-01

    Human cytomegalovirus (HCMV) encodes numerous proteins and microRNAs that function to evade the immune response and allow the virus to replicate and disseminate in the face of a competent innate and acquired immune system. The establishment of a latent infection by CMV, which if completely quiescent at the level of viral gene expression would represent an ultimate in immune evasion strategies, is not sufficient for lifelong persistence and dissemination of the virus. CMV needs to reactivate and replicate in a lytic cycle of infection in order to disseminate further, which occurs in the face of a fully primed secondary immune response. Without reactivation, latency itself would be redundant for the virus. It is also becoming clear that latency is not a totally quiescent state, but is characterized by limited viral gene expression. Therefore, the virus also needs immune evasion strategies during latency. An effective immune response to CMV is required or viral replication will cause morbidity and ultimately mortality in the host. There is clearly a complex balance between virus immune evasion and host immune recognition over a lifetime. This poses the important question of whether long-term evasion or manipulation of the immune response driven by CMV is detrimental to health. In this meeting report, three groups used the murine model of CMV (MCMV) to examine if the contribution of the virus to immune senescence is set by the (i) initial viral inoculum, (ii) inflation of T cell responses, (iii) or the balance between functionally distinct effector CD4+ T cells. The work of other groups studying the CMV response in humans is discussed. Their work asks whether the ability to make immune responses to new antigens is compromised by (i) age and HCMV carriage, (ii) long-term exposure to HCMV giving rise to an overall immunosuppressive environment and increased levels of latent virus, or (iii) adapted virus mutants (used as potential vaccines) that have the capacity to

  9. The Immune System: Basis of so much Health and Disease: 4. Immunocytes.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-05-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system, this article covers cells of the immune system (immunocytes). Clinical relevance: Modern dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  10. [The role of the innate immune system in atopic dermatitis].

    Science.gov (United States)

    Volz, T; Kaesler, S; Skabytska, Y; Biedermann, T

    2015-02-01

    The mechanisms how the innate immune system detects microbes and mounts a rapid immune response have been more and more elucidated in the past years. Subsequently it has been shown that innate immunity also shapes adaptive immune responses and determines their quality that can be either inflammatory or tolerogenic. As atopic dermatitis is characterized by disturbances of innate and adaptive immune responses, colonization with pathogens and defects in skin barrier function, insight into mechanisms of innate immunity has helped to understand the vicious circle of ongoing skin inflammation seen in atopic dermatitis patients. Elucidating general mechanisms of the innate immune system and its functions in atopic dermatitis paves the way for developing new therapies. Especially the novel insights into the human microbiome and potential functional consequences make the innate immune system a very fundamental and promising target. As a result atopic dermatitis manifestations can be attenuated or even resolved. These currently developed strategies will be introduced in the current review.

  11. A minimal model for multiple epidemics and immunity spreading.

    Directory of Open Access Journals (Sweden)

    Kim Sneppen

    Full Text Available Pathogens and parasites are ubiquitous in the living world, being limited only by availability of suitable hosts. The ability to transmit a particular disease depends on competing infections as well as on the status of host immunity. Multiple diseases compete for the same resource and their fate is coupled to each other. Such couplings have many facets, for example cross-immunization between related influenza strains, mutual inhibition by killing the host, or possible even a mutual catalytic effect if host immunity is impaired. We here introduce a minimal model for an unlimited number of unrelated pathogens whose interaction is simplified to simple mutual exclusion. The model incorporates an ongoing development of host immunity to past diseases, while leaving the system open for emergence of new diseases. The model exhibits a rich dynamical behavior with interacting infection waves, leaving broad trails of immunization in the host population. This obtained immunization pattern depends only on the system size and on the mutation rate that initiates new diseases.

  12. The Immune System in Hypertension

    Science.gov (United States)

    Trott, Daniel W.; Harrison, David G.

    2014-01-01

    While hypertension has predominantly been attributed to perturbations of the vasculature, kidney, and central nervous system, research for almost 50 yr has shown that the immune system also contributes to this disease. Inflammatory cells accumulate in the kidneys and vasculature of humans and experimental animals with hypertension and likely…

  13. Neuroimmune Interactions: From the Brain to the Immune System and Vice Versa.

    Science.gov (United States)

    Dantzer, Robert

    2018-01-01

    Because of the compartmentalization of disciplines that shaped the academic landscape of biology and biomedical sciences in the past, physiological systems have long been studied in isolation from each other. This has particularly been the case for the immune system. As a consequence of its ties with pathology and microbiology, immunology as a discipline has largely grown independently of physiology. Accordingly, it has taken a long time for immunologists to accept the concept that the immune system is not self-regulated but functions in close association with the nervous system. These associations are present at different levels of organization. At the local level, there is clear evidence for the production and use of immune factors by the central nervous system and for the production and use of neuroendocrine mediators by the immune system. Short-range interactions between immune cells and peripheral nerve endings innervating immune organs allow the immune system to recruit local neuronal elements for fine tuning of the immune response. Reciprocally, immune cells and mediators play a regulatory role in the nervous system and participate in the elimination and plasticity of synapses during development as well as in synaptic plasticity at adulthood. At the whole organism level, long-range interactions between immune cells and the central nervous system allow the immune system to engage the rest of the body in the fight against infection from pathogenic microorganisms and permit the nervous system to regulate immune functioning. Alterations in communication pathways between the immune system and the nervous system can account for many pathological conditions that were initially attributed to strict organ dysfunction. This applies in particular to psychiatric disorders and several immune-mediated diseases. This review will show how our understanding of this balance between long-range and short-range interactions between the immune system and the central nervous

  14. The Immune System in Obesity: Developing Paradigms Amidst Inconvenient Truths.

    Science.gov (United States)

    Agrawal, Madhur; Kern, Philip A; Nikolajczyk, Barbara S

    2017-08-15

    Adipose tissue (AT) houses both innate and adaptive immune systems that are crucial for preserving AT function and metabolic homeostasis. In this review, we summarize recent information regarding progression of obesity-associated AT inflammation and insulin resistance. We additionally consider alterations in AT distribution and the immune system in males vs. females and among different racial populations. Innate and adaptive immune cell-derived inflammation drives insulin resistance both locally and systemically. However, new evidence also suggests that the immune system is equally vital for adipocyte differentiation and protection from ectopic lipid deposition. Furthermore, roles of anti-inflammatory immune cells such as regulatory T cells, "M2-like" macrophages, eosinophils, and mast cells are being explored, primarily due to promise of immunotherapeutic applications. Both immune responses and AT distribution are strongly influenced by factors like sex and race, which have been largely underappreciated in the field of metabolically-associated inflammation, or meta-flammation. More studies are required to recognize factors that switch inflammation from controlled to uncontrolled in obesity-associated pathogenesis and to integrate the combined effects of meta-flammation and immunometabolism. It is critical to recognize that the AT-associated immune system can be alternately beneficial and destructive; therefore, simply blocking immune responses early in obesity may not be the best clinical approach. The dearth of information on gender and race-associated disparities in metabolism, AT distribution, and the immune system suggest that a greater understanding of such differences will be critical to develop personalized treatments for obesity and the associated metabolic dysfunction.

  15. Impaired immune responses in the lungs of aged mice following influenza infection

    Directory of Open Access Journals (Sweden)

    Toapanta Franklin R

    2009-11-01

    Full Text Available Abstract Background Each year, influenza virus infection causes severe morbidity and mortality, particularly in the most susceptible groups including children, the elderly (>65 years-old and people with chronic respiratory diseases. Among the several factors that contribute to the increased susceptibility in elderly populations are the higher prevalence of chronic diseases (e.g. diabetes and the senescence of the immune system. Methods In this study, aged and adult mice were infected with sublethal doses of influenza virus (A/Puerto Rico/8/1934. Differences in weight loss, morbidity, virus titer and the kinetics of lung infiltration with cells of the innate and adaptive immune responses were analyzed. Additionally, the main cytokines and chemokines produced by these cells were also assayed. Results Compared to adult mice, aged mice had higher morbidity, lost weight more rapidly, and recovered more slowly from infection. There was a delay in the accumulation of granulocytic cells and conventional dendritic cells (cDCs, but not macrophages in the lungs of aged mice compared to adult animals. The delayed infiltration kinetics of APCs in aged animals correlated with alteration in their activation (CD40 expression, which also correlated with a delayed detection of cytokines and chemokines in lung homogenates. This was associated with retarded lung infiltration by natural killer (NK, CD4+ and CD8+ T-cells. Furthermore, the percentage of activated (CD69+ influenza-specific and IL-2 producer CD8+ T-cells was higher in adult mice compared to aged ones. Additionally, activation (CD69+ of adult B-cells was earlier and correlated with a quicker development of neutralizing antibodies in adult animals. Conclusion Overall, alterations in APC priming and activation lead to delayed production of cytokines and chemokines in the lungs that ultimately affected the infiltration of immune cells following influenza infection. This resulted in delayed activation of the

  16. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients

    NARCIS (Netherlands)

    Wieten, R. W.; Goorhuis, A.; Jonker, E. F. F.; de Bree, G. J.; de Visser, A. W.; van Genderen, P. J. J.; Remmerswaal, E. B. M.; ten Berge, I. J. M.; Visser, L. G.; Grobusch, M. P.; van Leeuwen, E. M. M.

    2016-01-01

    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen

  17. Systems biology of neutrophil differentiation and immune response

    DEFF Research Database (Denmark)

    Theilgaard-Mönch, Kim; Porse, Bo T; Borregaard, Niels

    2005-01-01

    Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies. These stu......Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies....... These studies have identified a plethora of novel effector proteins stored in the granules of neutrophils. In addition, these studies provide evidence that neutrophil differentiation and immune response are governed by a highly coordinated transcriptional programme that regulates cellular fate and function...

  18. Parental Exposure to Dim Light at Night Prior to Mating Alters Offspring Adaptive Immunity

    OpenAIRE

    Ciss?, Yasmine M.; Russart, Kathryn L.G.; Nelson, Randy J.

    2017-01-01

    Exposure to dim light at night (dLAN) disrupts natural light/dark cycles and impairs endogenous circadian rhythms necessary to maintain optimal biological function, including the endocrine and immune systems. We have previously demonstrated that white dLAN compromises innate and cell mediated immune responses in adult Siberian hamsters (Phodopus sungorus). We hypothesized that dLAN has transgenerational influences on immune function. Adult male and female Siberian hamsters were exposed to eit...

  19. Trade-offs between sexual advertisement and immune function in the pied flycatcher (Ficedula hypoleuca).

    OpenAIRE

    Kilpimaa, Janne; Alatalo, Rauno V.; Siitari, Heli

    2004-01-01

    Good genes models of sexual selection assume that sexual advertisement is costly and thus the level of advertisement honestly reveals heritable viability. Recently it has been suggested that an important cost of sexual advertisement might be impairment of the functioning of the immune system. In this field experiment we investigated the possible trade-offs between immune function and sexual advertisement by manipulating both mating effort and activity of immune defence in male pied flycatcher...

  20. Systemic activation of the immune system in HIV infection: The role of the immune complexes (hypothesis).

    Science.gov (United States)

    Korolevskaya, Larisa B; Shmagel, Konstantin V; Shmagel, Nadezhda G; Saidakova, Evgeniya V

    2016-03-01

    Currently, immune activation is proven to be the basis for the HIV infection pathogenesis and a strong predictor of the disease progression. Among the causes of systemic immune activation the virus and its products, related infectious agents, pro-inflammatory cytokines, and regulatory CD4+ T cells' decrease are considered. Recently microbial translocation (bacterial products yield into the bloodstream as a result of the gastrointestinal tract mucosal barrier integrity damage) became the most popular hypothesis. Previously, we have found an association between immune complexes present in the bloodstream of HIV infected patients and the T cell activation. On this basis, we propose a significantly modified hypothesis of immune activation in HIV infection. It is based on the immune complexes' participation in the immunocompetent cells' activation. Immune complexes are continuously formed in the chronic phase of the infection. Together with TLR-ligands (viral antigens, bacterial products coming from the damaged gut) present in the bloodstream they interact with macrophages. As a result macrophages are transformed into the type II activated forms. These macrophages block IL-12 production and start synthesizing IL-10. High level of this cytokine slows down the development of the full-scale Th1-response. The anti-viral reactions are shifted towards the serogenesis. Newly synthesized antibodies' binding to viral antigens leads to continuous formation of the immune complexes capable of interacting with antigen-presenting cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Modulating the immune system through nanotechnology.

    Science.gov (United States)

    Dacoba, Tamara G; Olivera, Ana; Torres, Dolores; Crecente-Campo, José; Alonso, María José

    2017-12-01

    Nowadays, nanotechnology-based modulation of the immune system is presented as a cutting-edge strategy, which may lead to significant improvements in the treatment of severe diseases. In particular, efforts have been focused on the development of nanotechnology-based vaccines, which could be used for immunization or generation of tolerance. In this review, we highlight how different immune responses can be elicited by tuning nanosystems properties. In addition, we discuss specific formulation approaches designed for the development of anti-infectious and anti-autoimmune vaccines, as well as those intended to prevent the formation of antibodies against biologicals. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Immunity against Ixodes scapularis salivary proteins expressed within 24 hours of attachment thwarts tick feeding and impairs Borrelia transmission.

    Directory of Open Access Journals (Sweden)

    Sukanya Narasimhan

    2007-05-01

    Full Text Available In North America, the black-legged tick, Ixodes scapularis, an obligate haematophagus arthropod, is a vector of several human pathogens including Borrelia burgdorferi, the Lyme disease agent. In this report, we show that the tick salivary gland transcriptome and proteome is dynamic and changes during the process of engorgement. We demonstrate, using a guinea pig model of I. scapularis feeding and B. burgdorferi transmission, that immunity directed against salivary proteins expressed in the first 24 h of tick attachment - and not later - is sufficient to evoke all the hallmarks of acquired tick-immunity, to thwart tick feeding and also to impair Borrelia transmission. Defining this subset of proteins will promote a mechanistic understanding of novel I. scapularis proteins critical for the initiation of tick feeding and for Borrelia transmission.

  3. Regional specialization within the intestinal immune system

    DEFF Research Database (Denmark)

    Mowat, Allan M.; Agace, William Winston

    2014-01-01

    The intestine represents the largest compartment of the immune system. It is continually exposed to antigens and immunomodulatory agents from the diet and the commensal microbiota, and it is the port of entry for many clinically important pathogens. Intestinal immune processes are also increasingly...... implicated in controlling disease development elsewhere in the body. In this Review, we detail the anatomical and physiological distinctions that are observed in the small and large intestines, and we suggest how these may account for the diversity in the immune apparatus that is seen throughout...... the intestine. We describe how the distribution of innate, adaptive and innate-like immune cells varies in different segments of the intestine and discuss the environmental factors that may influence this. Finally, we consider the implications of regional immune specialization for inflammatory disease...

  4. Direct and Electronic Health Record Access to the Clinical Decision Support for Immunizations in the Minnesota Immunization Information System.

    Science.gov (United States)

    Rajamani, Sripriya; Bieringer, Aaron; Wallerius, Stephanie; Jensen, Daniel; Winden, Tamara; Muscoplat, Miriam Halstead

    2016-01-01

    Immunization information systems (IIS) are population-based and confidential computerized systems maintained by public health agencies containing individual data on immunizations from participating health care providers. IIS hold comprehensive vaccination histories given across providers and over time. An important aspect to IIS is the clinical decision support for immunizations (CDSi), consisting of vaccine forecasting algorithms to determine needed immunizations. The study objective was to analyze the CDSi presentation by IIS in Minnesota (Minnesota Immunization Information Connection [MIIC]) through direct access by IIS interface and by access through electronic health records (EHRs) to outline similarities and differences. The immunization data presented were similar across the three systems examined, but with varying ability to integrate data across MIIC and EHR, which impacts immunization data reconciliation. Study findings will lead to better understanding of immunization data display, clinical decision support, and user functionalities with the ultimate goal of promoting IIS CDSi to improve vaccination rates.

  5. Effects of prebiotics on immune system and cytokine expression.

    Science.gov (United States)

    Shokryazdan, Parisa; Faseleh Jahromi, Mohammad; Navidshad, Bahman; Liang, Juan Boo

    2017-02-01

    Nowadays, use of prebiotics as feed and food additives has received increasing interest because of the beneficial effects of prebiotics on the health of animals and humans. One of the beneficial effects of prebiotics is stimulation of immune system, which can be direct or indirect through increasing population of beneficial microbes or probiotics, especially lactic acid bacteria and bifidobacteria, in the gut. An important mechanism of action of probiotics and prebiotics, by which they can affect the immune system, is changing the expression of cytokines. The present review tried to summarize the findings of studies that investigated the effects of prebiotics on immune system with focusing on their effects on cytokine expression. Generally, most of reviewed studies indicated beneficial effects for prebiotics in terms of improving immune system, by increasing the expression of anti-inflammatory cytokines, while reducing the expressions of proinflammatory cytokines. However, most of studies mainly considered the indirect effects of prebiotics on the immune system (through changing the composition and population of gut microbiota), and their direct effects still need to be further studied using prebiotics with different degree of polymerization in different hosts.

  6. Thermodynamics as the driving principle behind the immune system

    Directory of Open Access Journals (Sweden)

    Eduardo Finger

    2012-09-01

    Full Text Available Over the last 120 years, few things contributed more to ourunderstanding of immune system than the study of its behavior inthe host/parasite relationship. Despite the advances though, a fewquestions remain, such as what drives the immune system? Whatare its guiding principles? If we ask these questions randomly, mostwill immediately answer “defend the body from external threats,” butwhat exactly do we defend ourselves from? How do these threatsharm us? What criteria define what constitutes a threat? On theother hand, if the immune system evolved to defend us againstexternal threats, how does its action against “internal” processes,such as neoplasms, qualify? Why do we die from cancer? Or frominfection? Or even, why do we die at all? These apparently obviousquestions are nor simple neither trivial, and the difficulty answeringthem reveals the complex reality that the immune system handles.The objective of this article is to articulate for the reader something that he instinctively already knows: that the decisions of the immune system are thermodynamically driven. Additionally, we will discuss how this apparent change in paradigm alters concepts such as health, disease, and therapeutics.

  7. Artificial immune system applications in computer security

    CERN Document Server

    Tan, Ying

    2016-01-01

    This book provides state-of-the-art information on the use, design, and development of the Artificial Immune System (AIS) and AIS-based solutions to computer security issues. Artificial Immune System: Applications in Computer Security focuses on the technologies and applications of AIS in malware detection proposed in recent years by the Computational Intelligence Laboratory of Peking University (CIL@PKU). It offers a theoretical perspective as well as practical solutions for readers interested in AIS, machine learning, pattern recognition and computer security. The book begins by introducing the basic concepts, typical algorithms, important features, and some applications of AIS. The second chapter introduces malware and its detection methods, especially for immune-based malware detection approaches. Successive chapters present a variety of advanced detection approaches for malware, including Virus Detection System, K-Nearest Neighbour (KNN), RBF networ s, and Support Vector Machines (SVM), Danger theory, ...

  8. Single-cell technologies to study the immune system.

    Science.gov (United States)

    Proserpio, Valentina; Mahata, Bidesh

    2016-02-01

    The immune system is composed of a variety of cells that act in a coordinated fashion to protect the organism against a multitude of different pathogens. The great variability of existing pathogens corresponds to a similar high heterogeneity of the immune cells. The study of individual immune cells, the fundamental unit of immunity, has recently transformed from a qualitative microscopic imaging to a nearly complete quantitative transcriptomic analysis. This shift has been driven by the rapid development of multiple single-cell technologies. These new advances are expected to boost the detection of less frequent cell types and transient or intermediate cell states. They will highlight the individuality of each single cell and greatly expand the resolution of current available classifications and differentiation trajectories. In this review we discuss the recent advancement and application of single-cell technologies, their limitations and future applications to study the immune system. © 2015 The Authors. Immunology Published by John Wiley & Sons Ltd.

  9. Immune System Activation and Depression: Roles of Serotonin in the Central Nervous System and Periphery.

    Science.gov (United States)

    Robson, Matthew J; Quinlan, Meagan A; Blakely, Randy D

    2017-05-17

    Serotonin (5-hydroxytryptamine, 5-HT) has long been recognized as a key contributor to the regulation of mood and anxiety and is strongly associated with the etiology of major depressive disorder (MDD). Although more known for its roles within the central nervous system (CNS), 5-HT is recognized to modulate several key aspects of immune system function that may contribute to the development of MDD. Copious amounts of research have outlined a connection between alterations in immune system function, inflammation status, and MDD. Supporting this connection, peripheral immune activation results in changes in the function and/or expression of many components of 5-HT signaling that are associated with depressive-like phenotypes. How 5-HT is utilized by the immune system to effect CNS function and ultimately behaviors related to depression is still not well understood. This Review summarizes the evidence that immune system alterations related to depression affect CNS 5-HT signaling that can alter MDD-relevant behaviors and that 5-HT regulates immune system signaling within the CNS and periphery. We suggest that targeting the interrelationships between immune and 5-HT signaling may provide more effective treatments for subsets of those suffering from inflammation-associated MDD.

  10. Mind-Body Medicine and Immune System Outcomes: A Systematic Review

    OpenAIRE

    Wahbeh, Helané; Haywood, Ashley; Kaufman, Karen; Zwickey, Heather

    2009-01-01

    This study is a systematic review of mind-body interventions that used immune outcomes in order to: 1) characterize mind-body medicine studies that assessed immune outcomes, 2) evaluate the quality of mind-body medicine studies measuring immune system effects, and 3) systematically evaluate the evidence for mind-body interventions effect on immune system outcomes using existing formal tools. 111 studies with 4,777 subjects were reviewed. The three largest intervention type categories were Rel...

  11. Behavioural conditioning of immune functions: how the central nervous system controls peripheral immune responses by evoking associative learning processes.

    Science.gov (United States)

    Riether, Carsten; Doenlen, Raphaël; Pacheco-López, Gustavo; Niemi, Maj-Britt; Engler, Andrea; Engler, Harald; Schedlowski, Manfred

    2008-01-01

    During the last 30 years of psychoneuroimmunology research the intense bi-directional communication between the central nervous system (CNS) and the immune system has been demonstrated in studies on the interaction between the nervous-endocrine-immune systems. One of the most intriguing examples of such interaction is the capability of the CNS to associate an immune status with specific environmental stimuli. In this review, we systematically summarize experimental evidence demonstrating the behavioural conditioning of peripheral immune functions. In particular, we focus on the mechanisms underlying the behavioural conditioning process and provide a theoretical framework that indicates the potential feasibility of behaviourally conditioned immune changes in clinical situations.

  12. Lymphoma: Immune Evasion Strategies

    International Nuclear Information System (INIS)

    Upadhyay, Ranjan; Hammerich, Linda; Peng, Paul; Brown, Brian; Merad, Miriam; Brody, Joshua D.

    2015-01-01

    While the cellular origin of lymphoma is often characterized by chromosomal translocations and other genetic aberrations, its growth and development into a malignant neoplasm is highly dependent upon its ability to escape natural host defenses. Neoplastic cells interact with a variety of non-malignant cells in the tumor milieu to create an immunosuppressive microenvironment. The resulting functional impairment and dysregulation of tumor-associated immune cells not only allows for passive growth of the malignancy but may even provide active growth signals upon which the tumor subsequently becomes dependent. In the past decade, the success of immune checkpoint blockade and adoptive cell transfer for relapsed or refractory lymphomas has validated immunotherapy as a possible treatment cornerstone. Here, we review the mechanisms by which lymphomas have been found to evade and even reprogram the immune system, including alterations in surface molecules, recruitment of immunosuppressive subpopulations, and secretion of anti-inflammatory factors. A fundamental understanding of the immune evasion strategies utilized by lymphomas may lead to better prognostic markers and guide the development of targeted interventions that are both safer and more effective than current standards of care

  13. Lymphoma: Immune Evasion Strategies

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyay, Ranjan; Hammerich, Linda; Peng, Paul [Division of Hematology and Medical Oncology, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Brown, Brian [Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Merad, Miriam [Department of Oncological Sciences, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States); Brody, Joshua D., E-mail: joshua.brody@mssm.edu [Division of Hematology and Medical Oncology, Icahn School of Medicine at Mount Sinai, New York, NY 10029 (United States)

    2015-04-30

    While the cellular origin of lymphoma is often characterized by chromosomal translocations and other genetic aberrations, its growth and development into a malignant neoplasm is highly dependent upon its ability to escape natural host defenses. Neoplastic cells interact with a variety of non-malignant cells in the tumor milieu to create an immunosuppressive microenvironment. The resulting functional impairment and dysregulation of tumor-associated immune cells not only allows for passive growth of the malignancy but may even provide active growth signals upon which the tumor subsequently becomes dependent. In the past decade, the success of immune checkpoint blockade and adoptive cell transfer for relapsed or refractory lymphomas has validated immunotherapy as a possible treatment cornerstone. Here, we review the mechanisms by which lymphomas have been found to evade and even reprogram the immune system, including alterations in surface molecules, recruitment of immunosuppressive subpopulations, and secretion of anti-inflammatory factors. A fundamental understanding of the immune evasion strategies utilized by lymphomas may lead to better prognostic markers and guide the development of targeted interventions that are both safer and more effective than current standards of care.

  14. The role of immune system exhaustion on cancer cell escape and anti-tumor immune induction after irradiation.

    Science.gov (United States)

    Mendes, Fernando; Domingues, Cátia; Rodrigues-Santos, Paulo; Abrantes, Ana Margarida; Gonçalves, Ana Cristina; Estrela, Jéssica; Encarnação, João; Pires, Ana Salomé; Laranjo, Mafalda; Alves, Vera; Teixo, Ricardo; Sarmento, Ana Bela; Botelho, Maria Filomena; Rosa, Manuel Santos

    2016-04-01

    Immune surveillance seems to represent an effective tumor suppressor mechanism. However, some cancer cells survive and become variants, being poorly immunogenic and able to enter a steady-state phase. These cells become functionally dormant or remain hidden clinically throughout. Neoplastic cells seem to be able to instruct immune cells to undergo changes promoting malignancy. Radiotherapy may act as a trigger of the immune response. After radiotherapy a sequence of reactions occurs, starting in the damage of oncogenic cells by multiple mechanisms, leading to the immune system positive feedback against the tumor. The link between radiotherapy and the immune system is evident. T cells, macrophages, Natural Killer cells and other immune cells seem to have a key role in controlling the tumor. T cells may be dysfunctional and remain in a state of T cell exhaustion, nonetheless, they often retain a high potential for successful defense against cancer, being able to be mobilized to become highly functional. The lack of clinical trials on a large scale makes data a little robust, in spite of promising information, there are still many variables in the studies relating to radiation and immune system. The clarification of the mechanisms underlying immune response to radiation exposure may contribute to treatment improvement, gain of life quality and span of patients. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Breakdown of the innate immune system by bacterial proteases

    NARCIS (Netherlands)

    Laarman, A.J.

    2011-01-01

    Bacteria have developed many strategies to circumvent our immune system to survive and colonize human tissues. One of these strategies is by secreting proteases that specifically target the innate immune system. Aureolysin is a metalloprotease from Staphylococcus aureus which target the main

  16. Country Immunization Information System Assessments - Kenya, 2015 and Ghana, 2016.

    Science.gov (United States)

    Scott, Colleen; Clarke, Kristie E N; Grevendonk, Jan; Dolan, Samantha B; Ahmed, Hussein Osman; Kamau, Peter; Ademba, Peter Aswani; Osadebe, Lynda; Bonsu, George; Opare, Joseph; Diamenu, Stanley; Amenuvegbe, Gregory; Quaye, Pamela; Osei-Sarpong, Fred; Abotsi, Francis; Ankrah, Joseph Dwomor; MacNeil, Adam

    2017-11-10

    The collection, analysis, and use of data to measure and improve immunization program performance are priorities for the World Health Organization (WHO), global partners, and national immunization programs (NIPs). High quality data are essential for evidence-based decision-making to support successful NIPs. Consistent recording and reporting practices, optimal access to and use of health information systems, and rigorous interpretation and use of data for decision-making are characteristics of high-quality immunization information systems. In 2015 and 2016, immunization information system assessments (IISAs) were conducted in Kenya and Ghana using a new WHO and CDC assessment methodology designed to identify root causes of immunization data quality problems and facilitate development of plans for improvement. Data quality challenges common to both countries included low confidence in facility-level target population data (Kenya = 50%, Ghana = 53%) and poor data concordance between child registers and facility tally sheets (Kenya = 0%, Ghana = 3%). In Kenya, systemic challenges included limited supportive supervision and lack of resources to access electronic reporting systems; in Ghana, challenges included a poorly defined subdistrict administrative level. Data quality improvement plans (DQIPs) based on assessment findings are being implemented in both countries. IISAs can help countries identify and address root causes of poor immunization data to provide a stronger evidence base for future investments in immunization programs.

  17. Artificial immune system algorithm in VLSI circuit configuration

    Science.gov (United States)

    Mansor, Mohd. Asyraf; Sathasivam, Saratha; Kasihmuddin, Mohd Shareduwan Mohd

    2017-08-01

    In artificial intelligence, the artificial immune system is a robust bio-inspired heuristic method, extensively used in solving many constraint optimization problems, anomaly detection, and pattern recognition. This paper discusses the implementation and performance of artificial immune system (AIS) algorithm integrated with Hopfield neural networks for VLSI circuit configuration based on 3-Satisfiability problems. Specifically, we emphasized on the clonal selection technique in our binary artificial immune system algorithm. We restrict our logic construction to 3-Satisfiability (3-SAT) clauses in order to outfit with the transistor configuration in VLSI circuit. The core impetus of this research is to find an ideal hybrid model to assist in the VLSI circuit configuration. In this paper, we compared the artificial immune system (AIS) algorithm (HNN-3SATAIS) with the brute force algorithm incorporated with Hopfield neural network (HNN-3SATBF). Microsoft Visual C++ 2013 was used as a platform for training, simulating and validating the performances of the proposed network. The results depict that the HNN-3SATAIS outperformed HNN-3SATBF in terms of circuit accuracy and CPU time. Thus, HNN-3SATAIS can be used to detect an early error in the VLSI circuit design.

  18. Transgenerational Social Stress, Immune Factors, Hormones, and Social Behavior

    Directory of Open Access Journals (Sweden)

    Christopher Anthony Murgatroyd

    2016-01-01

    Full Text Available A social signal transduction theory of depression has been proposed that states that exposure to social adversity alters the immune response and these changes mediate symptoms of depression such as anhedonia and impairments in social behavior. The exposure of maternal rats to the chronic social stress (CSS of a male intruder depresses maternal care and impairs social behavior in the F1 and F2 offspring of these dams. The objective of the present study was to characterize basal peripheral levels of several immune factors and related hormone levels in the adult F2 offspring of CSS exposed dams and assess whether changes in these factors are associated with previously reported deficits in allogrooming behavior. CSS decreased acid glycoprotein (α1AGP and intercellular adhesion molecule-1 (ICAM-1 in F2 females, and increased granulocyte macrophage-colony stimulating factor (GM-CSF in F2 males. There were also sex dependent changes in IL-18, tissue inhibitors of metalloproteinases 1 (TIMP-1, and vascular endothelial growth factor (VEGF. Progesterone was decreased and alpha melanocyte stimulating hormone (α-MSH was increased in F2 males, and brain-derived neurotrophic factor (BDNF was decreased in F2 females. Changes in α1AGP, GM-CSF, progesterone and α-MSH were correlated with decreased allogrooming in the F2 offspring of stressed dams. These results support the hypothesis that transgenerational social stress affects both the immune system and social behavior, and also support previous studies on the adverse effects of early life stress on immune functioning and stress associated immunological disorders, including the increasing prevalence of asthma. The immune system may represent an important transgenerational etiological factor in disorders which involve social and/or early life stress associated changes in social behavior, such as depression, anxiety, and autism, as well as comorbid immune disorders. Future studies involving immune and

  19. [Stress and auto-immunity].

    Science.gov (United States)

    Delévaux, I; Chamoux, A; Aumaître, O

    2013-08-01

    The etiology of auto-immune disorders is multifactorial. Stress is probably a participating factor. Indeed, a high proportion of patients with auto-immune diseases report uncommon stress before disease onset or disease flare. The biological consequences of stress are increasingly well understood. Glucocorticoids and catecholamines released by hypothalamic-pituitary-adrenal axis during stress will alter the balance Th1/Th2 and the balance Th17/Treg. Stress impairs cellular immunity, decreases immune tolerance and stimulates humoral immunity exposing individuals to autoimmune disease among others. The treatment for autoimmune disease should include stress management. Copyright © 2012 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  20. New insights into innate immune control of systemic candidiasis

    Science.gov (United States)

    Lionakis, Michail S.

    2014-01-01

    Systemic infection caused by Candida species is the fourth leading cause of nosocomial bloodstream infection in modern hospitals and carries high morbidity and mortality despite antifungal therapy. A recent surge of immunological studies in the mouse models of systemic candidiasis and the parallel discovery and phenotypic characterization of inherited genetic disorders in antifungal immune factors that are associated with enhanced susceptibility or resistance to the infection have provided new insights into the cellular and molecular basis of protective innate immune responses against Candida. In this review, the new developments in our understanding of how the mammalian immune system responds to systemic Candida challenge are synthesized and important future research directions are highlighted. PMID:25023483

  1. IMMUNE SYSTEM MATURITY AND SENSITIVITY TO CHEMICAL EXPOSURE

    Science.gov (United States)

    It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. The immune system continues to mature after birth, and functional immaturity accounts for m...

  2. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100-Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    NARCIS (Netherlands)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery

  3. Influence of Physical Activity and Nutrition on Obesity-Related Immune Function

    Directory of Open Access Journals (Sweden)

    Chun-Jung Huang

    2013-01-01

    Full Text Available Research examining immune function during obesity suggests that excessive adiposity is linked to impaired immune responses leading to pathology. The deleterious effects of obesity on immunity have been associated with the systemic proinflammatory profile generated by the secretory molecules derived from adipose cells. These include inflammatory peptides, such as TNF-α, CRP, and IL-6. Consequently, obesity is now characterized as a state of chronic low-grade systemic inflammation, a condition considerably linked to the development of comorbidity. Given the critical role of adipose tissue in the inflammatory process, especially in obese individuals, it becomes an important clinical objective to identify lifestyle factors that may affect the obesity-immune system relationship. For instance, stress, physical activity, and nutrition have each shown to be a significant lifestyle factor influencing the inflammatory profile associated with the state of obesity. Therefore, the purpose of this review is to comprehensively evaluate the impact of lifestyle factors, in particular psychological stress, physical activity, and nutrition, on obesity-related immune function with specific focus on inflammation.

  4. Chronic grouped social restriction triggers long-lasting immune system adaptations.

    Science.gov (United States)

    Tian, Rui; Hou, Gonglin; Song, Liuwei; Zhang, Jianming; Yuan, Ti-Fei

    2017-05-16

    Chronic stress triggers rigorous psychological and physiological changes, including immunological system adaptations. However, the effects of long-term social restriction on human immune system have not been investigated. The present study is to investigate the effect of chronic stress on immune changes in human blood, with the stress stimuli controlled.10 male volunteers were group isolated from the modern society in a 50-meter-square room for 150 days, with enriched nutrition and good living conditions provided. Serum examination of immune system markers demonstrated numerous changes in different aspects of the immune functions. The changes were observed as early as 30 days and could last for another 150 days after the termination of the restriction period (300 days' time point). The results strongly argued for the adaptation of immunological system under chronic social restriction stress in adult human, preceding a clear change in psychological conditions. The changes of these immune system factors could as well act as the serum biomarkers in clinical early-diagnosis of stress-related disorders.

  5. Modulation of systemic immune responses through commensal gastrointestinal microbiota.

    Directory of Open Access Journals (Sweden)

    Kyle M Schachtschneider

    Full Text Available Colonization of the gastrointestinal (GI tract is initiated during birth and continually seeded from the individual's environment. Gastrointestinal microorganisms play a central role in developing and modulating host immune responses and have been the subject of investigation over the last decades. Animal studies have demonstrated the impact of GI tract microbiota on local gastrointestinal immune responses; however, the full spectrum of action of early gastrointestinal tract stimulation and subsequent modulation of systemic immune responses is poorly understood. This study explored the utility of an oral microbial inoculum as a therapeutic tool to affect porcine systemic immune responses. For this study a litter of 12 pigs was split into two groups. One group of pigs was inoculated with a non-pathogenic oral inoculum (modulated, while another group (control was not. DNA extracted from nasal swabs and fecal samples collected throughout the study was sequenced to determine the effects of the oral inoculation on GI and respiratory microbial communities. The effects of GI microbial modulation on systemic immune responses were evaluated by experimentally infecting with the pathogen Mycoplasma hyopneumoniae. Coughing levels, pathology, toll-like receptors 2 and 6, and cytokine production were measured throughout the study. Sequencing results show a successful modulation of the GI and respiratory microbiomes through oral inoculation. Delayed type hypersensitivity responses were stronger (p = 0.07, and the average coughing levels and respiratory TNF-α variance were significantly lower in the modulated group (p<0.0001 and p = 0.0153, respectively. The M. hyopneumoniae infection study showed beneficial effects of the oral inoculum on systemic immune responses including antibody production, severity of infection and cytokine levels. These results suggest that an oral microbial inoculation can be used to modulate microbial communities, as well as

  6. Graphene and the immune system: Challenges and potentiality.

    Science.gov (United States)

    Orecchioni, Marco; Ménard-Moyon, Cécilia; Delogu, Lucia Gemma; Bianco, Alberto

    2016-10-01

    In the growing area of nanomedicine, graphene-based materials (GBMs) are some of the most recent explored nanomaterials. For the majority of GBM applications in nanomedicine, the immune system plays a fundamental role. It is necessary to well understand the complexity of the interactions between GBMs, the immune cells, and the immune components and how they could be of advantage for novel effective diagnostic and therapeutic approaches. In this review, we aimed at painting the current picture of GBMs in the background of the immune system. The picture we have drawn looks like a cubist image, a sort of Picasso-like portrait looking at the topic from all perspectives: the challenges (due to the potential toxicity) and the potentiality like the conjugation of GBMs to biomolecules to develop advanced nanomedicine tools. In this context, we have described and discussed i) the impact of graphene on immune cells, ii) graphene as immunobiosensor, and iii) antibodies conjugated to graphene for tumor targeting. Thanks to the huge advances on graphene research, it seems realistic to hypothesize in the near future that some graphene immunoconjugates, endowed of defined immune properties, can go through preclinical test and be successfully used in nanomedicine. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Molecular mechanisms of aging and immune system regulation in Drosophila.

    Science.gov (United States)

    Eleftherianos, Ioannis; Castillo, Julio Cesar

    2012-01-01

    Aging is a complex process that involves the accumulation of deleterious changes resulting in overall decline in several vital functions, leading to the progressive deterioration in physiological condition of the organism and eventually causing disease and death. The immune system is the most important host-defense mechanism in humans and is also highly conserved in insects. Extensive research in vertebrates has concluded that aging of the immune function results in increased susceptibility to infectious disease and chronic inflammation. Over the years, interest has grown in studying the molecular interaction between aging and the immune response to pathogenic infections. The fruit fly Drosophila melanogaster is an excellent model system for dissecting the genetic and genomic basis of important biological processes, such as aging and the innate immune system, and deciphering parallel mechanisms in vertebrate animals. Here, we review the recent advances in the identification of key players modulating the relationship between molecular aging networks and immune signal transduction pathways in the fly. Understanding the details of the molecular events involved in aging and immune system regulation will potentially lead to the development of strategies for decreasing the impact of age-related diseases, thus improving human health and life span.

  8. Under Pressure: Interactions between Commensal Microbiota and the Teleost Immune System

    Directory of Open Access Journals (Sweden)

    Cecelia Kelly

    2017-05-01

    Full Text Available Commensal microorganisms inhabit every mucosal surface of teleost fish. At these surfaces, microorganisms directly and indirectly shape the teleost immune system. This review provides a comprehensive overview of how the microbiota and microbiota-derived products influence both the mucosal and systemic immune system of fish. The cross talk between the microbiota and the teleost immune system shifts significantly under stress or disease scenarios rendering commensals into opportunists or pathogens. Lessons learnt from germ-free fish models as well as from oral administration of live probiotics to fish highlight the vast impact that microbiota have on immune development, antibody production, mucosal homeostasis, and resistance to stress. Future studies should dissect the specific mechanisms by which different members of the fish microbiota and the metabolites they produce interact with pathogens, with other commensals, and with the teleost immune system.

  9. Cancer-Targeted Oncolytic Adenoviruses for Modulation of the Immune System.

    Science.gov (United States)

    Cerullo, Vincenzo; Capasso, Cristian; Vaha-Koskela, Markus; Hemminki, Otto; Hemminki, Akseli

    2018-01-01

    Adenovirus is one of the most commonly used vectors for gene therapy and it is the first approved virus-derived drug for treatment of cancer. As an oncolytic agent, it can induce lysis of infected cells, but it can also engage the immune system, promoting activation and maturation of antigen- presenting cells (APCs). In essence, oncolysis combined with the associated immunostimulatory actions result in a "personalized in situ vaccine" for each patient. In order to take full advantage of these features, we should try to understand how adenovirus interacts with the immune system, what are the receptors involved in triggering subsequent signals and which kind of responses they elicit. Tackling these questions will give us further insight in how to manipulate adenovirus-mediated immune responses for enhancement of anti-tumor efficacy. In this review, we first highlight how oncolytic adenovirus interacts with the innate immune system and its receptors such as Toll-like receptors, nucleotide-binding and oligomerization domain (NOD)- like receptors and other immune sensors. Then we describe the effect of these interactions on the adaptive immune system and its cells, especially B and T lymphocytes. Finally, we summarize the most significant preclinical and clinical results in the field of gene therapy where researchers have engineered adenovirus to manipulate the host immune system by expressing cytokines and signalingmediators. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  10. Role of neuropilin-2 in the immune system.

    Science.gov (United States)

    Schellenburg, S; Schulz, A; Poitz, D M; Muders, M H

    2017-10-01

    Neuropilins (NRPs) are single transmembrane receptors with short cytoplasmic tails and are dependent on receptors like VEGF receptors or Plexins for signal transduction. NRPs are known to be important in angiogenesis, lymphangiogenesis, and axon guidance. The Neuropilin-family consists of two members, Neuropilin-1 (NRP1) and Neuropilin-2 (NRP2). They are up to 44 % homologous and conserved in all vertebrates. High levels of NRP2 are found on immune cells. Current research is very limited regarding the functions of NRP2 on these cells. Recent evidence suggests that NRP2 is important for migration, antigen presentation, phagocytosis and cell-cell contact within the immune system. Additionally, posttranslational NRP2 modifications like polysialylation are crucial for the function of some immune cells. This review is an overview about expression and functions of NRP2 in the immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashley M. Sherrid

    2013-01-01

    Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

  12. The role of the immune system in Alzheimer disease: Etiology and treatment.

    Science.gov (United States)

    Jevtic, Stefan; Sengar, Ameet S; Salter, Michael W; McLaurin, JoAnne

    2017-11-01

    The immune system is now considered a major factor in Alzheimer Disease (AD). This review seeks to demonstrate how various aspects of the immune system, both in the brain and peripherally, interact to contribute to AD. We highlight classical nervous system immune components, such as complement and microglia, as well as novel aspects of the peripheral immune system that can influence disease, such as monocytes and lymphocytes. By detailing the roles of various immune cells in AD, we summarize an emerging perspective for disease etiology and future therapeutic targets. Copyright © 2017. Published by Elsevier B.V.

  13. Neural Control of the Immune System

    Science.gov (United States)

    Sundman, Eva; Olofsson, Peder S.

    2014-01-01

    Neural reflexes support homeostasis by modulating the function of organ systems. Recent advances in neuroscience and immunology have revealed that neural reflexes also regulate the immune system. Activation of the vagus nerve modulates leukocyte cytokine production and alleviates experimental shock and autoimmune disease, and recent data have…

  14. Roles of Zinc Signaling in the Immune System.

    Science.gov (United States)

    Hojyo, Shintaro; Fukada, Toshiyuki

    2016-01-01

    Zinc (Zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. Zn deficiency depresses both innate and adaptive immune responses. However, the precise physiological mechanisms of the Zn-mediated regulation of the immune system have been largely unclear. Zn homeostasis is tightly controlled by the coordinated activity of Zn transporters and metallothioneins, which regulate the transport, distribution, and storage of Zn. There is growing evidence that Zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. In this review, we highlight the emerging functional roles of Zn and Zn transporters in immunity, focusing on how crosstalk between Zn and immune-related signaling guides the normal development and function of immune cells.

  15. Immune algorithm based active PID control for structure systems

    International Nuclear Information System (INIS)

    Lee, Young Jin; Cho, Hyun Cheol; Lee, Kwon Soon

    2006-01-01

    An immune algorithm is a kind of evolutional computation strategies, which is developed in the basis of a real immune mechanism in the human body. Recently, scientific or engineering applications using this scheme are remarkably increased due to its significant ability in terms of adaptation and robustness for external disturbances. Particularly, this algorithm is efficient to search optimal parameters against complicated dynamic systems with uncertainty and perturbation. In this paper, we investigate an immune algorithm embedded Proportional Integral Derivate (called I P ID) control, in which an optimal parameter vector of the controller is determined offline by using a cell-mediated immune response of the immunized mechanism. For evaluation, we apply the proposed control to mitigation of vibrations for nonlinear structural systems, cased by external environment load such as winds and earthquakes. Comparing to traditional controls under same simulation scenarios, we demonstrate the innovation control is superior especially in robustness aspect

  16. Diversity of aging of the immune system classified in the cotton rat (Sigmodon hispidus) model of human infectious diseases.

    Science.gov (United States)

    Guichelaar, Teun; van Erp, Elisabeth A; Hoeboer, Jeroen; Smits, Noortje A M; van Els, Cécile A C M; Pieren, Daan K J; Luytjes, Willem

    2018-05-01

    Susceptibility and declined resistance to human pathogens like respiratory syncytial virus (RSV) at old age is well represented in the cotton rat (Sigmodon hispidus). Despite providing a preferred model of human infectious diseases, little is known about aging of its adaptive immune system. We aimed to define aging-related changes of the immune system of this species. Concomitantly, we asked whether the rate of immunological alterations may be stratified by physiological aberrations encountered during aging. With increasing age, cotton rats showed reduced frequencies of T cells, impaired induction of antibodies to RSV, higher incidence of aberrations of organs and signs of lipemia. Moreover, old animals expressed high biological heterogeneity, but the age-related reduction of T cell frequency was only observed in those specimens that displayed aberrant organs. Thus, cotton rats show age-related alterations of lymphocytes that can be classified by links with health status. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Sympathetic neural modulation of the immune system

    International Nuclear Information System (INIS)

    Madden, K.S.

    1989-01-01

    One route by which the central nervous system communicates with lymphoid organs in the periphery is through the sympathetic nervous system (SNS). To study SNS regulation of immune activity in vivo, selective removal of peripheral noradrenergic nerve fibers was achieved by administration of the neurotoxic drug, 6-hydroxydopamine (6-OHDA), to adult mice. To assess SNS influence on lymphocyte proliferation in vitro, uptake of 125 iododeoxyuridine ( 125 IUdR), a DNA precursor, was measured following 6-OHDA treatment. Sympathectomy prior to epicutaneous immunization with TNCB did not alter draining lymph nodes (LN) cell proliferation, whereas 6-OHDA treatment before footpad immunization with KLH reduced DNA synthesis in popliteal LN by 50%. In mice which were not deliberately immunized, sympathectomy stimulated 125 IUdR uptake inguinal and axillary LN, spleen, and bone marrow. In vitro, these LN and spleen cells exhibited decreased proliferation responses to the T cell mitogen, concanavalin A (Con A), whereas lipopolysaccharide (LPS)-stimulated IgG secretion was enhanced. Studies examining 51 Cr-labeled lymphocyte trafficking to LN suggested that altered cell migration may play a part in sympathectomy-induced changes in LN cell function

  18. Clonal Selection Based Artificial Immune System for Generalized Pattern Recognition

    Science.gov (United States)

    Huntsberger, Terry

    2011-01-01

    The last two decades has seen a rapid increase in the application of AIS (Artificial Immune Systems) modeled after the human immune system to a wide range of areas including network intrusion detection, job shop scheduling, classification, pattern recognition, and robot control. JPL (Jet Propulsion Laboratory) has developed an integrated pattern recognition/classification system called AISLE (Artificial Immune System for Learning and Exploration) based on biologically inspired models of B-cell dynamics in the immune system. When used for unsupervised or supervised classification, the method scales linearly with the number of dimensions, has performance that is relatively independent of the total size of the dataset, and has been shown to perform as well as traditional clustering methods. When used for pattern recognition, the method efficiently isolates the appropriate matches in the data set. The paper presents the underlying structure of AISLE and the results from a number of experimental studies.

  19. Hidden Consequences of Living in a Wormy World : Nematode-Induced Immune Suppression Facilitates Tuberculosis Invasion in African Buffalo

    NARCIS (Netherlands)

    Ezenwa, Vanessa O.; Etienne, Rampal S.; Luikart, Gordon; Beja-Pereira, Albano; Jolles, Anna E.

    2010-01-01

    Most hosts are infected with multiple parasites, and responses of the immune system to co occurring parasites may influence disease spread. Helminth infection can bias the host immune response toward a T-helper type 2 Th2) over a type 1 Th1) response, impairing the host's ability to control

  20. The ontogeny of the porcine immune system

    Czech Academy of Sciences Publication Activity Database

    Šinkora, Marek; Butler, J. E.

    2009-01-01

    Roč. 33, č. 3 (2009), s. 273-283 ISSN 0145-305X R&D Projects: GA ČR GA524/07/0087; GA ČR GA523/07/0088 Institutional research plan: CEZ:AV0Z50200510 Keywords : ontogeny of the porcine immune system * swine adaptive immunity * development of alpha beta and gamma delta T cells Subject RIV: EC - Immunology Impact factor: 3.290, year: 2009

  1. Prolonged protection against Intranasal challenge with influenza virus following systemic immunization or combinations of mucosal and systemic immunizations with a heat-labile toxin mutant.

    Science.gov (United States)

    Zhou, Fengmin; Goodsell, Amanda; Uematsu, Yasushi; Vajdy, Michael

    2009-04-01

    Seasonal influenza virus infections cause considerable morbidity and mortality in the world, and there is a serious threat of a pandemic influenza with the potential to cause millions of deaths. Therefore, practical influenza vaccines and vaccination strategies that can confer protection against intranasal infection with influenza viruses are needed. In this study, we demonstrate that using LTK63, a nontoxic mutant of the heat-labile toxin from Escherichia coli, as an adjuvant for both mucosal and systemic immunizations, systemic (intramuscular) immunization or combinations of mucosal (intranasal) and intramuscular immunizations protected mice against intranasal challenge with a lethal dose of live influenza virus at 3.5 months after the second immunization.

  2. CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity.

    Science.gov (United States)

    Barrangou, Rodolphe; Marraffini, Luciano A

    2014-04-24

    Clustered regularly interspaced short palindromic repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing and can be repurposed for numerous DNA targeting applications including transcriptional control. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity

    Science.gov (United States)

    Barrangou, Rodolphe; Marraffini, Luciano A.

    2014-01-01

    Summary Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing, and can be repurposed for numerous DNA targeting applications including transcriptional control. PMID:24766887

  4. Genome-wide analysis of immune system genes by EST profiling

    Science.gov (United States)

    Giallourakis, Cosmas; Benita, Yair; Molinie, Benoit; Cao, Zhifang; Despo, Orion; Pratt, Henry E.; Zukerberg, Lawrence R.; Daly, Mark J.; Rioux, John D.; Xavier, Ramnik J.

    2013-01-01

    Profiling studies of mRNA and miRNA, particularly microarray-based studies, have been extensively used to create compendia of genes that are preferentially expressed in the immune system. In some instances, functional studies have been subsequently pursued. Recent efforts such as ENCODE have demonstrated the benefit of coupling RNA-Seq analysis with information from expressed sequence tags (ESTs) for transcriptomic analysis. However, the full characterization and identification of transcripts that function as modulators of human immune responses remains incomplete. In this study, we demonstrate that an integrated analysis of human ESTs provides a robust platform to identify the immune transcriptome. Beyond recovering a reference set of immune-enriched genes and providing large-scale cross-validation of previous microarray studies, we discovered hundreds of novel genes preferentially expressed in the immune system, including non-coding RNAs. As a result, we have established the Immunogene database, representing an integrated EST “road map” of gene expression in human immune cells, which can be used to further investigate the function of coding and non-coding genes in the immune system. Using this approach, we have uncovered a unique metabolic gene signature of human macrophages and identified PRDM15 as a novel overexpressed gene in human lymphomas. Thus we demonstrate the utility of EST profiling as a basis for further deconstruction of physiologic and pathologic immune processes. PMID:23616578

  5. Is immune system-related hypertension associated with ovarian hormone deficiency?

    Science.gov (United States)

    Sandberg, Kathryn; Ji, Hong; Einstein, Gillian; Au, April; Hay, Meredith

    2016-03-01

    What is the topic of this review? This review summarizes recent data on the role of ovarian hormones and sex in inflammation-related hypertension. What advances does it highlight? The adaptive immune system has recently been implicated in the development of hypertension in males but not in females. The role of the immune system in the development of hypertension in women and its relationship to ovarian hormone production are highlighted. The immune system is known to contribute to the development of high blood pressure in males. However, the role of the immune system in the development of high blood pressure in females and the role of ovarian hormones has only recently begun to be studied. In animal studies, both the sex of the host and the T cell are critical biological determinants of susceptibility and resistance to hypertension induced by angiotensin II. In women, natural menopause is known to result in significant changes in the expression of genes regulating the immune system. Likewise, in animal models, ovariectomy results in hypertension and an upregulation in T-cell tumour necrosis factor-α-related genes. Oestrogen replacement results in decreases in inflammatory genes in the brain regions involved in blood pressure regulation. Together, these studies suggest that the response of the adaptive immune system to ovarian hormone deficiency is a significant contributor to hypertension in women. © 2015 The Authors. Experimental Physiology © 2015 The Physiological Society.

  6. Vascular, glial, and lymphatic immune gateways of the central nervous system

    NARCIS (Netherlands)

    Engelhardt, Britta; Carare, Roxana O.; Bechmann, Ingo; Fluegel, Alexander; Laman, Jon D.; Weller, Roy O.

    Immune privilege of the central nervous system (CNS) has been ascribed to the presence of a blood-brain barrier and the lack of lymphatic vessels within the CNS parenchyma. However, immune reactions occur within the CNS and it is clear that the CNS has a unique relationship with the immune system.

  7. Protein-Energy Malnutrition (PEM is Believed to Lead to an Increased Susceptibility to Infection, or cause Impaired Immunity

    Directory of Open Access Journals (Sweden)

    Mellova Amir Masrizal

    2003-08-01

    Full Text Available Infection, occurring with malnutrition, is a major cause of morbidity in all age groups and is responsible for two-thirds of all death under 5 yr of age in developing countries. Many cells of the immune system are known to depend for their function on metabolic pathways that employ various nutrients as critical factors. The most consistent changes in immune competence in PEM are in cell-mediated immunity, the bactericidal function of neutrophils, the complement system, the secretory immunoglobin A, and antibody response.

  8. A Service Oriented Architecture Approach to Achieve Interoperability between Immunization Information Systems in Iran.

    Science.gov (United States)

    Hosseini, Masoud; Ahmadi, Maryam; Dixon, Brian E

    2014-01-01

    Clinical decision support (CDS) systems can support vaccine forecasting and immunization reminders; however, immunization decision-making requires data from fragmented, independent systems. Interoperability and accurate data exchange between immunization information systems (IIS) is an essential factor to utilize Immunization CDS systems. Service oriented architecture (SOA) and Health Level 7 (HL7) are dominant standards for web-based exchange of clinical information. We implemented a system based on SOA and HL7 v3 to support immunization CDS in Iran. We evaluated system performance by exchanging 1500 immunization records for roughly 400 infants between two IISs. System turnaround time is less than a minute for synchronous operation calls and the retrieved immunization history of infants were always identical in different systems. CDS generated reports were accordant to immunization guidelines and the calculations for next visit times were accurate. Interoperability is rare or nonexistent between IIS. Since inter-state data exchange is rare in United States, this approach could be a good prototype to achieve interoperability of immunization information.

  9. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    Science.gov (United States)

    Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei

    2017-11-01

    Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  10. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    Directory of Open Access Journals (Sweden)

    Yushi Yao

    2017-11-01

    Full Text Available Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM, which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  11. Metabolites: messengers between the microbiota and the immune system.

    Science.gov (United States)

    Levy, Maayan; Thaiss, Christoph A; Elinav, Eran

    2016-07-15

    The mammalian intestine harbors one of the largest microbial densities on Earth, necessitating the implementation of control mechanisms by which the host evaluates the state of microbial colonization and reacts to deviations from homeostasis. While microbial recognition by the innate immune system has been firmly established as an efficient means by which the host evaluates microbial presence, recent work has uncovered a central role for bacterial metabolites in the orchestration of the host immune response. In this review, we highlight examples of how microbiota-modulated metabolites control the development, differentiation, and activity of the immune system and classify them into functional categories that illustrate the spectrum of ways by which microbial metabolites influence host physiology. A comprehensive understanding of how microbiota-derived metabolites shape the human immune system is critical for the rational design of therapies for microbiota-driven diseases. © 2016 Levy et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Quantifying adaptive evolution in the Drosophila immune system.

    Directory of Open Access Journals (Sweden)

    Darren J Obbard

    2009-10-01

    Full Text Available It is estimated that a large proportion of amino acid substitutions in Drosophila have been fixed by natural selection, and as organisms are faced with an ever-changing array of pathogens and parasites to which they must adapt, we have investigated the role of parasite-mediated selection as a likely cause. To quantify the effect, and to identify which genes and pathways are most likely to be involved in the host-parasite arms race, we have re-sequenced population samples of 136 immunity and 287 position-matched non-immunity genes in two species of Drosophila. Using these data, and a new extension of the McDonald-Kreitman approach, we estimate that natural selection fixes advantageous amino acid changes in immunity genes at nearly double the rate of other genes. We find the rate of adaptive evolution in immunity genes is also more variable than other genes, with a small subset of immune genes evolving under intense selection. These genes, which are likely to represent hotspots of host-parasite coevolution, tend to share similar functions or belong to the same pathways, such as the antiviral RNAi pathway and the IMD signalling pathway. These patterns appear to be general features of immune system evolution in both species, as rates of adaptive evolution are correlated between the D. melanogaster and D. simulans lineages. In summary, our data provide quantitative estimates of the elevated rate of adaptive evolution in immune system genes relative to the rest of the genome, and they suggest that adaptation to parasites is an important force driving molecular evolution.

  13. Schizophrenia and the immune system: pathophysiology, prevention, and treatment.

    Science.gov (United States)

    Richard, Michelle D; Brahm, Nancy C

    2012-05-01

    Published evidence on established and theoretical connections between immune system dysfunction and schizophrenia is reviewed, with a discussion of developments in the search for immunologically-targeted treatments. A growing body of evidence indicates that immunologic influences may play an important role in the etiology and course of schizophrenia. A literature search identified more than 100 articles pertaining to suspected immunologic influences on schizophrenia published over the past 15 years. Schizophrenia researchers have explored a wide range of potential immune system-related causal or contributory factors, including neurobiological and neuroanatomical disorders, genetic abnormalities, and environmental influences such as maternal perinatal infection. Efforts to establish an immunologic basis for schizophrenia and identify reliable immune markers continue to be hindered by sampling challenges and methodological problems. In aggregate, the available evidence indicates that at least some cases of schizophrenia have an immunologic component, suggesting that immune-focused prevention strategies (e.g., counseling of pregnant women to avoid immune stressors) and close monitoring of at-risk children are appropriate. While antipsychotics remain the standard treatments for schizophrenia, a variety of drugs with immunologic effects have been investigated as adjunctive therapies, with variable and sometimes conflicting results; these include the cyclooxygenase-2 inhibitor celecoxib, immune-modulating agents (e.g., azathioprine and various anticytokine agents such as atlizumab, anakinra, and tumor necrosis factor-α blockers), and an investigational anti-interferon-γ agent. The published evidence indicates that immune system dysfunction related to genetic, environmental, and neurobiological influences may play a role in the etiology of schizophrenia in a subset of patients.

  14. The role of the immune system in the generation of neuropathic pain.

    Science.gov (United States)

    Calvo, Margarita; Dawes, John M; Bennett, David L H

    2012-07-01

    Persistent pain is a sequela of several neurological conditions with a primary immune basis, such as Guillain-Barré syndrome and multiple sclerosis. Additionally, diverse forms of injury to the peripheral or the central nervous systems--whether traumatic, metabolic, or toxic--result in substantial recruitment and activation of immune cells. This response involves the innate immune system, but evidence also exists of T-lymphocyte recruitment, and in some patient cohorts antibodies to neuronal antigens have been reported. Mediators released by immune cells, such as cytokines, sensitise nociceptive signalling in the peripheral and central nervous systems. Preclinical data suggest an immune pathogenesis of neuropathic pain, but clinical evidence of a central role of the immune system is less clear. An important challenge for the future is to establish to what extent this immune response initiates or maintains neuropathic pain in patients and thus whether it is amenable to therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Respiratory and Metabolic Impacts of Crustacean Immunity: Are there Implications for the Insects?

    Science.gov (United States)

    Burnett, Karen G; Burnett, Louis E

    2015-11-01

    Extensive similarities in the molecular architecture of the crustacean immune system to that of insects give credence to the current view that the Hexapoda, including Insecta, arose within the clade Pancrustacea. The crustacean immune system is mediated largely by hemocytes, relying on suites of pattern recognition receptors, effector functions, and signaling pathways that parallel those of insects. In crustaceans, as in insects, the cardiovascular system facilitates movement of hemocytes and delivery of soluble immune factors, thereby supporting immune surveillance and defense along with other physiological functions such as transport of nutrients, wastes, and hormones. Crustaceans also rely heavily on their cardiovascular systems to mediate gas exchange; insects are less reliant on internal circulation for this function. Among the largest crustaceans, the decapods have developed a condensed heart and a highly arteriolized cardiovascular system that supports the metabolic demands of their often large body size. However, recent studies indicate that mounting an immune response can impair gas exchange and metabolism in their highly developed vascular system. When circulating hemocytes detect the presence of potential pathogens, they aggregate rapidly with each other and with the pathogen. These growing aggregates can become trapped in the microvasculature of the gill where they are melanized and may be eliminated at the next molt. Prior to molting, trapped aggregates of hemocytes also can impair hemolymph flow and oxygenation at the gill. Small shifts to anaerobic metabolism only partially compensate for this decrease in oxygen uptake. The resulting metabolic depression is likely to impact other energy-expensive cellular processes and whole-animal performance. For crustaceans that often live in microbially-rich, but oxygen-poor aquatic environments, there appear to be distinct tradeoffs, based on the gill's multiple roles in respiration and immunity. Insects have

  16. The Role of Non-specific and Specific Immune Systems in Poultry against Newcastle Disease

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2015-09-01

    Full Text Available Newcastle disease (ND is caused by avian paramyxovirus-1 which belong to Avulavirus genus and Paramyxoviridae family. The birds have abnormalities in humoral (bursa fabricius and cellular (thymus and spleen lymphoid organs. Lesions decrease the immune system. Immune system consists of non-specific and specific immune systems. The main components of non-specific immunity are physical and chemical barrier (feather and skin or mucosa, phagocytic cells (macrophages and natural killer, protein complement and the mediator of inflammation and cytokines. Interferons (IFNs belong to a group of cytokines that play a major role in the nonspecific or innate (natural immunity. The virulent ND virus encodes protein of V gene can be suppressed IFN type I. This leads to non-specific immune system fail to respond to the virulent strains resulting in severe pathogenicity. The defense mechanism of the host is replaced by specific immunity (adaptive immunity when natural immunity fails to overcome the infection. The specific immune system consists of humoral mediated immunity (HMI and cell-mediated immunity (CMI. The cells of immune system that react specifically with the antigen are B lymphocytes producing the antibodies, T lymphocytes that regulate the synthesis of antibodies and T cells as effector or the direct cytotoxic cells. Both non-specific and specific immunities are complementary against the invasion of ND virus in the birds. The objective of this article is to discuss the role of non specific and specific immune system in ND.

  17. The conservative physiology of the immune system

    Directory of Open Access Journals (Sweden)

    N.M. Vaz

    2003-01-01

    Full Text Available Current immunological opinion disdains the necessity to define global interconnections between lymphocytes and regards natural autoantibodies and autoreactive T cells as intrinsically pathogenic. Immunological theories address the recognition of foreignness by independent clones of lymphocytes, not the relations among lymphocytes or between lymphocytes and the organism. However, although extremely variable in cellular/molecular composition, the immune system preserves as invariant a set of essential relations among its components and constantly enacts contacts with the organism of which it is a component. These invariant relations are reflected, for example, in the life-long stability of profiles of reactivity of immunoglobulins formed by normal organisms (natural antibodies. Oral contacts with dietary proteins and the intestinal microbiota also result in steady states that lack the progressive quality of secondary-type reactivity. Autoreactivity (natural autoantibody and autoreactive T cell formation is also stable and lacks the progressive quality of clonal expansion. Specific immune responses, currently regarded as the fundament of the operation of the immune system, may actually result from transient interruptions in this stable connectivity among lymphocytes. More permanent deficits in interconnectivity result in oligoclonal expansions of T lymphocytes, as seen in Omenn's syndrome and in the experimental transplantation of a suboptimal diversity of syngeneic T cells to immunodeficient hosts, which also have pathogenic consequences. Contrary to theories that forbid autoreactivity as potentially pathogenic, the physiology of the immune system is conservative and autoreactive. Pathology derives from failures of these conservative mechanisms.

  18. Impaired sense of smell and altered olfactory system in RAG-1-/- immunodeficient mice

    Directory of Open Access Journals (Sweden)

    Lorenza eRattazzi

    2015-09-01

    Full Text Available Immune deficiencies are often associated with a number of physical manifestations including loss of sense of smell and an increased level of anxiety. We have previously shown that T and B cell-deficient recombinase activating gene (RAG-1-/- knockout mice have an increased level of anxiety-like behavior and altered gene expression involved in olfaction. In this study, we expanded these findings by testing the structure and functional development of the olfactory system in RAG-1-/- mice. Our results show that these mice have a reduced engagement in different types of odors and this phenotype is associated with disorganized architecture of glomerular tissue and atrophy of the main olfactory epithelium. Most intriguingly this defect manifests specifically in adult age and is not due to impairment in the patterning of the olfactory neuron staining at the embryo stage. Together these findings provide a formerly unreported biological evidence for an altered function of the olfactory system in RAG-1-/- mice.

  19. When carbon nanotubes encounter the immune system: desirable and undesirable effects.

    Science.gov (United States)

    Dumortier, Hélène

    2013-12-01

    The role of our immune system is to bring efficient protection against invasion by foreign elements, not only pathogens but also any material it may be in contact with. Nanoparticles may enter the body and encounter the immune system either intentionally (e.g. administration for biomedical application) or not (e.g. respiratory occupational exposure). Therefore, it is of fundamental importance to get a thorough knowledge of the way they interact with immune cells and all related consequences. Among nanomaterials, carbon nanotubes (CNTs) are of special interest because of their tremendous field of applications. Consequently, their increasing production, processing and eventual incorporation into new types of composites and/or into biological systems have raised fundamental issues regarding their potential impact on health. This review aims at giving an overview of the known desirable and undesirable effects of CNTs on the immune system, i.e. beneficial modulation of immune cells by CNTs engineered for biomedical applications versus toxicity, inflammation and unwanted immune reactions triggered by CNTs themselves. © 2013 Elsevier B.V. All rights reserved.

  20. The contribution of the immune system to parturition

    Directory of Open Access Journals (Sweden)

    R. De Jongh

    1996-01-01

    Full Text Available The immune system plays a central role before and during parturition, including the main physiological processes of parturition: uterine contractions and cervical ripening. The immune system comprises white blood cells and their secretions. Polymorphonuclear cells and macrophages invade the cervical tissue and release compounds, such as oxygen radicals and enzymes, which break down the cervical matrix to allow softening and dilatation. During this inflammatory process, white blood cells undergo chemotaxis, adherence to endothelial cells, diapedesis, migration and activation. Factors that regulate white blood cell invasion and secretion include cytokines such as tumour necrosis factor and interleukins. Glucocorticoids, sex hormones and prostaglandins, affect cytokine synthesis. They also modulate the target cells, resulting in altered responses to cytokines. On the other hand, the immune system has profound effects on the hormonal system and prostaglandin synthesis. In animals, nitric oxide has marked effects on uterine quiescence during gestation. At the same time, it plays an important role in regulating the vascular tone of uterine arteries and has anti-adhesive effects on leukocytes. Cytokines are found in amniotic fluid, and in maternal and foetal serum at term and preterm. Several intrauterine cells have been shown to produce these cytoldnes. Since neither white blood cells, cytokines nor nitric oxide seem to be the ultimate intermediate for human parturition, the immune system is an additional but obligatory and underestimated component in the physiology of delivery. Scientists, obstetricians and anaesthesiologists must thus be aware of these processes.

  1. Tumor-Derived Exosomes and Their Role in Tumor-Induced Immune Suppression

    Directory of Open Access Journals (Sweden)

    Theresa L. Whiteside

    2016-10-01

    Full Text Available Tumor-derived exosomes (TEX are emerging as critical components of an intercellular information network between the tumor and the host. The tumor escapes from the host immune system by using a variety of mechanisms designed to impair or eliminate anti-tumor immunity. TEX carrying a cargo of immunoinhibitory molecules and factors represent one such mechanism. TEX, which are present in all body fluids of cancer patients, deliver negative molecular or genetic signals to immune cells re-programming their functions. Although TEX can also stimulate immune activity, in the microenvironments dominated by the tumor, TEX tend to mediate immune suppression thus promoting tumor progression. The TEX content, in part resembling that of the parent cell, may serve as a source of cancer biomarkers. TEX also interfere with immune therapies. A better understanding of TEX and their contribution to cancer progression and cancer patients’ response to immune therapies represents a challenging new field of investigation.

  2. Dietary long chain n-3 polyunsaturated fatty acids prevent impaired social behaviour and normalize brain dopamine levels in food allergic mice

    NARCIS (Netherlands)

    de Theije, Caroline G M; van den Elsen, Lieke W J; Willemsen, Linette E M; Milosevic, Vanja; Korte-Bouws, Gerdien A H; Lopes da Silva, Sofia; Broersen, Laus M; Korte, S Mechiel; Olivier, Berend; Garssen, Johan; Kraneveld, Aletta D

    2015-01-01

    Allergy is suggested to exacerbate impaired behaviour in children with neurodevelopmental disorders. We have previously shown that food allergy impaired social behaviour in mice. Dietary fatty acid composition may affect both the immune and nervous system. The aim of this study was to assess the

  3. Oncolytic Viral Therapy and the Immune System: A Double-Edged Sword Against Cancer.

    Science.gov (United States)

    Marelli, Giulia; Howells, Anwen; Lemoine, Nicholas R; Wang, Yaohe

    2018-01-01

    Oncolytic viral therapy is a new promising strategy against cancer. Oncolytic viruses (OVs) can replicate in cancer cells but not in normal cells, leading to lysis of the tumor mass. Beside this primary effect, OVs can also stimulate the immune system. Tumors are an immuno-suppressive environment in which the immune system is silenced in order to avoid the immune response against cancer cells. The delivery of OVs into the tumor wakes up the immune system so that it can facilitate a strong and durable response against the tumor itself. Both innate and adaptive immune responses contribute to this process, producing an immune response against tumor antigens and facilitating immunological memory. However, viruses are recognized by the immune system as pathogens and the consequent anti-viral response could represent a big hurdle for OVs. Finding a balance between anti-tumor and anti-viral immunity is, under this new light, a priority for researchers. In this review, we provide an overview of the various ways in which different components of the immune system can be allied with OVs. We have analyzed the different immune responses in order to highlight the new and promising perspectives leading to increased anti-tumor response and decreased immune reaction to the OVs.

  4. Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints.

    Science.gov (United States)

    Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

    2015-06-01

    Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system-with its capacity for memory, exquisite specificity and central and universal role in human biology-immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer.

  5. Biological Immune System Applications on Mobile Robot for Disabled People

    Directory of Open Access Journals (Sweden)

    Songmin Jia

    2014-01-01

    Full Text Available To improve the service quality of service robots for the disabled, immune system is applied on robot for its advantages such as diversity, dynamic, parallel management, self-organization, and self-adaptation. According to the immune system theory, local environment condition sensed by robot is considered an antigen while robot is regarded as B-cell and possible node as antibody, respectively. Antibody-antigen affinity is employed to choose the optimal possible node to ensure the service robot can pass through the optimal path. The paper details the immune system applications on service robot and gives experimental results.

  6. CHECKPOINT INHIBITOR IMMUNE THERAPY: Systemic Indications and Ophthalmic Side Effects.

    Science.gov (United States)

    Dalvin, Lauren A; Shields, Carol L; Orloff, Marlana; Sato, Takami; Shields, Jerry A

    2018-06-01

    To review immune checkpoint inhibitor indications and ophthalmic side effects. A literature review was performed using a PubMed search for publications between 1990 and 2017. Immune checkpoint inhibitors are designed to treat system malignancies by targeting one of three ligands, leading to T-cell activation for attack against malignant cells. These ligands (and targeted drug) include cytotoxic T-lymphocyte antigen-4 (CTLA-4, ipilimumab), programmed death protein 1 (PD-1, pembrolizumab, nivolumab), and programmed death ligand-1 (PD-L1, atezolizumab, avelumab, durvalumab). These medications upregulate the immune system and cause autoimmune-like side effects. Ophthalmic side effects most frequently manifest as uveitis (1%) and dry eye (1-24%). Other side effects include myasthenia gravis (n = 19 reports), inflammatory orbitopathy (n = 11), keratitis (n = 3), cranial nerve palsy (n = 3), optic neuropathy (n = 2), serous retinal detachment (n = 2), extraocular muscle myopathy (n = 1), atypical chorioretinal lesions (n = 1), immune retinopathy (n = 1), and neuroretinitis (n = 1). Most inflammatory side effects are managed with topical or periocular corticosteroids, but advanced cases require systemic corticosteroids and cessation of checkpoint inhibitor therapy. Checkpoint inhibitors enhance the immune system by releasing inhibition on T cells, with risk of autoimmune-like side effects. Ophthalmologists should include immune-related adverse events in their differential when examining cancer patients with new ocular symptoms.

  7. Inactivated Influenza Vaccine That Provides Rapid, Innate-Immune-System-Mediated Protection and Subsequent Long-Term Adaptive Immunity.

    Science.gov (United States)

    Chua, Brendon Y; Wong, Chinn Yi; Mifsud, Edin J; Edenborough, Kathryn M; Sekiya, Toshiki; Tan, Amabel C L; Mercuri, Francesca; Rockman, Steve; Chen, Weisan; Turner, Stephen J; Doherty, Peter C; Kelso, Anne; Brown, Lorena E; Jackson, David C

    2015-10-27

    The continual threat to global health posed by influenza has led to increased efforts to improve the effectiveness of influenza vaccines for use in epidemics and pandemics. We show in this study that formulation of a low dose of inactivated detergent-split influenza vaccine with a Toll-like receptor 2 (TLR2) agonist-based lipopeptide adjuvant (R4Pam2Cys) provides (i) immediate, antigen-independent immunity mediated by the innate immune system and (ii) significant enhancement of antigen-dependent immunity which exhibits an increased breadth of effector function. Intranasal administration of mice with vaccine formulated with R4Pam2Cys but not vaccine alone provides protection against both homologous and serologically distinct (heterologous) viral strains within a day of administration. Vaccination in the presence of R4Pam2Cys subsequently also induces high levels of systemic IgM, IgG1, and IgG2b antibodies and pulmonary IgA antibodies that inhibit hemagglutination (HA) and neuraminidase (NA) activities of homologous but not heterologous virus. Improved primary virus nucleoprotein (NP)-specific CD8(+) T cell responses are also induced by the use of R4Pam2Cys and are associated with robust recall responses to provide heterologous protection. These protective effects are demonstrated in wild-type and antibody-deficient animals but not in those depleted of CD8(+) T cells. Using a contact-dependent virus transmission model, we also found that heterologous virus transmission from vaccinated mice to naive mice is significantly reduced. These results demonstrate the potential of adding a TLR2 agonist to an existing seasonal influenza vaccine to improve its utility by inducing immediate short-term nonspecific antiviral protection and also antigen-specific responses to provide homologous and heterologous immunity. The innate and adaptive immune systems differ in mechanisms, specificities, and times at which they take effect. The innate immune system responds within hours of

  8. The enkephalinergic nervous system and its immunomodulation on the developing immune system during the ontogenesis of oyster Crassostrea gigas.

    Science.gov (United States)

    Liu, Zhaoqun; Zhou, Zhi; Wang, Lingling; Song, Xiaorui; Chen, Hao; Wang, Weilin; Liu, Rui; Wang, Mengqiang; Wang, Hao; Song, Linsheng

    2015-08-01

    Enkephalinergic neuroendocrine-immune regulatory system is one of the most important neuroendocrine-immune systems in both vertebrates and invertebrates for its significant role in the immune regulation. In the present study, the early onset of enkephalinergic nervous system and its immunomodulation on the developing immune system during the ontogenesis of oyster Crassostrea gigas were investigated to illustrate the function of neural regulation on the innate immune system in oyster larvae. [Met(5)]-enkephalin (Met-ENK) was firstly observed on the marginal of the dorsal half of D-hinged larvae. Six immune-related molecules, including four PRRs (CgCTL-1, CgCTL-2, CgCTL-4, CgNatterin-3) and two immune effectors (CgTNF-1 and CgEcSOD) were detected in the early developmental stages of trochophore, D-hinged and umbo larvae of oyster. After incubated with [Met(5)]-enkephalin, the mRNA expression level of all the PRRs changed significantly (p immune effectors were up-regulated significantly at 3 h and 6 h in trochophore larvae (p system of oyster was firstly appeared in D-hinged larvae, while the primitive immune defense system existed in the region of prototroch in trochophore larvae and developed maturely after D-hinged larvae. The developing immune system could be regulated by the neurotransmitter [Met(5)]-enkephalin released by the neuroendocrine system in oyster C. gigas. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Influence of chemotherapy for lymphoma in canine parvovirus DNA distribution and specific humoral immunity.

    Science.gov (United States)

    Elias, M A; Duarte, A; Nunes, T; Lourenço, A M; Braz, B S; Vicente, G; Henriques, J; Tavares, L

    2014-12-01

    In man, the combination of cancer and its treatment increases patients' susceptibility to opportunistic infections, due to immune system impairment. In veterinary medicine little information is available concerning this issue. In order to evaluate if a similar dysfunction is induced in small animals undergoing chemotherapy, we assessed the complete blood count, leukocytic, plasma and fecal canine parvovirus (CPV) viral load, and anti-CPV protective antibody titers, in dogs with lymphoma treated with CHOP (cyclophosphamide, doxorubicin, vincristine and prednisolone) protocol, before and during chemotherapy. There was no evidence of decreased immune response, either at admission or after two chemotherapy cycles, indicating that the previously established immunity against CPV was not significantly impaired, supporting the idea that immunosuppression as a result of hematopoietic neoplasms and their treatment in dogs requires further investigation and conclusions cannot be extrapolated from human literature. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  11. Archaeal CRISPR-based immune systems

    DEFF Research Database (Denmark)

    Garrett, Roger A; Vestergaard, Gisle Alberg; Shah, Shiraz Ali

    2011-01-01

    CRISPR (clustered regularly interspaced short palindromic repeats)-based immune systems are essentially modular with three primary functions: the excision and integration of new spacers, the processing of CRISPR transcripts to yield mature CRISPR RNAs (crRNAs), and the targeting and cleavage...... of foreign nucleic acid. The primary target appears to be the DNA of foreign genetic elements, but the CRISPR/Cmr system that is widespread amongst archaea also specifically targets and cleaves RNA in vitro. The archaeal CRISPR systems tend to be both diverse and complex. Here we examine evidence...... of CRISPR loci and the evidence for intergenomic exchange of CRISPR systems....

  12. Optimal approximation of linear systems by artificial immune response

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    This paper puts forward a novel artificial immune response algorithm for optimal approximation of linear systems. A quaternion model of artificial immune response is proposed for engineering computing. The model abstracts four elements, namely, antigen, antibody, reaction rules among antibodies, and driving algorithm describing how the rules are applied to antibodies, to simulate the process of immune response. Some reaction rules including clonal selection rules, immunological memory rules and immune regulation rules are introduced. Using the theorem of Markov chain, it is proofed that the new model is convergent. The experimental study on the optimal approximation of a stable linear system and an unstable one show that the approximate models searched by the new model have better performance indices than those obtained by some existing algorithms including the differential evolution algorithm and the multi-agent genetic algorithm.

  13. Physiologic TLR9-CpG-DNA interaction is essential for the homeostasis of the intestinal immune system.

    Science.gov (United States)

    Hofmann, Claudia; Dunger, Nadja; Doser, Kristina; Lippert, Elisabeth; Siller, Sebastian; Edinger, Matthias; Falk, Werner; Obermeier, Florian

    2014-01-01

    Cytosine-guanosine dinucleotide (CpG) motifs are immunostimulatory components of bacterial DNA and activators of innate immunity through Toll-like receptor 9 (TLR9). Administration of CpG oligodeoxynucleotides before the onset of experimental colitis prevents intestinal inflammation by enforcement of regulatory mechanisms. It was investigated whether physiologic CpG/TLR9 interactions are critical for the homeostasis of the intestinal immune system. Mesenteric lymph node cell and lamina propria mononuclear cell (LPMC) populations from BALB/c wild-type (wt) or TLR9 mice were assessed by flow cytometry and proteome profiling. Cytokine secretion was determined and nuclear extracts were analyzed for nuclear factor kappa B (NF-κB) and cAMP response-element binding protein activity. To assess the colitogenic potential of intestinal T cells, CD4-enriched cells from LPMC of wt or TLR9 donor mice were injected intraperitoneally in recipient CB-17 SCID mice. TLR9 deficiency was accompanied by slight changes in cellular composition and phosphorylation of signaling proteins of mesenteric lymph node cell and LPMC. LPMC from TLR9 mice displayed an increased proinflammatory phenotype compared with wt LPMC. NF-κB activity in cells from TLR9 mice was enhanced, whereas cAMP response-element binding activity was reduced compared with wt. Transfer of lamina propria CD4-enriched T cells from TLR9 mice induced severe colitis, whereas wt lamina propria CD4-enriched T cells displayed an attenuated phenotype. Lack of physiologic CpG/TLR9 interaction impairs the function of the intestinal immune system indicated by enhanced proinflammatory properties. Thus, physiologic CpG/TLR interaction is essential for homeostasis of the intestinal immune system as it is required for the induction of counterregulating anti-inflammatory mechanisms.

  14. Impaired sleep and allostatic load

    DEFF Research Database (Denmark)

    Clark, Alice Jessie; Dich, Nadya; Lange, Theis

    2014-01-01

    Objective: Understanding the mechanisms linking sleep impairment to morbidity and mortality is important for future prevention, but these mechanisms are far from elucidated. We aimed to determine the relation between impaired sleep, both in terms of duration and disturbed sleep, and allostatic load...... Biobank with comprehensive information on sleep duration, disturbed sleep, objective measures of an extensive range of biological risk markers, and physical conditions. Results: Long sleep (mean difference 0.23; 95% confidence interval, 0.13, 0.32) and disturbed sleep (0.14; 0.06, 0.22) were associated...... with higher AL as well as with high-risk levels of risk markers from the anthropometric, metabolic, and immune system. Sub-analyses suggested that the association between disturbed sleep and AL might be explained by underlying disorders. Whereas there was no association between short sleep and AL...

  15. Impairment of the glymphatic system after diabetes

    DEFF Research Database (Denmark)

    Jiang, Quan; Zhang, Li; Ding, Guangliang

    2017-01-01

    diabetes affects the glymphatic system. The current study is the first investigation of the effect of diabetes on the glymphatic system and the link between alteration of glymphatic clearance and cognitive impairment in Type-2 diabetes mellitus rats. MRI analysis revealed that clearance of cerebrospinal...... to the retention of Gd-DTPA contrast and fluorescent tracer in the hippocampus of Type-2 diabetes mellitus rats. Type-2 diabetes mellitus suppresses clearance of interstitial fluid in the hippocampus and hypothalamus, suggesting that an impairment of the glymphatic system contributes to Type-2 diabetes mellitus......The glymphatic system has recently been shown to clear brain extracellular solutes and abnormalities in glymphatic clearance system may contribute to both initiation and progression of neurological diseases. Despite that diabetes is known as a risk factor for vascular diseases, little is known how...

  16. [Gut microbiota and immune crosstalk in metabolic disease].

    Science.gov (United States)

    Burcelin, Rémy

    2017-01-01

    The aim of the review is to discuss about the role played by the defence crosstalk between the gut microbiota and the intestinal immune system, in the development of metabolic disease focusing on obesity and diabetes. Starting from physiological and pathological stand points and based on the latest published data, this review is addressing how the concept of the hologenome theory of evolution can drive the fate of metabolic disease. The notion of "metabolic infection" to explain the "metabolic inflammation" is discussed. This imply comments about the process of bacterial translocation and impaired intestinal immune defense against commensals. Eventually this review sets the soil for personalized medicine. The monthly increase in the number of publications on the gut microbiota to intestinal immune defense and the control of metabolism demonstrate the importance of this field of investigation. The notion of commensal as "self or non-self" has to be reevaluated in the light of the current data. Furthermore, data demonstrate the major role played by short chain fatty acids, secondary bile acids, LPS, peptidoglycans, indole derivatives, and other bacteria-related molecules on the shaping of cells involved in the intestinal protection against commensals is now becoming a central player in the incidence of metabolic diseases. The literature demonstrates that the onset of metabolic diseases and some specific co-morbidities can be explained by a gut microbiota to intestinal immune system crosstalk. Therefore, one should now consider this avenue of investigation as a putative source of biomarkers and therapeutic targets to personalize the treatment of metabolic disease and its co-morbidities. Gut microbiota is considered as a major regulator of metabolic disease. This reconciles the notion of metabolic inflammation and the epidemic development of the disease. In addition to evidence showing that a specific gut microbiota characterizes patients with obesity, type 2 diabetes

  17. Endocrine and Local IGF-I in the Bony Fish Immune System.

    Science.gov (United States)

    Franz, Anne-Constance; Faass, Oliver; Köllner, Bernd; Shved, Natallia; Link, Karl; Casanova, Ayako; Wenger, Michael; D'Cotta, Helena; Baroiller, Jean-François; Ullrich, Oliver; Reinecke, Manfred; Eppler, Elisabeth

    2016-01-26

    A role for GH and IGF-I in the modulation of the immune system has been under discussion for decades. Generally, GH is considered a stimulator of innate immune parameters in mammals and teleost fish. The stimulatory effects in humans as well as in bony fish often appear to be correlated with elevated endocrine IGF-I (liver-derived), which has also been shown to be suppressed during infection in some studies. Nevertheless, data are still fragmentary. Some studies point to an important role of GH and IGF-I particularly during immune organ development and constitution. Even less is known about the potential relevance of local (autocrine/paracrine) IGF-I within adult and developing immune organs, and the distinct localization of IGF-I in immune cells and tissues of mammals and fish has not been systematically defined. Thus far, IGF-I has been localized in different mammalian immune cell types, particularly macrophages and granulocytes, and in supporting cells, but not in T-lymphocytes. In the present study, we detected IGF-I in phagocytic cells isolated from rainbow trout head kidney and, in contrast to some findings in mammals, in T-cells of a channel catfish cell line. Thus, although numerous analogies among mammals and teleosts exist not only for the GH/IGF-system, but also for the immune system, there are differences that should be further investigated. For instance, it is unclear whether the primarily reported role of GH/IGF-I in the innate immune response is due to the lack of studies focusing on the adaptive immune system, or whether it truly preferentially concerns innate immune parameters. Infectious challenges in combination with GH/IGF-I manipulations are another important topic that has not been sufficiently addressed to date, particularly with respect to developmental and environmental influences on fish growth and health.

  18. Endocrine and Local IGF-I in the Bony Fish Immune System

    Directory of Open Access Journals (Sweden)

    Anne-Constance Franz

    2016-01-01

    Full Text Available A role for GH and IGF-I in the modulation of the immune system has been under discussion for decades. Generally, GH is considered a stimulator of innate immune parameters in mammals and teleost fish. The stimulatory effects in humans as well as in bony fish often appear to be correlated with elevated endocrine IGF-I (liver-derived, which has also been shown to be suppressed during infection in some studies. Nevertheless, data are still fragmentary. Some studies point to an important role of GH and IGF-I particularly during immune organ development and constitution. Even less is known about the potential relevance of local (autocrine/paracrine IGF-I within adult and developing immune organs, and the distinct localization of IGF-I in immune cells and tissues of mammals and fish has not been systematically defined. Thus far, IGF-I has been localized in different mammalian immune cell types, particularly macrophages and granulocytes, and in supporting cells, but not in T-lymphocytes. In the present study, we detected IGF-I in phagocytic cells isolated from rainbow trout head kidney and, in contrast to some findings in mammals, in T-cells of a channel catfish cell line. Thus, although numerous analogies among mammals and teleosts exist not only for the GH/IGF-system, but also for the immune system, there are differences that should be further investigated. For instance, it is unclear whether the primarily reported role of GH/IGF-I in the innate immune response is due to the lack of studies focusing on the adaptive immune system, or whether it truly preferentially concerns innate immune parameters. Infectious challenges in combination with GH/IGF-I manipulations are another important topic that has not been sufficiently addressed to date, particularly with respect to developmental and environmental influences on fish growth and health.

  19. Dermatology in the Darwin anniversary. Part 2: Evolution of the skin-associated immune system.

    Science.gov (United States)

    Wölfle, Ute; Martin, Stefan; Emde, Matthias; Schempp, Christoph

    2009-10-01

    The present review highlights the evolution of the skin-associated immune system from the invertebrates to the vertebrates and man. In the invertebrates a non-specific humoral immune response dominates. It includes antimicrobial peptides, oxidases, lysozyme, agglutinins, coagulins and melanin. The cellular immune system initially consists of undifferentiated mesenchymal stem cells. Later migrating phagocytes and natural killer cells occur. From the fishes on, dendritic cells are present, linking innate and adaptive immune responses. In addition to this unspecific but highly effective immune system, the specific immune response, based on genetic recombination, is present in the vertebrates starting with the chondral fishes. The adaptive immune system possesses unlimited numbers of highly specific antibodies and T-cell receptors, increasingly tissue specific MHC restriction, and cellular memory. Elements of the skin-associated adaptive immune system are first detectable in the teleost fishes in the form of intraepithelial IgM positive lymphocytes and dendritic cells. Moving up to mammals and man, the skin-associated immune system became more and more complex and effective.

  20. Oral supplementation with Lactobacillus delbrueckii subsp. bulgaricus 8481 enhances systemic immunity in elderly subjects.

    Science.gov (United States)

    Moro-García, Marco Antonio; Alonso-Arias, Rebeca; Baltadjieva, Maria; Fernández Benítez, Carlos; Fernández Barrial, Manuel Amadeo; Díaz Ruisánchez, Enrique; Alonso Santos, Ricardo; Alvarez Sánchez, Magdalena; Saavedra Miján, Juan; López-Larrea, Carlos

    2013-08-01

    Throughout life, there is an aging of the immune system that causes impairment of its defense capability. Prevention or delay of this deterioration is considered crucial to maintain general health and increase longevity. We evaluated whether dietary supplementation with Lactobacillus delbrueckii subsp. bulgaricus 8481 could enhance the immune response in the elderly. This multi-center, double-blind, and placebo controlled study enrolled 61 elderly volunteers who were randomly assigned to receive either placebo or probiotics. Each capsule of probiotics contained at least 3 × 10(7)  L. delbrueckii subsp. bulgaricus 8481. Individuals in the study were administered three capsules per day for 6 months. Blood samples were obtained at baseline (time 0), end of month 3, and month 6. We characterized cell subpopulations, measured cytokines by flow cytometry, quantified T cell receptor excision circle (TREC) by real-time PCR (RT-PCR), and determined human β-defensin-2 (hBD-2) concentrations and human cytomegalovirus (CMV) titers by enzyme-linked immunosorbent assay (ELISA). Elderly responded to the intake of probiotic with an increase in the percentage of NK cells, an improvement in the parameters defining the immune risk profile (IRP), and an increase in the T cell subsets that are less differentiated. The probiotic group also showed decreased concentrations of the pro-inflammatory cytokine IL-8 but increased antimicrobial peptide hBD-2. These effects disappeared within 6 months of stopping the probiotic intake. Immunomodulation induced by L. delbrueckii subsp. bulgaricus 8481 could favor the maintenance of an adequate immune response, mainly by slowing the aging of the T cell subpopulations and increasing the number of immature T cells which are potential responders to new antigens.

  1. The reaction of the immune system of fish to vaccination

    NARCIS (Netherlands)

    Lamers, C.H.J.

    1985-01-01

    The studies presented in this thesis deal with the effect of bacterial antigens of Yersinia ruckeri and Aeromonashydrophila on the immune system of carp. The antigens were administered by injection or by bath treatment. The effect on the immune system was studied by

  2. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    Science.gov (United States)

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  3. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    Directory of Open Access Journals (Sweden)

    Oana Marcu

    2011-01-01

    Full Text Available Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  4. The Mucosal Immune System of Teleost Fish

    Directory of Open Access Journals (Sweden)

    Irene Salinas

    2015-08-01

    Full Text Available Teleost fish possess an adaptive immune system associated with each of their mucosal body surfaces. Evidence obtained from mucosal vaccination and mucosal infection studies reveal that adaptive immune responses take place at the different mucosal surfaces of teleost. The main mucosa-associated lymphoid tissues (MALT of teleosts are the gut-associated lymphoid tissue (GALT, skin-associated lymphoid tissue (SALT, the gill-associated lymphoid tissue (GIALT and the recently discovered nasopharynx-associated lymphoid tissue (NALT. Teleost MALT includes diffuse B cells and T cells with specific phenotypes different from their systemic counterparts that have co-evolved to defend the microbe-rich mucosal environment. Both B and T cells respond to mucosal infection or vaccination. Specific antibody responses can be measured in the gills, gut and skin mucosal secretions of teleost fish following mucosal infection or vaccination. Rainbow trout studies have shown that IgT antibodies and IgT+ B cells are the predominant B cell subset in all MALT and respond in a compartmentalized manner to mucosal infection. Our current knowledge on adaptive immunity in teleosts is limited compared to the mammalian literature. New research tools and in vivo models are currently being developed in order to help reveal the great intricacy of teleost mucosal adaptive immunity and help improve mucosal vaccination protocols for use in aquaculture.

  5. The Role of the Immune System in Metabolic Health and Disease.

    Science.gov (United States)

    Zmora, Niv; Bashiardes, Stavros; Levy, Maayan; Elinav, Eran

    2017-03-07

    In addition to the immune system's traditional roles of conferring anti-infectious and anti-neoplastic protection, it has been recently implicated in the regulation of systemic metabolic homeostasis. This cross-talk between the immune and the metabolic systems is pivotal in promoting "metabolic health" throughout the life of an organism and plays fundamental roles in its adaptation to ever-changing environmental makeups and nutritional availability. Perturbations in this intricate immune-metabolic cross-talk contribute to the tendency to develop altered metabolic states that may culminate in metabolic disorders such as malnutrition, obesity, type 2 diabetes mellitus (T2DM), and other features of the metabolic syndrome. Regulators of immune-metabolic interactions include host genetics, nutritional status, and the intestinal microbiome. In this Perspective, we highlight current understanding of immune-metabolism interactions, illustrate differences among individuals and between populations in this respect, and point toward future avenues of research possibly enabling immune harnessing as means of personalized treatment for common metabolic disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. High-Density Lipoproteins and the Immune System

    Directory of Open Access Journals (Sweden)

    Hidesuke Kaji

    2013-01-01

    Full Text Available High-density lipoprotein (HDL plays a major role in vasodilation and in the reduction of low-density lipoprotein (LDL oxidation, inflammation, apoptosis, thrombosis, and infection; however, HDL is now less functional in these roles under certain conditions. This paper focuses on HDL, its anti-inflammation behavior, and the mechanisms by which HDL interacts with components of the innate and adaptive immune systems. Genome-wide association studies (GWAS and proteomic studies have elucidated important molecules involved in the interaction between HDL and the immune system. An understanding of these mechanisms is expected to be useful for the prevention and treatment of chronic inflammation due to metabolic syndrome, atherosclerosis, or various autoimmune diseases.

  7. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    Science.gov (United States)

    2006-07-06

    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  8. A mathematical model of radiation effect on the immunity system

    International Nuclear Information System (INIS)

    Smirnova, O.A.

    1984-01-01

    A mathematical model, simulating the effect of ionizing radiation on the dynamics of humoral immune reaction is suggested. It represents the system of nonlinear differential equations and is realized in the form of program in Fortran computer language. The model describes the primary immune reaction of nonirradiated organism on T-independent antigen, reflects the postradiation lymphopoiesis dynamics in nonimmunized mammals, simulates the processes of injury and recovery of the humoral immunity system under the combined effect of ionizing radiation and antigenic stimulation. The model can be used for forecasting imminity state in irradiated mammals

  9. Restimulation-induced T-cell death through NTB-A/SAP signaling pathway is impaired in tuberculosis patients with depressed immune responses.

    Science.gov (United States)

    Hernández Del Pino, Rodrigo E; Pellegrini, Joaquín M; Rovetta, Ana I; Peña, Delfina; Álvarez, Guadalupe I; Rolandelli, Agustín; Musella, Rosa M; Palmero, Domingo J; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E

    2017-09-01

    Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T- and B-cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25 high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T-cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype.

  10. Why the Immune System Should Be Concerned by Nanomaterials?

    Directory of Open Access Journals (Sweden)

    Marc J. Pallardy

    2017-05-01

    Full Text Available Particles possess huge specific surface area and therefore nanomaterials exhibit unique characteristics, such as special physical properties and chemical hyper-reactivity, which make them particularly attractive but also raise numerous questions concerning their safety. Interactions of nanomaterials with the immune system can potentially lead to immunosuppression, hypersensitivity (allergy, immunogenicity and autoimmunity, involving both innate and adaptive immune responses. Inherent physical and chemical NP characteristics may influence their immunotoxicity, i.e., the adverse effects that can result from exposure. This review will focus on the possible interaction of nanomaterials including protein aggregates with the innate immune system with specific emphasis on antigen-presenting cells, i.e., dendritic cells, macrophages and monocytes.

  11. [The role of protein glycosylation in immune system].

    Science.gov (United States)

    Ząbczyńska, Marta; Pocheć, Ewa

    2015-01-01

    Glycosylation is one of the most frequent post-translational modifications of proteins. The majority of cell surface and secreted proteins involved in immune response is glycosylated. The structural diversity of glycans depends on monosaccharide composition, type of glycosidic linkage and branching. These structural modifications determine a great variability of glycoproteins. The oligosaccharide components of proteins are regulated mostly by expression of glycosyltransferases and glycosidases and many environmental factors. Glycosylation influences the function of all immune cells. Glycans play a crucial role in intercellular contacts and leukocytes migration. These interactions are important in activation and proliferation of leukocytes and during immune response. The key immune proteins, such as TCR, MHC, TLR and antibodies are glycosylated. Sugars on the surface of pathogens and self-surface glycoproteins are recognized by special carbohydrate binding proteins called lectins. Changes of glycan structure are common in many pathological processes occurring in immune system, therefore they are used as molecular markers of different diseases.

  12. Web-based e-learning and virtual lab of human-artificial immune system.

    Science.gov (United States)

    Gong, Tao; Ding, Yongsheng; Xiong, Qin

    2014-05-01

    Human immune system is as important in keeping the body healthy as the brain in supporting the intelligence. However, the traditional models of the human immune system are built on the mathematics equations, which are not easy for students to understand. To help the students to understand the immune systems, a web-based e-learning approach with virtual lab is designed for the intelligent system control course by using new intelligent educational technology. Comparing the traditional graduate educational model within the classroom, the web-based e-learning with the virtual lab shows the higher inspiration in guiding the graduate students to think independently and innovatively, as the students said. It has been found that this web-based immune e-learning system with the online virtual lab is useful for teaching the graduate students to understand the immune systems in an easier way and design their simulations more creatively and cooperatively. The teaching practice shows that the optimum web-based e-learning system can be used to increase the learning effectiveness of the students.

  13. Perinatal Environmental Effects on the Neonatal Immune System

    DEFF Research Database (Denmark)

    Thysen, Anna Hammerich

    2014-01-01

    are thought to be programmed in utero supporting a role of the early environment. The aim of the present PhD thesis was to study if known risk factors are imprinted in the immune system of newborns. The hypotheses were that cesarean section and season of birth would influence the immune signature in early...... life. Both are known to be associated with disease. We analyzed the distribution of circulating immune cells from cord blood in the children part of the ongoing unselected COPSAC2010 birth cohort by multi-color flow cytometry. Moreover, airway mucosal cytokines and chemokines of 1-month-old children...

  14. The Neuromodulation of the Intestinal Immune System and Its Relevance in Inflammatory Bowel Disease.

    Science.gov (United States)

    Di Giovangiulio, Martina; Verheijden, Simon; Bosmans, Goele; Stakenborg, Nathalie; Boeckxstaens, Guy E; Matteoli, Gianluca

    2015-01-01

    One of the main tasks of the immune system is to discriminate and appropriately react to "danger" or "non-danger" signals. This is crucial in the gastrointestinal tract, where the immune system is confronted with a myriad of food antigens and symbiotic microflora that are in constant contact with the mucosa, in addition to any potential pathogens. This large number of antigens and commensal microflora, which are essential for providing vital nutrients, must be tolerated by the intestinal immune system to prevent aberrant inflammation. Hence, the balance between immune activation versus tolerance should be tightly regulated to maintain intestinal homeostasis and to prevent immune activation indiscriminately against all luminal antigens. Loss of this delicate equilibrium can lead to chronic activation of the intestinal immune response resulting in intestinal disorders, such as inflammatory bowel diseases (IBD). In order to maintain homeostasis, the immune system has evolved diverse regulatory strategies including additional non-immunological actors able to control the immune response. Accumulating evidence strongly indicates a bidirectional link between the two systems in which the brain modulates the immune response via the detection of circulating cytokines and via direct afferent input from sensory fibers and from enteric neurons. In the current review, we will highlight the most recent findings regarding the cross-talk between the nervous system and the mucosal immune system and will discuss the potential use of these neuronal circuits and neuromediators as novel therapeutic tools to reestablish immune tolerance and treat intestinal chronic inflammation.

  15. Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Wang, Yong [Department of Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Weng, Zhiping; Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Harrod, Kevin S. [Department of Anesthesiology and Perioperative Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S., E-mail: treena@uab.edu [Department of Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2016-10-01

    Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4{sup +/+} wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4{sup +/−} heterozygous mice. To confirm these observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca{sup ++} homeostasis. ATO induces Ca{sup ++}-dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca{sup ++} homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic. - Highlights: • ATF4 regulates arsenic-mediated impairment in macrophage functions. • Arsenic-mediated alterations in pulmonary macrophage are diminished in ATF4{sup +/−} mice

  16. Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Wang, Yong; Weng, Zhiping; Elmets, Craig A.; Harrod, Kevin S.; Deshane, Jessy S.; Athar, Mohammad

    2016-01-01

    Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4 +/+ wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4 +/− heterozygous mice. To confirm these observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca ++ homeostasis. ATO induces Ca ++ -dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca ++ homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic. - Highlights: • ATF4 regulates arsenic-mediated impairment in macrophage functions. • Arsenic-mediated alterations in pulmonary macrophage are diminished in ATF4 +/− mice. • Changes in macrophage

  17. The Microbiota, the Immune System and the Allograft

    Science.gov (United States)

    Alegre, Maria-Luisa; Mannon, Roslyn B.; Mannon, Peter J.

    2015-01-01

    The microbiota represents the complex collections of microbial communities that colonize a host. In health, the microbiota is essential for metabolism, protection against pathogens and maturation of the immune system. In return, the immune system determines the composition of the microbiota. Altered microbial composition (dysbiosis) has been correlated with a number of diseases in humans. The tight reciprocal immune/microbial interactions complicate determining whether dysbiosis is a cause and/or a consequence of immune dysregulation and disease initiation or progression. However, a number of studies in germ-free and antibiotic-treated animal models support causal roles for intestinal bacteria in disease susceptibility. The role of the microbiota in transplant recipients is only starting to be investigated and its study is further complicated by putative contributions of both recipient and donor microbiota. Moreover, both flora may be affected directly or indirectly by immunosuppressive drugs and anti-microbial prophylaxis taken by transplant patients, as well as by inflammatory processes secondary to ischemia/reperfusion and allorecognition, and the underlying cause of end-organ failure. Whether the ensuing dysbiosis affects alloresponses and whether therapies aimed at correcting dysbiosis should be considered in transplant patients constitutes an exciting new field of research. PMID:24840316

  18. Long-Range Activation of Systemic Immunity through Peptidoglycan Diffusion in Drosophila

    Science.gov (United States)

    Gendrin, Mathilde; Welchman, David P.; Poidevin, Mickael; Hervé, Mireille; Lemaitre, Bruno

    2009-01-01

    The systemic immune response of Drosophila is known to be induced both by septic injury and by oral infection with certain bacteria, and is characterized by the secretion of antimicrobial peptides (AMPs) into the haemolymph. To investigate other possible routes of bacterial infection, we deposited Erwinia carotovora (Ecc15) on various sites of the cuticle and monitored the immune response via expression of the AMP gene Diptericin. A strong response was observed to deposition on the genital plate of males (up to 20% of a septic injury response), but not females. We show that the principal response to genital infection is systemic, but that some AMPs, particularly Defensin, are induced locally in the genital tract. At late time points we detected bacteria in the haemolymph of immune deficient RelishE20 flies, indicating that the genital plate can be a route of entry for pathogens, and that the immune response protects flies against the progression of genital infection. The protective role of the immune response is further illustrated by our observation that RelishE20 flies exhibit significant lethality in response to genital Ecc15 infections. We next show that a systemic immune response can be induced by deposition of the bacterial elicitor peptidoglycan (PGN), or its terminal monomer tracheal cytotoxin (TCT), on the genital plate. This immune response is downregulated by PGRP-LB and Pirk, known regulators of the Imd pathway, and can be suppressed by the overexpression of PGRP-LB in the haemolymph compartment. Finally, we provide strong evidence that TCT can activate a systemic response by crossing epithelia, by showing that radiolabelled TCT deposited on the genital plate can subsequently be detected in the haemolymph. Genital infection is thus an intriguing new model for studying the systemic immune response to local epithelial infections and a potential route of entry for naturally occurring pathogens of Drosophila. PMID:20019799

  19. Keeping the immune system in check: a role for mitophagy.

    Science.gov (United States)

    Lazarou, Michael

    2015-01-01

    Mitochondria play a central role in many facets of cellular function including energy production, control of cell death and immune signaling. Breakdown of any of these pathways because of mitochondrial deficits or excessive reactive oxygen species production has detrimental consequences for immune system function and cell viability. Maintaining the functional integrity of mitochondria is therefore a critical challenge for the cell. Surveillance systems that monitor mitochondrial status enable the cell to identify and either repair or eliminate dysfunctional mitochondria. Mitophagy is a selective form of autophagy that eliminates dysfunctional mitochondria from the population to maintain overall mitochondrial health. This review covers the major players involved in mitophagy and explores the role mitophagy plays to support the immune system.

  20. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    Science.gov (United States)

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  1. Current understanding of interactions between nanoparticles and the immune system.

    Science.gov (United States)

    Dobrovolskaia, Marina A; Shurin, Michael; Shvedova, Anna A

    2016-05-15

    The delivery of drugs, antigens, and imaging agents benefits from using nanotechnology-based carriers. The successful translation of nanoformulations to the clinic involves thorough assessment of their safety profiles, which, among other end-points, includes evaluation of immunotoxicity. The past decade of research focusing on nanoparticle interaction with the immune system has been fruitful in terms of understanding the basics of nanoparticle immunocompatibility, developing a bioanalytical infrastructure to screen for nanoparticle-mediated immune reactions, beginning to uncover the mechanisms of nanoparticle immunotoxicity, and utilizing current knowledge about the structure-activity relationship between nanoparticles' physicochemical properties and their effects on the immune system to guide safe drug delivery. In the present review, we focus on the most prominent pieces of the nanoparticle-immune system puzzle and discuss the achievements, disappointments, and lessons learned over the past 15years of research on the immunotoxicity of engineered nanomaterials. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Local and systemic humoral immune response in farmed Atlantic salmon (Salmo salar L.) under a natural amoebic gill disease outbreak.

    Science.gov (United States)

    Marcos-López, Mar; Espinosa Ruiz, Cristóbal; Rodger, Hamish D; O'Connor, Ian; MacCarthy, Eugene; Esteban, M Ángeles

    2017-07-01

    Amoebic gill disease (AGD), caused by the protozoan parasite Neoparamoeba perurans, is one of the most significant infectious diseases for Atlantic salmon (Salmo salar L.) mariculture. The present study investigated the humoral immune response (both local in gill mucus and systemic in serum) of farmed Atlantic salmon naturally infected with N. perurans in commercial sea pens, at two different stages of the disease and after freshwater treatment. Parameters analysed included activity of immune related enzymes (i.e. lysozyme, peroxidase, protease, anti-protease, esterase, alkaline phosphatase), IgM levels, and the terminal carbohydrate profile in the gill mucus. Overall, greater variations between groups were noted in the immune parameters determined in gill mucus than the equivalent in the serum. In gill mucus, IgM levels and peroxidase, lysozyme, esterase and protease activities were decreased in fish showing longer exposure time to the infection and higher disease severity, then showed a sequential increase after treatment. Results obtained highlight the capacity of gills to elicit a local response to the infection, indicate an impaired immune response at the later stages of the disease, and show partial reestablishment of the host immune status after freshwater treatment. In addition to providing data on the humoral response to AGD, this study increases knowledge on gill mucosal humoral immunity, since some of the parameters were analysed for the first time in gill mucus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. RNA-Seq revealed the impairment of immune defence of tilapia against the infection of Streptococcus agalactiae with simulated climate warming.

    Science.gov (United States)

    Wang, Le; Liu, Peng; Wan, Zi Yi; Huang, Shu Qing; Wen, Yan Fei; Lin, Grace; Yue, Gen Hua

    2016-08-01

    Global warming is one of the causes of disease outbreaks in fishes. Understanding its mechanisms is critical in aquaculture and fisheries. We used tilapia to study the effects of a high temperature on the infection of a bacterial pathogen Streptococcus agalactiae using RNA-Seq. We found that the dissolved oxygen level in water at 32 °C is lower than at 22 °C, and tilapia infected with the pathogen died more rapidly at 32 °C. The gene expression profiles showed significant differences in fish raised under different conditions. We identified 126 and 576 differentially expressed genes (DEGs) at 4 and 24 h post infection at 22 °C, respectively, whereas at 32 °C, the data were 312 and 1670, respectively. Almost all responding pathways at 22 °C were involved in the immune responses, whereas at 32 °C, the enriched pathways were not only involved in immune responses but also involved in oxygen and energy metabolisms. We identified significant signals of immunosuppression of immune responses at 32 °C. In addition, many of the enriched transcription factors and DEGs under positive selection were involved in immune responses, oxygen and/or energy metabolisms. Our results suggest that global warming could reduce the oxygen level in water and impair the defence of tilapia against bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Hibernation : the immune system at rest?

    NARCIS (Netherlands)

    Bouma, Hjalmar R.; Carey, Hannah V.; Kroese, Frans G. M.

    2010-01-01

    Mammalian hibernation consists of torpor phases when metabolism is severely depressed, and T can reach as low as approximately -2 degrees C, interrupted by euthermic arousal phases. Hibernation affects the function of the innate and the adaptive immune systems. Torpor drastically reduces numbers of

  5. Immune System and Genetics: A Different Approach to the Diversity of Antibodies

    International Nuclear Information System (INIS)

    Matta Camacho, Nubia Estela

    2011-01-01

    It is common to find in immunology or genetic books a chapter entitled immune system and genetics; this association focuses on how the generation of antibodies broke the paradigm one gene, one protein, since in this case one gene generates millions of proteins. However, the immune system has many more links to genetics and heredity. For example, any substance or compound that an organism produces is a potential antigen, when it is recognized as foreign by the immune system of another organism from the same or different species. The proteins that are potentially antigenic are encoded by the individual's genotype. The ability of the immune system to respond to antigenic proteins, as well as the type and intensity of that response, are also correlated with the organism's genotype. In addition, deficiencies in the immune response may be associated with mutations or genetic polymorphisms, which result in susceptibility to infection diseases.

  6. Interactions between adipose tissue and the immune system in health and malnutrition.

    Science.gov (United States)

    Wensveen, Felix M; Valentić, Sonja; Šestan, Marko; Wensveen, Tamara Turk; Polić, Bojan

    2015-09-01

    Adipose tissue provides the body with a storage depot of nutrients that is drained during times of starvation and replenished when food sources are abundant. As such, it is the primary sensor for nutrient availability in the milieu of an organism, which it communicates to the body through the excretion of hormones. Adipose tissue regulates a multitude of body functions associated with metabolism, such as gluconeogenesis, feeding and nutrient uptake. The immune system forms a vital layer of protection against micro-organisms that try to gain access to the nutrients contained in the body. Because infections need to be resolved as quickly as possible, speed is favored over energy-efficiency in an immune response. Especially when immune cells are activated, they switch to fast, but energy-inefficient anaerobic respiration to fulfill their energetic needs. Despite the necessity for an effective immune system, it is not given free rein in its energy expenditure. Signals derived from adipose tissue limit immune cell numbers and activity under conditions of nutrient shortage, whereas they allow proper immune cell activity when food sources are sufficiently available. When excessive fat accumulation occurs, such as in diet-induced obesity, adipose tissue becomes the site of pathological immune cell activation, causing chronic low-grade systemic inflammation. Obesity is therefore associated with a number of disorders in which the immune system plays a central role, such as atherosclerosis and non-alcoholic steatohepatitis. In this review, we will discuss the way in which adipose tissue regulates activity of the immune system under healthy and pathological conditions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Complement anaphylatoxins as immune regulators in cancer.

    Science.gov (United States)

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-08-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  8. Role of the Immune System in Diabetic Kidney Disease.

    Science.gov (United States)

    Hickey, Fionnuala B; Martin, Finian

    2018-03-12

    The purpose of this review is to examine the proposed role of immune modulation in the development and progression of diabetic kidney disease (DKD). Diabetic kidney disease has not historically been considered an immune-mediated disease; however, increasing evidence is emerging in support of an immune role in its pathophysiology. Both systemic and local renal inflammation have been associated with DKD. Infiltration of immune cells, predominantly macrophages, into the kidney has been reported in a number of both experimental and clinical studies. In addition, increased levels of circulating pro-inflammatory cytokines have been linked to disease progression. Consequently, a variety of therapeutic strategies involving modulation of the immune response are currently being investigated in diabetic kidney disease. Although no current therapies for DKD are directly based on immune modulation many of the therapies in clinical use have anti-inflammatory effects along with their primary actions. Macrophages emerge as the most likely beneficial immune cell target and compounds which reduce macrophage infiltration to the kidney have shown potential in both animal models and clinical trials.

  9. Persisting injuries in immune system and their effects on health in a-bomb survivors

    International Nuclear Information System (INIS)

    Kusunoki, Yoichiro; Hayashi, Tomonori; Kyoizumi, Seishi

    2000-01-01

    This review describes findings concerning persisting effects of A-bomb radiation on immune cells and their relation to diseases. Injuries in immune system are mainly the depression of cellular immunity mediated by T-lymphocytes, especially CD4 T-cells, and the elevation of humoral immunity by B-cells. These are conceivably the imbalance results in immune system of incomplete recovery of those T-cells after exposure and thymus retraction by aging and of consequently affecting the functional differentiation of CD4 T-cells to lower the cellular immunity and to elevate the humoral immunity. Lowered cellular immunity in the survivors can be related to their liver and cardiovascular diseases caused by infection and cancer caused by tumor antigens and oncoviruses. Thus immunological investigations of the survivors are revealing not only the effect of radiation on the immune system but also the correlation between immunity and diseases. (K.H.)

  10. Persisting injuries in immune system and their effects on health in a-bomb survivors

    Energy Technology Data Exchange (ETDEWEB)

    Kusunoki, Yoichiro; Hayashi, Tomonori; Kyoizumi, Seishi [Radiation Effects Research Foundation, Hiroshima (Japan)

    2000-12-01

    This review describes findings concerning persisting effects of A-bomb radiation on immune cells and their relation to diseases. Injuries in immune system are mainly the depression of cellular immunity mediated by T-lymphocytes, especially CD4 T-cells, and the elevation of humoral immunity by B-cells. These are conceivably the imbalance results in immune system of incomplete recovery of those T-cells after exposure and thymus retraction by aging and of consequently affecting the functional differentiation of CD4 T-cells to lower the cellular immunity and to elevate the humoral immunity. Lowered cellular immunity in the survivors can be related to their liver and cardiovascular diseases caused by infection and cancer caused by tumor antigens and oncoviruses. Thus immunological investigations of the survivors are revealing not only the effect of radiation on the immune system but also the correlation between immunity and diseases. (K.H.)

  11. Impaired Cellular Immunity in the Murine Neural Crest Conditional Deletion of Endothelin Receptor-B Model of Hirschsprung's Disease.

    Directory of Open Access Journals (Sweden)

    Ankush Gosain

    Full Text Available Hirschsprung's disease (HSCR is characterized by aganglionosis from failure of neural crest cell (NCC migration to the distal hindgut. Up to 40% of HSCR patients suffer Hirschsprung's-associated enterocolitis (HAEC, with an incidence that is unchanged from the pre-operative to the post-operative state. Recent reports indicate that signaling pathways involved in NCC migration may also be involved in the development of secondary lymphoid organs. We hypothesize that gastrointestinal (GI mucosal immune defects occur in HSCR that may contribute to enterocolitis. EdnrB was deleted from the neural crest (EdnrBNCC-/- resulting in mutants with defective NCC migration, distal colonic aganglionosis and the development of enterocolitis. The mucosal immune apparatus of these mice was interrogated at post-natal day (P 21-24, prior to histological signs of enterocolitis. We found that EdnrBNCC-/- display lymphopenia of their Peyer's Patches, the major inductive site of GI mucosal immunity. EdnrBNCC-/- Peyer's Patches demonstrate decreased B-lymphocytes, specifically IgM+IgDhi (Mature B-lymphocytes, which are normally activated and produce IgA following antigen presentation. EdnrBNCC-/- animals demonstrate decreased small intestinal secretory IgA, but unchanged nasal and bronchial airway secretory IgA, indicating a gut-specific defect in IgA production or secretion. In the spleen, which is the primary source of IgA-producing Mature B-lymphocytes, EdnrBNCC-/- animals display decreased B-lymphocytes, but an increase in Mature B-lymphocytes. EdnrBNCC-/- spleens are also small and show altered architecture, with decreased red pulp and a paucity of B-lymphocytes in the germinal centers and marginal zone. Taken together, these findings suggest impaired GI mucosal immunity in EdnrBNCC-/- animals, with the spleen as a potential site of the defect. These findings build upon the growing body of literature that suggests that intestinal defects in HSCR are not restricted

  12. Memory and Specificity in the Insect Immune System: Current Perspectives and Future Challenges

    Directory of Open Access Journals (Sweden)

    Dustin Cooper

    2017-05-01

    Full Text Available The immune response of a host to a pathogen is typically described as either innate or adaptive. The innate form of the immune response is conserved across all organisms, including insects. Previous and recent research has focused on the nature of the insect immune system and the results imply that the innate immune response of insects is more robust and specific than previously thought. Priming of the insect innate immune system involves the exposure of insects to dead or a sublethal dose of microbes in order to elicit an initial response. Comparing subsequent infections in primed insects to non-primed individuals indicates that the insect innate immune response may possess some of the qualities of an adaptive immune system. Although some studies demonstrate that the protective effects of priming are due to a “loitering” innate immune response, others have presented more convincing elements of adaptivity. While an immune mechanism capable of producing the same degree of recognition specificity as seen in vertebrates has yet to be discovered in insects, a few interesting cases have been identified and discussed.

  13. Complement: a key system for immune surveillance and homeostasis.

    Science.gov (United States)

    Ricklin, Daniel; Hajishengallis, George; Yang, Kun; Lambris, John D

    2010-09-01

    Nearly a century after the significance of the human complement system was recognized, we have come to realize that its functions extend far beyond the elimination of microbes. Complement acts as a rapid and efficient immune surveillance system that has distinct effects on healthy and altered host cells and foreign intruders. By eliminating cellular debris and infectious microbes, orchestrating immune responses and sending 'danger' signals, complement contributes substantially to homeostasis, but it can also take action against healthy cells if not properly controlled. This review describes our updated view of the function, structure and dynamics of the complement network, highlights its interconnection with immunity at large and with other endogenous pathways, and illustrates its multiple roles in homeostasis and disease.

  14. Immune System and Its Link to Rheumatic Diseases

    Science.gov (United States)

    ... system, which contributes to the illness. So therapy targeting our own immune system can help alleviate the ... by the American College of Rheumatology Communications and Marketing Committee. This information is provided for general education ...

  15. Curcumin Prevents Acute Neuroinflammation and Long-Term Memory Impairment Induced by Systemic Lipopolysaccharide in Mice

    Directory of Open Access Journals (Sweden)

    Vincenzo Sorrenti

    2018-03-01

    Full Text Available Systemic lipopolysaccharide (LPS induces an acute inflammatory response in the central nervous system (CNS (“neuroinflammation” characterized by altered functions of microglial cells, the major resident immune cells of the CNS, and an increased inflammatory profile that can result in long-term neuronal cell damage and severe behavioral and cognitive consequences. Curcumin, a natural compound, exerts CNS anti-inflammatory and neuroprotective functions mainly after chronic treatment. However, its effect after acute treatment has not been well investigated. In the present study, we provide evidence that 50 mg/kg of curcumin, orally administered for 2 consecutive days before a single intraperitoneal injection of a high dose of LPS (5 mg/kg in young adult mice prevents the CNS immune response. Curcumin, able to enter brain tissue in biologically relevant concentrations, reduced acute and transient microglia activation, pro-inflammatory mediator production, and the behavioral symptoms of sickness. In addition, short-term treatment with curcumin, administered at the time of LPS challenge, anticipated the recovery from memory impairments observed 1 month after the inflammatory stimulus, when mice had completely recovered from the acute neuroinflammation. Together, these results suggest that the preventive effect of curcumin in inhibiting the acute effects of neuroinflammation could be of value in reducing the long-term consequences of brain inflammation, including cognitive deficits such as memory dysfunction.

  16. Hepatitis C, innate immunity and alcohol: friends or foes?

    Science.gov (United States)

    Osna, Natalia A; Ganesan, Murali; Kharbanda, Kusum K

    2015-02-05

    Hepatitis C and alcohol are the most widespread causes of liver disease worldwide. Approximately 80% of patients with a history of hepatitis C and alcohol abuse develop chronic liver injury. Alcohol consumption in hepatitis C virus (HCV)-infected patients exacerbates liver disease leading to rapid progression of fibrosis, cirrhosis and even hepatocellular carcinoma. Hepatocytes are the main sites of HCV-infection and ethanol metabolism, both of which generate oxidative stress. Oxidative stress levels affect HCV replication and innate immunity, resulting in a greater susceptibility for HCV-infection and virus spread in the alcoholic patients. In this review paper, we analyze the effects of ethanol metabolism and other factors on HCV replication. In addition, we illustrate the mechanisms of how HCV hijacks innate immunity and how ethanol exposure regulates this process. We also clarify the effects of HCV and ethanol metabolism on interferon signaling-a crucial point for activation of anti-viral genes to protect cells from virus-and the role that HCV- and ethanol-induced impairments play in adaptive immunity which is necessary for recognition of virally-infected hepatocytes. In conclusion, ethanol exposure potentiates the suppressive effects of HCV on innate immunity, which activates viral spread in the liver and finally, leads to impairments in adaptive immunity. The dysregulation of immune response results in impaired elimination of HCV-infected cells, viral persistence, progressive liver damage and establishment of chronic infection that worsens the outcomes of chronic hepatitis C in alcoholic patients.

  17. Hepatitis C, Innate Immunity and Alcohol: Friends or Foes?

    Directory of Open Access Journals (Sweden)

    Natalia A. Osna

    2015-02-01

    Full Text Available Hepatitis C and alcohol are the most widespread causes of liver disease worldwide. Approximately 80% of patients with a history of hepatitis C and alcohol abuse develop chronic liver injury. Alcohol consumption in hepatitis C virus (HCV-infected patients exacerbates liver disease leading to rapid progression of fibrosis, cirrhosis and even hepatocellular carcinoma. Hepatocytes are the main sites of HCV-infection and ethanol metabolism, both of which generate oxidative stress. Oxidative stress levels affect HCV replication and innate immunity, resulting in a greater susceptibility for HCV-infection and virus spread in the alcoholic patients. In this review paper, we analyze the effects of ethanol metabolism and other factors on HCV replication. In addition, we illustrate the mechanisms of how HCV hijacks innate immunity and how ethanol exposure regulates this process. We also clarify the effects of HCV and ethanol metabolism on interferon signaling—a crucial point for activation of anti-viral genes to protect cells from virus—and the role that HCV- and ethanol-induced impairments play in adaptive immunity which is necessary for recognition of virally-infected hepatocytes. In conclusion, ethanol exposure potentiates the suppressive effects of HCV on innate immunity, which activates viral spread in the liver and finally, leads to impairments in adaptive immunity. The dysregulation of immune response results in impaired elimination of HCV-infected cells, viral persistence, progressive liver damage and establishment of chronic infection that worsens the outcomes of chronic hepatitis C in alcoholic patients.

  18. Small and long regulatory RNAs in the immune system and immune diseases

    NARCIS (Netherlands)

    Stachurska, Anna; Zorro, Maria M.; van der Sijde, Marijke R.; Withoff, Sebo

    2014-01-01

    Cellular differentiation is regulated on the level of gene expression, and it is known that dysregulation of gene expression can lead to deficiencies in differentiation that contribute to a variety of diseases, particularly of the immune system. Until recently, it was thought that the dysregulation

  19. A benign helminth alters the host immune system and the gut microbiota in a rat model system.

    Directory of Open Access Journals (Sweden)

    Laura Wegener Parfrey

    Full Text Available Helminths and bacteria are major players in the mammalian gut ecosystem and each influences the host immune system and health. Declines in helminth prevalence and bacterial diversity appear to play a role in the dramatic rise of immune mediated inflammatory diseases (IMIDs in western populations. Helminths are potent modulators of immune system and their reintroduction is a promising therapeutic avenue for IMIDs. However, the introduction of helminths represents a disturbance for the host and it is important to understand the impact of helminth reintroduction on the host, including the immune system and gut microbiome. We tested the impact of a benign tapeworm, Hymenolepis diminuta, in a rat model system. We find that H. diminuta infection results in increased interleukin 10 gene expression in the beginning of the prepatent period, consistent with induction of a type 2 immune response. We also find induction of humoral immunity during the patent period, shown here by increased IgA in feces. Further, we see an immuno-modulatory effect in the small intestine and spleen in patent period, as measured by reductions in tissue immune cells. We observed shifts in microbiota community composition during the patent period (beta-diversity in response to H. diminuta infection. However, these compositional changes appear to be minor; they occur within families and genera common to both treatment groups. There was no change in alpha diversity. Hymenolepis diminuta is a promising model for helminth therapy because it establishes long-term, stable colonization in rats and modulates the immune system without causing bacterial dysbiosis. These results suggest that the goal of engineering a therapeutic helminth that can safely manipulate the mammalian immune system without disrupting the rest of the gut ecosystem is in reach.

  20. A benign helminth alters the host immune system and the gut microbiota in a rat model system.

    Science.gov (United States)

    Wegener Parfrey, Laura; Jirků, Milan; Šíma, Radek; Jalovecká, Marie; Sak, Bohumil; Grigore, Karina; Jirků Pomajbíková, Kateřina

    2017-01-01

    Helminths and bacteria are major players in the mammalian gut ecosystem and each influences the host immune system and health. Declines in helminth prevalence and bacterial diversity appear to play a role in the dramatic rise of immune mediated inflammatory diseases (IMIDs) in western populations. Helminths are potent modulators of immune system and their reintroduction is a promising therapeutic avenue for IMIDs. However, the introduction of helminths represents a disturbance for the host and it is important to understand the impact of helminth reintroduction on the host, including the immune system and gut microbiome. We tested the impact of a benign tapeworm, Hymenolepis diminuta, in a rat model system. We find that H. diminuta infection results in increased interleukin 10 gene expression in the beginning of the prepatent period, consistent with induction of a type 2 immune response. We also find induction of humoral immunity during the patent period, shown here by increased IgA in feces. Further, we see an immuno-modulatory effect in the small intestine and spleen in patent period, as measured by reductions in tissue immune cells. We observed shifts in microbiota community composition during the patent period (beta-diversity) in response to H. diminuta infection. However, these compositional changes appear to be minor; they occur within families and genera common to both treatment groups. There was no change in alpha diversity. Hymenolepis diminuta is a promising model for helminth therapy because it establishes long-term, stable colonization in rats and modulates the immune system without causing bacterial dysbiosis. These results suggest that the goal of engineering a therapeutic helminth that can safely manipulate the mammalian immune system without disrupting the rest of the gut ecosystem is in reach.

  1. Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints

    International Nuclear Information System (INIS)

    Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

    2015-01-01

    Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system—with its capacity for memory, exquisite specificity and central and universal role in human biology—immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer

  2. An Immune System Inspired Theory for Crime and Violence in Cities

    Directory of Open Access Journals (Sweden)

    Soumya Banerjee

    2017-06-01

    Full Text Available Crime is ubiquitous and has been around for millennia. Crime is analogous to a pathogenic infection and police response to it is similar to an immune response. The biological immune system is also engaged in an arms race with pathogens. We propose an immune system inspired theory of crime and violence in human societies, especially in large agglomerations like cities. In this work we suggest that an immune system inspired theory of crime can provide a new perspective on the dynamics of violence in societies. The competitive dynamics between police and criminals has similarities to how the immune system is involved in an arms race with invading pathogens. Cities have properties similar to biological organisms and in this theory the police and military forces would be the immune system that protects against detrimental internal and external forces. Our theory has implications for public policy: ranging from how much financial resource to invest in crime fighting, to optimal policing strategies, pre-placement of police, and number of police to be allocated to different cities. Our work can also be applied to other forms of violence in human societies (like terrorism and violence in other primate societies and eusocial insects. We hope this will be the first step towards a quantitative theory of violence and conflict in human societies. Ultimately we hope that this will help in designing smart and efficient cities that can scale and be sustainable despite population increase.

  3. Mind-Body Medicine and Immune System Outcomes: A Systematic Review.

    Science.gov (United States)

    Wahbeh, Helané; Haywood, Ashley; Kaufman, Karen; Zwickey, Heather

    2009-01-01

    This study is a systematic review of mind-body interventions that used immune outcomes in order to: 1) characterize mind-body medicine studies that assessed immune outcomes, 2) evaluate the quality of mind-body medicine studies measuring immune system effects, and 3) systematically evaluate the evidence for mind-body interventions effect on immune system outcomes using existing formal tools. 111 studies with 4,777 subjects were reviewed. The three largest intervention type categories were Relaxation Training (n=25), Cognitive Based Stress Management (n=22), and Hypnosis (n=21). Half the studies were conducted with healthy subjects (n=51). HIV (n=18), cancer (n=13) and allergies (n=7) were the most prominent conditions examined in the studies comprising of non-healthy subjects. Natural killer cell and CD4 T lymphocyte measures were the most commonly studied outcomes. Most outcome and modality categories had limited or inconclusive evidence. Relaxation training had the strongest scientific evidence of a mind-body medicine affecting immune outcomes. Immunoglobulin A had the strongest scientific evidence for positive effects from mind-body medicine. Issues for mind-body medicine studies with immune outcomes are discussed and recommendations are made to help improve future clinical trials.

  4. A Systems Vaccinology Approach Reveals Temporal Transcriptomic Changes of Immune Responses to the Yellow Fever 17D Vaccine.

    Science.gov (United States)

    Hou, Jue; Wang, Shuhui; Jia, Manxue; Li, Dan; Liu, Ying; Li, Zhengpeng; Zhu, Hong; Xu, Huifang; Sun, Meiping; Lu, Li; Zhou, Zhinan; Peng, Hong; Zhang, Qichen; Fu, Shihong; Liang, Guodong; Yao, Lena; Yu, Xuesong; Carpp, Lindsay N; Huang, Yunda; McElrath, Julie; Self, Steve; Shao, Yiming

    2017-08-15

    In this study, we used a systems vaccinology approach to identify temporal changes in immune response signatures to the yellow fever (YF)-17D vaccine, with the aim of comprehensively characterizing immune responses associated with protective immunity. We conducted a cohort study in which 21 healthy subjects in China were administered one dose of the YF-17D vaccine; PBMCs were collected at 0 h and then at 4 h and days 1, 2, 3, 5, 7, 14, 28, 84, and 168 postvaccination, and analyzed by transcriptional profiling and immunological assays. At 4 h postvaccination, genes associated with innate cell differentiation and cytokine pathways were dramatically downregulated, whereas receptor genes were upregulated, compared with their baseline levels at 0 h. Immune response pathways were primarily upregulated on days 5 and 7, accompanied by the upregulation of the transcriptional factors JUP, STAT1, and EIF2AK2. We also observed robust activation of innate immunity within 2 d postvaccination and a durable adaptive response, as assessed by transcriptional profiling. Coexpression network analysis indicated that lysosome activity and lymphocyte proliferation were associated with dendritic cell (DC) and CD4 + T cell responses; FGL2, NFAM1, CCR1, and TNFSF13B were involved in these associations. Moreover, individuals who were baseline-seropositive for Abs against another flavivirus exhibited significantly impaired DC, NK cell, and T cell function in response to YF-17D vaccination. Overall, our findings indicate that YF-17D vaccination induces a prompt innate immune response and DC activation, a robust Ag-specific T cell response, and a persistent B cell/memory B cell response. Copyright © 2017 by The American Association of Immunologists, Inc.

  5. [The role of immune system in the control of cancer development and growth].

    Science.gov (United States)

    Sütő, Gábor

    2016-06-01

    The role of immune system is the maintenace of the integritiy of the living organism. The elements of the immune system are connected by several ways forming a complex biological network. This network senses the changes of the inner and outer environment and works out the most effective response against infections and tumors. Dysfunction of the immune system leads to the development of cancer development and chronic inflammatory diseases. Modulation of the checkpoints of the immune system opened new perspecitves in the treatment of rheumatological and oncological diseases as well. Beside the potent antiinflammatory activity, new therapies are able to stimulate anticancer activity of the immune system. The result of these recent developments is a better outcome of malignant diseases, which had an unfavorable outcome in the past. Orv. Hetil., 2016, 157(Suppl. 2), 3-8.

  6. Gut Microbiota-Immune System Crosstalk and Pancreatic Disorders

    Directory of Open Access Journals (Sweden)

    D. Pagliari

    2018-01-01

    Full Text Available Gut microbiota is key to the development and modulation of the mucosal immune system. It plays a central role in several physiological functions, in the modulation of inflammatory signaling and in the protection against infections. In healthy states, there is a perfect balance between commensal and pathogens, and microbiota and the immune system interact to maintain gut homeostasis. The alteration of such balance, called dysbiosis, determines an intestinal bacterial overgrowth which leads to the disruption of the intestinal barrier with systemic translocation of pathogens. The pancreas does not possess its own microbiota, and it is believed that inflammatory and neoplastic processes affecting the gland may be linked to intestinal dysbiosis. Increasing research evidence testifies a correlation between intestinal dysbiosis and various pancreatic disorders, but it remains unclear whether dysbiosis is the cause or an effect. The analysis of specific alterations in the microbiome profile may permit to develop novel tools for the early detection of several pancreatic disorders, utilizing samples, such as blood, saliva, and stools. Future studies will have to elucidate the mechanisms by which gut microbiota is modulated and how it tunes the immune system, in order to be able to develop innovative treatment strategies for pancreatic disorders.

  7. Ubiquitin-specific Protease-7 Inhibition Impairs Tip60-dependent Foxp3+ T-regulatory Cell Function and Promotes Antitumor Immunity

    Directory of Open Access Journals (Sweden)

    Liqing Wang

    2016-11-01

    Full Text Available Foxp3+ T-regulatory (Treg cells are known to suppress protective host immune responses to a wide variety of solid tumors, but their therapeutic targeting is largely restricted to their transient depletion or “secondary” modulation, e.g. using anti-CTLA-4 monoclonal antibody. Our ongoing studies of the post-translational modifications that regulate Foxp3 demonstrated that the histone/protein acetyltransferase, Tip60, plays a dominant role in promoting acetylation, dimerization and function in Treg cells. We now show that the ubiquitin-specific protease, Usp7, controls Treg function largely by stabilizing the expression and promoting the multimerization of Tip60 and Foxp3. Genetic or pharmacologic targeting of Usp7 impairs Foxp3+ Treg suppressive functions, while conventional T cell responses remain intact. As a result, pharmacologic inhibitors of Usp7 can limit tumor growth in immunocompetent mice, and promote the efficacy of antitumor vaccines and immune checkpoint therapy with anti-PD1 monoclonal antibody in murine models. Hence, pharmacologic therapy with Usp7 inhibitors may have an important role in future cancer immunotherapy.

  8. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Spector, June T., E-mail: spectj@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); De Roos, Anneclaire J., E-mail: ajd335@drexel.edu [Epidemiology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Ulrich, Cornelia M., E-mail: neli.ulrich@nct-heidelberg.de [Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Cancer Prevention Program, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Sheppard, Lianne, E-mail: sheppard@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Biostatistics, School of Public Health, University of Washington, Seattle, WA (United States); Sjoedin, Andreas, E-mail: asjodin@cdc.gov [National Center for Environmental Health, CDC, 4770 Buford Highway NE, Atlanta, GA 30341 (United States); Wener, Mark H., E-mail: wener@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); Wood, Brent, E-mail: woodbl@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); and others

    2014-05-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  9. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    International Nuclear Information System (INIS)

    Spector, June T.; De Roos, Anneclaire J.; Ulrich, Cornelia M.; Sheppard, Lianne; Sjoedin, Andreas; Wener, Mark H.; Wood, Brent

    2014-01-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  10. Pattern dynamics of the reaction-diffusion immune system.

    Science.gov (United States)

    Zheng, Qianqian; Shen, Jianwei; Wang, Zhijie

    2018-01-01

    In this paper, we will investigate the effect of diffusion, which is ubiquitous in nature, on the immune system using a reaction-diffusion model in order to understand the dynamical behavior of complex patterns and control the dynamics of different patterns. Through control theory and linear stability analysis of local equilibrium, we obtain the optimal condition under which the system loses stability and a Turing pattern occurs. By combining mathematical analysis and numerical simulation, we show the possible patterns and how these patterns evolve. In addition, we establish a bridge between the complex patterns and the biological mechanism using the results from a previous study in Nature Cell Biology. The results in this paper can help us better understand the biological significance of the immune system.

  11. A role of the adaptive immune system in glucose homeostasis.

    Science.gov (United States)

    Bronsart, Laura L; Contag, Christopher H

    2016-01-01

    The immune system, including the adaptive immune response, has recently been recognized as having a significant role in diet-induced insulin resistance. In this study, we aimed to determine if the adaptive immune system also functions in maintaining physiological glucose homeostasis in the absence of diet-induced disease. SCID mice and immunocompetent control animals were phenotypically assessed for variations in metabolic parameters and cytokine profiles. Additionally, the glucose tolerance of SCID and immunocompetent control animals was assessed following introduction of a high-fat diet. SCID mice on a normal chow diet were significantly insulin resistant relative to control animals despite having less fat mass. This was associated with a significant increase in the innate immunity-stimulating cytokines granulocyte colony-stimulating factor, monocyte chemoattractant protein 1 (MCP1), and MCP3. Additionally, the SCID mouse phenotype was exacerbated in response to a high-fat diet as evidenced by the further significant progression of glucose intolerance. These results support the notion that the adaptive immune system plays a fundamental biological role in glucose homeostasis, and that the absence of functional B and T cells results in disruption in the concentrations of various cytokines associated with macrophage proliferation and recruitment. Additionally, the absence of functional B and T cells is not protective against diet-induced pathology.

  12. Influence of Melatonin on the Immune System of Fish: A Review

    Science.gov (United States)

    Esteban, M. Ángeles; Cuesta, Alberto; Chaves-Pozo, Elena; Meseguer, José

    2013-01-01

    Endocrine-immune system interactions have been widely demonstrated in mammals, whereas in fish, these relationships remain unclear. Of the organs that constitute the endocrine system, the pineal gland and its secretory product melatonin act in the synchronization of daily and seasonal rhythms in most vertebrates, including fish. Seasonal differences in immunocompetence and disease prevalence have been well documented in humans. Seasonality also strongly influences the life history of fish by controlling the timing of physiological events, such as reproduction, food intake, locomotor activity, and growth performance. Apart from its synchronizing capabilities, the role of melatonin in physiological processes in fish is not thoroughly understood. The purpose of this review is to summarize current studies on the effects of melatonin on the fish immune system. These studies suggest that melatonin represents an important component of fish endocrine-immune system interactions. The elucidation of the defense mechanisms of fish will facilitate the development of health management tools to support the growing finfish aquaculture industry as well as address questions concerning the origins and evolution of the immune system in vertebrates. PMID:23579958

  13. Geometric Distribution-Based Readers Scheduling Optimization Algorithm Using Artificial Immune System

    Directory of Open Access Journals (Sweden)

    Litian Duan

    2016-11-01

    Full Text Available In the multiple-reader environment (MRE of radio frequency identification (RFID system, multiple readers are often scheduled to interrogate the randomized tags via operating at different time slots or frequency channels to decrease the signal interferences. Based on this, a Geometric Distribution-based Multiple-reader Scheduling Optimization Algorithm using Artificial Immune System (GD-MRSOA-AIS is proposed to fairly and optimally schedule the readers operating from the viewpoint of resource allocations. GD-MRSOA-AIS is composed of two parts, where a geometric distribution function combined with the fairness consideration is first introduced to generate the feasible scheduling schemes for reader operation. After that, artificial immune system (including immune clone, immune mutation and immune suppression quickly optimize these feasible ones as the optimal scheduling scheme to ensure that readers are fairly operating with larger effective interrogation range and lower interferences. Compared with the state-of-the-art algorithm, the simulation results indicate that GD-MRSOA-AIS could efficiently schedules the multiple readers operating with a fairer resource allocation scheme, performing in larger effective interrogation range.

  14. The effect of ionizing radiation on immune system

    International Nuclear Information System (INIS)

    Gyuleva, I.

    1999-01-01

    Delayed radiation effects of irradiation at relatively high doses - 0.52- 2 Gy in result of severe accidents are discussed. The immune response of lymphocyte populations manifested in formation of different kind of mutant cells at Hiroshima-A-bombing and Chernobyl accident are presented. It is of great interest the hypothesis presented launched by RERF (Japanese Foundation for Radiation Effect Research, Hiroshima) for radiation induced predominant of T H2 -lymphocytes in comparison to T H1 as delayed immune response at the Hiroshima-A-bomb survivors. The aspect of immune status is quite different at low doses irradiation (0.02 - 0.2 Gy). There is some stimulation in immune response known as hormesis effect. It is suggested that T-cell activation has key role in immune system stimulation at doses under 0.2 Gy. There is also activation of DNA-reparation mechanisms. Suppression of the hypothalamus-hypophysis-suprarenal axis brings to enhancing of immune potential. Chinese people living in a region with three-times higher background radiation, X-ray examined patients as well as occupationally exposed personnel have been investigated. Radioprotective effect of some cytokines and their influence on the individual radiosensitivity are also discussed.The investigations have to be continued because of some inconsistent results

  15. Innate immune system and preeclampsia

    Directory of Open Access Journals (Sweden)

    Alejandra ePerez-Sepulveda

    2014-05-01

    Full Text Available Normal pregnancy is considered as a Th2 type immunological state that favors an immune-tolerance environment in order to prevent fetal rejection. PE has been classically described as a Th1/Th2 imbalance; however, the Th1/Th2 paradigm has proven insufficient to fully explain the functional and molecular changes observed during normal/pathological pregnancies. Recent studies have expanded the Th1/Th2 into a Th1⁄Th2⁄Th17 and regulatory T (Treg cells paradigm and where dendritic cells could have a crucial role. Recently, some evidence has emerged supporting the idea that mesenchymal stem cells might be part of the feto-maternal tolerance environment. This review will discuss the involvement of the innate immune system in the establishment of a physiological environment that favors pregnancy and possible alterations related to the development of preeclampsia.

  16. Organization of an optimal adaptive immune system

    Science.gov (United States)

    Walczak, Aleksandra; Mayer, Andreas; Balasubramanian, Vijay; Mora, Thierry

    The repertoire of lymphocyte receptors in the adaptive immune system protects organisms from a diverse set of pathogens. A well-adapted repertoire should be tuned to the pathogenic environment to reduce the cost of infections. I will discuss a general framework for predicting the optimal repertoire that minimizes the cost of infections contracted from a given distribution of pathogens. The theory predicts that the immune system will have more receptors for rare antigens than expected from the frequency of encounters and individuals exposed to the same infections will have sparse repertoires that are largely different, but nevertheless exploit cross-reactivity to provide the same coverage of antigens. I will show that the optimal repertoires can be reached by dynamics that describes the competitive binding of antigens by receptors, and selective amplification of stimulated receptors.

  17. Simple Smartphone-Based Guiding System for Visually Impaired People.

    Science.gov (United States)

    Lin, Bor-Shing; Lee, Cheng-Che; Chiang, Pei-Ying

    2017-06-13

    Visually impaired people are often unaware of dangers in front of them, even in familiar environments. Furthermore, in unfamiliar environments, such people require guidance to reduce the risk of colliding with obstacles. This study proposes a simple smartphone-based guiding system for solving the navigation problems for visually impaired people and achieving obstacle avoidance to enable visually impaired people to travel smoothly from a beginning point to a destination with greater awareness of their surroundings. In this study, a computer image recognition system and smartphone application were integrated to form a simple assisted guiding system. Two operating modes, online mode and offline mode, can be chosen depending on network availability. When the system begins to operate, the smartphone captures the scene in front of the user and sends the captured images to the backend server to be processed. The backend server uses the faster region convolutional neural network algorithm or the you only look once algorithm to recognize multiple obstacles in every image, and it subsequently sends the results back to the smartphone. The results of obstacle recognition in this study reached 60%, which is sufficient for assisting visually impaired people in realizing the types and locations of obstacles around them.

  18. Simple Smartphone-Based Guiding System for Visually Impaired People

    Directory of Open Access Journals (Sweden)

    Bor-Shing Lin

    2017-06-01

    Full Text Available Visually impaired people are often unaware of dangers in front of them, even in familiar environments. Furthermore, in unfamiliar environments, such people require guidance to reduce the risk of colliding with obstacles. This study proposes a simple smartphone-based guiding system for solving the navigation problems for visually impaired people and achieving obstacle avoidance to enable visually impaired people to travel smoothly from a beginning point to a destination with greater awareness of their surroundings. In this study, a computer image recognition system and smartphone application were integrated to form a simple assisted guiding system. Two operating modes, online mode and offline mode, can be chosen depending on network availability. When the system begins to operate, the smartphone captures the scene in front of the user and sends the captured images to the backend server to be processed. The backend server uses the faster region convolutional neural network algorithm or the you only look once algorithm to recognize multiple obstacles in every image, and it subsequently sends the results back to the smartphone. The results of obstacle recognition in this study reached 60%, which is sufficient for assisting visually impaired people in realizing the types and locations of obstacles around them.

  19. Comparative Genomics Reveals the Origins and Diversity of Arthropod Immune Systems.

    Science.gov (United States)

    Palmer, William J; Jiggins, Francis M

    2015-08-01

    Insects are an important model for the study of innate immune systems, but remarkably little is known about the immune system of other arthropod groups despite their importance as disease vectors, pests, and components of biological diversity. Using comparative genomics, we have characterized the immune system of all the major groups of arthropods beyond insects for the first time--studying five chelicerates, a myriapod, and a crustacean. We found clear traces of an ancient origin of innate immunity, with some arthropods having Toll-like receptors and C3-complement factors that are more closely related in sequence or structure to vertebrates than other arthropods. Across the arthropods some components of the immune system, such as the Toll signaling pathway, are highly conserved. However, there is also remarkable diversity. The chelicerates apparently lack the Imd signaling pathway and beta-1,3 glucan binding proteins--a key class of pathogen recognition receptors. Many genes have large copy number variation across species, and this may sometimes be accompanied by changes in function. For example, we find that peptidoglycan recognition proteins have frequently lost their catalytic activity and switch between secreted and intracellular forms. We also find that there has been widespread and extensive duplication of the cellular immune receptor Dscam (Down syndrome cell adhesion molecule), which may be an alternative way to generate the high diversity produced by alternative splicing in insects. In the antiviral short interfering RNAi pathway Argonaute 2 evolves rapidly and is frequently duplicated, with a highly variable copy number. Our results provide a detailed analysis of the immune systems of several important groups of animals for the first time and lay the foundations for functional work on these groups. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Controlling Cytomegalovirus: Helping the Immune System Take the Lead

    Directory of Open Access Journals (Sweden)

    Patrick J. Hanley

    2014-05-01

    Full Text Available Cytomegalovirus, of the Herpesviridae family, has evolved alongside humans for thousands of years with an intricate balance of latency, immune evasion, and transmission. While upwards of 70% of humans have evidence of CMV infection, the majority of healthy people show little to no clinical symptoms of primary infection and CMV disease is rarely observed during persistent infection in immunocompetent hosts. Despite the fact that the majority of infected individuals are asymptomatic, immunologically, CMV hijacks the immune system by infecting and remaining latent in antigen-presenting cells that occasionally reactivate subclinically and present antigen to T cells, eventually causing the inflation of CMV-specific T cells until they can compromise up to 10% of the entire T cell repertoire. Because of this impact on the immune system, as well as its importance in fields such as stem cell and organ transplant, the relationship between CMV and the immune response has been studied in depth. Here we provide a review of many of these studies and insights into how CMV-specific T cells are currently being used therapeutically.

  1. Role of the immune system in cardiac tissue damage and repair following myocardial infarction.

    Science.gov (United States)

    Saparov, Arman; Ogay, Vyacheslav; Nurgozhin, Talgat; Chen, William C W; Mansurov, Nurlan; Issabekova, Assel; Zhakupova, Jamilya

    2017-09-01

    The immune system plays a crucial role in the initiation, development, and resolution of inflammation following myocardial infarction (MI). The lack of oxygen and nutrients causes the death of cardiomyocytes and leads to the exposure of danger-associated molecular patterns that are recognized by the immune system to initiate inflammation. At the initial stage of post-MI inflammation, the immune system further damages cardiac tissue to clear cell debris. The excessive production of reactive oxygen species (ROS) by immune cells and the inability of the anti-oxidant system to neutralize ROS cause oxidative stress that further aggravates inflammation. On the other hand, the cells of both innate and adaptive immune system and their secreted factors are critically instrumental in the very dynamic and complex processes of regulating inflammation and mediating cardiac repair. It is important to decipher the balance between detrimental and beneficial effects of the immune system in MI. This enables us to identify better therapeutic targets for reducing the infarct size, sustaining the cardiac function, and minimizing the likelihood of heart failure. This review discusses the role of both innate and adaptive immune systems in cardiac tissue damage and repair in experimental models of MI.

  2. Hepatitis B virus surface antigen impairs myeloid dendritic cell function: a possible immune escape mechanism of hepatitis B virus

    Science.gov (United States)

    Op den Brouw, Marjoleine L; Binda, Rekha S; van Roosmalen, Mark H; Protzer, Ulrike; Janssen, Harry L A; van der Molen, Renate G; Woltman, Andrea M

    2009-01-01

    Chronic hepatitis B virus (HBV) infection is the result of an inadequate immune response towards the virus. Myeloid dendritic cells (mDC) of patients with chronic HBV are impaired in their maturation and function, resulting in more tolerogenic rather than immunogenic responses, which may contribute to viral persistence. The mechanism responsible for altered mDC function remains unclear. The HBV-infected patients display large amounts of HBV particles and viral proteins in their circulation, especially the surface antigen HBsAg, which allows multiple interactions between the virus, its viral proteins and DC. To assess whether HBV directly influences mDC function, the effects of HBV and HBsAg on human mDC maturation and function were investigated in vitro. As already described for internalization of HBV by DC, the present study shows that peripheral blood-derived mDC of healthy controls also actively take up HBsAg in a time-dependent manner. Cytokine-induced maturation in the presence of HBV or HBsAg resulted in a significantly more tolerogenic mDC phenotype as demonstrated by a diminished up-regulation of costimulatory molecules and a decreased T-cell stimulatory capacity, as assessed by T-cell proliferation and interferon-γ production. In addition, the presence of HBV significantly reduced interleukin-12 production by mDC. These results show that both HBV particles and purified HBsAg have an immune modulatory capacity and may directly contribute to the dysfunction of mDC in patients with chronic HBV. The direct immune regulatory effect of HBV and circulating HBsAg particles on the function of DC can be considered as part of the mechanism by which HBV escapes immunity. PMID:18624732

  3. Complement System Part II: Role in Immunity

    Science.gov (United States)

    Merle, Nicolas S.; Noe, Remi; Halbwachs-Mecarelli, Lise; Fremeaux-Bacchi, Veronique; Roumenina, Lubka T.

    2015-01-01

    The complement system has been considered for a long time as a simple lytic cascade, aimed to kill bacteria infecting the host organism. Nowadays, this vision has changed and it is well accepted that complement is a complex innate immune surveillance system, playing a key role in host homeostasis, inflammation, and in the defense against pathogens. This review discusses recent advances in the understanding of the role of complement in physiology and pathology. It starts with a description of complement contribution to the normal physiology (homeostasis) of a healthy organism, including the silent clearance of apoptotic cells and maintenance of cell survival. In pathology, complement can be a friend or a foe. It acts as a friend in the defense against pathogens, by inducing opsonization and a direct killing by C5b–9 membrane attack complex and by triggering inflammatory responses with the anaphylatoxins C3a and C5a. Opsonization plays also a major role in the mounting of an adaptive immune response, involving antigen presenting cells, T-, and B-lymphocytes. Nevertheless, it can be also an enemy, when pathogens hijack complement regulators to protect themselves from the immune system. Inadequate complement activation becomes a disease cause, as in atypical hemolytic uremic syndrome, C3 glomerulopathies, and systemic lupus erythematosus. Age-related macular degeneration and cancer will be described as examples showing that complement contributes to a large variety of conditions, far exceeding the classical examples of diseases associated with complement deficiencies. Finally, we discuss complement as a therapeutic target. PMID:26074922

  4. The role of the immune system in central nervous system plasticity after acute injury.

    Science.gov (United States)

    Peruzzotti-Jametti, Luca; Donegá, Matteo; Giusto, Elena; Mallucci, Giulia; Marchetti, Bianca; Pluchino, Stefano

    2014-12-26

    Acute brain injuries cause rapid cell death that activates bidirectional crosstalk between the injured brain and the immune system. In the acute phase, the damaged CNS activates resident and circulating immune cells via the local and systemic release of soluble mediators. This early immune activation is necessary to confine the injured tissue and foster the clearance of cellular debris, thus bringing the inflammatory reaction to a close. In the chronic phase, a sustained immune activation has been described in many CNS disorders, and the degree of this prolonged response has variable effects on spontaneous brain regenerative processes. The challenge for treating acute CNS damage is to understand how to optimally engage and modify these immune responses, thus providing new strategies that will compensate for tissue lost to injury. Herein we have reviewed the available information regarding the role and function of the innate and adaptive immune responses in influencing CNS plasticity during the acute and chronic phases of after injury. We have examined how CNS damage evolves along the activation of main cellular and molecular pathways that are associated with intrinsic repair, neuronal functional plasticity and facilitation of tissue reorganization. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Immunity to transplantable nitrosourea-induced neurogenic tumors. III. Systemic adoptive transfer of immunity

    International Nuclear Information System (INIS)

    Shibuya, N.; Hochgeschwender, U.; Kida, Y.; Hochwald, G.M.; Thorbecke, G.J.; Cravioto, H.

    1984-01-01

    The effect of intravenously injected tumor immune spleen cells on growth of 3 X 10 5 gliosarcoma T 9 cells injected intradermally (ID) or intracerebrally (IC) into sublethally irradiated CDF rats was evaluated. Spleen cells from donor rats with sufficient immunity to reject 5 X 10 5 T 9 cells inhibited the growth of T 9 cells mixed with spleen cells in a ratio of 1:25 and injected ID, but could not act after intravenous transfer. However, donor rats which had rejected increasing T 9 challenge doses up to 1 X 10 7 cells produced immune spleen cells which, upon IV transfer, could inhibit growth of ID T 9 challenge but not of EB-679, an unrelated glioma, in recipient rats. Rejection of IC T 9 challenge was also obtained after IV transfer, in recipients of such ''hyperimmune'' spleen cells, but was less (60% maximum) than that noted after ID T 9 challenge (100% maximum). The removal of B cells from the transferred spleen cells did not affect the results, suggesting that the specific immunity was mediated by T cells. The authors conclude that the special immunological circumstances of tumors growing in the brain renders them less accessible to rejection by systemically transferred immune cells, but it is nevertheless possible to effect a significant incidence of rejection of syngeneic tumor growth in the brain by the intravenous transfer of hyperimmune spleen cells

  6. Role of the immune system in regeneration and its dynamic interplay with adult stem cells.

    Science.gov (United States)

    Abnave, Prasad; Ghigo, Eric

    2018-04-09

    The immune system plays an indispensable role in the process of tissue regeneration following damage as well as during homeostasis. Inflammation and immune cell recruitment are signs of early onset injury. At the wound site, immune cells not only help to clear debris but also secrete numerous signalling molecules that induce appropriate cell proliferation and differentiation programmes essential for successful regeneration. However, the immune system does not always perform a complementary role in regeneration and several reports have suggested that increased inflammation can inhibit the regeneration process. Successful regeneration requires a balanced immune cell response, with the recruitment of accurately polarised immune cells in an appropriate quantity. The regulatory interactions of the immune system with regeneration are not unidirectional. Stem cells, as key players in regeneration, can also modulate the immune system in several ways to facilitate regeneration. In this review, we will focus on recent research demonstrating the key role of immune system in the regeneration process as well as the immunomodulatory effects of stem cells. Finally, we propose that research investigating the interplay between the immune system and stem cells within highly regenerating animals can benefit the identification of the key interactions and molecules required for successful regeneration. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. The eye: A window to the soul of the immune system.

    Science.gov (United States)

    Perez, V L; Saeed, A M; Tan, Y; Urbieta, M; Cruz-Guilloty, F

    2013-09-01

    The eye is considered as an immune privileged site, and with good reason. It has evolved a variety of molecular and cellular mechanisms that limit immune responses to preserve vision. For example, the cornea is mainly protected from autoimmunity by the lack of blood and lymphatic vessels, whereas the retina-blood barrier is maintained in an immunosuppressive state by the retinal pigment epithelium. However, there are several scenarios in which immune privilege is altered and the eye becomes susceptible to immune attack. In this review, we highlight the role of the immune system in two clinical conditions that affect the anterior and posterior segments of the eye: corneal transplantation and age-related macular degeneration. Interestingly, crosstalk between the innate and adaptive immune systems is critical in both acute and chronic inflammatory responses in the eye, with T cells playing a central role in combination with neutrophils and macrophages. In addition, we emphasize the advantage of using the eye as a model for in vivo longitudinal imaging of the immune system in action. Through this technique, it has been possible to identify functionally distinct intra-graft motility patterns of responding T cells, as well as the importance of chemokine signaling in situ for T cell activation. The detailed study of ocular autoimmunity could provide novel therapeutic strategies for blinding diseases while also providing more general information on acute versus chronic inflammation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. The Role of the Immune System in Obesity and Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Payal S. Patel

    2013-01-01

    Full Text Available The innate immune system provides organisms with rapid and well-coordinated protection from foreign pathogens. However, under certain conditions of metabolic dysfunction, components of the innate immune system may be activated in the absence of external pathogens, leading to pathologic consequences. Indeed, there appears to be an intimate relationship between metabolic diseases and immune dysfunction; for example, macrophages are prime players in the initiation of a chronic inflammatory state in obesity which leads to insulin resistance. In response to increases in free fatty acid release from obese adipose depots, M1-polarized macrophages infiltrate adipose tissues. These M1 macrophages trigger inflammatory signaling and stress responses within cells that signal through JNK or IKKβ pathways, leading to insulin resistance. If overnutrition persists, mechanisms that counteract inflammation (such as M2 macrophages and PPAR signaling are suppressed, and the inflammation becomes chronic. Although macrophages are a principal constituent of obese adipose tissue inflammation, other components of the immune system such as lymphocytes and mast cells also contribute to the inflammatory cascade. Thus it is not merely an increased mass of adipose tissue that directly leads to attenuation of insulin action, but rather adipose tissue inflammation activated by the immune system in obese individuals that leads to insulin resistance.

  9. The role of the immune system in neurofibromatosis type 1-associated nervous system tumors.

    Science.gov (United States)

    Karmakar, Souvik; Reilly, Karlyne M

    2017-01-01

    With the recent development of new anticancer therapies targeting the immune system, it is important to understand which immune cell types and cytokines play critical roles in suppressing or promoting tumorigenesis. The role of mast cells in promoting neurofibroma growth in neurofibromatosis type 1 (NF1) patients was hypothesized decades ago. More recent experiments in mouse models have demonstrated the causal role of mast cells in neurofibroma development and of microglia in optic pathway glioma development. We review here what is known about the role of NF1 mutation in immune cell function and the role of immune cells in promoting tumorigenesis in NF1. We also review the therapies targeting immune cell pathways and their promise in NF1 tumors.

  10. Systemic and Terminal Ileum Mucosal Immunity Elicited by Oral Immunization With the Ty21a Typhoid Vaccine in HumansSummary

    Directory of Open Access Journals (Sweden)

    Jayaum S. Booth

    2017-11-01

    Full Text Available Background & Aims: Systemic cellular immunity elicited by the Ty21a oral typhoid vaccine has been extensively characterized. However, very limited data are available in humans regarding mucosal immunity at the site of infection (terminal ileum [TI]. Here we investigated the host immunity elicited by Ty21a immunization on terminal ileum–lamina propria mononuclear cells (LPMC and peripheral blood in volunteers undergoing routine colonoscopy. Methods: We characterized LPMC-T memory (TM subsets and assessed Salmonella enterica serovar Typhi (S Typhi–specific responses by multichromatic flow cytometry. Results: No differences were observed in cell yields and phenotypes in LPMC CD8+-TM subsets following Ty21a immunization. However, Ty21a immunization elicited LPMC CD8+ T cells exhibiting significant S Typhi–specific responses (interferon-γ, tumor necrosis factor-α, interleukin-17A, and/or CD107a in all major TM subsets (T-effector/memory [TEM], T-central/memory, and TEM-CD45RA+, although each TM subset exhibited unique characteristics. We also investigated whether Ty21a immunization elicited S Typhi–specific multifunctional effectors in LPMC CD8+ TEM. We observed that LPMC CD8+ TEM responses were mostly multifunctional, except for those cells exhibiting the characteristics associated with cytotoxic responses. Finally, we compared mucosal with systemic responses and made the important observation that LPMC CD8+ S Typhi–specific responses were unique and distinct from their systemic counterparts. Conclusions: This study provides the first demonstration of S Typhi–specific responses in the human terminal ileum mucosa and provides novel insights into the generation of mucosal immune responses following oral Ty21a immunization. Keywords: Lamina Propria Mononuclear Cells, Multifunctional T Cells, CD8+-T Memory Cells, Typhoid, Vaccines

  11. Hopf bifurcation for tumor-immune competition systems with delay

    Directory of Open Access Journals (Sweden)

    Ping Bi

    2014-01-01

    Full Text Available In this article, a immune response system with delay is considered, which consists of two-dimensional nonlinear differential equations. The main purpose of this paper is to explore the Hopf bifurcation of a immune response system with delay. The general formula of the direction, the estimation formula of period and stability of bifurcated periodic solution are also given. Especially, the conditions of the global existence of periodic solutions bifurcating from Hopf bifurcations are given. Numerical simulations are carried out to illustrate the the theoretical analysis and the obtained results.

  12. Liver-inherent immune system: its role in blood-stage malaria.

    Science.gov (United States)

    Wunderlich, Frank; Al-Quraishy, Saleh; Dkhil, Mohamed A

    2014-01-01

    The liver is well known as that organ which is obligately required for the intrahepatocyte development of the pre-erythrocytic stages of the malaria-causative agent Plasmodium. However, largely neglected is the fact that the liver is also a central player of the host defense against the morbidity- and mortality-causing blood stages of the malaria parasites. Indeed, the liver is equipped with a unique immune system that acts locally, however, with systemic impact. Its main "antipodal" functions are to recognize and to generate effective immunoreactivity against pathogens on the one hand, and to generate tolerance to avoid immunoreactivity with "self" and harmless substances as dietary compounds on the other hand. This review provides an introductory survey of the liver-inherent immune system: its pathogen recognition receptors including Toll-like receptors (TLRs) and its major cell constituents with their different facilities to fight and eliminate pathogens. Then, evidence is presented that the liver is also an essential organ to overcome blood-stage malaria. Finally, we discuss effector responses of the liver-inherent immune system directed against blood-stage malaria: activation of TLRs, acute phase response, phagocytic activity, cytokine-mediated pro- and anti-inflammatory responses, generation of "protective" autoimmunity by extrathymic T cells and B-1 cells, and T cell-mediated repair of liver injuries mainly produced by malaria-induced overreactions of the liver-inherent immune system.

  13. The Bidirectional Relationship between Sleep and Immunity against Infections

    Directory of Open Access Journals (Sweden)

    Elizabeth G. Ibarra-Coronado

    2015-01-01

    Full Text Available Sleep is considered an important modulator of the immune response. Thus, a lack of sleep can weaken immunity, increasing organism susceptibility to infection. For instance, shorter sleep durations are associated with a rise in suffering from the common cold. The function of sleep in altering immune responses must be determined to understand how sleep deprivation increases the susceptibility to viral, bacterial, and parasitic infections. There are several explanations for greater susceptibility to infections after reduced sleep, such as impaired mitogenic proliferation of lymphocytes, decreased HLA-DR expression, the upregulation of CD14+, and variations in CD4+ and CD8+ T lymphocytes, which have been observed during partial sleep deprivation. Also, steroid hormones, in addition to regulating sexual behavior, influence sleep. Thus, we hypothesize that sleep and the immune-endocrine system have a bidirectional relationship in governing various physiological processes, including immunity to infections. This review discusses the evidence on the bidirectional effects of the immune response against viral, bacterial, and parasitic infections on sleep patterns and how the lack of sleep affects the immune response against such agents. Because sleep is essential in the maintenance of homeostasis, these situations must be adapted to elicit changes in sleep patterns and other physiological parameters during the immune response to infections to which the organism is continuously exposed.

  14. Regulation of TGFβ in the immune system: An emerging role for integrins and dendritic cells

    OpenAIRE

    Worthington, John J.; Fenton, Thomas M.; Czajkowska, Beata I.; Klementowicz, Joanna E.; Travis, Mark A.

    2012-01-01

    Regulation of an immune response requires complex crosstalk between cells of the innate and adaptive immune systems, via both cell?cell contact and secretion of cytokines. An important cytokine with a broad regulatory role in the immune system is transforming growth factor-? (TGF-?). TGF-? is produced by and has effects on many different cells of the immune system, and plays fundamental roles in the regulation of immune responses during homeostasis, infection and disease. Although many cells ...

  15. Engineering Plant Immunity via CRISPR/Cas13a System

    KAUST Repository

    Aljedaani, Fatimah R.

    2018-01-01

    systems function as an adaptive immune system to provide bacteria with resistance against invading phages and conjugative plasmids. Interestingly, CRISPR/Cas9 system was shown to interfere with eukaryotic DNA viruses and confer resistance against plant DNA

  16. Engineering Plant Immunity via CRISPR/Cas13a System

    KAUST Repository

    Aljedaani, Fatimah R.

    2018-05-01

    Viral diseases constitute a major threat to the agricultural production and food security throughout the world. Plants cope with the invading viruses by triggering immune responses and small RNA interference (RNAi) systems. In prokaryotes, CRISPR/Cas systems function as an adaptive immune system to provide bacteria with resistance against invading phages and conjugative plasmids. Interestingly, CRISPR/Cas9 system was shown to interfere with eukaryotic DNA viruses and confer resistance against plant DNA viruses. The majority of the plant viruses have RNA genomes. The aim of this study is to test the ability of the newly discovered CRISPR/Cas13a immune system, that targets and cleaves single stranded RNA (ssRNA) in prokaryotes, to provide resistance against RNA viruses in plants. Here, I employ the CRISPR/Cas13a system for molecular interference against Turnip Mosaic Virus (TuMV), a plant RNA virus. The results of this study established the CRISPR/Cas13a as a molecular interference machinery against RNA viruses in plants. Specifically, my data show that the CRISPR/Cas13a machinery is able to interfere with and degrade the TuMV (TuMV-GFP) RNA genome. In conclusion, these data indicate that the CRISPR/Cas13 systems can be employed for engineering interference and durable resistance against RNA viruses in diverse plant species.

  17. Mapping the Fetomaternal Peripheral Immune System at Term Pregnancy.

    Science.gov (United States)

    Fragiadakis, Gabriela K; Baca, Quentin J; Gherardini, Pier Federico; Ganio, Edward A; Gaudilliere, Dyani K; Tingle, Martha; Lancero, Hope L; McNeil, Leslie S; Spitzer, Matthew H; Wong, Ronald J; Shaw, Gary M; Darmstadt, Gary L; Sylvester, Karl G; Winn, Virginia D; Carvalho, Brendan; Lewis, David B; Stevenson, David K; Nolan, Garry P; Aghaeepour, Nima; Angst, Martin S; Gaudilliere, Brice L

    2016-12-01

    Preterm labor and infections are the leading causes of neonatal deaths worldwide. During pregnancy, immunological cross talk between the mother and her fetus is critical for the maintenance of pregnancy and the delivery of an immunocompetent neonate. A precise understanding of healthy fetomaternal immunity is the important first step to identifying dysregulated immune mechanisms driving adverse maternal or neonatal outcomes. This study combined single-cell mass cytometry of paired peripheral and umbilical cord blood samples from mothers and their neonates with a graphical approach developed for the visualization of high-dimensional data to provide a high-resolution reference map of the cellular composition and functional organization of the healthy fetal and maternal immune systems at birth. The approach enabled mapping of known phenotypical and functional characteristics of fetal immunity (including the functional hyperresponsiveness of CD4 + and CD8 + T cells and the global blunting of innate immune responses). It also allowed discovery of new properties that distinguish the fetal and maternal immune systems. For example, examination of paired samples revealed differences in endogenous signaling tone that are unique to a mother and her offspring, including increased ERK1/2, MAPK-activated protein kinase 2, rpS6, and CREB phosphorylation in fetal Tbet + CD4 + T cells, CD8 + T cells, B cells, and CD56 lo CD16 + NK cells and decreased ERK1/2, MAPK-activated protein kinase 2, and STAT1 phosphorylation in fetal intermediate and nonclassical monocytes. This highly interactive functional map of healthy fetomaternal immunity builds the core reference for a growing data repository that will allow inferring deviations from normal associated with adverse maternal and neonatal outcomes. Copyright © 2016 by The American Association of Immunologists, Inc.

  18. Distributed Computations Environment Protection Using Artificial Immune Systems

    Directory of Open Access Journals (Sweden)

    A. V. Moiseev

    2011-12-01

    Full Text Available In this article the authors describe possibility of artificial immune systems applying for distributed computations environment protection from definite types of malicious impacts.

  19. The Mucosal Immune System and Its Regulation by Autophagy.

    Science.gov (United States)

    Kabat, Agnieszka M; Pott, Johanna; Maloy, Kevin J

    2016-01-01

    The gastrointestinal tract presents a unique challenge to the mucosal immune system, which has to constantly monitor the vast surface for the presence of pathogens, while at the same time maintaining tolerance to beneficial or innocuous antigens. In the intestinal mucosa, specialized innate and adaptive immune components participate in directing appropriate immune responses toward these diverse challenges. Recent studies provide compelling evidence that the process of autophagy influences several aspects of mucosal immune responses. Initially described as a "self-eating" survival pathway that enables nutrient recycling during starvation, autophagy has now been connected to multiple cellular responses, including several aspects of immunity. Initial links between autophagy and host immunity came from the observations that autophagy can target intracellular bacteria for degradation. However, subsequent studies indicated that autophagy plays a much broader role in immune responses, as it can impact antigen processing, thymic selection, lymphocyte homeostasis, and the regulation of immunoglobulin and cytokine secretion. In this review, we provide a comprehensive overview of mucosal immune cells and discuss how autophagy influences many aspects of their physiology and function. We focus on cell type-specific roles of autophagy in the gut, with a particular emphasis on the effects of autophagy on the intestinal T cell compartment. We also provide a perspective on how manipulation of autophagy may potentially be used to treat mucosal inflammatory disorders.

  20. Inorganic nanoparticles and the immune system: detection, selective activation and tolerance

    Science.gov (United States)

    Bastús, Neus G.; Sánchez-Tilló, Ester; Pujals, Silvia; Comenge, Joan; Giralt, Ernest; Celada, Antonio; Lloberas, Jorge; Puntes, Victor F.

    2012-03-01

    The immune system is the responsible for body integrity and prevention of external invasion. On one side, nanoparticles are no triggers that the immune system is prepared to detect, on the other side it is known that foreign bodies, not only bacteria, viruses and parasites, but also inorganic matter, can cause various pathologies such as silicosis, asbestosis or inflammatory reactions. Therefore, nanoparticles entering the body, after interaction with proteins, will be either recognized as self-agents or detected by the immune system, encompassing immunostimulation or immunosuppression responses. The nature of these interactions seems to be dictated not specially by the composition of the material but by modifications of NP coating (composition, surface charge and structure). Herein, we explore the use of gold nanoparticles as substrates to carry multifunctional ligands to manipulate the immune system in a controlled manner, from undetection to immunostimulation. Murine bone marrow macrophages can be activated with artificial nanometric objects consisting of a gold nanoparticle functionalized with peptides. In the presence of some conjugates, macrophage proliferation was stopped and pro-inflammatory cytokines were induced. The biochemical type of response depended on the type of conjugated peptide and was correlated with the degree of ordering in the peptide coating. These findings help to illustrate the basic requirements involved in medical NP conjugate design to either activate the immune system or hide from it, in order to reach their targets before being removed by phagocytes. Additionally, it opens up the possibility to modulate the immune response in order to suppress unwanted responses resulting from autoimmunity, or allergy or to stimulate protective responses against pathogens.

  1. Triggering the adaptive immune system with commensal gut bacteria protects against insulin resistance and dysglycemia

    Directory of Open Access Journals (Sweden)

    Céline Pomié

    2016-06-01

    Full Text Available Objective: To demonstrate that glycemia and insulin resistance are controlled by a mechanism involving the adaptive immune system and gut microbiota crosstalk. Methods: We triggered the immune system with microbial extracts specifically from the intestinal ileum contents of HFD-diabetic mice by the process of immunization. 35 days later, immunized mice were fed a HFD for up to two months in order to challenge the development of metabolic features. The immune responses were quantified. Eventually, adoptive transfer of immune cells from the microbiota-immunized mice to naïve mice was performed to demonstrate the causality of the microbiota-stimulated adaptive immune system on the development of metabolic disease. The gut microbiota of the immunized HFD-fed mice was characterized in order to demonstrate whether the manipulation of the microbiota to immune system interaction reverses the causal deleterious effect of gut microbiota dysbiosis on metabolic disease. Results: Subcutaneous injection (immunization procedure of ileum microbial extracts prevented hyperglycemia and insulin resistance in a dose-dependent manner in response to a HFD. The immunization enhanced the proliferation of CD4 and CD8 T cells in lymphoid organs, also increased cytokine production and antibody secretion. As a mechanism explaining the metabolic improvement, the immunization procedure reversed gut microbiota dysbiosis. Finally, adoptive transfer of immune cells from immunized mice improved metabolic features in response to HFD. Conclusions: Glycemia and insulin sensitivity can be regulated by triggering the adaptive immunity to microbiota interaction. This reduces the gut microbiota dysbiosis induced by a fat-enriched diet. Keywords: Gut microbiota and metabolic diseases, Immunity, Insulin resistance

  2. Salmonella enterica Induces And Subverts The Plant Immune System

    Directory of Open Access Journals (Sweden)

    Ana Victoria Garcia

    2014-04-01

    Full Text Available Infections with Salmonella enterica belong to the most prominent causes of food poisoning and infected fruits and vegetables represent important vectors for salmonellosis. Whereas it was shown that plants raise defense responses against Salmonella, these bacteria persist and proliferate in various plant tissues. Recent reports shed light into the molecular interaction between plants and Salmonella, highlighting the defense pathways induced and the means used by the bacteria to escape the plant immune system and accomplish colonization. It was recently shown that plants detect Salmonella pathogen-associated molecular patterns (PAMPs, such as the flagellin peptide flg22, and activate hallmarks of the defense program known as PAMP-triggered immunity (PTI. Interestingly, certain Salmonella strains carry mutations in the flg22 domain triggering PTI, suggesting that a strategy of Salmonella is to escape plant detection by mutating PAMP motifs. Another strategy may rely on the type III secretion system (T3SS as T3SS mutants were found to induce stronger plant defense responses than wild type bacteria. Although Salmonella effector delivery into plant cells has not been shown, expression of Salmonella effectors in plant tissues shows that these bacteria also possess powerful means to manipulate the plant immune system. Altogether, the data gathered suggest that Salmonella triggers PTI in plants and evolved strategies to avoid or subvert plant immunity.

  3. Salmonella enterica induces and subverts the plant immune system

    KAUST Repository

    García, Ana V.

    2014-04-04

    Infections with Salmonella enterica belong to the most prominent causes of food poisoning and infected fruits and vegetables represent important vectors for salmonellosis. Although it was shown that plants raise defense responses against Salmonella, these bacteria persist and proliferate in various plant tissues. Recent reports shed light into the molecular interaction between plants and Salmonella, highlighting the defense pathways induced and the means used by the bacteria to escape the plant immune system and accomplish colonization. It was recently shown that plants detect Salmonella pathogen-associated molecular patterns (PAMPs), such as the flagellin peptide flg22, and activate hallmarks of the defense program known as PAMP-triggered immunity (PTI). Interestingly, certain Salmonella strains carry mutations in the flg22 domain triggering PTI, suggesting that a strategy of Salmonella is to escape plant detection by mutating PAMP motifs. Another strategy may rely on the type III secretion system (T3SS) as T3SS mutants were found to induce stronger plant defense responses than wild type bacteria. Although Salmonella effector delivery into plant cells has not been shown, expression of Salmonella effectors in plant tissues shows that these bacteria also possess powerful means to manipulate the plant immune system. Altogether, these data suggest that Salmonella triggers PTI in plants and evolved strategies to avoid or subvert plant immunity. 2014 Garca and Hirt.

  4. Retroviruses as tools to study the immune system.

    Science.gov (United States)

    Lois, C; Refaeli, Y; Qin, X F; Van Parijs, L

    2001-08-01

    Retrovirus-based vectors provide an efficient means to introduce and express genes in cells of the immune system and have become a popular tool to study immune function. They are easy to manipulate and provide stable, long-term gene expression because they integrate into the genome. Current retroviral vectors do have limitations that affect their usefulness in certain applications. However, recent advances suggest a number of ways in which these vectors might be improved to extend their utility in immunological research.

  5. Systemic Comorbidity in Children with Cataracts in Nigeria: Advocacy for Rubella Immunization

    Directory of Open Access Journals (Sweden)

    Roseline Duke

    2015-01-01

    Full Text Available Background. Congenital and developmental cataracts are leading causes of childhood blindness and severe visual impairment. They may be associated with systemic diseases including congenital heart diseases which are among the major causes of morbidity and mortality in childhood. The pattern of systemic comorbidities seen in children diagnosed with cataract in Calabar, Nigeria, was studied. Methods. A retrospective review was conducted on the children who had cataract surgery between 2011 and 2012. Diagnosis of the systemic condition was documented. Results. A total of 66 children were recruited for the study. Cardiac disease was seen in 26 children (39.9%, followed by delayed milestone in 16 (24.2%, intellectual disability in 14 (21.2%, deafness in 11 (16.7%, epilepsy in 4 (6.1%, and physical handicap in 3 (4.5% of them. Clinically confirmed Congenital Rubella Syndrome was seen in 30 (45% of the children. The pattern of CHD seen was as follows: patent ductus arteriosus in 16 (24.2% followed by ventricular-septal defect in 5 (7.6%, atrial-septal defect in 3 (4.5%, and pulmonary stenosis in 2 (3%. Conclusion. Systemic comorbidities, especially cardiac anomalies, are common among children with cataract in Nigeria. Congenital Rubella Syndrome may be a prominent cause of childhood cataract in our environment. Routine immunization of school girls against rubella is advocated as a measure to mitigate this trend.

  6. Role of immune system in type 1 diabetes mellitus pathogenesis.

    Science.gov (United States)

    Szablewski, Leszek

    2014-09-01

    The immune system is the body's natural defense system against invading pathogens. It protects the body from infection and works to communicate an individual's well-being through a complex network of interconnected cells and cytokines. This system is an associated host defense. An uncontrolled immune system has the potential to trigger negative complications in the host. Type 1 diabetes results from the destruction of pancreatic β-cells by a β-cell-specific autoimmune process. Examples of β-cell autoantigens are insulin, glutamic acid decarboxylase, tyrosine phosphatase, and insulinoma antigen. There are many autoimmune diseases, but type 1 diabetes mellitus is one of the well-characterized autoimmune diseases. The mechanisms involved in the β-cell destruction are still not clear; it is generally believed that β-cell autoantigens, macrophages, dendritic cells, B lymphocytes, and T lymphocytes are involved in the β-cell-specific autoimmune process. It is necessary to determine what exact factors are causing the immune system to become unregulated in such a manner as to promote an autoimmune response. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. The interplay between the immune system and chemotherapy: emerging methods for optimizing therapy.

    Science.gov (United States)

    Ghiringhelli, François; Apetoh, Lionel

    2014-01-01

    Preclinical studies have revealed an unexpected ability of the immune system to contribute to the success of chemotherapy and radiotherapy. Anticancer therapies can trigger immune system activation by promoting the release of danger signals from dying tumor cells and/or the elimination of immunosuppressive cells. We have, however, recently discovered that some chemotherapies, such as 5-fluorouracil and gemcitabine, exert conflicting effects on anticancer immune responses. Although 5-fluorouracil and Gem selectively eliminated myeloid-derived suppressive cells in tumor-bearing rodents, these chemotherapies promoted the release of IL-1β and the development of pro-angiogenic IL-17-producing CD4 T cells. The ambivalent effects of chemotherapy on immune responses should thus be carefully considered to design effective combination therapies based on chemotherapy and immune modulators. Herein, we discuss how the initial findings underscoring the key role of the immune system in mediating the antitumor efficacy of anticancer agents could begin to translate into effective therapies in humans.

  8. Influence of diabetes mellitus on immunity to human tuberculosis.

    Science.gov (United States)

    Kumar Nathella, Pavan; Babu, Subash

    2017-09-01

    Type 2 diabetes mellitus(DM) is a major risk factor for the development of active pulmonary tuberculosis (TB), with development of DM pandemic in countries where TB is also endemic. Understanding the impact of DM on TB and the determinants of co-morbidity is essential in responding to this growing public health problem with improved therapeutic approaches. Despite the clinical and public health significance posed by the dual burden of TB and DM, little is known about the immunological and biochemical mechanisms of susceptibility. One possible mechanism is that an impaired immune response in patients with DM facilitates either primary infection with Mycobacterium tuberculosis or reactivation of latent TB. Diabetes is associated with immune dysfunction and alterations in the components of the immune system, including altered levels of specific cytokines and chemokines. Some effects of DM on adaptive immunity that are potentially relevant to TB defence have been identified in humans. In this review, we summarize current findings regarding the alterations in the innate and adaptive immune responses and immunological mechanisms of susceptibility of patients with DM to M. tuberculosis infection and disease. © 2017 John Wiley & Sons Ltd.

  9. The Role of the Immune System in Autism Spectrum Disorder.

    Science.gov (United States)

    Meltzer, Amory; Van de Water, Judy

    2017-01-01

    Autism is a neurodevelopmental disorder characterized by deficits in communication and social skills as well as repetitive and stereotypical behaviors. While much effort has focused on the identification of genes associated with autism, research emerging within the past two decades suggests that immune dysfunction is a viable risk factor contributing to the neurodevelopmental deficits observed in autism spectrum disorders (ASD). Further, it is the heterogeneity within this disorder that has brought to light much of the current thinking regarding the subphenotypes within ASD and how the immune system is associated with these distinctions. This review will focus on the two main axes of immune involvement in ASD, namely dysfunction in the prenatal and postnatal periods. During gestation, prenatal insults including maternal infection and subsequent immunological activation may increase the risk of autism in the child. Similarly, the presence of maternally derived anti-brain autoantibodies found in ~20% of mothers whose children are at risk for developing autism has defined an additional subphenotype of ASD. The postnatal environment, on the other hand, is characterized by related but distinct profiles of immune dysregulation, inflammation, and endogenous autoantibodies that all persist within the affected individual. Further definition of the role of immune dysregulation in ASD thus necessitates a deeper understanding of the interaction between both maternal and child immune systems, and the role they have in diagnosis and treatment.

  10. Overview on experimental models of interactions between nanoparticles and the immune system.

    Science.gov (United States)

    Najafi-Hajivar, Saeedeh; Zakeri-Milani, Parvin; Mohammadi, Hamed; Niazi, Mehri; Soleymani-Goloujeh, Mehdi; Baradaran, Behzad; Valizadeh, Hadi

    2016-10-01

    Nanotechnology increasingly plays a significant role in modern medicine development. The clear benefits of using nanomaterials in various biomedical applications are often challenged by concerns about the lack of adequate data regarding their toxicity. Two decades of nanotoxicology research have shown that the interactions between nanoparticles (NPs) and biosystem are remarkably complex. This complexity derives from NPs' ability to bind and interact with biological cells and change their surface characteristics. One area of interest involves the interactions between NPs and the immune component. Immune system's function in the maintenance of tissue homeostasis is to protect the host from unfamiliar agents. This is done through effective surveillance and elimination of foreign substances and abnormal self cells from the body. Research shows that nanomaterials can stimulate and/or suppress the immune responses, and that their compatibility with the immune system is largely determined by their surface properties. NP size, shape, composition, protein binding and administration routes seem to be the main factors that contribute to the interactions of NPs with the immune system. In the present article, we focus on the relationship between effective physiochemical properties of NPs and their immunogenic effects. In addition, we review more details about immunological responses of different types of NPs. Understanding the interactions of nanomaterials with the immune system is essential for the engineering of new NP-based systems for medical applications. Copyright © 2016. Published by Elsevier Masson SAS.

  11. Effect of the novel influenza A (H1N1 virus in the human immune system.

    Directory of Open Access Journals (Sweden)

    Evangelos J Giamarellos-Bourboulis

    Full Text Available BACKGROUND: The pandemic by the novel H1N1 virus has created the need to study any probable effects of that infection in the immune system of the host. METHODOLOGY/PRINCIPAL FINDINGS: Blood was sampled within the first two days of the presentation of signs of infection from 10 healthy volunteers; from 18 cases of flu-like syndrome; and from 31 cases of infection by H1N1 confirmed by reverse RT-PCR. Absolute counts of subtypes of monocytes and of lymphocytes were determined after staining with monoclonal antibodies and analysis by flow cytometry. Peripheral blood mononuclear cells (PBMCs were isolated from patients and stimulated with various bacterial stimuli. Concentrations of tumour necrosis factor-alpha, interleukin (IL-1beta, IL-6, IL-18, interferon (FN-alpha and of IFN-gamma were estimated in supernatants by an enzyme immunoassay. Infection by H1N1 was accompanied by an increase of monocytes. PBMCs of patients evoked strong cytokine production after stimulation with most of bacterial stimuli. Defective cytokine responses were shown in response to stimulation with phytohemagglutin and with heat-killed Streptococcus pneumoniae. Adaptive immune responses of H1N1-infected patients were characterized by decreases of CD4-lymphocytes and of B-lymphocytes and by increase of T-regulatory lymphocytes (Tregs. CONCLUSIONS/SIGNIFICANCE: Infection by the H1N1 virus is accompanied by a characteristic impairment of the innate immune responses characterized by defective cytokine responses to S.pneumoniae. Alterations of the adaptive immune responses are predominated by increase of Tregs. These findings signify a predisposition for pneumococcal infections after infection by H1N1 influenza.

  12. Effect of the novel influenza A (H1N1) virus in the human immune system.

    Science.gov (United States)

    Giamarellos-Bourboulis, Evangelos J; Raftogiannis, Maria; Antonopoulou, Anastasia; Baziaka, Fotini; Koutoukas, Pantelis; Savva, Athina; Kanni, Theodora; Georgitsi, Marianna; Pistiki, Aikaterini; Tsaganos, Thomas; Pelekanos, Nikolaos; Athanassia, Sofia; Galani, Labrini; Giannitsioti, Efthymia; Kavatha, Dimitra; Kontopidou, Flora; Mouktaroudi, Maria; Poulakou, Garyfallia; Sakka, Vissaria; Panagopoulos, Periklis; Papadopoulos, Antonios; Kanellakopoulou, Kyriaki; Giamarellou, Helen

    2009-12-23

    The pandemic by the novel H1N1 virus has created the need to study any probable effects of that infection in the immune system of the host. Blood was sampled within the first two days of the presentation of signs of infection from 10 healthy volunteers; from 18 cases of flu-like syndrome; and from 31 cases of infection by H1N1 confirmed by reverse RT-PCR. Absolute counts of subtypes of monocytes and of lymphocytes were determined after staining with monoclonal antibodies and analysis by flow cytometry. Peripheral blood mononuclear cells (PBMCs) were isolated from patients and stimulated with various bacterial stimuli. Concentrations of tumour necrosis factor-alpha, interleukin (IL)-1beta, IL-6, IL-18, interferon (FN)-alpha and of IFN-gamma were estimated in supernatants by an enzyme immunoassay. Infection by H1N1 was accompanied by an increase of monocytes. PBMCs of patients evoked strong cytokine production after stimulation with most of bacterial stimuli. Defective cytokine responses were shown in response to stimulation with phytohemagglutin and with heat-killed Streptococcus pneumoniae. Adaptive immune responses of H1N1-infected patients were characterized by decreases of CD4-lymphocytes and of B-lymphocytes and by increase of T-regulatory lymphocytes (Tregs). Infection by the H1N1 virus is accompanied by a characteristic impairment of the innate immune responses characterized by defective cytokine responses to S.pneumoniae. Alterations of the adaptive immune responses are predominated by increase of Tregs. These findings signify a predisposition for pneumococcal infections after infection by H1N1 influenza.

  13. Role of microRNAs in the immune system, inflammation and cancer.

    Science.gov (United States)

    Raisch, Jennifer; Darfeuille-Michaud, Arlette; Nguyen, Hang Thi Thu

    2013-05-28

    MicroRNAs, a key class of gene expression regulators, have emerged as crucial players in various biological processes such as cellular proliferation and differentiation, development and apoptosis. In addition, microRNAs are coming to light as crucial regulators of innate and adaptive immune responses, and their abnormal expression and/or function in the immune system have been linked to multiple human diseases including inflammatory disorders, such as inflammatory bowel disease, and cancers. In this review, we discuss our current understanding of microRNAs with a focus on their role and mode of action in regulating the immune system during inflammation and carcinogenesis.

  14. Human immune system mouse models of Ebola virus infection.

    Science.gov (United States)

    Spengler, Jessica R; Prescott, Joseph; Feldmann, Heinz; Spiropoulou, Christina F

    2017-08-01

    Human immune system (HIS) mice, immunodeficient mice engrafted with human cells (with or without donor-matched tissue), offer a unique opportunity to study pathogens that cause disease predominantly or exclusively in humans. Several HIS mouse models have recently been used to study Ebola virus (EBOV) infection and disease. The results of these studies are encouraging and support further development and use of these models in Ebola research. HIS mice provide a small animal model to study EBOV isolates, investigate early viral interactions with human immune cells, screen vaccines and therapeutics that modulate the immune system, and investigate sequelae in survivors. Here we review existing models, discuss their use in pathogenesis studies and therapeutic screening, and highlight considerations for study design and analysis. Finally, we point out caveats to current models, and recommend future efforts for modeling EBOV infection in HIS mice. Published by Elsevier B.V.

  15. Organ system view of the hepatic innate immunity in HCV infection.

    Science.gov (United States)

    Bang, Bo-Ram; Elmasry, Sandra; Saito, Takeshi

    2016-12-01

    An orchestration of innate and adaptive immunity determines the infection outcome and whether the host achieves clearance or allows the pathogen to establish persistent infection. The robust activation of the innate immune response plays the most critical role in both limiting viral replication and halting the spread of the pathogen immediately after infection. The magnitude of innate immune activation is coupled with the efficient mounting of the adaptive immunity. Although immunity against HCV infection is known to be inadequate as most cases transitions to chronicity, approximately 25% of acute infection cases result in spontaneous clearance. The exact immune mechanisms that govern the infection outcome remain largely unknown; recent discoveries suggest that the innate immune system facilitates this event. Both infected hepatocytes and local innate immune cells trigger the front line defense program of the liver as well as the recruitment of diverse adaptive immune cells to the site of infection. Although hepatocyte is the target of HCV infection, nearly all cell types that exist in the liver are involved in the innate defense and contribute to the pathophysiology of hepatic inflammation. The main focus of this comprehensive review is to discuss the current knowledge on how each hepatic cell type contributes to the organ system level innate immunity against HCV infection as well as interplays with the viral evasion program. Furthermore, this review article also aims to synchronize the observations from both molecular biological studies and clinical studies with the ultimate goal of improving our understanding of HCV mediated hepatitis. J. Med. Virol. 88:2025-2037, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Improving vaccine registries through mobile technologies: a vision for mobile enhanced Immunization information systems.

    Science.gov (United States)

    Wilson, Kumanan; Atkinson, Katherine M; Deeks, Shelley L; Crowcroft, Natasha S

    2016-01-01

    Immunization registries or information systems are critical to improving the quality and evaluating the ongoing success of immunization programs. However, the completeness of these systems is challenged by a myriad of factors including the fragmentation of vaccine administration, increasing mobility of individuals, new vaccine development, use of multiple products, and increasingly frequent changes in recommendations. Mobile technologies could offer a solution, which mitigates some of these challenges. Engaging individuals to have more control of their own immunization information using their mobile devices could improve the timeliness and accuracy of data in central immunization information systems. Other opportunities presented by mobile technologies that could be exploited to improve immunization information systems include mobile reporting of adverse events following immunization, the capacity to scan 2D barcodes, and enabling bidirectional communication between individuals and public health officials. Challenges to utilizing mobile solutions include ensuring privacy of data, access, and equity concerns, obtaining consent and ensuring adoption of technology at sufficiently high rates. By empowering individuals with their own health information, mobile technologies can also serve as a mechanism to transfer immunization information as individuals cross local, regional, and national borders. Ultimately, mobile enhanced immunization information systems can help realize the goal of the individual, the healthcare provider, and public health officials always having access to the same immunization information. © The Author 2015. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Mechanisms for eco-immunity in a changing enviroment: how does the coral innate immune system contend with climate change?

    Science.gov (United States)

    Traylor-Knowles, N. G.

    2016-02-01

    Innate immunity plays a central role in maintaining homeostasis, and within the context of impending climate change scenarios, understanding how this system works is critical. However, the actual mechanisms involved in the evolution of the innate immune system are largely unknown. Cnidaria (including corals, sea anemones and jellyfish) are well suited for studying the fundamental functions of innate immunity because they share a common ancestor with bilaterians. This study will highlight the transcriptomic changes during a heat shock in the coral Acropora hyacinthus of American Samoa, examining the temporal changes, every half an hour for 5 hours. We hypothesize that genes involved in innate immunity, and extracellular matrix maintenance will be key components to the heat stress response. This presentation will highlight the novel role of the tumor necrosis factor receptor gene family as a responder to heat stress and present future directions for this developing field in coral reef research.

  18. Immune System Dysregulation and Herpesvirus Reactivation Persist During Long-Duration Spaceflight

    Science.gov (United States)

    Crucian, B. E.; Mehta, S.; Stowe, R. P.; Uchakin, P.; Quiriarte, H.; Pierson, D.; Sams, C. F.

    2011-01-01

    This poster presentation reviews a study that is designed to address immune system dysregulation and the risk to crewmembers in long duration exploration class missions. This study will address these objectives: (1) Determine the status of adaptive immunity physiological stress, viral immunity, latent herpesvirus reactivation in astronauts during 6 month missions to the International Space Station; (2) determine the clinical risk related to immune dysregulation for exploration class spaceflight; and (3) determine an appropriate monitoring strategy for spaceflight-associated immune dysfunction that could be used for the evaluation of countermeasures. The study anticipates 17 subjects, and for this presentation, (midpoint study data) 10 subjects are reviewed.

  19. The intersection of cancer, cancer stem cells, and the immune system: therapeutic opportunities.

    Science.gov (United States)

    Silver, Daniel J; Sinyuk, Maksim; Vogelbaum, Michael A; Ahluwalia, Manmeet S; Lathia, Justin D

    2016-02-01

    During brain neoplasia, malignant cells subjugate the immune system to provide an environment that favors tumor growth. These mechanisms capitalize on tumor-promoting functions of various immune cell types and typically result in suppression of tumor immune rejection. Immunotherapy efforts are underway to disrupt these mechanisms and turn the immune system against developing tumors. While many of these therapies are already in early-stage clinical trials, understanding how these therapies impact various tumor cell populations, including self-renewing cancer stem cells, may help to predict their efficacy and clarify their mechanisms of action. Moreover, interrogating the biology of glioma cell, cancer stem cell, and immune cell interactions may provide additional therapeutic targets to leverage against disease progression. In this review, we begin by highlighting a series of investigations into immune cell-mediated tumor promotion that do not parse the tumor into stem and non-stem components. We then take a closer look at the immune-suppressive mechanisms derived specifically from cancer stem cell interactions with the immune system and end with an update on immunotherapy and cancer stem cell-directed clinical trials in glioblastoma. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. [Environmental pollutants as adjuvant factors of immune system derived diseases].

    Science.gov (United States)

    Lehmann, Irina

    2017-06-01

    The main task of the immune system is to protect the body against invading pathogens. To be able to do so, immune cells must be able to recognize and combat exogenous challenges and at the same time tolerate body-borne structures. A complex regulatory network controls the sensitive balance between defense and tolerance. Perturbation of this network ultimately leads to the development of chronic inflammation, such as allergies, autoimmune reactions, and infections, because the immune system is no longer able to efficiently eliminate invading pathogens. Environmental pollutants can cause such perturbations by affecting the function of immune cells in such a way that they would react hypersensitively against allergens and the body's own structures, respectively, or that they would be no longer able to adequately combat pathogens. This indirect effect is also known as adjuvant effect. For pesticides, heavy metals, wood preservatives, or volatile organic compounds such adjuvant effects are well known. Examples of the mechanism by which environmental toxins contribute to chronic inflammatory diseases are manifold and will be discussed along asthma and allergies.While the immune system of healthy adults is typically well able to distinguish between foreign and endogenous substances even under adverse environmental conditions, that of children would react much more sensible upon comparable environmental challenges. To prevent priming for diseases by environmental cues during that highly sensitive period of early childhood children are to be particularly protected.

  1. Cyclic Dinucleotides in the Scope of the Mammalian Immune System.

    Science.gov (United States)

    Mankan, Arun K; Müller, Martina; Witte, Gregor; Hornung, Veit

    2017-01-01

    First discovered in prokaryotes and more recently in eukaryotes, cyclic dinucleotides (CDNs) constitute a unique branch of second messenger signaling systems. Within prokaryotes CDNs regulate a wide array of different biological processes, whereas in the vertebrate system CDN signaling is largely dedicated to activation of the innate immune system. In this book chapter we summarize the occurrence and signaling pathways of these small-molecule second messengers, most importantly in the scope of the mammalian immune system. In this regard, our main focus is the role of the cGAS-STING axis in the context of microbial infection and sterile inflammation and its implications for therapeutic applications.

  2. Diabetes mellitus and impairment of intestinal barier function

    OpenAIRE

    Hoffmanová, Iva

    2015-01-01

    Introduction: Impairment of intestinal barrier function is involved in pathogenesis of immune mediated diseases (such as type 1 diabetes mellitus or celiac disease) and metabolic diseases (such as type 2 diabetes mellitus). Aims of study: The first aim was to analyze impairment of mucosal part of intestinal barrier in both type of diabetes and to describe differences when compared to celiac disease, which is a typical condition associated with impairment of intestinal barrier function. The se...

  3. Increasing Hematopoietic Stem Cell Yield to Develop Mice with Human Immune Systems

    Directory of Open Access Journals (Sweden)

    Juan-Carlos Biancotti

    2013-01-01

    Full Text Available Hematopoietic stem cells (HSCs are unique in their capacity to give rise to all mature cells of the immune system. For years, HSC transplantation has been used for treatment of genetic and neoplastic diseases of the hematopoietic and immune systems. The sourcing of HSCs from human umbilical cord blood has salient advantages over isolation from mobilized peripheral blood. However, poor sample yield has prompted development of methodologies to expand HSCs ex vivo. Cytokines, trophic factors, and small molecules have been variously used to promote survival and proliferation of HSCs in culture, whilst strategies to lower the concentration of inhibitors in the culture media have recently been applied to promote HSC expansion. In this paper, we outline strategies to expand HSCs in vitro, and to improve engraftment and reconstitution of human immune systems in immunocompromised mice. To the extent that these “humanized” mice are representative of the endogenous human immune system, they will be invaluable tools for both basic science and translational medicine.

  4. Inside the mucosal immune system.

    Directory of Open Access Journals (Sweden)

    Jerry R McGhee

    Full Text Available An intricate network of innate and immune cells and their derived mediators function in unison to protect us from toxic elements and infectious microbial diseases that are encountered in our environment. This vast network operates efficiently by use of a single cell epithelium in, for example, the gastrointestinal (GI and upper respiratory (UR tracts, fortified by adjoining cells and lymphoid tissues that protect its integrity. Perturbations certainly occur, sometimes resulting in inflammatory diseases or infections that can be debilitating and life threatening. For example, allergies in the eyes, skin, nose, and the UR or digestive tracts are common. Likewise, genetic background and environmental microbial encounters can lead to inflammatory bowel diseases (IBDs. This mucosal immune system (MIS in both health and disease is currently under intense investigation worldwide by scientists with diverse expertise and interests. Despite this activity, there are numerous questions remaining that will require detailed answers in order to use the MIS to our advantage. In this issue of PLOS Biology, a research article describes a multi-scale in vivo systems approach to determine precisely how the gut epithelium responds to an inflammatory cytokine, tumor necrosis factor-alpha (TNF-α, given by the intravenous route. This article reveals a previously unknown pathway in which several cell types and their secreted mediators work in unison to prevent epithelial cell death in the mouse small intestine. The results of this interesting study illustrate how in vivo systems biology approaches can be used to unravel the complex mechanisms used to protect the host from its environment.

  5. [Saccharomyces boulardii CNCM I-745 influences the gut-associated immune system].

    Science.gov (United States)

    Stier, Heike; Bischoff, Stephan C

    2017-06-01

    The impact of the intestinal microbiome is increasing steadily with regard to the immune function und the defense against pathogens. The medicinal yeast Saccharomyces boulardii CNCM I-745 (S. boulardii) has been used as probiotic for the prevention and treatment of infectious diarrhea since more than 50 years. Meta-analyses confirm the clinical efficacy of S. boulardii to treat diarrhea of various origins in children and adults. This review article summarizes experimental studies on molecular and immunological mechanisms which explain the proven clinical efficacy of S. boulardii. Thereby the focus is on the gut-associated immune system. S. boulardii stimulates the release of immunoglobulins and cytokines and also induces the maturation of immune cells. This suggests that S. boulardii is capable of activating the unspecific immune system. In case of an infection, S. boulardii is able to bind pathogenic bacteria and to neutralize their toxins. Moreover, the medicinal yeast can attenuate the overreacting inflammatory immune response, by interfering with the signaling cascade, which is induced by the infection, and that way influences the innate and adaptive immune system. Thanks to these mechanisms the pathogens' potential of adhesion is lessened. Thus the intestinal epithelial layer is protected and diarrhea-induced fluid loss is reduced. The different molecular and immunological mechanisms investigated in the experimental studies prove the already confirmed very good clinical efficacy of S. boulardii in infectious diarrhea caused by pathogens such as bacteria, viruses, and fungi.

  6. Crosstalk between Platelets and the Immune System: Old Systems with New Discoveries

    Directory of Open Access Journals (Sweden)

    Conglei Li

    2012-01-01

    Full Text Available Platelets are small anucleate cells circulating in the blood. It has been recognized for more than 100 years that platelet adhesion and aggregation at the site of vascular injury are critical events in hemostasis and thrombosis; however, recent studies demonstrated that, in addition to these classic roles, platelets also have important functions in inflammation and the immune response. Platelets contain many proinflammatory molecules and cytokines (e.g., P-selectin, CD40L, IL-1β, etc., which support leukocyte trafficking, modulate immunoglobulin class switch, and germinal center formation. Platelets express several functional Toll-like receptors (TLRs, such as TLR-2, TLR-4, and TLR-9, which may potentially link innate immunity with thrombosis. Interestingly, platelets also contain multiple anti-inflammatory molecules and cytokines (e.g., transforming growth factor-β and thrombospondin-1. Emerging evidence also suggests that platelets are involved in lymphatic vessel development by directly interacting with lymphatic endothelial cells through C-type lectin-like receptor 2. Besides the active contributions of platelets to the immune system, platelets are passively targeted in several immune-mediated diseases, such as autoimmune thrombocytopenia, infection-associated thrombocytopenia, and fetal and neonatal alloimmune thrombocytopenia. These data suggest that platelets are important immune cells and may contribute to innate and adaptive immunity under both physiological and pathological conditions.

  7. Studying the Impact of Spaceflight Environment on Immune Functions Using New Molecular Diagnostics System

    Science.gov (United States)

    Cohen, Luchino

    Immune functions are altered during space flights. Latent virus reactivation, reduction in the number of immune cells, decreased cell activation and increased sensitivity of astronauts to infections following their return on Earth demonstrate that the immune system is less efficient during space flight. The causes of this immune deficiency are not fully understood and this dysfunction during long-term missions could result in the appearance of opportunistic infections or a decrease in the immuno-surveillance mechanisms that eradicate cancer cells. Therefore, the immune functions of astronauts will have to be monitored continuously during long-term missions in space, using miniature and semi-automated diagnostic systems. The objectives of this project are to study the causes of space-related immunodeficiency, to develop countermeasures to maintain an optimal immune function and to improve our capacity to detect infectious diseases during space missions through the monitoring of astronauts' immune system. In order to achieve these objectives, an Immune Function Diagnostic System (IFDS) will be designed to perform a set of immunological assays on board spacecrafts or on planet-bound bases. Through flow cytometric assays and molecular biology analyses, this diagnostic system could improve medical surveillance of astronauts and could be used to test countermeasures aimed at preventing immune deficiency during space missions. The capacity of the instrument to assess cellular fluorescence and to quantify the presence of soluble molecules in biological samples would support advanced molecular studies in space life sciences. Finally, such diagnostic system could also be used on Earth in remote areas or in mobile hospitals following natural disasters to fight against infectious diseases and other pathologies.

  8. Dynamic route guidance algorithm based algorithm based on artificial immune system

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    To improve the performance of the K-shortest paths search in intelligent traffic guidance systems,this paper proposes an optimal search algorithm based on the intelligent optimization search theory and the memphor mechanism of vertebrate immune systems.This algorithm,applied to the urban traffic network model established by the node-expanding method,can expediently realize K-shortest paths search in the urban traffic guidance systems.Because of the immune memory and global parallel search ability from artificial immune systems,K shortest paths can be found without any repeat,which indicates evidently the superiority of the algorithm to the conventional ones.Not only does it perform a better parallelism,the algorithm also prevents premature phenomenon that often occurs in genetic algorithms.Thus,it is especially suitable for real-time requirement of the traffic guidance system and other engineering optimal applications.A case study verifies the efficiency and the practicability of the algorithm aforementioned.

  9. Potential immunotoxic effects of trichloroethylene-induced IV allergic reaction in renal impairment

    Directory of Open Access Journals (Sweden)

    Jun-Feng Yu

    2017-08-01

    Full Text Available Trichloroethylene (TCE is known to induce allergic contact dermatitis and subsequent occupational medicamentosa-like dermatitis (OMLD with multi-system injuries, including liver, kidney, and skin injuries. However, the mechanisms underlying immune system dysfunction that result in organ injury have not yet been clearly elucidated. In the present study, we measured the levels of secreted cytokines by effect or T cells in TCE-treated guinea pigs to better understand the contribution of allergic disorders in renal injuries. We immunized guinea pigs with trichloroethylene using the Guinea Pig Maximization Test (GPMT and scored the inflammation on the guinea pigs’ skin. The kidney function and ultra-structural changes in the kidneys were detected using biochemical methods and electron microscopy. The deposition of cytokines was determined using immunohistochemistry. The sensitization rate was 63.16% in the TCE-sensitized groups. The electron microscopy results showed tubular epithelial cell mitochondrial swelling, vacuolar degeneration, and atrophy of the microvillus in the sensitized groups. A high degree of cytokine deposition was observed in the renal tubular proximal epithelial cells in the TCE-sensitized groups. As observed in this study, the variation in the level of immune system activation not only indicates that TCE can largely magnify the immune reaction but also suggests a potential role of immune dysfunction in renal impairment.

  10. Physical activity influences the immune system of breast cancer patients

    Directory of Open Access Journals (Sweden)

    Thorsten Schmidt

    2017-01-01

    Full Text Available It has been suggested that physical activity in breast cancer patients can not only improve quality of life. Influences on physical and psychological levels have been evaluated, but effects on the immune system of breast cancer patients are hardly known. A PubMed search identified relevant trials and meta-analyses from 1970 to 2013. This review summarizes the results of international studies and the current discussion of effects of physical activity on the immune system of breast cancer patients. Highlighted are effects of physical activity on the immune system. Seven original articles and 14 reviews included in this review. Two original and the review articles includes other tumor entities besides breast cancer.Evaluated methods such as dose-response relationships for exercise in oncology, hardly exist. Increased immunological anti-cancer activity due to physical activity is probably mediated via an increase in number and cytotoxicity of monocytes and natural killer cells and cytokines.

  11. Immunization Information Systems: A Decade of Progress in Law and Policy

    Science.gov (United States)

    Martin, Daniel W.; Lowery, N. Elaine; Brand, Bill; Gold, Rebecca; Horlick, Gail

    2015-01-01

    This article reports on a study of laws, regulations, and policies governing Immunization Information Systems (IIS, also known as “immunization registries”) in states and selected urban areas of the United States. The study included a search of relevant statutes, administrative codes and published attorney general opinions/findings, an online questionnaire completed by immunization program managers and/or their staff, and follow-up telephone interviews. The legal/regulatory framework for IIS has changed considerably since 2000, largely in ways that improve IIS’ ability to perform their public health functions while continuing to maintain strict confidentiality and privacy controls. Nevertheless, the exchange of immunization data and other health information between care providers and public health and between entities in different jurisdictions remains difficult due in part to ongoing regulatory diversity. To continue to be leaders in health information exchange and facilitate immunization of children and adults, IIS will need to address the challenges presented by the interplay of federal and state legislation, regulations, and policies and continue to move toward standardized data collection and sharing necessary for interoperable systems. PMID:24402434

  12. Ganoderma atrum polysaccharide improves age-related oxidative stress and immune impairment in mice.

    Science.gov (United States)

    Li, Wen-Juan; Nie, Shao-Ping; Peng, Xiao-Ping; Liu, Xiao-Zhen; Li, Chang; Chen, Yi; Li, Jing-En; Song, Wan-Rui; Xie, Ming-Yong

    2012-02-15

    The aim of the present study was to investigate whether oxidative stress and immune dysfunction could be attenuated by Ganoderma atrum polysaccharide (PSG-1) in d-galactose (d-gal)-induced aging mice, and provide evidence for its effects. The results showed that PSG-1 significantly decreased lipid peroxidation in liver, brain, and spleen, but concomitantly increased the activities of superoxide dismutase, catalase, and glutathione peroxidase compared with the d-gal group. Elevation of glutathione contents and attenuation of glutathione disulfide contents were also found in PSG-1-treated animals. Furthermore, the results showed that PSG-1 treatment increased basal lymphocyte proliferation as well as T cell and B cell proliferation and enhanced interleukin-2 production. Taken together, the results suggested that PSG-1 had potential as a novel agent to promote health and improve aging-associated pathologies, at least in part, via modification of the redox system and improvement of immune function.

  13. The effects of stress hormones on immune function may be vital for the adaptive reconfiguration of the immune system during fight-or-flight behavior.

    Science.gov (United States)

    Adamo, Shelley A

    2014-09-01

    Intense, short-term stress (i.e., robust activation of the fight-or-flight response) typically produces a transient decline in resistance to disease in animals across phyla. Chemical mediators of the stress response (e.g., stress hormones) help induce this decline, suggesting that this transient immunosuppression is an evolved response. However, determining the function of stress hormones on immune function is difficult because of their complexity. Nevertheless, evidence suggests that stress hormones help maintain maximal resistance to disease during the physiological changes needed to optimize the body for intense physical activity. Work on insects demonstrates that stress hormones both shunt resources away from the immune system during fight-or-flight responses as well as reconfigure the immune system. Reconfiguring the immune system minimizes the impact of the loss of these resources and reduces the increased costs of some immune functions due to the physiological changes demanded by the fight-or-flight response. For example, during the stress response of the cricket Gryllus texensis, some molecular resources are shunted away from the immune system and toward lipid transport, resulting in a reduction in resistance to disease. However, insects' immune cells (hemocytes) have receptors for octopamine (the insect stress neurohormone). Octopamine increases many hemocyte functions, such as phagocytosis, and these changes would tend to mitigate the decline in immunity due to the loss of molecular resources. Moreover, because the stress response generates oxidative stress, some immune responses are probably more costly when activated during a stress response (e.g., those that produce reactive molecules). Some of these immune responses are depressed during stress in crickets, while others, whose costs are probably not increased during a stress response, are enhanced. Some effects of stress hormones on immune systems may be better understood as examples of reconfiguration

  14. Impaired immune function in children and adults with Fanconi anemia.

    Science.gov (United States)

    Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

    2017-11-01

    Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.

  15. From immunotoxicity to carcinogenicity: the effects of carbamate pesticides on the immune system.

    Science.gov (United States)

    Dhouib, Ines; Jallouli, Manel; Annabi, Alya; Marzouki, Soumaya; Gharbi, Najoua; Elfazaa, Saloua; Lasram, Mohamed Montassar

    2016-05-01

    The immune system can be the target of many chemicals, with potentially severe adverse effects on the host's health. In the literature, carbamate (CM) pesticides have been implicated in the increasing prevalence of diseases associated with alterations of the immune response, such as hypersensitivity reactions, some autoimmune diseases and cancers. CMs may initiate, facilitate, or exacerbate pathological immune processes, resulting in immunotoxicity by induction of mutations in genes coding for immunoregulatory factors and modifying immune tolerance. In the present study, direct immunotoxicity, endocrine disruption and inhibition of esterases activities have been introduced as the main mechanisms of CMs-induced immune dysregulation. Moreover, the evidence on the relationship between CM pesticide exposure, dysregulation of the immune system and predisposition to different types of cancers, allergies, autoimmune and infectious diseases is criticized. In addition, in this review, we will discuss the relationship between immunotoxicity and cancer, and the advances made toward understanding the basis of cancer immune evasion.

  16. Leptin as immune mediator: Interaction between neuroendocrine and immune system.

    Science.gov (United States)

    Procaccini, Claudio; La Rocca, Claudia; Carbone, Fortunata; De Rosa, Veronica; Galgani, Mario; Matarese, Giuseppe

    2017-01-01

    Leptin is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. Initially described as an anti-obesity hormone, leptin has subsequently been shown to exert pleiotropic effects, being also able to influence haematopoiesis, thermogenesis, reproduction, angiogenesis, and more importantly immune homeostasis. As a cytokine, leptin can affect both innate and adaptive immunity, by inducing a pro-inflammatory response and thus playing a key role in the regulation of the pathogenesis of several autoimmune/inflammatory diseases. In this review, we discuss the most recent advances on the role of leptin as immune-modulator in mammals and we also provide an overview on its main functions in non-mammalian vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Current understanding of interactions between nanoparticles and the immune system

    International Nuclear Information System (INIS)

    Dobrovolskaia, Marina A.; Shurin, Michael; Shvedova, Anna A.

    2016-01-01

    The delivery of drugs, antigens, and imaging agents benefits from using nanotechnology-based carriers. The successful translation of nanoformulations to the clinic involves thorough assessment of their safety profiles, which, among other end-points, includes evaluation of immunotoxicity. The past decade of research focusing on nanoparticle interaction with the immune system has been fruitful in terms of understanding the basics of nanoparticle immunocompatibility, developing a bioanalytical infrastructure to screen for nanoparticle-mediated immune reactions, beginning to uncover the mechanisms of nanoparticle immunotoxicity, and utilizing current knowledge about the structure–activity relationship between nanoparticles' physicochemical properties and their effects on the immune system to guide safe drug delivery. In the present review, we focus on the most prominent pieces of the nanoparticle–immune system puzzle and discuss the achievements, disappointments, and lessons learned over the past 15 years of research on the immunotoxicity of engineered nanomaterials. - Graphical abstract: API — active pharmaceutical ingredient; NP — nanoparticles; PCP — physicochemical properties, CARPA — complement activation-related pseudoallergy, ICH — International Conference on Harmonization. Display Omitted - Highlights: • Achievements, disappointments and lessons learned over past decade are reviewed. • Areas in focus include characterization, immunotoxicity and utility in drug delivery. • Future direction focusing on mechanistic immunotoxicity studies is proposed.

  18. Current understanding of interactions between nanoparticles and the immune system

    Energy Technology Data Exchange (ETDEWEB)

    Dobrovolskaia, Marina A., E-mail: marina@mail.nih.gov [Nanotechnology Characterization Laboratory, Cancer Research Technology Program, Leidos Biomedical Research Inc., Frederick National Laboratory for Cancer Research, NCI at Frederick, Frederick, MD 21702 (United States); Shurin, Michael [Department of Pathology, University of Pittsburgh Medical Center, Pittsburgh, PA 15213 (United States); Department of Immunology, University of Pittsburgh Medical Center, Pittsburgh, PA 15213 (United States); Shvedova, Anna A., E-mail: ats1@cdc.gov [Health Effects Laboratory Division, National Institute of Occupational Safety and Health, Centers for Disease Control and Prevention, Morgantown, WV 26505 (United States); Department of Physiology and Pharmacology, West Virginia University, Morgantown, WV 26506 (United States)

    2016-05-15

    The delivery of drugs, antigens, and imaging agents benefits from using nanotechnology-based carriers. The successful translation of nanoformulations to the clinic involves thorough assessment of their safety profiles, which, among other end-points, includes evaluation of immunotoxicity. The past decade of research focusing on nanoparticle interaction with the immune system has been fruitful in terms of understanding the basics of nanoparticle immunocompatibility, developing a bioanalytical infrastructure to screen for nanoparticle-mediated immune reactions, beginning to uncover the mechanisms of nanoparticle immunotoxicity, and utilizing current knowledge about the structure–activity relationship between nanoparticles' physicochemical properties and their effects on the immune system to guide safe drug delivery. In the present review, we focus on the most prominent pieces of the nanoparticle–immune system puzzle and discuss the achievements, disappointments, and lessons learned over the past 15 years of research on the immunotoxicity of engineered nanomaterials. - Graphical abstract: API — active pharmaceutical ingredient; NP — nanoparticles; PCP — physicochemical properties, CARPA — complement activation-related pseudoallergy, ICH — International Conference on Harmonization. Display Omitted - Highlights: • Achievements, disappointments and lessons learned over past decade are reviewed. • Areas in focus include characterization, immunotoxicity and utility in drug delivery. • Future direction focusing on mechanistic immunotoxicity studies is proposed.

  19. Complex role for the immune system in initiation and progression of pancreatic cancer.

    Science.gov (United States)

    Inman, Kristin S; Francis, Amanda A; Murray, Nicole R

    2014-08-28

    The immune system plays a complex role in the development and progression of pancreatic cancer. Inflammation can promote the formation of premalignant lesions and accelerate pancreatic cancer development. Conversely, pancreatic cancer is characterized by an immunosuppressive environment, which is thought to promote tumor progression and invasion. Here we review the current literature describing the role of the immune response in the progressive development of pancreatic cancer, with a focus on the mechanisms that drive recruitment and activation of immune cells at the tumor site, and our current understanding of the function of the immune cell types at the tumor. Recent clinical and preclinical data are reviewed, detailing the involvement of the immune response in pancreatitis and pancreatic cancer, including the role of specific cytokines and implications for disease outcome. Acute pancreatitis is characterized by a predominantly innate immune response, while chronic pancreatitis elicits an immune response that involves both innate and adaptive immune cells, and often results in profound systemic immune-suppression. Pancreatic adenocarcinoma is characterized by marked immune dysfunction driven by immunosuppressive cell types, tumor-promoting immune cells, and defective or absent inflammatory cells. Recent studies reveal that immune cells interact with cancer stem cells and tumor stromal cells, and these interactions have an impact on development and progression of pancreatic ductal adenocarcinoma (PDAC). Finally, current PDAC therapies are reviewed and the potential for harnessing the actions of the immune response to assist in targeting pancreatic cancer using immunotherapy is discussed.

  20. Dim light at night interferes with the development of the short-day phenotype and impairs cell-mediated immunity in Siberian hamsters (Phodopus sungorus).

    Science.gov (United States)

    Aubrecht, Taryn G; Weil, Zachary M; Nelson, Randy J

    2014-10-01

    Winter is a challenging time to survive and breed outside of the tropics. Animals use day length (photoperiod) to regulate seasonally appropriate adaptations in anticipation of challenging winter conditions. The net result of these photoperiod-mediated adjustments is enhanced immune function and increased survival. Thus, the ability to discriminate day length information is critical for survival and reproduction in small animals. However, during the past century, urban and suburban development has rapidly expanded and filled the night sky with light from various sources, obscuring crucial light-dark signals, which alters physiological interpretation of day lengths. Furthermore, reduced space, increased proximity to people, and the presence of light at night may act as stressors for small animals. Whereas acute stressors typically enhance immune responses, chronic exposure to stressors often impairs immune responses. Therefore, we hypothesized that the combination of dim light at night and chronic stress interferes with enhanced cell-mediated immunity observed during short days. Siberian hamsters (Phodopus sungorus) were assigned to short or long days with dark nights (0 lux) or dim (5 lux) light at night for 10 weeks. Following 2 weeks of chronic restraint (6 hr/day), a model of chronic stress, delayed type hypersensitivity (DTH) responses were assessed. Both dim light at night and restraint reduced the DTH response. Dim light at night during long nights produced an intermediate short day phenotype. These results suggest the constant presence of light at night could negatively affect survival of photoperiodic rodents by disrupting the timing of breeding and immune responses. © 2014 Wiley Periodicals, Inc.

  1. Immune System Dysregulation, Viral Reactivation and Stress During Short-Duration Space Flight

    Science.gov (United States)

    Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2010-01-01

    This slide presentation reviews a study that was conducted to ascertain if the immune system dysregulation, viral reactivation and stress from short duration space flight were a result of the stress of landing and readjustment to gravity. The objectives of the study were to replace several recent immune studies with one comprehensive study that will include in-flight sampling; address lack of in-flight data: (i.e., determine the in-flight status of immunity, physiological stress, viral immunity/reactivation); determine the clinical risk related to immune dysregulation for exploration class spaceflight; and determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  2. Interactions between Innate Lymphoid Cells and Cells of the Innate and Adaptive Immune System.

    Science.gov (United States)

    Symowski, Cornelia; Voehringer, David

    2017-01-01

    Type 2 innate lymphoid cells (ILC2s) are a major source of cytokines, which are also produced by Th2 cells and several cell types of the innate immune system. Work over the past few years indicates that ILC2s play a central role in regulating type 2 immune responses against allergens and helminths. ILC2s can interact with a variety of cells types of the innate and adaptive immune system by cell-cell contacts or by communication via soluble factors. In this review, we provide an overview about recent advances in our understanding how ILC2s orchestrate type 2 immune responses with focus on direct interactions between ILC2s and other cells of the immune system.

  3. Stochastic responses of tumor–immune system with periodic treatment

    International Nuclear Information System (INIS)

    Li Dong-Xi; Li Ying

    2017-01-01

    We investigate the stochastic responses of a tumor–immune system competition model with environmental noise and periodic treatment. Firstly, a mathematical model describing the interaction between tumor cells and immune system under external fluctuations and periodic treatment is established based on the stochastic differential equation. Then, sufficient conditions for extinction and persistence of the tumor cells are derived by constructing Lyapunov functions and Ito’s formula. Finally, numerical simulations are introduced to illustrate and verify the results. The results of this work provide the theoretical basis for designing more effective and precise therapeutic strategies to eliminate cancer cells, especially for combining the immunotherapy and the traditional tools. (paper)

  4. Linking the microbiota, chronic disease and the immune system

    Science.gov (United States)

    Hand, Timothy W.; Vujkovic-Cvijin, Ivan; Ridaura, Vanessa K.; Belkaid, Yasmine

    2016-01-01

    Chronic inflammatory diseases are the most important causes of mortality in the world today and are on the rise. We now know that immune-driven inflammation is critical in the etiology of these diseases, though the environmental triggers and cellular mechanisms that lead to their development are still mysterious. Many chronic inflammatory diseases are associated with significant shifts in the microbiota towards inflammatory configurations, which can affect the host both by inducing local and systemic inflammation and by alterations in microbiota-derived metabolites. This review discusses recent findings suggesting that shifts in the microbiota may contribute to chronic disease via effects on the immune system. PMID:27623245

  5. The postnatal development of the mucosal immune system and mucosal tolerance in domestic animals

    OpenAIRE

    Bailey , Mick; Haverson , Karin

    2006-01-01

    International audience; The mucosal immune system is exposed to a range of antigens associated with pathogens, to which it must mount active immune responses. However, it is also exposed to a large number of harmless antigens associated with food and with commensal microbial flora, to which expression of active, inflammatory immune responses to these antigens is undesirable. The mucosal immune system must contain machinery capable of evaluating the antigens to which it is exposed and mounting...

  6. Crosstalk between bone niche and immune system: osteoimmunology signaling as a potential target for cancer treatment.

    Science.gov (United States)

    Criscitiello, Carmen; Viale, Giulia; Gelao, Lucia; Esposito, Angela; De Laurentiis, Michele; De Placido, Sabino; Santangelo, Michele; Goldhirsch, Aron; Curigliano, Giuseppe

    2015-02-01

    There is a well recognized link between the bone and the immune system and in recent years there has been a major effort to elucidate the multiple functions of the molecules expressed in both bone and immune cells. Several molecules that were initially identified and studied in the immune system have been shown to have essential functions also in the bone. An interdisciplinary field embracing immune and bone biology has been brought together and called "osteoimmunology". The co-regulation of the skeletal and immune systems strikingly exemplifies the extreme complexity of such an interaction. Their interdependency must be considered in designing therapeutic approaches for either of the two systems. In other words, it is necessary to think of the osteoimmune system as a complex physiological unit. Denosumab was originally introduced to specifically target bone resorption, but it is now under evaluation for its effect on the long term immune response. Similarly, our current and still growing knowledge of the intimate link between the immune system and bone will be beneficial for the safety of drugs targeting either of these integrated systems. Given the large number of molecules exerting functions on both the skeletal and immune systems, osteoimmunological understanding is becoming increasingly important. Both bone and immune systems are frequently disrupted in cancer; and they may be crucial in regulating tumor growth and progression. Some therapies - such as bisphosphonates and receptor activator of NF-κB ligand (RANKL) targeted drugs - that aim at reducing pathologic osteolysis in cancer may interact with the immune system, thus providing potential favorable effects on survival. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. The Role of the Immune System in Ovarian Cancer and Implications on Therapy.

    Science.gov (United States)

    Menderes, Gulden; Schwab, Carlton L; Black, Jonathan; Santin, Alessandro D

    2016-06-01

    Ovarian cancer is the leading cause of death from gynecologic malignancy in the United States. While the treatment options have improved with conventional cytotoxic chemotherapy and advanced surgical techniques, disease recurrence is common and fatal in nearly all cases. Current evidence suggests that the immune system and its ability to recognize and eliminate microscopic disease is paramount in preventing recurrence. The goal of immunotherapy is to balance the activation of the immune system against cancer while preventing the potential for tremendous toxicity elicited by immune modulation. In this paper we will review the role of immune system in disease pathogenesis and different immunotherapies available for the treatment of ovarian cancer as well as current ongoing studies and potential future directions.

  8. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  9. Effects of chromium on the immune system.

    Science.gov (United States)

    Shrivastava, Richa; Upreti, R K; Seth, P K; Chaturvedi, U C

    2002-09-06

    Chromium is a naturally occurring heavy metal found commonly in the environment in trivalent, Cr(III), and hexavalent, Cr(VI), forms. Cr(VI) compounds have been declared as a potent occupational carcinogen among workers in chrome plating, stainless steel, and pigment industries. The reduction of Cr(VI) to Cr(III) results in the formation of reactive intermediates that together with oxidative stress oxidative tissue damage and a cascade of cellular events including modulation of apoptosis regulatory gene p53, contribute to the cytotoxicity, genotoxicity and carcinogenicity of Cr(VI)-containing compounds. On the other hand, chromium is an essential nutrient required to promote the action of insulin in body tissues so that the body can use sugars, proteins and fats. Chromium is of significant importance in altering the immune response by immunostimulatory or immunosuppressive processes as shown by its effects on T and B lymphocytes, macrophages, cytokine production and the immune response that may induce hypersensitivity reactions. This review gives an overview of the effects of chromium on the immune system of the body. Copyright 2002 Federation of European Microbiological Societies

  10. The nociception genes painless and Piezo are required for the cellular immune response of Drosophila larvae to wasp parasitization.

    Science.gov (United States)

    Tokusumi, Yumiko; Tokusumi, Tsuyoshi; Schulz, Robert A

    2017-05-13

    In vertebrates, interaction between the nervous system and immune system is important to protect a challenged host from stress inputs from external sources. In this study, we demonstrate that sensory neurons are involved in the cellular immune response elicited by wasp infestation of Drosophila larvae. Multidendritic class IV neurons sense contacts from external stimuli and induce avoidance behaviors for host defense. Our findings show that inactivation of these sensory neurons impairs the cellular response against wasp parasitization. We also demonstrate that the nociception genes encoding the mechanosensory receptors Painless and Piezo, both expressed in class IV neurons, are essential for the normal cellular immune response to parasite challenge. Copyright © 2017. Published by Elsevier Inc.

  11. Systemic lipopolysaccharide administration impairs retrieval of context-object discrimination, but not spatial, memory: Evidence for selective disruption of specific hippocampus-dependent memory functions during acute neuroinflammation.

    Science.gov (United States)

    Czerniawski, Jennifer; Miyashita, Teiko; Lewandowski, Gail; Guzowski, John F

    2015-02-01

    Neuroinflammation is implicated in impairments in neuronal function and cognition that arise with aging, trauma, and/or disease. Therefore, understanding the underlying basis of the effect of immune system activation on neural function could lead to therapies for treating cognitive decline. Although neuroinflammation is widely thought to preferentially impair hippocampus-dependent memory, data on the effects of cytokines on cognition are mixed. One possible explanation for these inconsistent results is that cytokines may disrupt specific neural processes underlying some forms of memory but not others. In an earlier study, we tested the effect of systemic administration of bacterial lipopolysaccharide (LPS) on retrieval of hippocampus-dependent context memory and neural circuit function in CA3 and CA1 (Czerniawski and Guzowski, 2014). Paralleling impairment in context discrimination memory, we observed changes in neural circuit function consistent with disrupted pattern separation function. In the current study we tested the hypothesis that acute neuroinflammation selectively disrupts memory retrieval in tasks requiring hippocampal pattern separation processes. Male Sprague-Dawley rats given LPS systemically prior to testing exhibited intact performance in tasks that do not require hippocampal pattern separation processes: novel object recognition and spatial memory in the water maze. By contrast, memory retrieval in a task thought to require hippocampal pattern separation, context-object discrimination, was strongly impaired in LPS-treated rats in the absence of any gross effects on exploratory activity or motivation. These data show that LPS administration does not impair memory retrieval in all hippocampus-dependent tasks, and support the hypothesis that acute neuroinflammation impairs context discrimination memory via disruption of pattern separation processes in hippocampus. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Food components and the Immune System: from tonic agents to allergens

    Directory of Open Access Journals (Sweden)

    Ana Maria Caetano Faria

    2013-05-01

    Full Text Available The intestinal mucosa is the major site of contact with antigens, and it lodges the largest lymphoid tissue in the body. In physiological conditions, microbiota and dietary antigens are the natural sources of stimulation for the gut associated lymphoid tissues (GALT and for the immune system as a whole. Germ free models have provided some insights on the immunological role of gut antigens. However, most of the GALT is not located in the large intestine, where gut microbiota is prominent. It is concentrated in the small intestine where protein absorption takes place. In this review, we will address the involvement of food components in the development and the function of the immune system. Studies in mice have already shown that dietary proteins are critical elements for the developmental shift of the immature neonatal immune profile into a fully developed immune system. The immunological effects of other food components (such as vitamins and lipids will also be addressed. Most of the cells in the GALT are activated and local proinflammatory mediators are abundant. Regulatory elements are known to provide a delicate yet robust balance that keeps the gut homeostasis at check. Usually antigenic contact in the gut induces two major immune responses, oral tolerance and production of secretory IgA. However, under pathological conditions mucosal homeostasis is disturbed resulting in inflammatory reactions such as food hypersensitivity. Food allergy development depends on many factors such as genetic predisposition, biochemical features of allergens and a growing array of environmental elements. Neuroimmune interactions are also implicated in food allergy and they are examples of the high complexity of the phenomenon. Recent findings on the gut circuits triggered by food components will be reviewed to show that, far beyond their role as nutrients, they are critical players in the operation of immune system in health and disease.

  13. CRISPR-Cas: evolution of an RNA-based adaptive immunity system in prokaryotes.

    Science.gov (United States)

    Koonin, Eugene V; Makarova, Kira S

    2013-05-01

    The CRISPR-Cas (clustered regularly interspaced short palindromic repeats, CRISPR-associated genes) is an adaptive immunity system in bacteria and archaea that functions via a distinct self-non-self recognition mechanism that is partially analogous to the mechanism of eukaryotic RNA interference (RNAi). The CRISPR-Cas system incorporates fragments of virus or plasmid DNA into the CRISPR repeat cassettes and employs the processed transcripts of these spacers as guide RNAs to cleave the cognate foreign DNA or RNA. The Cas proteins, however, are not homologous to the proteins involved in RNAi and comprise numerous, highly diverged families. The majority of the Cas proteins contain diverse variants of the RNA recognition motif (RRM), a widespread RNA-binding domain. Despite the fast evolution that is typical of the cas genes, the presence of diverse versions of the RRM in most Cas proteins provides for a simple scenario for the evolution of the three distinct types of CRISPR-cas systems. In addition to several proteins that are directly implicated in the immune response, the cas genes encode a variety of proteins that are homologous to prokaryotic toxins that typically possess nuclease activity. The predicted toxins associated with CRISPR-Cas systems include the essential Cas2 protein, proteins of COG1517 that, in addition to a ligand-binding domain and a helix-turn-helix domain, typically contain different nuclease domains and several other predicted nucleases. The tight association of the CRISPR-Cas immunity systems with predicted toxins that, upon activation, would induce dormancy or cell death suggests that adaptive immunity and dormancy/suicide response are functionally coupled. Such coupling could manifest in the persistence state being induced and potentially providing conditions for more effective action of the immune system or in cell death being triggered when immunity fails.

  14. Hormones in the immune system and their possible role. A critical review.

    Science.gov (United States)

    Csaba, György

    2014-09-01

    Immune cells synthesize, store and secrete hormones, which are identical with the hormones of the endocrine glands. These are: the POMC hormones (ACTH, endorphin), the thyroid system hormones (TRH, TSH, T3), growth hormone (GH), prolactin, melatonin, histamine, serotonin, catecholamines, GnRH, LHRH, hCG, renin, VIP, ANG II. This means that the immune cells contain all of the hormones, which were searched at all and they also have receptors for these hormones. From this point of view the immune cells are similar to the unicells (Tetrahymena), so it can be supposed that these cells retained the properties characteristic at a low level of phylogeny while other cells during the evolution accumulated to form endocrine glands. In contrast to the glandular endocrine cells, immune cells are polyproducers and polyreceivers. As they are mobile cells, they are able to transport the stored hormone to different places (packed transport) or attracted by local factors, accumulate in the neighborhood of the target, synthesizing and secreting hormones locally. This is taking place, e.g. in the case of endorphin, where the accumulating immune cells calms pain caused by the inflammation. The targeted packed transport is more economical than the hormone-pouring to the blood circulation of glandular endocrines and the targeting also cares the other receptor-bearing cells timely not needed the effect. Mostly the immune-effects of immune-cell derived hormones were studied (except endorphin), however, it is not exactly cleared, while the system could have scarcely studied important roles in other cases. The evolutionary aspects and the known as well, as possible roles of immune-endocrine system and their hormones are listed and discussed.

  15. Aggression, Social Stress, and the Immune System in Humans and Animal Models

    Directory of Open Access Journals (Sweden)

    Aki Takahashi

    2018-03-01

    Full Text Available Social stress can lead to the development of psychological problems ranging from exaggerated anxiety and depression to antisocial and violence-related behaviors. Increasing evidence suggests that the immune system is involved in responses to social stress in adulthood. For example, human studies show that individuals with high aggression traits display heightened inflammatory cytokine levels and dysregulated immune responses such as slower wound healing. Similar findings have been observed in patients with depression, and comorbidity of depression and aggression was correlated with stronger immune dysregulation. Therefore, dysregulation of the immune system may be one of the mediators of social stress that produces aggression and/or depression. Similar to humans, aggressive animals also show increased levels of several proinflammatory cytokines, however, unlike humans these animals are more protected from infectious organisms and have faster wound healing than animals with low aggression. On the other hand, subordinate animals that receive repeated social defeat stress have been shown to develop escalated and dysregulated immune responses such as glucocorticoid insensitivity in monocytes. In this review we synthesize the current evidence in humans, non-human primates, and rodents to show a role for the immune system in responses to social stress leading to psychiatric problems such as aggression or depression. We argue that while depression and aggression represent two fundamentally different behavioral and physiological responses to social stress, it is possible that some overlapped, as well as distinct, pattern of immune signaling may underlie both of them. We also argue the necessity of studying animal models of maladaptive aggression induced by social stress (i.e., social isolation for understanding neuro-immune mechanism of aggression, which may be relevant to human aggression.

  16. Aggression, Social Stress, and the Immune System in Humans and Animal Models.

    Science.gov (United States)

    Takahashi, Aki; Flanigan, Meghan E; McEwen, Bruce S; Russo, Scott J

    2018-01-01

    Social stress can lead to the development of psychological problems ranging from exaggerated anxiety and depression to antisocial and violence-related behaviors. Increasing evidence suggests that the immune system is involved in responses to social stress in adulthood. For example, human studies show that individuals with high aggression traits display heightened inflammatory cytokine levels and dysregulated immune responses such as slower wound healing. Similar findings have been observed in patients with depression, and comorbidity of depression and aggression was correlated with stronger immune dysregulation. Therefore, dysregulation of the immune system may be one of the mediators of social stress that produces aggression and/or depression. Similar to humans, aggressive animals also show increased levels of several proinflammatory cytokines, however, unlike humans these animals are more protected from infectious organisms and have faster wound healing than animals with low aggression. On the other hand, subordinate animals that receive repeated social defeat stress have been shown to develop escalated and dysregulated immune responses such as glucocorticoid insensitivity in monocytes. In this review we synthesize the current evidence in humans, non-human primates, and rodents to show a role for the immune system in responses to social stress leading to psychiatric problems such as aggression or depression. We argue that while depression and aggression represent two fundamentally different behavioral and physiological responses to social stress, it is possible that some overlapped, as well as distinct, pattern of immune signaling may underlie both of them. We also argue the necessity of studying animal models of maladaptive aggression induced by social stress (i.e., social isolation) for understanding neuro-immune mechanism of aggression, which may be relevant to human aggression.

  17. T cell immunity

    OpenAIRE

    Emel Bülbül Başkan

    2013-01-01

    Since birth, our immune system is constantly bombarded with self-antigens and foreign pathogens. To stay healthy, complex immune strategies have evolved in our immune system to maintain self-tolerance and to defend against foreign pathogens. Effector T cells are the key players in steering the immune responses to execute immune functions. While effector T cells were initially identified to be immune promoting, recent studies unraveled negative regulatory functions of effector T cells...

  18. Recovery of the immune system after exercise.

    Science.gov (United States)

    Peake, Jonathan M; Neubauer, Oliver; Walsh, Neil P; Simpson, Richard J

    2017-05-01

    The notion that prolonged, intense exercise causes an "open window" of immunodepression during recovery after exercise is well accepted. Repeated exercise bouts or intensified training without sufficient recovery may increase the risk of illness. However, except for salivary IgA, clear and consistent markers of this immunodepression remain elusive. Exercise increases circulating neutrophil and monocyte counts and reduces circulating lymphocyte count during recovery. This lymphopenia results from preferential egress of lymphocyte subtypes with potent effector functions [e.g., natural killer (NK) cells, γδ T cells, and CD8 + T cells]. These lymphocytes most likely translocate to peripheral sites of potential antigen encounter (e.g., lungs and gut). This redeployment of effector lymphocytes is an integral part of the physiological stress response to exercise. Current knowledge about changes in immune function during recovery from exercise is derived from assessment at the cell population level of isolated cells ex vivo or in blood. This assessment can be biased by large changes in the distribution of immune cells between blood and peripheral tissues during and after exercise. Some evidence suggests that reduced immune cell function in vitro may coincide with changes in vivo and rates of illness after exercise, but more work is required to substantiate this notion. Among the various nutritional strategies and physical therapies that athletes use to recover from exercise, carbohydrate supplementation is the most effective for minimizing immune disturbances during exercise recovery. Sleep is an important aspect of recovery, but more research is needed to determine how sleep disruption influences the immune system of athletes. Copyright © 2017 the American Physiological Society.

  19. Correlation between obesity, adipokines and the immune system

    Directory of Open Access Journals (Sweden)

    Marcos Regini Silveira

    2009-09-01

    Full Text Available Obesity is a worldwide health problem and the increase in its incidence, risks and consequences are a matter of growing concern. Obesity is characterized by the accumulation of fat in the body. Many studies are currently investigating obesity and associated comorbidities in an attempt to clarify the mechanisms involved. Fat tissue is a dynamic organ that secretes several factors, including adipokines. Adipokines are bioactive peptides secreted by fat cells, which are important for energy regulation and inflammatory and immune responses. Leptin, adiponectin and resistin are the most studied adipokines. The aim of this review was to gather information about these adipokines (leptin, adiponectin and resistin and their relationship with the immune response in obese individuals, as well as the susceptibility of these patients to infections. The results of the literature review permit some observations. The circulating levels of these adipokines are directly involved in the degree of obesity of the patient. High or low circulating concentrations of these adipokines may have beneficial or negative effects on immune competence, with obese patients being more susceptible to infection and inflammation than eutrophic individuals.Key words: Obesity; Adipokines; Leptin; Adiponectin; Resistin; Immune system.

  20. Focusing on Ciona intestinalis (Tunicata) innate immune system. Evolutionary implications

    OpenAIRE

    N Parrinello

    2009-01-01

    Phylogenetic analyses based on molecular data provide compelling evidence that ascidians are of critical importance for studying chordate immune system evolution. The Ciona intestinalis draft genome sequence allows searches for phylogenetic relationships, gene cloning and expression of immunorelevant molecules. Acidians lack of the pivotal components of the vertebrate recombinatory adaptive immunity, i.e., MHC, TCRs and dimeric immunoglobulins. However, bioinformatic sequence analyses recogni...

  1. The immune system in space, including Earth-based benefits of space-based research.

    Science.gov (United States)

    Sonnenfeld, Gerald

    2005-08-01

    Exposure to space flight conditions has been shown to result in alterations in immune responses. Changes in immune responses of humans and experimental animals have been shown to be altered during and after space flight of humans and experimental animals or cell cultures of lymphoid cells. Exposure of subjects to ground-based models of space flight conditions, such as hindlimb unloading of rodents or chronic bed rest of humans, has also resulted in changes in the immune system. The relationship of these changes to compromised resistance to infection or tumors in space flight has not been fully established, but results from model systems suggest that alterations in the immune system that occur in space flight conditions may be related to decreases in resistance to infection. The establishment of such a relationship could lead to the development of countermeasures that could prevent or ameliorate any compromises in resistance to infection resulting from exposure to space flight conditions. An understanding of the mechanisms of space flight conditions effects on the immune response and development of countermeasures to prevent them could contribute to the development of treatments for compromised immunity on earth.

  2. Probiotic bacteria and the immune system: mechanistic insights and therapeutic implications

    NARCIS (Netherlands)

    Mariman, R.

    2013-01-01

    This thesis aimed to provide insight into the role of microbiota-host interactions in the regulation of mucosal and systemic immunity in the context of IBD. Regulation of microbiota composition (e.g. by probiotics and prebiotics) offers the possibility to modulate immune responses and contribute to

  3. Introduction to the role of the immune system in melanoma.

    Science.gov (United States)

    Margolin, Kim

    2014-06-01

    The concept of immunosurveillance of cancer has been widely accepted for many years, but only recently have the precise mechanisms of tumor-host immune interactions been revealed. Inflammatory and immune reactions play a role in melanomagenesis, and may contribute to the eradication of tumor as well as potentiating its growth and proliferation. Studies of the role of tumor-immune system interactions are providing insights into the pathogenesis and opportunities for highly effective therapeutic strategies. Some patients, even with advanced disease, are now cured with immunotherapy, and increasing numbers of such cures are likely in future. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Senescence of the adaptive immune system in health and aging-associated autoimmune disease

    NARCIS (Netherlands)

    van der Geest, Kornelis Stephan Mario

    2015-01-01

    Aging of the immune system may contribute to the development of aging-associated autoimmune diseases, such as giant cell arteritis, polymyalgia rheumatica and rheumatoid arthritis. The aim of this thesis was to identify aging-dependent changes of the adaptive immune system that promote autoimmunity

  5. Ovarian cancer and the immune system - The role of targeted therapies.

    Science.gov (United States)

    Turner, Taylor B; Buchsbaum, Donald J; Straughn, J Michael; Randall, Troy D; Arend, Rebecca C

    2016-08-01

    The majority of patients with epithelial ovarian cancer are diagnosed with advanced disease. While many of these patients will respond initially to chemotherapy, the majority will relapse and die of their disease. Targeted therapies that block or activate specific intracellular signaling pathways have been disappointing. In the past 15years, the role of the immune system in ovarian cancer has been investigated. Patients with a more robust immune response, as documented by the presence of lymphocytes infiltrating within their tumor, have increased survival and better response to chemotherapy. In addition, a strong immunosuppressive environment often accompanies ovarian cancer. Recent research has identified potential therapies that leverage the immune system to identify and destroy tumor cells that previously evaded immunosurveillance mechanisms. In this review, we discuss the role of the immune system in ovarian cancer and focus on specific pathways and molecules that show a potential for targeted therapy. We also review the ongoing clinical trials using targeted immunotherapy in ovarian cancer. The role of targeted immunotherapy in patients with ovarian cancer represents a field of growing research and clinical importance. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Imbalanced immune homeostasis in immune thrombocytopenia.

    Science.gov (United States)

    Yazdanbakhsh, Karina

    2016-04-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Evolution of JAK-STAT pathway components: mechanisms and role in immune system development.

    Directory of Open Access Journals (Sweden)

    Clifford Liongue

    Full Text Available BACKGROUND: Lying downstream of a myriad of cytokine receptors, the Janus kinase (JAK-Signal transducer and activator of transcription (STAT pathway is pivotal for the development and function of the immune system, with additional important roles in other biological systems. To gain further insight into immune system evolution, we have performed a comprehensive bioinformatic analysis of the JAK-STAT pathway components, including the key negative regulators of this pathway, the SH2-domain containing tyrosine phosphatase (SHP, Protein inhibitors against Stats (PIAS, and Suppressor of cytokine signaling (SOCS proteins across a diverse range of organisms. RESULTS: Our analysis has demonstrated significant expansion of JAK-STAT pathway components co-incident with the emergence of adaptive immunity, with whole genome duplication being the principal mechanism for generating this additional diversity. In contrast, expansion of upstream cytokine receptors appears to be a pivotal driver for the differential diversification of specific pathway components. CONCLUSION: Diversification of JAK-STAT pathway components during early vertebrate development occurred concurrently with a major expansion of upstream cytokine receptors and two rounds of whole genome duplications. This produced an intricate cell-cell communication system that has made a significant contribution to the evolution of the immune system, particularly the emergence of adaptive immunity.

  8. The interplay between the gut microbiota and the immune system.

    Science.gov (United States)

    Geuking, Markus B; Köller, Yasmin; Rupp, Sandra; McCoy, Kathy D

    2014-01-01

    The impact of the gut microbiota on immune homeostasis within the gut and, importantly, also at systemic sites has gained tremendous research interest over the last few years. The intestinal microbiota is an integral component of a fascinating ecosystem that interacts with and benefits its host on several complex levels to achieve a mutualistic relationship. Host-microbial homeostasis involves appropriate immune regulation within the gut mucosa to maintain a healthy gut while preventing uncontrolled immune responses against the beneficial commensal microbiota potentially leading to chronic inflammatory bowel diseases (IBD). Furthermore, recent studies suggest that the microbiota composition might impact on the susceptibility to immune-mediated disorders such as autoimmunity and allergy. Understanding how the microbiota modulates susceptibility to these diseases is an important step toward better prevention or treatment options for such diseases.

  9. Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-16-2-0032 TITLE: Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines PRINCIPAL INVESTIGATOR...CONTRACT NUMBER Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines 5b. GRANT NUMBER W81XWH-16-2-0032 5c. PROGRAM ELEMENT...cell) responses will be measured using molecular and cellular approaches and the data analyzed using a systems biology approach. During the first

  10. Novel Therapeutic Strategies for Solid Tumor Based on Body's Intrinsic Antitumor Immune System.

    Science.gov (United States)

    Duan, Haifeng

    2018-05-22

    The accumulation of mutated somatic cells due to the incompetency of body's immune system may lead to tumor onset. Therefore, enhancing the ability of the system to eliminate such cells should be the core of tumor therapy. The intrinsic antitumor immunity is triggered by tumor-specific antigens (TSA) or TSA-sensitized dendritic cells (DC). Once initiated, specific anti-tumor antibodies are produced and tumor-specific killer immune cells, including cytotoxic T lymphocytes (CTL), NK cells, and macrophages, are raised or induced. Several strategies may enhance antitumor action of immune system, such as supplying tumor-targeted antibody, activating T cells, enhancing the activity and tumor recognition of NK cells, promoting tumor-targeted phagocytosis of macrophages, and eliminating the immunosuppressive myeloid-derived suppressor cells (MDSCs) and Treg cells. Apart from the immune system, the removal of tumor burden still needs to be assisted by drugs, surgery or radiation. And the body's internal environment and tumor microenvironment should be improved to recover immune cell function and prevent tumor growth. Multiple microenvironment modulatory therapies may be applied, including addressing hypoxia and oxidative stress, correcting metabolic disorders, and controlling chronic inflammation. Finally, to cure tumor and prevent tumor recurrence, repairing or supporting therapy that consist of tissue repair and nutritional supplement should be applied properly. © 2018 The Author(s). Published by S. Karger AG, Basel.

  11. Immunity by equilibrium.

    Science.gov (United States)

    Eberl, Gérard

    2016-08-01

    The classical model of immunity posits that the immune system reacts to pathogens and injury and restores homeostasis. Indeed, a century of research has uncovered the means and mechanisms by which the immune system recognizes danger and regulates its own activity. However, this classical model does not fully explain complex phenomena, such as tolerance, allergy, the increased prevalence of inflammatory pathologies in industrialized nations and immunity to multiple infections. In this Essay, I propose a model of immunity that is based on equilibrium, in which the healthy immune system is always active and in a state of dynamic equilibrium between antagonistic types of response. This equilibrium is regulated both by the internal milieu and by the microbial environment. As a result, alteration of the internal milieu or microbial environment leads to immune disequilibrium, which determines tolerance, protective immunity and inflammatory pathology.

  12. Stromal cell contributions to the homeostasis and functionality of the immune system.

    Science.gov (United States)

    Mueller, Scott N; Germain, Ronald N

    2009-09-01

    A defining characteristic of the immune system is the constant movement of many of its constituent cells through the secondary lymphoid tissues, mainly the spleen and lymph nodes, where crucial interactions that underlie homeostatic regulation, peripheral tolerance and the effective development of adaptive immune responses take place. What has only recently been recognized is the role that non-haematopoietic stromal elements have in many aspects of immune cell migration, activation and survival. In this Review, we summarize our current understanding of lymphoid compartment stromal cells, examine their possible heterogeneity, discuss how these cells contribute to immune homeostasis and the efficient initiation of adaptive immune responses, and highlight how targeting of these elements by some pathogens can influence the host immune response.

  13. Immunological regulation of metabolism--a novel quintessential role for the immune system in health and disease.

    Science.gov (United States)

    Schaefer, Jeremy S; Klein, John R

    2011-01-01

    The hypothalamus-pituitary-thyroid (HPT) axis is an integrated hormone network that is essential for maintaining metabolic homeostasis. It has long been known that thyroid stimulating hormone (TSH), a central component of the HPT axis, can be made by cells of the immune system; however, the role of immune system TSH remains enigmatic and most studies have viewed it as a cytokine used to regulate immune function. Recent studies now indicate that immune system-derived TSH, in particular, a splice variant of TSHβ that is preferentially made by cells of the immune system, is produced by a subset of hematopoietic cells that traffic to the thyroid. On the basis of these and other findings, we propose the novel hypothesis that the immune system is an active participant in the regulation of basal metabolism. We further speculate that this process plays a critical role during acute and chronic infections and that it contributes to a wide range of chronic inflammatory conditions with links to thyroid dysregulation. This hypothesis, which is amenable to empirical analysis, defines a previously unknown role for the immune system in health and disease, and it provides a dynamic connection between immune-endocrine interactions at the organismic level.

  14. The immune system as a target for antibiotics

    NARCIS (Netherlands)

    Grondel, J.L.

    1986-01-01

    Studies on antibiotics, oxytetracycline (OxyTC) in particular, are presented in this thesis with respect to the influence of these drugs on the immune system of carp and chickens. Special attention was paid to the pharmacokinetic behaviour of

  15. Connecting the immune system, systemic chronic inflammation and the gut microbiome: The role of sex.

    Science.gov (United States)

    Rizzetto, Lisa; Fava, Francesca; Tuohy, Kieran M; Selmi, Carlo

    2018-05-31

    Unresolved low grade systemic inflammation represents the underlying pathological mechanism driving immune and metabolic pathways involved in autoimmune diseases (AID). Mechanistic studies in animal models of AID and observational studies in patients have found alterations in gut microbiota communities and their metabolites, suggesting a microbial contribution to the onset or progression of AID. The gut microbiota and its metabolites have been shown to influence immune functions and immune homeostasis both within the gut and systematically. Microbial derived-short chain fatty acid (SCFA) and bio-transformed bile acid (BA) have been shown to influence the immune system acting as ligands specific cell signaling receptors like GPRCs, TGR5 and FXR, or via epigenetic processes. Similarly, intestinal permeability (leaky gut) and bacterial translocation are important contributors to chronic systemic inflammation and, without repair of the intestinal barrier, might represent a continuous inflammatory stimulus capable of triggering autoimmune processes. Recent studies indicate gender-specific differences in immunity, with the gut microbiota shaping and being concomitantly shaped by the hormonal milieu governing differences between the sexes. A bi-directional cross-talk between microbiota and the endocrine system is emerging with bacteria being able to produce hormones (e.g. serotonin, dopamine and somatostatine), respond to host hormones (e.g. estrogens) and regulate host hormones' homeostasis (e.g by inhibiting gene prolactin transcription or converting glucocorticoids to androgens). We review herein how gut microbiota and its metabolites regulate immune function, intestinal permeability and possibly AID pathological processes. Further, we describe the dysbiosis within the gut microbiota observed in different AID and speculate how restoring gut microbiota composition and its regulatory metabolites by dietary intervention including prebiotics and probiotics could help in

  16. Aggravating Impact of Nanoparticles on Immune-Mediated Pulmonary Inflammation

    Directory of Open Access Journals (Sweden)

    Ken-Ichiro Inoue

    2011-01-01

    Full Text Available Although the adverse health effects of nanoparticles have been proposed and are being clarified, their aggravating effects on pre-existing pathological conditions have not been fully investigated. In this review, we provide insights into the immunotoxicity of both airborne and engineered nanoparticles as an exacerbating factor on hypersusceptible subjects, especially those with immune-mediated pulmonary inflammation, using our in vivo experimental model. First, we exhibit the effects of nanoparticles on pulmonary inflammation induced by bacterial endotoxin (lipopolysaccharide: LPS as a disease model in innate immunity, and demonstrate that nanoparticles instilled through both an intratracheal tube and an inhalation system can exacerbate the lung inflammation. Second, we introduce the effects of nanoparticles on allergic pulmonary inflammation as a disease model in adaptive immunity, and show that repetitive pulmonary exposure to nanoparticles has aggravating effects on allergic inflammation, including adjuvant effects on Th2-milieu. Third, we show that very small nanoparticle exposure exacerbates emphysematous pulmonary inflammation, which is concomitant with enhanced lung expression of proinflammatory molecules (including those that are innate immunity related. Taken together, nanoparticle exposure may synergistically facilitate pathological pulmonary inflammation via both innate and adaptive immunological impairment.

  17. Immunoediting: evidence of the multifaceted role of the immune system in self-metastatic tumor growth.

    Science.gov (United States)

    Enderling, Heiko; Hlatky, Lynn; Hahnfeldt, Philip

    2012-07-28

    The role of the immune system in tumor progression has been a subject for discussion for many decades. Numerous studies suggest that a low immune response might be beneficial, if not necessary, for tumor growth, and only a strong immune response can counter tumor growth and thus inhibit progression. We implement a cellular automaton model previously described that captures the dynamical interactions between the cancer stem and non-stem cell populations of a tumor through a process of self-metastasis. By overlaying on this model the diffusion of immune reactants into the tumor from a peripheral source to target cells, we simulate the process of immune-system-induced cell kill on tumor progression. A low cytotoxic immune reaction continuously kills cancer cells and, although at a low rate, thereby causes the liberation of space-constrained cancer stem cells to drive self-metastatic progression and continued tumor growth. With increasing immune system strength, however, tumor growth peaks, and then eventually falls below the intrinsic tumor sizes observed without an immune response. With this increasing immune response the number and proportion of cancer stem cells monotonically increases, implicating an additional unexpected consequence, that of cancer stem cell selection, to the immune response. Cancer stem cells and immune cytotoxicity alone are sufficient to explain the three-step "immunoediting" concept - the modulation of tumor growth through inhibition, selection and promotion.

  18. The Immune System Bridges the Gut Microbiota with Systemic Energy Homeostasis: Focus on TLRs, Mucosal Barrier, and SCFAs.

    Science.gov (United States)

    Spiljar, Martina; Merkler, Doron; Trajkovski, Mirko

    2017-01-01

    The gut microbiota is essential for the development and regulation of the immune system and the metabolism of the host. Germ-free animals have altered immunity with increased susceptibility to immunologic diseases and show metabolic alterations. Here, we focus on two of the major immune-mediated microbiota-influenced components that signal far beyond their local environment. First, the activation or suppression of the toll-like receptors (TLRs) by microbial signals can dictate the tone of the immune response, and they are implicated in regulation of the energy homeostasis. Second, we discuss the intestinal mucosal surface is an immunologic component that protects the host from pathogenic invasion, is tightly regulated with regard to its permeability and can influence the systemic energy balance. The short chain fatty acids are a group of molecules that can both modulate the intestinal barrier and escape the gut to influence systemic health. As modulators of the immune response, the microbiota-derived signals influence functions of distant organs and can change susceptibility to metabolic diseases.

  19. Unraveling the relationship between microbial translocation and systemic immune activation in HIV infection

    Science.gov (United States)

    Shan, Liang; Siliciano, Robert F.

    2014-01-01

    Chronic immune activation is a key factor in HIV-1 disease progression. The translocation of microbial products from the intestinal lumen into the systemic circulation occurs during HIV-1 infection and is associated closely with immune activation; however, it has not been determined conclusively whether microbial translocation drives immune activation or occurs as a consequence of HIV-1 infection. In an important study in this issue of the JCI, Kristoff and colleagues describe the role of microbial translocation in producing immune activation in an animal model of HIV-1 infection, SIV infection of pigtailed macaques. Blocking translocation of intestinal bacterial LPS into the circulation dramatically reduced T cell activation and proliferation, production of proinflammatory cytokines, and plasma SIV RNA levels. This study directly demonstrates that microbial translocation promotes the systemic immune activation associated with HIV-1/SIV infection. PMID:24837427

  20. Modular and coordinated expression of immune system regulatory and signaling components in the developing and adult nervous system.

    Science.gov (United States)

    Monzón-Sandoval, Jimena; Castillo-Morales, Atahualpa; Crampton, Sean; McKelvey, Laura; Nolan, Aoife; O'Keeffe, Gerard; Gutierrez, Humberto

    2015-01-01

    During development, the nervous system (NS) is assembled and sculpted through a concerted series of neurodevelopmental events orchestrated by a complex genetic programme. While neural-specific gene expression plays a critical part in this process, in recent years, a number of immune-related signaling and regulatory components have also been shown to play key physiological roles in the developing and adult NS. While the involvement of individual immune-related signaling components in neural functions may reflect their ubiquitous character, it may also reflect a much wider, as yet undescribed, genetic network of immune-related molecules acting as an intrinsic component of the neural-specific regulatory machinery that ultimately shapes the NS. In order to gain insights into the scale and wider functional organization of immune-related genetic networks in the NS, we examined the large scale pattern of expression of these genes in the brain. Our results show a highly significant correlated expression and transcriptional clustering among immune-related genes in the developing and adult brain, and this correlation was the highest in the brain when compared to muscle, liver, kidney and endothelial cells. We experimentally tested the regulatory clustering of immune system (IS) genes by using microarray expression profiling in cultures of dissociated neurons stimulated with the pro-inflammatory cytokine TNF-alpha, and found a highly significant enrichment of immune system-related genes among the resulting differentially expressed genes. Our findings strongly suggest a coherent recruitment of entire immune-related genetic regulatory modules by the neural-specific genetic programme that shapes the NS.

  1. Growth versus immunity--a redirection of the cell cycle?

    Science.gov (United States)

    Eichmann, Ruth; Schäfer, Patrick

    2015-08-01

    Diseases caused by plant pathogens significantly reduce growth and yield in agricultural crop production. Raising immunity in crops is therefore a major aim in breeding programs. However, efforts to enhance immunity are challenged by the occurrence of growth inhibition triggered by immunity that can be as detrimental as diseases. In this review, we will propose molecular models to explain the inhibitory growth-immunity crosstalk. We will briefly discuss why the resource reallocation model might not represent the driving force for the observed growth-immunity trade-offs. We suggest a model in which immunity redirects and initiates hormone signalling activities that can impair plant growth by antagonising cell cycle regulation and meristem activities. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Role of leptin as a link between metabolism and the immune system.

    Science.gov (United States)

    Pérez-Pérez, Antonio; Vilariño-García, Teresa; Fernández-Riejos, Patricia; Martín-González, Jenifer; Segura-Egea, Juan José; Sánchez-Margalet, Víctor

    2017-06-01

    Leptin is an adipocyte-derived hormone not only with an important role in the central control of energy metabolism, but also with many pleiotropic effects in different physiological systems. One of these peripheral functions of leptin is a regulatory role in the interplay between energy metabolism and the immune system, being a cornerstone of the new field of immunometabolism. Leptin receptor is expressed throughout the immune system and the regulatory effects of leptin include cells from both the innate and adaptive immune system. Leptin is one of the adipokines responsible for the inflammatory state found in obesity that predisposes not only to type 2 diabetes, metabolic syndrome and cardiovascular disease, but also to autoimmune and allergic diseases. Leptin is an important mediator of the immunosuppressive state in undernutrition status. Placenta is the second source of leptin and it may play a role in the immunomodulation during pregnancy. Finally, recent work has pointed to the participation of leptin and leptin receptor in the pathophysiology of inflammation in oral biology. Therefore, leptin and leptin receptor should be considered for investigation as a marker of inflammation and immune activation in the frontier of innate-adaptive system, and as possible targets for intervention in the immunometabolic mediated pathophysiology. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. The immune system, natural autoantibodies and general homeostasis in health and disease.

    Science.gov (United States)

    Poletaev, A; Boura, P

    2011-10-01

    It is generally accepted that the destination of the immune system is not only to discriminate between self and non-self but also to mount responses against non-self. During the last decades, it became evident that weak self-reactivity is a necessary condition for immune homeostasis. Natural self reactivity and the internal image created by autoantibodies, participate greatly to the maintenance of homeostasis. Under conditions of increased or altered antigenic pressure, the homeostatic status is disrupted and the organism becomes vulnerable to the emergence of diseases. "Immunculus" is the self-reactive and interconnected entity of the immune system, provided by a complicated network of natural autoantibobies of different specificity, as a mosaic picture. Quantitative changes in each part of the image are related to variations of expression of relative antigens. The immune system takes in account image information from the continuous screening of the antigenic status and compares between presented state and the desired (optimal) one. Substantial and prolonged deviations from the optimal state, triggers the induction of compensatory and reparative processes, aiming to restore molecular and functional homeostasis. So, natural autoimmunity through the ability of natural a-Abs to induce mechanisms of natural and acquired immunity, aims to prevent pathogenic processes and maintain or restore health status.

  4. Early infections by myxoma virus of young rabbits (Oryctolagus cuniculus) protected by maternal antibodies activate their immune system and enhance herd immunity in wild populations.

    Science.gov (United States)

    Marchandeau, Stéphane; Pontier, Dominique; Guitton, Jean-Sébastien; Letty, Jérôme; Fouchet, David; Aubineau, Jacky; Berger, Francis; Léonard, Yves; Roobrouck, Alain; Gelfi, Jacqueline; Peralta, Brigitte; Bertagnoli, Stéphane

    2014-03-04

    The role of maternal antibodies is to protect newborns against acute early infection by pathogens. This can be achieved either by preventing any infection or by allowing attenuated infections associated with activation of the immune system, the two strategies being based on different cost/benefit ratios. We carried out an epidemiological survey of myxomatosis, which is a highly lethal infectious disease, in two distant wild populations of rabbits to describe the epidemiological pattern of the disease. Detection of specific IgM and IgG enabled us to describe the pattern of immunity. We show that maternal immunity attenuates early infection of juveniles and enables activation of their immune system. This mechanism associated with steady circulation of the myxoma virus in both populations, which induces frequent reinfections of immune rabbits, leads to the maintenance of high immunity levels within populations. Thus, myxomatosis has a low impact, with most infections being asymptomatic. This work shows that infection of young rabbits protected by maternal antibodies induces attenuated disease and activates their immune system. This may play a major role in reducing the impact of a highly lethal disease when ecological conditions enable permanent circulation of the pathogen.

  5. Wearable Smart System for Visually Impaired People

    OpenAIRE

    Ali Jasim Ramadhan

    2018-01-01

    In this paper, we present a wearable smart system to help visually impaired persons (VIPs) walk by themselves through the streets, navigate in public places, and seek assistance. The main components of the system are a microcontroller board, various sensors, cellular communication and GPS modules, and a solar panel. The system employs a set of sensors to track the path and alert the user of obstacles in front of them. The user is alerted by a sound emitted through a buzzer and by vibrations o...

  6. Impairment of the glymphatic system after diabetes.

    Science.gov (United States)

    Jiang, Quan; Zhang, Li; Ding, Guangliang; Davoodi-Bojd, Esmaeil; Li, Qingjiang; Li, Lian; Sadry, Neema; Nedergaard, Maiken; Chopp, Michael; Zhang, Zhenggang

    2017-04-01

    The glymphatic system has recently been shown to clear brain extracellular solutes and abnormalities in glymphatic clearance system may contribute to both initiation and progression of neurological diseases. Despite that diabetes is known as a risk factor for vascular diseases, little is known how diabetes affects the glymphatic system. The current study is the first investigation of the effect of diabetes on the glymphatic system and the link between alteration of glymphatic clearance and cognitive impairment in Type-2 diabetes mellitus rats. MRI analysis revealed that clearance of cerebrospinal fluid contrast agent Gd-DTPA from the interstitial space was slowed by a factor of three in the hippocampus of Type-2 diabetes mellitus rats compared to the non-DM rats and confirmed by florescence imaging analysis. Cognitive deficits detected by behavioral tests were highly and inversely correlated to the retention of Gd-DTPA contrast and fluorescent tracer in the hippocampus of Type-2 diabetes mellitus rats. Type-2 diabetes mellitus suppresses clearance of interstitial fluid in the hippocampus and hypothalamus, suggesting that an impairment of the glymphatic system contributes to Type-2 diabetes mellitus-induced cognitive deficits. Whole brain MRI provides a sensitive, non-invasive tool to quantitatively evaluate cerebrospinal fluid and interstitial fluid exchange in Type-2 diabetes mellitus and possibly in other neurological disorders, with potential clinical application.

  7. Materials to Engineer the Immune System

    Science.gov (United States)

    2011-04-01

    alone (Lysate), or with GM-CSF and lysate (GM+Lys), and 14 days later 200,000 NT1 cells were injected into the mammary pad. Mice survival was...followed over time. Fig. 2. Therapeutic vaccination against NT1 transplantable tumors. NT1 cells (200,000) were injected into the mammary...Engineer the Immune System David Mooney Harvard College Cambridge, MA 02136 Dendritic cells , GM-CSF, CpG, poly(lactide-co-glycolide) The

  8. Hormesis of Low Doses of Ionizing Radiation Exposure on Immune System

    International Nuclear Information System (INIS)

    Ragab, M.H.; Abbas, M.O.; El-Asady, R.S.; Amer, H.A.; El-Khouly, W.A.; Shabon, M.H.

    2015-01-01

    The effect of low doses of ionizing radiation on the immune system has been a controversial subject. To evaluate the effect of low-doses γ-irradiation exposure on immune system. An animal model, using Rattus Rattus rats was used. The rats were divided into groups exposed to either continuous or fractionated 100, 200, 300, 400 and 500 mSv of radiation and compared to control rats that did not receive radiation. All groups were exposed to a total white blood count (Wcs), lymphocyte count and serum IgG level measurement, as indicators of the function of the cell-mediated (T lymphocytes) and the humoral (B lymphocytes) immune system. The results of the current study revealed that the counts of total leukocytes (WBCs) and lymphocytes, as well as the serum level of IgG were increased significantly in rats receiving low dose radiation, indicating enhancement of immune system. The data suggests that low-dose gamma-radiation improved hematological parameters and significantly enhances immune response indices of the exposed rats. These findings are similar to the radiation adaptive responses in which a small dose of pre irradiation would induce certain radiation resistance and enhances the cell response after exposure to further irradiation doses The applied low doses used in the present study may appear effective inducing the radio adaptive response. Farooqi and Kesavan (1993) and Bravard et al. (1999) reported that the adaptive response to ionizing radiation refers to the phenomenon by which cells irradiated with low (cGy) or sublethal doses (conditioning doses) become less susceptible to genotoxic effects of a subsequent high dose (challenge dose, several Gy).

  9. An Indoor Navigation System for the Visually Impaired

    Directory of Open Access Journals (Sweden)

    Luis A. Guerrero

    2012-06-01

    Full Text Available Navigation in indoor environments is highly challenging for the severely visually impaired, particularly in spaces visited for the first time. Several solutions have been proposed to deal with this challenge. Although some of them have shown to be useful in real scenarios, they involve an important deployment effort or use artifacts that are not natural for blind users. This paper presents an indoor navigation system that was designed taking into consideration usability as the quality requirement to be maximized. This solution enables one to identify the position of a person and calculates the velocity and direction of his movements. Using this information, the system determines the user’s trajectory, locates possible obstacles in that route, and offers navigation information to the user. The solution has been evaluated using two experimental scenarios. Although the results are still not enough to provide strong conclusions, they indicate that the system is suitable to guide visually impaired people through an unknown built environment.

  10. An indoor navigation system for the visually impaired.

    Science.gov (United States)

    Guerrero, Luis A; Vasquez, Francisco; Ochoa, Sergio F

    2012-01-01

    Navigation in indoor environments is highly challenging for the severely visually impaired, particularly in spaces visited for the first time. Several solutions have been proposed to deal with this challenge. Although some of them have shown to be useful in real scenarios, they involve an important deployment effort or use artifacts that are not natural for blind users. This paper presents an indoor navigation system that was designed taking into consideration usability as the quality requirement to be maximized. This solution enables one to identify the position of a person and calculates the velocity and direction of his movements. Using this information, the system determines the user's trajectory, locates possible obstacles in that route, and offers navigation information to the user. The solution has been evaluated using two experimental scenarios. Although the results are still not enough to provide strong conclusions, they indicate that the system is suitable to guide visually impaired people through an unknown built environment.

  11. Control of an automated mobile manipulator using artificial immune system

    Science.gov (United States)

    Deepak, B. B. V. L.; Parhi, Dayal R.

    2016-03-01

    This paper addresses the coordination and control of a wheeled mobile manipulator (WMM) using artificial immune system. The aim of the developed methodology is to navigate the system autonomously and transport jobs and tools in manufacturing environments. This study integrates the kinematic structures of a four-axis manipulator and a differential wheeled mobile platform. The motion of the developed WMM is controlled by the complete system of parametric equation in terms of joint velocities and makes the robot to follow desired trajectories by the manipulator and platform within its workspace. The developed robot system performs its action intelligently according to the sensed environmental criteria within its search space. To verify the effectiveness of the proposed immune-based motion planner for WMM, simulations as well as experimental results are presented in various unknown environments.

  12. Comprehensive Transcriptome Profiling and Functional Analysis of the Frog (Bombina maxima) Immune System

    Science.gov (United States)

    Zhao, Feng; Yan, Chao; Wang, Xuan; Yang, Yang; Wang, Guangyin; Lee, Wenhui; Xiang, Yang; Zhang, Yun

    2014-01-01

    Amphibians occupy a key phylogenetic position in vertebrates and evolution of the immune system. But, the resources of its transcriptome or genome are still little now. Bombina maxima possess strong ability to survival in very harsh environment with a more mature immune system. We obtained a comprehensive transcriptome by RNA-sequencing technology. 14.3% of transcripts were identified to be skin-specific genes, most of which were not isolated from skin secretion in previous works or novel non-coding RNAs. 27.9% of transcripts were mapped into 242 predicted KEGG pathways and 6.16% of transcripts related to human disease and cancer. Of 39 448 transcripts with the coding sequence, at least 1501 transcripts (570 genes) related to the immune system process. The molecules of immune signalling pathway were almost presented, several transcripts with high expression in skin and stomach. Experiments showed that lipopolysaccharide or bacteria challenge stimulated pro-inflammatory cytokine production and activation of pro-inflammatory caspase-1. These frog's data can remarkably expand the existing genome or transcriptome resources of amphibians, especially immunity data. The entity of the data provides a valuable platform for further investigation on more detailed immune response in B. maxima and a comparative study with other amphibians. PMID:23942912

  13. Olive oil and immune system functions: potential involvement in immunonutrition

    Directory of Open Access Journals (Sweden)

    Álvarez de Cienfuegos, Gerardo

    2004-03-01

    Full Text Available Olive oil plays a crucial role as a main component of the Mediterranean diet, which has shown important benefits for the human health. According to the current knowledge, the administration of diets containing olive oil exerts some beneficial effects on the immune system functions due likely to the action of oleic acid rather than other substances contained in this fat. In the last few years, epidemiological, clinical and experimental studies have evidenced the potential of certain dietary lipids (containing polyunsaturated or monounsaturated fatty acids as modulators of immune system functions due to their ability to suppress several functions of immune system in both humans and animals. As a result, these fats have been applied in the reduction of symptoms from diseases characterized by an overactivation of the immune system (autoimmune diseases or in the reduction of cancer risk. Here, we review several relevant experimental and clinical data associated with the beneficial effects of olive oil upon the health, the mechanisms of action and the immune function susceptible of being be altered by the administration of dietary lipids and particularly of olive oil. In addition, we will also discuss the detrimental effects on the immune system functions caused by the administration of certain dietary lipids attributed mainly to a reduction of host natural resistance against infectious microorganisms as well as the involvement of olive oil diets in the regulation of immune resistance.El aceite de oliva tiene un papel crucial como componente de la dieta Mediterránea, con importantes beneficios sobre la salud humana. Dietas conteniendo aceite de oliva actúan de manera favorable en las funciones del sistema inmune por la acción sobretodo del ácido oleico. Los estudios epidemiológicos, clínicos y experimentales publicados en los últimos años demuestran que ciertos lípidos de la dieta [ácidos grasos monoinsaturados (MUFA y poliinsaturados (PUFA

  14. Radiation injury of the developing immune system in the beagle dog

    International Nuclear Information System (INIS)

    Miller, G.K.

    1982-01-01

    Fetal lymphoid organs of the beagle dog were studied to determine if the developing immune system displays an age-dependent sensitivity to ionizing radiation. Pregnant beagle dams received abdominal 60 Co gamma exposures to 200R or were sham irradiated at one of three ages in gestation; 35, 40, or 45 days postcoitus. The mean calculated dose to each fetus was 1.5 Gy. Half the fetuses in each litter were harvested by hysterotomy at five days and half at ten days postirradiation (PI). The volumes of the thymus lobules and lobular cortices were significantly reduced at five and ten days PI as compared to age matched controls. Radiation damage in the developing immune system was expressed in the lymphocyte populations of fetal lymphoid organs and in thymus epithelium. Damage was qualitatively and quantitatively more severe following irradiation earlier in gestation, confirming that the developing immune system displays an age-dependent sensitivity. Prenatal radiation injury to the developing lymphoid system could compromise postnatal immunologic function and could alter immunoregulation

  15. Signal transduction in cells of the immune system in microgravity

    Directory of Open Access Journals (Sweden)

    Huber Kathrin

    2008-10-01

    Full Text Available Abstract Life on Earth developed in the presence and under the constant influence of gravity. Gravity has been present during the entire evolution, from the first organic molecule to mammals and humans. Modern research revealed clearly that gravity is important, probably indispensable for the function of living systems, from unicellular organisms to men. Thus, gravity research is no more or less a fundamental question about the conditions of life on Earth. Since the first space missions and supported thereafter by a multitude of space and ground-based experiments, it is well known that immune cell function is severely suppressed in microgravity, which renders the cells of the immune system an ideal model organism to investigate the influence of gravity on the cellular and molecular level. Here we review the current knowledge about the question, if and how cellular signal transduction depends on the existence of gravity, with special focus on cells of the immune system. Since immune cell function is fundamental to keep the organism under imnological surveillance during the defence against pathogens, to investigate the effects and possible molecular mechanisms of altered gravity is indispensable for long-term space flights to Earth Moon or Mars. Thus, understanding the impact of gravity on cellular functions on Earth will provide not only important informations about the development of life on Earth, but also for therapeutic and preventive strategies to cope successfully with medical problems during space exploration.

  16. Delayed development of systemic immunity in preterm pigs as a model for preterm infants

    DEFF Research Database (Denmark)

    Nguyen, Duc Ninh; Jiang, Pingping; Frøkiær, Hanne

    2016-01-01

    -mediated IL-6 and TNF-α production. These immune parameters remained different between preterm and near-term pigs at 2-3 weeks, even when adjusted for post-conceptional age. Our data suggest that systemic immunity follows a distinct developmental trajectory following preterm birth that may be influenced......Preterm neonates are highly sensitive to systemic infections in early life but little is known about systemic immune development following preterm birth. We hypothesized that preterm neonates have immature systemic immunity with distinct developmental trajectory for the first several weeks of life......, relative to those born at near-term or term. Using pigs as a model, we characterized blood leukocyte subsets, antimicrobial activities and TLR-mediated cytokine production during the first weeks after preterm birth. Relative to near-term and term pigs, newborn preterm pigs had low blood leukocyte counts...

  17. Dissecting Phaseolus vulgaris innate immune system against Colletotrichum lindemuthianum infection.

    Directory of Open Access Journals (Sweden)

    Paula Rodrigues Oblessuc

    Full Text Available BACKGROUND: The genus Colletotrichum is one of the most economically important plant pathogens, causing anthracnose on a wide range of crops including common beans (Phaseolus vulgaris L.. Crop yield can be dramatically decreased depending on the plant cultivar used and the environmental conditions. This study aimed to identify potential genetic components of the bean immune system to provide environmentally friendly control measures against this fungus. METHODOLOGY AND PRINCIPAL FINDINGS: As the common bean is not amenable to reverse genetics to explore functionality and its genome is not fully curated, we used putative Arabidopsis orthologs of bean expressed sequence tag (EST to perform bioinformatic analysis and experimental validation of gene expression to identify common bean genes regulated during the incompatible interaction with C. lindemuthianum. Similar to model pathosystems, Gene Ontology (GO analysis indicated that hormone biosynthesis and signaling in common beans seem to be modulated by fungus infection. For instance, cytokinin and ethylene responses were up-regulated and jasmonic acid, gibberellin, and abscisic acid responses were down-regulated, indicating that these hormones may play a central role in this pathosystem. Importantly, we have identified putative bean gene orthologs of Arabidopsis genes involved in the plant immune system. Based on experimental validation of gene expression, we propose that hypersensitive reaction as part of effector-triggered immunity may operate, at least in part, by down-regulating genes, such as FLS2-like and MKK5-like, putative orthologs of the Arabidopsis genes involved in pathogen perception and downstream signaling. CONCLUSIONS/SIGNIFICANCE: We have identified specific bean genes and uncovered metabolic processes and pathways that may be involved in the immune response against pathogens. Our transcriptome database is a rich resource for mining novel defense-related genes, which enabled us to

  18. Anopheles gambiae antiviral immune response to systemic O'nyong-nyong infection.

    Directory of Open Access Journals (Sweden)

    Joanna Waldock

    Full Text Available Mosquito-borne viral diseases cause significant burden in much of the developing world. Although host-virus interactions have been studied extensively in the vertebrate host, little is known about mosquito responses to viral infection. In contrast to mosquitoes of the Aedes and Culex genera, Anopheles gambiae, the principal vector of human malaria, naturally transmits very few arboviruses, the most important of which is O'nyong-nyong virus (ONNV. Here we have investigated the A. gambiae immune response to systemic ONNV infection using forward and reverse genetic approaches.We have used DNA microarrays to profile the transcriptional response of A. gambiae inoculated with ONNV and investigate the antiviral function of candidate genes through RNAi gene silencing assays. Our results demonstrate that A. gambiae responses to systemic viral infection involve genes covering all aspects of innate immunity including pathogen recognition, modulation of immune signalling, complement-mediated lysis/opsonisation and other immune effector mechanisms. Patterns of transcriptional regulation and co-infections of A. gambiae with ONNV and the rodent malaria parasite Plasmodium berghei suggest that hemolymph immune responses to viral infection are diverted away from melanisation. We show that four viral responsive genes encoding two putative recognition receptors, a galectin and an MD2-like receptor, and two effector lysozymes, function in limiting viral load.This study is the first step in elucidating the antiviral mechanisms of A. gambiae mosquitoes, and has revealed interesting differences between A. gambiae and other invertebrates. Our data suggest that mechanisms employed by A. gambiae are distinct from described invertebrate antiviral immunity to date, and involve the complement-like branch of the humoral immune response, supressing the melanisation response that is prominent in anti-parasitic immunity. The antiviral immune response in A. gambiae is thus

  19. The Effect of Microbiota and the Immune System on the Development and Organization of the Enteric Nervous System.

    Science.gov (United States)

    Obata, Yuuki; Pachnis, Vassilis

    2016-11-01

    The gastrointestinal (GI) tract is essential for the absorption of nutrients, induction of mucosal and systemic immune responses, and maintenance of a healthy gut microbiota. Key aspects of gastrointestinal physiology are controlled by the enteric nervous system (ENS), which is composed of neurons and glial cells. The ENS is exposed to and interacts with the outer (microbiota, metabolites, and nutrients) and inner (immune cells and stromal cells) microenvironment of the gut. Although the cellular blueprint of the ENS is mostly in place by birth, the functional maturation of intestinal neural networks is completed within the microenvironment of the postnatal gut, under the influence of gut microbiota and the mucosal immune system. Recent studies have shown the importance of molecular interactions among microbiota, enteric neurons, and immune cells for GI homeostasis. In addition to its role in GI physiology, the ENS has been associated with the pathogenesis of neurodegenerative disorders, such as Parkinson's disease, raising the possibility that microbiota-ENS interactions could offer a viable strategy for influencing the course of brain diseases. Here, we discuss recent advances on the role of microbiota and the immune system on the development and homeostasis of the ENS, a key relay station along the gut-brain axis. Copyright © 2016 AGA Institute. Published by Elsevier Inc. All rights reserved.

  20. Genes of the major histocompatibility complex highlight interactions of the innate and adaptive immune system

    Directory of Open Access Journals (Sweden)

    Barbara Lukasch

    2017-08-01

    Full Text Available Background A well-functioning immune defence is crucial for fitness, but our knowledge about the immune system and its complex interactions is still limited. Major histocompatibility complex (MHC molecules are involved in T-cell mediated adaptive immune responses, but MHC is also highly upregulated during the initial innate immune response. The aim of our study was therefore to determine to what extent the highly polymorphic MHC is involved in interactions of the innate and adaptive immune defence and if specific functional MHC alleles (FA or heterozygosity at the MHC are more important. Methods To do this we used captive house sparrows (Passer domesticus to survey MHC diversity and immune function controlling for several environmental factors. MHC class I alleles were identified using parallel amplicon sequencing and to mirror immune function, several immunological tests that correspond to the innate and adaptive immunity were conducted. Results Our results reveal that MHC was linked to all immune tests, highlighting its importance for the immune defence. While all innate responses were associated with one single FA, adaptive responses (cell-mediated and humoral were associated with several different alleles. Discussion We found that repeated injections of an antibody in nestlings and adults were linked to different FA and hence might affect different areas of the immune system. Also, individuals with a higher number of different FA produced a smaller secondary response, indicating a disadvantage of having numerous MHC alleles. These results demonstrate the complexity of the immune system in relation to the MHC and lay the foundation for other studies to further investigate this topic.

  1. Genes of the major histocompatibility complex highlight interactions of the innate and adaptive immune system.

    Science.gov (United States)

    Lukasch, Barbara; Westerdahl, Helena; Strandh, Maria; Winkler, Hans; Moodley, Yoshan; Knauer, Felix; Hoi, Herbert

    2017-01-01

    A well-functioning immune defence is crucial for fitness, but our knowledge about the immune system and its complex interactions is still limited. Major histocompatibility complex (MHC) molecules are involved in T-cell mediated adaptive immune responses, but MHC is also highly upregulated during the initial innate immune response. The aim of our study was therefore to determine to what extent the highly polymorphic MHC is involved in interactions of the innate and adaptive immune defence and if specific functional MHC alleles (FA) or heterozygosity at the MHC are more important. To do this we used captive house sparrows ( Passer domesticus ) to survey MHC diversity and immune function controlling for several environmental factors. MHC class I alleles were identified using parallel amplicon sequencing and to mirror immune function, several immunological tests that correspond to the innate and adaptive immunity were conducted. Our results reveal that MHC was linked to all immune tests, highlighting its importance for the immune defence. While all innate responses were associated with one single FA, adaptive responses (cell-mediated and humoral) were associated with several different alleles. We found that repeated injections of an antibody in nestlings and adults were linked to different FA and hence might affect different areas of the immune system. Also, individuals with a higher number of different FA produced a smaller secondary response, indicating a disadvantage of having numerous MHC alleles. These results demonstrate the complexity of the immune system in relation to the MHC and lay the foundation for other studies to further investigate this topic.

  2. Immune cell-poor melanomas benefit from PD-1 blockade after targeted type I IFN activation.

    Science.gov (United States)

    Bald, Tobias; Landsberg, Jennifer; Lopez-Ramos, Dorys; Renn, Marcel; Glodde, Nicole; Jansen, Philipp; Gaffal, Evelyn; Steitz, Julia; Tolba, Rene; Kalinke, Ulrich; Limmer, Andreas; Jönsson, Göran; Hölzel, Michael; Tüting, Thomas

    2014-06-01

    Infiltration of human melanomas with cytotoxic immune cells correlates with spontaneous type I IFN activation and a favorable prognosis. Therapeutic blockade of immune-inhibitory receptors in patients with preexisting lymphocytic infiltrates prolongs survival, but new complementary strategies are needed to activate cellular antitumor immunity in immune cell-poor melanomas. Here, we show that primary melanomas in Hgf-Cdk4(R24C) mice, which imitate human immune cell-poor melanomas with a poor outcome, escape IFN-induced immune surveillance and editing. Peritumoral injections of immunostimulatory RNA initiated a cytotoxic inflammatory response in the tumor microenvironment and significantly impaired tumor growth. This critically required the coordinated induction of type I IFN responses by dendritic, myeloid, natural killer, and T cells. Importantly, antibody-mediated blockade of the IFN-induced immune-inhibitory interaction between PD-L1 and PD-1 receptors further prolonged the survival. These results highlight important interconnections between type I IFNs and immune-inhibitory receptors in melanoma pathogenesis, which serve as targets for combination immunotherapies. Using a genetically engineered mouse melanoma model, we demonstrate that targeted activation of the type I IFN system with immunostimulatory RNA in combination with blockade of immune-inhibitory receptors is a rational strategy to expose immune cell-poor tumors to cellular immune surveillance. ©2014 American Association for Cancer Research.

  3. Glucocorticoids interact with the hippocampal endocannabinoid system in impairing retrieval of contextual fear memory

    Science.gov (United States)

    Atsak, Piray; Hauer, Daniela; Campolongo, Patrizia; Schelling, Gustav; McGaugh, James L.; Roozendaal, Benno

    2012-01-01

    There is extensive evidence that glucocorticoid hormones impair the retrieval of memory of emotionally arousing experiences. Although it is known that glucocorticoid effects on memory retrieval impairment depend on rapid interactions with arousal-induced noradrenergic activity, the exact mechanism underlying this presumably nongenomically mediated glucocorticoid action remains to be elucidated. Here, we show that the hippocampal endocannabinoid system, a rapidly activated retrograde messenger system, is involved in mediating glucocorticoid effects on retrieval of contextual fear memory. Systemic administration of corticosterone (0.3–3 mg/kg) to male Sprague–Dawley rats 1 h before retention testing impaired the retrieval of contextual fear memory without impairing the retrieval of auditory fear memory or directly affecting the expression of freezing behavior. Importantly, a blockade of hippocampal CB1 receptors with AM251 prevented the impairing effect of corticosterone on retrieval of contextual fear memory, whereas the same impairing dose of corticosterone increased hippocampal levels of the endocannabinoid 2-arachidonoylglycerol. We also found that antagonism of hippocampal β-adrenoceptor activity with local infusions of propranolol blocked the memory retrieval impairment induced by the CB receptor agonist WIN55,212–2. Thus, these findings strongly suggest that the endocannabinoid system plays an intermediary role in regulating rapid glucocorticoid effects on noradrenergic activity in impairing memory retrieval of emotionally arousing experiences. PMID:22331883

  4. Immune system stimulation in rats by Lactobacillus sp. isolates from Raffia wine (Raphia vinifera).

    Science.gov (United States)

    Flore, Tiepma N E; François, Zambou N; Félicité, Tchouanguep M

    2010-01-01

    The immune system consists of organs and several cell types. Antigen interaction with these cells induces a cellular immune response mediated by activated cells. The effects of lactic acid bacteria on the systemic immune response and on the secretory immune system are described. The current investigation sets out to examine the possible effects of isolated wine lacto-bacilli upon various hematologic and immunologic parameters in rats. We have fed rats with probiotic isolates from Raffia wine and challenged with castor oil; two control groups were fed with castor oil and others were not. We counted blood cells at the end of the experiment; all isolates seemed to cause a decrease of circulating white blood cells. The percentage of lymphocytes and the total protein in the spleen increased in the treated animals; also a normal aspect of faeces was observed compared to the control. These isolates of Lactobacillus seem to occur to immune cell-mediated responses in rats.

  5. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  6. Will Global Climate Change Alter Fundamental Human Immune Reactivity: Implications for Child Health?

    Science.gov (United States)

    Swaminathan, Ashwin; Lucas, Robyn M; Harley, David; McMichael, Anthony J

    2014-11-11

    The human immune system is an interface across which many climate change sensitive exposures can affect health outcomes. Gaining an understanding of the range of potential effects that climate change could have on immune function will be of considerable importance, particularly for child health, but has, as yet, received minimal research attention. We postulate several mechanisms whereby climate change sensitive exposures and conditions will subtly impair aspects of the human immune response, thereby altering the distribution of vulnerability within populations-particularly for children-to infection and disease. Key climate change-sensitive pathways include under-nutrition, psychological stress and exposure to ambient ultraviolet radiation, with effects on susceptibility to infection, allergy and autoimmune diseases. Other climate change sensitive exposures may also be important and interact, either additively or synergistically, to alter health risks. Conducting directed research in this area is imperative as the potential public health implications of climate change-induced weakening of the immune system at both individual and population levels are profound. This is particularly relevant for the already vulnerable children of the developing world, who will bear a disproportionate burden of future adverse environmental and geopolitical consequences of climate change.

  7. Will Global Climate Change Alter Fundamental Human Immune Reactivity: Implications for Child Health?

    Directory of Open Access Journals (Sweden)

    Ashwin Swaminathan

    2014-11-01

    Full Text Available The human immune system is an interface across which many climate change sensitive exposures can affect health outcomes. Gaining an understanding of the range of potential effects that climate change could have on immune function will be of considerable importance, particularly for child health, but has, as yet, received minimal research attention. We postulate several mechanisms whereby climate change sensitive exposures and conditions will subtly impair aspects of the human immune response, thereby altering the distribution of vulnerability within populations—particularly for children—to infection and disease. Key climate change-sensitive pathways include under-nutrition, psychological stress and exposure to ambient ultraviolet radiation, with effects on susceptibility to infection, allergy and autoimmune diseases. Other climate change sensitive exposures may also be important and interact, either additively or synergistically, to alter health risks. Conducting directed research in this area is imperative as the potential public health implications of climate change-induced weakening of the immune system at both individual and population levels are profound. This is particularly relevant for the already vulnerable children of the developing world, who will bear a disproportionate burden of future adverse environmental and geopolitical consequences of climate change.

  8. Physiological and pathophysiological bone turnover - role of the immune system.

    Science.gov (United States)

    Weitzmann, M Neale; Ofotokun, Ighovwerha

    2016-09-01

    Osteoporosis develops when the rate of osteoclastic bone breakdown (resorption) exceeds that of osteoblastic bone formation, which leads to loss of BMD and deterioration of bone structure and strength. Osteoporosis increases the risk of fragility fractures, a cause of substantial morbidity and mortality, especially in elderly patients. This imbalance between bone formation and bone resorption is brought about by natural ageing processes, but is frequently exacerbated by a number of pathological conditions. Of importance to the aetiology of osteoporosis are findings over the past two decades attesting to a deep integration of the skeletal system with the immune system (the immuno-skeletal interface (ISI)). Although protective of the skeleton under physiological conditions, the ISI might contribute to bone destruction in a growing number of pathophysiological states. Although numerous research groups have investigated how the immune system affects basal and pathological osteoclastic bone resorption, recent findings suggest that the reach of the adaptive immune response extends to the regulation of osteoblastic bone formation. This Review examines the evolution of the field of osteoimmunology and how advances in our understanding of the ISI might lead to novel approaches to prevent and treat bone loss, and avert fractures.

  9. Regulation of TGFβ in the immune system: an emerging role for integrins and dendritic cells.

    Science.gov (United States)

    Worthington, John J; Fenton, Thomas M; Czajkowska, Beata I; Klementowicz, Joanna E; Travis, Mark A

    2012-12-01

    Regulation of an immune response requires complex crosstalk between cells of the innate and adaptive immune systems, via both cell-cell contact and secretion of cytokines. An important cytokine with a broad regulatory role in the immune system is transforming growth factor-β (TGF-β). TGF-β is produced by and has effects on many different cells of the immune system, and plays fundamental roles in the regulation of immune responses during homeostasis, infection and disease. Although many cells can produce TGFβ, it is always produced as an inactive complex that must be activated to bind to the TGFβ receptor complex and promote downstream signalling. Thus, regulation of TGFβ activation is a crucial step in controlling TGFβ function. This review will discuss how TGFβ controls diverse immune responses and how TGFβ function is regulated, with a focus on recent work highlighting a critical role for the integrin αvβ8 expressed by dendritic cells in activating TGFβ. Copyright © 2012 Elsevier GmbH. All rights reserved.

  10. Dual role of delay effects in a tumour-immune system.

    Science.gov (United States)

    Yu, Min; Dong, Yueping; Takeuchi, Yasuhiro

    2017-08-01

    In this paper, a previous tumour-immune interaction model is simplified by neglecting a relatively weak direct immune activation by the tumour cells, which can still keep the essential dynamics properties of the original model. As the immune activation process is not instantaneous, we now incorporate one delay for the activation of the effector cells (ECs) by helper T cells (HTCs) into the model. Furthermore, we investigate the stability and instability regions of the tumour-presence equilibrium state of the delay-induced system with respect to two parameters, the activation rate of ECs by HTCs and the HTCs stimulation rate by the presence of identified tumour antigens. We show the dual role of this delay that can induce stability switches exhibiting destabilization as well as stabilization of the tumour-presence equilibrium. Besides, our results reveal that an appropriate immune activation time delay plays a significant role in control of tumour growth.

  11. Characterising the CRISPR immune system in Archaea using genome sequence analysis

    DEFF Research Database (Denmark)

    Shah, Shiraz Ali

    Archaea, a group of microorganisms distinct from bacteria and eukaryotes, are equipped with an adaptive immune system called the CRISPR system, which relies on an RNA interference mechanism to combat invading viruses and plasmids. Using a genome sequence analysis approach, the four components...... of archaeal genomic CRISPR loci were analysed, namely, repeats, spacers, leaders and cas genes. Based on analysis of spacer sequences it was predicted that the immune system combats viruses and plasmids by targeting their DNA. Furthermore, analysis of repeats, leaders and cas genes revealed that CRISPR...... systems exist as distinct families which have key differences between themselves. Closely related organisms were seen harbouring different CRISPR systems, while some distantly related species carried similar systems, indicating frequent horizontal exchange. Moreover, it was found that cas genes of Type I...

  12. The effect of tonsillectomy on the immune system: A systematic review and meta-analysis.

    Science.gov (United States)

    Bitar, Mohamad A; Dowli, Alexander; Mourad, Marc

    2015-08-01

    The immunological sequelae of tonsillectomy in children have been a source of debate among physicians and a continuous concern for parents. Contradictory pertinent results exist in the literature. To understand the real effect of tonsillectomy on the immune system. MEDLINE, EMBASE and COCHRANE. Articles addressing the effect of tonsillectomy on the immune system, up to Dec 2014. Related keywords and medical subject headings were used during the search. The abstracts were reviewed to determine suitability for inclusion based on a set of criteria. Manual crosscheck of references was performed. We checked the tests results and the conclusion of each study to classify it as supporting or refuting the hypothesis of a negative effect of tonsillectomy on the immune system. We reviewed 35 articles, published between 1971 and 2014, including 1997 patients. Only Four studies (11.4%), including 406 patients (20.3%) found that tonsillectomy negatively affects the immune system. We performed a separate meta-analysis on various reviewed humoral and cellular immunological parameters (e.g. total and specific serum Ig's, SecIgA, cellular immunity, and Ag specific Ig). There is more evidence to suggest that tonsillectomy has no negative clinical or immunological sequalae on the immune system. Study limitations included heterogeneity in the diagnostic tools, timing of testing, indication for tonsillectomy and patients' age. It is reasonable to say that there is enough evidence to conclude that tonsillectomy has no clinically significant negative effect on the immune system. It will be important for future studies to uniformly use both preoperative and control laboratory tests' levels to compare the postoperative levels with, to have short and long term follow-up levels, and to include both humoral and cellular immunity in their measurements. The results should reassure both surgeons and parents that tonsillectomy has no proven clinical sequalae. If more research is to be done in the

  13. Effects of alcohol consumption on the allergen-specific immune response in mice

    DEFF Research Database (Denmark)

    Linneberg, Allan; Roursgaard, Martin; Hersoug, Lars-Georg

    2008-01-01

    There is evidence that chronic alcohol consumption impairs the T-helper 1 (Th1) lymphocyte-regulated cell-mediated immune response possibly favoring a Th2 deviation of the immune response. Moreover, a few epidemiological studies have linked alcohol consumption to allergen-specific IgE sensitization....

  14. Small and Long Regulatory RNAs in the Immune System and Immune Diseases

    OpenAIRE

    Stachurska, Anna; Zorro, Maria M.; van der Sijde, Marijke R.; Withoff, Sebo

    2014-01-01

    Cellular differentiation is regulated on the level of gene expression, and it is known that dysregulation of gene expression can lead to deficiencies in differentiation that contribute to a variety of diseases, particularly of the immune system. Until recently, it was thought that the dysregulation was governed by changes in the binding or activity of a class of proteins called transcription factors. However, the discovery of micro-RNAs and recent descriptions of long non-coding RNAs (lncRNAs...

  15. Construction of an integrated gene regulatory network link to stress-related immune system in cattle.

    Science.gov (United States)

    Behdani, Elham; Bakhtiarizadeh, Mohammad Reza

    2017-10-01

    The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.

  16. The application of an artificial immune system for solving the identification problem

    Directory of Open Access Journals (Sweden)

    Astachova Irina

    2017-01-01

    Full Text Available Ecological prognosis sets the identification task, which is to find the capacity of pollution sources based on the available experimental data. This problem is an inverse problem, for the solution of which the method of symbolic regression is considered. The distributed artificial immune system is used as an algorithm for the problem solving. The artificial immune system (AIS is a model that allows solving various problems of identification, its concept was borrowed from biology. The solution is sought using a distributed version of the artificial immune system, which is implemented through a network. This distributed network can operate in any heterogeneous environment, which is achieved through the use of cross-platform Python programming language. AIS demonstrates the ability to restore the original function in the problem of identification. The obtained solution for the test data is represented by the graph.

  17. The role of retinoic acid in tolerance and immunity.

    Science.gov (United States)

    Hall, Jason A; Grainger, John R; Spencer, Sean P; Belkaid, Yasmine

    2011-07-22

    Vitamin A elicits a broad array of immune responses through its metabolite, retinoic acid (RA). Recent evidence indicates that loss of RA leads to impaired immunity, whereas excess RA can potentially promote inflammatory disorders. In this review, we discuss recent advances showcasing the crucial contributions of RA to both immunological tolerance and the elicitation of adaptive immune responses. Further, we provide a comprehensive overview of the cell types and factors that control the production of RA and discuss how host perturbations may affect the ability of this metabolite to control tolerance and immunity or to instigate pathology. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Immune system handling time may alter the outcome of competition between pathogens and the immune system.

    Science.gov (United States)

    Greenspoon, Philip B; Banton, Sydney; Mideo, Nicole

    2018-06-14

    Predators may be limited in their ability to kill prey (i.e., have type II or III functional responses), an insight that has had far-reaching consequences in the ecological literature. With few exceptions, however, this possibility has not been extended to the behaviour of immune cells, which kill pathogens much as predators kill their prey. Rather, models of the within-host environment have tended to tacitly assume that immune cells have an unlimited ability to target and kill pathogens (i.e., a type I functional response). Here we explore the effects of changing this assumption on infection outcomes (i.e., pathogen loads). We incorporate immune cell handling time into an ecological model of the within-host environment that considers both the predatory nature of the pathogen-immune cell interaction as well as competition between immune cells and pathogens for host resources. Unless pathogens can preempt immune cells for host resources, adding an immune cell handling time increases equilibrium pathogen load. We find that the shape of the relationship between energy intake and pathogen load can change: with a type I functional response, pathogen load is maximised at intermediate inputs, while for a type II or III functional response, pathogen load is solely increasing. With a type II functional response, pathogen load can fluctuate rather than settling to an equilibrium, a phenomenon unobserved with type I or III functional responses. Our work adds to a growing literature highlighting the role of resource availability in host-parasite interactions. Implications of our results for adaptive anorexia are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Hygiene and other early childhood influences on the subsequent function of the immune system.

    Science.gov (United States)

    Rook, Graham A W; Lowry, Christopher A; Raison, Charles L

    2015-08-18

    The immune system influences brain development and function. Hygiene and other early childhood influences impact the subsequent function of the immune system during adulthood, with consequences for vulnerability to neurodevelopmental and psychiatric disorders. Inflammatory events during pregnancy can act directly to cause developmental problems in the central nervous system (CNS) that have been implicated in schizophrenia and autism. The immune system also acts indirectly by "farming" the intestinal microbiota, which then influences brain development and function via the multiple pathways that constitute the gut-brain axis. The gut microbiota also regulates the immune system. Regulation of the immune system is crucial because inflammatory states in pregnancy need to be limited, and throughout life inflammation needs to be terminated completely when not required; for example, persistently raised levels of background inflammation during adulthood (in the presence or absence of a clinically apparent inflammatory stimulus) correlate with an increased risk of depression. A number of factors in the perinatal period, notably immigration from rural low-income to rich developed settings, caesarean delivery, breastfeeding and antibiotic abuse have profound effects on the microbiota and on immunoregulation during early life that persist into adulthood. Many aspects of the modern western environment deprive the infant of the immunoregulatory organisms with which humans co-evolved, while encouraging exposure to non-immunoregulatory organisms, associated with more recently evolved "crowd" infections. Finally, there are complex interactions between perinatal psychosocial stressors, the microbiota, and the immune system that have significant additional effects on both physical and psychiatric wellbeing in subsequent adulthood. This article is part of a Special Issue entitled Neuroimmunology in Health And Disease. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights

  20. Orchestration of pulmonary T cell immunity during Mycobacterium tuberculosis infection: immunity interruptus

    Science.gov (United States)

    Behar, Samuel M.; Carpenter, Stephen M.; Booty, Matthew G.; Barber, Daniel L.; Jayaraman, Pushpa

    2014-01-01

    Despite the introduction almost a century ago of Mycobacterium bovis BCG (BCG), an attenuated form of M. bovis that is used as a vaccine against Mycobacterium tuberculosis, tuberculosis remains a global health threat and kills more than 1.5 million people each year. This is mostly because BCG fails to prevent pulmonary disease – the contagious form of tuberculosis. Although there have been significant advances in understanding how the immune system responds to infection, the qualities that define protective immunity against M. tuberculosis remain poorly characterized. The ability to predict who will maintain control over the infection and who will succumb to clinical disease would revolutionize our approach to surveillance, control, and treatment. Here we review the current understanding of pulmonary T cell responses following M. tuberculosis infection. While infection elicits a strong immune response that contains infection, M. tuberculosis evades eradication. Traditionally, its intracellular lifestyle and alteration of macrophage function are viewed as the dominant mechanisms of evasion. Now we appreciate that chronic inflammation leads to T cell dysfunction. While this may arise as the host balances the goals of bacterial sterilization and avoidance of tissue damage, it is becoming clear that T cell dysfunction impairs host resistance. Defining the mechanisms that lead to T cell dysfunction is crucial as memory T cell responses are likely to be subject to the same subject to the same pressures. Thus, success of T cell based vaccines is predicated on memory T cells avoiding exhaustion while at the same time not promoting overt tissue damage. PMID:25311810

  1. Loss of renal function causes premature aging of the immune system.

    Science.gov (United States)

    Betjes, Michiel G H; Meijers, Ruud W J; Litjens, Nicolle H R

    2013-01-01

    Uremia-associated immune deficiency is a well-known complication of loss of renal function and contributes significantly to the overall mortality and morbidity of patients with end-stage renal disease. Chronic inflammation and increased oxidative stress are underlying the uremia-associated immune deficiency. In this review, the differential impact of uremia on the cellular immune system is summarized. Virtually all immune cells studied show a combination of an activated status and loss of function. However, uremia preferentially decreases the number and function of lymphoid cells while myeloid cells show normal and/or elevated cell numbers with increased production of inflammatory cytokines and reactive oxygen species. These particular changes are compatible with immunological aging, which is characterized by loss of thymic function, attrition of telomeres and an expanded memory T cell population. Similar to aging in healthy individuals, the proinflammatory and potential cardiotoxic subsets of CD28(null) T cells and CD16(+) monocytes are increased. Epigenetically changed hematopoietic stem cells may be involved in immunological aging as specific DNA regions become hypermethylated. Proinflammatory T cells and monocytes persist after kidney transplantation, which constitutes a persistent cardiovascular risk factor. Possible therapeutic options to reverse or halt uremia-associated immunological aging are discussed. Premature aging of the immune system is a dominant feature in patients with end-stage renal failure, which corresponds to immunological aging in elderly healthy individuals, which is characterized by preferential loss of cells belonging to the lymphoid cell lineage, inflammation and expansion of proinflammatory immune cells. © 2013 S. Karger AG, Basel.

  2. Candidate innate immune system gene expression in the ecological model Daphnia.

    Science.gov (United States)

    Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J

    2011-10-01

    The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive

  3. Influence of Hesperidin on the Systemic and Intestinal Rat Immune Response

    Directory of Open Access Journals (Sweden)

    Mariona Camps-Bossacoma

    2017-06-01

    Full Text Available Polyphenols, widely found in edible plants, influence the immune system. Nevertheless, the immunomodulatory properties of hesperidin, the predominant flavanone in oranges, have not been deeply studied. To establish the effect of hesperidin on in vivo immune response, two different conditions of immune system stimulations in Lewis rats were applied. In the first experimental design, rats were intraperitoneally immunized with ovalbumin (OVA plus Bordetella pertussis toxin and alum as the adjuvants, and orally given 100 or 200 mg/kg hesperidin. In the second experimental design, rats were orally sensitized with OVA together with cholera toxin and fed a diet containing 0.5% hesperidin. In the first approach, hesperidin administration changed mesenteric lymph node lymphocyte (MLNL composition, increasing the TCRαβ+ cell percentage and decreasing that of B lymphocytes. Furthermore, hesperidin enhanced the interferon (IFN-γ production in stimulated MLNL. In the second approach, hesperidin intake modified the lymphocyte composition in the intestinal epithelium (TCRγδ+ cells and the lamina propria (TCRγδ+, CD45RA+, natural killer, natural killer T, TCRαβ+CD4+, and TCRαβ+CD8+ cells. Nevertheless, hesperidin did not modify the level of serum anti-OVA antibodies in either study. In conclusion, hesperidin does possess immunoregulatory properties in the intestinal immune response, but this effect is not able to influence the synthesis of specific antibodies.

  4. Antioxidant status, immune system, blood metabolites and carcass ...

    African Journals Online (AJOL)

    This experiment was conducted to evaluate the effects of dietary turmeric rhizome powder (TP) on performance, blood metabolite, immune system, antioxidant status, and relative weight of organs in pre and post heat stressed broilers. Two hundred and sixty-four (264) day-old male Arian broiler chicks were randomly ...

  5. Combined local and systemic immunization is essential for durable T-cell mediated heterosubtypic immunity against influenza A virus

    DEFF Research Database (Denmark)

    Uddbäck, Ida Elin Maria; Pedersen, Line M I; Pedersen, Sara R

    2016-01-01

    nucleoprotein have previously been found to induce short-term protection in mice. In this study we confirm that systemic (subcutaneous (s.c.) immunization rapidly induced heterosubtypic protection predominantly mediated by CD8 T cells, but within three months clinical protection completely disappeared. Local......The threat from unpredictable influenza virus pandemics necessitates the development of a new type of influenza vaccine. Since the internal proteins are highly conserved, induction of T cells targeting these antigens may provide the solution. Indeed, adenoviral (Ad) vectors expressing flu...... (intranasal (i.n.)) immunization elicited delayed, but more lasting protection despite relatively inefficient immunization. However, by far, the most robust protection was induced by simultaneous, combined (i.n. + s.c.) vaccination, and, notably, in this case clinical protection lasted at least 8 months...

  6. Influence on the mouse immune system of chronic ingestion of 137Cs

    International Nuclear Information System (INIS)

    Bertho, Jean-Marc; Faure, Marie-Cecile; Louiba, Sonia; Tourlonias, Elie; Stefani, Johanna; Siffert, Baptiste; Paquet, Francois; Dublineau, Isabelle

    2011-01-01

    The aim of this work was to determine the possible occurrence of damage to the immune system during the course of chronic ingestion of 137 Cs. BALB/C mice were used, with 137 Cs intake via drinking water at a concentration of 20 kBq l -1 . Adults received 137 Cs before mating and offspring were sacrificed at various ages between birth and 20 weeks. Phenotypic analysis of circulating blood cells and thymocytes did not show any significant modification of immune cell populations in animals ingesting 137 Cs as compared with control animals, with the exception of a slight increase in Treg percentage at the age of 12 weeks. Functional tests, including proliferative response to mitogens such as phytohaemagglutinin, response to alloantigens in mixed lymphocyte reaction and immunoglobulin response to vaccine antigens such as tetanus toxin and keyhole limpet haemocyanin did not show any significant functional modification of the immune system in 137 Cs-ingesting animals as compared with control animals. Overall, our results suggest that chronic ingestion of a low concentration of 137 Cs in drinking water in the long term does not have any biologically relevant effect on the immune system.

  7. Nutritional modulation of age-related changes in the immune system and risk of infection

    Science.gov (United States)

    The immune system undergoes some adverse alterations during aging, many of which have been implicated in the increased morbidity and mortality associated with infection in the elderly. In addition to intrinsic changes to the immune system with aging, the elderly are more likely to have poor nutritio...

  8. Impairment of T-regulatory cells in cord blood of atopic mothers.

    Science.gov (United States)

    Schaub, Bianca; Liu, Jing; Höppler, Sabine; Haug, Severine; Sattler, Christine; Lluis, Anna; Illi, Sabina; von Mutius, Erika

    2008-06-01

    Maternal atopy is a strong predictor for the development of childhood allergic diseases. The underlying mechanisms are ill defined, yet regulatory T (Treg) and T(H)17 cells may play a key role potentially shaping the early immune system toward a proallergic or antiallergic immune regulation. We examined T(H)1/T(H)2, Treg, and T(H)17 cell responses to innate (lipid A/peptidoglycan) and mitogen/adaptive (phytohemagglutinin/Dermatophagoides pteronyssinus 1) immune stimulation in cord blood from offspring of atopic/nonatopic mothers. Cord blood mononuclear cells from 161 healthy neonates (59% nonatopic, 41% atopic mothers) were investigated regarding Treg and T(H)17 cells (mRNA/surface markers), suppressive function, and proliferation/cytokine secretion. Cord blood from offspring of atopic mothers showed fewer innate-induced Treg cells (CD4(+)CD25(+)high), lower mRNA expression of associated markers (glucocorticoid-induced tumor necrosis factor receptor-related protein/lymphocyte activation gene 3; P cell function was impaired in mitogen-induced suppression of T effector cells in cord blood of offspring from atopic mothers (P = .03). Furthermore, IL-10 and IFN-gamma secretion were decreased in innate-stimulated cord blood of offspring from atopic mothers (P = .04/.05). Innate-induced IL-17 was independent of maternal atopy and highly correlated with IL-13 secretion. In offspring of atopic mothers, Treg cell numbers, expression, and function were impaired at birth. T(H)17 cells were correlated with T(H)2 cells, independently of maternal atopy.

  9. Knockdown of autophagy enhances innate immune response in hepatitis C virus infected hepatocytes

    Science.gov (United States)

    Shrivastava, Shubham; Raychoudhuri, Amit; Steele, Robert; Ray, Ranjit; Ray, Ratna B.

    2010-01-01

    The role of autophagy in disease pathogenesis following viral infection is beginning to be elucidated. We have previously reported that hepatitis C virus (HCV) infection in hepatocytes induces autophagy. However, the biological significance of HCV induced autophagy has not been clarified. Autophagy has recently been identified as a novel component of innate immune system against viral infection. In the present study, we have shown that knockdown of autophagy related protein Beclin1 or ATG7 in immortalized human hepatocytes (IHH) inhibited HCV growth. Beclin1 or ATG7 knockdown IHH when infected with HCV exhibited an increased expression of IFN-β, OAS-1, IFN-α and IFI27 mRNAs of the interferon signaling pathways as compared to infection of control IHH. Subsequent study demonstrated that HCV infection in autophagy impaired IHH displayed caspase activation, PARP cleavage and apoptotic cell death. Conclusion The disruption of autophagy machinery in HCV infected hepatocytes activated IFN signaling pathway, and induced apoptosis. Together, these results suggest that HCV induced autophagy impairs innate immune response. PMID:21274862

  10. Vitamin C and Immune Function

    Directory of Open Access Journals (Sweden)

    Anitra C. Carr

    2017-11-01

    Full Text Available Vitamin C is an essential micronutrient for humans, with pleiotropic functions related to its ability to donate electrons. It is a potent antioxidant and a cofactor for a family of biosynthetic and gene regulatory enzymes. Vitamin C contributes to immune defense by supporting various cellular functions of both the innate and adaptive immune system. Vitamin C supports epithelial barrier function against pathogens and promotes the oxidant scavenging activity of the skin, thereby potentially protecting against environmental oxidative stress. Vitamin C accumulates in phagocytic cells, such as neutrophils, and can enhance chemotaxis, phagocytosis, generation of reactive oxygen species, and ultimately microbial killing. It is also needed for apoptosis and clearance of the spent neutrophils from sites of infection by macrophages, thereby decreasing necrosis/NETosis and potential tissue damage. The role of vitamin C in lymphocytes is less clear, but it has been shown to enhance differentiation and proliferation of B- and T-cells, likely due to its gene regulating effects. Vitamin C deficiency results in impaired immunity and higher susceptibility to infections. In turn, infections significantly impact on vitamin C levels due to enhanced inflammation and metabolic requirements. Furthermore, supplementation with vitamin C appears to be able to both prevent and treat respiratory and systemic infections. Prophylactic prevention of infection requires dietary vitamin C intakes that provide at least adequate, if not saturating plasma levels (i.e., 100–200 mg/day, which optimize cell and tissue levels. In contrast, treatment of established infections requires significantly higher (gram doses of the vitamin to compensate for the increased inflammatory response and metabolic demand.

  11. Does exposure to UV radiation induce a shift to a Th-2-like immune reaction?

    International Nuclear Information System (INIS)

    Ullrich, S.E.

    1996-01-01

    In addition to being the primary cause of skin cancer, UV radiation is immune suppressive and there appears to be a link between the ability of UV to suppress the immune response and induce skin cancer. Cytokines made by UV-irradiated keratinocytes play an essential role in activating immune suppression. In particular, we have found that keratinocyte-derived interleukin (IL)-10 is responsible for the systemic impairment of antigen presenting cell function and the UV-induced suppression of delayed-type hypersenstivity (DTH). Antigen presentation by splenic adherent cells isolated from UV-irradiated mice to T helper-1 type T (Th1) cells is suppressed, whereas antigen presentation to T helper-2 type T (Th2) cells is enhanced. The enhanced antigen presentation to Th2 cells and the impaired presentation to Th1 cells can be reversed in vivo by injecting the UV-irradiated mice with monoclonal anti-IL-10 antibody. Furthermore, immune suppression can be transferred from UV-irradiated mice to normal recipients by adoptive transfer of T cells. Injecting the recipient mice with anti-IL-4 or anti-IL-10 prevents the transfer of immune suppression, suggesting the suppressor cells are Th2 cells. In addition, injecting UV-irradiated mice with IL-12, a cytokine that has been shown to be the primary inducer of Th1 cells, and one that prevents the differentiation of Th2 cells in vivo, reverses UV-induced immune suppression. These findings support the hypothesis that UV exposure activates IL-10 secretion, which depresses the function of Th1 cells, while enhancing the activity of Th2 cells. (Author)

  12. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans

    NARCIS (Netherlands)

    Kox, M.; Eijk, L.T.G.J. van; Zwaag, J.; Wildenberg, J. van den; Sweep, F.C.; Hoeven, J.G. van der; Pickkers, P.

    2014-01-01

    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot

  13. Plant innate immunity

    Indian Academy of Sciences (India)

    Plants are invaded by an array of pathogens of which only a few succeed in causing disease. The attack by others is countered by a sophisticated immune system possessed by the plants. The plant immune system is broadly divided into two, viz. microbial-associated molecular-patterns-triggered immunity (MTI) and ...

  14. Analytical tools for the study of cellular glycosylation in the immune system

    Directory of Open Access Journals (Sweden)

    Yvette eVan Kooyk

    2013-12-01

    Full Text Available It is becoming increasingly clear that glycosylation plays important role in intercellular communication within the immune system. Glycosylation-dependent interactions are crucial for the innate and adaptive immune system and regulate immune cell trafficking, synapse formation, activation, and survival. These functions take place by the cis or trans interaction of lectins with glycans. Classical immunological and biochemical methods have been used for the study of lectin function; however, the investigation of their counterparts, glycans, requires very specialized methodologies that have been extensively developed in the past decade within the Glycobiology scientific community. This Mini-Review intends to summarize the available technology for the study of glycan biosynthesis, its regulation and characterization for their application to the study of glycans in Immunology.

  15. Immunity's fourth dimension: approaching the circadian-immune connection.

    Science.gov (United States)

    Arjona, Alvaro; Silver, Adam C; Walker, Wendy E; Fikrig, Erol

    2012-12-01

    The circadian system ensures the generation and maintenance of self-sustained ~24-h rhythms in physiology that are linked to internal and environmental changes. In mammals, daily variations in light intensity and other cues are integrated by a hypothalamic master clock that conveys circadian information to peripheral molecular clocks that orchestrate physiology. Multiple immune parameters also vary throughout the day and disruption of circadian homeostasis is associated with immune-related disease. Here, we discuss the molecular links between the circadian and immune systems and examine their outputs and disease implications. Understanding the mechanisms that underlie circadian-immune crosstalk may prove valuable for devising novel prophylactic and therapeutic interventions. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-16-2-0031 TITLE: Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines PRINCIPAL...SUBTITLE 5a. CONTRACT NUMBER Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines 5b. GRANT NUMBER W81XWH-16-2-0031 5c...adaptive (T and B cell) responses will be measured using molecular and cellular approaches and the data analyzed using a systems biology approach

  17. Model systems to analyze the role of miRNAs and commensal microflora in bovine mucosal immune system development.

    Science.gov (United States)

    Liang, Guanxiang; Malmuthuge, Nilusha; Guan, Le Luo; Griebel, Philip

    2015-07-01

    Information is rapidly accumulating regarding the role of miRNAs as key regulators of immune system development and function. It is also increasingly evident that miRNAs play an important role in host-pathogen interactions through regulation of both innate and acquired immune responses. Little is known, however, about the specific role of miRNAs in regulating normal development of the mucosal immune system, especially during the neonatal period. Furthermore, there is limited knowledge regarding the possible role the commensal microbiome may play in regulating mucosal miRNAs expression, although evidence is emerging that a variety of enteric pathogens influence miRNA expression. The current review focuses on recent information that miRNAs play an important role in regulating early development of the bovine mucosal immune system. A possible role for the commensal microbiome in regulating mucosal development by altering miRNA expression is also discussed. Finally, we explore the potential advantages of using the newborn calf as a model to determine how interactions between developmental programming, maternal factors in colostrum, and colonization of the