WorldWideScience

Sample records for impaired epidermal wound

  1. Epidermal growth factor in alkali-burned corneal epithelial wound healing.

    Science.gov (United States)

    Singh, G; Foster, C S

    1987-06-15

    We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

  2. Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

    Directory of Open Access Journals (Sweden)

    Sabita N. Saldanha

    2015-12-01

    Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

  3. Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

    Directory of Open Access Journals (Sweden)

    Michelle T Juarez

    2011-12-01

    Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

  4. Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

    Science.gov (United States)

    Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

    2010-07-20

    The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.

  5. Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis

    Science.gov (United States)

    Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin

    2016-01-01

    Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054

  6. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  7. Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.

    Science.gov (United States)

    Tsai, Chang-Ru; Anderson, Aimee E; Burra, Sirisha; Jo, Juyeon; Galko, Michael J

    2017-07-01

    Yorkie (Yki), the transcriptional co-activator of the Hippo signaling pathway, has well-characterized roles in balancing apoptosis and cell division during organ growth control. Yki is also required in diverse tissue regenerative contexts. In most cases this requirement reflects its well-characterized roles in balancing apoptosis and cell division. Whether Yki has repair functions outside of the control of cell proliferation, death, and growth is not clear. Here we show that Yki and Scalloped (Sd) are required for epidermal wound closure in the Drosophila larval epidermis. Using a GFP-tagged Yki transgene we show that Yki transiently translocates to some epidermal nuclei upon wounding. Genetic analysis strongly suggests that Yki interacts with the known wound healing pathway, Jun N-terminal kinase (JNK), but not with Platelet Derived Growth Factor/Vascular-Endothelial Growth Factor receptor (Pvr). Yki likely acts downstream of or parallel to JNK signaling and does not appear to regulate either proliferation or apoptosis in the larval epidermis during wound repair. Analysis of actin structures after wounding suggests that Yki and Sd promote wound closure through actin regulation. In sum, we found that Yki regulates an epithelial tissue repair process independently of its previously documented roles in balancing proliferation and apoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Enhanced healing of mitomycin C-treated healing-impaired wounds in rats with PRP-containing fragmin/protamine microparticles (PRP&F/P MPs).

    Science.gov (United States)

    Takikawa, Megumi; Ishihara, Masayuki; Takabayashi, Yuki; Sumi, Yuki; Takikawa, Makoto; Yoshida, Ryuichi; Nakamura, Shingo; Hattori, Hidemi; Yanagibayashi, Satoshi; Yamamoto, Naoto; Kiyosawa, Tomoharu

    2015-04-13

    The purpose of this study was to evaluate the accelerating effects of platelet-rich plasma-containing (PRP&) fragmin/protamine microparticles (F/P MPs) for repairing mitomycin C-treated healing-impaired wounds. Staining with terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL-staining) showed that apoptosis of dermal fibroblast cells (DFCs) and epidermal keratinocyte cells (EKCs) were significantly induced in the skin of the mitomycin C-treated rats. Full-thickness skin defects were made on the back of rats and mitomycin C was applied on the wounds to prepare a healing-impaired wound. After washing out the mitomycin C, saline (control), F/P MPs alone, PRP alone, and PRP&F/P MPs were injected around the wounds. The rats were later euthanised and histological sections of the wounds were then prepared at indicated time periods after the treatment. These results indicated the numbers of large, medium, and small capillary lumens 7 days after injection of PRP&F/P MPs were significantly higher than those after injection of PRP or F/P MPs alone. Furthermore, epithelium and granulation tissue formations were significantly stimulated in the healing-impaired wounds treated with PRP&F/P MPs 3, 7 and 14 days after injection of PRP&F/P MPs.

  9. Wound Healing in Patients With Impaired Kidney Function.

    Science.gov (United States)

    Maroz, Natallia; Simman, Richard

    2013-04-01

    Renal impairment has long been known to affect wound healing. However, information on differences in the spectrum of wound healing depending on the type of renal insufficiency is limited. Acute kidney injury (AKI) may be observed with different wound types. On one hand, it follows acute traumatic conditions such as crush injury, burns, and post-surgical wounds, and on the other hand, it arises as simultaneous targeting of skin and kidneys by autoimmune-mediated vasculitis. Chronic kidney disease (CKD) and end-stage renal disease (ESRD) often occur in older people, who have limited physical mobility and predisposition for developing pressure-related wounds. The common risk factors for poor wound healing, generally observed in patients with CKD and ESRD, include poorly controlled diabetes mellitus, neuropathy, peripheral vascular disease, chronic venous insufficiency, and aging. ESRD patients have a unique spectrum of wounds related to impaired calcium-phosphorus metabolism, including calciphylaxis, in addition to having the risk factors presented by CKD patients. Overall, there is a wide range of uremic toxins: they may affect local mechanisms of wound healing and also adversely affect the functioning of multiple systems. In the present literature review, we discuss the association between different types of renal impairments and their effects on wound healing and examine this association from different aspects related to the management of wounds in renal impairment patients.

  10. Wound-Healing Potential of Cultured Epidermal Sheets Is Unaltered after Lyophilization: A Preclinical Study in Comparison to Cryopreserved CES

    Directory of Open Access Journals (Sweden)

    H. Jang

    2013-01-01

    Full Text Available Lyophilized Cultured Epidermal Sheets (L-CES have been reported to be as effective as the cryopreserved CES (F-CES in treating skin ulcers. However, unlike F-CES, no preclinical study assessing wound-healing effects has been conducted for L-CES. The present study was set out to investigate the microstructure, cytokine profile, and wound-healing effects of L-CES in comparison to those of F-CES. Keratinocytes were cultured to prepare CES, followed by cryopreservation at −70°C and lyophilization. Under microscopic observation, intact cells with apparent intracellular junctions were observed in L-CES. The L-CES, like fresh CES, consisted of three to four well-maintained epidermal layers, as shown by the expression of keratins, involucrin, and p63. There were no differences in the epidermal layer or protein expression between L-CES and F-CES, and both CES were comparable to fresh CES. TGF-α, EGF, VEGF, IL-1α, and MMPs were detected in L-CES at levels similar to those in F-CES. In a mouse study, wounds treated with L-CES or F-CES completely healed at least 4 days faster than untreated wounds. CES-treated wounds completely healed by day 10, while the untreated wounds did not heal by day 14. Masson’s trichrome staining showed that collagen deposition in the CES-treated wounds was highly increased in the dermis of the wound center compared to that in the control wounds. Thus, this study demonstrates that L-CES is as clinically effective as F-CES for wound treatment.

  11. Macrophage dysfunction impairs resolution of inflammation in the wounds of diabetic mice.

    Directory of Open Access Journals (Sweden)

    Savita Khanna

    2010-03-01

    Full Text Available Chronic inflammation is a characteristic feature of diabetic cutaneous wounds. We sought to delineate novel mechanisms involved in the impairment of resolution of inflammation in diabetic cutaneous wounds. At the wound-site, efficient dead cell clearance (efferocytosis is a pre-requisite for the timely resolution of inflammation and successful healing.Macrophages isolated from wounds of diabetic mice showed significant impairment in efferocytosis. Impaired efferocytosis was associated with significantly higher burden of apoptotic cells in wound tissue as well as higher expression of pro-inflammatory and lower expression of anti-inflammatory cytokines. Observations related to apoptotic cell load at the wound site in mice were validated in the wound tissue of diabetic and non-diabetic patients. Forced Fas ligand driven elevation of apoptotic cell burden at the wound site augmented pro-inflammatory and attenuated anti-inflammatory cytokine response. Furthermore, successful efferocytosis switched wound macrophages from pro-inflammatory to an anti-inflammatory mode.Taken together, this study presents first evidence demonstrating that diabetic wounds suffer from dysfunctional macrophage efferocytosis resulting in increased apoptotic cell burden at the wound site. This burden, in turn, prolongs the inflammatory phase and complicates wound healing.

  12. Plasminogen activation independent of uPA and tPA maintains wound healing in gene-deficient mice

    DEFF Research Database (Denmark)

    Lund, Leif R; Green, Kirsty A; Stoop, Allart A

    2006-01-01

    Simultaneous ablation of the two known activators of plasminogen (Plg), urokinase-type (uPA) and the tissue-type (tPA), results in a substantial delay in skin wound healing. However, wound closure and epidermal re-epithelialization are significantly less impaired in uPA;tPA double-deficient mice ...

  13. Impaired cutaneous wound healing in mice lacking tetranectin

    DEFF Research Database (Denmark)

    Iba, Kousuke; Hatakeyama, Naoko; Kojima, Takashi

    2009-01-01

    disruption of the tetranectin gene to elucidate the biological function of tetranectin. In this study, we showed that wound healing was markedly delayed in tetranectin-null mice compared with wild-type mice. A single full-thickness incision was made in the dorsal skin. By 14 days after the incision......, the wounds fully healed in all wild-type mice based on the macroscopic closure; in contrast, the progress of wound healing in the tetranectin null mice appeared to be impaired. In histological analysis, wounds of wild-type mice showed complete reepithelialization and healed by 14 days after the incision....... However, those of tetranectin-null mice never showed complete reepithelialization at 14 days. At 21 days after the injury, the wound healed and was covered with an epidermis. These results supported the fact that tetranectin may play a role in the wound healing process....

  14. Effects of epidermal growth factor in artificial tear on vitamin C levels of corneal wounded eye tissues.

    Science.gov (United States)

    Gönül, B; Kaplan, B; Bilgihan, K; Budak, M T

    2001-04-01

    To investigate the effect of artificial tear (AT) solution and epidermal growth factor (EGF) treatment on the cornea and aqueous humour ascorbic acid (AA) levels of full-thickness corneal wounded eyes. The effect of EGF on the AA levels of aqueous humour and corneal wound tissue was determined in full-thickness corneal wounded rabbit eyes on the seventh post-operative day. There were three groups: untreated controls, AT-treated controls and an EGF+AT-treated experimental group (n = 6 in each group). Corneal wounded eyes were topically treated with 5 microl AT or 5 microl EGF in AT (1 mg/l EGF in AT prepaaration which contained 3.0% carbopol 940) twice daily for 6 days after operation. The wound strengths were also measured on the seventh post-operative day as a measure of wound healing. Statistical analysis was carried out using the Mann-Whitney U-test by Statview program. The wound strengths of corneas, and AA levels of wound tissues and aqueous humour, increased significantly following AT and EGF treatment (p < 0.05). In the corneal wounded eye, aqueous humour serves as a source of vitamin C and there may be a relation between EGF treatment in AT and AA levels of corneal wounded eye tissues.

  15. Effects on Glycemic Control in Impaired Wound Healing in Spontaneously Diabetic Torii (SDT) Fatty Rats.

    Science.gov (United States)

    Katsuhiro, Miyajima; Hui Teoh, Soon; Yamashiro, Hideaki; Shinohara, Masami; Fatchiyah, Fatchiyah; Ohta, Takeshi; Yamada, Takahisa

    2018-02-01

    Impaired diabetic wound healing is an important issue in diabetic complications. The present study aims to evaluate the protective effect on glycemic control against impaired diabetic wound healing using a diabetic rat model. We investigated the wound healing process and effect on the impaired wound repair by glycemic control in the Spontaneously Diabetic Torii (SDT) fatty rat, which is a new animal model of obese type 2 diabetes and may be a good model for study impaired wound healing. Male SDT fatty rats at 15 weeks of age were administered orally with sodium glucose co-transporter (SGLT) 2 inhibitor for 3 weeks. Wounds were induced at 2 weeks after SGLT 2 inhibitor treatment, and the wound areas were periodically examined in morphological and histological analyses. The SDT fatty rats showed a delayed wound healing as compared with the normal rats, but a glycemic control improved the impaired wound healing. In histological analysis in the skin of SDT fatty rats showed severe infiltration of inflammatory cell, hemorrhage and many bacterial masses in the remaining and slight fibrosis of crust on skin tissue . Thought that this results skin performance to be a delay of crust formation and regeneration of epithelium; however, these findings were ameliorated in the SGLT 2 inhibitor treated group. Glycemic control is effective for treatment in diabetic wounds and the SDT fatty rat may be useful to investigate pathophysiological changes in impaired diabetic wound healing.

  16. Intralesional epidermal growth factor for diabetic foot wounds: the first cases in Turkey

    Directory of Open Access Journals (Sweden)

    Bulent M. Ertugrul

    2015-08-01

    Full Text Available Background: Intralesional recombinant epidermal growth factor (EGF was produced in the Centre for Genetic Engineering and Biotechnology (CIGB, Cuba, in 1988 and licensed in 2006. Because it may accelerate wound healing, it is a potential new treatment option in patients with a diabetic foot wound (whether infected or not as an adjunct to standard treatment (i.e. debridement, antibiotics. We conducted the initial evaluation of EGF for diabetic foot wounds in Turkey. Methods: We enrolled 17 patients who were hospitalized in various medical centers for a foot ulcer and/or infection and for whom below the knee amputation was suggested to all except one. All patients received 75 μg intralesional EGF three times per week on alternate days. Results: The appearance of new granulation tissue on the wound site (≥75% was observed in 13 patients (76%, and complete wound closure was observed in 3 patients (18%, yielding a ‘complete recovery’ rate of 94%. The most common side effects were tremor (n=10, 59% and nausea (n=6, 35%. In only one case,a serious side effect requiring cessation of EGF treatment was noted. That patient experienced severe hypotension at the 16th application session, and treatment was discontinued. At baseline, a total of 21 causative bacteria were isolated from 15 patients, whereascultures were sterile in two patients. The most frequently isolated species was Pseudomonas aeruginosa. Conclusion: Thus, this preliminary study suggests that EGF seems to be a potential adjunctive treatment option in patients with limb-threatening diabetic foot wounds.

  17. Clinical experience with Leptospermum honey use for treatment of hard to heal neonatal wounds: case series.

    Science.gov (United States)

    Boyar, V; Handa, D; Clemens, K; Shimborske, D

    2014-02-01

    Preterm, critically ill neonates represent a challenge in wound healing. Many factors predispose infants to skin injuries, including decreased epidermal-dermal cohesion, deficient stratum corneum, relatively alkaline pH of skin surface, impaired nutrition and presence of multiple devices on the skin. We present a case series describing the use of medical-grade honey-Leptospermum honey (Medihoney), for successful treatment of slowly healing neonatal wounds, specifically stage 3 pressure ulcer, dehiscent and infected sternal wound, and full-thickness wound from an extravasation injury.

  18. Acute Ultraviolet Radiation Perturbs Epithelialization but not the Biomechanical Strength of Full-thickness Cutaneous Wounds

    DEFF Research Database (Denmark)

    Danielsen, Patricia L; Lerche, Catharina M; Wulf, Hans Christian

    2016-01-01

    SED, 3 SED and 5 SED. Twenty-four hours after UV irradiation, inflammation was quantified by skin reflectance (erythema) and myeloperoxidase (MPO) tissue levels, and two 6 mm full-thickness excisional wounds and one 3 cm incisional wound were inflicted. Epidermal hyperplasia was assessed...... (P epithelial coverage decreased (P = 0.024) by increasing the UVR dose, whereas there was no significant difference (P = 0.765) in wound MPO levels. Neither wound width (P = 0.850) nor breaking strength (P...... = 0.320) differed among the groups. Solar-simulated UVR 24 h before wounding impaired epithelialization but was not detrimental for surgical incisional wound healing....

  19. Effect of head-irradiation upon epidermal mitotic activity during wound healing in the adrenalectomized mice

    International Nuclear Information System (INIS)

    Kobayashi, Koshi

    1977-01-01

    Epidermal mitotic activity during wound healing was estimated both in the adrenalectomized, head-irradiated mice and in the adrenalectomized, non-irradiated mice, and was compared with those obtained previously from the unoperated, head-irradiated mice. It was found that head-irradiation caused a mitotic depression to a much smaller extent in the adrenalectomized mice than it did in the unoperated mice, though adrenalectomy itself had exerted a great inhibitory effect upon the mitosis induced by an injury. Whether this abscopal effect of head-irradiation upon the mitotic activity was mediated via the adrenals, and whether in the adrenalectomized mice the head-irradiation acted to increase epidermal response to injury, making the mitotic pattern of adrenalectomized mice to come near that of control mice were discussed. (auth.)

  20. Tobacco toxins deposited on surfaces (third hand smoke) impair wound healing.

    Science.gov (United States)

    Dhall, Sandeep; Alamat, Raquelle; Castro, Anthony; Sarker, Altaf H; Mao, Jian-Hua; Chan, Alex; Hang, Bo; Martins-Green, Manuela

    2016-07-01

    Third hand smoke (THS) is the accumulation of second hand smoke (SHS) toxins on surfaces in homes, cars, clothing and hair of smokers. It is known that 88M US nonsmokers ≥3 years old living in homes of smokers are exposed to THS toxicants and show blood cotinine levels of ≥0.05 ng/ml, indicating that the toxins are circulating in their circulatory systems. The goal of the present study is to investigate the mechanisms by which THS causes impaired wound healing. We show that mice living under conditions that mimic THS exposure in humans display delayed wound closure, impaired collagen deposition, altered inflammatory response, decreased angiogenesis, microvessels with fibrin cuffs and a highly proteolytic wound environment. Moreover, THS-exposed mouse wounds have high levels of oxidative stress and significantly lower levels of antioxidant activity leading to molecular damage, including protein nitration, lipid peroxidation and DNA damage that contribute to tissue dysfunction. Furthermore, we show that elastase is elevated, suggesting that elastin is degraded and the plasticity of the wound tissue is decreased. Taken together, our results lead us to conclude that THS toxicants delay and impair wound healing by disrupting the sequential processes that lead to normal healing. In addition, the lack of elastin results in loss of wound plasticity, which may be responsible for reopening of wounds. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  1. Inhibitory effects of omega-3 fatty acids on injury-induced epidermal growth factor receptor transactivation contribute to delayed wound healing

    OpenAIRE

    Turk, Harmony F.; Monk, Jennifer M.; Fan, Yang-Yi; Callaway, Evelyn S.; Weeks, Brad; Chapkin, Robert S.

    2013-01-01

    Epidermal growth factor receptor (EGFR)-mediated signaling is required for optimal intestinal wound healing. Since n-3 polyunsaturated fatty acids (PUFA), specifically docosahexaenoic acid (DHA), alter EGFR signaling and suppress downstream activation of key signaling pathways, we hypothesized that DHA would be detrimental to the process of intestinal wound healing. Using a mouse immortalized colonocyte model, DHA uniquely reduced EGFR ligand-induced receptor activation, whereas DHA and its m...

  2. Skin-resident stem cells and wound healing.

    Science.gov (United States)

    Iwata, Yohei; Akamatsu, Hirohiko; Hasebe, Yuichi; Hasegawa, Seiji; Sugiura, Kazumitsu

    2017-01-01

    CD271 is common stem cell marker for the epidermis and dermis. We assessed a kinetic movement of epidermal and dermal CD271 + cells in the wound healing process to elucidate the possible involvement with chronic skin ulcers. Epidermal CD271 + cells were proliferated and migrated from 3 days after wounding. Purified epidermal CD271 + cells expressed higher TGFβ2 and VEGFα transcripts than CD271 - cells. Delayed wound healing was observed in the aged mice compared with young mice. During the wound healing process, the peak of dermal CD271 + cell accumulation was delayed in aged mice compared with young mice. The expression levels of collagen-1, -3, -5, F4-80, EGF, FGF2, TGFβ1, and IL-1α were significantly increased in young mice compared with aged mice. Furthermore, purified dermal CD271 + cells expressed higher FGF2, EGF, PDGFB, and TGFβ1 gene transcripts than CD271 - cells. These results suggested that epidermal and dermal CD271 + cells were closely associated with wound healing process by producing various growth factors. Epidermal and dermal CD271 + cells in chronic skin ulcer patients were significantly reduced compared with healthy controls. Thus, both epidermal and dermal stem cells can play an important role in wound healing process.

  3. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  4. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

  5. OK-432 as a sclerosing agent to treat wound-healing impairment.

    Science.gov (United States)

    Fasching, G; Sinzig, M

    2007-12-01

    We report on the application of OK-432 (picibanil) in a patient with prolonged wound healing impairment. A 13-year-old girl had suffered a polytrauma with a displaced fracture of the sacrum which required neurosurgical decompression of the sacral plexus. Postoperatively, a seroma with recurrent fistulation was seen. Excision of the wound, prolonged suction drainage and the instillation of hypertonic glucose solution did not have any effect over a period of four months postoperatively. Relying on our personal experience of the treatment of lymphangiomas using OK-432 we instilled OK-432 into the wound. Leakage stopped immediately, there was a regression of fluid accumulation and four weeks later the ultrasound examination was normal. The patient is still asymptomatic four years after treatment. OK-432 can be used effectively for the treatment of chronic wound healing impairment.

  6. Pathogenesis and treatment of impaired wound healing in diabetes mellitus: new insights.

    Science.gov (United States)

    Baltzis, Dimitrios; Eleftheriadou, Ioanna; Veves, Aristidis

    2014-08-01

    Diabetic foot ulcers (DFUs) are one of the most common and serious complications of diabetes mellitus, as wound healing is impaired in the diabetic foot. Wound healing is a dynamic and complex biological process that can be divided into four partly overlapping phases: hemostasis, inflammation, proliferative and remodeling. These phases involve a large number of cell types, extracellular components, growth factors and cytokines. Diabetes mellitus causes impaired wound healing by affecting one or more biological mechanisms of these processes. Most often, it is triggered by hyperglycemia, chronic inflammation, micro- and macro-circulatory dysfunction, hypoxia, autonomic and sensory neuropathy, and impaired neuropeptide signaling. Research focused on thoroughly understanding these mechanisms would allow for specifically targeted treatment of diabetic foot ulcers. The main principles for DFU treatment are wound debridement, pressure off-loading, revascularization and infection management. New treatment options such as bioengineered skin substitutes, extracellular matrix proteins, growth factors, and negative pressure wound therapy, have emerged as adjunctive therapies for ulcers. Future treatment strategies include stem cell-based therapies, delivery of gene encoding growth factors, application of angiotensin receptors analogs and neuropeptides like substance P, as well as inhibition of inflammatory cytokines. This review provides an outlook of the pathophysiology in diabetic wound healing and summarizes the established and adjunctive treatment strategies, as well as the future therapeutic options for the treatment of DFUs.

  7. Leptin promotes wound healing in the skin.

    Directory of Open Access Journals (Sweden)

    Susumu Tadokoro

    Full Text Available Leptin, a 16 kDa anti-obesity hormone, exhibits various physiological properties. Interestingly, skin wound healing was proven to delay in leptin-deficient ob/ob mice. However, little is known on the mechanisms of this phenomenon. In this study, we attempted to elucidate a role of leptin in wound healing of skin.Immunohistochemical analysis was performed to confirm the expression of the leptin receptor (Ob-R in human and mouse skin. Leptin was topically administered to chemical wounds created in mouse back skin along with sustained-release absorbable hydrogel. The process of wound repair was histologically observed and the area of ulceration was measured over time. The effect of leptin on the proliferation, differentiation and migration of human epidermal keratinocytes was investigated.Ob-R was expressed in epidermal cells of human and mouse skin. Topical administration of leptin significantly promoted wound healing. Histological analysis showed more blood vessels in the dermal connective tissues in the leptin-treated group. The proliferation, differentiation/function and migration of human epidermal keratinocytes were enhanced by exogenous leptin.Topically administered leptin was proven to promote wound healing in the skin by accelerating proliferation, differentiation/function and migration of epidermal keratinocytes and enhancing angiogenesis around the wounded area. These results strongly suggest that topical administration of leptin may be useful as a treatment to promote wound healing in the skin.

  8. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  9. Serine Proteolytic Pathway Activation Reveals an Expanded Ensemble of Wound Response Genes in Drosophila

    Science.gov (United States)

    Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William

    2013-01-01

    After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905

  10. Tissue-Engineered Skin Substitute Enhances Wound Healing after Radiation Therapy.

    Science.gov (United States)

    Busra, Mohd Fauzi bin Mh; Chowdhury, Shiplu Roy; bin Ismail, Fuad; bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2016-03-01

    When given in conjunction with surgery for treating cancer, radiation therapy may result in impaired wound healing, which, in turn, could cause skin ulcers. In this study, bilayer and monolayer autologous skin substitutes were used to treat an irradiated wound. A single dose of 30 Gy of linear electron beam radiation was applied to the hind limb of nude mice before creating the skin lesion (area of 78.6 mm). Monolayer tissue-engineered skin substitutes (MTESSs) were prepared by entrapping cultured keratinocytes in fibrin matrix, and bilayer tissue-engineered skin substitutes (BTESSs) were prepared by entrapping keratinocytes and fibroblasts in separate layers. Bilayer tissue-engineered skin substitute and MTESS were implanted to the wound area. Gross appearance and wound area were analyzed to evaluate wound healing efficiency. Skin regeneration and morphological appearance were observed via histological and electron microscopy. Protein expressions of transforming growth factor β1 (TGF-β1), platelet-derived growth factor BB (PDGF-BB), and vascular endothelial growth factor (VEGF) in skin regeneration were evaluated by immunohistochemistry (IHC). Macroscopic observation revealed that at day 13, treatments with BTESS completely healed the irradiated wound, whereas wound sizes of 1.1 ± 0.05 and 6.8 ± 0.14 mm were measured in the MTESS-treated and untreated control groups, respectively. Hematoxylin-eosin (H&E) analysis showed formation of compact and organized epidermal and dermal layers in the BTESS-treated group, as compared with MTESS-treated and untreated control groups. Ultrastructural analysis indicates maturation of skin in BTESS-treated wound evidenced by formation of intermediate filament bundles in the dermal layer and low intercellular space in the epidermal layer. Expressions of TGF-β1, PDGF-BB, and VEGF were also higher in BTESS-treated wounds, compared with MTESS-treated wounds. These results indicate that BTESS is the preferred treatment for

  11. In vivo performance of chitosan/soy-based membranes as wound-dressing devices for acute skin wounds.

    Science.gov (United States)

    Santos, Tírcia C; Höring, Bernhard; Reise, Kathrin; Marques, Alexandra P; Silva, Simone S; Oliveira, Joaquim M; Mano, João F; Castro, António G; Reis, Rui L; van Griensven, Martijn

    2013-04-01

    Wound management represents a major clinical challenge on what concerns healing enhancement and pain control. The selection of an appropriate dressing plays an important role in both recovery and esthetic appearance of the regenerated tissue. Despite the wide range of available dressings, the progress in the wound care market relies on the increasing interest in using natural-based biomedical products. Herein, a rat wound-dressing model of partial-thickness skin wounds was used to study newly developed chitosan/soy (cht/soy)-based membranes as wound-dressing materials. Healing and repair of nondressed, cht/soy membrane-dressed, and Epigard(®)-dressed wounds were followed macroscopically and histologically for 1 and 2 weeks. cht/soy membranes performed better than the controls, promoting a faster wound repair. Re-epithelialization, observed 1 week after wounding, was followed by cornification of the outermost epidermal layer at the second week of dressing, indicating repair of the wounded tissue. The use of this rodent model, although in impaired healing conditions, may enclose some drawbacks regarding the inevitable wound contraction. Moreover, being the main purpose the evaluation of cht/soy-based membranes' performance in the absence of growth factors, the choice of a clinically relevant positive control was limited to a polymeric mesh, without any growth factor influencing skin healing/repair, Epigard. These new cht/soy membranes possess the desired features regarding healing/repair stimulation, ease of handling, and final esthetic appearance-thus, valuable properties for wound dressings.

  12. Clinically relevant doses of lidocaine and bupivacaine do not impair cutaneous wound healing in mice.

    Science.gov (United States)

    Waite, A; Gilliver, S C; Masterson, G R; Hardman, M J; Ashcroft, G S

    2010-06-01

    Lidocaine and bupivacaine are commonly infiltrated into surgical cutaneous wounds to provide local anaesthesia after surgical procedures. However, very little is known about their effects on cutaneous wound healing. If an inhibitory effect is demonstrated, then the balance between the benefits of postoperative local anaesthesia and the negatives of impaired cutaneous wound healing may affect the decision to use local anaesthesia or not. Furthermore, if a difference in the rate of healing of lidocaine- and bupivacaine-treated cutaneous wounds is revealed, or if an inhibitory effect is found to be dose-dependent, then this may well influence the choice of agent and its concentration for clinical use. Immediately before incisional wounding, we administered lidocaine and bupivacaine intradermally to adult female mice, some of which had been ovariectomized to act as a model of post-menopausal women (like post-menopausal women, ovariectomized mice heal wounds poorly, with increased proteolysis and inflammation). Day 3 wound tissue was analysed histologically and tested for expression of inflammatory and proteolytic factors. On day 3 post-wounding, wound areas and extent of re-epithelialization were comparable between the control and local anaesthetic-treated animals, in both intact and ovariectomized groups. Both tested drugs significantly increased wound activity of the degradative enzyme matrix metalloproteinase-2 relative to controls, while lidocaine also increased wound neutrophil numbers. Although lidocaine and bupivacaine influenced local inflammatory and proteolytic factors, they did not impair the rate of healing in either of two well-established models (mimicking normal human wound healing and impaired age-related healing).

  13. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  14. Extracellular superoxide dismutase deficiency impairs wound healing in advanced age by reducing neovascularization and fibroblast function.

    Science.gov (United States)

    Fujiwara, Toshihiro; Duscher, Dominik; Rustad, Kristine C; Kosaraju, Revanth; Rodrigues, Melanie; Whittam, Alexander J; Januszyk, Michael; Maan, Zeshaan N; Gurtner, Geoffrey C

    2016-03-01

    Advanced age is characterized by impairments in wound healing, and evidence is accumulating that this may be due in part to a concomitant increase in oxidative stress. Extended exposure to reactive oxygen species (ROS) is thought to lead to cellular dysfunction and organismal death via the destructive oxidation of intra-cellular proteins, lipids and nucleic acids. Extracellular superoxide dismutase (ecSOD/SOD3) is a prime antioxidant enzyme in the extracellular space that eliminates ROS. Here, we demonstrate that reduced SOD3 levels contribute to healing impairments in aged mice. These impairments include delayed wound closure, reduced neovascularization, impaired fibroblast proliferation and increased neutrophil recruitment. We further establish that SOD3 KO and aged fibroblasts both display reduced production of TGF-β1, leading to decreased differentiation of fibroblasts into myofibroblasts. Taken together, these results suggest that wound healing impairments in ageing are associated with increased levels of ROS, decreased SOD3 expression and impaired extracellular oxidative stress regulation. Our results identify SOD3 as a possible target to correct age-related cellular dysfunction in wound healing. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Enhancement of skin wound healing with decellularized scaffolds loaded with hyaluronic acid and epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Su, Zhongchun; Ma, Huan; Wu, Zhengzheng [Institute of Biomedicine, National Engineering Research Center of Genetic Medicine, Key Lab for Genetic Medicine of Guangdong Province, Jinan University, Guangzhou 510632 (China); Zeng, Huilan [Department of Hematology, The First Affiliated Hospital, Jinan University, Guangzhou 510632 (China); Li, Zhizhong [Department of Bone, The First Affiliated Hospital, Jinan University, Guangzhou 510632 (China); Wang, Yuechun; Liu, Gexiu [Department of Physiology, School of Medicine, Jinan University, Guangzhou 510632 (China); Xu, Bin; Lin, Yongliang; Zhang, Peng [Grandhope Biotech Co., Ltd., Building D, #408, Guangzhou International Business Incubator, Guangzhou Science Park, Guangzhou 510663, Guangdong (China); Wei, Xing, E-mail: wei70@hotmail.com [Institute of Biomedicine, National Engineering Research Center of Genetic Medicine, Key Lab for Genetic Medicine of Guangdong Province, Jinan University, Guangzhou 510632 (China)

    2014-11-01

    Current therapy for skin wound healing still relies on skin transplantation. Many studies were done to try to find out ways to replace skin transplantation, but there is still no effective alternative therapy. In this study, decellularized scaffolds were prepared from pig peritoneum by a series of physical and chemical treatments, and scaffolds loaded with hyaluronic acid (HA) and epidermal growth factor (EGF) were tested for their effect on wound healing. MTT assay showed that EGF increased NIH3T3 cell viability and confirmed that EGF used in this study was biologically active in vitro. Scanning electron microscope (SEM) showed that HA stably attached to scaffolds even after soaking in PBS for 48 h. ELISA assay showed that HA increased the adsorption of EGF to scaffolds and sustained the release of EGF from scaffolds. Animal study showed that the wounds covered with scaffolds containing HA and EGF recovered best among all 4 groups and had wound healing rates of 49.86%, 70.94% and 87.41% respectively for days 10, 15 and 20 post-surgery compared to scaffolds alone with wound healing rates of 29.26%, 42.80% and 70.14%. In addition, the wounds covered with scaffolds containing EGF alone were smaller than no EGF scaffolds on days 10, 15 and 20 post-surgery. Hematoxylin–Eosin (HE) staining confirmed these results by showing that on days 10, 15 and 20 post-surgery, the thicker epidermis and dermis layers were observed in the wounds covered with scaffolds containing HA and EGF than scaffolds alone. In addition, the thicker epidermis and dermis layers were also observed in the wounds covered with scaffolds containing EGF than scaffolds alone. Skin appendages were observed on day 20 only in the wound covered with scaffolds containing HA and EGF. These results demonstrate that the scaffolds containing HA and EGF can enhance wound healing. - Highlights: • HA can increase the adsorption of EGF to decellularized scaffolds. • HA can sustain the release of EGF from

  16. Loss of the Desmosomal Component Perp Impairs Wound Healing In Vivo

    Directory of Open Access Journals (Sweden)

    Veronica G. Beaudry

    2010-01-01

    Full Text Available Epithelial wound closure is a complex biological process that relies on the concerted action of activated keratinocytes and dermal fibroblasts to resurface and close the exposed wound. Modulation of cell-cell adhesion junctions is thought to facilitate cellular proliferation and migration of keratinocytes across the wound. In particular, desmosomes, adhesion complexes critical for maintaining epithelial integrity, are downregulated at the wound edge. It is unclear, however, how compromised desmosomal adhesion would affect wound reepithelialization, given the need for a delicate balance between downmodulating adhesive strength to permit changes in cellular morphology and maintaining adhesion to allow coordinated migration of keratinocyte sheets. Here, we explore the contribution of desmosomal adhesion to wound healing using mice deficient for the desmosomal component Perp. We find that Perp conditional knockout mice display delayed wound healing relative to controls. Furthermore, we determine that while loss of Perp compromises cell-cell adhesion, it does not impair keratinocyte proliferation and actually enhances keratinocyte migration in in vitro assays. Thus, Perp's role in promoting cell adhesion is essential for wound closure. Together, these studies suggest a role for desmosomal adhesion in efficient wound healing.

  17. The role of nuclear hormone receptors in cutaneous wound repair.

    Science.gov (United States)

    Rieger, Sandra; Zhao, Hengguang; Martin, Paige; Abe, Koichiro; Lisse, Thomas S

    2015-01-01

    The cutaneous wound repair process involves balancing a dynamic series of events ranging from inflammation, oxidative stress, cell migration, proliferation, survival and differentiation. A complex series of secreted trophic factors, cytokines, surface and intracellular proteins are expressed in a temporospatial manner to restore skin integrity after wounding. Impaired initiation, maintenance or termination of the tissue repair processes can lead to perturbed healing, necrosis, fibrosis or even cancer. Nuclear hormone receptors (NHRs) in the cutaneous environment regulate tissue repair processes such as fibroplasia and angiogenesis. Defects in functional NHRs and their ligands are associated with the clinical phenotypes of chronic non-healing wounds and skin endocrine disorders. The functional relationship between NHRs and skin niche cells such as epidermal keratinocytes and dermal fibroblasts is pivotal for successful wound closure and permanent repair. The aim of this review is to delineate the cutaneous effects and cross-talk of various nuclear receptors upon injury towards functional tissue restoration. Copyright © 2014 John Wiley & Sons, Ltd.

  18. The molecular biology in wound healing & non-healing wound.

    Science.gov (United States)

    Qing, Chun

    2017-08-01

    The development of molecular biology and other new biotechnologies helps us to recognize the wound healing and non-healing wound of skin in the past 30 years. This review mainly focuses on the molecular biology of many cytokines (including growth factors) and other molecular factors such as extracellular matrix (ECM) on wound healing. The molecular biology in cell movement such as epidermal cells in wound healing was also discussed. Moreover many common chronic wounds such as pressure ulcers, leg ulcers, diabetic foot wounds, venous stasis ulcers, etc. usually deteriorate into non-healing wounds. Therefore the molecular biology such as advanced glycation end products (AGEs) and other molecular factors in diabetes non-healing wounds were also reviewed. Copyright © 2017 Daping Hospital and the Research Institute of Surgery of the Third Military Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  19. Impairment of wound healing after operative treatment of mandibular fractures, and the influence of dexamethasone.

    Science.gov (United States)

    Snäll, Johanna; Kormi, Eeva; Lindqvist, Christian; Suominen, Anna Liisa; Mesimäki, Karri; Törnwall, Jyrki; Thorén, Hanna

    2013-12-01

    Our aim was to clarify the incidence of impaired wound healing after open reduction and ostheosynthesis of mandibular fractures, and to find out whether the use of dexamethasone during the operation increased the risk. Patients were drawn from a larger group of healthy adult dentate patients who had participated in a single-blind, randomised study, the aim of which was to clarify the benefits of operative dexamethasone after treatment of facial fractures. The present analysis comprised 41 patients who had had open reduction and fixation of mandibular fractures with titanium miniplates and monocortical screws through one or 2 intraoral approaches. The outcome variable was impaired healing of the wound. The primary predictive variable was the perioperative use of dexamethasone; other potential predictive variables were age, sex, smoking habit, type of fracture, delay in treatment, and duration of operation. Wound healing was impaired in 13/41 patients (32%) (13/53 of all fractures). The incidence among patients who were given dexamethasone and those who were not did not differ significantly. Only age over 25 was significantly associated with delayed healing (p=0.02). The use of dexamethasone 30 mg perioperatively did not significantly increase the risk of impaired wound healing in healthy patients with clinically uninfected mandibular fractures fixed with titanium miniplates through an intraoral approach. Older age is a significant predictor of impaired healing, which emphasises the importance of thorough anti-infective care in these patients during and after the operation. Copyright © 2013 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  20. Inhibitory effects of omega-3 fatty acids on injury-induced epidermal growth factor receptor transactivation contribute to delayed wound healing.

    Science.gov (United States)

    Turk, Harmony F; Monk, Jennifer M; Fan, Yang-Yi; Callaway, Evelyn S; Weeks, Brad; Chapkin, Robert S

    2013-05-01

    Epidermal growth factor receptor (EGFR)-mediated signaling is required for optimal intestinal wound healing. Since n-3 polyunsaturated fatty acids (PUFA), specifically docosahexaenoic acid (DHA), alter EGFR signaling and suppress downstream activation of key signaling pathways, we hypothesized that DHA would be detrimental to the process of intestinal wound healing. Using a mouse immortalized colonocyte model, DHA uniquely reduced EGFR ligand-induced receptor activation, whereas DHA and its metabolic precursor eicosapentaenoic acid (EPA) reduced wound-induced EGFR transactivation compared with control (no fatty acid or linoleic acid). Under wounding conditions, the suppression of EGFR activation was associated with a reduction in downstream activation of cytoskeletal remodeling proteins (PLCγ1, Rac1, and Cdc42). Subsequently, DHA and EPA reduced cell migration in response to wounding. Mice were fed a corn oil-, DHA-, or EPA-enriched diet prior to intestinal wounding (2.5% dextran sodium sulfate for 5 days followed by termination after 0, 3, or 6 days of recovery). Mortality was increased in EPA-fed mice and colonic histological injury scores were increased in EPA- and DHA-fed mice compared with corn oil-fed (control) mice. Although kinetics of colonic EGFR activation and downstream signaling (PLCγ1, Rac1, and Cdc42) were delayed by both n-3 PUFA, colonic repair was increased in EPA- relative to DHA-fed mice. These results indicate that, during the early response to intestinal wounding, DHA and EPA uniquely delay the activation of key wound-healing processes in the colon. This effect is mediated, at least in part, via suppression of EGFR-mediated signaling and downstream cytoskeletal remodeling.

  1. The reduction in inflammation and impairment in wound healing by using strontium chloride hexahydrate.

    Science.gov (United States)

    Berksoy Hayta, Sibel; Durmuş, Kasim; Altuntaş, Emine Elif; Yildiz, Esin; Hisarciklıo, Mehmet; Akyol, Melih

    2018-03-01

    Numerous growth factors, cytokine, mitogen and chemotactic factors are involved in wound healing. Even though inflammation is important for the stimulation of proliferative phase, excessive inflammation also causes impairment in wound healing. Strontium salts suppress keratinocyte-induced TNF-alpha and interleukin-1 and interleukin-6 in in vitro cultures. This study was conducted to determine the effects of administration of topical strontium chloride hexahydrate on wound healing through TNF-alpha and TGF-beta in surgical wound healing model of in-vivo rat skin. Twenty-four rats were used in the study. After approximately 2 cm cutaneous-subcutaneous incision was horizontally carried out on the mid-neckline of the rats, the incision was again closed using 2.0 vicryl. The rats were assigned into three groups including eight rats in each group. Placebo emollient ointment and also the ointments, which were containing 5% and 10% strontium chloride hexahydrate and were prepared at the same base with placebo ointment, were administered to the groups by a blind executor twice a day for a week. At the end of seventh day, the rats were sacrificed and cutaneous and subcutaneous tissue of their wound site was resected for histopathological examination. Scoring of histopathological wound healing and scoring of tissue TNF-alpha and TGF-beta level with immunohistochemical staining were performed. The groups, to which both 5% and 10% strontium chloride hexahydrate was administered, had lower immunohistochemical TNF-alpha levels and histopathological wound scores compared to controls, which was statistically significant (p < 0.05). Strontium chloride hexahydrate can lead to impairment in wound healing by suppressing inflammation through TNF-alpha.

  2. Human Platelet-Rich Plasma- and Extracellular Matrix-Derived Peptides Promote Impaired Cutaneous Wound Healing In Vivo

    Science.gov (United States)

    Demidova-Rice, Tatiana N.; Wolf, Lindsey; Deckenback, Jeffry; Hamblin, Michael R.; Herman, Ira M.

    2012-01-01

    Previous work in our laboratory has described several pro-angiogenic short peptides derived from endothelial extracellular matrices degraded by bacterial collagenase. Here we tested whether these peptides could stimulate wound healing in vivo. Our experiments demonstrated that a peptide created as combination of fragments of tenascin X and fibrillin 1 (comb1) applied into cranial dermal wounds created in mice treated with cyclophosphamide to impair wound healing, can improve the rate of wound closure. Furthermore, we identify and characterize a novel peptide (UN3) created and modified from two naturally-occurring peptides, which are present in human platelet-rich plasma. In vitro testing of UN3 demonstrates that it causes a 50% increase in endothelial proliferation, 250% increase in angiogenic response and a tripling of epithelial cell migration in response to injury. Results of in vivo experiments where comb1 and UN3 peptides were added together to cranial wounds in cyclophosphamide-treated mice leads to improvement of wound vascularization as shown by an increase of the number of blood vessels present in the wound beds. Application of the peptides markedly promotes cellular responses to injury and essentially restores wound healing dynamics to those of normal, acute wounds in the absence of cyclophosphamide impairment. Our current work is aimed at understanding the mechanisms underlying the stimulatory effects of these peptides as well as identification of the cellular receptors mediating these effects. PMID:22384158

  3. Neonatal hyperthyroidism impairs epinephrine-provoked secretion of nerve growth factor and epidermal growth factor in mouse saliva.

    Science.gov (United States)

    Lakshmanan, J; Landel, C P

    1986-07-01

    We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.

  4. Epicutaneous aeroallergen sensitization in atopic dermatitis infants - determining the role of epidermal barrier impairment.

    Science.gov (United States)

    Boralevi, F; Hubiche, T; Léauté-Labrèze, C; Saubusse, E; Fayon, M; Roul, S; Maurice-Tison, S; Taïeb, A

    2008-02-01

    Sensitization to atopens is an early phenomenon that overlaps with the onset of atopic dermatitis (AD) in infancy. Early epidermal barrier impairment may facilitate the epicutaneous penetration of atopens. To correlate transepidermal water loss (TEWL) and aeroallergen sensitization in infants with AD. In this cross-sectional study we enrolled 59 AD children and 30 controls aged 3-12 months. Transepidermal water loss in uninvolved skin, specific immunoglobulin E, atopy patch test (APT) and skin prick tests were performed with respect to seven aeroallergens, i.e., Dermatophagoides pteronyssinus, D. farinae, cat, dog, birch pollen, ambrosia, and cockroach. Environmental conditions were assessed by a questionnaire, and the house dust mite (HDM) concentration was determined in dust samples. Eighty-nine percent of AD infants had a positive APT vs one out of eleven controls. AD infants had a significantly higher mean TEWL than controls (27.4 vs 11.1 g/m(2)/h, P cats, and dogs at home. This study confirms the high prevalence of delayed sensitization to indoor and outdoor aeroallergens in AD infants, and shows that the higher the TEWL, the higher the prevalence of sensitization to aeroallergens. These data are in favor of a major role of a constitutive epidermal barrier impairment in determining early atopen sensitization in infants with AD.

  5. Impaired intestinal wound healing in Fhl2-deficient mice is due to disturbed collagen metabolism

    International Nuclear Information System (INIS)

    Kirfel, Jutta; Pantelis, Dimitrios; Kabba, Mustapha; Kahl, Philip; Roeper, Anke; Kalff, Joerg C.; Buettner, Reinhard

    2008-01-01

    Four and one half LIM domain protein FHL2 participates in many cellular processes involved in tissue repair such as regulation of gene expression, cytoarchitecture, cell adhesion, migration and signal transduction. The repair process after wounding is initiated by the release of peptides and bioactive lipids. These molecules induce synthesis and deposition of a provisional extracellular matrix. We showed previously that sphingosine-1-phosphate (S1P) triggers a signal transduction cascade mediating nuclear translocation of FHL2 in response to activation of the RhoA GTPase. Our present study shows that FHL2 is an important signal transducer influencing the outcome of intestinal anastomotic healing. Early wound healing is accompanied by reconstitution and remodelling of the extracellular matrix and collagen is primarily responsible for wound strength. Our results show that impaired intestinal wound healing in Fhl2-deficient mice is due to disturbed collagen III metabolism. Impaired collagen III synthesis reduced the mechanical stability of the anastomoses and led to lower bursting pressure in Fhl2-deficient mice after surgery. Our data confirm that FHL2 is an important factor regulating collagen expression in the early phase of wound healing, and thereby is critically involved in the physiologic process of anastomosis healing after bowel surgery and thus may represent a new therapeutic target

  6. Atypical Diabetic Foot Ulcer Keratinocyte Protein Signaling Correlates with Impaired Wound Healing

    Science.gov (United States)

    Hoke, Glenn D.; Ramos, Corrine; Hoke, Nicholas N.; Crossland, Mary C.; Shawler, Lisa G.

    2016-01-01

    Diabetes mellitus is associated with chronic diabetic foot ulcers (DFUs) and wound infections often resulting in lower extremity amputations. The protein signaling architecture of the mechanisms responsible for impaired DFU healing has not been characterized. In this preliminary clinical study, the intracellular levels of proteins involved in signal transduction networks relevant to wound healing were non-biasedly measured using reverse-phase protein arrays (RPPA) in keratinocytes isolated from DFU wound biopsies. RPPA allows for the simultaneous documentation and assessment of the signaling pathways active in each DFU. Thus, RPPA provides for the accurate mapping of wound healing pathways associated with apoptosis, proliferation, senescence, survival, and angiogenesis. From the study data, we have identified potential diagnostic, or predictive, biomarkers for DFU wound healing derived from the ratios of quantified signaling protein expressions within interconnected pathways. These biomarkers may allow physicians to personalize therapeutic strategies for DFU management on an individual basis based upon the signaling architecture present in each wound. Additionally, we have identified altered, interconnected signaling pathways within DFU keratinocytes that may help guide the development of therapeutics to modulate these dysregulated pathways, many of which parallel the therapeutic targets which are the hallmarks of molecular therapies for treating cancer. PMID:27840833

  7. Atypical Diabetic Foot Ulcer Keratinocyte Protein Signaling Correlates with Impaired Wound Healing.

    Science.gov (United States)

    Hoke, Glenn D; Ramos, Corrine; Hoke, Nicholas N; Crossland, Mary C; Shawler, Lisa G; Boykin, Joseph V

    2016-01-01

    Diabetes mellitus is associated with chronic diabetic foot ulcers (DFUs) and wound infections often resulting in lower extremity amputations. The protein signaling architecture of the mechanisms responsible for impaired DFU healing has not been characterized. In this preliminary clinical study, the intracellular levels of proteins involved in signal transduction networks relevant to wound healing were non-biasedly measured using reverse-phase protein arrays (RPPA) in keratinocytes isolated from DFU wound biopsies. RPPA allows for the simultaneous documentation and assessment of the signaling pathways active in each DFU. Thus, RPPA provides for the accurate mapping of wound healing pathways associated with apoptosis, proliferation, senescence, survival, and angiogenesis. From the study data, we have identified potential diagnostic, or predictive, biomarkers for DFU wound healing derived from the ratios of quantified signaling protein expressions within interconnected pathways. These biomarkers may allow physicians to personalize therapeutic strategies for DFU management on an individual basis based upon the signaling architecture present in each wound. Additionally, we have identified altered, interconnected signaling pathways within DFU keratinocytes that may help guide the development of therapeutics to modulate these dysregulated pathways, many of which parallel the therapeutic targets which are the hallmarks of molecular therapies for treating cancer.

  8. Using leptospermum honey to manage wounds impaired by radiotherapy: a case series.

    Science.gov (United States)

    Robson, Val; Cooper, Rose

    2009-01-01

    Radiation-induced tissue injury and wounds with radiation-impaired healing are traumatic for patients and challenging for their caregivers. Standardized management approaches do not exist. The effect of Leptospermum honey as a primary dressing for managing these wounds was assessed in four patients (age range 63 to 93 years) who had previously undergone radiotherapy that left them with fragile friable areas of damaged skin that did not respond to conventional treatment. Compromised areas involved the neck, cheek, groin/perineum, and chest. In patients 1 and 2, after topical application of honey via hydrofiber rope and nonadhesive foam, respectively, improvements in the size and condition of wound/periwound area and a reduction in pain were noted before death or loss to follow-up. After including honey in the treatment regimen of patients 3 and 4, complete healing was noted in 2.5 weeks (with honey and paraffin) and 6 weeks (with honey-soaked hydrofiber rope), respectively. No adverse events were reported. Honey as an adjunct to conventional wound/skin care post radiation therapy shows promise for less painful healing in these chronic wounds. Prospective, randomized, controlled clinical studies are needed to confirm these observations.

  9. Quantitative stain-free and continuous multimodal monitoring of wound healing in vitro with digital holographic microscopy.

    Directory of Open Access Journals (Sweden)

    Dominik Bettenworth

    Full Text Available Impaired epithelial wound healing has significant pathophysiological implications in several conditions including gastrointestinal ulcers, anastomotic leakage and venous or diabetic skin ulcers. Promising drug candidates for accelerating wound closure are commonly evaluated in in vitro wound assays. However, staining procedures and discontinuous monitoring are major drawbacks hampering accurate assessment of wound assays. We therefore investigated digital holographic microscopy (DHM to appropriately monitor wound healing in vitro and secondly, to provide multimodal quantitative information on morphological and functional cell alterations as well as on motility changes upon cytokine stimulation. Wound closure as reflected by proliferation and migration of Caco-2 cells in wound healing assays was studied and assessed in time-lapse series for 40 h in the presence of stimulating epidermal growth factor (EGF and inhibiting mitomycin c. Therefore, digital holograms were recorded continuously every thirty minutes. Morphological changes including cell thickness, dry mass and tissue density were analyzed by data from quantitative digital holographic phase microscopy. Stimulation of Caco-2 cells with EGF or mitomycin c resulted in significant morphological changes during wound healing compared to control cells. In conclusion, DHM allows accurate, stain-free and continuous multimodal quantitative monitoring of wound healing in vitro and could be a promising new technique for assessment of wound healing.

  10. High levels of pigment epithelium-derived factor in diabetes impair wound healing through suppression of Wnt signaling.

    Science.gov (United States)

    Qi, Weiwei; Yang, Chuan; Dai, Zhiyu; Che, Di; Feng, Juan; Mao, Yuling; Cheng, Rui; Wang, Zhongxiao; He, Xuemin; Zhou, Ti; Gu, Xiaoqiong; Yan, Li; Yang, Xia; Ma, Jian-Xing; Gao, Guoquan

    2015-04-01

    Diabetic foot ulcer (DFU) caused by impaired wound healing is a common vascular complication of diabetes. The current study revealed that plasma levels of pigment epithelium-derived factor (PEDF) were elevated in type 2 diabetic patients with DFU and in db/db mice. To test whether elevated PEDF levels contribute to skin wound-healing delay in diabetes, endogenous PEDF was neutralized with an anti-PEDF antibody in db/db mice. Our results showed that neutralization of PEDF accelerated wound healing, increased angiogenesis in the wound skin, and improved the functions and numbers of endothelial progenitor cells (EPCs) in the diabetic mice. Further, PEDF-deficient mice showed higher baseline blood flow in the skin, higher density of cutaneous microvessels, increased skin thickness, improved numbers and functions of circulating EPCs, and accelerated wound healing compared with wild-type mice. Overexpression of PEDF suppressed the Wnt signaling pathway in the wound skin. Lithium chloride-induced Wnt signaling activation downstream of the PEDF interaction site attenuated the inhibitory effect of PEDF on EPCs and rescued the wound-healing deficiency in diabetic mice. Taken together, these results suggest that elevated circulating PEDF levels contribute to impaired wound healing in the process of angiogenesis and vasculogenesis through the inhibition of Wnt/β-catenin signaling. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  11. Diabetes-impaired wound healing is improved by matrix therapy with heparan sulfate glycosaminoglycan mimetic OTR4120 in rats

    NARCIS (Netherlands)

    M. Tong (Miao); B. Tuk (Bastiaan); P. Shang (Peng); J.M. Hekking-Weijma (Ineke); E.M.G. Fijneman (Esther ); M. Guijt (Marnix); S.E.R. Hovius (Steven); J.W. van Neck (Han)

    2012-01-01

    textabstractWound healing in diabetes is frequently impaired, and its treatment remains a challenge. We tested a therapeutic strategy of potentiating intrinsic tissue regeneration by restoring the wound cellular environment using a heparan sulfate glycosaminoglycan mimetic, OTR4120. The effect of

  12. Fibroblast-Specific Deletion of Hypoxia Inducible Factor-1 Critically Impairs Murine Cutaneous Neovascularization and Wound Healing.

    Science.gov (United States)

    Duscher, Dominik; Maan, Zeshaan N; Whittam, Alexander J; Sorkin, Michael; Hu, Michael S; Walmsley, Graham G; Baker, Hutton; Fischer, Lauren H; Januszyk, Michael; Wong, Victor W; Gurtner, Geoffrey C

    2015-11-01

    Diabetes and aging are known risk factors for impaired neovascularization in response to ischemic insult, resulting in chronic wounds, and poor outcomes following myocardial infarction and cerebrovascular injury. Hypoxia-inducible factor (HIF)-1α, has been identified as a critical regulator of the response to ischemic injury and is dysfunctional in diabetic and elderly patients. To better understand the role of this master hypoxia regulator within cutaneous tissue, the authors generated and evaluated a fibroblast-specific HIF-1α knockout mouse model. The authors generated floxed HIF-1 mice (HIF-1) by introducing loxP sites around exon 1 of the HIF-1 allele in C57BL/6J mice. Fibroblast-restricted HIF-1α knockout (FbKO) mice were generated by breeding our HIF-1 with tamoxifen-inducible Col1a2-Cre mice (Col1a2-CreER). HIF-1α knockout was evaluated on a DNA, RNA, and protein level. Knockout and wild-type mice were subjected to ischemic flap and wound healing models, and CD31 immunohistochemistry was performed to assess vascularity of healed wounds. Quantitative real-time polymerase chain reaction of FbKO skin demonstrated significantly reduced Hif1 and Vegfa expression compared with wild-type. This finding was confirmed at the protein level (p wound closure and vascularity (p wound healing, reduced wound vascularity, and significant impairment in the ischemic neovascular response. These findings provide new insight into the importance of cell-specific responses to hypoxia during cutaneous neovascularization.

  13. Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.

    Science.gov (United States)

    Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali

    2016-03-01

    Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Randomized comparison of polyglycolic acid and polyglyconate sutures for abdominal fascial closure after laparotomy in patients with suspected impaired wound healing

    DEFF Research Database (Denmark)

    Osther, P J; Gjøde, P; Mortensen, Sophie Berit Bondegaard

    1995-01-01

    A randomized study of abdominal fascial closure using interrupted polyglyconate and polyglycolic acid sutures after laparotomy was carried out in 204 consecutive patients with suspected impaired wound healing. There were no statistically significant differences between the two sutures with regard...... to the development of fascial disruption and incisional hernia. Wound infection demanding surgical intervention was found in 7 per cent of patients with polyglyconate sutures and in 16 per cent of those with polyglycolic acid sutures (P = 0.04). Monofilament polyglyconate suture does not reduce the incidence...... of fascial disruption and incisional hernia after laparotomy in patients with suspected impaired wound healing but the incidence of wound infection may be reduced compared with that of multifilament polyglycolic acid suture....

  15. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  16. Saliva and wound healing.

    Science.gov (United States)

    Brand, Henk S; Ligtenberg, Antoon J M; Veerman, Enno C I

    2014-01-01

    Oral wounds heal faster and with less scar formation than skin wounds. One of the key factors involved is saliva, which promotes wound healing in several ways. Saliva creates a humid environment, thus improving the survival and functioning of inflammatory cells that are crucial for wound healing. In addition, saliva contains several proteins which play a role in the different stages of wound healing. Saliva contains substantial amounts of tissue factor, which dramatically accelerates blood clotting. Subsequently, epidermal growth factor in saliva promotes the proliferation of epithelial cells. Secretory leucocyte protease inhibitor inhibits the tissue-degrading activity of enzymes like elastase and trypsin. Absence of this protease inhibitor delays oral wound healing. Salivary histatins in vitro promote wound closure by enhancing cell spreading and cell migration, but do not stimulate cell proliferation. A synthetic cyclic variant of histatin exhibits a 1,000-fold higher activity than linear histatin, which makes this cyclic variant a promising agent for the development of a new wound healing medication. Conclusively, recognition of the many roles salivary proteins play in wound healing makes saliva a promising source for the development of new drugs involved in tissue regeneration.

  17. 5alpha-dihydrotestosterone (DHT) retards wound closure by inhibiting re-epithelialization.

    Science.gov (United States)

    Gilliver, S C; Ruckshanthi, J P D; Hardman, M J; Zeef, L A H; Ashcroft, G S

    2009-01-01

    The ongoing search for explanations as to why elderly males heal acute skin wounds more slowly than do their female counterparts (and are more strongly disposed to conditions of chronic ulceration) has identified endogenous oestrogens and androgens as being respectively enhancers and inhibitors of repair. We previously demonstrated that blocking the conversion of testosterone to 5alpha-dihydrotestosterone (DHT) limits its ability to impair healing, suggesting that DHT is a more potent inhibitor of repair than is testosterone. The present study aimed to delineate the central mechanisms by which androgens delay repair. Whilst the contractile properties of neither rat wounds in vivo nor fibroblast-impregnated collagenous discs in vitro appeared to be influenced by androgen manipulations, the global blockade of DHT biosynthesis markedly accelerated re-epithelialization of incisional and excisional wounds and reduced local expression of beta-catenin, a key inhibitor of repair. Moreover, DHT retarded the in vitro migration of epidermal keratinocytes following scratch wounding. By contrast, it failed to influence the migratory and proliferative properties of dermal fibroblasts, suggesting that its primary inhibitory effect is upon re-epithelialization. These novel findings may be of particular significance in the context of chronic ulceration, for which being male is a key risk factor.

  18. Mitochondria-targeted antioxidant SkQ1 improves impaired dermal wound healing in old mice.

    Science.gov (United States)

    Demyanenko, Ilya A; Popova, Ekaterina N; Zakharova, Vlada V; Ilyinskaya, Olga P; Vasilieva, Tamara V; Romashchenko, Valeria P; Fedorov, Artem V; Manskikh, Vasily N; Skulachev, Maxim V; Zinovkin, Roman A; Pletjushkina, Olga Yu; Skulachev, Vladimir P; Chernyak, Boris V

    2015-07-01

    The process of skin wound healing is delayed or impaired in aging animals. To investigate the possible role of mitochondrial reactive oxygen species (mtROS) in cutaneous wound healing of aged mice, we have applied the mitochondria-targeted antioxidant SkQ1. The SkQ1 treatment resulted in accelerated resolution of the inflammatory phase, formation of granulation tissue, vascularization and epithelization of the wounds. The wounds of SkQ1-treated mice contained increased amount of myofibroblasts which produce extracellular matrix proteins and growth factors mediating granulation tissue formation. This effect resembled SkQ1-induced differentiation of fibroblasts to myofibroblast, observed earlierin vitro. The Transforming Growth Factor beta (TGFb) produced by SkQ1-treated fibroblasts was found to stimulated motility of endothelial cells in vitro, an effect which may underlie pro-angiogenic action of SkQ1 in the wounds. In vitro experiments showed that SkQ1 prevented decomposition of VE-cadherin containing contacts and following increase in permeability of endothelial cells monolayer, induced by pro-inflammatory cytokine TNF. Prevention of excessive reaction of endothelium to the pro-inflammatory cytokine(s) might account for anti-inflammatory effect of SkQ1. Our findings point to an important role of mtROS in pathogenesis of age-related chronic wounds.

  19. Peripheral surgical wounding may induce cognitive impairment through interlukin-6-dependent mechanisms in aged mice

    OpenAIRE

    Dong, Yuanlin; Xu, Zhipeng; Huang, Lining; Zhang, Yiying; Xie, Zhongcong

    2016-01-01

    Post-operative cognitive dysfunction (POCD) is associated with morbidity, mortality and increased cost of medical care. However, the neuropathogenesis and targeted interventions of POCD remain largely to be determined. We have found that the peripheral surgical wounding induces an age-dependent A? accumulation, neuroinflammation and cognitive impairment in aged mice. Pro-inflammatory cytokine interlukin-6 (IL-6) has been reported to be associated with cognitive impairment in rodents and human...

  20. Bio-Conjugated Polycaprolactone Membranes: A Novel Wound Dressing

    Directory of Open Access Journals (Sweden)

    Elijah Zhengyang Cai

    2014-11-01

    Full Text Available BackgroundThe combination of polycaprolactone and hyaluronic acid creates an ideal environment for wound healing. Hyaluronic acid maintains a moist wound environment and accelerates the in-growth of granulation tissue. Polycaprolactone has excellent mechanical strength, limits inflammation and is biocompatible. This study evaluates the safety and efficacy of bio-conjugated polycaprolactone membranes (BPM as a wound dressing.Methods16 New Zealand white rabbits were sedated and local anaesthesia was administered. Two 3.0×3.0 cm full-thickness wounds were created on the dorsum of each rabbit, between the lowest rib and the pelvic bone. The wounds were dressed with either BPM (n=12 or Mepitel (n=12 (control, a polyamide-silicon wound dressing. These were evaluated macroscopically on the 7th, 14th, 21st, and 28th postoperative days for granulation, re-epithelialization, infection, and wound size, and histologically for epidermal and dermal regeneration.ResultsBoth groups showed a comparable extent of granulation and re-epithelialization. No signs of infection were observed. There was no significant difference (P>0.05 in wound size between the two groups. BPM (n=6: 8.33 cm2, 4.90 cm2, 3.12 cm2, 1.84 cm2; Mepitel (n=6: 10.29 cm2, 5.53 cm2, 3.63 cm2, 2.02 cm2; at the 7th, 14th, 21st, and 28th postoperative days. The extents of epidermal and dermal regeneration were comparable between the two groups.ConclusionsBPM is comparable to Mepitel as a safe and efficacious wound dressing.

  1. PSEUDOMONAS AERUGINOSA BIOFILM INFECTION SUPPRESSES LOCAL HOST RESPONSE IN BURN WOUNDS

    DEFF Research Database (Denmark)

    Trostrup, H.; Lerche, C. J.; Christophersen, L.

    2015-01-01

    Introduction: Non-invasive monitoring of wound healing is warranted. Opticalcoherence tomography (OCT) enables instant visualization of the epidermis andupper dermis. We have studied the healing of uniform epidermal wounds inhumans using OCT. Methods: Thirty-two, 16 females and 16 males, non-smok...

  2. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  3. Bacterial Aggregates Establish at the Edges of Acute Epidermal Wounds

    DEFF Research Database (Denmark)

    Bay, Lene; Kragh, Kasper N.; Eickhardt, Steffen R.

    2018-01-01

    for culturing from the wounds and adjacent skin, and the wounds including adjacent skin were excised. Tissue sections were stained with peptide nucleic acid (PNA) fluorescence in situ hybridization (FISH) probes, counterstained by 4′,6-diamidino-2-phenylindole, and evaluated by confocal laser scanning...... microscopy (CLSM). Results: No bacterial aggregates were detected at day 0. At day 4, coagulase-negative staphylococci (CoNS) were the sole bacteria identified by CLSM/PNA-FISH and culturing. CoNS was isolated from 78% of the wound swabs and 48% of the skin swabs. Bacterial aggregates (5–150 μm) were...

  4. Factors Affecting Wound Healing

    Science.gov (United States)

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutaneous wound healing and the potential cellular and/or molecular mechanisms involved. The factors discussed include oxygenation, infection, age and sex hormones, stress, diabetes, obesity, medications, alcoholism, smoking, and nutrition. A better understanding of the influence of these factors on repair may lead to therapeutics that improve wound healing and resolve impaired wounds. PMID:20139336

  5. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed

  6. Antioxidant Sol-Gel Improves Cutaneous Wound Healing in Streptozotocin-Induced Diabetic Rats

    Science.gov (United States)

    Lee, Yen-Hsien; Chang, Jung-Jhih; Chien, Chiang-Ting; Yang, Ming-Chien; Chien, Hsiung-Fei

    2012-01-01

    We examined the effects of vitamin C in Pluronic F127 on diabetic wound healing. Full-thickness excision skin wounds were made in normal and diabetic Wistar rats to evaluate the effect of saline, saline plus vitamin C (antioxidant sol), Pluronic F127, or Pluronic F127 plus vitamin C (antioxidant sol-gel). The rate of wound contraction, the levels of epidermal and dermal maturation, collagen synthesis, and apoptosis production in the wound tissue were determined. In vitro data showed that after 6 hours of air exposure, the order of the scavenging abilities for HOCl, H2O2, and O2  − was antioxidant sol-gel > antioxidant saline > Pluronic F127 = saline. After 7 and 14 days of wound injury, the antioxidant sol-gel improved wound healing significantly by accelerated epidermal and dermal maturation, an increase in collagen content, and a decrease in apoptosis formation. However, the wounds of all treatments healed mostly at 3 weeks. Vitamin C in Pluronic F127 hastened cutaneous wound healing by its antioxidant and antiapoptotic mechanisms through a good drug delivery system. This study showed that Pluronic F127 plus vitamin C could potentially be employed as a novel wound-healing enhancer. PMID:22919368

  7. Up-regulation of Hsp72 and keratin16 mediates wound healing in streptozotocin diabetic rats

    Directory of Open Access Journals (Sweden)

    Rasha R. Ahmed

    2015-01-01

    Full Text Available BACKGROUND: Impaired wound healing is a complication of diabetes and a serious problem in clinical practice. We previously found that whey protein (WP was able to regulate wound healing normally in streptozotocin (STZ-dia-betic models. This subsequent study was designed to assess the effect of WP on heat shock protein-72 (Hsp72 and keratin16 (Krt16 expression during wound healing in diabetic rats. METHODS: WP at a dosage of 100 mg/kg of body weight was orally administered daily to wounded normal and STZ-diabetic rats for 8 days. RESULTS: At day 4, the WP-treated diabetic wound was significantly reduced compared to that in the corresponding control. Diabetic wounded rats developed severe inflammatory infiltration and moderate capillary dilatation and regeneration. Treated rats had mild necrotic formation, moderate infiltration, moderate to severe capillary dilatation and regeneration, in addition to moderate epidermal formation. Hsp72 and Krt16 densities showed low and dense activity in diabetic wounded and diabetic wounded treated groups, respectively. At day 8, WP-treatment of diabetic wounded animals revealed great amelioration with complete recovery and closure of the wound. Reactivity of Hsp72 and Krt16 was reversed, showing dense and low, or medium and low, activity in the diabetic wounded and diabetic wounded treated groups, respectively. Hsp72 expression in the pancreas was found to show dense reactivity with WP-treated diabetic wound rats. CONCLUSION: This data provides evidence for the potential impact of WP in the up-regulation of Hsp72 and Krt16 in T1D, resulting in an improved wound healing process in diabetic models.

  8. Promotion of accelerated repair in a radiation impaired wound healing model in murine skin

    International Nuclear Information System (INIS)

    Walker, M.D.

    2000-02-01

    therapeutic modalities investigated were unable to counteract any radiation damage and promote acceleration of repair in this impaired wound healing model. (author)

  9. Stem Cells in Skin Regeneration, Wound Healing, and Their Clinical Applications.

    Science.gov (United States)

    Ojeh, Nkemcho; Pastar, Irena; Tomic-Canic, Marjana; Stojadinovic, Olivera

    2015-10-23

    The skin is the largest organ of the body and has an array of functions. Skin compartments, epidermis, and hair follicles house stem cells that are indispensable for skin homeostasis and regeneration. These stem cells also contribute to wound repair, resulting in restoration of tissue integrity and function of damaged tissue. Unsuccessful wound healing processes often lead to non-healing wounds. Chronic wounds are caused by depletion of stem cells and a variety of other cellular and molecular mechanisms, many of which are still poorly understood. Current chronic wound therapies are limited, so the search to develop better therapeutic strategies is ongoing. Adult stem cells are gaining recognition as potential candidates for numerous skin pathologies. In this review, we will discuss epidermal and other stem cells present in the skin, and highlight some of the therapeutic applications of epidermal stem cells and other adult stem cells as tools for cell/scaffold-based therapies for non-healing wounds and other skin disorders. We will also discuss emerging concepts and offer some perspectives on how skin tissue-engineered products can be optimized to provide efficacious therapy in cutaneous repair and regeneration.

  10. Sympathetic Denervation Accelerates Wound Contraction but Inhibits Reepithelialization and Pericyte Proliferation in Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Zhifang Zheng

    2017-01-01

    Full Text Available Previous studies focused on the effects of sympathetic denervation with 6-hydroxydopamine (6-OHDA on nondiabetic wounds, but the effects of 6-OHDA on diabetic wounds have not been previously reported. In this study, treated mice received intraperitoneal 6-OHDA, and control mice received intraperitoneal injections of normal saline. Full-thickness wounds were established on the backs of mice. The wounds were sectioned (four mice per group for analysis at 2, 5, 7, 10, 14, 17, and 21 days after injury. The wound areas in the control group were larger than those in the treatment group. Histological scores for epidermal and dermal regeneration were reduced in the 6-OHDA-treated group on day 21. The mast cells (MCs in each field decreased after sympathectomy on days 17 and 21. The expression levels of norepinephrine, epidermal growth factor (EGF, interleukin-1 beta, NG2 proteoglycan, and desmin in the treatment group were less than those in the control group. In conclusion, 6-OHDA delays reepithelialization during wound healing in diabetic mice by decreasing EGF, but increases wound contraction by reducing IL-1β levels and the number of MCs. Besides, 6-OHDA led to reduced pericyte proliferation in diabetic wounds, which might explain the vascular dysfunction after sympathetic nerve loss in diabetic wounds.

  11. Healing of excisional wound in alloxan induced diabetic sheep: A planimetric and histopathologic study

    Directory of Open Access Journals (Sweden)

    Farshid Sarrafzadeh-Rezaei

    2013-09-01

    Full Text Available Healing of skin wound is a multi-factorial and complex process. Proper treatment of diabetic wounds is still a major clinical challenge. Although diabetes mellitus can occur in ruminants, healing of wounds in diabetic ruminants has not yet been investigated. The aim of this study was to evaluate healing of ovine excisional diabetic wound model. Eight 4-month-old Iranian Makoui wethers were equally divided to diabetic and nondiabetic groups. Alloxan monohydrate (60 mg kg-1, IV was used for diabetes induction. In each wether, an excisional wound was created on the dorsum of the animal. Photographs were taken in distinct times for planimetric evaluation. Wound samples were taken on day 21 post-wounding for histopathologic evaluations of epidermal thickness, number of fibroblasts and number of new blood vessels. The planimetric study showed slightly delay in wound closure of diabetic animals, however, it was not significantly different from nondiabetic wounds (p ≥ 0.05. Furthermore, epidermal thickness, number of fibroblasts and number of blood vessels were significantly lower in diabetic group (p < 0.05. We concluded that healing of excisional diabetic wounds in sheep may be compromised, as seen in other species. However, contraction rate of these wounds may not be delayed due to metabolic features of ruminants and these animals might go under surgeries without any serious concern. However, healing quality of these wounds may be lower than normal wounds.

  12. Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

    Science.gov (United States)

    Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

    2011-09-01

    Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

  13. Innate sensing of microbial products promotes wound-induced skin cancer

    Science.gov (United States)

    Hoste, Esther; Arwert, Esther N.; Lal, Rohit; South, Andrew P.; Salas-Alanis, Julio C.; Murrell, Dedee F.; Donati, Giacomo; Watt, Fiona M.

    2015-01-01

    The association between tissue damage, chronic inflammation and cancer is well known. However, the underlying mechanisms are unclear. Here we characterize a mouse model in which constitutive epidermal extracellular-signal-regulated kinase-MAP-kinase signalling results in epidermal inflammation, and skin wounding induces tumours. We show that tumour incidence correlates with wound size and inflammatory infiltrate. Ablation of tumour necrosis factor receptor (TNFR)-1/-2, Myeloid Differentiation primary response gene 88 or Toll-like receptor (TLR)-5, the bacterial flagellin receptor, but not other innate immune sensors, in radiosensitive leukocytes protects against tumour formation. Antibiotic treatment inhibits, whereas injection of flagellin induces, tumours in a TLR-5-dependent manner. TLR-5 is also involved in chemical-induced skin carcinogenesis in wild-type mice. Leukocytic TLR-5 signalling mediates upregulation of the alarmin HMGB1 (High Mobility Group Box 1) in wound-induced papillomas. HMGB1 is elevated in tumours of patients with Recessive Dystrophic Epidermolysis Bullosa, a disease characterized by chronic skin damage. We conclude that in our experimental model the combination of bacteria, chronic inflammation and wounding cooperate to trigger skin cancer. PMID:25575023

  14. Effect of pore size and cross-linking of a novel collagen-elastin dermal substitute on wound healing.

    Science.gov (United States)

    Boekema, Bouke K H L; Vlig, Marcel; Olde Damink, Leon; Middelkoop, Esther; Eummelen, Lizette; Bühren, Anne V; Ulrich, Magda M W

    2014-02-01

    Collagen-elastin (CE) scaffolds are frequently used for dermal replacement in the treatment of full-thickness skin defects such as burn wounds. But little is known about the optimal pore size and level of cross-linking. Different formulations of dermal substitutes with unidirectional pores were tested in porcine full-thickness wounds in combination with autologous split skin mesh grafts (SSG). Effect on wound healing was evaluated both macro- and microscopically. CE scaffolds with a pore size of 80 or 100 μm resulted in good wound healing after one-stage grafting. Application of scaffolds with a larger average pore size (120 μm) resulted in more myofibroblasts and more foreign body giant cells (FBGC). Moderate crosslinking impaired wound healing as it resulted in more wound contraction, more FBGC and increased epidermal thickness compared to no cross-linking. In addition, take rate and redness were negatively affected compared to SSG only. Vascularization and the number of myofibroblasts were not affected by cross-linking. Surprisingly, stability of cross-linked scaffolds was not increased in the wound environment, in contrast to in vitro results. Cross-linking reduced the proliferation of fibroblasts in vitro, which might explain the reduced clinical outcome. The non-cross-linked CE substitute with unidirectional pores allowed one-stage grafting of SSG, resulting in good wound healing. In addition, only a very mild foreign body reaction was observed. Cross-linking of CE scaffolds negatively affected wound healing on several important parameters. The optimal non-cross-linked CE substitute is a promising candidate for future clinical evaluation.

  15. Effect of aging on wound healing: current concepts.

    Science.gov (United States)

    Pittman, Joyce

    2007-01-01

    The population is aging, and advanced age is commonly identified as a risk factor for delayed wound healing. Therefore, it is important for WOC nurses to be knowledgeable about how aging affects the wound healing and repair process, and strategies they can use to promote healing in the elderly population. Impaired wound healing in the aged is due partly to comorbidities common among the elderly, but evidence also suggests that inherent differences in cellular structure and function may impair tissue repair and regeneration as well. This article will address the effect of aging on wound healing, with a particular focus on processes of cellular senescence and related factors hypothesized to result in slowed or impaired wound healing in the elderly.

  16. Myofibroblasts in palatal wound healing: prospects for the reduction of wound contraction after cleft palate repair.

    NARCIS (Netherlands)

    Beurden, H.E. van; Hoff, J.W. Von den; Torensma, R.; Maltha, J.C.; Kuijpers-Jagtman, A.M.

    2005-01-01

    The surgical closure of orofacial clefts is considered to impair maxillary growth and dento-alveolar development. Wound contraction and subsequent scar tissue formation, during healing of these surgical wounds, contribute largely to these growth disturbances. The potential to minimize wound

  17. Different wound healing properties of dermis, adipose, and gingiva mesenchymal stromal cells.

    Science.gov (United States)

    Boink, Mireille A; van den Broek, Lenie J; Roffel, Sanne; Nazmi, Kamran; Bolscher, Jan G M; Gefen, Amit; Veerman, Enno C I; Gibbs, Susan

    2016-01-01

    Oral wounds heal faster and with better scar quality than skin wounds. Deep skin wounds where adipose tissue is exposed, have a greater risk of forming hypertrophic scars. Differences in wound healing and final scar quality might be related to differences in mesenchymal stromal cells (MSC) and their ability to respond to intrinsic (autocrine) and extrinsic signals, such as human salivary histatin, epidermal growth factor, and transforming growth factor beta1. Dermis-, adipose-, and gingiva-derived MSC were compared for their regenerative potential with regards to proliferation, migration, and matrix contraction. Proliferation was assessed by cell counting and migration using a scratch wound assay. Matrix contraction and alpha smooth muscle actin was assessed in MSC populated collagen gels, and also in skin and gingival full thickness tissue engineered equivalents (reconstructed epithelium on MSC populated matrix). Compared to skin-derived MSC, gingiva MSC showed greater proliferation and migration capacity, and less matrix contraction in full thickness tissue equivalents, which may partly explain the superior oral wound healing. Epidermal keratinocytes were required for enhanced adipose MSC matrix contraction and alpha smooth muscle actin expression, and may therefore contribute to adverse scarring in deep cutaneous wounds. Histatin enhanced migration without influencing proliferation or matrix contraction in all three MSC, indicating that salivary peptides may have a beneficial effect on wound closure in general. Transforming growth factor beta1 enhanced contraction and alpha smooth muscle actin expression in all three MSC types when incorporated into collagen gels. Understanding the mechanisms responsible for the superior oral wound healing will aid us to develop advanced strategies for optimal skin regeneration, wound healing and scar formation. © 2015 by the Wound Healing Society.

  18. DNA Damage-Inducible Transcript 4 Is an Innate Surveillant of Hair Follicular Stress in Vitamin D Receptor Knockout Mice and a Regulator of Wound Re-Epithelialization.

    Science.gov (United States)

    Zhao, Hengguang; Rieger, Sandra; Abe, Koichiro; Hewison, Martin; Lisse, Thomas S

    2016-11-26

    Mice and human patients with impaired vitamin D receptor (VDR) signaling have normal developmental hair growth but display aberrant post-morphogenic hair cycle progression associated with alopecia. In addition, VDR -/- mice exhibit impaired cutaneous wound healing. We undertook experiments to determine whether the stress-inducible regulator of energy homeostasis, DNA damage-inducible transcript 4 (Ddit4), is involved in these processes. By analyzing hair cycle activation in vivo, we show that VDR -/- mice at day 14 exhibit increased Ddit4 expression within follicular stress compartments. At day 29, degenerating VDR -/- follicular keratinocytes, but not bulge stem cells, continue to exhibit an increase in Ddit4 expression. At day 47, when normal follicles and epidermis are quiescent and enriched for Ddit4, VDR -/- skin lacks Ddit4 expression. In a skin wound healing assay, the re-epithelialized epidermis in wildtype (WT) but not VDR -/- animals harbor a population of Ddit4- and Krt10-positive cells. Our study suggests that VDR regulates Ddit4 expression during epidermal homeostasis and the wound healing process, while elevated Ddit4 represents an early growth-arresting stress response within VDR -/- follicles.

  19. DNA Damage-Inducible Transcript 4 Is an Innate Surveillant of Hair Follicular Stress in Vitamin D Receptor Knockout Mice and a Regulator of Wound Re-Epithelialization

    Directory of Open Access Journals (Sweden)

    Hengguang Zhao

    2016-11-01

    Full Text Available Mice and human patients with impaired vitamin D receptor (VDR signaling have normal developmental hair growth but display aberrant post-morphogenic hair cycle progression associated with alopecia. In addition, VDR–/– mice exhibit impaired cutaneous wound healing. We undertook experiments to determine whether the stress-inducible regulator of energy homeostasis, DNA damage-inducible transcript 4 (Ddit4, is involved in these processes. By analyzing hair cycle activation in vivo, we show that VDR−/− mice at day 14 exhibit increased Ddit4 expression within follicular stress compartments. At day 29, degenerating VDR−/− follicular keratinocytes, but not bulge stem cells, continue to exhibit an increase in Ddit4 expression. At day 47, when normal follicles and epidermis are quiescent and enriched for Ddit4, VDR−/− skin lacks Ddit4 expression. In a skin wound healing assay, the re-epithelialized epidermis in wildtype (WT but not VDR−/− animals harbor a population of Ddit4- and Krt10-positive cells. Our study suggests that VDR regulates Ddit4 expression during epidermal homeostasis and the wound healing process, while elevated Ddit4 represents an early growth-arresting stress response within VDR−/− follicles.

  20. Impaired Healing of a Cutaneous Wound in an Inducible Nitric Oxide Synthase-Knockout Mouse

    Directory of Open Access Journals (Sweden)

    Takashi Kitano

    2017-01-01

    Full Text Available Background. We investigated the effects of loss of inducible nitric oxide synthase (iNOS on the healing process of cutaneous excisional injury by using iNOS-null (KO mice. Population of granulation tissue-related cell types, that is, myofibroblasts and macrophages, growth factor expression, and reepithelialization were evaluated. Methods. KO and wild type (WT mice of C57BL/6 background were used. Under general anesthesia two round full-thickness excision wounds of 5.0 mm in diameter were produced in dorsal skin. After specific intervals of healing, macroscopic observation, histology, immunohistochemistry, and real-time reverse transcription-polymerase chain reaction (RT-PCR were employed to evaluate the healing process. Results. The loss of iNOS retards granulation tissue formation and reepithelialization in excision wound model in mice. Detailed analyses showed that myofibroblast appearance, macrophage infiltration, and mRNA expression of transforming growth factor b and of collagen 1α2 were all suppressed by lacking iNOS. Conclusions. iNOS is required in the process of cutaneous wound healing. Lacking iNOS retards macrophage invasion and its expression of fibrogenic components that might further impair fibrogenic behaviors of fibroblasts.

  1. Early induction of NRF2 antioxidant pathway by RHBDF2 mediates rapid cutaneous wound healing.

    Science.gov (United States)

    Hosur, Vishnu; Burzenski, Lisa M; Stearns, Timothy M; Farley, Michelle L; Sundberg, John P; Wiles, Michael V; Shultz, Leonard D

    2017-04-01

    Rhomboid family protein RHBDF2, an upstream regulator of the epidermal growth factor (EGF) receptor signaling, has been implicated in cutaneous wound healing. However, the underlying molecular mechanisms are still emerging. In humans, a gain-of-function mutation in the RHBDF2 gene accelerates cutaneous wound healing in an EGFR-dependent manner. Likewise, a gain-of-function mutation in the mouse Rhbdf2 gene (Rhbdf2 cub/cub ) shows a regenerative phenotype (rapid ear-hole closure) resulting from constitutive activation of the EGFR pathway. Because the RHBDF2-regulated EGFR pathway is relevant to cutaneous wound healing in humans, we used Rhbdf2 cub/cub mice to investigate the biological networks and pathways leading to accelerated ear-hole closure, with the goal of identifying therapeutic targets potentially effective in promoting wound healing in humans. Comparative transcriptome analysis of ear pinna tissue from Rhbdf2 cub/cub and Rhbdf2 +/+ mice at 0h, 15min, 2h, and 24h post-wounding revealed an early induction of the nuclear factor E2-related factor 2 (NRF2)-mediated anti-oxidative pathway (0h and 15min), followed by the integrin-receptor aggregation pathway (2h) as early-stage events immediately and shortly after wounding in Rhbdf2 cub/cub mice. Additionally, we observed genes enriched for the Fc fragment of the IgG receptor IIIa (FCGR3A)-mediated phagocytosis pathway 24h post-wounding. Although cutaneous wound repair in healthy individuals is generally non-problematic, it can be severely impaired due to aging, diabetes, and chronic inflammation. This study suggests that activation of the NRF2-antioxidant pathway by rhomboid protein RHBDF2 might be beneficial in treating chronic non-healing wounds. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Aging influences wound healing in patients with chronic lower extremity wounds treated in a specialized Wound Care Center.

    Science.gov (United States)

    Wicke, Corinna; Bachinger, Andreas; Coerper, Stephan; Beckert, Stefan; Witte, Maria B; Königsrainer, Alfred

    2009-01-01

    With the dramatic increase in the aging population, the study and care of wounds in the elderly have become priority topics for both researchers and clinicians. The effects of aging on wound healing in humans have remained controversial. The study was a 5-year epidemiological evaluation of standardized data collected regularly during patients' visits at a specialized Wound Care Center with the aim to determine the key factors influencing the healing of chronic lower extremity wounds. In this analysis of 1,158 chronic wounds, the frequency of wound closure was statistically significantly lower in older patients compared with younger patients. The share of closed wounds decreased by nearly 25% in the elderly patients (>or=70 years). The relationship between the patient's age and the proportion of wound closure was nonlinear. The effect of aging on the frequency of wound closure of chronic wounds became clinically apparent after age 60. The chronicity of the wounds was illustrated by their recurrent nature, their long duration, the presence of multiple wounds, and the frequency of concurrent infection. Comorbidity was documented by the coprevalence of up to three underlying diseases related to impaired wound healing. The present study clearly showed that aging affects chronic wound healing negatively.

  3. Sinonasal Epithelial Wound Resealing in an In Vitro Model: Inhibition of Wound Closure with IL-4 Exposure

    Science.gov (United States)

    Wise, Sarah K.; Den Beste, Kyle A.; Hoddeson, Elizabeth K.; Parkos, Charles A.; Nusrat, Asma

    2013-01-01

    Background Prolonged healing and persistent inflammation following surgery for rhinosinusitis impacts patient satisfaction and healthcare resources. Cytokines interleukin (IL)-4, 5, and 13 are important mediators in Th2 inflammatory rhinosinusitis. Decreased wound healing has been demonstrated with Th2 cytokine exposure, but this has not been extensively studied in sinonasal epithelium. We hypothesized that in vitro exposure of primary sinonasal epithelial cell cultures to Th2 inflammatory cytokine IL-4 and IL-13 would impair wound resealing and decrease expression of annexin A2 at the wound edge. Methods Following 24-hour exposure to IL-4, 5, or 13 versus controls, sterile linear mechanical wounds were created in primary sinonasal epithelial cultures (n = 12 wounds per condition). Wounds were followed for 36 hours or until complete closure and residual wound areas were calculated by image analysis. Group differences in annexin A2 were assessed by immunofluorescence labeling, confocal microscopy, and Western blots. Results Significant wound closure differences were identified across cytokine exposure groups (pprotein levels were decreased in IL-4 treated wounds when compared to control wounds (p<0.01). Conclusions Th2 cytokine IL-4 decreases sinonasal epithelial wound closure in vitro. Annexin A2 is also diminished with IL-4 exposure. This supports the hypothesis that IL-4 exposure impairs sinonasal epithelial wound healing and may contribute to prolonged healing in Th2 inflammatory rhinosinusitis. PMID:23468432

  4. Wound Healing in Older Adults.

    Science.gov (United States)

    Gould, Lisa J; Fulton, Ana Tuya

    2016-02-01

    Impaired wound healing in the elderly represents a major clinical problem that is growing as our population ages. Wound healing is affected by age and by co-morbid conditions, particularly diabetes and obesity. This is particularly important in Rhode Island as the state has a very high percentage of vulnerable older adults. A multi- disciplinary approach that incorporates the skills of a comprehensive wound center with specialized nursing, geriatric medicine and palliative care will facilitate rapid wound healing, reduce costs and improve outcomes for our older adults that suffer from 'problem wounds'.

  5. Wound healing from dermal grafts containing CD34+ cells is comparable to split-thickness skin micrografts

    DEFF Research Database (Denmark)

    Nuutila, Kristo; Singh, Mansher; Kruse, Carla

    2017-01-01

    BACKGROUND:: Epidermal stem cells present in the skin appendages of the dermis might be crucial in wound healing. In this study we located these cells in the dermis and evaluated their contribution to full-thickness wound healing in a porcine model. METHODS:: Four sequentially deeper 0.35mm thick...

  6. Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks

    Directory of Open Access Journals (Sweden)

    Sang Wha Kim

    2014-03-01

    Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.

  7. Factors Affecting Wound Healing

    OpenAIRE

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutane...

  8. Wound Healing Effects of Rose Placenta in a Mouse Model of Full-Thickness Wounds

    Directory of Open Access Journals (Sweden)

    Yang Woo Kim

    2015-11-01

    Full Text Available BackgroundRosa damascena, a type of herb, has been used for wound healing in Eastern folk medicine. The goal of this study was to evaluate the effectiveness of rose placenta from R. damascena in a full-thickness wound model in mice.MethodsSixty six-week-old C57BL/6N mice were used. Full-thickness wounds were made with an 8-mm diameter punch. Two wounds were made on each side of the back, and wounds were assigned randomly to the control and experimental groups. Rose placenta (250 µg was injected in the experimental group, and normal saline was injected in the control group. Wound sizes were measured with digital photography, and specimens were harvested. Immunohistochemical staining was performed to assess the expression of epidermal growth factor (EGF, vascular endothelial growth factor (VEGF, transforming growth factor-β1 (TGF-β1, and CD31. Vessel density was measured. Quantitative analysis using an enzyme-linked immunosorbent assay (ELISA for EGF was performed. All evaluations were performed on postoperative days 0, 2, 4, 7, and 10. Statistical analyses were performed using the paired t-test.Results On days 4, 7, and 10, the wounds treated with rose placenta were significantly smaller. On day 2, VEGF and EGF expression increased in the experimental group. On days 7 and 10, TGF-β1 expression decreased in the experimental group. On day 10, vessel density increased in the experimental group. The increase in EGF on day 2 was confirmed with ELISA.ConclusionsRose placenta was found to be associated with improved wound healing in a mouse full-thickness wound model via increased EGF release. Rose placenta may potentially be a novel drug candidate for enhancing wound healing.

  9. Knockdown of SVCT2 impairs in-vitro cell attachment, migration and wound healing in bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Rajnikumar Sangani

    2014-03-01

    Full Text Available Bone marrow stromal cell (BMSC adhesion and migration are fundamental to a number of pathophysiologic processes, including fracture and wound healing. Vitamin C is beneficial for bone formation, fracture repair and wound healing. However, the role of the vitamin C transporter in BMSC adhesion, migration and wound healing is not known. In this study, we knocked-down the sodium-dependent vitamin C transporter, SVCT2, the only known transporter of vitamin C in BMSCs, and performed cell adhesion, migration, in-vitro scratch wound healing and F-actin re-arrangement studies. We also investigated the role of oxidative stress on the above processes. Our results demonstrate that both oxidative stress and down-regulation of SVCT2 decreased cell attachment and spreading. A trans-well cell migration assay showed that vitamin C helped in BMSC migration and that knockdown of SVCT2 decreased cell migration. In the in-vitro scratch wound healing studies, we established that oxidative stress dose-dependently impairs wound healing. Furthermore, the supplementation of vitamin C significantly rescued the BMSCs from oxidative stress and increased wound closing. The knockdown of SVCT2 in BMSCs strikingly decreased wound healing, and supplementing with vitamin C failed to rescue cells efficiently. The knockdown of SVCT2 and induction of oxidative stress in cells produced an alteration in cytoskeletal dynamics. Signaling studies showed that oxidative stress phosphorylated members of the MAP kinase family (p38 and that vitamin C inhibited their phosphorylation. Taken together, these results indicate that both the SVCT2 transporter and oxidative stress play a vital role in BMSC attachment, migration and cytoskeletal re-arrangement. BMSC-based cell therapy and modulation of SVCT2 could lead to a novel therapeutic approach that enhances bone remodeling, fracture repair and wound healing in chronic disease conditions.

  10. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  11. Adenoviral Gene Delivery to Primary Human Cutaneous Cells and Burn Wounds

    OpenAIRE

    Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars

    2006-01-01

    The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determine...

  12. Potential Use of Essential Oil Isolated from Cleistocalyx operculatus Leaves as a Topical Dermatological Agent for Treatment of Burn Wound.

    Science.gov (United States)

    Tran, Gia-Buu; Le, Nghia-Thu Tram; Dam, Sao-Mai

    2018-01-01

    Several herbal remedies have been used as topical agents to cure burn wound, one of the most common injuries in worldwide. In this study, we investigated the potential use of Cleistocalyx operculatus essential oil to treat the burn wound. We identified a total of 13 bioactive compounds of essential oil, several of which exhibited the anti-inflammatory and antimicrobial activities. Furthermore, the essential oil showed the antibacterial effect against S. aureus but not with P. aeruginosa. The supportive effect of essential oil on burn wound healing process also has been proven. Among three groups of mice, wound contraction rate of essential oil treated group (100%) was significantly higher than tamanu oil treated (79%) and control mice (71%) after 20 days (0.22 ± 0.03 versus 0.31 ± 0.02 cm 2 , resp., p essential oil formed a complete epidermal structure, thick and neatly arranged fibers, and scattered immune cells in burn wound. On the contrary, saline treated burn wound formed uneven epidermal layer with necrotic ulcer, infiltration of immune cells, and existence of granulation tissue. This finding demonstrated Cleistocalyx operculatus essential oil as promising topical dermatological agent to treat burn wound.

  13. Effect of ginseng root polysaccharides on cutaneous wound repair in ...

    African Journals Online (AJOL)

    with WGP (15 mg or 30 mg) or mouse epidermal growth factor (mEGF, 0.1 mL, 2000 IU/mL), respectively. .... dorsal hair was clipped, and one full-thickness, round wound ..... Aloe vera induce MMP-3 and TIMP-2 gene expression during the ...

  14. [ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].

    Science.gov (United States)

    Song, Zhifang; Liu, Dewu

    2014-07-01

    To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.

  15. Anterior gradient 2 is induced in cutaneous wound and promotes wound healing through its adhesion domain.

    Science.gov (United States)

    Zhu, Qi; Mangukiya, Hitesh Bhagavanbhai; Mashausi, Dhahiri Saidi; Guo, Hao; Negi, Hema; Merugu, Siva Bharath; Wu, Zhenghua; Li, Dawei

    2017-09-01

    Anterior gradient 2 (AGR2), a member of protein disulfide isomerase (PDI) family, is both located in cytoplasm and secreted into extracellular matrix. The orthologs of AGR2 have been linked to limb regeneration in newt and wound healing in zebrafish. In mammals, AGR2 influences multiple cell signaling pathways in tumor formation and in normal cell functions related to new tissue formation like angiogenesis. However, the function of AGR2 in mammalian wound healing remains unknown. This study aimed to investigate AGR2 expression and its function during skin wound healing and the possible application of external AGR2 in cutaneous wound to accelerate the healing process. Our results showed that AGR2 expression was induced in the migrating epidermal tongue and hyperplastic epidermis after skin excision. Topical application of recombinant AGR2 significantly accelerated wound-healing process by increasing the migration of keratinocytes (Kera.) and the recruitment of fibroblasts (Fibro.) near the wounded area. External AGR2 also promoted the migration of Kera. and Fibro. in vitro in a dose-dependent manner. The adhesion domain of AGR2 was required for the formation of focal adhesions in migrating Fibro., leading to the directional migration along AGR2 gradient. These results indicate that recombinant AGR2 accelerates skin wound healing through regulation of Kera. and Fibro. migration, thus demonstrating its potential utility as an alternative strategy of the therapeutics to accelerate the healing of acute or chronic skin wounds. © 2017 Federation of European Biochemical Societies.

  16. What Makes the Optimal Wound Healing Material? A Review of Current Science and Introduction of a Synthetic Nanofabricated Wound Care Scaffold.

    Science.gov (United States)

    MacEwan, Matthew R; MacEwan, Sarah; Kovacs, Tamas R; Batts, Joel

    2017-10-02

    Wound matrix materials are used to improve the regeneration of dermal and epidermal layers in both acute and chronic wounds. Contemporary wound matrices are primarily composed of biologic materials such as processed xenogeneic and allogeneic tissues. Unfortunately, existing biologic wound matrices possess multiple limitations including poor longevity, durability, strength, and enzymatic resistance required for persistent support for new tissue formation. A fully-synthetic, resorbable electrospun material (Restrata Wound Matrix, Acera, St.Louis, Missouri ) that exhibits structural similarities to the native extracellular matrix offers a new approach to the treatment of acute and chronic wounds. This novel matrix is the first product to combine the advantages of synthetic construction (e.g. resistance to enzymatic degradation, excellent biocompatibility, strength/durability and controlled degradation) with the positive attributes of biologic materials (e.g. biomimetic architecture similar to human extracellular matrix (ECM), fibrous architecture optimized to support cellular migration and proliferation, engineered porosity to encourage tissue ingrowth and vascularization). These features allow RWM to achieve rapid and complete healing of full-thickness wounds that, in preclinical studies, is comparable to Integra Bilayer Wound Matrix (Integra LifeSciences, Plainsboro, New Jersey), a gold standard biologic material with diverse clinical indications in the wound care. Together, this review suggests that the RWM offers a unique fully-synthetic alternative to existing biologic matrices that is effective, widely available, easy to store, simple to apply and low cost.

  17. The molecular signature of impaired diabetic wound healing identifies serpinB3 as a healing biomarker.

    Science.gov (United States)

    Fadini, Gian Paolo; Albiero, Mattia; Millioni, Renato; Poncina, Nicol; Rigato, Mauro; Scotton, Rachele; Boscari, Federico; Brocco, Enrico; Arrigoni, Giorgio; Villano, Gianmarco; Turato, Cristian; Biasiolo, Alessandra; Pontisso, Patrizia; Avogaro, Angelo

    2014-09-01

    Chronic foot ulceration is a severe complication of diabetes, driving morbidity and mortality. The mechanisms underlying delaying wound healing in diabetes are incompletely understood and tools to identify such pathways are eagerly awaited. Wound biopsies were obtained from 75 patients with diabetic foot ulcers. Matched subgroups of rapidly healing (RH, n = 17) and non-healing (NH, n = 11) patients were selected. Proteomic analysis was performed by labelling with isobaric tag for relative and absolute quantification and mass spectrometry. Differentially expressed proteins were analysed in NH vs RH for identification of pathogenic pathways. Individual sample gene/protein validation and in vivo validation of candidate pathways in mouse models were carried out. Pathway analyses were conducted on 92/286 proteins that were differentially expressed in NH vs RH. The following pathways were enriched in NH vs RH patients: apoptosis, protease inhibitors, epithelial differentiation, serine endopeptidase activity, coagulation and regulation of defence response. SerpinB3 was strongly upregulated in RH vs NH wounds, validated as protein and mRNA in individual samples. To test the relevance of serpinB3 in vivo, we used a transgenic mouse model with α1-antitrypsin promoter-driven overexpression of human SERPINB3. In this model, wound healing was unaffected by SERPINB3 overexpression in non-diabetic or diabetic mice with or without hindlimb ischaemia. In an independent validation cohort of 47 patients, high serpinB3 protein content was confirmed as a biomarker of healing improvement. We provide a benchmark for the unbiased discovery of novel molecular targets and biomarkers of impaired diabetic wound healing. High serpinB3 protein content was found to be a biomarker of successful healing in diabetic patients.

  18. Increased expression of TLR9 associated with pro-inflammatory S100A8 and IL-8 in diabetic wounds could lead to unresolved inflammation in type 2 diabetes mellitus (T2DM) cases with impaired wound healing.

    Science.gov (United States)

    Singh, Kanhaiya; Agrawal, Neeraj K; Gupta, Sanjeev K; Sinha, Pratima; Singh, Kiran

    2016-01-01

    Type 2 diabetes mellitus (T2DM) is characterized by persistent hyperglycemia which causes a chain of abrupt biochemical and physiological changes. Immune dys-regulation is the hallmark of T2DM that could contribute to prolonged inflammation causing transformation of wounds into non-healing chronic ulcers. Toll like receptor -9 (TLR9) is a major receptor involved in innate immune regulation. TLR9 activation induces release of pro-inflammatory molecules like S100A8 and interleukin-8 (IL-8) by myeloid cells causing migration of myeloid cells to the site of inflammation. We hypothesized that pro-inflammatory S100A8 and IL-8 proteins could cause persistent inflammation in chronic wounds like diabetic foot ulcer (DFU) and may contribute to impaired wound healing in T2DM patients. Expression of TLR9 and its downstream effector molecules S100A8, and IL-8 were analyzed in chronic diabetic wound and non-diabetic control wound tissue samples by semiquantitative reverse transcriptase - polymerase chain reaction (RT-PCR), quantitative RT-PCR, western blot and immunofluorescence. CD11b(+)CD33(+) myeloid cells were analyzed by flow cytometry. TLR9 message and protein were higher in diabetic wounds compared to control wounds (p=0.03, t=2.21 for TLR9 mRNA; p=diabetic wounds (p=0.003, t=3.1 for S100A8 mRNA; p=0.04, t=2.04 for IL-8). CD11b(+) CD33(+) myeloid cells were decreased in T2DM as compared to non-diabetic controls (p=0.001, t=3.6). DFU subjects had higher levels of CD11b(+) CD33(+) myeloid cells as compared to non-DFU T2DM control (p=0.003, t=2.8). Infection in the wound microenvironment could be the cause of increase in CD11b(+)CD33(+) myeloid cells in DFU (p=0.03, t=2.5). The up-regulation of myeloid cell-derived pro-inflammatory molecules S100A8 and IL-8 in combination with lower levels of CD11b(+) CD33(+) myeloid cells may cause the impairment of wound healing in T2DM subjects leading to chronic ulcers. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Neutralisation of uPA with a monoclonal antibody reduces plasmin formation and delays skin wound healing in tPA-deficient mice

    DEFF Research Database (Denmark)

    Jögi, Annika; Rønø, Birgitte; Lund, Ida K

    2010-01-01

    Proteolytic degradation by plasmin and metalloproteinases is essential for epidermal regeneration in skin wound healing. Plasminogen deficient mice have severely delayed wound closure as have mice simultaneously lacking the two plasminogen activators, urokinase-type plasminogen activator (u......PA) and tissue-type plasminogen activator (tPA). In contrast, individual genetic deficiencies in either uPA or tPA lead to wound healing kinetics with no or only slightly delayed closure of skin wounds....

  20. Wound healing with nonthermal microplasma jets generated in arrays of hourglass microcavity devices

    Science.gov (United States)

    Hum Park, Chan; Lee, Joong Seob; Heui Kim, Ji; Kim, Dong-Kyu; Lee, Ok Joo; Ju, Hyung Woo; Moon, Bo Mi; Cho, Jin Hoon; Kim, Min Hwan; Sun, Peter Peng; Park, Sung-Jin; Eden, J. Gary

    2014-10-01

    Clinical studies are reported in which artificial wounds in rat epidermal and dermal tissue have been treated by arrays of sub-500 µm diameter, low temperature plasma microjets. Fabricated in Al/nanoporous alumina (Al2O3) by wet chemical and microablation processes, each plasma jet device has a double parabolic (hourglass) structure, and arrays as large as 6  ×  6 devices with 500 µm diameter apertures have been tested to date. Treatment of 1 cm2 acute epidermal wounds for 20-40 s daily with an array of microplasma jets generated in He feedstock gas promoted wound recovery significantly, as evidenced by tissue histology and measured wound area. Seven days after wound formation, the wound area of the untreated control was 40  ±  2% of its initial value, whereas that for an identical wound treated twice daily for 20 s was 9  ±  2% of its original surface area. No histological distinctions were observed between wounds treated twice each day for 10 or 20 s - only the full recovery time differed. Spectra produced in the visible and ultraviolet by He jets in room air are dominated by atomic oxygen (3p 5P → 3s 5S) at 777 nm and violet fluorescence (391.4 nm) from N2+, a species produced when the He (2s 3S1) metastable is deactivated by Penning ionization of N2. Although the combined cross-sectional area of the jets in the array is only 7% of the wound area, the microplasma treatment results in spatially uniform, and accelerated, wound healing. Both effects are attributed to the increased surface area of the jet array (relative to a single jet having an equivalent diameter) and the concomitant enhancement in the generation of molecular radicals, and metastable atoms and molecules (such as {{\\text{N}}2}≤ft(A{}{}3 Σ \\text{u}+\\right) ).

  1. Wound healing with nonthermal microplasma jets generated in arrays of hourglass microcavity devices

    International Nuclear Information System (INIS)

    Park, Chan Hum; Lee, Joong Seob; Kim, Ji Heui; Kim, Dong-Kyu; Lee, Ok Joo; Ju, Hyung Woo; Moon, Bo Mi; Cho, Jin Hoon; Kim, Min Hwan; Sun, Peter Peng; Park, Sung-Jin; Eden, J Gary

    2014-01-01

    Clinical studies are reported in which artificial wounds in rat epidermal and dermal tissue have been treated by arrays of sub-500 µm diameter, low temperature plasma microjets. Fabricated in Al/nanoporous alumina (Al 2 O 3 ) by wet chemical and microablation processes, each plasma jet device has a double parabolic (hourglass) structure, and arrays as large as 6  ×  6 devices with 500 µm diameter apertures have been tested to date. Treatment of 1 cm 2 acute epidermal wounds for 20–40 s daily with an array of microplasma jets generated in He feedstock gas promoted wound recovery significantly, as evidenced by tissue histology and measured wound area. Seven days after wound formation, the wound area of the untreated control was 40  ±  2% of its initial value, whereas that for an identical wound treated twice daily for 20 s was 9  ±  2% of its original surface area. No histological distinctions were observed between wounds treated twice each day for 10 or 20 s – only the full recovery time differed. Spectra produced in the visible and ultraviolet by He jets in room air are dominated by atomic oxygen (3p 5 P → 3s 5 S) at 777 nm and violet fluorescence (391.4 nm) from N 2 + , a species produced when the He (2s 3 S 1 ) metastable is deactivated by Penning ionization of N 2 . Although the combined cross-sectional area of the jets in the array is only 7% of the wound area, the microplasma treatment results in spatially uniform, and accelerated, wound healing. Both effects are attributed to the increased surface area of the jet array (relative to a single jet having an equivalent diameter) and the concomitant enhancement in the generation of molecular radicals, and metastable atoms and molecules (such as N 2 (A 3 Σ u + )). (paper)

  2. Age-related aspects of cutaneous wound healing: a mini-review.

    Science.gov (United States)

    Sgonc, Roswitha; Gruber, Johann

    2013-01-01

    As the aging population in developed countries is growing in both numbers and percentage, the medical, social, and economic burdens posed by nonhealing wounds are increasing. Hence, it is all the more important to understand the mechanisms underlying age-related impairments in wound healing. The purpose of this article is to give a concise overview of (1) normal wound healing, (2) alterations in aging skin that have an impact on wound repair, (3) alterations in the repair process of aged skin, and (4) general factors associated with old age that might impair wound healing, with a focus on the literature of the last 10 years. Copyright © 2012 S. Karger AG, Basel.

  3. Drug delivery systems and materials for wound healing applications.

    Science.gov (United States)

    Saghazadeh, Saghi; Rinoldi, Chiara; Schot, Maik; Kashaf, Sara Saheb; Sharifi, Fatemeh; Jalilian, Elmira; Nuutila, Kristo; Giatsidis, Giorgio; Mostafalu, Pooria; Derakhshandeh, Hossein; Yue, Kan; Swieszkowski, Wojciech; Memic, Adnan; Tamayol, Ali; Khademhosseini, Ali

    2018-04-05

    Chronic, non-healing wounds place a significant burden on patients and healthcare systems, resulting in impaired mobility, limb amputation, or even death. Chronic wounds result from a disruption in the highly orchestrated cascade of events involved in wound closure. Significant advances in our understanding of the pathophysiology of chronic wounds have resulted in the development of drugs designed to target different aspects of the impaired processes. However, the hostility of the wound environment rich in degradative enzymes and its elevated pH, combined with differences in the time scales of different physiological processes involved in tissue regeneration require the use of effective drug delivery systems. In this review, we will first discuss the pathophysiology of chronic wounds and then the materials used for engineering drug delivery systems. Different passive and active drug delivery systems used in wound care will be reviewed. In addition, the architecture of the delivery platform and its ability to modulate drug delivery are discussed. Emerging technologies and the opportunities for engineering more effective wound care devices are also highlighted. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Hydrogen sulfide improves diabetic wound healing in ob/ob mice via attenuating inflammation.

    Science.gov (United States)

    Zhao, Huichen; Lu, Shengxia; Chai, Jiachao; Zhang, Yuchao; Ma, Xiaoli; Chen, Jicui; Guan, Qingbo; Wan, Meiyan; Liu, Yuantao

    2017-09-01

    The proposed mechanisms of impaired wound healing in diabetes involve sustained inflammation, excess oxidative stress and compromised agiogenesis. Hydrogen sulfide (H 2 S) has been reported to have multiple biological activities. We aim to investigate the role of H 2 S in impaired wound healing in ob/ob mice and explore the possible mechanisms involved. Full-thickness skin dorsal wounds were created on ob/ob mice and C57BL/6 mice. Cystathionine-γ-lyase (CSE) expression and H 2 S production were determined in granulation tissues of the wounds. Effects of NaHS on wound healing were evaluated. Inflammation and angiogenesis in granulation tissues of the wounds were examined. CSE expression, and H 2 S content were significantly reduced in granulation tissues of wounds in ob/ob mice compared with control mice. NaHS treatment significantly improved wound healing in ob/ob mice, which was associated with reduced neutrophil and macrophage infiltration, decreased production of tumor necrosis factor (TNF)-α, interleukin (IL)-6. NaHS treatment decreased metalloproteinase (MMP)-9, whereas increased collagen deposition and vascular-like structures in granulation tissues of wounds in ob/ob mice. CSE down-regulation may play a role in the pathogenesis of diabetic impaired wound healing. Exogenous H 2 S could be a potential agent to improve diabetic impaired wound healing by attenuating inflammation and increasing angiogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  6. Zmpste24-/- mouse model for senescent wound healing research.

    Science.gov (United States)

    Butala, Parag; Szpalski, Caroline; Soares, Marc; Davidson, Edward H; Knobel, Denis; Warren, Stephen M

    2012-12-01

    The graying of our population has motivated the authors to better understand age-related impairments in wound healing. To increase research throughput, the authors hypothesized that the Hutchinson-Gilford progeria syndrome Zmpste24-deficient (Zmpste24(-/-)) mouse could serve as a model of senescent wound healing. Using a stented excisional wound closure model, the authors tested this hypothesis on 8-week-old male Zmpste24(-/-) mice (n = 25) and age-matched male C57BL/6J wild-type mice (n = 25). Wounds were measured photogrammetrically and harvested for immunohistochemistry, enzyme-linked immunosorbent assay, and quantitative real-time polymerase chain reaction, and circulating vasculogenic progenitor cells were measured by flow cytometry. Zmpste24(-/-) mice had a significant delay in wound closure compared with wild-type mice during the proliferative/vasculogenic phase. Zmpste24(-/-) wounds had decreased proliferation, increased 8-hydroxy-2'-deoxyguanosine levels, increased proapoptotic signaling (i.e., p53, PUMA, BAX), decreased antiapoptotic signaling (i.e., Bcl-2), and increased DNA fragmentation. These changes correlated with decreased local vasculogenic growth factor expression, decreased mobilization of bone marrow-derived vasculogenic progenitor cells, and decreased new blood vessel formation. Age-related impairments in wound closure are multifactorial. The authors' data suggest that the Hutchinson-Gilford progeria syndrome Zmpste24(-/-) progeroid syndrome shares mechanistic overlap with normal aging and therefore might provide a uniquely informative model with which to study age-associated impairments in wound closure.

  7. Surgical pathology to describe the clinical margin of debridement of chronic wounds using a wound electronic medical record.

    Science.gov (United States)

    Golinko, Michael S; Joffe, Renata; de Vinck, David; Chandrasekaran, Eashwar; Stojadinovic, Olivera; Barrientos, Stephan; Vukelic, Sasa; Tomic-Canic, Marjana; Brem, Harold

    2009-08-01

    Chronic wounds, including diabetic foot ulcers (DFU), pressure ulcers (PU), and venous ulcers (VU) result from multiple physiologic impairments. Operative debridement is a mainstay of treatment to remove nonviable tissue and to stimulate wound healing. Unlike tumor resection, however, operative wound specimens are not routinely sent for pathology. The objective of this study was to describe the pathology present in chronic wounds. Pathology reports of the skin edge and wound base from 397 initial debridements in 336 consecutive patients with chronic wounds were retrospectively reviewed. All data were entered and stored in a Wound Electronic Medical Record. Pathology data were extracted from the Wound Electronic Medical Record, coded, and quantified. Up to 15 distinct histopathologic findings across 7 tissue types were observed after review of pathology reports from chronic wounds. Specifically, the pathology of epidermis revealed hyperkeratosis: 66% in DFUs, 31% in PUs, and 29% in VUs. Dermal pathology revealed fibrosis in 49% of DFUs, 30% of PUs, and 15% of VUs. Wound bed pathology revealed necrosis in the subcutaneous tissue in 67% of DFUs, 55% of PUs, and 19% of VUs. Fibrosis was reported in between 19% and 52% of all wound types. Acute osteomyelitis was present in 39% of DFUs, 33% of PUs, and 29% of VUs. This observational study of the histopathology of initial surgical debridement of chronic wounds revealed a wide range of findings across multiple tissue levels. Although certain findings such as osteomyelitis and gangrene have been shown to directly relate to impaired wound healing and amputation, other findings require additional investigation. To rigorously define a margin of debridement, a prospective study relating histopathology and clinical outcomes such as healing rates and amputation is needed.

  8. Komodo dragon-inspired synthetic peptide DRGN-1 promotes wound-healing of a mixed-biofilm infected wound.

    Science.gov (United States)

    M C Chung, Ezra; Dean, Scott N; Propst, Crystal N; Bishop, Barney M; van Hoek, Monique L

    2017-01-01

    Cationic antimicrobial peptides are multifunctional molecules that have a high potential as therapeutic agents. We have identified a histone H1-derived peptide from the Komodo dragon ( Varanus komodoensis) , called VK25. Using this peptide as inspiration, we designed a synthetic peptide called DRGN-1. We evaluated the antimicrobial and anti-biofilm activity of both peptides against Pseudomonas aeruginosa and Staphylococcus aureus . DRGN-1, more than VK25, exhibited potent antimicrobial and anti-biofilm activity, and permeabilized bacterial membranes. Wound healing was significantly enhanced by DRGN-1 in both uninfected and mixed biofilm ( Pseudomonas aeruginosa and Staphylococcus aureus )-infected murine wounds. In a scratch wound closure assay used to elucidate the wound healing mechanism, the peptide promoted the migration of HEKa keratinocyte cells, which was inhibited by mitomycin C (proliferation inhibitor) and AG1478 (epidermal growth factor receptor inhibitor). DRGN-1 also activated the EGFR-STAT1/3 pathway. Thus, DRGN-1 is a candidate for use as a topical wound treatment. Wound infections are a major concern; made increasingly complicated by the emerging, rapid spread of bacterial resistance. The novel synthetic peptide DRGN-1 (inspired by a peptide identified from Komodo dragon) exhibits pathogen-directed and host-directed activities in promoting the clearance and healing of polymicrobial ( Pseudomonas aeruginosa & Staphylococcus aureus ) biofilm infected wounds. The effectiveness of this peptide cannot be attributed solely to its ability to act upon the bacteria and disrupt the biofilm, but also reflects the peptide's ability to promsote keratinocyte migration. When applied in a murine model, infected wounds treated with DRGN-1 healed significantly faster than did untreated wounds, or wounds treated with other peptides. The host-directed mechanism of action was determined to be via the EGFR-STAT1/3 pathway. The pathogen-directed mechanism of action was

  9. Conducted healing to treat large skin wounds.

    Science.gov (United States)

    Salgado, M I; Petroianu, A; Alberti, L R; Burgarelli, G L; Barbosa, A J A

    2013-01-01

    Improvement of the healing process to provide better aesthetical and functional results continues to be a surgical challenge. This study compared the treatment of skin wounds by means of conducted healing (an original method of treatment by secondary healing) and by the use of autogenous skin grafts. Two skin segments, one on each side of the dorsum,were removed from 17 rabbits. The side that served as a graft donor site was left open as to undergo conducted healing (A)and was submitted only to debridement and local care with dressings. The skin removed from the side mentioned above was implanted as a graft (B) to cover the wound on the other side. Thus, each animal received the two types of treatment on its dorsum (A and B). The rabbits were divided into two groups according to the size of the wounds: Group 1 - A and B (4 cm2)and Group 2 - A and B (25 cm2). The healing time was 19 days for Group 1 and 35 days for Group 2. The final macro- and microscopic aspects of the healing process were analysed comparatively among all subgroups. The presence of inflammatory cells, epidermal cysts and of giant cells was evaluated. No macro- or microscopic differences were observed while comparing the wounds that underwent conducted healing and those in which grafting was employed, although the wounds submitted to conducted healing healed more rapidly. Conducted wound healing was effective for the treatment of skin wounds. Celsius.

  10. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  11. The unique and cooperative roles of the Grainy head-like transcription factors in epidermal development reflect unexpected target gene specificity.

    Science.gov (United States)

    Boglev, Yeliz; Wilanowski, Tomasz; Caddy, Jacinta; Parekh, Vishwas; Auden, Alana; Darido, Charbel; Hislop, Nikki R; Cangkrama, Michael; Ting, Stephen B; Jane, Stephen M

    2011-01-15

    The Grainy head-like 3 (Grhl3) gene encodes a transcription factor that plays essential roles in epidermal morphogenesis during embryonic development, with deficient mice exhibiting failed skin barrier formation, defective wound repair, and loss of eyelid fusion. Despite sharing significant sequence homology, overlapping expression patterns, and an identical core consensus DNA binding site, the other members of the Grhl family (Grhl1 and -2) fail to compensate for the loss of Grhl3 in these processes. Here, we have employed diverse genetic models, coupled with biochemical studies, to define the inter-relationships of the Grhl factors in epidermal development. We show that Grhl1 and Grhl3 have evolved complete functional independence, as evidenced by a lack of genetic interactions in embryos carrying combinations of targeted alleles of these genes. In contrast, compound heterozygous Grhl2/Grhl3 embryos displayed failed wound repair, and loss of a single Grhl2 allele in Grhl3-null embryos results in fully penetrant eyes open at birth. Expression of Grhl2 from the Grhl3 locus in homozygous knock-in mice corrects the wound repair defect, but these embryos still display a complete failure of skin barrier formation. This functional dissociation is due to unexpected differences in target gene specificity, as both GRHL2 and GRHL3 bind to and regulate expression of the wound repair gene Rho GEF 19, but regulation of the barrier forming gene, Transglutaminase 1 (TGase1), is unique to GRHL3. Our findings define the mechanisms underpinning the unique and cooperative roles of the Grhl genes in epidermal development. Copyright © 2010 Elsevier Inc. All rights reserved.

  12. A human model of small fiber neuropathy to study wound healing.

    Science.gov (United States)

    Illigens, Ben M W; Gibbons, Christopher H

    2013-01-01

    The aim of this study was to develop a human model of acute wound healing that isolated the effects of small fiber neuropathy on the healing process. Twenty-five healthy subjects had the transient receptor vanilloid 1 agonist capsaicin and placebo creams topically applied to contralateral areas on the skin of the thigh for 48 hours. Subjects had shallow (1.2 millimeter) and deep (>3 millimeter) punch skin biopsies from each thigh on days 1 and 14. Biopsy wound healing was monitored photographically until closure. Intra-epidermal and sweat-gland nerve fiber densities were measured for each biopsy. Shallow wounds in capsaicin-treated sites healed more slowly than in placebo treated skin with biopsies taken on day 1 (PDeep biopsies in the capsaicin and placebo areas healed at similar rates at both time points. Nerve fiber densities were reduced only in capsaicin treated regions (Pshallow, but not deep wounds. This novel human model may prove valuable in the study of wound healing in patients with neuropathy.

  13. The electric field near human skin wounds declines with age and provides a noninvasive indicator of wound healing.

    Science.gov (United States)

    Nuccitelli, Richard; Nuccitelli, Pamela; Li, Changyi; Narsing, Suman; Pariser, David M; Lui, Kaying

    2011-01-01

    Due to the transepidermal potential of 15-50 mV, inside positive, an injury current is driven out of all human skin wounds. The flow of this current generates a lateral electric field within the epidermis that is more negative at the wound edge than at regions more lateral from the wound edge. Electric fields in this region could be as large as 40 mV/mm, and electric fields of this magnitude have been shown to stimulate human keratinocyte migration toward the wounded region. After flowing out of the wound, the current returns through the space between the epidermis and stratum corneum, generating a lateral field above the epidermis in the opposite direction. Here, we report the results from the first clinical trial designed to measure this lateral electric field adjacent to human skin wounds noninvasively. Using a new instrument, the Dermacorder®, we found that the mean lateral electric field in the space between the epidermis and stratum corneum adjacent to a lancet wound in 18-25-year-olds is 107-148 mV/mm, 48% larger on average than that in 65-80-year-olds. We also conducted extensive measurements of the lateral electric field adjacent to mouse wounds as they healed and compared this field with histological sections through the wound to determine the correlation between the electric field and the rate of epithelial wound closure. Immediately after wounding, the average lateral electric field was 122 ± 9 mV/mm. When the wound is filled in with a thick, disorganized epidermal layer, the mean field falls to 79 ± 4 mV/mm. Once this epidermis forms a compact structure with only three cell layers, the mean field is 59 ± 5 mV/mm. Thus, the peak-to-peak spatial variation in surface potential is largest in fresh wounds and slowly declines as the wound closes. The rate of wound healing is slightly greater when wounds are kept moist as expected, but we could find no correlation between the amplitude of the electric field and the rate of wound

  14. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  15. Debridement and wound bed preparation.

    Science.gov (United States)

    Falabella, Anna F

    2006-01-01

    Debridement can play a vital role in wound bed preparation and the removal of barriers that impair wound healing. In accordance with the TIME principles, debridement can help remove nonviable tissue, control inflammation or infection, decrease excess moisture, and stimulate a nonadvancing wound edge. There are many types of debridement, each with a set of advantages and disadvantages that must be clearly understood by the healthcare team. Failure to use the correct debridement method for a given type of wound may lead to further delays in healing, increase patient suffering, and unnecessarily increase the cost of care. This review article discusses the various methods of debridement, describes currently available debriding agents, evaluates the clinical data regarding their efficacy and safety, and describes strategies for the management of problematic nonhealing wounds.

  16. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  17. Clinical application of a tissue-cultured skin autograft: an alternative for the treatment of non-healing or slowly healing wounds?

    Science.gov (United States)

    Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland

    2014-01-01

    The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.

  18. Exercise, Obesity, and Cutaneous Wound Healing: Evidence from Rodent and Human Studies.

    Science.gov (United States)

    Pence, Brandt D; Woods, Jeffrey A

    2014-01-01

    Significance: Impaired cutaneous wound healing is a major health concern. Obesity has been shown in a number of studies to impair wound healing, and chronic nonhealing wounds in obesity and diabetes are a major cause of limb amputations in the United States. Recent Advances: Recent evidence indicates that aberrant wound site inflammation may be an underlying cause for delayed healing. Obesity, diabetes, and other conditions such as stress and aging can result in a chronic low-level inflammatory state, thereby potentially affecting wound healing negatively. Critical Issues: Interventions which can speed the healing rate in individuals with slowly healing or nonhealing wounds are of critical importance. Recently, physical exercise training has been shown to speed healing in both aged and obese mice and in older adults. Exercise is a relatively low-cost intervention strategy which may be able to be used clinically to prevent or treat impairments in the wound-healing process. Future Directions: Little is known about the mechanisms by which exercise speeds healing. Future translational studies should address potential mechanisms for these exercise effects. Additionally, clinical studies in obese humans are necessary to determine if findings in obese rodent models translate to the human population.

  19. Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

    Science.gov (United States)

    Crawford, Melissa; Dagnino, Lina

    2017-10-02

    The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

  20. The Application of Bactericidal Silver Nanoparticles in Wound Treatment

    Directory of Open Access Journals (Sweden)

    Geewoo Nam

    2015-07-01

    Full Text Available Even with the prevalence of wounds, the medical technol‐ ogy for efficiently managing skin damage is still primitive. The disruption of any of the numerous healing processes can lead to problems in the time-sensitive healing actions of the dermal and epidermal layers. Bacterial infection is one of the major obstacles to proper wound healing as it poses a danger of causing long-term negative effects. Keeping the wound free of bacteria is imperative to the proper and hasty repair of dermal wounds. Silver has been widely used to treat wounds for its bactericidal properties. Although the mechanism of silver’s antibacterial action is not fully understood, it exhibits a significant antimicrobial efficacy against a wide spectrum of bacterial species. A number of different approaches to the mechanism are reported and presented in this review. Silver nanoparticles (AgNPs have been reported to exhibit enhanced antibac‐ terial activity due to their increased surface-area-to-volume ratio. AgNPs are capable of various modifications, signifi‐ cantly broadening the therapeutic properties of the mate‐ rial as a result. This review explores the different aspects of silver and silver nanoparticles, and their antibacterial properties, which can be applied in the field of wound treatments.

  1. Peripheral surgical wounding and age-dependent neuroinflammation in mice.

    Directory of Open Access Journals (Sweden)

    Zhipeng Xu

    Full Text Available Post-operative cognitive dysfunction is associated with morbidity and mortality. However, its neuropathogenesis remains largely to be determined. Neuroinflammation and accumulation of β-amyloid (Aβ have been reported to contribute to cognitive dysfunction in humans and cognitive impairment in animals. Our recent studies have established a pre-clinical model in mice, and have found that the peripheral surgical wounding without the influence of general anesthesia induces an age-dependent Aβ accumulation and cognitive impairment in mice. We therefore set out to assess the effects of peripheral surgical wounding, in the absence of general anesthesia, on neuroinflammation in mice with different ages. Abdominal surgery under local anesthesia was established in 9 and 18 month-old mice. The levels of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, Iba1 positive cells (the marker of microglia activation, CD33, and cognitive function in mice were determined. The peripheral surgical wounding increased the levels of TNF-α, IL-6, and Iba1 positive cells in the hippocampus of both 9 and 18 month-old mice, and age potentiated these effects. The peripheral surgical wounding increased the levels of CD33 in the hippocampus of 18, but not 9, month-old mice. Finally, anti-inflammatory drug ibuprofen ameliorated the peripheral surgical wounding-induced cognitive impairment in 18 month-old mice. These data suggested that the peripheral surgical wounding could induce an age-dependent neuroinflammation and elevation of CD33 levels in the hippocampus of mice, which could lead to cognitive impairment in aged mice. Pending further studies, anti-inflammatory therapies may reduce the risk of postoperative cognitive dysfunction in elderly patients.

  2. Neutrophil depletion in the early inflammatory phase delayed cutaneous wound healing in older rats: improvements due to the use of un-denatured camel whey protein.

    Science.gov (United States)

    Ebaid, Hossam

    2014-03-04

    While it is known that advanced age alters the recruitment of neutrophils during wound healing, thereby delaying the wound healing process, little is known about prolonged wound healing in advanced ages. Thus, we investigated the correlation of neutrophil recruitment with healing events, and the impact of whey protein (WP) on neutrophil activation. The animals were allocated into wounded young group, wounded older group and wounded older rats with daily treatment of WP at a dose of 100 mg/kg of body weight. Our results pointed to a marked deficiency in the number of neutrophils in the wounds of older rats, which was accompanied with impairment of the healing process. In the group of older rats, phagocytic activity, as tested by fluorescence microscopy, declined throughout the first 24 hours after wounding. Both the neutrophil number and the phagocytic activity recovered in older rats which received WP supplementation. Interestingly, WP was found to significantly up-regulate the MIP-1α and CINC-1 mRNA expression in old rats. On the other hand, the wound size in older rats was significantly higher than that in younger ones. Blood angiogenesis was also significantly delayed in the older group as opposed to the young rats. WP, however, was found to return these indices to normal levels in the older rats. Proliferation and epidermal migration of the keratinocytes and the collagen deposition were also returned to the normal rates. This data confirms the critical role of neutrophil recruitment in the early inflammatory phase of wound healing in older rats. In addition, WP protein was used to improve neutrophil function in older rats, healing events returned to a more normal profile. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/2100966986117779.

  3. Skin wound healing in MMP2-deficient and MMP2 / plasminogen double-deficient mice

    DEFF Research Database (Denmark)

    Frøssing, Signe; Rønø, Birgitte; Hald, Andreas

    2010-01-01

    -sensitive MMPs during wound healing. To address whether MMP2 is accountable for the galardin-induced healing deficiency in wildtype and Plg-deficient mice, incisional skin wounds were generated in MMP2 single-deficient mice and in MMP2/Plg double-deficient mice and followed until healed. Alternatively, tissue...... was isolated 7 days post wounding for histological and biochemical analyses. No difference was found in the time from wounding to overt gross restoration of the epidermal surface between MMP2-deficient and wildtype control littermate mice. MMP2/Plg double-deficient mice were viable and fertile, and displayed...... an unchallenged general phenotype resembling that of Plg-deficient mice, including development of rectal prolapses. MMP2/Plg double-deficient mice displayed a slight increase in the wound length throughout the healing period compared with Plg-deficient mice. However, the overall time to complete healing...

  4. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  5. A homolog of Drosophila grainy head is essential for epidermal integrity in mice.

    Science.gov (United States)

    Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M

    2005-04-15

    The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.

  6. Consequences of age on ischemic wound healing in rats: altered antioxidant activity and delayed wound closure.

    Science.gov (United States)

    Moor, Andrea N; Tummel, Evan; Prather, Jamie L; Jung, Michelle; Lopez, Jonathan J; Connors, Sarah; Gould, Lisa J

    2014-04-01

    Advertisements targeted at the elderly population suggest that antioxidant therapy will reduce free radicals and promote wound healing, yet few scientific studies substantiate these claims. To better understand the potential utility of supplemental antioxidant therapy for wound healing, we tested the hypothesis that age and tissue ischemia alter the balance of endogenous antioxidant enzymes. Using a bipedicled skin flap model, ischemic and non-ischemic wounds were created on young and aged rats. Wound closure and the balance of the critical antioxidants superoxide dismutase and glutathione in the wound bed were determined. Ischemia delayed wound closure significantly more in aged rats. Lower superoxide dismutase 2 and glutathione in non-ischemic wounds of aged rats indicate a basal deficit due to age alone. Ischemic wounds from aged rats had lower superoxide dismutase 2 protein and activity initially, coupled with decreased ratios of reduced/oxidized glutathione and lower glutathione peroxidase activity. De novo glutathione synthesis, to restore redox balance in aged ischemic wounds, was initiated as evidenced by increased glutamate cysteine ligase. Results demonstrate deficiencies in two antioxidant pathways in aged rats that become exaggerated in ischemic tissue, culminating in profoundly impaired wound healing and prolonged inflammation.

  7. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  8. Grhl3 and Lmo4 play coordinate roles in epidermal migration.

    Science.gov (United States)

    Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M

    2008-09-01

    In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.

  9. Comparative Analysis of Angiogenic Gene Expression in Normal and Impaired Wound Healing in Diabetic Mice: Effects of Extracorporeal Shock Wave Therapy

    Science.gov (United States)

    2010-01-01

    an impaired wound was able to tum-on and/or augment for a prolonged period a number of key proangiogenic genes which were previously silent , and...Lania G, Zhang Z, Huynh T et al (2009) Early thyroid devel- opment requires a Tbxl-Fgf8 pathway. Dev Bioi 328(1):109-117 58. Terasaki K, Kanzaki T

  10. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  11. Role of adipose-derived stem cells in wound healing.

    Science.gov (United States)

    Hassan, Waqar Ul; Greiser, Udo; Wang, Wenxin

    2014-01-01

    Impaired wound healing remains a challenge to date and causes debilitating effects with tremendous suffering. Recent advances in tissue engineering approaches in the area of cell therapy have provided promising treatment options to meet the challenges of impaired skin wound healing such as diabetic foot ulcers. Over the last few years, stem cell therapy has emerged as a novel therapeutic approach for various diseases including wound repair and tissue regeneration. Several different types of stem cells have been studied in both preclinical and clinical settings such as bone marrow-derived stem cells, adipose-derived stem cells (ASCs), circulating angiogenic cells (e.g., endothelial progenitor cells), human dermal fibroblasts, and keratinocytes for wound healing. Adipose tissue is an abundant source of mesenchymal stem cells, which have shown an improved outcome in wound healing studies. ASCs are pluripotent stem cells with the ability to differentiate into different lineages and to secrete paracrine factors initiating tissue regeneration process. The abundant supply of fat tissue, ease of isolation, extensive proliferative capacities ex vivo, and their ability to secrete pro-angiogenic growth factors make them an ideal cell type to use in therapies for the treatment of nonhealing wounds. In this review, we look at the pathogenesis of chronic wounds, role of stem cells in wound healing, and more specifically look at the role of ASCs, their mechanism of action and their safety profile in wound repair and tissue regeneration. © 2014 by the Wound Healing Society.

  12. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  13. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  14. Age-associated intracellular superoxide dismutase deficiency potentiates dermal fibroblast dysfunction during wound healing.

    Science.gov (United States)

    Fujiwara, Toshihiro; Dohi, Teruyuki; Maan, Zeshaan N; Rustad, Kristine C; Kwon, Sun Hyung; Padmanabhan, Jagannath; Whittam, Alexander J; Suga, Hirotaka; Duscher, Dominik; Rodrigues, Melanie; Gurtner, Geoffrey C

    2017-07-04

    Reactive oxygen species (ROS) impair wound healing through destructive oxidation of intracellular proteins, lipids and nucleic acids. Intracellular superoxide dismutase (SOD1) regulates ROS levels and plays a critical role in tissue homoeostasis. Recent evidence suggests that age-associated wound healing impairments may partially result from decreased SOD1 expression. We investigated the mechanistic basis by which increased oxidative stress links to age-associated impaired wound healing. Fibroblasts were isolated from unwounded skin of young and aged mice, and myofibroblast differentiation was assessed by measuring α-smooth muscle actin and collagen gel contraction. Excisional wounds were created on young and aged mice to study the healing rate, ROS levels and SOD1 expression. A mechanistic link between oxidative stress and fibroblast function was explored by assessing the TGF-β1 signalling pathway components in young and aged mice. Age-related wounds displayed reduced myofibroblast differentiation and delayed wound healing, consistent with a decrease in the in vitro capacity for fibroblast-myofibroblast transition following oxidative stress. Young fibroblasts with normal SOD1 expression exhibited increased phosphorylation of ERK in response to elevated ROS. In contrast, aged fibroblasts with reduced SOD1 expression displayed a reduced capacity to modulate intracellular ROS. Collectively, age-associated wound healing impairments are associated with fibroblast dysfunction that is likely the result of decreased SOD1 expression and subsequent dysregulation of intracellular ROS. Strategies targeting these mechanisms may suggest a new therapeutic approach in the treatment of chronic non-healing wounds in the aged population. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Effects of Foeniculum vulgare essential oil compounds, fenchone and limonene, on experimental wound healing.

    Science.gov (United States)

    Keskin, I; Gunal, Y; Ayla, S; Kolbasi, B; Sakul, A; Kilic, U; Gok, O; Koroglu, K; Ozbek, H

    2017-01-01

    We investigated the wound healing efficacy of the Foeniculum vulgare compounds, fenchone and limonene, using an excisional cutaneous wound model in rats. An excision wound was made on the back of the rat and fenchone and limonene were applied topically to the wounds once daily, separately or together, for 10 days. Tissue sections from the wounds were evaluated for histopathology. The healing potential was assessed by comparison to an untreated control group and an olive oil treated sham group. We scored wound healing based on epidermal regeneration, granulation tissue thickness and angiogenesis. After day 6, wound contraction with limonene was significantly better than for the control group. Ten days after treatment, a significant increase was observed in wound contraction and re-epithelialization in both fenchone and limonene oil treated groups compared to the sham group. Groups treated with fenchone and with fenchone + limonene scored significantly higher than the control group, but the difference was not statistically significant compared to the olive oil treated group. Our findings support the beneficial effects of fenchone and limonene for augmenting wound healing. The anti-inflammatory and antimicrobial activities of fenchone and limonene oil increased collagen synthesis and decreased the number of inflammatory cells during wound healing and may be useful for treating skin wounds.

  16. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

    DEFF Research Database (Denmark)

    Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

    2009-01-01

    BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

  17. Expression of Neuropeptides and Cytokines in a Rabbit Model of Diabetic Neuroischemic Wound-Healing

    Science.gov (United States)

    Nabzdyk, Leena Pradhan; Kuchibhotla, Sarada; Guthrie, Patrick; Chun, Maggie; Auster, Michael E; Nabzdyk, Christoph; Deso, Steven; Andersen, Nicholas; LoGerfo, Frank W.; Veves, Aristidis

    2013-01-01

    Objective The present study is designed to understand the contribution of peripheral vascular disease and peripheral neuropathy to the wound-healing impairment associated with diabetes. Using a rabbit model of diabetic neuroischemic wound-healing we investigated rate of healing, leukocyte infiltration and expression of cytokines, Interleukin (IL)-8 and IL-6, and, neuropeptides, Substance P (SP) and Neuropeptide Y (NPY). Design of study Diabetes was induced in White New Zealand rabbits by administering alloxan while control rabbits received saline. Ten days later animals in both groups underwent surgery. One ear served as a sham and the other was made ischemic (ligation of central+rostral arteries), or neuroischemic (ischemia+ resection of central+rostral nerves). Four, 6mm punch biopsy wounds were created in both ears and wound-healing was followed for ten days using computerized planimetry. Results Non-diabetic sham and ischemic wounds healed significantly more rapidly than diabetic sham and ischemic wounds. Healing was slowest in neuroischemic wounds, irrespective of diabetic status. A high M1/M2 macrophage ratio and a high pro-inflammatory cytokine expression, both indicators of chronic-proinflammatory state, and low neuropeptide expression were seen in pre-injury diabetic skin. Post-injury, in diabetic wounds M1/M2 ratio remained high, the reactive increase in cytokine expression was low and neuropeptide expression was further decreased in neuroischemic wounds. Conclusion This rabbit model illustrates how a combination of a high M1/M2 ratio, a failure to mount post-injury cytokine response as well as a diminished neuropeptide expression contribute to wound-healing impairment in diabetes. The addition of neuropathy to ischemia leads to equivalently severe impaired wound-healing irrespective of diabetes status, suggesting that in the presence of ischemia, loss of neuropeptide function contributes to the impaired healing associated with diabetes. PMID:23755976

  18. Natural and synthetic polymers for wounds and burns dressing.

    Science.gov (United States)

    Mogoşanu, George Dan; Grumezescu, Alexandru Mihai

    2014-03-25

    In the last years, health care professionals faced with an increasing number of patients suffering from wounds and burns difficult to treat and heal. During the wound healing process, the dressing protects the injury and contributes to the recovery of dermal and epidermal tissues. Because their biocompatibility, biodegradability and similarity to macromolecules recognized by the human body, some natural polymers such as polysaccharides (alginates, chitin, chitosan, heparin, chondroitin), proteoglycans and proteins (collagen, gelatin, fibrin, keratin, silk fibroin, eggshell membrane) are extensively used in wounds and burns management. Obtained by electrospinning technique, some synthetic polymers like biomimetic extracellular matrix micro/nanoscale fibers based on polyglycolic acid, polylactic acid, polyacrylic acid, poly-ɛ-caprolactone, polyvinylpyrrolidone, polyvinyl alcohol, polyethylene glycol, exhibit in vivo and in vitro wound healing properties and enhance re-epithelialization. They provide an optimal microenvironment for cell proliferation, migration and differentiation, due to their biocompatibility, biodegradability, peculiar structure and good mechanical properties. Thus, synthetic polymers are used also in regenerative medicine for cartilage, bone, vascular, nerve and ligament repair and restoration. Biocompatible with fibroblasts and keratinocytes, tissue engineered skin is indicated for regeneration and remodeling of human epidermis and wound healing improving the treatment of severe skin defects or partial-thickness burn injuries. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Exploring the Urtica dioica Leaves Hemostatic and Wound-Healing Potential

    Directory of Open Access Journals (Sweden)

    Karama Zouari Bouassida

    2017-01-01

    Full Text Available The present paper investigated the efficiency of Urtica dioica (U. dioica on hemostatic and wound healing activities. U. dioica leaf extracts were evaluated for their antibacterial and antioxidant effects as well as their flavonoid and polyphenol content. The hydroethanolic extract (EtOH-H2OE, showing the most potent antibacterial and antioxidant activities in vitro, thanks to its flavonoid and polyphenol richness, was selected for hemostatic and wound healing evaluation. Twenty-four rats completing full-thickness wounds were split into four groups. The wounds were topically treated with saline solution, glycerol, “CICAFLORA,” and U. dioica EtOH-H2OE (50 µL/mm2 until day 11. The wound healing effect was assessed by macroscopic, histological, and biochemical parameters. Rats treated with EtOH-H2OE showed fast wound closure (92.39% compared to the control animals (60.91% on the 11th day of wounding (P<0.01. Histopathological and biochemical explorations showed full epidermal regeneration and an improvement of the hydroxyproline content in the U. dioica EtOH-H2OE treated rats. Analysis of fatty acids and sterols by GC-MS showed the presence of unsaturated fatty acids and a high concentration of lupeol known for their involvement in reepithelialization. These results prove the efficiency of U. dioica EtOH-H2OE in wound healing and supported its traditional use.

  20. Tilapia Piscidin 4 (TP4 Stimulates Cell Proliferation and Wound Closure in MRSA-Infected Wounds in Mice

    Directory of Open Access Journals (Sweden)

    Hang-Ning Huang

    2015-05-01

    Full Text Available Antimicrobial peptides (AMPs are endogenous antibiotics that directly affect microorganisms, and also have a variety of receptor-mediated functions. One such AMP, Tilapia piscidin 4 (TP4, was isolated from Nile tilapia (Oreochromis niloticus; TP4 has antibacterial effects and regulates the innate immune system. The aim of the present study was to characterize the role of TP4 in the regulation of wound closure in mice and proliferation of a keratinocyte cell line (HaCaT and fibroblast cell line (Hs-68. In vitro, TP4 stimulated cell proliferation and activated collagen I, collagen III, and keratinocyte growth factor (KGF gene expression in Hs-68 cells, which induces keratin production by HaCaT cells. This effect was detectable at TP4 concentrations of 6.25 µg/mL in both cell lines. In vivo, TP4 was found to be highly effective at combating peritonitis and wound infection caused by MRSA in mouse models, without inducing adverse behavioral effects or liver or kidney toxicity. Taken together, our results indicate that TP4 enhances the survival rate of mice infected with the bacterial pathogen MRSA through both antimicrobial and wound closure activities mediated by epidermal growth factor (EGF, transforming growth factor (TGF, and vascular endothelial growth factor (VEGF. The peptide is likely involved in antibacterial processes and regulation of tissue homeostasis in infected wounds in mice. Overall, these results suggest that TP4 may be suitable for development as a novel topical agent for wound dressing.

  1. Multifunctional skin-like electronics for quantitative, clinical monitoring of cutaneous wound healing.

    Science.gov (United States)

    Hattori, Yoshiaki; Falgout, Leo; Lee, Woosik; Jung, Sung-Young; Poon, Emily; Lee, Jung Woo; Na, Ilyoun; Geisler, Amelia; Sadhwani, Divya; Zhang, Yihui; Su, Yewang; Wang, Xiaoqi; Liu, Zhuangjian; Xia, Jing; Cheng, Huanyu; Webb, R Chad; Bonifas, Andrew P; Won, Philip; Jeong, Jae-Woong; Jang, Kyung-In; Song, Young Min; Nardone, Beatrice; Nodzenski, Michael; Fan, Jonathan A; Huang, Yonggang; West, Dennis P; Paller, Amy S; Alam, Murad; Yeo, Woon-Hong; Rogers, John A

    2014-10-01

    Non-invasive, biomedical devices have the potential to provide important, quantitative data for the assessment of skin diseases and wound healing. Traditional methods either rely on qualitative visual and tactile judgments of a professional and/or data obtained using instrumentation with forms that do not readily allow intimate integration with sensitive skin near a wound site. Here, an electronic sensor platform that can softly and reversibly laminate perilesionally at wounds to provide highly accurate, quantitative data of relevance to the management of surgical wound healing is reported. Clinical studies on patients using thermal sensors and actuators in fractal layouts provide precise time-dependent mapping of temperature and thermal conductivity of the skin near the wounds. Analytical and simulation results establish the fundamentals of the sensing modalities, the mechanics of the system, and strategies for optimized design. The use of this type of "epidermal" electronics system in a realistic clinical setting with human subjects establishes a set of practical procedures in disinfection, reuse, and protocols for quantitative measurement. The results have the potential to address important unmet needs in chronic wound management. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Androgen receptor–mediated inhibition of cutaneous wound healing

    OpenAIRE

    Ashcroft, Gillian S.; Mills, Stuart J.

    2002-01-01

    Impaired wound healing states in the elderly lead to substantial morbidity, mortality, and a cost to the USHealth Services of over $9 billion per annum. In addition to intrinsic aging per se causing delayed healing, studies have suggested marked sex-differences in wound repair. We report that castration of male mice results in a striking acceleration of local cutaneous wound healing, and is associated with a reduced inflammatory response and increased hair growth. Using a hairless mouse model...

  3. Wound healing delays in α-Klotho-deficient mice that have skin appearance similar to that in aged humans - Study of delayed wound healing mechanism.

    Science.gov (United States)

    Yamauchi, Makoto; Hirohashi, Yoshihiko; Torigoe, Toshihiko; Matsumoto, Yoshitaka; Yamashita, Ken; Kayama, Musashi; Sato, Noriyuki; Yotsuyanagi, Takatoshi

    2016-05-13

    Skin atrophy and delayed wound healing are observed in aged humans; however, the molecular mechanism are still elusive. The aim of this study was to analyze the molecular mechanisms of delayed wound healing by aging using α-Klotho-deficient (kl/kl) mice, which have phenotypes similar to those of aged humans. The kl/kl mice showed delayed wound healing and impaired granulation formation compared with those in wild-type (WT) mice. The skin graft experiments revealed that delayed wound healing depends on humoral factors, but not on kl/kl skin tissue. The mRNA expression levels of cytokines related to acute inflammation including IL-1β, IL-6 and TNF-α were higher in wound lesions of kl/kl mice compared with the levels in WT mice by RT-PCR analysis. LPS-induced TNF-α production model using spleen cells revealed that TNF-α production was significantly increased in the presence of FGF23. Thus, higher levels of FGF23 in kl/kl mouse may have a role to increase TNF-α production in would lesion independently of α-Klotho protein, and impair granulation formation and delay wound healing. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. SDF-1 improves wound healing ability of glucocorticoid-treated adipose tissue-derived mesenchymal stem cells.

    Science.gov (United States)

    Kato, Toshiki; Khanh, Vuong Cat; Sato, Kazutoshi; Takeuchi, Kosuke; Carolina, Erica; Yamashita, Toshiharu; Sugaya, Hisashi; Yoshioka, Tomokazu; Mishima, Hajime; Ohneda, Osamu

    2017-11-18

    Glucocorticoids cause the delayed wound healing by suppressing inflammation that is required for wound healing process. Adipose tissue-derived mesenchymal stem cells (AT-MSCs) play an important role for wound healing by their cytokine productions including stromal derived factor 1 (SDF-1). However, it has not been clear how glucocorticoids affect the wound healing ability of AT-MSCs. In this study, we found that glucocorticoid downregulated SDF-1 expression in AT-MSCs. In addition, glucocorticoid-treated AT-MSCs induced less migration of inflammatory cells and impaired wound healing capacity compared with glucocorticoid-untreated AT-MSCs. Of note, prostaglandin E2 (PGE2) synthesis-related gene expression was downregulated by glucocorticoid and PGE2 treatment rescued not only SDF-1 expression in the presence of glucocorticoid but also their wound healing capacity in vivo. Furthermore, we found SDF-1-overexpressed AT-MSCs restored wound healing capacity even after treatment of glucocorticoid. Consistent with the results obtained from glucocorticoid-treated AT-MSCs, we found that AT-MSCs isolated from steroidal osteonecrosis donors (sAT-MSCs) who received chronic glucocorticoid therapy showed less SDF-1 expression and impaired wound healing capacity compared with traumatic osteonecrosis donor-derived AT-MSCs (nAT-MSCs). Moreover, the SDF-1 level was also reduced in plasma derived from steroidal osteonecrosis donors compared with traumatic osteonecrosis donors. These results provide the evidence that concomitant application of AT-MSCs with glucocorticoid shows impaired biological modulatory effects that induce impaired wound healing. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Adenoviral gene delivery to primary human cutaneous cells and burn wounds.

    Science.gov (United States)

    Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars

    2006-01-01

    The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determined up to 30 days. Expression was quantified by FACS analysis and fluorimeter. Cytotoxicity was measured using the trypan blue exclusion method. 45 male Sprague Dawley rats received 2x10(8) pfu of Ad5-CMV-LacZ or carrier control intradermally into either superficial partial thickness scald burn or unburned skin. Animals were euthanized after 48 h, 7 or 14 days posttreatment. Transgene expression was assessed using immunohistochemistry and bioluminescent assays. The highest transfection rate was observed 48 h posttransfection: 79% for HKC, 70% for HFB, and 48% for HaCaT. The eGFP expression was detectable in all groups over 30 days (P>0.05). Cytotoxic effects of the adenoviral vector were observed for HFB after 10 days and HaCaT after 30 days. Reporter gene expression in vivo was significantly higher in burned skin compared with unburned skin (P=0,004). Gene expression decreases from 2 to 7 days with no significant expression after 14 days. This study demonstrates that effective adenoviral-mediated gene transfer of epidermal primary cells and cell-lines is feasible. Ex vivo gene transfer in epithelial cells might have promise for the use in severely burned patients who receive autologous keratinocyte sheets. Transient cutaneous gene delivery in burn wounds using adenoviral vectors causes significant concentrations in the wound tissue for at least 1 week. Based on these findings, we hypothesize that transient cutaneous adenoviral gene delivery of wound healing promoting factors has

  6. Injury-activated glial cells promote wound healing of the adult skin in mice.

    Science.gov (United States)

    Parfejevs, Vadims; Debbache, Julien; Shakhova, Olga; Schaefer, Simon M; Glausch, Mareen; Wegner, Michael; Suter, Ueli; Riekstina, Una; Werner, Sabine; Sommer, Lukas

    2018-01-16

    Cutaneous wound healing is a complex process that aims to re-establish the original structure of the skin and its functions. Among other disorders, peripheral neuropathies are known to severely impair wound healing capabilities of the skin, revealing the importance of skin innervation for proper repair. Here, we report that peripheral glia are crucially involved in this process. Using a mouse model of wound healing, combined with in vivo fate mapping, we show that injury activates peripheral glia by promoting de-differentiation, cell-cycle re-entry and dissemination of the cells into the wound bed. Moreover, injury-activated glia upregulate the expression of many secreted factors previously associated with wound healing and promote myofibroblast differentiation by paracrine modulation of TGF-β signalling. Accordingly, depletion of these cells impairs epithelial proliferation and wound closure through contraction, while their expansion promotes myofibroblast formation. Thus, injury-activated glia and/or their secretome might have therapeutic potential in human wound healing disorders.

  7. Targeted inactivation of integrin-linked kinase in hair follicle stem cells reveals an important modulatory role in skin repair after injury.

    Science.gov (United States)

    Nakrieko, Kerry-Ann; Rudkouskaya, Alena; Irvine, Timothy S; D'Souza, Sudhir J A; Dagnino, Lina

    2011-07-15

    Integrin-linked kinase (ILK) is key for normal epidermal morphogenesis, but little is known about its role in hair follicle stem cells and epidermal regeneration. Hair follicle stem cells are important contributors to newly formed epidermis following injury. We inactivated the Ilk gene in the keratin 15--expressing stem cell population of the mouse hair follicle bulge. Loss of ILK expression in these cells resulted in impaired cutaneous wound healing, with substantially decreased wound closure rates. ILK-deficient stem cells produced very few descendants that moved toward the epidermal surface and into the advancing epithelium that covers the wound. Furthermore, those few mutant cells that homed in the regenerated epidermis exhibited a reduced residence time. Paradoxically, ILK-deficient bulge stem cells responded to anagen growth signals and contributed to newly regenerated hair follicles during this phase of hair follicle growth. Thus ILK plays an important modulatory role in the normal contribution of hair follicle stem cell progeny to the regenerating epidermis following injury.

  8. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  9. In Vivo Assessment of Printed Microvasculature in a Bilayer Skin Graft to Treat Full-Thickness Wounds

    Science.gov (United States)

    Yanez, Maria; Rincon, Julio; Dones, Aracely; De Maria, Carmelo; Gonzales, Raoul

    2015-01-01

    Chronic wounds such as diabetic foot ulcers and venous leg ulcers are common problems in people suffering from type 2 diabetes. These can cause pain, and nerve damage, eventually leading to foot or leg amputation. These types of wounds are very difficult to treat and sometimes take months or even years to heal because of many possible complications during the process. Allogeneic skin grafting has been used to improve wound healing, but the majority of grafts do not survive several days after being implanted. We have been studying the behavior of fibroblasts and keratinocytes in engineered capillary-like endothelial networks. A dermo-epidermal graft has been implanted in an athymic nude mouse model to assess the integration with the host tissue as well as the wound healing process. To build these networks into a skin graft, a modified inkjet printer was used, which allowed the deposit of human microvascular endothelial cells. Neonatal human dermal fibroblast cells and neonatal human epidermal keratinocytes were manually mixed in the collagen matrix while endothelial cells printed. A full-thickness wound was created at the top of the back of athymic nude mice and the area was covered by the bilayered graft. Mice of the different groups were followed until completion of the specified experimental time line, at which time the animals were humanely euthanized and tissue samples were collected. Wound contraction improved by up to 10% when compared with the control groups. Histological analysis showed the neoskin having similar appearance to the normal skin. Both layers, dermis and epidermis, were present with thicknesses resembling normal skin. Immunohistochemistry analysis showed favorable results proving survival of the implanted cells, and confocal images showed the human cells' location in the samples that were collocated with the bilayer printed skin graft. PMID:25051339

  10. Effects of topical topiramate in wound healing in mice.

    Science.gov (United States)

    Jara, Carlos Poblete; Bóbbo, Vanessa Cristina Dias; Carraro, Rodrigo Scarpari; de Araujo, Thiago Matos Ferreira; Lima, Maria H M; Velloso, Licio A; Araújo, Eliana P

    2018-02-23

    Recent studies have indicated that systemic topiramate can induce an improvement on the aesthetic appearance of skin scars. Here, we evaluated topical topiramate as an agent to improve wound healing in C57/BL6 mice. Mice were inflicted with a 6.0 mm punch to create two wounds in the skin of the dorsal region. Thereafter, mice were randomly assigned to either vehicle or topical topiramate (20 µl of 2% cream) once a day for 14 days, beginning on the same day as wound generation. We analyzed the wound samples over real-time PCR, Western blotting, and microscopy. There was no effect of the topiramate treatment on the time for complete reepithelization of the wound. However, on microscopic analysis, topiramate treatment resulted in increased granulation tissue, thicker epidermal repair, and improved deposition of type I collagen fibers. During wound healing, there were increased expressions of anti-inflammatory markers, such as IL-10, TGF-β1, and reduced expression of the active form of JNK. In addition, topiramate treatment increased the expression of active forms of two intermediaries in the insulin-signaling pathway, IRS-1 and Akt. Finally, at the end of the wound-healing process, topiramate treatment resulted in increased expression of SOX-2, a transcription factor that is essential to maintain cell self-renewal of undifferentiated embryonic stem cells. We conclude that topical topiramate can improve the overall quality of wound healing in the healthy skin of mice. This improvement is accompanied by reduced expression of markers involved in inflammation and increased expression of proteins of the insulin-signaling pathway.

  11. Characterizing the mechanical response of epidermal cell monolayers during wound healing

    OpenAIRE

    Valencia Blanco, Leticia

    2017-01-01

    Mención Internacional en el título de doctor Epithelial migration plays an important role during re-epithelization phase in wound healing. Several skin diseases, such as chronic ulcers, fail during this stage. During last years a new insight into this problem has arisen introducing a mechanical point of view of this process. Kinematics and density distribution within the epithelium play key role during collective migration. Besides, the capacity of cells to proliferate and p...

  12. The Role of Matrix Metalloproteinases in Diabetic Wound Healing in relation to Photobiomodulation.

    Science.gov (United States)

    Ayuk, Sandra Matabi; Abrahamse, Heidi; Houreld, Nicolette Nadene

    2016-01-01

    The integration of several cellular responses initiates the process of wound healing. Matrix Metalloproteinases (MMPs) play an integral role in wound healing. Their main function is degradation, by removal of damaged extracellular matrix (ECM) during the inflammatory phase, breakdown of the capillary basement membrane for angiogenesis and cell migration during the proliferation phase, and contraction and remodelling of tissue in the remodelling phase. For effective healing to occur, all wounds require a certain amount of these enzymes, which on the contrary could be very damaging at high concentrations causing excessive degradation and impaired wound healing. The imbalance in MMPs may increase the chronicity of a wound, a familiar problem seen in diabetic patients. The association of diabetes with impaired wound healing and other vascular complications is a serious public health issue. These may eventually lead to chronic foot ulcers and amputation. Low intensity laser irradiation (LILI) or photobiomodulation (PBM) is known to stimulate several wound healing processes; however, its role in matrix proteins and diabetic wound healing has not been fully investigated. This review focuses on the role of MMPs in diabetic wound healing and their interaction in PBM.

  13. The Role of Matrix Metalloproteinases in Diabetic Wound Healing in relation to Photobiomodulation

    Directory of Open Access Journals (Sweden)

    Sandra Matabi Ayuk

    2016-01-01

    Full Text Available The integration of several cellular responses initiates the process of wound healing. Matrix Metalloproteinases (MMPs play an integral role in wound healing. Their main function is degradation, by removal of damaged extracellular matrix (ECM during the inflammatory phase, breakdown of the capillary basement membrane for angiogenesis and cell migration during the proliferation phase, and contraction and remodelling of tissue in the remodelling phase. For effective healing to occur, all wounds require a certain amount of these enzymes, which on the contrary could be very damaging at high concentrations causing excessive degradation and impaired wound healing. The imbalance in MMPs may increase the chronicity of a wound, a familiar problem seen in diabetic patients. The association of diabetes with impaired wound healing and other vascular complications is a serious public health issue. These may eventually lead to chronic foot ulcers and amputation. Low intensity laser irradiation (LILI or photobiomodulation (PBM is known to stimulate several wound healing processes; however, its role in matrix proteins and diabetic wound healing has not been fully investigated. This review focuses on the role of MMPs in diabetic wound healing and their interaction in PBM.

  14. Wounding coordinately induces cell wall protein, cell cycle and pectin methyl esterase genes involved in tuber closing layer and wound periderm development.

    Science.gov (United States)

    Neubauer, Jonathan D; Lulai, Edward C; Thompson, Asunta L; Suttle, Jeffrey C; Bolton, Melvin D

    2012-04-15

    Little is known about the coordinate induction of genes that may be involved in agriculturally important wound-healing events. In this study, wound-healing events were determined together with wound-induced expression profiles of selected cell cycle, cell wall protein, and pectin methyl esterase genes using two diverse potato genotypes and two harvests (NDTX4271-5R and Russet Burbank tubers; 2008 and 2009 harvests). By 5 d after wounding, the closing layer and a nascent phellogen had formed. Phellogen cell divisions generated phellem layers until cessation of cell division at 28 d after wounding for both genotypes and harvests. Cell cycle genes encoding epidermal growth factor binding protein (StEBP), cyclin-dependent kinase B (StCDKB) and cyclin-dependent kinase regulatory subunit (StCKS1At) were induced by 1 d after wounding; these expressions coordinated with related phellogen formation and the induction and cessation of phellem cell formation. Genes encoding the structural cell wall proteins extensin (StExt1) and extensin-like (StExtlk) were dramatically up-regulated by 1-5 d after wounding, suggesting involvement with closing layer and later phellem cell layer formation. Wounding up-regulated pectin methyl esterase genes (StPME and StPrePME); StPME expression increased during closing layer and phellem cell formation, whereas maximum expression of StPrePME occurred at 5-14 d after wounding, implicating involvement in later modifications for closing layer and phellem cell formation. The coordinate induction and expression profile of StTLRP, a gene encoding a cell wall strengthening "tyrosine-and lysine-rich protein," suggested a role in the formation of the closing layer followed by phellem cell generation and maturation. Collectively, the genes monitored were wound-inducible and their expression profiles markedly coordinated with closing layer formation and the index for phellogen layer meristematic activity during wound periderm development; results were more

  15. Insulin and TOR signal in parallel through FOXO and S6K to promote epithelial wound healing

    Science.gov (United States)

    Kakanj, Parisa; Moussian, Bernard; Grönke, Sebastian; Bustos, Victor; Eming, Sabine A.; Partridge, Linda; Leptin, Maria

    2016-01-01

    The TOR and Insulin/IGF signalling (IIS) network controls growth, metabolism and ageing. Although reducing TOR or insulin signalling can be beneficial for ageing, it can be detrimental for wound healing, but the reasons for this difference are unknown. Here we show that IIS is activated in the cells surrounding an epidermal wound in Drosophila melanogaster larvae, resulting in PI3K activation and redistribution of the transcription factor FOXO. Insulin and TOR signalling are independently necessary for normal wound healing, with FOXO and S6K as their respective effectors. IIS is specifically required in cells surrounding the wound, and the effect is independent of glycogen metabolism. Insulin signalling is needed for the efficient assembly of an actomyosin cable around the wound, and constitutively active myosin II regulatory light chain suppresses the effects of reduced IIS. These findings may have implications for the role of insulin signalling and FOXO activation in diabetic wound healing. PMID:27713427

  16. miRNA delivery for skin wound healing.

    Science.gov (United States)

    Meng, Zhao; Zhou, Dezhong; Gao, Yongsheng; Zeng, Ming; Wang, Wenxin

    2017-12-19

    The wound healing has remained a worldwide challenge as one of significant public health problems. Pathological scars and chronic wounds caused by injury, aging or diabetes lead to impaired tissue repair and regeneration. Due to the unique biological wound environment, the wound healing is a highly complicated process, efficient and targeted treatments are still lacking. Hence, research-driven to discover more efficient therapeutics is a highly urgent demand. Recently, the research results have revealed that microRNA (miRNA) is a promising tool in therapeutic and diagnostic fields because miRNA is an essential regulator in cellular physiology and pathology. Therefore, new technologies for wound healing based on miRNA have been developed and miRNA delivery has become a significant research topic in the field of gene delivery. Copyright © 2017. Published by Elsevier B.V.

  17. Eff ect of vitamin E isoforms on the primary intention Eff ect of vitamin E isoforms on the primary intention skin wound healing of diabetic rats

    Directory of Open Access Journals (Sweden)

    Bijo Elsy

    2017-10-01

    Full Text Available Introduction: Impaired wound healing events is a common complication in diabetes. One of the effective nutritional antioxidant on skin wound healing is vitamin E which contains saturated tocopherol and unsaturated tocotrienol forms. This present study is designed to explore the effect of different vitamin E isoforms on stitched skin wound in both healthy and diabetic rats. Materials and Methods: Forty eight albino rats were divided into eight groups; healthy control, diabetic control, healthy treated (d-α-tocopherol, d-δ-TRF and co-administrated and diabetic treated (d-αtocopherol, d-δ-TRF and co-administrated. Diabetes was induced through single subcutaneous injection of alloxan at the dose of 100 mg/kg. Treated groups were administered d-a-tocopherol (200 mg/kg, d-δ-TRF (200 mg/kg and co-administration (100 mg/kg of these two compounds each orally and daily for three weeks. A horizontal skin incision was made on right mid-thigh region at 2.95 ± 0.17cm in length and wound was closed with an absorbable suture. Results: Histopathological and histomorphological results at the end of 3rd week revealed that the d-δ-TRF treated groups promote the regeneration and reorganization of epidermal and dermal components in healing of primary intention more effectively than the d-α-tocopherol and co-administrated groups. Conclusion: It is concluded that among different vitamin E isoforms the d-δ-TRF appears to be a more effective nutritional antioxidant on skin wound healing in both healthy and diabetics.

  18. A novel model of chronic wounds: importance of redox imbalance and biofilm-forming bacteria for establishment of chronicity.

    Directory of Open Access Journals (Sweden)

    Sandeep Dhall

    Full Text Available Chronic wounds have a large impact on health, affecting ∼6.5 M people and costing ∼$25B/year in the US alone. We previously discovered that a genetically modified mouse model displays impaired healing similar to problematic wounds in humans and that sometimes the wounds become chronic. Here we show how and why these impaired wounds become chronic, describe a way whereby we can drive impaired wounds to chronicity at will and propose that the same processes are involved in chronic wound development in humans. We hypothesize that exacerbated levels of oxidative stress are critical for initiation of chronicity. We show that, very early after injury, wounds with impaired healing contain elevated levels of reactive oxygen and nitrogen species and, much like in humans, these levels increase with age. Moreover, the activity of anti-oxidant enzymes is not elevated, leading to buildup of oxidative stress in the wound environment. To induce chronicity, we exacerbated the redox imbalance by further inhibiting the antioxidant enzymes and by infecting the wounds with biofilm-forming bacteria isolated from the chronic wounds that developed naturally in these mice. These wounds do not re-epithelialize, the granulation tissue lacks vascularization and interstitial collagen fibers, they contain an antibiotic-resistant mixed bioflora with biofilm-forming capacity, and they stay open for several weeks. These findings are highly significant because they show for the first time that chronic wounds can be generated in an animal model effectively and consistently. The availability of such a model will significantly propel the field forward because it can be used to develop strategies to regain redox balance that may result in inhibition of biofilm formation and result in restoration of healthy wound tissue. Furthermore, the model can lead to the understanding of other fundamental mechanisms of chronic wound development that can potentially lead to novel therapies.

  19. Effects of structurally stabilized EGF and bFGF on wound healing in type I and type II diabetic mice.

    Science.gov (United States)

    Choi, Seong Mi; Lee, Kyoung-Mi; Kim, Hyun Jung; Park, Ik Kyu; Kang, Hwi Ju; Shin, Hang-Cheol; Baek, Dawoon; Choi, Yoorim; Park, Kwang Hwan; Lee, Jin Woo

    2018-01-15

    Diabetes mellitus comprises a multiple metabolic disorder that affects millions of people worldwide and consequentially poses challenges for clinical treatment. Among the various complications, diabetic ulcer constitutes the most prevalent associated disorder and leads to delayed wound healing. To enhance wound healing capacity, we developed structurally stabilized epidermal growth factor (ST-EGF) and basic fibroblast growth factor (ST-bFGF) to overcome limitations of commercially available EGF (CA-EGF) and bFGF (CA-bFGF), such as short half-life and loss of activity after loading onto a matrix. Neither ST-EGF nor ST-bFGF was toxic, and both were more stable at higher temperatures than CA-EGF and CA-bFGF. We loaded ST-EGF and ST-bFGF onto a hyaluronate-collagen dressing (HCD) matrix, a biocompatible carrier, and tested the effectiveness of this system in promoting wound healing in a mouse model of diabetes. Wounds treated with HCD matrix loaded with 0.3 μg/cm 2 ST-EGF or 1 μg/cm 2 ST-bFGF showed a more rapid rate of tissue repair as compared to the control in type I and II diabetes models. Our results indicate that an HDC matrix loaded with 0.3 μg/cm 2 ST-EGF or 1 μg/cm 2 ST-bFGF can promote wound healing in diabetic ulcers and are suitable for use in wound dressings owing to their stability for long periods at room temperature. Various types of dressing materials loaded with growth factors, such as VEGF, EGF, and bFGF, are widely used to effect wound repair. However, such growth factor-loaded materials have several limitations for use as therapeutic agents in healing-impaired diabetic wounds. To overcome these limitations, we have developed new materials containing structurally stabilized EGF (ST-EGF) and bFGF (ST-bFGF). To confirm the wound healing capacity of newly developed materials (ST-EGF and ST-bFGF-loaded hyaluronate-collagen dressing [HCD] matrix), we applied these matrices in type I and type II diabetic wounds. Notably, these matrices were

  20. Dynamic protein expression patterns during intraoral wound healing in the rat.

    NARCIS (Netherlands)

    Beurden, H.E. van; Snoek, P.A.; Hoff, J.W. Von den; Torensma, R.; Maltha, J.C.; Kuijpers-Jagtman, A.M.

    2005-01-01

    Wound healing after cleft palate surgery is often associated with impairment of maxillary growth and dento-alveolar development. Wound contraction and scar tissue formation contribute strongly to these effects. In vitro studies have revealed that fibroblasts isolated during different phases of

  1. Effects of carbon dioxide therapy on the healing of acute skin wounds induced on the back of rats

    Directory of Open Access Journals (Sweden)

    Maria Vitória Carmo Penhavel

    2013-05-01

    Full Text Available PURPOSE: To evaluate the healing effect of carbon dioxide therapy on skin wounds induced on the back of rats. METHODS: Sixteen rats underwent excision of a round dermal-epidermal dorsal skin flap of 2.5 cm in diameter. The animals were divided into two groups, as follows: carbon dioxide group - subcutaneous injections of carbon dioxide on the day of operation and at three, six and nine days postoperatively; control group - no postoperative wound treatment. Wounds were photographed on the day of operation and at six and 14 days postoperatively for analysis of wound area and major diameter. All animals were euthanized on day 14 after surgery. The dorsal skin and the underlying muscle layer containing the wound were resected for histopathological analysis. RESULTS: There was no statistically significant difference between groups in the percentage of wound closure, in histopathological findings, or in the reduction of wound area and major diameter at 14 days postoperatively. CONCLUSION: Under the experimental conditions in which this study was conducted, carbon dioxide therapy had no effects on the healing of acute skin wounds in rats.

  2. Thyrotropin-releasing hormone (TRH promotes wound re-epithelialisation in frog and human skin.

    Directory of Open Access Journals (Sweden)

    Natalia T Meier

    Full Text Available There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression. Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters.

  3. Thyrotropin-Releasing Hormone (TRH) Promotes Wound Re-Epithelialisation in Frog and Human Skin

    Science.gov (United States)

    Zhang, Guo-You; Emelianov, Vladimir; Paredes, Roberto; Debus, Sebastian; Augustin, Matthias; Funk, Wolfgang; Amaya, Enrique; Kloepper, Jennifer E.; Hardman, Matthew J.; Paus, Ralf

    2013-01-01

    There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis) skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH) as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression). Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters. PMID:24023889

  4. Pseudomonas aeruginosa uses T3SS to inhibit diabetic wound healing.

    Science.gov (United States)

    Goldufsky, Josef; Wood, Stephen J; Jayaraman, Vijayakumar; Majdobeh, Omar; Chen, Lin; Qin, Shanshan; Zhang, Chunxiang; DiPietro, Luisa A; Shafikhani, Sasha H

    2015-01-01

    Diabetic foot ulcers are responsible for more hospitalizations than any other complication of diabetes. Bacterial infection is recognized as an important factor associated with impaired healing in diabetic ulcers. Pseudomonas aeruginosa is the most frequently detected Gram-negative pathogen in diabetic ulcers. P. aeruginosa infection has been shown to impair healing in diabetic wounds in a manner that correlates with its ability to form biofilm. While the majority of infections in diabetic ulcers are biofilm associated, 33% of infections are nonbiofilm in nature. P. aeruginosa is the most prevalent Gram-negative pathogen in all diabetic wound types, which suggests that the deleterious impact of P. aeruginosa on healing in diabetic wounds goes beyond its ability to form biofilm and likely involves other factors. The Type III Secretion System (T3SS) virulence structure is required for the pathogenesis of all P. aeruginosa clinical isolates, suggesting that it may also play a role in the inhibition of wound repair in diabetic skin ulcers. We evaluated the role of T3SS in mediating P. aeruginosa-induced tissue damage in the wounds of diabetic mice. Our data demonstrate that P. aeruginosa establishes a robust and persistent infection in diabetic wounds independent of its ability to form biofilm and causes severe wound damage in a manner that primarily depends on its T3SS. © 2015 by the Wound Healing Society.

  5. Acmella oleracea and Achyrocline satureioides as Sources of Natural Products in Topical Wound Care.

    Science.gov (United States)

    Yamane, Lais Thiemi; de Paula, Eneida; Jorge, Michelle Pedroza; de Freitas-Blanco, Verônica Santana; Junior, Ílio Montanari; Figueira, Glyn Mara; Anholeto, Luís Adriano; de Oliveira, Patricia Rosa; Rodrigues, Rodney Alexandre Ferreira

    2016-01-01

    The Brazilian forests have one of the world's biggest biodiversities. Achyrocline satureioides (macela) and Acmella oleracea (jambu) are native species from Brazil with a huge therapeutic potential, with proved anti-inflammatory and anesthetic action, respectively. The jambu's crude extract after depigmentation with activated charcoal and macela's essential oil were incorporated in a film made with hydroxyethyl cellulose. Those films were evaluated by mechanical test using a texturometer and anti-inflammatory and anesthetic activities by in vivo tests: wound healing and antinociceptive. The film containing the highest concentration of depigmented jambu's extract and macela's essential oil obtained an anesthesia time of 83.6 (±28.5) min longer when compared with the positive control EMLA®; the same occurred with the wound healing test; the film containing the highest concentration had a higher wound contraction (62.0% ± 12.1) compared to the positive control allantoin and the histopathological analysis demonstrated that it increases collagen synthesis and epidermal thickening. The results demonstrate that the films have a potential use in skin wounds, pressure sore, and infected surgical wounds treatment.

  6. SDF-1 alpha expression during wound healing in the aged is HIF dependent.

    Science.gov (United States)

    Loh, Shang A; Chang, Edward I; Galvez, Michael G; Thangarajah, Hariharan; El-ftesi, Samyra; Vial, Ivan N; Lin, Darius A; Gurtner, Geoffrey C

    2009-02-01

    Age-related impairments in wound healing are associated with decreased neovascularization, a process that is regulated by hypoxia-responsive cytokines, including stromal cell-derived factor (SDF)-1 alpha. Interleukin-1 beta is an important inflammatory cytokine involved in wound healing and is believed to regulate SDF-1 alpha expression independent of hypoxia signaling. Thus, the authors examined the relative importance of interleukin (IL)-1 beta and hypoxia-inducible factor (HIF)-1 alpha on SDF-1 alpha expression in aged wound healing. Young and aged mice (n = 4 per group) were examined for wound healing using a murine excisional wound model. Wounds were harvested at days 0, 1, 3, 5, and 7 for histologic analysis, immunohistochemistry, enzyme-linked immunosorbent assay, and Western blot. An engineered wild-type and mutated SDF luciferase reporter construct were used to determine HIF transactivation. Aged mice demonstrated significantly impaired wound healing, reduced granulation tissue, and increased epithelial gap compared with young controls. Real-time polymerase chain reaction demonstrated reduced SDF-1 alpha levels in aged wounds that correlated with reduced CD31+ neovessels. Western blots revealed decreased HIF-1 alpha protein in aged wounds. However, both IL-1 beta and macrophage infiltrate were unchanged between young and aged animals. Using the wild-type and mutated SDF luciferase reporter construct in which the hypoxia response element was deleted, only young fibroblasts were able to respond to IL-1 beta stimulation, and this response was abrogated by mutating the HIF-binding sites. This suggests that HIF binding is essential for SDF-1 transactivation in response to both inflammatory and hypoxic stimuli. SDF-1 alpha deficiency observed during aged wound healing is attributable predominantly to decreased HIF-1 alpha levels rather than impaired IL-1 beta expression.

  7. The effect of local hyperglycemia on skin cells in vitro and on wound healing in euglycemic rats

    DEFF Research Database (Denmark)

    Kruse, Carla R; Singh, Mansher; Sørensen, Jens A

    2016-01-01

    BACKGROUND: Multiple previous studies have established that high systemic blood glucose concentration impairs skin wound healing. However, the effects of local hyperglycemia on wound healing are not well defined. Comprehensive animal studies and in vitro studies using both fibroblasts and keratin......BACKGROUND: Multiple previous studies have established that high systemic blood glucose concentration impairs skin wound healing. However, the effects of local hyperglycemia on wound healing are not well defined. Comprehensive animal studies and in vitro studies using both fibroblasts...

  8. A human model of small fiber neuropathy to study wound healing.

    Directory of Open Access Journals (Sweden)

    Ben M W Illigens

    Full Text Available The aim of this study was to develop a human model of acute wound healing that isolated the effects of small fiber neuropathy on the healing process. Twenty-five healthy subjects had the transient receptor vanilloid 1 agonist capsaicin and placebo creams topically applied to contralateral areas on the skin of the thigh for 48 hours. Subjects had shallow (1.2 millimeter and deep (>3 millimeter punch skin biopsies from each thigh on days 1 and 14. Biopsy wound healing was monitored photographically until closure. Intra-epidermal and sweat-gland nerve fiber densities were measured for each biopsy. Shallow wounds in capsaicin-treated sites healed more slowly than in placebo treated skin with biopsies taken on day 1 (P<0.001 and day 14 (P<0.001. Deep biopsies in the capsaicin and placebo areas healed at similar rates at both time points. Nerve fiber densities were reduced only in capsaicin treated regions (P<0.01. In conclusion, topical application of capsaicin causes a small fiber neuropathy and is associated with a delay in healing of shallow, but not deep wounds. This novel human model may prove valuable in the study of wound healing in patients with neuropathy.

  9. Tissue transglutaminase in normal and abnormal wound healing: review article

    OpenAIRE

    Verderio, EAM; Johnson, T; Griffin, M

    2004-01-01

    A complex series of events involving inflammation, cell migration and proliferation, ECM stabilisation and remodelling, neovascularisation and apoptosis are crucial to the tissue response to injury. Wound healing involves the dynamic interactions of multiple cells types with components of the extracellular matrix (ECM) and growth factors. Impaired wound healing as a consequence of aging, injury or disease may lead to serious disabilities and poor quality of life. Abnormal wound healing may al...

  10. The extracellular adherence protein (Eap) of Staphylococcus aureus inhibits wound healing by interfering with host defense and repair mechanisms.

    Science.gov (United States)

    Athanasopoulos, Athanasios N; Economopoulou, Matina; Orlova, Valeria V; Sobke, Astrid; Schneider, Darius; Weber, Holger; Augustin, Hellmut G; Eming, Sabine A; Schubert, Uwe; Linn, Thomas; Nawroth, Peter P; Hussain, Muzaffar; Hammes, Hans-Peter; Herrmann, Mathias; Preissner, Klaus T; Chavakis, Triantafyllos

    2006-04-01

    Staphylococcus aureus is a major human pathogen interfering with host-cell functions. Impaired wound healing is often observed in S aureus-infected wounds, yet, the underlying mechanisms are poorly defined. Here, we identify the extracellular adherence protein (Eap) of S aureus to be responsible for impaired wound healing. In a mouse wound-healing model wound closure was inhibited in the presence of wild-type S aureus and this effect was reversible when the wounds were incubated with an isogenic Eap-deficient strain. Isolated Eap also delayed wound closure. In the presence of Eap, recruitment of inflammatory cells to the wound site as well as neovascularization of the wound were prevented. In vitro, Eap significantly reduced intercellular adhesion molecule 1 (ICAM-1)-dependent leukocyte-endothelial interactions and diminished the consequent activation of the proinflammatory transcription factor nuclear factor kappaB (NFkappaB) in leukocytes associated with a decrease in expression of tissue factor. Moreover, Eap blocked alphav-integrin-mediated endothelial-cell migration and capillary tube formation, and neovascularization in matrigels in vivo. Collectively, the potent anti-inflammatory and antiangiogenic properties of Eap provide an underlying mechanism that may explain the impaired wound healing in S aureus-infected wounds. Eap may also serve as a lead compound for new anti-inflammatory and antiangiogenic therapies in several pathologies.

  11. Ascorbic acid deficiency impairs wound healing in surgical patients: Four case reports

    Directory of Open Access Journals (Sweden)

    A. Bikker

    2016-01-01

    Conclusion: AA deficiency is not uncommon in the hospital population, especially in those at risk. Treating deficient patients with AA leads to swift improvement of the wound healing process post-surgery, thereby reducing the costs of extensive wound treatment and extended stay in hospital.

  12. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  13. Fibroblast implantation enhances wound healing as indicated by breaking strength determinations

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, W W; Goepfert, H; Romsdahl, M; Hersen, J; Withers, R H; Jesse, R H

    1978-09-01

    Irradiation of normal tissues at the dose/time factor employed in the treatment of solid tumors impairs the subsequent healing of surgical wounds made in those tissues. Irreversible radiation damage to regional fibroblasts is one cause of impared healing. This study was conducted to determine whether syngeneic guinea pig fibroblasts is one cause of impared healing. This study was conducted to determine whether syngeneic guinea pig fibroblasts, harvested from tissue culture when injected into irradiated guinea pig skin at the time of wound closure, could improve wound healing. Breaking strength determinations indicate that irradiated wounds demonstrate enhanced wound healing if implanted with fibroblasts.

  14. Chitosan-aluminum monostearate composite sponge dressing containing asiaticoside for wound healing and angiogenesis promotion in chronic wound.

    Science.gov (United States)

    Phaechamud, Thawatchai; Yodkhum, Kotchamon; Charoenteeraboon, Juree; Tabata, Yasuhiko

    2015-05-01

    There are many factors that delay healing in chronic wounds including lowering level of growth factors and increasing exudate level comprising high amount of tissue destructive enzymes. Asiaticoside possesses interesting wound healing and angiogenic activities that are employed to stimulate tissue regeneration in wound healing application. This study attempted to develop chitosan-aluminum monostearate (Alst) composite sponge containing asiaticoside for use as an absorbent medical dressing in chronic wound. N-methyl-2-pyrrolidone (NMP) was used to enhance homogeneity of asiaticoside in the polymer composite matrix. The sponge dressings were prepared by lyophilization and dehydrothermal treatment (DHT). Functional group interaction, crystallinity, and morphology of the prepared sponges were investigated using FT-IR, PXRD, and SEM, respectively. Physicochemical properties, porosity, hydrophilic/hydrophobic properties and mechanical property, were evaluated. Wound dressing properties, water vapor transmission rate (WVTR), fluid absorbency, oxygen permeation (OP), and bio-adhesive property, were investigated. In vitro asiaticoside release study was conducted using immersion method. Cytotoxicity was studied in normal human dermal fibroblast (NHDF) and normal human epidermal keratinocyte (NHEK). Angiogenic activity of asiaticoside was evaluated using chick-chorioallantoic membrane (CAM) assay. FT-IR and PXRD results revealed the amidation after DHT to enhance the crystallinity of the prepared sponges. The prepared sponges had high porosity comprising high Alst-loaded amount that exhibited more compact structure. Alst enhanced hydrophobicity therefore it reduced the fluid absorption and WVTR together with bio-adhesion of the prepared sponge dressings. Porosity of all sponges was more than 85% therefore resulting in their high OP. Enhancing hydrophobicity of the material by Alst and more homogeneity caused by NMP eventually retarded the asiaticoside release for 7 days. The

  15. Silver nanoparticle/bacterial cellulose gel membranes for antibacterial wound dressing: investigation in vitro and in vivo

    International Nuclear Information System (INIS)

    Wu, Jian; Zheng, Yudong; Wen, Xiaoxiao; Lin, Qinghua; Chen, Xiaohua; Wu, Zhigu

    2014-01-01

    Bacterial cellulose (BC) has attracted increasing attention as a novel wound dressing material, but its antimicrobial activity, which is one of the critical skin-barrier functions in wound healing, is not sufficient for use in practical applications. To overcome such a deficiency, silver nanoparticles were generated and self-assembled on the surface of BC nanofibers, forming a stable and evenly distributed Ag nanoparticle coated BC nanofiber (AgNP-BC). The performance of AgNP-BC was systematically studied in terms of antibacterial activities, cytocompatibility and effects on wound healing. The results showed that AgNP-BC exhibited significant antibacterial activity against Staphylococcus aureus. Moreover, AgNP-BC allowed attachment, and growth of rat fibroblasts with low cytotoxicity emerged. Based on these advantages, AgNP-BC samples were applied in a second-degree rat wound model. Wound flora showed a significant reduction during the healing. The fresh epidermal and dermis thicknesses with AgNP-BC samples were 111 and 855 µm respectively, higher than 74 and 619 µm for BC groups and 57 and 473 µm for untreated control wounds. The results demonstrated that AgNP-BC could reduce inflammation and promote scald wound healing. (paper)

  16. Lumican as a multivalent effector in wound healing.

    Science.gov (United States)

    Karamanou, Konstantina; Perrot, Gwenn; Maquart, Francois-Xavier; Brézillon, Stéphane

    2018-03-01

    Wound healing, a complex physiological process, is responsible for tissue repair after exposure to destructive stimuli, without resulting in complete functional regeneration. Injuries can be stromal or epithelial, and most cases of wound repair have been studied in the skin and cornea. Lumican, a small leucine-rich proteoglycan, is expressed in the extracellular matrices of several tissues, such as the cornea, cartilage, and skin. This molecule has been shown to regulate collagen fibrillogenesis, keratinocyte phenotypes, and corneal transparency modulation. Lumican is also involved in the extravasation of inflammatory cells and angiogenesis, which are both critical in stromal wound healing. Lumican is the only member of the small leucine-rich proteoglycan family expressed by the epithelia during wound healing. This review summarizes the importance of lumican in wound healing and potential methods of lumican drug delivery to target wound repair are discussed. The involvement of lumican in corneal wound healing is described based on in vitro and in vivo models, with critical emphasis on its underlying mechanisms of action. Similarly, the expression and role of lumican in the healing of other tissues are presented, with emphasis on skin wound healing. Overall, lumican promotes normal wound repair and broadens new therapeutic perspectives for impaired wound healing. Copyright © 2018. Published by Elsevier B.V.

  17. Acute and Impaired Wound Healing: Pathophysiology and Current Methods for Drug Delivery, Part 1: Normal and Chronic Wounds: Biology, Causes, and Approaches to Care

    Science.gov (United States)

    Demidova-Rice, Tatiana N.; Hamblin, Michael R.; Herman, Ira M.

    2012-01-01

    This is the first installment of 2 articles that discuss the biology and pathophysiology of wound healing, review the role that growth factors play in this process, and describe current ways of growth factor delivery into the wound bed. Part 1 discusses the latest advances in clinicians’ understanding of the control points that regulate wound healing. Importantly, biological similarities and differences between acute and chronic wounds are considered, including the signaling pathways that initiate cellular and tissue responses after injury, which may be impeded during chronic wound healing. PMID:22713781

  18. Transforming growth factor beta 1 dependent regulation of Tenascin-C in radiation impaired wound healing

    International Nuclear Information System (INIS)

    Wehrhan, Falk; Roedel, Franz; Grabenbauer, Gerhard G.; Amann, Kerstin; Brueckl, Wolfgang; Schultze-Mosgau, Stefan

    2004-01-01

    Background: Following preoperative radiotherapy prior to ablative surgery of squamous epithelial cell carcinomas of the head and neck region fibrocontractive wound healing disorders occur. Tenascin-C is significantly increased in fibrotic tissue conditions and can be stimulated by the transcription factor NFκB p65. Previous studies showed a reduction of irradiation induced fibrosis during the wound healing process by anti-TGFβ 1 -treatment. The aim of the study was to clarify the question whether Tenascin-C expression is elevated in radiation impaired wounds and whether anti-TGFβ 1 -treatment is capable to influence Tenascin-C and NFκB expression. Material and methods: Wistar rats (male, weight 300-500 g) underwent preoperative irradiation of the head and neck region with 40 Gy, fractionated four times 10 Gy (16 animals), whereas 8 non-irradiated animals served as a control. Four weeks after irradiation a free myocutaneous gracilis flap taken from the groin was transplanted to the neck. Eight animals additionally received 5 μg anti-TGFβ 1 into the graft bed by intradermal injection prior to each fraction of irradiation and on days 1-7 post-operation. On day 14 and 28 following surgery immunohistochemistry (ABC-POX method) was performed assessing the cytoplasmic NFκB and Tenascin-C staining in the transition area between transplant and graft bed. For quantitative considerations the labeling index (ratio: positive cells/total cells) was determined. Results: A significantly altered expression of Tenascin-C in the preirradiated tissue was observed following anti-TGFβ 1 -treatment. NFκB protein was upregulated in irradiated animals and was significantly reduced in the anti-TGFβ 1 treated group on day 28 after transplantation. Conclusions: Tenascin-C expression is prolonged in irradiated animals as compared to non-irradiated tissue. Tenascin-C seems to be regulated by TGFβ 1 as the application of TGFβ 1 -neutralizing antibodies reduces Tenascin-C expression

  19. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Directory of Open Access Journals (Sweden)

    David Judah

    Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  20. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Science.gov (United States)

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  1. Wound-Related Allergic/Irritant Contact Dermatitis.

    Science.gov (United States)

    Alavi, Afsaneh; Sibbald, R Gary; Ladizinski, Barry; Saraiya, Ami; Lee, Kachiu C; Skotnicki-Grant, Sandy; Maibach, Howard

    2016-06-01

    To provide information from a literature review about the prevention, recognition, and treatment for contact dermatitis. This continuing education activity is intended for physicians and nurses with an interest in skin and wound care. After participating in this educational activity, the participant should be better able to:1. Identify signs and symptoms of and diagnostic measures for contact dermatitis.2. Identify causes and risks for contact dermatitis.3. Select appropriate treatment for contact dermatitis and its prevention. Contact dermatitis to wound care products is a common, often neglected problem. A review was conducted to identify articles relevant to contact dermatitis.A PubMed English-language literature review was conducted for appropriate articles published between January 2000 and December 2015.Contact dermatitis is both irritant (80% of cases) or allergic (20% of cases). Frequent use of potential contact allergens and impaired barrier function of the skin can lead to rising sensitization in patients with chronic wounds. Common known allergens to avoid in wound care patients include fragrances, colophony, lanolin, and topical antibiotics.Clinicians should be cognizant of the allergens in wound care products and the potential for sensitization. All medical devices, including wound dressings, adhesives, and bandages, should be labeled with their complete ingredients, and manufacturers should be encouraged to remove common allergens from wound care products, including topical creams, ointments, and dressings.

  2. Promotion of Wound Healing by an Agonist of Adenosine A2A Receptor Is Dependent on Tissue Plasminogen Activator.

    Science.gov (United States)

    Montesinos, M Carmen; Desai-Merchant, Avani; Cronstein, Bruce N

    2015-12-01

    Impaired wound healing, as it occurs in diabetes mellitus or long-term corticoid treatment, is commonly associated with disability, diminished quality of life, and high economic costs. Selective agonists of the A2A receptor subtype of adenosine, an endogenous regulator of inflammation, promote tissue repair in animal models, both healthy and with impaired healing. Plasmin-mediated proteolysis of fibrin and other matrix proteins is essential for cell migration at sites of injury. Since adenosine A2A receptor activation increases plasminogen activator release from macrophages and mast cells, we studied the effect of a selective agonist, CGS-21680, on full-thickness excisional wound closure in wild-type, urokinase plasminogen activator (uPA)-deficient, and tissue plasminogen activator (tPA)-deficient mice. Wound closure was impaired in tPA- and uPA-deficient mice as compared with wild-type mice, and topical application of CGS-21680 significantly increased the rate at which wounds closed in wild-type mice and uPA-deficient mice, but not in tPA-deficient mice. Immunostaining of tissue sections showed that tPA was present in endothelial cells and histiocytes by day 3 post-wound and also by day 6. In contrast, uPA was more prominent in these cell types only by day 6 post-wound. Our results confirm that plasminogen activation contributes to wound repair and are consistent with the hypothesis that adenosine A2A receptor activation promotes wound closure by a mechanism that depends upon tPA, but not uPA. Moreover, our results suggest that topical adenosine A2A receptor agonists may be useful in promotion of wound closure in patients with impaired wound healing.

  3. Study of the effect of PAPA NONOate on the rate of diabetic wound ...

    African Journals Online (AJOL)

    Yomi

    2012-04-03

    Apr 3, 2012 ... release nitric oxide on the rate of wound healing and collagen synthesis on ... represent a potential treatment for impaired wound healing in diabetes by increasing the rate of ..... structural proteins in the extra cellular matrix of.

  4. Acmella oleracea and Achyrocline satureioides as Sources of Natural Products in Topical Wound Care

    Directory of Open Access Journals (Sweden)

    Lais Thiemi Yamane

    2016-01-01

    Full Text Available The Brazilian forests have one of the world’s biggest biodiversities. Achyrocline satureioides (macela and Acmella oleracea (jambu are native species from Brazil with a huge therapeutic potential, with proved anti-inflammatory and anesthetic action, respectively. The jambu’s crude extract after depigmentation with activated charcoal and macela’s essential oil were incorporated in a film made with hydroxyethyl cellulose. Those films were evaluated by mechanical test using a texturometer and anti-inflammatory and anesthetic activities by in vivo tests: wound healing and antinociceptive. The film containing the highest concentration of depigmented jambu’s extract and macela’s essential oil obtained an anesthesia time of 83.6 (±28.5 min longer when compared with the positive control EMLA®; the same occurred with the wound healing test; the film containing the highest concentration had a higher wound contraction (62.0%±12.1 compared to the positive control allantoin and the histopathological analysis demonstrated that it increases collagen synthesis and epidermal thickening. The results demonstrate that the films have a potential use in skin wounds, pressure sore, and infected surgical wounds treatment.

  5. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  6. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  7. Lower limb revascularisation preceding surgical wound coverage - an interdisciplinary algorithm for chronic wound closure.

    Science.gov (United States)

    Aust, M C; Spies, M; Guggenheim, M; Gohritz, A; Kall, S; Rosenthal, H; Pichlmaier, M; Oehlert, G; Vogt, P M

    2008-08-01

    intervention. Vacuum-assisted closure (VAC) therapy was applied in 15 cases. Postoperatively, three cases of impaired wound healing and one infection occurred. Arterial insufficiency can be diagnosed safely by simple clinical examination. All clinically pathological results were successfully confirmed by angiography, allowing for a targeted peripheral vessel reopening to improve wound perfusion before surgery. This straightforward algorithm helped to improve the success of surgical therapy of chronic lower extremity wounds.

  8. The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology

    DEFF Research Database (Denmark)

    Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J

    2017-01-01

    The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....

  9. Improving mortality outcomes of Stevens Johnson syndrome/toxic epidermal necrolysis: A regional burns centre experience.

    Science.gov (United States)

    Nizamoglu, M; Ward, J A; Frew, Q; Gerrish, H; Martin, N; Shaw, A; Barnes, D; Shelly, O; Philp, B; El-Muttardi, N; Dziewulski, P

    2018-05-01

    Stevens Johnson Syndrome/toxic epidermal necrolysis (SJS/TEN) are rare, potentially fatal desquamative disorders characterised by large areas of partial thickness skin and mucosal loss. The degree of epidermal detachment that occurs has led to SJS/TEN being described as a burn-like condition. These patients benefit from judicious critical care, early debridement and meticulous wound care. This is best undertaken within a multidisciplinary setting led by clinicians experienced in the management of massive skin loss and its sequelae. In this study, we examined the clinical outcomes of SJS/TEN overlap & TEN patients managed by our regional burns service over a 12-year period. We present our treatment model for other burn centres treating SJS/TEN patients. A retrospective case review was performed for all patients with a clinical diagnosis of TEN or SJS/TEN overlap admitted to our paediatric and adult burns centre between June 2004 and December 2016. Patient demographics, percentage total body surface area (%TBSA), mucosal involvement, causation, severity of illness score (SCORTEN), length of stay and survival were appraised with appropriate statistical analysis performed using Graph Pad Prism 7.02 Software. During the study period, 42 patients (M26; F: 16) with TEN (n=32) and SJS/TEN overlap (n=10) were managed within our burns service. Mean %TBSA of cutaneous involvement was 57% (range 10-100%) and mean length of stay (LOS) was 27 days (range 1-144 days). We observed 4 deaths in our series compared to 16 predicted by SCORTEN giving a standardised mortality ratio (SMR) of 24%. Management in our burns service with an aggressive wound care protocol involving debridement of blistered epidermis and wound closure with synthetic and biological dressings seems to have produced benefits in mortality when compared to predicted outcomes. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  10. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  11. Reactive carbonyl compounds impair wound healing by vimentin collapse and loss of the primary cilium.

    Science.gov (United States)

    Rodríguez-Ribera, Lara; Slattery, Craig; Mc Morrow, Tara; Marcos, Ricard; Pastor, Susana

    2017-10-01

    In renal pathologies tubulo-interstitial fibrosis results from an aberrant wound-healing ability where the normal epithelial tissue is substituted for scar tissue caused by accumulation of extracellular matrix proteins (ECM). During the wound-healing process, epithelial cells may undergo epithelial-mesenchymal transition (EMT) acquiring a mesenchymal-like phenotype that allows cells to migrate and re-epithelialize the wound site. It has been reported that chronic inflammation and uremic milieu are involved in wound-healing and enhanced kidney damage in chronic kidney disease (CKD) patients. In this study we evaluated reactive carbonyl compounds (RCC) effects on renal wound healing. The compounds resulting from carbonyl stress evaluated in this study were glyoxal (GO), methylglyoxal (MGO), malondialdehyde (MDA) and 4-hydroxy-hexenal (HHE). Wound repair ability was evaluated by the wound healing assay using HK-2 cells. EMT was evaluated by morphological, protein and transcriptional changes using microscopy, western blot, zymography and RT-qPCR. Changes in the vimentin network and primary cilia were assessed by immunofluorescence. Our data demonstrated that MDA and GO delay wound closure mediated by vimentin disruption, which caused collagen I mRNA decrease, and deciliation. In contrast, HHE treatment (and MGO to a minor degree) induced morphological changes and increased mesenchymal marker expression and gelatinase activity in HK-2 cells. In this study, we have demonstrated for the first time that exposure to RCC differentially affects wound healing in proximal tubular epithelia. A better comprehension of effects of uremic toxins on wound healing and fibrosis and migration is necessary to seek mechanisms to slow down renal fibrosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. PKCδ inhibition normalizes the wound-healing capacity of diabetic human fibroblasts.

    Science.gov (United States)

    Khamaisi, Mogher; Katagiri, Sayaka; Keenan, Hillary; Park, Kyoungmin; Maeda, Yasutaka; Li, Qian; Qi, Weier; Thomou, Thomas; Eschuk, Danielle; Tellechea, Ana; Veves, Aris; Huang, Chenyu; Orgill, Dennis Paul; Wagers, Amy; King, George L

    2016-03-01

    Abnormal fibroblast function underlies poor wound healing in patients with diabetes; however, the mechanisms that impair wound healing are poorly defined. Here, we evaluated fibroblasts from individuals who had type 1 diabetes (T1D) for 50 years or more (Medalists, n = 26) and from age-matched controls (n = 7). Compared with those from controls, Medalist fibroblasts demonstrated a reduced migration response to insulin, lower VEGF expression, and less phosphorylated AKT (p-AKT), but not p-ERK, activation. Medalist fibroblasts were also functionally less effective at wound closure in nude mice. Activation of the δ isoform of protein kinase C (PKCδ) was increased in postmortem fibroblasts from Medalists, fibroblasts from living T1D subjects, biopsies of active wounds of living T1D subjects, and granulation tissues from mice with streptozotocin-induced diabetes. Diabetes-induced PKCD mRNA expression was related to a 2-fold increase in the mRNA half-life. Pharmacologic inhibition and siRNA-mediated knockdown of PKCδ or expression of a dominant-negative isoform restored insulin signaling of p-AKT and VEGF expression in vitro and improved wound healing in vivo. Additionally, increasing PKCδ expression in control fibroblasts produced the same abnormalities as those seen in Medalist fibroblasts. Our results indicate that persistent PKCδ elevation in fibroblasts from diabetic patients inhibits insulin signaling and function to impair wound healing and suggest PKCδ inhibition as a potential therapy to improve wound healing in diabetic patients.

  13. Novel nanofibrous dressings containing rhEGF and Aloe vera for wound healing applications.

    Science.gov (United States)

    Garcia-Orue, Itxaso; Gainza, Garazi; Gutierrez, Franciso Borja; Aguirre, Jose Javier; Evora, Carmen; Pedraz, Jose Luis; Hernandez, Rosa Maria; Delgado, Araceli; Igartua, Manoli

    2017-05-25

    Nanofibrous membranes produced by electrospinning possess a large surface area-to-volume ratio, which mimics the three-dimensional structure of the extracellular matrix. Thus, nanofibrous dressings are a promising alternative for chronic wound healing, since they can replace the natural ECM until it is repaired. Therefore, in this study we have developed a PLGA nanofibrous membrane that contains recombinant human Epidermal Growth Factor (rhEGF) and Aloe vera (AV) extract. Both of them promote wound healing, as EGF is a wound healing mediator and AV stimulates the proliferation and activity of fibroblast. The obtained membranes were composed of uniform and randomly oriented fibers with an average diameter of 356.03±112.05nm, they presented a porosity of 87.92±11.96% and the amount of rhEGF was 9.76±1.75μg/mg. The in vitro viability assay demonstrated that the membranes containing rhEGF and AV improved fibroblast proliferation, revealing the beneficial effect of the combination. Furthermore, these membranes accelerated significantly wound closure and reepithelisation in an in vivo full thickness wound healing assay carried out in db/db mice. Overall, these findings demonstrated the potential of PLGA nanofibers containing rhEGF and AV for the treatment of chronic wounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Differential Downregulation of E-Cadherin and Desmoglein by Epidermal Growth Factor

    Directory of Open Access Journals (Sweden)

    Miquella G. Chavez

    2012-01-01

    Full Text Available Modulation of cell : cell junctions is a key event in cutaneous wound repair. In this study we report that activation of the epidermal growth factor (EGF receptor disrupts cel : cell adhesion, but with different kinetics and fates for the desmosomal cadherin desmoglein and for E-cadherin. Downregulation of desmoglein preceded that of E-cadherin in vivo and in an EGF-stimulated in vitro wound reepithelialization model. Dual immunofluorescence staining revealed that neither E-cadherin nor desmoglein-2 internalized with the EGF receptor, or with one another. In response to EGF, desmoglein-2 entered a recycling compartment based on predominant colocalization with the recycling marker Rab11. In contrast, E-cadherin downregulation was accompanied by cleavage of the extracellular domain. A broad-spectrum matrix metalloproteinase inhibitor protected E-cadherin but not the desmosomal cadherin, desmoglein-2, from EGF-stimulated disruption. These findings demonstrate that although activation of the EGF receptor regulates adherens junction and desmosomal components, this stimulus downregulates associated cadherins through different mechanisms.

  15. Heberprot-P: a novel product for treating advanced diabetic foot ulcer.

    Science.gov (United States)

    Berlanga, Jorge; Fernández, José I; López, Ernesto; López, Pedro A; del Río, Amaurys; Valenzuela, Carmen; Baldomero, Julio; Muzio, Verena; Raíces, Manuel; Silva, Ricardo; Acevedo, Boris E; Herrera, Luis

    2013-01-01

    Diabetic foot ulcer is a principal diabetic complication. It has been shown that diabetic patients have decreased growth factor concentrations in their tissues, particularly epidermal growth factor. Growth factor shortage impairs wound healing, which leads to chronic nonhealing wounds and sometimes eventual amputation. Ischemic diabetic foot ulcer is the most difficult to treat and confers the highest amputation risk. Injecting epidermal growth factor deep into the wound bottom and contours encourages a more effective pharmacodynamic response in terms of granulation tissue growth and wound closure. Epidermal growth factor injected into the ulcer matrix may also result in association with extracellular matrix proteins, thus enhancing cell proliferation and migration. Heberprot-P is an innovative Cuban product containing recombinant human epidermal growth factor for peri- and intra-lesional infiltration; evidence reveals it accelerates healing of deep and complex ulcers, both ischemic and neuropathic, and reduces diabetes-related amputations. Clinical trials of Heberprot-P in patients with diabetic foot ulcers have shown that repeated local infiltration of this product can enhance healing of chronic wounds safely and efficaciously. As a result, Heberprot-P was registered in Cuba in 2006, and in 2007 was included in the National Basic Medications List and approved for marketing. It has been registered in 15 other countries, enabling treatment of more than 100,000 patients. Heberprot-P is a unique therapy for the most complicated and recalcitrant chronic wounds usually associated with high amputation risk. Local injection in complex diabetic wounds has demonstrated a favorable risk-benefit ratio by speeding healing, reducing recurrences and attenuating amputation risk. Further testing and deployment worldwide of Heberprot-P would provide an opportunity to assess the product's potential to address an important unmet medical need.

  16. Neurotensin-loaded PLGA/CNC composite nanofiber membranes accelerate diabetic wound healing.

    Science.gov (United States)

    Zheng, Zhifang; Liu, Yishu; Huang, Wenhua; Mo, Yunfei; Lan, Yong; Guo, Rui; Cheng, Biao

    2018-04-13

    Diabetic foot ulcers (DFUs) are a threat to human health and can lead to amputation and even death. Recently neurotensin (NT), an inflammatory modulator in wound healing, was found to be beneficial for diabetic wound healing. As we demonstrated previously, polylactide-polyglycolide (PLGA) and cellulose nanocrystals (CNCs) (PLGA/CNC) nanofiber membranes show good cytocompatibility and facilitate fibroblast adhesion, spreading and proliferation. PLGA/CNC nanofiber membranes are novel materials that have not been used previously as NT carriers in diabetic wounds. This study aims to explore the therapeutic efficacy and possible mechanisms of NT-loaded PLGA/CNC nanofiber membranes in full-thickness skin wounds in spontaneously diabetic mice. The results showed that NT could be sustained released from NT-loaded PLGA/CNC composite nanofiber membranes for 2 weeks. NT-loaded PLGA/CNC composite nanofiber membranes induced more rapid healing than other control groups. After NT exposure, the histological scores of the epidermal and dermal regeneration and the ratios of the fibrotic area to the whole area were increased. NT-loaded PLGA/CNC composite nanofiber membranes also decreased the expressions of the inflammatory cytokines IL-1β and IL-6. These results suggest that NT-loaded PLGA/CNC composite nanofiber membranes for sustained delivery of NT should effectively promote tissue regeneration for the treatment of DFUs.

  17. The DAF-16/FOXO transcription factor functions as a regulator of epidermal innate immunity.

    Science.gov (United States)

    Zou, Cheng-Gang; Tu, Qiu; Niu, Jie; Ji, Xing-Lai; Zhang, Ke-Qin

    2013-01-01

    The Caenorhabditis elegans DAF-16 transcription factor is critical for diverse biological processes, particularly longevity and stress resistance. Disruption of the DAF-2 signaling cascade promotes DAF-16 activation, and confers resistance to killing by pathogenic bacteria, such as Pseudomonas aeruginosa, Staphylococcus aureus, and Enterococcus faecalis. However, daf-16 mutants exhibit similar sensitivity to these bacteria as wild-type animals, suggesting that DAF-16 is not normally activated by these bacterial pathogens. In this report, we demonstrate that DAF-16 can be directly activated by fungal infection and wounding in wild-type animals, which is independent of the DAF-2 pathway. Fungal infection and wounding initiate the Gαq signaling cascade, leading to Ca(2+) release. Ca(2+) mediates the activation of BLI-3, a dual-oxidase, resulting in the production of reactive oxygen species (ROS). ROS then activate DAF-16 through a Ste20-like kinase-1/CST-1. Our results indicate that DAF-16 in the epidermis is required for survival after fungal infection and wounding. Thus, the EGL-30-Ca(2+)-BLI-3-CST-1-DAF-16 signaling represents a previously unknown pathway to regulate epidermal damage response.

  18. DNA Methylation Dynamics Regulate the Formation of a Regenerative Wound Epithelium during Axolotl Limb Regeneration.

    Directory of Open Access Journals (Sweden)

    Cristian Aguilar

    Full Text Available The formation of a blastema during regeneration of an axolotl limb involves important changes in the behavior and function of cells at the site of injury. One of the earliest events is the formation of the wound epithelium and subsequently the apical epidermal cap, which involves in vivo dedifferentiation that is controlled by signaling from the nerve. We have investigated the role of epigenetic modifications to the genome as a possible mechanism for regulating changes in gene expression patterns of keratinocytes of the wound and blastema epithelium that are involved in regeneration. We report a modulation of the expression DNMT3a, a de novo DNA methyltransferase, within the first 72 hours post injury that is dependent on nerve signaling. Treatment of skin wounds on the upper forelimb with decitabine, a DNA methyltransferase inhibitor, induced changes in gene expression and cellular behavior associated with a regenerative response. Furthermore, decitabine-treated wounds were able to participate in regeneration while untreated wounds inhibited a regenerative response. Elucidation of the specific epigenetic modifications that mediate cellular dedifferentiation likely will lead to insights for initiating a regenerative response in organisms that lack this ability.

  19. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  20. The Histopathological Investigation of Red and Blue Light Emitting Diode on Treating Skin Wounds in Japanese Big-Ear White Rabbit.

    Directory of Open Access Journals (Sweden)

    Yanhong Li

    Full Text Available The biological effects of different wavelengths of light emitting diode (LED light tend to vary from each other. Research into use of photobiomodulation for treatment of skin wounds and the underlying mechanisms has been largely lacking. We explored the histopathological basis of the therapeutic effect of photobiomodulation and the relation between duration of exposure and photobiomodulation effect of different wavelengths of LED in a Japanese big-ear white rabbit skin-wound model. Skin wound model was established in 16 rabbits (three wounds per rabbit: one served as control, the other two wounds were irradiated by red and blue LED lights, respectively. Rabbits were then divided into 2 equal groups based on the duration of exposure to LED lights (15 and 30 min/exposure. The number of wounds that showed healing and the percentage of healed wound area were recorded. Histopathological examination and skin expression levels of fibroblast growth factor (FGF, epidermal growth factor (EGF, endothelial marker (CD31, proliferating cell nuclear antigen (Ki67 and macrophagocyte (CD68 infiltration, and the proliferation of skin collagen fibers was assessed. On days 16 and 17 of irradiation, the healing rates in red (15 min and 30 min and blue (15 min and 30 min groups were 50%, 37.5%, 25% and 37.5%, respectively, while the healing rate in the control group was 12.5%. The percentage healed area in the red light groups was significantly higher than those in other groups. Collagen fiber and skin thickness were significantly increased in both red light groups; expression of EGF, FGF, CD31 and Ki67 in the red light groups was significantly higher than those in other groups; the expression of FGF in red (30 min group was not significantly different from that in the blue light and control groups. The effect of blue light on wound healing was poorer than that of red light. Red light appeared to hasten wound healing by promoting fibrous tissue, epidermal and

  1. Mesenchymal stem cells ameliorate impaired wound healing through enhancing keratinocyte functions in diabetic foot ulcerations on the plantar skin of rats.

    Science.gov (United States)

    Kato, Jiro; Kamiya, Hideki; Himeno, Tatsuhito; Shibata, Taiga; Kondo, Masaki; Okawa, Tetsuji; Fujiya, Atsushi; Fukami, Ayako; Uenishi, Eita; Seino, Yusuke; Tsunekawa, Shin; Hamada, Yoji; Naruse, Keiko; Oiso, Yutaka; Nakamura, Jiro

    2014-01-01

    Although the initial healing stage involves a re-epithelialization in humans, diabetic foot ulceration (DFU) has been investigated using rodent models with wounds on the thigh skin, in which a wound contraction is initiated. In this study, we established a rodent model of DFU on the plantar skin and evaluated the therapeutic efficacy of bone-marrow-derived mesenchymal stem cells (BM-MSCs) in this model. The wounds made on the hind paws or thighs of streptozotocin induced diabetic or control rats were treated with BM-MSCs. Expression levels of phosphorylated focal adhesion kinase (pFAK), matrix metaroprotease (MMP)-2, EGF, and IGF-1, were evaluated in human keratinocytes, which were cultured in conditioned media of BM-MSCs (MSC-CM) with high glucose levels. Re-epithelialization initiated the healing process on the plantar, but not on the thigh, skin. The therapy utilizing BM-MSCs ameliorated the delayed healing in diabetic rats. In the keratinocytes cultured with MSC-CM, the decreased pFAK levels in the high glucose condition were restored, and the MMP2, EGF, and IGF-1 levels increased. Our study established a novel rat DFU model. The impaired healing process in diabetic rats was ameliorated by transplantation of BM-MSCs. This amelioration might be accounted for by the modification of keratinocyte functions. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

    Directory of Open Access Journals (Sweden)

    Aleksandra Piwko-Czuchra

    Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

  3. Effects of whole body γ irradiation on skin wound cells and the repaired-promoting action of W11-a12

    International Nuclear Information System (INIS)

    Shu Chongxiang; Cheng Tianmin; Yan Guohe; Ran Xinze

    2002-01-01

    Objective: To study the effects of 6 Gy whole body γ irradiation on components of wound cells and the repair-promoting action of W 11 -a 12 , an extract from Periplaneta americana. Methods: After mice were received 6 Gy gamma ray irradiation, the area of healing range in wound cross section, the cellular infiltration of wound and the content of basic fibroblast growth factor (bFGF) in wound epithelial cells were observed and the healing-promoting effect of W 11 -a 12 on the radiation-impaired wound was investigated. Results: The area of healing range in cross section was decreased, various infiltrated cells were all inhibited by radiation, but the range of inhibition was more or less different, and the descending order of severity was as follows: macrophages, vascular endothelial cells, fibroblasts and epithelial cells. The content of bFGF in epithelial cells was decreased. W 11 -a 12 had beneficial heal-promoting effect on radiation-impaired wound: it increased cellular infiltration and promoted synthesis and secretion of bFGF in epithelial cells. Conclusion: The depletion of wound cells is mainly responsible for the healing deficits of radiation-impaired skin wound and W 11 -a 12 enhances cell migration and proliferation and promotes synthesis and secretion of bFGF in epithelial cells

  4. Chitosan–aluminum monostearate composite sponge dressing containing asiaticoside for wound healing and angiogenesis promotion in chronic wound

    International Nuclear Information System (INIS)

    Phaechamud, Thawatchai; Yodkhum, Kotchamon; Charoenteeraboon, Juree; Tabata, Yasuhiko

    2015-01-01

    There are many factors that delay healing in chronic wounds including lowering level of growth factors and increasing exudate level comprising high amount of tissue destructive enzymes. Asiaticoside possesses interesting wound healing and angiogenic activities that are employed to stimulate tissue regeneration in wound healing application. This study attempted to develop chitosan–aluminum monostearate (Alst) composite sponge containing asiaticoside for use as an absorbent medical dressing in chronic wound. N-methyl-2-pyrrolidone (NMP) was used to enhance homogeneity of asiaticoside in the polymer composite matrix. The sponge dressings were prepared by lyophilization and dehydrothermal treatment (DHT). Functional group interaction, crystallinity, and morphology of the prepared sponges were investigated using FT-IR, PXRD, and SEM, respectively. Physicochemical properties, porosity, hydrophilic/hydrophobic properties and mechanical property, were evaluated. Wound dressing properties, water vapor transmission rate (WVTR), fluid absorbency, oxygen permeation (OP), and bio-adhesive property, were investigated. In vitro asiaticoside release study was conducted using immersion method. Cytotoxicity was studied in normal human dermal fibroblast (NHDF) and normal human epidermal keratinocyte (NHEK). Angiogenic activity of asiaticoside was evaluated using chick-chorioallantoic membrane (CAM) assay. FT-IR and PXRD results revealed the amidation after DHT to enhance the crystallinity of the prepared sponges. The prepared sponges had high porosity comprising high Alst-loaded amount that exhibited more compact structure. Alst enhanced hydrophobicity therefore it reduced the fluid absorption and WVTR together with bio-adhesion of the prepared sponge dressings. Porosity of all sponges was more than 85% therefore resulting in their high OP. Enhancing hydrophobicity of the material by Alst and more homogeneity caused by NMP eventually retarded the asiaticoside release for 7 days

  5. Chitosan–aluminum monostearate composite sponge dressing containing asiaticoside for wound healing and angiogenesis promotion in chronic wound

    Energy Technology Data Exchange (ETDEWEB)

    Phaechamud, Thawatchai, E-mail: thawatchaienator@gmail.com [Department of Pharmaceutical Technology, Faculty of Pharmacy, Silpakorn University, Nakorn Pathom 73000 (Thailand); Yodkhum, Kotchamon, E-mail: marskotchamon@gmail.com [Department of Pharmaceutical Technology, Faculty of Pharmacy, Silpakorn University, Nakorn Pathom 73000 (Thailand); Charoenteeraboon, Juree, E-mail: juree@su.ac.th [Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University, Nakorn Pathom 73000 (Thailand); Tabata, Yasuhiko, E-mail: yasuhiko@frontier.kyoto-u.ac.jp [Department of Biomaterials, Field of tissue engineering, Institute for Frontier Medical Science, Kyoto University, Kyoto 606-8507 (Japan)

    2015-05-01

    There are many factors that delay healing in chronic wounds including lowering level of growth factors and increasing exudate level comprising high amount of tissue destructive enzymes. Asiaticoside possesses interesting wound healing and angiogenic activities that are employed to stimulate tissue regeneration in wound healing application. This study attempted to develop chitosan–aluminum monostearate (Alst) composite sponge containing asiaticoside for use as an absorbent medical dressing in chronic wound. N-methyl-2-pyrrolidone (NMP) was used to enhance homogeneity of asiaticoside in the polymer composite matrix. The sponge dressings were prepared by lyophilization and dehydrothermal treatment (DHT). Functional group interaction, crystallinity, and morphology of the prepared sponges were investigated using FT-IR, PXRD, and SEM, respectively. Physicochemical properties, porosity, hydrophilic/hydrophobic properties and mechanical property, were evaluated. Wound dressing properties, water vapor transmission rate (WVTR), fluid absorbency, oxygen permeation (OP), and bio-adhesive property, were investigated. In vitro asiaticoside release study was conducted using immersion method. Cytotoxicity was studied in normal human dermal fibroblast (NHDF) and normal human epidermal keratinocyte (NHEK). Angiogenic activity of asiaticoside was evaluated using chick-chorioallantoic membrane (CAM) assay. FT-IR and PXRD results revealed the amidation after DHT to enhance the crystallinity of the prepared sponges. The prepared sponges had high porosity comprising high Alst-loaded amount that exhibited more compact structure. Alst enhanced hydrophobicity therefore it reduced the fluid absorption and WVTR together with bio-adhesion of the prepared sponge dressings. Porosity of all sponges was more than 85% therefore resulting in their high OP. Enhancing hydrophobicity of the material by Alst and more homogeneity caused by NMP eventually retarded the asiaticoside release for 7 days

  6. Epidermal transglutaminase (TGase 3 is required for proper hair development, but not the formation of the epidermal barrier.

    Directory of Open Access Journals (Sweden)

    Susan John

    Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.

  7. Multifunctional activities of KSLW synthetic antimicrobial decapeptide: Implications for wound healing

    Science.gov (United States)

    Williams, Richard Leroy

    Wound healing is a complex process leading to the maintenance of skin integrity. Stress is known to increase susceptibility to bacterial infection, alter proinflammatory cytokine expression, and delay wound closure. Recently, antimicrobial peptides have generated interest due to their prokaryotic selectivity, decreased microbial resistance and multifunctional roles in wound healing, including fibroblast stimulation, keratinocyte migration and leukocyte migration. The objective of this dissertation project was to evaluate the effect of a synthetic antimicrobial decapeptide (KSLW) on bacterial clearance inflammation, and wound closure during stress-impaired healing. SKH-1 mice were randomly assigned to either control or restraint-stressed (RST) groups. Punch biopsy wounds (3.5 mm in diameter) were created bilaterally on the dorsal skin. Wounds were injected with 50 microL of empty carriers or KSLW prepared in Pluronic-F68, phospholipid micelles, or saline. Bacterial assays of harvested wounds were conducted on BHI agar. Wound closure was determined by photoplanimetry. Cytokine and growth factor mRNA expression was assessed with real-time RT-PCR. Human neutrophil migration assays and checkerboard analyses were performed using Transweli plates, and counting on hemacytometer. Oxidative burst activity was measured by spectrophotometric analysis of 2,7-dichlorofluorescein oxidation. KSLW-treatment resulted in significant reductions in bacterial load among RST mice, with no difference from control after 24h. The effect was sustained 5 days post-wounding, in RST mice treated with KSLW-F68. Temporal analysis of gene induction revealed reversals of stress-induced altered expression of growth factors, proinflammatory cytokines, and chemokines essential for favorable wound healing, at various time points. KSLW-treatment in RST mice demonstrated faster wound closure throughout the stress period. KSLW, at micromolar concentrations, demonstrated a significant effect on neutrophil

  8. Collagen sheet dressings for cutaneous lesions of toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    S Bhattacharya

    2011-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is associated with a significant mortality of 30-50% and long-term sequelae. Treatment includes early admission to a burn unit, where management with precise fluid, electrolyte, protein, and energy supplementation, moderate mechanical ventilation, and expert wound care can be provided. Specific treatment with immunosuppressive drugs or immunoglobulins did not show an improved outcome in most studies and remains controversial. We have treated the cutaneous lesions of seven patients of TEN with collagen sheet dressings and have found a significant reduction in morbidity. The sheets are a one-time dressing, easy to apply and they reduce fluid loss, prevent infection, reduce pain, avoid repeated dressings and gradually peal off as the underlying lesions heal.

  9. Propionyl-L-Carnitine Enhances Wound Healing and Counteracts Microvascular Endothelial Cell Dysfunction.

    Directory of Open Access Journals (Sweden)

    Maria Giovanna Scioli

    Full Text Available Impaired wound healing represents a high cost for health care systems. Endothelial dysfunction characterizes dermal microangiopathy and contributes to delayed wound healing and chronic ulcers. Endothelial dysfunction impairs cutaneous microvascular blood flow by inducing an imbalance between vasorelaxation and vasoconstriction as a consequence of reduced nitric oxide (NO production and the increase of oxidative stress and inflammation. Propionyl-L-carnitine (PLC is a natural derivative of carnitine that has been reported to ameliorate post-ischemic blood flow recovery.We investigated the effects of PLC in rat skin flap and cutaneous wound healing. A daily oral PLC treatment improved skin flap viability and associated with reactive oxygen species (ROS reduction, inducible nitric oxide synthase (iNOS and NO up-regulation, accelerated wound healing and increased capillary density, likely favoring dermal angiogenesis by up-regulation for iNOS, vascular endothelial growth factor (VEGF, placental growth factor (PlGF and reduction of NADPH-oxidase 4 (Nox4 expression. In serum-deprived human dermal microvascular endothelial cell cultures, PLC ameliorated endothelial dysfunction by increasing iNOS, PlGF, VEGF receptors 1 and 2 expression and NO level. In addition, PLC counteracted serum deprivation-induced impairment of mitochondrial β-oxidation, Nox4 and cellular adhesion molecule (CAM expression, ROS generation and leukocyte adhesion. Moreover, dermal microvascular endothelial cell dysfunction was prevented by Nox4 inhibition. Interestingly, inhibition of β-oxidation counteracted the beneficial effects of PLC on oxidative stress and endothelial dysfunction.PLC treatment improved rat skin flap viability, accelerated wound healing and dermal angiogenesis. The beneficial effects of PLC likely derived from improvement of mitochondrial β-oxidation and reduction of Nox4-mediated oxidative stress and endothelial dysfunction. Antioxidant therapy and

  10. Effect of smoking, abstention, and nicotine patch on epidermal healing and collagenase in skin transudate

    DEFF Research Database (Denmark)

    Sorensen, L.T.; Zillmer, R.; Agren, M.

    2009-01-01

    Delayed wound healing may explain postoperative tissue and wound dehiscence in smokers, but the effects of smoking and smoking cessation on the cellular mechanisms remain unclear. Suction blisters were raised in 48 smokers and 30 never smokers. The fluid was retrieved and the epidermal roof...... and in 6 never smokers. Matrix metalloproteinase (MMP)-8 and MMP-1 levels in suction blister fluid were assessed by an enzyme-linked immunosorbent assay. Random-effects models for repeated measurements were applied and p ....47-19.92) g/cm(2) hour (mean, 95% CI) in smokers and 13.89 (9.46-18.33) in never smokers (p smokers TEWL was 18.95 (15.20-22.70)(p smokers). In smokers, MMP-8 was 36.4 (24.3-48.5) ng/mL (mean, 95% CI) and 15.2 (1.4-30.2) ng/mL in never smokers (p

  11. Effect of Hevea brasiliensis latex sap gel on healing of acute skin wounds induced on the back of rats

    Directory of Open Access Journals (Sweden)

    Maria Vitória Carmo Penhavel

    Full Text Available Objective : to evaluate the effect of topical delivery of latex cream-gel in acute cutaneous wounds induced on the back of rats. Methods : we subjected sixteen rats to dermo-epidermal excision of a round dorsal skin flap, with 2.5cm diameter. We divided the animals into two groups: Latex Group: application of cream-gel-based latex throughout the wound bed on postoperative days zero, three, six and nine; Control group: no treatment on the wound. Photographs of the lesions were taken on the procedure day and on the 6th and 14th postoperative days, for analyzing the area and the larger diameter of the wound. We carried out euthanasia of all animals on the 14th postoperative day, when we resected he dorsal skin and the underlying muscle layer supporting the wound for histopathological study. Results : there was no statistically significant difference in the percentage of wound closure, in the histopathological findings or in the reduction of the area and of the largest diameter of the wounds among the groups studied on the 14th postoperative day. Conclusion : according to the experimental conditions in which the study was conducted, latex cream-gel did not interfere in the healing of acute cutaneous wounds in rats.

  12. In vitro migration and adhesion of fibroblasts from different phases of palatal wound healing.

    NARCIS (Netherlands)

    Beurden, H.E. van; Snoek, P.A.; Hoff, J.W. Von den; Torensma, R.; Maltha, J.C.; Kuijpers-Jagtman, A.M.

    2006-01-01

    Cleft palate patients often show mid-facial growth impairment after surgical closure of the defect. This is a consequence of palatal wound healing, and more specifically of wound contraction and scar tissue formation. Cells of the fibroblast lineage are responsible for these processes and they

  13. Chemokine Involvement in Fetal and Adult Wound Healing

    Science.gov (United States)

    Balaji, Swathi; Watson, Carey L.; Ranjan, Rajeev; King, Alice; Bollyky, Paul L.; Keswani, Sundeep G.

    2015-01-01

    Significance: Fetal wounds heal with a regenerative phenotype that is indistinguishable from surrounding skin with restored skin integrity. Compared to this benchmark, all postnatal wound healing is impaired and characterized by scar formation. The biologic basis of the fetal regenerative phenotype can serve as a roadmap to recapitulating regenerative repair in adult wounds. Reduced leukocyte infiltration, likely mediated, in part, through changes in the chemokine milieu, is a fundamental feature of fetal wound healing. Recent Advances: The contributions of chemokines to wound healing are a topic of active investigation. Recent discoveries have opened the possibility of targeting chemokines therapeutically to treat disease processes and improve healing capability, including the possibility of achieving a scarless phenotype in postnatal wounds. Critical Issues: Successful wound healing is a complex process, in which there is a significant interplay between multiple cell types, signaling molecules, growth factors, and extracellular matrix. Chemokines play a crucial role in this interplay and have been shown to have different effects in various stages of the healing process. Understanding how these chemokines are locally produced and regulated during wound healing and how the chemokine milieu differs in fetal versus postnatal wounds may help us identify ways in which we can target chemokine pathways. Future Directions: Further studies on the role of chemokines and their role in the healing process will greatly advance the potential for using these molecules as therapeutic targets. PMID:26543680

  14. Targeting connexin 43 in diabetic wound healing: Future perspectives

    Directory of Open Access Journals (Sweden)

    Bajpai S

    2009-01-01

    Full Text Available The unknown mechanisms of impaired tissue repair in diabetes mellitus are making this disease a serious clinical problem for the physicians worldwide. The lacuna in the knowledge of the etiology of diabetic wounds necessitates more focused research in order to develop new targeting tools with higher efficacy for their effective management. Gap-junction proteins, connexins, have shown some promising results in the process of diabetic wound healing. Till now the role of connexins has been implicated in peripheral neuropathy, deafness, skin disorders, cataract, germ cell development and treatment of cancer. Recent findings have revealed that gap junctions play a key role in normal as well as diabetic wound healing. The purpose of this review is to provide the information related to etiology, epidemiology, clinical presentation of diabetic wounds and to analyze the role of connexin 43 (Cx43 in the diabetic wound healing process. The current control strategies and the future research challenges have also been discussed briefly in this review.

  15. Microencapsulated equine mesenchymal stromal cells promote cutaneous wound healing in vitro.

    Science.gov (United States)

    Bussche, Leen; Harman, Rebecca M; Syracuse, Bethany A; Plante, Eric L; Lu, Yen-Chun; Curtis, Theresa M; Ma, Minglin; Van de Walle, Gerlinde R

    2015-04-11

    The prevalence of impaired cutaneous wound healing is high and treatment is difficult and often ineffective, leading to negative social and economic impacts for our society. Innovative treatments to improve cutaneous wound healing by promoting complete tissue regeneration are therefore urgently needed. Mesenchymal stromal cells (MSCs) have been reported to provide paracrine signals that promote wound healing, but (i) how they exert their effects on target cells is unclear and (ii) a suitable delivery system to supply these MSC-derived secreted factors in a controlled and safe way is unavailable. The present study was designed to provide answers to these questions by using the horse as a translational model. Specifically, we aimed to (i) evaluate the in vitro effects of equine MSC-derived conditioned medium (CM), containing all factors secreted by MSCs, on equine dermal fibroblasts, a cell type critical for successful wound healing, and (ii) explore the potential of microencapsulated equine MSCs to deliver CM to wounded cells in vitro. MSCs were isolated from the peripheral blood of healthy horses. Equine dermal fibroblasts from the NBL-6 (horse dermal fibroblast cell) line were wounded in vitro, and cell migration and expression levels of genes involved in wound healing were evaluated after treatment with MSC-CM or NBL-6-CM. These assays were repeated by using the CM collected from MSCs encapsulated in core-shell hydrogel microcapsules. Our salient findings were that equine MSC-derived CM stimulated the migration of equine dermal fibroblasts and increased their expression level of genes that positively contribute to wound healing. In addition, we found that equine MSCs packaged in core-shell hydrogel microcapsules had similar effects on equine dermal fibroblast migration and gene expression, indicating that microencapsulation of MSCs does not interfere with the release of bioactive factors. Our results demonstrate that the use of CM from MSCs might be a promising

  16. Effect of Malva sylvestris cream on burn injury and wounds in rats

    Directory of Open Access Journals (Sweden)

    Ebrahim Nasiri

    2015-06-01

    Full Text Available Objectives: Burn injury is one of the most health-threatening problems in the world. Malva sylvestris (M. sylvestris flowershave a high mucilage content and are used as a remedy for cut wound and dermal infected wounds in Iranian folklore Medicine. The purpose of this study was to investigate the effect of M. sylvestris cream on the second degree burn injury in rats. Materials and Methods: Five groups of 10 rats per group were burned with hot metal plate. Animals were administrated divided as control, normal saline, standard silver sulfadiazine 1% (SSD, 5% M. sylvestris, and 10% M. sylvestris into separate groups. Wound area, percentage of wound contraction, and histological and bacteriological assessments were evaluated. Results: Wound sizes were not significantly different among groups on 1st and 3rd days after burn injury, while they were significantly different among groups after 7th day post-burn injury. The average areas of wounds on the 15th day were 7.5±2.9, 6.7±2, 10.5±1.6, 4.7±2, and 4.5±2 cm2 for base cream, normal saline, SSD, 5% M. sylvestris, and 10% M. sylvestris, respectively. The results of histology exhibited well-formed horizontally-oriented collagen fibers in MS topical treatment groups. Microorganisms existed in the SSD group were most probably Staphilococcus epidermitis and for NS group were staphylococcus saprophiteccus. Conclusion: M. sylvestris cream improved histological changes of tissue components in the process of healing when compared with SSD cream. Therefore, it can be used as a topical treatment agent for burn wound.

  17. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  18. Efficient Healing Takes Some Nerve: Electrical Stimulation Enhances Innervation in Cutaneous Human Wounds.

    Science.gov (United States)

    Emmerson, Elaine

    2017-03-01

    Cutaneous nerves extend throughout the dermis and epidermis and control both the functional and reparative capacity of the skin. Denervation of the skin impairs cutaneous healing, presenting evidence that nerves provide cues essential for timely wound repair. Sebastian et al. demonstrate that electrical stimulation promotes reinnervation and neural differentiation in human acute wounds, thus accelerating wound repair. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  19. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  20. In situ synthesis of silver-nanoparticles/bacterial cellulose composites for slow-released antimicrobial wound dressing.

    Science.gov (United States)

    Wu, Jian; Zheng, Yudong; Song, Wenhui; Luan, Jiabin; Wen, Xiaoxiao; Wu, Zhigu; Chen, Xiaohua; Wang, Qi; Guo, Shaolin

    2014-02-15

    Bacterial cellulose has attracted increasing attention as a novel wound dressing material, but it has no antimicrobial activity, which is one of critical skin-barrier functions in wound healing. To overcome such deficiency, we developed a novel method to synthesize and impregnate silver nanoparticles on to bacterial cellulose nanofibres (AgNP-BC). Uniform spherical silver nano-particles (10-30 nm) were generated and self-assembled on the surface of BC nano-fibers, forming a stable and evenly distributed Ag nanoparticles coated BC nanofiber. Such hybrid nanostructure prevented Ag nanoparticles from dropping off BC network and thus minimized the toxicity of nanoparticles. Regardless the slow Ag(+) release, AgNP-BC still exhibited significant antibacterial activities with more than 99% reductions in Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa. Moreover, AgNP-BC allowed attachment and growth of epidermal cells with no cytotoxicity emerged. The results demonstrated that AgNP-BC could reduce inflammation and promote wound healing. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Excisional wound healing is delayed in a murine model of chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Akhil K Seth

    Full Text Available BACKGROUND: Approximately 15% of the United States population suffers from chronic kidney disease (CKD, often demonstrating an associated impairment in wound healing. This study outlines the development of a surgical murine model of CKD in order to investigate the mechanisms underlying this impairment. METHODS: CKD was induced in mice by partial cauterization of one kidney cortex and contralateral nephrectomy, modifying a previously published technique. After a minimum of 6-weeks, splinted, dorsal excisional wounds were created to permit assessment of wound healing parameters. Wounds were harvested on postoperative days (POD 0, 3, 7, and 14 for histological, immunofluorescent, and quantitative PCR (qPCR. RESULTS: CKD mice exhibited deranged blood chemistry and hematology profiles, including profound uremia and anemia. Significant decreases in re-epithelialization and granulation tissue deposition rates were found in uremic mice wounds relative to controls. On immunofluorescent analysis, uremic mice demonstrated significant reductions in cellular proliferation (BrdU and angiogenesis (CD31, with a concurrent increase in inflammation (CD45 as compared to controls. CKD mice also displayed differential expression of wound healing-related genes (VEGF, IL-1β, eNOS, iNOS on qPCR. CONCLUSIONS: These findings represent the first reported investigation of cutaneous healing in a CKD animal model. Ongoing studies of this significantly delayed wound healing phenotype include the establishment of renal failure model in diabetic strains to study the combined effects of CKD and diabetes.

  2. Quantitative assessment of wound-healing process as a response to laser-induced micro-injuries

    Science.gov (United States)

    Liu, Yang; Bargo, Paulo; Kollias, Nikiforos

    2009-02-01

    Currently, most investigations of wound healing rely on invasive biopsy followed by histology and immunohistochemistry staining. There is a great need to develop non-invasive techniques for in vivo diagnostic, clinical and scientific evaluation. Here, we performed a comprehensive investigation on the dynamic wound healing process as a response to laser-induced microinjuries using non-invasive imaging techniques such as reflectance laser-scanning confocal microscopy and video microscopy. Eight healthy subjects ranging from Fitzpatrick skin type II-VI with age from 27 to 57 years were recruited. The volar forearm of each subject was treated with a laser device that generates an array of microbeams with an infrared wavelength. The microscopic changes of epidermal cells and collagen during the wound healing process were assessed non-invasively using confocal microscopy. We also developed a quantitative method to evaluate the dynamic wound healing process at the microscopic level in three areas of interest: (1) treated micro-wounding zone, (2) surrounding collateral damage zone and (3) normal area. The depth-dependent intensity profile derived from reflectance confocal microscope images clearly distinguishes the three areas of interest and quantitatively measures the cellular structure-associated changes. A progressive change in depth-dependent intensity profiles in subjects with different ages parallels the clinical observation of wound healing rate. The quantitative analysis developed in this study may find broad applications in assessing the skin response to treatment at a microscopic level.

  3. Impregnation of silver sulfadiazine into bacterial cellulose for antimicrobial and biocompatible wound dressing

    International Nuclear Information System (INIS)

    Luan, Jiabin; Wu, Jian; Zheng, Yudong; Wang, Guojie; Guo, Jia; Ding, Xun; Song, Wenhui

    2012-01-01

    Silver sulfadiazine (SSD) is a useful antimicrobial agent for wound treatment. However, recent findings indicate that conventional SSD cream has several drawbacks for use in treatments. Bacterial cellulose (BC) is a promising material for wound dressing due to its outstanding properties of holding water, strength and degradability. Unfortunately, BC itself exhibits no antimicrobial activity. A combination of SSD and BC is envisaged to form a new class of wound dressing with both antimicrobial activity and biocompatibility, which has not been reported to date. To achieve antimicrobial activity, SSD particles were impregnated into BC by immersing BC into SSD suspension after ultrasonication, namely SSD–BC. Parameters influencing SSD–BC impregnation were systematically studied. Optimized conditions of sonication time for no less than 90 min and the proper pH value between 6.6 and 9.0 were suggested. The absorption of SSD onto the BC nanofibrous network was revealed by XRD and SEM analyses. The SSD–BC membranes exhibited significant antimicrobial activities against Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus evaluated by the disc diffusion method. In addition, the favorable biocompatibility of SSD–BC was verified by MTT colorimetry, epidermal cell counting method and optical microscopy. The results demonstrate the potential of SSD–BC membranes as a new class of antimicrobial and biocompatible wound dressing. (paper)

  4. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  5. Platelet-rich plasma with keratinocytes and fibroblasts enhance healing of full-thickness wounds.

    Science.gov (United States)

    Law, Jia Xian; Chowdhury, Shiplu Roy; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

    2017-08-01

    Advances in tissue engineering led to the development of various tissue-engineered skin substitutes (TESS) for the treatment of skin injuries. The majority of the autologous TESS required lengthy and costly cell expansion process to fabricate. In this study, we determine the possibility of using a low density of human skin cells suspended in platelet-rich plasma (PRP)-enriched medium to promote the healing of full-thickness skin wounds. To achieve this, full-thickness wounds of size 1.767 cm 2 were created at the dorsum part of nude mice and treated with keratinocytes (2 × 10 4  cells/cm 2 ) and fibroblasts (3 × 10 4  cells/cm 2 ) suspended in 10% PRP-enriched medium. Wound examination was conducted weekly and the animals were euthanized after 2 weeks. Gross examination showed that re-epithelialization was fastest in the PRP+cells group at both day 7 and 14, followed by the PRP group and NT group receiving no treatment. Only the PRP+cells group achieved complete wound closure by 2 weeks. Epidermal layer was presence in the central region of the wound of the PRP+cells and PRP groups but absence in the NT group. Comparison between the PRP+cells and PRP groups showed that the PRP+cells-treated wound was more mature as indicated by the presence of thinner epidermis with single cell layer thick basal keratinocytes and less cellular dermis. In summary, the combination of low cell density and diluted PRP creates a synergistic effect which expedites the healing of full-thickness wounds. This combination has the potential to be developed as a rapid wound therapy via the direct application of freshly harvested skin cells in diluted PRP. Copyright © 2017 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  6. Expression of Msx-2 during development, regeneration, and wound healing in axolotl limbs.

    Science.gov (United States)

    Carlson, M R; Bryant, S V; Gardiner, D M

    1998-12-15

    Msx genes are transcription factors that are expressed during embryogenesis of developing appendages in regions of epithelial-mesenchymal interactions. Various lines of evidence indicate that these genes function to maintain embryonic tissues in an undifferentiated, proliferative state. We have identified the axolotl homolog of Msx-2, and investigated its expression during limb development, limb regeneration, and wound healing. As in limb buds of higher vertebrates, axolotl Msx-2 is expressed in the apical epidermis and mesenchyme; however, its expression domain is more extensive, reflecting the broader region of the apical epidermal cap in amphibians. Msx-2 expression is downregulated at late stages of limb development, but is reexpressed within one hour after limb amputation. Msx-2 is also reexpressed during wound healing, and may be essential in the early stages of initiation of the limb regeneration cascade.

  7. A crucial role of beta 1 integrins for keratinocyte migration in vitro and during cutaneous wound repair

    DEFF Research Database (Denmark)

    Grose, Richard; Hutter, Caroline; Bloch, Wilhelm

    2002-01-01

    of beta 1 integrins in keratinocytes caused a severe defect in wound healing. beta 1-null keratinocytes showed impaired migration and were more densely packed in the hyperproliferative epithelium. Surprisingly, their proliferation rate was not reduced in early wounds and even increased in late wounds....... The failure in re-epithelialisation resulted in a prolonged inflammatory response, leading to dramatic alterations in the expression of important wound-regulated genes. Ultimately, beta 1-deficient epidermis did cover the wound bed, but the epithelial architecture was abnormal. These findings demonstrate...

  8. Chitosan Dermal Substitute and Chitosan Skin Substitute Contribute to Accelerated Full-Thickness Wound Healing in Irradiated Rats

    Directory of Open Access Journals (Sweden)

    Abu Bakar Mohd Hilmi

    2013-01-01

    Full Text Available Wounds with full-thickness skin loss are commonly managed by skin grafting. In the absence of a graft, reepithelialization is imperfect and leads to increased scar formation. Biomaterials can alter wound healing so that it produces more regenerative tissue and fewer scars. This current study use the new chitosan based biomaterial in full-thickness wound with impaired healing on rat model. Wounds were evaluated after being treated with a chitosan dermal substitute, a chitosan skin substitute, or duoderm CGF. Wounds treated with the chitosan skin substitute showed the most re-epithelialization (33.2 ± 2.8%, longest epithelial tongue (1.62 ± 0.13 mm, and shortest migratory tongue distance (7.11 ± 0.25 mm. The scar size of wounds treated with the chitosan dermal substitute (0.13 ± 0.02 cm and chitosan skin substitute (0.16 ± 0.05 cm were significantly decreased (P<0.05 compared with duoderm (0.45 ± 0.11 cm. Human leukocyte antigen (HLA expression on days 7, 14, and 21 revealed the presence of human hair follicle stem cells and fibroblasts that were incorporated into and surviving in the irradiated wound. We have proven that a chitosan dermal substitute and chitosan skin substitute are suitable for wound healing in full-thickness wounds that are impaired due to radiation.

  9. Survey of Antibiotic-producing Bacteria Associated with the Epidermal Mucus Layers of Rays and Skates

    Directory of Open Access Journals (Sweden)

    Kim B. Ritchie

    2017-07-01

    Full Text Available Elasmobranchs represent a distinct group of cartilaginous fishes that harbor a remarkable ability to heal wounds rapidly and without infection. To date very little work has addressed this phenomenon although it is suggested that antibiotic capabilities associated with epidermal surfaces may be a factor. The study of benefits derived from mutualistic interactions between unicellular and multicellular organisms is a rapidly growing area of research. Here we survey and identify bacterial associates of three ray and one skate species in order to assess the potential for antibiotic production from elasmobranch associated bacteria as a novel source for new antibiotics.

  10. Effect of smoking, smoking cessation, and nicotine patch on wound dimension, vitamin C, and systemic markers of collagen metabolism

    DEFF Research Database (Denmark)

    Sørensen, Lars Tue; Toft, Birgitte G; Rygaard, Jørgen

    2010-01-01

    Postoperative wound disruption and tissue-destructive disorders are more frequent in smokers than in nonsmokers. Impaired wound healing and altered connective tissue turnover are suggested mechanisms, but exact details remain unknown....

  11. Glucose Toxic Effects on Granulation Tissue Productive Cells: The Diabetics’ Impaired Healing

    Directory of Open Access Journals (Sweden)

    Jorge Berlanga-Acosta

    2013-01-01

    Full Text Available Type 2 diabetes mellitus is a metabolic noncommunicable disease with an expanding pandemic magnitude. Diabetes predisposes to lower extremities ulceration and impairs the healing process leading to wound chronification. Diabetes also dismantles innate immunity favoring wound infection. Amputation is therefore acknowledged as one of the disease’s complications. Hyperglycemia is the proximal detonator of systemic and local toxic effectors including proinflammation, acute-phase proteins elevation, and spillover of reactive oxygen and nitrogen species. Insulin axis deficiency weakens wounds’ anabolism and predisposes to inflammation. The systemic accumulation of advanced glycation end-products irreversibly impairs the entire physiology from cells-to-organs. These factors in concert hamper fibroblasts and endothelial cells proliferation, migration, homing, secretion, and organization of a productive granulation tissue. Diabetic wound bed may turn chronically inflammed, procatabolic, and an additional source of circulating pro-inflammatory cytokines, establishing a self-perpetuating loop. Diabetic fibroblasts and endothelial cells may bear mitochondrial damages becoming prone to apoptosis, which impairs granulation tissue cellularity and perfusion. Endothelial progenitor cells recruitment and tubulogenesis are also impaired. Failure of wound reepithelialization remains a clinical challenge while it appears to be biologically multifactorial. Ulcer prevention by primary care surveillance, education, and attention programs is of outmost importance to reduce worldwide amputation figures.

  12. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  13. Abnormalities of lymphocyte function and phenotypic pattern in a case of toxic epidermal necrolysis

    DEFF Research Database (Denmark)

    Hagdrup, H; Tønnesen, E; Clemmensen, O

    1992-01-01

    We examined the blood lymphocyte function and phenotypic pattern in a patient with toxic epidermal necrolysis after taking salazopyrin. We studied cell surface markers, natural killer cell activity and mitogen-induced lymphocyte transformation. Our results point to temporary immunosuppression...... as evidenced by lymphopenia with a large "null cell" population, reduced natural killer cell activity, and impaired lymphocyte response to mitogens....

  14. Dynamic protein expression patterns during intraoral wound healing in the rat.

    Science.gov (United States)

    van Beurden, Hugo E; Snoek, Patricia A M; Von den Hoff, Johannes W; Torensma, Ruurd; Maltha, Jaap C; Kuijpers-Jagtman, Anne M

    2005-04-01

    Wound healing after cleft palate surgery is often associated with impairment of maxillary growth and dento-alveolar development. Wound contraction and scar tissue formation contribute strongly to these effects. In vitro studies have revealed that fibroblasts isolated during different phases of palatal wound healing show phenotypical differences. They change from a quiescent to an activated state and then partly back to a quiescent state. In this study, we evaluated the existence of fibroblast phenotypes at several time-points during palatal wound healing in the rat. Based on cytoskeletal changes (alpha-sma, vimentin, vinculin), integrin expression (alpha1, alpha2, alpha(v) and beta1) and changes in cellularity, we conclude that phenotypically different fibroblast populations are also present during in vivo wound healing. Alpha-sma and the integrin subunits alpha1 and alpha(v) were significantly up-regulated, and vinculin was significantly down-regulated, at early time-points compared to late time-points in wound healing. These changes point to an activated fibroblast state early in wound healing. Later in wound healing, these activated fibroblasts return only partially to the unwounded situation. These results strongly support the idea that different fibroblast populations with specific phenotypes occur in the course of palatal wound healing.

  15. Mast Cells Regulate Wound Healing in Diabetes.

    Science.gov (United States)

    Tellechea, Ana; Leal, Ermelindo C; Kafanas, Antonios; Auster, Michael E; Kuchibhotla, Sarada; Ostrovsky, Yana; Tecilazich, Francesco; Baltzis, Dimitrios; Zheng, Yongjun; Carvalho, Eugénia; Zabolotny, Janice M; Weng, Zuyi; Petra, Anastasia; Patel, Arti; Panagiotidou, Smaro; Pradhan-Nabzdyk, Leena; Theoharides, Theoharis C; Veves, Aristidis

    2016-07-01

    Diabetic foot ulceration is a severe complication of diabetes that lacks effective treatment. Mast cells (MCs) contribute to wound healing, but their role in diabetes skin complications is poorly understood. Here we show that the number of degranulated MCs is increased in unwounded forearm and foot skin of patients with diabetes and in unwounded dorsal skin of diabetic mice (P diabetic mice. Pretreatment with the MC degranulation inhibitor disodium cromoglycate rescues diabetes-associated wound-healing impairment in mice and shifts macrophages to the regenerative M2 phenotype (P diabetic mice deficient in MCs have delayed wound healing compared with their wild-type (WT) controls, implying that some MC mediator is needed for proper healing. MCs are a major source of vascular endothelial growth factor (VEGF) in mouse skin, but the level of VEGF is reduced in diabetic mouse skin, and its release from human MCs is reduced in hyperglycemic conditions. Topical treatment with the MC trigger substance P does not affect wound healing in MC-deficient mice, but improves it in WT mice. In conclusion, the presence of nondegranulated MCs in unwounded skin is required for proper wound healing, and therapies inhibiting MC degranulation could improve wound healing in diabetes. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  16. Impact of diabetes on gingival wound healing via oxidative stress.

    Directory of Open Access Journals (Sweden)

    Daisuke Kido

    Full Text Available The aim of this study is to investigate the mechanisms linking high glucose to gingival wound healing. Bilateral wounds were created in the palatal gingiva adjacent to maxillary molars of control rats and rats with streptozotocin-induced diabetes. After evaluating postsurgical wound closure by digital imaging, the maxillae including wounds were resected for histological examinations. mRNA expressions of angiogenesis, inflammation, and oxidative stress markers in the surgical sites were quantified by real-time polymerase chain reaction. Primary fibroblast culture from the gingiva of both rats was performed in high glucose and normal medium. In vitro wound healing and cell proliferation assays were performed. Oxidative stress marker mRNA expressions and reactive oxygen species production were measured. Insulin resistance was evaluated via PI3K/Akt and MAPK/Erk signaling following insulin stimulation using Western blotting. To clarify oxidative stress involvement in high glucose culture and cells of diabetic rats, cells underwent N-acetyl-L-cysteine treatment; subsequent Akt activity was measured. Wound healing in diabetic rats was significantly delayed compared with that in control rats. Nox1, Nox2, Nox4, p-47, and tumor necrosis factor-α mRNA levels were significantly higher at baseline in diabetic rats than in control rats. In vitro study showed that cell proliferation and migration significantly decreased in diabetic and high glucose culture groups compared with control groups. Nox1, Nox2, Nox4, and p47 expressions and reactive oxygen species production were significantly higher in diabetic and high glucose culture groups than in control groups. Akt phosphorylation decreased in the high glucose groups compared with the control groups. Erk1/2 phosphorylation increased in the high glucose groups, with or without insulin treatment, compared with the control groups. Impaired Akt phosphorylation partially normalized after antioxidant N

  17. Evaluation of wound healing property of Caesalpinia mimosoides Lam.

    Science.gov (United States)

    Bhat, Pradeep Bhaskar; Hegde, Shruti; Upadhya, Vinayak; Hegde, Ganesh R; Habbu, Prasanna V; Mulgund, Gangadhar S

    2016-12-04

    Caesalpinia mimosoides Lam. is one of the important traditional folk medicinal plants in the treatment of skin diseases and wounds used by healers of Uttara Kannada district of Karnataka state (India). However scientific validation of documented traditional knowledge related to medicinal plants is an important path in current scenario to fulfill the increasing demand of herbal medicine. The study was carried out to evaluate the claimed uses of Caesalpinia mimosoides using antimicrobial, wound healing and antioxidant activities followed by detection of possible active bio-constituents. Extracts prepared by hot percolation method were subjected to preliminary phytochemical analysis followed by antimicrobial activity using MIC assay. In vivo wound healing activity was evaluated by circular excision and linear incision wound models. The extract with significant antimicrobial and wound healing activity was investigated for antioxidant capacity using DPPH, nitric oxide, antilipid peroxidation and total antioxidant activity methods. Total phenolic and flavonoid contents were also determined by Folin-Ciocalteu, Swain and Hillis methods. Possible bio-active constituents were identified by GC-MS technique. RP-UFLC-DAD analysis was carried out to quantify ethyl gallate and gallic acid in the plant extract. Preliminary phytochemical analysis showed positive results for ethanol and aqueous extracts for all the chemical constituents. The ethanol extract proved potent antimicrobial activity against both bacterial and fungal skin pathogens compared to other extracts. The efficacy of topical application of potent ethanol extract and traditionally used aqueous extracts was evidenced by the complete re-epithelization of the epidermal layer with increased percentage of wound contraction in a shorter period. However, aqueous extract failed to perform a consistent effect in the histopathological assessment. Ethanol extract showed effective scavenging activity against DPPH and nitric

  18. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  19. Effect of Absolute From Hibiscus syriacus L. Flower on Wound Healing in Keratinocytes

    Science.gov (United States)

    Yoon, Seok Won; Lee, Kang Pa; Kim, Do-Yoon; Hwang, Dae Il; Won, Kyung-Jong; Lee, Dae Won; Lee, Hwan Myung

    2017-01-01

    Background: Proliferation and migration of keratinocytes are essential for the repair of cutaneous wounds. Hibiscus syriacus L. has been used in Asian medicine; however, research on keratinocytes is inadequate. Objective: To establish the dermatological properties of absolute from Hibiscus syriacus L. flower (HSF) and to provide fundamental research for alternative medicine. Materials and Methods: We identified the composition of HSF absolute using gas chromatography-mass spectrometry analysis. We also examined the effect of HSF absolute in HaCaT cells using the XTT assay, Boyden chamber assay, sprout-out growth assay, and western blotting. We conducted an in-vivo wound healing assay in rat tail-skin. Results: Ten major active compounds were identified from HSF absolute. As determined by the XTT assay, Boyden chamber assay, and sprout-out growth assay results, HSF absolute exhibited similar effects as that of epidermal growth factor on the proliferation and migration patterns of keratinocytes (HaCaT cells), which were significantly increased after HSF absolute treatment. The expression levels of the phosphorylated signaling proteins relevant to proliferation, including extracellular signal-regulated kinase 1/2 (Erk 1/2) and Akt, were also determined by western blot analysis. Conclusion: These results of our in-vitro and ex-vivo studies indicate that HSF absolute induced cell growth and migration of HaCaT cells by phosphorylating both Erk 1/2 and Akt. Moreover, we confirmed the wound-healing effect of HSF on injury of the rat tail-skin. Therefore, our results suggest that HSF absolute is promising for use in cosmetics and alternative medicine. SUMMARY Hisbiscus syriacus L. flower absolute increases HaCaT cell migration and proliferation.Hisbiscus syriacus L. flower absolute regulates phosphorylation of ERK 1/2 and Akt in HaCaT cell.Treatment with Hisbiscus syriacus L. flower induced sprout outgrowth.The wound in the tail-skin of rat was reduced by Hisbiscus syriacus

  20. Health-related quality of life and patient burden in patients with split-thickness skin graft donor site wounds.

    Science.gov (United States)

    Humrich, Marco; Goepel, Lisa; Gutknecht, Mandy; Lohrberg, David; Blessmann, Marco; Bruning, Guido; Diener, Holger; Dissemond, Joachim; Hartmann, Bernd; Augustin, Matthias

    2018-04-01

    Split-thickness skin grafting is a common procedure to treat different kinds of wounds. This systematic, multicentre, observational, cross-sectional study of adult patients with split-thickness skin graft (STSG) donor site wounds was conducted to evaluate quality of life (QoL) impairments caused by donor site wounds following split-thickness skin grafting. Therefore, 112 patients from 12 wound centres in Germany were examined based on patient and physician questionnaires as well as a physical examination of the donor site wound. Most indications for skin grafting were postsurgical treatment (n = 51; 42.5%) and chronic wounds (n = 47; 39.2%). European QoL visual analoque scale (EQ VAS) averaged 64.7 ± 23.3, European QoL 5 dimensions (EQ-5D) averaged 77.4 ± 30.0. Wound-QoL (range: 0-4) was rated 0.8 ± 0.8 post-surgery and 0.4 ± 0.6 at the time of survey (on average 21 weeks between the time points). Compared to averaged Wound-QoL scores of chronic wounds donor site-related QoL impairments in split-thickness skin-graft patients were less pronounced. There were significant differences in patient burden immediately after surgery compared to the time of the survey, with medium effect sizes. This supports the hypothesis that faster healing of the donor site wound leads to more favourable patient-reported outcomes. © 2017 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

  1. Positive in vitro wound healing effects of functional inclusion bodies of a lipoxygenase from the Mexican axolotl.

    Science.gov (United States)

    Stamm, Anne; Strauß, Sarah; Vogt, Peter; Scheper, Thomas; Pepelanova, Iliyana

    2018-04-07

    AmbLOXe is a lipoxygenase, which is up-regulated during limb-redevelopment in the Mexican axolotl, Ambystoma mexicanum, an animal with remarkable regeneration capacity. Previous studies have shown that mammalian cells transformed with the gene of this epidermal lipoxygenase display faster migration and wound closure rate during in vitro wound healing experiments. In this study, the gene of AmbLOXe was codon-optimized for expression in Escherichia coli and was produced in the insoluble fraction as protein aggregates. These inclusion bodies or nanopills were shown to be reservoirs containing functional protein during in vitro wound healing assays. For this purpose, functional inclusion bodies were used to coat cell culture surfaces prior cell seeding or were added directly to the medium after cells reached confluence. In both scenarios, AmbLOXe inclusion bodies led to faster migration rate and wound closure, in comparison to controls containing either no AmbLOXe or GFP inclusion bodies. Our results demonstrate that AmbLOXe inclusion bodies are functional and may serve as stable reservoirs of this enzyme. Nevertheless, further studies with soluble enzyme are also necessary in order to start elucidating the exact molecular substrates of AmbLOXe and the biochemical pathways involved in the wound healing effect.

  2. Compromised Wound Healing in Ischemic Type 2 Diabetic Rats.

    Directory of Open Access Journals (Sweden)

    Peilang Yang

    Full Text Available Ischemia is one of the main epidemic factors and characteristics of diabetic chronic wounds, and exerts a profound effect on wound healing. To explore the mechanism of and the cure for diabetic impaired wound healing, we established a type 2 diabetic rat model. We used an 8 weeks high fat diet (HFD feeding regimen followed by multiple injections of streptozotocin (STZ at a dose of 10mg/kg to induce Wister rat to develop type 2 diabetes. Metabolic characteristics were assessed at the 5th week after the STZ injections to confirm the establishment of diabetes mellitus on the rodent model. A bipedicle flap, with length to width ratio 1.5, was performed on the back of the rat to make the flap area ischemic. Closure of excisional wounds on this bipedicle flap and related physiological and pathological changes were studied using histological, immunohistochemical, real time PCR and protein immunoblot approaches. Our results demonstrated that a combination of HFD feeding and a low dose of STZ is capable of inducing the rats to develop type 2 diabetes with noticeable insulin resistance, persistent hyperglycemia, moderate degree of insulinemia, as well as high serum cholesterol and high triglyceride levels. The excision wounds on the ischemic double pedicle flap showed deteriorative healing features comparing with non-ischemic diabetic wounds, including: delayed healing, exorbitant wound inflammatory response, excessive and prolonged ROS production and excessive production of MMPs. Our study suggested that HFD feeding combined with STZ injection could induce type 2 diabetes in rat. Our ischemic diabetic wound model is suitable for the investigation of human diabetic related wound repair; especically for diabetic chronic wounds.

  3. Comparison of the Hydroxylase Inhibitor Dimethyloxalylglycine and the Iron Chelator Deferoxamine in Diabetic and Aged Wound Healing.

    Science.gov (United States)

    Duscher, Dominik; Januszyk, Michael; Maan, Zeshaan N; Whittam, Alexander J; Hu, Michael S; Walmsley, Graham G; Dong, Yixiao; Khong, Sacha M; Longaker, Michael T; Gurtner, Geoffrey C

    2017-03-01

    A hallmark of diabetes mellitus is the breakdown of almost every reparative process in the human body, leading to critical impairments of wound healing. Stabilization and activity of the transcription factor hypoxia-inducible factor (HIF)-1α is impaired in diabetes, leading to deficits in new blood vessel formation in response to injury. In this article, the authors compare the effectiveness of two promising small-molecule therapeutics, the hydroxylase inhibitor dimethyloxalylglycine and the iron chelator deferoxamine, for attenuating diabetes-associated deficits in cutaneous wound healing by enhancing HIF-1α activation. HIF-1α stabilization, phosphorylation, and transactivation were measured in murine fibroblasts cultured under normoxic or hypoxic and low-glucose or high-glucose conditions following treatment with deferoxamine or dimethyloxalylglycine. In addition, diabetic wound healing and neovascularization were evaluated in db/db mice treated with topical solutions of either deferoxamine or dimethyloxalylglycine, and the efficacy of these molecules was also compared in aged mice. The authors show that deferoxamine stabilizes HIF-1α expression and improves HIF-1α transactivity in hypoxic and hyperglycemic states in vitro, whereas the effects of dimethyloxalylglycine are significantly blunted under hyperglycemic hypoxic conditions. In vivo, both dimethyloxalylglycine and deferoxamine enhance wound healing and vascularity in aged mice, but only deferoxamine universally augmented wound healing and neovascularization in the setting of both advanced age and diabetes. This first direct comparison of deferoxamine and dimethyloxalylglycine in the treatment of impaired wound healing suggests significant therapeutic potential for topical deferoxamine treatment in ischemic and diabetic disease.

  4. Effects of whole-body and partial-body x irradiation upon epidermal mitotic activity during wound healing in mouse skin

    International Nuclear Information System (INIS)

    Kobayashi, K.

    1977-01-01

    Mitotic activity of normal (unwounded) and wounded skin was measured in the control (nonirradiated) and whole-body or partial-body x-irradiated mouse. Higher mitotic activity in the anterior than in the posterior region of the body was found in both the normal and the wounded skin of the control mouse. Whole-body irradiation (500 R) depressed completely the mitotic activity of normal skin 2 to 4 days after irradiation. In spite of this depression in mitotic activity, a surgical incision made 1 to 3 days after irradiation could induce a burst of proliferation after an inhibition of an initial mitosis increase. When the animals were partially irradiated with 500 R 3 days before wounding, it was shown that mitosis at 24 hr after wounding was inhibited markedly by the local effect of irradiation and that mitosis also could be inhibited diversely by the abscopal effect of irradiation. Because of a close similarity of sequential mitotic patterns between whole-body-irradiated and flapped-skin-only-irradiated groups (direct irradiation), the effect of irradiation upon mitosis was considered to be primarily local. Some discussions were made concerning the possible reasons which made a difference in mitotic patterns between the head-only-irradiated group, the irradiated group including the head and other parts of the body except for the skin flap

  5. Exercise enhances wound healing and prevents cancer progression during aging by targeting macrophage polarity.

    Science.gov (United States)

    Goh, Jorming; Ladiges, Warren C

    2014-07-01

    Physical activity, which can include regular and repetitive exercise training, has been shown to decrease the incidence of age-related diseases. Aging is characterized by aberrant immune responses, including impaired wound healing and increased cancer risk. The behavior and polarized phenotype of tissue macrophages are distinct between young and old organisms. The balance of M1 and M2 macrophages is altered in the aged tissue microenvironment, with a tilt towards an M2-dominant macrophage population, as well as its associated signaling pathways. These M2-type responses may result in unresolved inflammation and create an environment that impairs wound healing and is favorable for cancer growth. We discuss the concept that exercise training can improve the regulation of macrophage polarization and normalize the inflammatory process, and thereby exert anticancer effects and enhance wound healing in older humans. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Local injection of high-molecular hyaluronan promotes wound healing in old rats by increasing angiogenesis.

    Science.gov (United States)

    Huang, Luying; Wang, Yi; Liu, Hua; Huang, Jianhua

    2018-02-02

    Impaired angiogenesis contributes to delayed wound healing in aging. Hyaluronan (HA) has a close relationship with angiogenesis and wound healing. However, HA content decreases with age. In this study, we used high molecular weight HA (HMW-HA) (1650 kDa), and investigated its effects on wound healing in old rats by local injection. We found that HMW-HA significantly increases proliferation, migration and tube formation in endothelial cells, and protects endothelial cells against apoptosis. Local injection of HMW-HA promotes wound healing by increasing angiogenesis in old rats. HMW-HA increases the phosphorylation of Src, ERK and AKT, leading to increased angiogenesis, suggesting that local injection of HMW-HA promotes wound healing in elderly patients.

  7. Redox Signaling in Diabetic Wound Healing Regulates Extracellular Matrix Deposition.

    Science.gov (United States)

    Kunkemoeller, Britta; Kyriakides, Themis R

    2017-10-20

    Impaired wound healing is a major complication of diabetes, and can lead to development of chronic foot ulcers in a significant number of patients. Despite the danger posed by poor healing, very few specific therapies exist, leaving patients at risk of hospitalization, amputation, and further decline in overall health. Recent Advances: Redox signaling is a key regulator of wound healing, especially through its influence on the extracellular matrix (ECM). Normal redox signaling is disrupted in diabetes leading to several pathological mechanisms that alter the balance between reactive oxygen species (ROS) generation and scavenging. Importantly, pathological oxidative stress can alter ECM structure and function. There is limited understanding of the specific role of altered redox signaling in the diabetic wound, although there is evidence that ROS are involved in the underlying pathology. Preclinical studies of antioxidant-based therapies for diabetic wound healing have yielded promising results. Redox-based therapeutics constitute a novel approach for the treatment of wounds in diabetes patients that deserve further investigation. Antioxid. Redox Signal. 27, 823-838.

  8. Diabetic Foot Ulcers and Epidermal Growth Factor: Revisiting the Local Delivery Route for a Successful Outcome

    Directory of Open Access Journals (Sweden)

    Jorge Berlanga-Acosta

    2017-01-01

    Full Text Available Soon after epidermal growth factor (EGF discovery, some in vivo models appeared demonstrating its property to enhance cutaneous wound healing. EGF was the first growth factor (GF introduced in the clinical arena as a healing enhancer, exerting its mitogenic effects on epithelial, fibroblastoid, and endothelial cells via a tyrosine kinase membrane receptor. Compelling evidences from the 90s documented that, for EGF, locally prolonged bioavailability and hourly interaction with the receptor were necessary for a successful tissue response. Eventually, the enthusiasm on the clinical use of EGF to steer the healing process was wiped out as the topical route to deliver proteins started to be questioned. The simultaneous in vivo experiments, emphasizing the impact of the parenterally administered EGF on epithelial and nonepithelial organs in terms of mitogenesis and cytoprotection, rendered the theoretical fundamentals for the injectable use of EGF and shaped the hypothesis that locally infiltrating the diabetic ulcers would lead to an effective healing. Although the diabetic chronic wounds microenvironment is hostile for local GFs bioavailability, EGF local infiltration circumvented the limitations of its topical application, thus expanding its therapeutic prospect. Our clinical pharmacovigilance and basic studies attest the significance of the GF local infiltration for chronic wounds healing.

  9. Dermal matrix proteins initiate re-epithelialization but are not sufficient for coordinated epidermal outgrowth in a new fish skin culture model.

    Science.gov (United States)

    Matsumoto, Reiko; Sugimoto, Masazumi

    2007-02-01

    We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.

  10. Effect of combined use of autologous adipose-derived stem cells and sterile biological films on chronic wound

    Directory of Open Access Journals (Sweden)

    Ming-hui LI

    2017-02-01

    Full Text Available Objective To analyze and evaluate the effectiveness of combined use of autologous adipose-derived stem cells (ADSCs and sterile biological films on chronic wound. Methods Sixty patients of chronic wound were selected from the General Hospital of Chinese People's Armed Police Forces, and randomly divided into three groups (20 each: the conventional treatment group (group A, the sterile biological films group (group B and ADSCs combined with sterile biological films group (group C. The wound healing time and healing rate of the 3 groups on 7, 21 and 40d after treatment were observed; The proliferation of the basilar membrane cells of wound epithelium in the 3 groups were observed before and 7, 14d after treatment, and the epithelization on 50d after treatment was also observed. The neonatal microvessel density (MVD in epidermal basal layer was calculated before and 7 days after treatment. Results On wound healing, the best result was shown in group C, manifested as the minor inflammatory response, the good formation of granulation tissue and faster speed in epithelial growth; and the result was better in group B than in group A. On wound healing time, the result was shown as group A > group B > group C, and the difference was statistically significant (P<0.05. On wound healing rate, cell proliferation and MVD, group C showed the best result in the 3 groups, group B was better than group A, and the differences were statistically significant (P<0.05. Conclusion ADSCs combined with sterile biological films in treatment of chronic wound healing may significantly improve the proliferation of repaired cells, promote wound vascular regeneration, improve the local growth environment and accelerate the wound healing. DOI: 10.11855/j.issn.0577-7402.2016.12.11

  11. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  12. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  13. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  14. The occurrence of biofilm in an equine experimental wound model of healing by secondary intention

    DEFF Research Database (Denmark)

    Jørgensen, Elin Lisby Kastbjerg; Bay, Lene; Bjarnsholt, Thomas

    2017-01-01

    impaired healing. Presence of biofilm in tissue biopsies was assessed by peptide nucleic acid fluorescence in situ hybridization (PNA FISH) and confocal laser scanning microscopy (CLSM). Bandaged limb wounds developed EGT and displayed delayed healing, while shoulder and un-bandaged limb wounds healed.......009). The finding that biofilm was most prevalent in bandaged limb wounds with EGT formation suggests that biofilm may be linked to delayed wound healing in horses, as has been observed in humans. The inability to clear bacteria could be related to hypoxia and low-grade inflammation in the EGT, but the interaction......In humans, biofilm is a well-known cause of delayed healing and low-grade inflammation of chronic wounds. In horses, biofilm formation in wounds has been studied to a very limited degree. The objective of this study was thus to investigate the occurrence of biofilm in equine experimental wounds...

  15. Human Wharton's jelly mesenchymal stem cells promote skin wound healing through paracrine signaling.

    Science.gov (United States)

    Arno, Anna I; Amini-Nik, Saeid; Blit, Patrick H; Al-Shehab, Mohammed; Belo, Cassandra; Herer, Elaine; Tien, Col Homer; Jeschke, Marc G

    2014-02-24

    The prevalence of nonhealing wounds is predicted to increase due to the growing aging population. Despite the use of novel skin substitutes and wound dressings, poorly vascularized wound niches impair wound repair. Mesenchymal stem cells (MSCs) have been reported to provide paracrine signals to promote wound healing, but the effect of human Wharton's jelly-derived MSCs (WJ-MSCs) has not yet been described in human normal skin. Human WJ-MSCs and normal skin fibroblasts were isolated from donated umbilical cords and normal adult human skin. Fibroblasts were treated with WJ-MSC-conditioned medium (WJ-MSC-CM) or nonconditioned medium. Expression of genes involved in re-epithelialization (transforming growth factor-β2), neovascularization (hypoxia-inducible factor-1α) and fibroproliferation (plasminogen activator inhibitor-1) was upregulated in WJ-MSC-CM-treated fibroblasts (P≤0.05). WJ-MSC-CM enhanced normal skin fibroblast proliferation (P≤0.001) and migration (P≤0.05), and promoted wound healing in an excisional full-thickness skin murine model. Under our experimental conditions, WJ-MSCs enhanced skin wound healing in an in vivo mouse model.

  16. Activation of the EPOR-β common receptor complex by cibinetide ameliorates impaired wound healing in mice with genetic diabetes.

    Science.gov (United States)

    Bitto, Alessandra; Irrera, Natasha; Pizzino, Gabriele; Pallio, Giovanni; Mannino, Federica; Vaccaro, Mario; Arcoraci, Vincenzo; Aliquò, Federica; Minutoli, Letteria; Colonna, Michele R; Galeano, Maria Rosaria; Brines, Michael; De Ponte, Chiara; Collino, Massimo; Squadrito, Francesco; Altavilla, Domenica

    2018-02-01

    Diabetes is characterized by poor wound healing which currently lacks an efficacious treatment. The innate repair receptor (IRR) is a master regulator of tissue protection and repair which is expressed as a response injury or metabolic stress, including in diabetes. Activation of the IRR might provide benefit for diabetic wound healing. A specific IRR agonist cibinetide was administered in an incisional wound healing model performed mice with genetic diabetes (db + /db + ) and compared to the normal wild-type. Animals were treated daily with cibinetide (30μg/kg/s.c.) or vehicle and euthanized 3, 7, and 14days after the injury to quantitate vascular endothelial growth factor (VEGF), malondialdehyde (MAL), phospho-Akt (pAkt), phospho e-NOS (p-eNOS), and nitrite/nitrate content within the wound. Additional evaluations included quantification of skin histological change, angiogenesis, scar strength, and time to complete wound closure. Throughout the wound healing process diabetic animals treated with vehicle exhibited increased wound MAL with reduced VEGF, pAkt, peNOS and nitrite/nitrate, all associated with poor re-epitheliziation, angiogenesis, and wound breaking strength. Cibenitide administration significantly improved these abnormalities. The results suggest that cibinetide-mediated IRR activation may represent an interesting strategy to treat diabetes-associated wound healing. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Neurotensin-loaded collagen dressings reduce inflammation and improve wound healing in diabetic mice.

    Science.gov (United States)

    Moura, Liane I F; Dias, Ana M A; Suesca, Edward; Casadiegos, Sergio; Leal, Ermelindo C; Fontanilla, Marta R; Carvalho, Lina; de Sousa, Hermínio C; Carvalho, Eugénia

    2014-01-01

    Impaired wound healing is an important clinical problem in diabetes mellitus and results in failure to completely heal diabetic foot ulcers (DFUs), which may lead to lower extremity amputations. In the present study, collagen based dressings were prepared to be applied as support for the delivery of neurotensin (NT), a neuropeptide that acts as an inflammatory modulator in wound healing. The performance of NT alone and NT-loaded collagen matrices to treat wounds in streptozotocin (STZ) diabetic induced mice was evaluated. Results showed that the prepared dressings were not-cytotoxic up to 72h after contact with macrophages (Raw 264.7) and human keratinocyte (HaCaT) cell lines. Moreover, those cells were shown to adhere to the collagen matrices without noticeable change in their morphology. NT-loaded collagen dressings induced faster healing (17% wound area reduction) in the early phases of wound healing in diabetic wounded mice. In addition, they also significantly reduced inflammatory cytokine expression namely, TNF-α (phealing, metalloproteinase 9 (MMP-9) is reduced in diabetic skin (pdiabetic wound enhancing the healing process. Nevertheless, a more prominent scar is observed in diabetic wounds treated with collagen when compared to the treatment with NT alone. © 2013.

  18. Gallic Acid Promotes Wound Healing in Normal and Hyperglucidic Conditions

    Directory of Open Access Journals (Sweden)

    Dong Joo Yang

    2016-07-01

    Full Text Available Skin is the outermost layer of the human body that is constantly exposed to environmental stressors, such as UV radiation and toxic chemicals, and is susceptible to mechanical wounding and injury. The ability of the skin to repair injuries is paramount for survival and it is disrupted in a spectrum of disorders leading to skin pathologies. Diabetic patients often suffer from chronic, impaired wound healing, which facilitate bacterial infections and necessitate amputation. Here, we studied the effects of gallic acid (GA, 3,4,5-trihydroxybenzoic acid; a plant-derived polyphenolic compound on would healing in normal and hyperglucidic conditions, to mimic diabetes, in human keratinocytes and fibroblasts. Our study reveals that GA is a potential antioxidant that directly upregulates the expression of antioxidant genes. In addition, GA accelerated cell migration of keratinocytes and fibroblasts in both normal and hyperglucidic conditions. Further, GA treatment activated factors known to be hallmarks of wound healing, such as focal adhesion kinases (FAK, c-Jun N-terminal kinases (JNK, and extracellular signal-regulated kinases (Erk, underpinning the beneficial role of GA in wound repair. Therefore, our results demonstrate that GA might be a viable wound healing agent and a potential intervention to treat wounds resulting from metabolic complications.

  19. Clinical evaluation comparing the efficacy of aquacel Ag with vaseline gauze versus 1% silver sulfadiazine cream in toxic epidermal necrolysis.

    Science.gov (United States)

    Huang, Shu-Hung; Lin, Cen-Hung; Chang, Kao-Ping; Wu, Sheng-Hua; Lin, Sin-Daw; Lai, Chung-Sheng; Ou, Su-Fei; Lee, Su-Shin

    2014-05-01

    The purpose of this study was to determine whether using Aquacel Ag (ConvaTec, Skillman, New Jersey) with Vaseline (Unilever, London, England) gauze instead of silver sulfadiazine cream (SSD) as the wound care protocol to treat toxic epidermal necrolysis (TEN) can improve wound healing, pain control, and reduction of labor costs. A retrospective chart review. A burn center with 2 plastic surgeons and 11 nursing staff. A pathologist diagnosed TEN in 35 patients admitted to the burn center from 1995 to 2009. Parameters included the patient's profile, dressing choice, severity-of-illness score for TEN, time to 95% re-epithelialization, visual analog scale pain scores before second dressing change, and labor cost. The exclusion criterion was wound care with neither Aquacel Ag with Vaseline nor SSD exclusively. Twenty patients were enrolled in this study. In the group using Aquacel Ag with Vaseline gauze, the visual analog scale score was significantly less than that of the SSD group (P = .02). Labor costs were significantly lower in the Aquacel Ag with Vaseline gauze group (P < .01). Commencement of specific dressing to 95% re-epithelialization (P = .09) and time spent in the second dressing change (P = .05) had no statistical significance between the 2 groups. This study showed that Aquacel Ag with Vaseline gauze decreased pain and labor costs but did not shorten wound healing time. Thus, Aquacel Ag with Vaseline gauze can be an efficient method for treating TEN wounds.

  20. Mathematical modeling in wound healing, bone regeneration and tissue engineering.

    Science.gov (United States)

    Geris, Liesbet; Gerisch, Alf; Schugart, Richard C

    2010-12-01

    The processes of wound healing and bone regeneration and problems in tissue engineering have been an active area for mathematical modeling in the last decade. Here we review a selection of recent models which aim at deriving strategies for improved healing. In wound healing, the models have particularly focused on the inflammatory response in order to improve the healing of chronic wound. For bone regeneration, the mathematical models have been applied to design optimal and new treatment strategies for normal and specific cases of impaired fracture healing. For the field of tissue engineering, we focus on mathematical models that analyze the interplay between cells and their biochemical cues within the scaffold to ensure optimal nutrient transport and maximal tissue production. Finally, we briefly comment on numerical issues arising from simulations of these mathematical models.

  1. Endogenous electric fields in embryos during development, regeneration and wound healing

    International Nuclear Information System (INIS)

    Nuccitelli, R.

    2003-01-01

    All embryos that have been investigated drive ionic currents through themselves and these currents will generate internal electric fields. Here, those examples in which such fields have been measured directly are discussed. The first such measurements were made in chick embryos and about 20 mV mm -1 was measured near the posterier intestinal portal in 2-4-day-old embryos. This electric field is important for the development of tail structures because reducing its magnitude results in abnormal tail development. The second embryonic electric field measured directly was in the axolotl, where a rostral-caudal field of about the same magnitude was detected. Modification of this field during neurulation but not gastrulation caused developmental abnormalities. Most recently, the development of left-right asymmetry in frog and chick embryos was found to require a voltage difference between blastomeres at a very early developmental stage. This field was measured in the chick embryo to be 10-20 mV mm -1 across the primitive streak. Mammalian skin wounds generate 150 mV mm -1 fields lateral to the wound and corneal epidermal wounds exhibit lateral fields of 40 mV mm -1 . The presence of these endogenous fields would suggest that exposures to external electric fields should be limited to magnitudes of less than 0.1 V m -1 . (author)

  2. Endogenous electric fields in embryos during development, regeneration and wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Nuccitelli, R

    2003-07-01

    All embryos that have been investigated drive ionic currents through themselves and these currents will generate internal electric fields. Here, those examples in which such fields have been measured directly are discussed. The first such measurements were made in chick embryos and about 20 mV mm-1 was measured near the posterier intestinal portal in 2-4-day-old embryos. This electric field is important for the development of tail structures because reducing its magnitude results in abnormal tail development. The second embryonic electric field measured directly was in the axolotl, where a rostral-caudal field of about the same magnitude was detected. Modification of this field during neurulation but not gastrulation caused developmental abnormalities. Most recently, the development of left-right asymmetry in frog and chick embryos was found to require a voltage difference between blastomeres at a very early developmental stage. This field was measured in the chick embryo to be 10-20 mV mm-1 across the primitive streak. Mammalian skin wounds generate 150 mV mm-1 fields lateral to the wound and corneal epidermal wounds exhibit lateral fields of 40 mV mm-1. The presence of these endogenous fields would suggest that exposures to external electric fields should be limited to magnitudes of less than 0.1 V m-1. (author)

  3. Evaluation of dermal wound healing and in vitro antioxidant efficiency of Bacillus subtilis SPB1 biosurfactant.

    Science.gov (United States)

    Zouari, Raida; Moalla-Rekik, Dorsaf; Sahnoun, Zouheir; Rebai, Tarek; Ellouze-Chaabouni, Semia; Ghribi-Aydi, Dhouha

    2016-12-01

    Lipopeptide microbial surfactants are endowed with unique surface properties as well as antimicrobial, anti-wrinkle, moisturizing and free radical scavenging activities. They were introduced safely in dermatological products, as long as they present low cytotoxicity against human cells. The present study was undertaken to evaluate the in vitro antioxidant activities and the wound healing potential of Bacillus subtilis SPB1 lipopeptide biosurfactant on excision wounds induced in experimental rats. The scavenging effect of Bacillus subtilis SPB1 biosurfactant on 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical at 1mg/mL was 70.4% (IC 50 =0.55mg/mL). The biosurfactant produced by Bacillus subtilis SPB1 also showed good reducing power and significant effects in terms of the β-carotene test (IC 50 =2.26mg/mL) when compared to BHA as a reference standard. Moreover, an interesting ferrous ion chelating activity (80.32%) was found for SPB1 biosurfactant at 1mg/mL. Furthermore, the topical application of Bacillus subtilis SPB1 biosurfactant based gel on the wound site in a rat model every two days, increased significantly the percentage of wound closure over a period of 13days, when compared to the untreated and CICAFLORA™-treated groups. Wound healing effect of SPB1 biosurfactant based gel was confirmed by histological study. Biopsies treated with SPB1 lipopeptides showed wholly re-epithelialized wound with a perfect epidermal regeneration. The present study provides justification for the use of Bacillus subtilis SPB1 lipopeptide biosurfactant based gel for the treatment of normal and complicated wounds as well as skin diseases. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. Substance P promotes wound healing in diabetes by modulating inflammation and macrophage phenotype.

    Science.gov (United States)

    Leal, Ermelindo C; Carvalho, Eugénia; Tellechea, Ana; Kafanas, Antonios; Tecilazich, Francesco; Kearney, Cathal; Kuchibhotla, Sarada; Auster, Michael E; Kokkotou, Efi; Mooney, David J; LoGerfo, Frank W; Pradhan-Nabzdyk, Leena; Veves, Aristidis

    2015-06-01

    Diabetic foot ulceration is a major complication of diabetes. Substance P (SP) is involved in wound healing, but its effect in diabetic skin wounds is unclear. We examined the effect of exogenous SP delivery on diabetic mouse and rabbit wounds. We also studied the impact of deficiency in SP or its receptor, neurokinin-1 receptor, on wound healing in mouse models. SP treatment improved wound healing in mice and rabbits, whereas the absence of SP or its receptor impaired wound progression in mice. Moreover, SP bioavailability in diabetic skin was reduced as SP gene expression was decreased, whereas the gene expression and protein levels of the enzyme that degrades SP, neutral endopeptidase, were increased. Diabetes and SP deficiency were associated with absence of an acute inflammatory response important for wound healing progression and instead revealed a persistent inflammation throughout the healing process. SP treatment induced an acute inflammatory response, which enabled the progression to the proliferative phase and modulated macrophage activation toward the M2 phenotype that promotes wound healing. In conclusion, SP treatment reverses the chronic proinflammatory state in diabetic skin and promotes healing of diabetic wounds. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  5. UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

    International Nuclear Information System (INIS)

    Olsen, W.M.; Elgjo, K.

    1990-01-01

    A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

  6. Electrospun tilapia collagen nanofibers accelerating wound healing via inducing keratinocytes proliferation and differentiation.

    Science.gov (United States)

    Zhou, Tian; Wang, Nanping; Xue, Yang; Ding, Tingting; Liu, Xin; Mo, Xiumei; Sun, Jiao

    2016-07-01

    The development of biomaterials with the ability to induce skin wound healing is a great challenge in biomedicine. In this study, tilapia skin collagen sponge and electrospun nanofibers were developed for wound dressing. The collagen sponge was composed of at least two α-peptides. It did not change the number of spleen-derived lymphocytes in BALB/c mice, the ratio of CD4(+)/CD8(+) lymphocytes, and the level of IgG or IgM in Sprague-Dawley rats. The tensile strength and contact angle of collagen nanofibers were 6.72±0.44MPa and 26.71±4.88°, respectively. They also had good thermal stability and swelling property. Furthermore, the nanofibers could significantly promote the proliferation of human keratinocytes (HaCaTs) and stimulate epidermal differentiation through the up-regulated gene expression of involucrin, filaggrin, and type I transglutaminase in HaCaTs. The collagen nanofibers could also facilitate rat skin regeneration. In the present study, electrospun biomimetic tilapia skin collagen nanofibers were succesfully prepared, were proved to have good bioactivity and could accelerate rat wound healing rapidly and effectively. These biological effects might be attributed to the biomimic extracellular matrix structure and the multiple amino acids of the collagen nanofibers. Therefore, the cost-efficient tilapia collagen nanofibers could be used as novel wound dressing, meanwhile effectively avoiding the risk of transmitting animal disease in the future clinical apllication. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. THE ROLE OF EPIDERMAL BARRIER IMPAIRMENTS IN ATOPIC DERMATITIS: MODERN CONCEPTS OF DISEASE PATHOGENESIS

    Directory of Open Access Journals (Sweden)

    Nikolay N. Murashkin

    2018-01-01

    Full Text Available Atopic dermatitis is a common chronic inflammatory skin disease characterized by a recurring course and progressive decrease in the quality of life. Recent studies in this area demonstrate the multifaceted pathogenesis of atopic dermatitis. Interaction of such factors as epidermal dysfunction, immune system disorders, and the consequences of genetic mutations contributes not only to the development of the disease but also to its progression and chronic course. The article presents various components of the etiopathogenesis of atopic dermatitis, describes the role of lipids, thereby the new therapeutic targets are revealed to specialists.

  8. Shedding Light on a New Treatment for Diabetic Wound Healing: A Review on Phototherapy

    Directory of Open Access Journals (Sweden)

    Nicolette N. Houreld

    2014-01-01

    Full Text Available Impaired wound healing is a common complication associated with diabetes with complex pathophysiological underlying mechanisms and often necessitates amputation. With the advancement in laser technology, irradiation of these wounds with low-intensity laser irradiation (LILI or phototherapy, has shown a vast improvement in wound healing. At the correct laser parameters, LILI has shown to increase migration, viability, and proliferation of diabetic cells in vitro; there is a stimulatory effect on the mitochondria with a resulting increase in adenosine triphosphate (ATP. In addition, LILI also has an anti-inflammatory and protective effect on these cells. In light of the ever present threat of diabetic foot ulcers, infection, and amputation, new improved therapies and the fortification of wound healing research deserves better prioritization. In this review we look at the complications associated with diabetic wound healing and the effect of laser irradiation both in vitro and in vivo in diabetic wound healing.

  9. Genetically induced cell death in bulge stem cells reveals their redundancy for hair and epidermal regeneration.

    Science.gov (United States)

    Driskell, Iwona; Oeztuerk-Winder, Feride; Humphreys, Peter; Frye, Michaela

    2015-03-01

    Adult mammalian epidermis contains multiple stem cell populations in which quiescent and more proliferative stem and progenitor populations coexist. However, the precise interrelation of these populations in homeostasis remains unclear. Here, we blocked the contribution of quiescent keratin 19 (K19)-expressing bulge stem cells to hair follicle formation through genetic ablation of the essential histone methyltransferase Setd8 that is required for the maintenance of adult skin. Deletion of Setd8 eliminated the contribution of bulge cells to hair follicle regeneration through inhibition of cell division and induction of cell death, but the growth and morphology of hair follicles were unaffected. Furthermore, ablation of Setd8 in the hair follicle bulge blocked the contribution of K19-postive stem cells to wounded epidermis, but the wound healing process was unaltered. Our data indicate that quiescent bulge stem cells are dispensable for hair follicle regeneration and epidermal injury in the short term and support the hypothesis that quiescent and cycling stem cell populations are equipotent. © 2014 AlphaMed Press.

  10. Carbon dioxide laser versus erbium:YAG laser in treatment of epidermal verrucous nevus: a comparative randomized clinical study.

    Science.gov (United States)

    Osman, Mai Abdel Raouf; Kassab, Ahmed Nazmi

    2017-08-01

    A verrucous epidermal nevus (VEN) is a skin disorder that has been treated using different treatment modalities with varying results. Ablative lasers such as carbon dioxide laser (CO 2 ) and erbium:yttrium-aluminum-garnet (Er:YAG) laser have been considered as the gold standard for the treatment of epidermal nevi. To evaluate and compare the efficacy, postoperative wound healing and side effects of pulsed CO 2 laser and Er:YAG laser for the treatment of verrucous epidermal nevi. Twenty patients with localized VEN were randomly divided into two groups. Group 1 was administered CO 2 laser and group 2 underwent Er:YAG laser treatment. A blinded physician evaluated the photographs and dermoscopic photomicrographs for the efficacy and possible side effects. All patients received one treatment session and were followed up over a 6-month period. Both lasers induced noticeable clinical improvement, but there were no significant differences between two lasers in treatment response, patient satisfaction, duration of erythema and side effects. The average time to re-epithelialization was 13.5 days with CO 2 and 7.9 days with Er:YAG laser (plaser group and no lesional recurrence was detected in CO 2 laser group since treatment. Apart from re-epithelialization, both lasers showed equivalent outcomes with respect to treatment response, patient satisfaction, side effects and complications.

  11. Effects of aflibercept on primary RPE cells: toxicity, wound healing, uptake and phagocytosis.

    Science.gov (United States)

    Klettner, Alexa; Tahmaz, Nihat; Dithmer, Michaela; Richert, Elisabeth; Roider, Johann

    2014-10-01

    Anti-VEGF treatment is the therapy of choice in age-related macular degeneration, and is also applied in diabetic macular oedema or retinal vein occlusion. Recently, the fusion protein, aflibercept, has been approved for therapeutic use. In this study, we investigate the effects of aflibercept on primary RPE cells. Primary RPE cells were prepared from freshly slaughtered pigs' eyes. The impact of aflibercept on cell viability was investigated with MTT and trypan blue exclusion assay. The influence of aflibercept on wound healing was assessed with a scratch assay. Intracellular uptake of aflibercept was investigated in immunohistochemistry and its influence on phagocytosis with a phagocytosis assay using opsonised latex beads. Aflibercept displays no cytotoxicity on RPE cells but impairs its wound healing ability. It is taken up into RPE cells and can be intracellularly detected for at least 7 days. Intracellular aflibercept impairs the phagocytic capacity of RPE cells. Aflibercept interferes with the physiology of RPE cells, as it is taken up into RPE cells, which is accompanied by a reduction of the phagocytic ability. Additionally, it impairs the wound healing capacity of RPE cells. These effects on the physiology of RPE cells may indicate possible side effects. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  12. Frozen cultured sheets of epidermal keratinocytes in reepithelialization and repair of the cornea after photorefractive keratectomy.

    Science.gov (United States)

    Castro-Muñozledo, Federico; Ozorno-Zarate, Jorge; Naranjo-Tackman, Ramon; Kuri-Harcuch, Walid

    2002-09-01

    To determine whether frozen cultured sheets of human allogeneic epidermal keratinocytes (CEAK) improved wound repair after experimental corneal ablation by photorefractive keratectomy (PRK). Hospital "Luis Sanchez Bulnes" de la Asociación para Evitar la Ceguera en Mexico, I.A.P, and Department of Cell Biology, CINVESTAV-IPN, Mexico City, Mexico. Transepithelial PRK was performed in the right eye of male albino rabbits to obtain a 112 microm deep and 6.0 mm diameter ablation zone. In 17 eyes, the ablations were covered with frozen CEAK; in 11 eyes, the ablations were covered with a disposable contact lens without the cultured sheets; and in the control group (13 eyes), the ablations were not covered. Subepithelial fibrosis and reepithelialization of the ablated zone were evaluated in serial paraffin-embedded tissue sections from all wounds. Treatment with CEAK reduced fibroblast proliferation and the inflammatory response beneath the ablated zone and produced better organization of the newly formed epithelium by eliminating significant hyperplasia or discontinuities in the periodic acid Shiff-stained basement membrane. It also led to accelerated reepithelialization. The use of frozen CEAK as a biologically active wound dressing improved tissue repair at 1 month in corneas ablated by transepithelial PRK in the male albino rabbit model. Treatment with CEAK could improve the outcome of PRK in humans.

  13. Hypoperfusion and Wound Healing: Another Dimension of Wound Assessment.

    Science.gov (United States)

    Smollock, Wendy; Montenegro, Paul; Czenis, Amy; He, Yuan

    2018-02-01

    To examine the correlation between mean arterial pressure (MAP) and wound healing indices and describe an analytical process that can be used accurately and prospectively when evaluating all types of skin ulcerations. A correlational study in a long-term-care facility.Participants (N = 230) were adults residing in a long-term-care facility with an average age of 77.8 years (range, 35-105). Assessment through both an index of wound healing and wound surface area. Signs of wound healing included a reduction of surface area and surface necrosis and increased granulation or epithelialization. Aggregate analyses for all wound locations revealed a positive correlation between the MAP and index of wound healing (r = 0.86, n = 501, P wound healing was noted for all wound locations in this data set when MAP values were 80 mm Hg or less (r = 0.95, n = 141, P wounds and MAP of less than 80 mm Hg yielded a very strong positive correlation. The data indicated that as perfusion decreased, wounds within the sample population declined (r = 0.93, n = 102, P wound healing or worsened wounds. A predictability of wounds stalling or declining related to the MAP was observed, regardless of topical treatment or standard-of-care interventions. Therefore, the data also suggest that remediating states of low perfusion should take precedence in making treatment decisions.

  14. The effects of cancer and cancer therapies on wound healing

    International Nuclear Information System (INIS)

    McCaw, D.L.

    1989-01-01

    Based on experimental evidence in rodents, most of the antineoplastic agents will affect wound healing. With most of the agents, this impairment is not sufficient to produce increased morbidity based on the clinical reports in humans. Radiation therapy appears to inhibit healing in both experimental animals and during clinical trials. In spite of this, it is reported that wounds in animals will heal when they are receiving radiation therapy after surgery. Based on the information presented here and experience at the University of Missouri, the decision to use adjuvant therapy should depend on the surgery performed. With a single incision that had no increased tension, there should be no hesitation to use adjuvant therapy. If removal of the tumor required reconstructive surgery, no radiation or chemotherapy should be used until the wound has healed. 30 references

  15. Wound care centers

    Science.gov (United States)

    Pressure ulcer - wound care center; Decubitus ulcer - wound care center; Diabetic ulcer - wound care center; Surgical wound - wound ... Common types of non-healing wounds include: Pressure sores Surgical ... flow, or swollen legs Certain wounds may not heal well due to: ...

  16. Human tissue inhibitor of metalloproteinases-1 improved wound healing in diabetes through its anti-apoptotic effect.

    Science.gov (United States)

    Lao, Guojuan; Ren, Meng; Wang, Xiaoyi; Zhang, Jinglu; Huang, Yanrui; Liu, Dan; Luo, Hengcong; Yang, Chuan; Yan, Li

    2017-09-08

    Impaired wound healing accompanies severe cell apoptosis in diabetic patients. Tissue inhibitor of metalloproteinases-1 (TIMP-1) was known to have effects on promoting growth and anti-apoptosis for cells. We aimed to determine the actual levels of TIMP-1 and cell apoptosis in: (i) the biopsies of diabetic and non-diabetic foot tissue and (ii) the human fibroblasts with or without treatments of advanced glycation end-products (AGEs). Next, we aimed to determine the improved levels of cell apoptosis and wound healing after the treatments of either active protein of TIMP-1 or in vivo expression of gene therapy vector-mediated TIMP-1 in both the human fibroblasts and the animal model of diabetic rats. The levels of TIMP-1 were significantly reduced in diabetic skin tissues and in AGEs-treated fibroblasts. Both AGEs-treated cells were effectively protected from apoptosis by active protein of TIMP-1 at appropriate dose level. So did the induced in vivo TIMP-1 expression after gene delivery. Similar effects were also found on the significant improvement of impaired wound healing in diabetic rats. We concluded that TIMP-1 improved wound healing through its anti-apoptotic effect. Treatments with either active protein TIMP-1 or TIMP-1 gene therapy delivered in local wound sites may be used as a strategy for accelerating diabetic wound healing. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Delayed cutaneous wound healing in aged rats compared to younger ones.

    Science.gov (United States)

    Soybir, Onur C; Gürdal, Sibel Ö; Oran, Ebru Ş; Tülübaş, Feti; Yüksel, Meral; Akyıldız, Ayşenur İ; Bilir, Ayhan; Soybir, Gürsel R

    2012-10-01

    Delayed wound healing in elderly males is a complex process in which the factors responsible are not fully understood. This study investigated the hormonal, oxidative and angiogenic factors affecting wound healing in aged rats. Two groups consisting of eight healthy male Wistar Albino rats [young (30 ± 7 days) and aged (360 ± 30 days)], and a cutaneous incision wound healing model were used. Scar tissue samples from wounds on the 7th, 14th and 21st days of healing were evaluated for hydroxyproline and vascular endothelial growth factor content. Macrophage, lymphocyte, fibroblast and polymorphonuclear cell infiltration; collagen formation and vascularization were assessed by light and electron microscopy. The free oxygen radical content of the wounds was measured by a chemiluminescence method. Blood sample analysis showed that the hydroxyproline and total testosterone levels were significantly higher, and the oxygen radical content was significantly lower in young rats. Histopathological, immunohistochemical and ultrastructural evaluations revealed higher amounts of fibroblasts and collagen fibers, and more vascularization in young rats. These results are indicative of the delayed wound healing in aged rats. A combination of multiple factors including hormonal regulation, free oxygen radicals and impaired angiogenesis appears to be the cause of delayed cutaneous healing. © 2011 The Authors. International Wound Journal © 2011 Blackwell Publishing Ltd and Medicalhelplines.com Inc.

  18. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  19. Exercise accelerates wound healing among healthy older adults: a preliminary investigation.

    Science.gov (United States)

    Emery, Charles F; Kiecolt-Glaser, Janice K; Glaser, Ronald; Malarkey, William B; Frid, David J

    2005-11-01

    Older adults are likely to experience delayed rates of wound healing, impaired neuroendocrine responsiveness, and increased daily stress. Exercise activity has been shown to have a positive effect on physiological functioning and psychological functioning among older adults. This study evaluated the effect of a 3-month exercise program on wound healing, neuroendocrine function, and perceived stress among healthy older adults. Twenty-eight healthy older adults (mean age 61.0 +/- 5.5 years) were assigned randomly to an exercise activity group (n = 13) or to a nonexercise control group (n = 15). One month following baseline randomization, after exercise participants had acclimated to the exercise routine, all participants underwent an experimental wound procedure. Wounds were measured 3 times per week until healed to calculate rate of wound healing. All participants completed assessments of exercise endurance, salivary cortisol, and self-reported stress prior to randomization and at the conclusion of the intervention. Exercise participants achieved significant improvements in cardiorespiratory fitness, as reflected by increased oxygen consumption (VO(2)max) and exercise duration. Wound healing occurred at a significantly faster rate in the exercise group [mean = 29.2 (9.0) days] than in the nonexercise group [38.9 (7.4) days; p =.012]. Exercise participants also experienced increased cortisol secretion during stress testing following the intervention. Group differences in wound healing and neuroendocrine responsiveness were found despite low levels of self-reported stress. A relatively short-term exercise intervention is associated with enhanced rates of wound healing among healthy older adults. Thus, exercise activity may be an important component of health care to promote wound healing.

  20. Influence of phytochemicals in piper betle linn leaf extract on wound healing.

    Science.gov (United States)

    Lien, Le Thi; Tho, Nguyen Thi; Ha, Do Minh; Hang, Pham Luong; Nghia, Phan Tuan; Thang, Nguyen Dinh

    2015-01-01

    Wound healing has being extensively investigated over the world. Healing impairment is caused by many reasons including increasing of free-radicals-mediated damage, delaying in granulation tissue formation, reducing in angiogenesis and decreasing in collagen reorganization. These facts consequently lead to chronic wound healing. Piper betle Linn (Betle) leaves have been folklore used as an ingredient of drugs for cutaneous wound treatment. However, the effect of betle leaf on wound healing is not yet well elucidated. In this study, we aimed to investigate the healing efficacy of methanol leaf extract of Piper betle Linn on proliferation of fibroblast NIH3T3 cells as well as full-thickness burn and excision wounds in swiss mice. Scratch wound healing assays were conducted to examine the effects of betle leaf extract on healing activity of fibroblast cells. Burn and excision wounds on swiss mouse skins were created for investigating the wound healing progress caused by the betle leaf extract. Malondialdehyde (MDA) was also evaluated to examine the products of lipid hydroperoxide (LPO) under conditions of with or without betle leaf extract treatment. The results of this study showed that Piper betle Linn leaf extract in methanol increased proliferation of NIH3T3 cells and promoted wound healing in vitro and in vivo with both burn wound and excision wound models. In addition, this extract significant decreased level of malondialdehyde (MDA) in liver of treated-mice compared with that in non-treated mice. Our results suggest that Piper betle Linn can be used as an ingredient in developing natural origin drugs for treatment of cutaneous wounds.

  1. The effect of OTR4120, a heparan sulfate glycosaminoglycan memetic on improving acute and impaired wound healing in rats

    NARCIS (Netherlands)

    M. Tong (Miao)

    2012-01-01

    markdownabstract__Abstract__ Dating back to the prehistoric times, wounds have been common with mankind. The treatment of wounds is an art as old as humanity. Today, wounds are of increasing concern in our society in terms of their prevalence and costs. In the developed countries, patients

  2. Rapid preparation of a noncultured skin cell suspension that promotes wound healing.

    Science.gov (United States)

    Yoon, Cheonjae; Lee, Jungsuk; Jeong, Hyosun; Lee, Sungjun; Sohn, Taesik; Chung, Sungphil

    2017-06-01

    Autologous skin cell suspensions have been used for wound healing in patients with burns and against normal pigmentation in vitiligo. To separate cells and the extracellular matrix from skin tissue, most researchers use enzymatic digestion. Therefore, this process is difficult to perform during a routine surgical procedure. We aimed to prepare a suspension of noncultured autologous skin cells (NCSCs) using a tissue homogenizer as a new method instead of harsh biochemical reagents. The potential clinical applicability of NCSCs was analyzed using a nude-rat model of burn healing. After optimization of the homogenizer settings, cell viability ranged from 52 to 89%. Scanning electron microscopy showed evidence of keratinocyte-like cell morphology, and several growth factors, including epidermal growth factor and basic fibroblast growth factor, were present in the NCSCs. The rat model revealed that NCSCs accelerated skin regeneration. NCSCs could be generated using a tissue homogenizer for enhancement of wound healing in vivo. In the NCSC group of wounds, on day 7 of epithelialization, granulation was observed, whereas on day 14, there was a significant increase in skin adnexa regeneration as compared to the control group (PBS treatment; p study suggests that the proposed process is rapid and does not require the use of biochemical agents. Thus, we recommend a combination of surgical treatment with the new therapy for a burn as an effective method.

  3. Application of Three - dimensional Wound Analyzer in the Small Wound Area Measurement during the Process of Wound Healing.

    Science.gov (United States)

    Sheng, Jiajun; Li, Haihang; Jin, Jian; Liu, Tong; Ma, Bing; Liu, Gongcheng; Zhu, Shihui

    2018-02-20

    The objective of this study was to determinate the reliability of 3-dimensional wound analyzer (3-DWMD) in the wound area measurement for animal small area in the process of wound healing. Seven Sprague-Dawley rats were used to establish the skin defect model. And the wound area and time consumption were measured on days 0, 5, 10, 15 using 3-DWMD, investigators, and planimetry method. The measurement results using 3-DWMD and investigators were analyzed comparative with that using planimetry method separately. A total 46 wounds, including 32 irregular wounds and regular 14 wounds, were measured. No matter calculating the irregular wounds or the regular wounds, there was no significant difference between 3-DWMD group and planimetry group in measuring wound area (P > 0.05). However, a statistically significant difference was found in time-consuming for measuring wound area between 3-DWMD group and planimetry group (P area, and its measurement results were consistent with planimetry method. Therefore, such measuring equipment has clinical reference value for measuring precision area of the wound in the process of wound healing.

  4. Three-Dimensional Human Tissue Models That Incorporate Diabetic Foot Ulcer-Derived Fibroblasts Mimic In Vivo Features of Chronic Wounds

    Science.gov (United States)

    Maione, Anna G.; Brudno, Yevgeny; Stojadinovic, Olivera; Park, Lara K.; Smith, Avi; Tellechea, Ana; Leal, Ermelindo C.; Kearney, Cathal J.; Veves, Aristidis; Tomic-Canic, Marjana; Mooney, David J.

    2015-01-01

    Diabetic foot ulcers (DFU) are a major, debilitating complication of diabetes mellitus. Unfortunately, many DFUs are refractory to existing treatments and frequently lead to amputation. The development of more effective therapies has been hampered by the lack of predictive in vitro methods to investigate the mechanisms underlying impaired healing. To address this need for realistic wound-healing models, we established patient-derived fibroblasts from DFUs and site-matched controls and used them to construct three-dimensional (3D) models of chronic wound healing. Incorporation of DFU-derived fibroblasts into these models accurately recapitulated the following key aspects of chronic ulcers: reduced stimulation of angiogenesis, increased keratinocyte proliferation, decreased re-epithelialization, and impaired extracellular matrix deposition. In addition to reflecting clinical attributes of DFUs, the wound-healing potential of DFU fibroblasts demonstrated in this suite of models correlated with in vivo wound closure in mice. Thus, the reported panel of 3D DFU models provides a more biologically relevant platform for elucidating the cell–cell and cell–matrix-related mechanisms responsible for chronic wound pathogenesis and may improve translation of in vitro findings into efficacious clinical applications. PMID:25343343

  5. Regularity of wound healing in rats irradiated locally with different doses of soft X-rays

    International Nuclear Information System (INIS)

    Liu Jianzhong; Zhou Yuanguo; Cheng Tianmin; Zhou Ping; Liu Xia; Li Ping

    2002-01-01

    Objective: To study the regular patter of wound healing in rats irradiated locally with different doses of soft X-rays. Methods: Rats were locally irradiated, and wounded immediately thereafter. Gross observation, histopathology and immunohistochemistry examinations, and image analysis were used to study the wound healing process. Results: The authors found that the delayed time of wound healing induced by soft X-ray irradiation of 0.50, 1.01, 1.96, 3,26, 4.00, 5.21 Gy was 1.6, 4.2, 5.4, 6.6, 8.2 and 9.4 days, respectively. Irradiation with 7.0 and 10.0 Gy caused failure of wound healing (up to 40 days). Compared to the non-irradiated wounds, the healing rates of irradiation-impaired wounds were lower during the whole healing process. From day 3 to day 9 after irradiation, the healing rates decreased along with increasing of the radiation dose, indicating the key phase of wound healing was delayed. After irradiation, the collagen synthesis was decreased, its arrangement was disordered, and the structure of granulation tissue was irregular. Conclusion: Soft X-rays irradiation may cause a delay of wound healing in a dose-dependent manner, and irradiation with 7.0 and 10.0 Gy cause failure of wound healing

  6. Dextran-based hydrogel containing chitosan microparticles loaded with growth factors to be used in wound healing

    International Nuclear Information System (INIS)

    Ribeiro, M.P.; Morgado, P.I.; Miguel, S.P.; Coutinho, P.; Correia, I.J.

    2013-01-01

    Skin injuries are traumatic events, which are seldom accompanied by complete structural and functional restoration of the original tissue. Different strategies have been developed in order to make the wound healing process faster and less painful. In the present study in vitro and in vivo assays were carried out to evaluate the applicability of a dextran hydrogel loaded with chitosan microparticles containing epidermal and vascular endothelial growth factors, for the improvement of the wound healing process. The carriers' morphology was characterized by scanning electron microscopy. Their cytotoxicity profile and degradation by-products were evaluated through in vitro assays. In vivo experiments were also performed to evaluate their applicability for the treatment of skin burns. The wound healing process was monitored through macroscopic and histological analysis. The macroscopic analysis showed that the period for wound healing occurs in animals treated with microparticle loaded hydrogels containing growth factors that were considerably smaller than that of control groups. Moreover, the histological analysis revealed the absence of reactive or granulomatous inflammatory reaction in skin lesions. The results obtained both in vitro and in vivo disclosed that these systems and its degradation by-products are biocompatible, contributed to the re-establishment of skin architecture and can be used in a near future for the controlled delivery of other bioactive agents used in regenerative medicine. - Highlights: • Evaluation of a hydrogel loaded with microparticles containing growth factors for wound healing • In vitro and in vivo assays were performed to characterize the properties of the skin substitute. • The monitoring of the wound healing process was done by macroscopic and histological analysis

  7. Dextran-based hydrogel containing chitosan microparticles loaded with growth factors to be used in wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, M.P. [CICS-UBI, Health Sciences Research Center, Faculty of Health Sciences, University of Beira Interior, Covilhã (Portugal); UDI-IPG, Research Unit for Inland Development, Polytechnic Institute of Guarda, Guarda (Portugal); Morgado, P.I.; Miguel, S.P. [CICS-UBI, Health Sciences Research Center, Faculty of Health Sciences, University of Beira Interior, Covilhã (Portugal); Coutinho, P. [CICS-UBI, Health Sciences Research Center, Faculty of Health Sciences, University of Beira Interior, Covilhã (Portugal); UDI-IPG, Research Unit for Inland Development, Polytechnic Institute of Guarda, Guarda (Portugal); Correia, I.J., E-mail: icorreia@ubi.pt [CICS-UBI, Health Sciences Research Center, Faculty of Health Sciences, University of Beira Interior, Covilhã (Portugal)

    2013-07-01

    Skin injuries are traumatic events, which are seldom accompanied by complete structural and functional restoration of the original tissue. Different strategies have been developed in order to make the wound healing process faster and less painful. In the present study in vitro and in vivo assays were carried out to evaluate the applicability of a dextran hydrogel loaded with chitosan microparticles containing epidermal and vascular endothelial growth factors, for the improvement of the wound healing process. The carriers' morphology was characterized by scanning electron microscopy. Their cytotoxicity profile and degradation by-products were evaluated through in vitro assays. In vivo experiments were also performed to evaluate their applicability for the treatment of skin burns. The wound healing process was monitored through macroscopic and histological analysis. The macroscopic analysis showed that the period for wound healing occurs in animals treated with microparticle loaded hydrogels containing growth factors that were considerably smaller than that of control groups. Moreover, the histological analysis revealed the absence of reactive or granulomatous inflammatory reaction in skin lesions. The results obtained both in vitro and in vivo disclosed that these systems and its degradation by-products are biocompatible, contributed to the re-establishment of skin architecture and can be used in a near future for the controlled delivery of other bioactive agents used in regenerative medicine. - Highlights: • Evaluation of a hydrogel loaded with microparticles containing growth factors for wound healing • In vitro and in vivo assays were performed to characterize the properties of the skin substitute. • The monitoring of the wound healing process was done by macroscopic and histological analysis.

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  9. Th erapeutic potential of d-Th erapeutic potential of d-δ-tocotrienol rich fraction -tocotrienol rich fraction on excisional skin wounds in diabetic rats

    Directory of Open Access Journals (Sweden)

    Bijo Elsy

    2017-10-01

    Full Text Available Introduction: Long-standing hyperglycemia in addition to many of its associated complications also hampers normal wound healing which may be further aggravated in the presence of infection and oxidative stress. Therefore, antioxidant supplementation appears to be strategically relevant for wound healing. This study is designed to explore the therapeutic potential of d-δ-tocotrienol rich fraction (d-δ-TRF on skin wound healing in both healthy and diabetic rats. Materials and Methods: Diabetes was induced through single subcutaneous injection of alloxan at the dose of 100 mg/kg at hip region. 24 albino rats were divided into four groups; healthy control, diabetic control, healthy treated and diabetic treated. d-δ-TRF was administered to treated groups (200 mg/kg, orally, daily for 3 weeks. Full thickness excisional skin wounds were. Wound area was studied by assessing the morphological, histomorphological and histological features at weekly intervals and biochemical analyses were performed at the end of 3rd week. Results: The findings of present study revealed that d-δ-TRF accelerated the skin wound healing by means of early regeneration of both epidermal and dermal components; enhancement of serum protein synthesis, improvement of antioxidant status, maintenance of glycemic condition and controlling serum creatinine levels in diabetic rats. Conclusion: It is concluded that d-δ-TRF has significant therapeutic potency on the healing of skin wounds in both healthy and diabetics.

  10. The morphological effect of electron irradiation on the healing of skin wounds and skin grafts in the rat

    International Nuclear Information System (INIS)

    Wang, Q.

    1995-01-01

    Current oncological practice frequently uses pre-, intra- or post-operative radiotherapy/chemotherapy. Before such treatment can begin it is imperative to establish that satisfactory wound healing will occur. Many previous studies have examined the response of wound healing to ionizing and non-ionizing radiation. In general, clinical and experimental reports indicate that ionizing radiation produces poor to difficult healing of wounds, and can even prevent healing altogether. It is for this reason that the effect of radiation on wound repair has been a long standing concern for surgeons, radiotherapists and radiobiologists. Electron irradiation produces large differences in depth-dose distributions. This enables the delivery of a constant maximal dose throughout the superficial layer of tissue, for example, the total depth of skin, with less damage in deeper tissue layers, compared to that produced by the use of electromagnetic radiation such as X-rays. It is for this reason that electron beam irradiation has been selected as a radiation source for radiation of the graft bed. To date there have been few morphological examinations of the effect of electron radiation on the healing of skin wounds in rats. A review of the literature shows no information on the use of radiation of the graft bed in skin graft surgery. In the present work the processes involved in wound repair in response to radiation were studied, morphologically, using two experimental models, incisional wounds combined with pre-operative radiation and skin autografts combined with radiation of the wound bed. In the latter case an unirradiated skin graft was surgically attached to an irradiated wound bed. Light microscopy (LM), backscattered electron imaging (BEI), scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used as investigative tools. These repair processes include inflammation, re-epithelialization, re-formation of the dermo-epidermal junction, re

  11. The morphological effect of electron irradiation on the healing of skin wounds and skin grafts in the rat

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Q

    1995-07-01

    Current oncological practice frequently uses pre-, intra- or post-operative radiotherapy/chemotherapy. Before such treatment can begin it is imperative to establish that satisfactory wound healing will occur. Many previous studies have examined the response of wound healing to ionizing and non-ionizing radiation. In general, clinical and experimental reports indicate that ionizing radiation produces poor to difficult healing of wounds, and can even prevent healing altogether. It is for this reason that the effect of radiation on wound repair has been a long standing concern for surgeons, radiotherapists and radiobiologists. Electron irradiation produces large differences in depth-dose distributions. This enables the delivery of a constant maximal dose throughout the superficial layer of tissue, for example, the total depth of skin, with less damage in deeper tissue layers, compared to that produced by the use of electromagnetic radiation such as X-rays. It is for this reason that electron beam irradiation has been selected as a radiation source for radiation of the graft bed. To date there have been few morphological examinations of the effect of electron radiation on the healing of skin wounds in rats. A review of the literature shows no information on the use of radiation of the graft bed in skin graft surgery. In the present work the processes involved in wound repair in response to radiation were studied, morphologically, using two experimental models, incisional wounds combined with pre-operative radiation and skin autografts combined with radiation of the wound bed. In the latter case an unirradiated skin graft was surgically attached to an irradiated wound bed. Light microscopy (LM), backscattered electron imaging (BEI), scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were used as investigative tools. These repair processes include inflammation, re-epithelialization, re-formation of the dermo-epidermal junction, re

  12. Decreased expression of heat shock proteins may lead to compromised wound healing in type 2 diabetes mellitus patients.

    Science.gov (United States)

    Singh, Kanhaiya; Agrawal, Neeraj K; Gupta, Sanjeev K; Mohan, Gyanendra; Chaturvedi, Sunanda; Singh, Kiran

    2015-01-01

    Heat shock proteins (HSPs) are inducible stress proteins expressed in cells exposed to stress. HSPs promote wound healing by recruitment of dermal fibroblasts to the site of injury and bring about protein homeostasis. Diabetic wounds are hard to heal and inadequate HSPs may be important contributors in the etiology of diabetic foot ulcers (DFU). To analyze the differential expression of HSPs and their downstream molecules in human diabetic wounds compared to control wounds. Expressional levels of HSP27, HSP47 and HSP70 and their downstream molecules like TLR4, p38-MAPK were seen in biopsies from 101 human diabetic wounds compared to 8 control subjects without diabetes using RT-PCR, western blot and immunohistochemistry. Our study suggested a significant down regulation of HSP70, HSP47 and HSP27 (p value=diabetic wounds. Our study demonstrates that the down regulation of HSPs in diabetic wounds is associated with wound healing impairment in T2DM subjects. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Polydeoxyribonucleotide stimulates angiogenesis and wound healing in the genetically diabetic mouse.

    Science.gov (United States)

    Galeano, Mariarosaria; Bitto, Alessandra; Altavilla, Domenica; Minutoli, Letteria; Polito, Francesca; Calò, Margherita; Lo Cascio, Patrizia; Stagno d'Alcontres, Francesco; Squadrito, Francesco

    2008-01-01

    Healing of diabetic wounds still remains a critical medical problem. Polydeoxyribonucleotide (PDRN), a compound having a mixture of deoxyribonucleotide polymers, stimulates the A2 purinergic receptor with no toxic or adverse effect. We studied the effects of PDRN in diabetes-related healing defect using an incisional skin-wound model produced on the back of female diabetic mice (db+/db+) and their normal littermates (db+/+m). Animals were treated daily for 12 days with PDRN (8 mg/kg/ip) or its vehicle (100 muL 0.9%NaCl). Mice were killed 3, 6, and 12 days after skin injury to measure vascular endothelial growth factor (VEGF) mRNA expression and protein synthesis, to assay angiogenesis and tissue remodeling through histological evaluation, and to study CD31, Angiopoietin-1 and Transglutaminase-II. Furthermore, we measured wound breaking strength at day 12. PDRN injection in diabetic mice resulted in an increased VEGF message (vehicle=1.0+/-0.2 n-fold vs. beta-actin; PDRN=1.5+/-0.09 n-fold vs. beta-actin) and protein wound content on day 6 (vehicle=0.3+/-0.07 pg/wound; PDRN=0.9+/-0.1 pg/wound). PDRN injection improved the impaired wound healing and increased the wound-breaking strength in diabetic mice. PDRN also caused a marked increase in CD31 immunostaining and induced Transglutaminase-II and Angiopoietin-1 expression. Furthermore, the concomitant administration of 3,7-dimethyl-1-propargilxanthine, a selective adenosine A2A receptor antagonist, abolished PDRN positive effects on healing. However, 3,7-dimethyl-1-propargilxanthine alone did not affect wound healing in both diabetic mice and normal littermates. These results suggest that PDRN might be useful in wound disorders associated with diabetes.

  14. Three-dimensional wound measurements for monitoring wound healing

    DEFF Research Database (Denmark)

    Bisgaard Jørgensen, Line; Møller Jeppesen, Sune; Halekoh, Ulrich

    Telemedicine is increasingly used for monitoring wound healing. Three-dimensional (3D) measurement methods enable clinicians to assess wound healing with respect to all dimensions. However, the currently available methods are inaccurate, costly or complicated to use. To address these issues, a 3D......-WAM camera was developed. This camera is able to measure wound size (2D area, 3D area, perimeter and volume) and to assess wound characteristics....

  15. Wnt and Notch signaling pathway involved in wound healing by targeting c-Myc and Hes1 separately.

    Science.gov (United States)

    Shi, Yan; Shu, Bin; Yang, Ronghua; Xu, Yingbin; Xing, Bangrong; Liu, Jian; Chen, Lei; Qi, Shaohai; Liu, Xusheng; Wang, Peng; Tang, Jinming; Xie, Julin

    2015-06-16

    Wnt and Notch signaling pathways are critically involved in relative cell fate decisions within the development of cutaneous tissues. Moreover, several studies identified the above two pathways as having a significant role during wound healing. However, their biological effects during cutaneous tissues repair are unclear. We employed a self-controlled model (Sprague-Dawley rats with full-thickness skin wounds) to observe the action and effect of Wnt/β-catenin and Notch signalings in vivo. The quality of wound repair relevant to the gain/loss-of-function Wnt/β-catenin and Notch activation was estimated by hematoxylin-and-eosin and Masson staining. Immunofluorescence analysis and Western blot analysis were used to elucidate the underlying mechanism of the regulation of Wnt and Notch signaling pathways in wound healing. Meanwhile, epidermal stem cells (ESCs) were cultured in keratinocyte serum-free medium with Jaggedl or in DAPT (N-[(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-1,1-dimethylethyl) to investigate whether the interruption of Notch signaling contributes to the expression of Wnt/β-catenin signaling. The results showed that in vivo the gain-of-function Wnt/β-catenin and Notch activation extended the ability to promote wound closure. We further determined that activation or inhibition of Wnt signaling and Notch signaling can affect the proliferation of ESCs, the differentiation and migration of keratinocytes, and follicle regeneration by targeting c-Myc and Hes1, which ultimately lead to enhanced or delayed wound healing. Furthermore, Western blot analysis suggested that the two pathways might interact in vivo and in vitro. These results suggest that Wnt and Notch signalings play important roles in cutaneous repair by targeting c-Myc and Hes1 separately. What's more, interaction between the above two pathways might act as a vital role in regulation of wound healing.

  16. Negative pressure therapy (vacuum for wound bed preparation among diabetic patients: case series

    Directory of Open Access Journals (Sweden)

    Marcus Castro Ferreira

    Full Text Available CONTEXT: Complications from diabetes mellitus affecting the lower limbs occur in 40 to 70% of such patients. Neuropathy is the main cause of ulceration and may be associated with vascular impairment. The wound evolves with necrosis and infection, and if not properly treated, amputation may be the end result. Surgical treatment is preferred in complex wounds without spontaneous healing. After debridement of the necrotic tissue, the wound bed needs to be prepared to receive a transplant of either a graft or a flap. Dressings can be used to prepare the wound bed, but this usually leads to longer duration of hospitalization. Negative pressure using a vacuum system has been proposed for speeding up the treatment. This paper had the objective of analyzing the effects of this therapy on wound bed preparation among diabetic patients. CASE SERIES: Eighty-four diabetic patients with wounds in their lower limbs were studied. A commercially available vacuum system was used for all patients after adequate debridement of necrotic tissues. For 65 patients, skin grafts completed the treatment and for the other 19, skin flaps were used. Wound bed preparation was achieved over an average time of 7.51 days for 65 patients and 10 days for 12 patients, and in only one case was not achieved. CONCLUSIONS: This experience suggests that negative pressure therapy may have an important role in wound bed preparation and as part of the treatment for wounds in the lower limbs of diabetic patients.

  17. Combination of HIF-1α gene transfection and HIF-1-activated bone marrow-derived angiogenic cell infusion improves burn wound healing in aged mice.

    Science.gov (United States)

    Du, J; Liu, L; Lay, F; Wang, Q; Dou, C; Zhang, X; Hosseini, S M; Simon, A; Rees, D J; Ahmed, A K; Sebastian, R; Sarkar, K; Milner, S; Marti, G P; Semenza, G L; Harmon, J W

    2013-11-01

    Impaired burn wound healing in the elderly represents a major clinical problem. Hypoxia-inducible factor-1 (HIF-1) is a transcriptional activator that orchestrates the cellular response to hypoxia. Its actions in dermal wounds promote angiogenesis and improve healing. In a murine burn wound model, aged mice had impaired wound healing associated with reduced levels of HIF-1. When gene therapy with HIF-1 alone did not correct these deficits, we explored the potential benefit of HIF-1 gene therapy combined with the intravenous infusion of bone marrow-derived angiogenic cells (BMDACs) cultured with dimethyloxalylglycine (DMOG). DMOG is known to reduce oxidative degradation of HIF-1. The mice treated with a plasmid DNA construct expressing a stabilized mutant form of HIF-1α (CA5-HIF-1α)+BMDACs had more rapid wound closure. By day 17, there were more mice with completely closed wounds in the treated group (χ(2), P=0.05). The dermal blood flow measured by laser Doppler showed significantly increased wound perfusion on day 11. Homing of BMDACs to the burn wound was dramatically enhanced by CA5-HIF-1α gene therapy. HIF-1α mRNA expression in the burn wound was increased after transfection with CA5-HIF-1α plasmid. Our findings offer insight into the pathophysiology of burns in the elderly and point to potential targets for developing new therapeutic strategies.

  18. Impaired epidermal wound healing in vivo upon inhibition or deletion of Rac1

    DEFF Research Database (Denmark)

    Tscharntke, Michael; Pofahl, Ruth; Chrostek-Grashoff, Anna

    2007-01-01

    inhibited on collagen I and, to a lesser extent, on fibronectin. Stroboscopic analysis of cell dynamics (SACED) of N17Rac1 transgenic and control keratinocytes identified decreased lamella-protrusion persistence in connection with increased ruffle frequency as a probable mechanism for the observed...

  19. The Extract of Lycium depressum Stocks Enhances Wound Healing in Streptozotocin-Induced Diabetic Rats.

    Science.gov (United States)

    Naji, Siamak; Zarei, Leila; Pourjabali, Masoumeh; Mohammadi, Rahim

    2017-06-01

    In diabetes, impaired wound healing and other tissue abnormalities are considered major concerns. The aim of the present study was to assess the wound-healing activity of methanolic extracts of the extract of Lycium depressum leaves. A total of 60 healthy male Wistar diabetic rats weighing approximately 160 to 180 g and 7 weeks of age were randomized into 10 groups for incision and excision wound models: sham surgery group (SHAM), including creation of wounds and no treatment; base formulation group (FG) with creation of wounds and application of base formulation ointment; treatment group 1 (TG1) with 1 g of powder extract of the plant material in ointment; treatment group 2 (TG2) with 2 g; and treatment group 4 (TG3) with 4 g of powder extract of the plant material in ointment. A wound was induced by an excision- and incision-based wound model in male rats. The mature green leaves of L depressum were collected and authenticated. Extractions of dried leaves were carried out. For wound-healing activity, the extracts were applied topically in the form of ointment and compared with control groups. The healing of the wound was assessed based on excision, incision, hydroxyproline estimation, and biomechanical and biochemical studies. The extract of L depressum leaves enhanced wound contraction, decreased epithelialization time, increased hydroxyproline content, and improved mechanical indices and histological characteristics in treatment groups compared with SHAM and FG ( P healing in a diabetes induced model.

  20. Adipose-derived stem cells seeded in Pluronic F-127 hydrogel promotes diabetic wound healing.

    Science.gov (United States)

    Kaisang, Lin; Siyu, Wang; Lijun, Fan; Daoyan, Pan; Xian, Cory J; Jie, Shen

    2017-09-01

    Chronic nonhealing wound is a multifactorial complication of diabetes that results specifically as a consequence of impaired angiogenesis and currently lacks in effective treatments. Although a stem cell-based therapy may provide a novel treatment to augment diabetic wound healing, inferior cell survival at the diabetic skin wound is one of the key causes that are responsible for the low efficacy of the stem cell therapy. In this work, we used an injectable, biocompatible, and thermosensitive hydrogel Pluronic F-127 to encapsulate allogeneic nondiabetic adipose-derived stem cells (ADSCs) and topically applied the cells to a full-thickness cutaneous wound in the streptozotocin-induced diabetic model in rats. The cells seeded in the hydrogel enhanced angiogenesis (CD31 marker) and promoted the cell proliferation (Ki67 marker) at the wound site and significantly accelerated wound closure, which was accompanied by facilitated regeneration of granulation tissue. Consistently, levels of the messenger RNA expression of key angiogenesis growth factor, vascular endothelial growth factor, and key wound healing growth factor, transforming growth factor beta 1, were also upregulated in the cell-treated wounds when compared with untreated wounds. The results indicated that the transplantation of allogeneic ADSCs via the hydrogel improves the efficiency of cell delivery and optimizes the performance of ADSCs for augmenting diabetic wound healing. In conclusion, this ADSC-based therapy may provide a novel therapeutic strategy for the treatment of nonhealing diabetic foot ulcers. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Monitoring combat wound healing by IR hyperspectral imaging

    Science.gov (United States)

    Howle, Chris R.; Spear, Abigail M.; Gazi, Ehsan; Crane, Nicole J.

    2016-03-01

    In recent conflicts, battlefield injuries consist largely of extensive soft injuries from blasts and high energy projectiles, including gunshot wounds. Repair of these large, traumatic wounds requires aggressive surgical treatment, including multiple surgical debridements to remove devitalised tissue and to reduce bacterial load. Identifying those patients with wound complications, such as infection and impaired healing, could greatly assist health care teams in providing the most appropriate and personalised care for combat casualties. Candidate technologies to enable this benefit include the fusion of imaging and optical spectroscopy to enable rapid identification of key markers. Hence, a novel system based on IR negative contrast imaging (NCI) is presented that employs an optical parametric oscillator (OPO) source comprising a periodically-poled LiNbO3 (PPLN) crystal. The crystal operates in the shortwave and midwave IR spectral regions (ca. 1.5 - 1.9 μm and 2.4 - 3.8 μm, respectively). Wavelength tuning is achieved by translating the crystal within the pump beam. System size and complexity are minimised by the use of single element detectors and the intracavity OPO design. Images are composed by raster scanning the monochromatic beam over the scene of interest; the reflection and/or absorption of the incident radiation by target materials and their surrounding environment provide a method for spatial location. Initial results using the NCI system to characterise wound biopsies are presented here.

  2. Mesenchymal stem cells delivered in a microsphere-based engineered skin contribute to cutaneous wound healing and sweat gland repair.

    Science.gov (United States)

    Huang, Sha; Lu, Gang; Wu, Yan; Jirigala, Enhe; Xu, Yongan; Ma, Kui; Fu, Xiaobing

    2012-04-01

    Bone-marrow-derived mesenchymal stem cells (BM-MSCs) can contribute to wound healing after skin injury. However, the role of BM-MSCs on repairing skin appendages in renewal tissues is incompletely explored. Moreover, most preclinical studies suggest that the therapeutic effects afforded by BM-MSCs transplantation are short-lived and relatively unstable. To assess whether engrafted bone-marrow-derived mesenchymal stem cells via a delivery system can participate in cutaneous wound healing and sweat-gland repair in mice. For safe and effective delivery of BM-MSCs to wounds, epidermal growth factor (EGF) microspheres were firstly developed to both support cells and maintain appropriate stimuli, then cell-seeded microspheres were incorporated with biomimetic scaffolds and thus fabricated an engineered skin construct with epithelial differentiation and proliferative potential. The applied efficacy was examined by implanting them into excisional wounds on both back and paws of hind legs in mice. After 3 weeks, BM-MSC-engineered skin (EGF loaded) treated wounds exhibited accelerated healing with increased re-epithelialization rates and less skin contraction. Furthermore, histological and immunofluorescence staining analysis revealed sweat glands-like structures became more apparent in BM-MSC-engineered skin (EGF loaded) treated wounds but the number of implanted BM-MSCs were decreased gradually in later phases of healing progression. Our study suggests that BM-MSCs delivered by this EGF microspheres-based engineered skin model may be a promising strategy to repair sweat glands and improve cutaneous wound healing after injury and success in this study might provide a potential benefit for BM-MSCs administration clinically. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  3. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  4. Impaired Biomechanical Properties of Diabetic Skin Implications in Pathogenesis of Diabetic Wound Complications

    NARCIS (Netherlands)

    Bermudez, Dustin M.; Herdrich, Benjamin J.; Xu, Junwang; Lind, Robert; Beason, David P.; Mitchell, Marc E.; Soslowsky, Louis J.; Liechty, Kenneth W.

    Diabetic skin is known to have deficient wound healing properties, but little is known of its intrinsic biomeclhanical properties. We hypothesize that diabetic skin possesses inferior biomechanical properties at baseline, rendering it more prone to injury. Skin from diabetic and nondiabetic mice and

  5. Roles of secretory leukocyte protease inhibitor amniotic membrane in oral wound healing

    Directory of Open Access Journals (Sweden)

    Elly Munadziroh

    2006-12-01

    Full Text Available Secretory Leukocyte Protease Inhibitor (SLPI is serine protease inhibitor. Secretory Leukocyte Protease Inhibitor is a protein found in secretions such as whole saliva, seminal fluid, cervical mucus, synovial fluid, breast milk, tears, and cerebral spinal fluid, as in secretions from the nose and bronchi, amniotic fluid and amniotic membrane etc. These findings demonstrate that SLPI function as a potent anti protease, anti inflammatory, bactericidal, antifungal, tissue repair, extra cellular synthesis. Impaired healing states are characterized by excessive proteolysis and often bacterial infection, leading to the hypothesis that SLPI may have a role in the process. The objectives of this article are to investigate the role of SLPI in oral inflammation and how it contributes to tissue repair in oral mucosa. The oral wound healing responses are impaired in the SLPI sufficient mice and matrix synthesis and collagen deposition are delayed. This study indicated that SLPI is a povital factor necessary for optimal wound healing.

  6. Development of a wound healing index for patients with chronic wounds.

    Science.gov (United States)

    Horn, Susan D; Fife, Caroline E; Smout, Randall J; Barrett, Ryan S; Thomson, Brett

    2013-01-01

    Randomized controlled trials in wound care generalize poorly because they exclude patients with significant comorbid conditions. Research using real-world wound care patients is hindered by lack of validated methods to stratify patients according to severity of underlying illnesses. We developed a comprehensive stratification system for patients with wounds that predicts healing likelihood. Complete medical record data on 50,967 wounds from the United States Wound Registry were assigned a clear outcome (healed, amputated, etc.). Factors known to be associated with healing were evaluated using logistic regression models. Significant variables (p healing for each wound type. Some variables predicted significantly in nearly all models: wound size, wound age, number of wounds, evidence of bioburden, tissue type exposed (Wagner grade or stage), being nonambulatory, and requiring hospitalization during the course of care. Variables significant in some models included renal failure, renal transplant, malnutrition, autoimmune disease, and cardiovascular disease. All models validated well when applied to the holdout sample. The "Wound Healing Index" can validly predict likelihood of wound healing among real-world patients and can facilitate comparative effectiveness research to identify patients needing advanced therapeutics. © 2013 by the Wound Healing Society.

  7. The healing effect of combined hydroalcoholic extract of Teocurium polium and the seed hull of Quercus brantii on burn wounds in rats

    Directory of Open Access Journals (Sweden)

    Mohammadi Jamshid

    2016-10-01

    Full Text Available Plants and their extracts have considerable potential for wound healing. So, The aim of this study was to evaluate the wound healing effect of combined hydroalcoholic extract of Teocurium Polium (TP and the seed hull of Quercus brantii (Persian oak (QB and comparing with silver sulfadiazine (SSD ointment (1% in rats. Animals were divided into six groups consist of normal (untreated, physiologic serum, TP, seed hulls of Quercus brantii (QB, combination of TP and QB and the other group was SSD. Burn area size, epidermal and dermal diameter, number of hair follicle, histopathology of the burn skin and concentration of plasma malondialdehide (MDA were determined in different groups. Animals treated with QB and TP, SSD and combination of two extracts (QB +TP showed a significant reduction in the burn area. Serum MDA decreased significantly in animals treated with QB, TP and QB+TP. Histological comparison has shown that TP, QB and combination of them significantly increased reepithelialization in burn wounds, as compared to normal group. In conclusion, our results demonstrated that topical application of TP and QB has a significant effect on the burn wound healing.

  8. Influence of acidic pH on keratinocyte function and re-epithelialisation of human in vitro wounds.

    Science.gov (United States)

    Lönnqvist, Susanna; Emanuelsson, Peter; Kratz, Gunnar

    2015-01-01

    Chronic wounds are one of the greatest challenges for the healthcare system. Today, a plethora of dressings are used in the treatment of these wounds, each with specific influence on the wound environment. Due to differences in the permeability of the dressings the use will result in differences in the pH balance in the wound bed. However, little is known about how changes in the pH in the wound environment affect the different phases of the healing process. The aim of the present study was to investigate the effects of acidic pH on the regeneration phase by studying keratinocyte function in vitro and re-epithelialisation in an in vitro model of human skin. In vitro assays showed reduced viability and migration rates in human keratinocytes when pH was lowered. Real time PCR revealed differential expression of genes related to wound healing and environmental impairment. Tissue culture showed no re-epithelialisation of wounds subjected to pH 5.0 and moderate re-epithelialisation at pH 6.0, compared to controls at pH 7.4. The results indicate that lowering pH down to pH 5.0 in wounds is counterproductive in aspect of keratinocyte function which is crucial for successful wound healing.

  9. Managing painful chronic wounds: the Wound Pain Management Model

    DEFF Research Database (Denmark)

    Price, Patricia; Fogh, Karsten; Glynn, Chris

    2007-01-01

    of the pain experience: location, duration, intensity, quality, onset and impact on activities of daily living. Holistic management must be based on a safe and effective mix of psychosocial approaches together with local and systemic pain management. It is no longer acceptable to ignore or inadequately...... to the wound should be handled as one of the main priorities in chronic wound management together with addressing the cause. Management of pain in chronic wounds depends on proper assessment, reporting and documenting patient experiences of pain. Assessment should be based on six critical dimensions...... document persistent wound pain and not to develop a treatment and monitoring strategy to improve the lives of persons with chronic wounds. Unless wound pain is optimally managed, patient suffering and costs to health care systems will increase. Udgivelsesdato: 2007-Apr...

  10. Advanced glycation end products delay corneal epithelial wound healing through reactive oxygen species generation.

    Science.gov (United States)

    Shi, Long; Chen, Hongmei; Yu, Xiaoming; Wu, Xinyi

    2013-11-01

    Delayed healing of corneal epithelial wounds is a serious complication in diabetes. Advanced glycation end products (AGEs) are intimately associated with the diabetic complications and are deleterious to the wound healing process. However, the effect of AGEs on corneal epithelial wound healing has not yet been evaluated. In the present study, we investigated the effect of AGE-modified bovine serum albumin (BSA) on corneal epithelial wound healing and its underlying mechanisms. Our data showed that AGE-BSA significantly increased the generation of intracellular ROS in telomerase-immortalized human corneal epithelial cells. However, the generation of intracellular ROS was completely inhibited by antioxidant N-acetylcysteine (NAC), anti-receptor of AGEs (RAGE) antibodies, or the inhibitor of NADPH oxidase. Moreover, AGE-BSA increased NADPH oxidase activity and protein expression of NADPH oxidase subunits, p22phox and Nox4, but anti-RAGE antibodies eliminated these effects. Furthermore, prevention of intracellular ROS generation using NAC or anti-RAGE antibodies rescued AGE-BSA-delayed epithelial wound healing in porcine corneal organ culture. In conclusion, our results demonstrated that AGE-BSA impaired corneal epithelial wound healing ex vivo. AGE-BSA increased intracellular ROS generation through NADPH oxidase activation, which accounted for the delayed corneal epithelial wound healing. These results may provide better insights for understanding the mechanism of delayed healing of corneal epithelial wounds in diabetes.

  11. Dual therapeutic functions of F-5 fragment in burn wounds: preventing wound progression and promoting wound healing in pigs

    Directory of Open Access Journals (Sweden)

    Ayesha Bhatia

    2016-01-01

    Full Text Available Burn injuries are a leading cause of morbidity including prolonged hospitalization, disfigurement, and disability. Currently there is no Food and Drug Administration-approved burn therapeutics. A clinical distinction of burn injuries from other acute wounds is the event of the so-called secondary burn wound progression within the first week of the injury, in which a burn expands horizontally and vertically from its initial boundary to a larger area. Therefore, an effective therapeutics for burns should show dual abilities to prevent the burn wound progression and thereafter promote burn wound healing. Herein we report that topically applied F-5 fragment of heat shock protein-90α is a dual functional agent to promote burn wound healing in pigs. First, F-5 prevents burn wound progression by protecting the surrounding cells from undergoing heat-induced caspase 3 activation and apoptosis with increased Akt activation. Accordingly, F-5–treated burn and excision wounds show a marked decline in inflammation. Thereafter, F-5 accelerates burn wound healing by stimulating the keratinocyte migration-led reepithelialization, leading to wound closure. This study addresses a topical agent that is capable of preventing burn wound progression and accelerating burn wound healing.

  12. Dual therapeutic functions of F-5 fragment in burn wounds: preventing wound progression and promoting wound healing in pigs.

    Science.gov (United States)

    Bhatia, Ayesha; O'Brien, Kathryn; Chen, Mei; Wong, Alex; Garner, Warren; Woodley, David T; Li, Wei

    2016-01-01

    Burn injuries are a leading cause of morbidity including prolonged hospitalization, disfigurement, and disability. Currently there is no Food and Drug Administration-approved burn therapeutics. A clinical distinction of burn injuries from other acute wounds is the event of the so-called secondary burn wound progression within the first week of the injury, in which a burn expands horizontally and vertically from its initial boundary to a larger area. Therefore, an effective therapeutics for burns should show dual abilities to prevent the burn wound progression and thereafter promote burn wound healing. Herein we report that topically applied F-5 fragment of heat shock protein-90α is a dual functional agent to promote burn wound healing in pigs. First, F-5 prevents burn wound progression by protecting the surrounding cells from undergoing heat-induced caspase 3 activation and apoptosis with increased Akt activation. Accordingly, F-5-treated burn and excision wounds show a marked decline in inflammation. Thereafter, F-5 accelerates burn wound healing by stimulating the keratinocyte migration-led reepithelialization, leading to wound closure. This study addresses a topical agent that is capable of preventing burn wound progression and accelerating burn wound healing.

  13. The alpha3 laminin subunit, alpha6beta4 and alpha3beta1 integrin coordinately regulate wound healing in cultured epithelial cells and in the skin

    DEFF Research Database (Denmark)

    Goldfinger, L E; Hopkinson, S B; deHart, G W

    1999-01-01

    Previously, we demonstrated that proteolytic processing within the globular domain of the alpha3 subunit of laminin-5 (LN5) converts LN5 from a cell motility-inducing factor to a protein complex that can trigger the formation of hemidesmosomes, certain cell-matrix attachment sites found in epithe......-inhibiting antibodies, we provide evidence that LN5 and its two integrin receptors (alpha6beta4 and alpha3beta1) appear necessary for wound healing to occur in MCF-10A cell culture wounds. We propose a model for healing of wounded epithelial tissues based on these results....... in epithelial cells. We have prepared a monoclonal antibody (12C4) whose epitope is located toward the carboxy terminus of the globular domain of the alpha3 laminin subunit. This epitope is lost from the alpha3 subunit as a consequence of proteolytic processing. Antibody 12C4 stains throughout the matrix...... the wound site. A similar phenomenon is observed in human skin wounds, since we also detect expression of the unprocessed alpha3 laminin subunit at the leading tip of the sheet of epidermal cells that epithelializes skin wounds in vivo. In addition, using alpha3 laminin subunit and integrin function...

  14. Role of Daptomycin on Burn Wound Healing in an Animal Methicillin-Resistant Staphylococcus aureus Infection Model.

    Science.gov (United States)

    Simonetti, Oriana; Lucarini, Guendalina; Orlando, Fiorenza; Pierpaoli, Elisa; Ghiselli, Roberto; Provinciali, Mauro; Castelli, Pamela; Guerrieri, Mario; Di Primio, Roberto; Offidani, Annamaria; Giacometti, Andrea; Cirioni, Oscar

    2017-09-01

    Prolonged hospitalization and antibiotic therapy are risk factors for the development of methicillin-resistant Staphylococcus aureus (MRSA) infections in thermal burn patients. We used a rat model to study the in vivo efficacy of daptomycin in the treatment of burn wound infections by S. aureus , and we evaluated the wound healing process through morphological and immunohistochemical analysis. A copper bar heated in boiling water was applied on a paraspinal site of each rat, resulting in two full-thickness burns. A small gauze was placed over each burn and inoculated with 5 × 10 7 CFU of S. aureus ATCC 43300. The study included two uninfected control groups with and without daptomycin treatment, an infected control group that did not receive any treatment, and two infected groups treated, respectively, with intraperitoneal daptomycin and teicoplanin. The main outcome measures were quantitative culture, histological evaluation of tissue repair, and immunohistochemical expression of wound healing markers: epidermal growth factor receptor (EGFR) and fibroblast growth factor 2 (FGF-2). The highest inhibition of infection was achieved in the group that received daptomycin, which reduced the bacterial load from 10 7 CFU/ml to about 10 3 CFU/g ( P repair by possibly reducing hypertrophic burn scar formation. Copyright © 2017 American Society for Microbiology.

  15. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  16. Do Preexisting Abdominal Scars Threaten Wound Healing in Abdominoplasty?

    OpenAIRE

    Shermak, Michele A.; Mallalieu, Jessie; Chang, David

    2010-01-01

    Purpose: Abdominal scars may impair healing after abdominoplasty. We aimed to determine whether right subcostal or upper midline scars led to increased wound healing problems. Methods and Materials: Review of all patients who had abdominoplasty from March 1998 to February 2008 was performed. Variables studied included age, gender, body mass index (BMI), medical history, and postoperative complications. Statistical analysis was performed in Stata SE, version 10. Results: Of 420 abdominoplasty ...

  17. Combination of ciclopirox olamine and sphingosine-1-phosphate as granulation enhancer in diabetic wounds.

    Science.gov (United States)

    Lim, Natalie Sheng Jie; Sham, Adeline; Chee, Stella Min Ling; Chan, Casey; Raghunath, Michael

    2016-09-01

    Granulation tissue formation requires a robust angiogenic response. As granulation tissue develops, collagen fibers are deposited and compacted. Forces generated in the wake of this process drive wound contraction to reduce the wound area. In diabetics, both angiogenesis and wound contraction are diminished leading to impaired wound healing. To emulate this pathology and to address it pharmacologically, we developed a wound healing model in the diabetic Zucker fatty rat and tested a topical proangiogenic strategy combining antifungal agent ciclopirox olamine (CPX) and lysophospholipid sphingosine-1-phosphate (S1P) to promote diabetic wound closure. In vitro, we demonstrated that CPX + S1P up-regulates a crucial driver of angiogenesis, hypoxia-inducible factor-1, in endothelial cells. Injection of CPX + S1P into subcutaneously implanted sponges in experimental rats showed, in an additive manner, a fivefold increased endothelial infiltration and lectin-perfused vessel length. We developed a splinted diabetic rodent model to achieve low wound contraction rates that are characteristic for the healing mode of diabetic ulcers in humans. We discovered specific dorsal sites that allowed for incremental full-thickness excisional wound depths from 1 mm (superficial) to 3 mm (deep). This enabled us to bring down wound contraction from 51% in superficial wounds to 8% in deep wounds. While the effects of topical gel treatment of CPX + S1P were masked by the rodent-characteristic dominant contraction in superficial wounds, they became clearly evident in deep diabetic wounds. Here, a fivefold increase of functional large vessels resulted in accelerated granulation tissue formulation, accompanied by a 40% increase of compacted thick collagen fibers. This was associated with substantially reduced matrix metalloproteinase-3 and -13 expression. These findings translated into a fivefold increase in granulation-driven contraction, promoting diabetic wound closure. With CPX

  18. Effect of γ irradiation on rate of wound healing in a scored confluent monolayer of cells and the repair-promoting role of W11-a12

    International Nuclear Information System (INIS)

    Shu Chongxiang; Lou Shufen; Cheng Tianmin; Li Shunan; Ran Xinze

    2002-01-01

    Objective: To investigate the effects of ionizing radiation on healing rate of experimental wound in a scored confluent monolayer of fibroblasts and vascular endothelial cells and the repair-promoting effect of W 11 -a 12 . Methods: The healing rates of the experimental wound in a scored confluent monolayer of 3T3 cells or ECV304 cells irradiated with 6 Gy 60 Co gamma rays were assayed by measuring the width of the wound. Results: After irradiation, the closure of scored wounds both in a confluent monolayer of 3T3 cells and in that of ECV304 cells was significantly delayed. The scored wound in a confluent monolayer of 3T3 cells was completely closed in the sham irradiation group, but it was only 77% in the irradiation group at the tenth hour post wounding. The healing rate of the scored wound in a confluent monolayer of irradiated ECV304 cells was 83.6% of that in the sham irradiation group W 11 -a 12 had good promoting action on the closure of wounds in scored confluent monolayers of these two kinds of cells. Conclusion: The direct inhibitory effects of irradiation on the proliferating and migrating capacity of both fibroblasts and vascular endothelial cells might be one of the important reasons for the delay of healing in irradiation-impaired wounds and W 11 -a 12 could promote healing of irradiation-impaired wound by means of enhancing cell migration and proliferation directly

  19. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  20. Acute and Impaired Wound Healing: Pathophysiology and Current Methods for Drug Delivery, Part 2: Role of Growth Factors in Normal and Pathological Wound Healing: Therapeutic Potential and Methods of Delivery

    Science.gov (United States)

    Demidova-Rice, Tatiana N.; Hamblin, Michael R.; Herman, Ira M.

    2012-01-01

    This is the second of 2 articles that discuss the biology and pathophysiology of wound healing, reviewing the role that growth factors play in this process and describing the current methods for growth factor delivery into the wound bed. PMID:22820962

  1. Tight glycaemic control is a key factor in wound healing enhancement strategies in an experimental diabetes mellitus model.

    LENUS (Irish Health Repository)

    O'Sullivan, J B

    2012-02-01

    BACKGROUND: Diabetes mellitus is a leading cause of impaired wound healing. The aim of this study was to establish a glucose-controlled diabetic wound healing model. METHOD: Sprague-Dawley rats were divided into three groups: Control group (C), Diabetic Non-glucose Controlled group (DNC) and Diabetic glucose Controlled group (DC). RESULTS: Glucose control was achieved using Insulman Rapid (average daily glucose level <10 mmol\\/L). 18 Sprague-Dawley rats underwent a dorsal skin wound incision and 10 days later were killed. Fresh and fixed wound tensile strength, hydroxyproline and transforming growth factor beta-1 levels were improved in the DC group when compared to the DNC group. The quantity of fibroblasts present was similar in each group. CONCLUSION: This study demonstrates the impact that diabetes has on acute wound healing and suggests that wound modulating agents must be tested in both the tightly glucose-controlled as well as the poorly glucose-controlled diabetic animal models prior to proceeding with translational clinical studies.

  2. Glucose oxidase incorporated collagen matrices for dermal wound repair in diabetic rat models: a biochemical study.

    Science.gov (United States)

    Arul, V; Masilamoni, J G; Jesudason, E P; Jaji, P J; Inayathullah, M; Dicky John, D G; Vignesh, S; Jayakumar, R

    2012-05-01

    Impaired wound healing in diabetes is a well-documented phenomenon. Emerging data favor the involvement of free radicals in the pathogenesis of diabetic wound healing. We investigated the beneficial role of the sustained release of reactive oxygen species (ROS) in diabetic dermal wound healing. In order to achieve the sustained delivery of ROS in the wound bed, we have incorporated glucose oxidase in the collagen matrix (GOIC), which is applied to the healing diabetic wound. Our in vitro proteolysis studies on incorporated GOIC show increased stability against the proteases in the collagen matrix. In this study, GOIC film and collagen film (CF) are used as dressing material on the wound of streptozotocin-induced diabetic rats. A significant increase in ROS (p < 0.05) was observed in the fibroblast of GOIC group during the inflammation period compared to the CF and control groups. This elevated level up regulated the antioxidant status in the granulation tissue and improved cellular proliferation in the GOIC group. Interestingly, our biochemical parameters nitric oxide, hydroxyproline, uronic acid, protein, and DNA content in the healing wound showed that there is an increase in proliferation of cells in GOIC when compared to the control and CF groups. In addition, evidence from wound contraction and histology reveals faster healing in the GOIC group. Our observations document that GOIC matrices could be effectively used for diabetic wound healing therapy.

  3. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  4. Deregulation of epidermal stem cell niche contributes to pathogenesis of non-healing venous ulcers

    Science.gov (United States)

    Nusbaum, Aron G.; Vukelic, Sasa; Krzyzanowska, Agata; Tomic-Canic, Marjana

    2014-01-01

    The epidermis is maintained by epidermal stem cells (ESC) that reside in distinct niches and contribute to homeostasis and wound closure. Keratinocytes at the non-healing edges of venous ulcers (VUs) are healing-incompetent, hyper-proliferative and non-migratory suggesting deregulation of ESCs. To date genes which regulate ESC niches have been studied in mice only. Utilizing microarray analysis of VU non-healing edges, we identified changes in expression of genes harboring regulation of ESCs and their fate. In a prospective clinical study of ten VUs, we confirmed suppression of the bone morphogenetic protein receptor and GATA binding protein3 as well as inhibitors of DNA-binding proteins 2 and 4. We also found decreased levels of phosphorylated glycogen synthase kinase 3, nuclear presence of ß-catenin and overexpression of its transcriptional target, c-myc indicating activation of the Wnt pathway. Additionally, we found down-regulation of leucine-rich repeats and immunoglobulin-like domains protein 1, a gene important for maintaining ESCs in a quiescent state, and absence of keratin 15, a marker of the basal stem cell compartment suggesting local depletion of ESCs. Our study shows that loss of genes important for regulation of ESCs and their fate along with activation of ß-catenin and c-myc in the VU may contribute to ESC deprivation and a hyper-proliferative, non-migratory, healing incapable wound edge. PMID:24635172

  5. Topical application of ex vivo expanded endothelial progenitor cells promotes vascularisation and wound healing in diabetic mice.

    Science.gov (United States)

    Asai, Jun; Takenaka, Hideya; Ii, Masaaki; Asahi, Michio; Kishimoto, Saburo; Katoh, Norito; Losordo, Douglas W

    2013-10-01

    Impaired wound healing leading to skin ulceration is a serious complication of diabetes and may be caused by defective angiogenesis. Endothelial progenitor cells (EPCs) can augment neovascularisation in the ischaemic tissue. Experiments were performed to test the hypothesis that locally administered EPCs can promote wound healing in diabetes. Full-thickness skin wounds were created on the dorsum of diabetic mice. EPCs were obtained from bone marrow mononuclear cells (BMMNCs) and applied topically to the wound immediately after surgery. Vehicle and non-selective BMMNCs were used as controls. Wound size was measured on days 5, 10 and 14 after treatment, followed by resection, histological analysis and quantification of vascularity. Topical application of EPCs significantly promoted wound healing, as assessed by closure rate and wound vascularity. Immunostaining revealed that transplanted EPCs induced increased expression of vascular endothelial growth factor and basic fibroblast growth factor. Few EPCs were observed in the neovasculature based on in vivo staining of the functional vasculature. Ex vivo expanded EPCs promote wound healing in diabetic mice via mechanisms involving increased local cytokine expression and enhanced neovascularisation of the wound. This strategy exploiting the therapeutic capacity of autologously derived EPCs may be a novel approach to skin repair in diabetes. © 2012 The Authors. International Wound Journal © 2012 John Wiley & Sons Ltd and Medicalhelplines.com Inc.

  6. Accelerated wound healing in mice by on-site production and delivery of CXCL12 by transformed lactic acid bacteria.

    Science.gov (United States)

    Vågesjö, Evelina; Öhnstedt, Emelie; Mortier, Anneleen; Lofton, Hava; Huss, Fredrik; Proost, Paul; Roos, Stefan; Phillipson, Mia

    2018-02-20

    Impaired wound closure is a growing medical problem associated with metabolic diseases and aging. Immune cells play important roles in wound healing by following instructions from the microenvironment. Here, we developed a technology to bioengineer the wound microenvironment and enhance healing abilities of the immune cells. This resulted in strongly accelerated wound healing and was achieved by transforming Lactobacilli with a plasmid encoding CXCL12. CXCL12-delivering bacteria administrated topically to wounds in mice efficiently enhanced wound closure by increasing proliferation of dermal cells and macrophages, and led to increased TGF-β expression in macrophages. Bacteria-produced lactic acid reduced the local pH, which inhibited the peptidase CD26 and consequently enhanced the availability of bioactive CXCL12. Importantly, treatment with CXCL12-delivering Lactobacilli also improved wound closure in mice with hyperglycemia or peripheral ischemia, conditions associated with chronic wounds, and in a human skin wound model. Further, initial safety studies demonstrated that the topically applied transformed bacteria exerted effects restricted to the wound, as neither bacteria nor the chemokine produced could be detected in systemic circulation. Development of drugs accelerating wound healing is limited by the proteolytic nature of wounds. Our technology overcomes this by on-site chemokine production and reduced degradation, which together ensure prolonged chemokine bioavailability that instructed local immune cells and enhanced wound healing. Copyright © 2018 the Author(s). Published by PNAS.

  7. Skin Wound Healing: An Update on the Current Knowledge and Concepts.

    Science.gov (United States)

    Sorg, Heiko; Tilkorn, Daniel J; Hager, Stephan; Hauser, Jörg; Mirastschijski, Ursula

    2017-01-01

    The integrity of healthy skin plays a crucial role in maintaining physiological homeostasis of the human body. The skin is the largest organ system of the body. As such, it plays pivotal roles in the protection against mechanical forces and infections, fluid imbalance, and thermal dysregulation. At the same time, it allows for flexibility to enable joint function in some areas of the body and more rigid fixation to hinder shifting of the palm or foot sole. Many instances lead to inadequate wound healing which necessitates medical intervention. Chronic conditions such as diabetes mellitus or peripheral vascular disease can lead to impaired wound healing. Acute trauma such as degloving or large-scale thermal injuries are followed by a loss of skin organ function rendering the organism vulnerable to infections, thermal dysregulation, and fluid loss. For this update article, we have reviewed the actual literature on skin wound healing purposes focusing on the main phases of wound healing, i.e., inflammation, proliferation, epithelialization, angiogenesis, remodeling, and scarring. The reader will get briefed on new insights and up-to-date concepts in skin wound healing. The macrophage as a key player in the inflammatory phase will be highlighted. During the epithelialization process, we will present the different concepts of how the wound will get closed, e.g., leapfrogging, lamellipodial crawling, shuffling, and the stem cell niche. The neovascularization represents an essential component in wound healing due to its fundamental impact from the very beginning after skin injury until the end of the wound remodeling. Here, the distinct pattern of the neovascularization process and the special new functions of the pericyte will be underscored. At the end, this update will present 3 topics of high interest in skin wound healing issues, dealing with scarring, tissue engineering, and plasma application. Although wound healing mechanisms and specific cell functions in wound

  8. Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

    Directory of Open Access Journals (Sweden)

    Qian Zhao

    2015-12-01

    Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

  9. Pseudomonas aeruginosa infection alters the macrophage phenotype switching process during wound healing in diabetic mice.

    Science.gov (United States)

    Chen, Sinuo; Li, Renren; Cheng, Chun; Xu, Jing-Ying; Jin, Caixia; Gao, Furong; Wang, Juan; Zhang, Jieping; Zhang, Jingfa; Wang, Hong; Lu, Lixia; Xu, Guo-Tong; Tian, Haibin

    2018-03-07

    Macrophages play critical roles in wound healing process. They switch from "classically activated" (M1) phenotype in the early inflammatory phase to "alternatively activated" (M2) phenotype in the later healing phase. However, the dynamic process of macrophage phenotype switching in diabetic wounds burdened with bacteria is unclear. In this report, Pseudomonas aeruginosa, frequently detected in diabetic foot ulcers, was inoculated into cutaneous wounds of db/db diabetic mice to mimic bacterium-infected diabetic wound healing. We observed that P. aeruginosa infection impaired diabetic wound healing and quickly promoted the expression of pro-inflammatory genes (M1 macrophage markers) tumor necrosis factor-α (tnf-α), interleukin-1β (il-1β) and il-6 in wounds. The expression of markers of M2 macrophages, including il-10, arginase-1, and ym1 were also upregulated. In addition, similar gene expression patterns were observed in macrophages isolated directly from wounds. Immunostaining showed that P. aeruginosa infection increased both the ratios of M1 and M2 macrophages in wounds compared with that in control groups, which was further confirmed by in vitro culturing macrophages with P. aeruginosa and skin fibroblast conditioned medium. However, the ratios of the expression levels of pro-inflammatory genes to anti-inflammatory gene il-10 was increased markedly in P. aeruginosa infected wounds and macrophages compared with that in control groups, and P. aeruginosa prolonged the presence of M1 macrophages in the wounds. These data demonstrated that P. aeruginosa in diabetic wounds activates a mixed M1/M2 macrophage phenotype with an excessive activation of M1 phenotype or relatively inadequate activation of M2 phenotype. © 2018 International Federation for Cell Biology.

  10. Open Wound Healing In Vivo: Monitoring Binding and Presence of Adhesion/Growth-Regulatory Galectins in Rat Skin during the Course of Complete Re-Epithelialization

    International Nuclear Information System (INIS)

    Gál, Peter; Vasilenko, Tomáš; Kostelníková, Martina; Jakubco, Ján; Kovác, Ivan; Sabol, František; André, Sabine; Kaltner, Herbert; Gabius, Hans-Joachim; Smetana, Karel Jr.

    2011-01-01

    Galectins are a family of carbohydrate-binding proteins that modulate inflammation and immunity. This functional versatility prompted us to perform a histochemical study of their occurrence during wound healing using rat skin as an in vivo model. Wound healing is a dynamic process that exhibits three basic phases: inflammation, proliferation, and maturation. In this study antibodies against keratins-10 and -14, wide-spectrum cytokeratin, vimentin, and fibronectin, and non-cross-reactive antibodies to galectins-1, -2, and -3 were applied to frozen sections of skin specimens two days (inflammatory phase), seven days (proliferation phase), and twenty-one days (maturation phase) after wounding. The presence of binding sites for galectins-1, -2, -3, and -7 as a measure for assessing changes in reactivity was determined using labeled proteins as probes. Our study detected a series of alterations in galectin parameters during the different phases of wound healing. Presence of galectin-1, for example, increased during the early phase of healing, whereas galectin-3 rapidly decreased in newly formed granulation tissue. In addition, nuclear reactivity of epidermal cells for galectin-2 occurred seven days post-trauma. The dynamic regulation of galectins during re-epithelialization intimates a role of these proteins in skin wound healing, most notably for galectin-1 increasing during the early phases and galectin-3 then slightly increasing during later phases of healing. Such changes may identify a potential target for the development of novel drugs to aid in wound repair and patients’ care

  11. Red Maca (Lepidium meyenii), a Plant from the Peruvian Highlands, Promotes Skin Wound Healing at Sea Level and at High Altitude in Adult Male Mice.

    Science.gov (United States)

    Nuñez, Denisse; Olavegoya, Paola; Gonzales, Gustavo F; Gonzales-Castañeda, Cynthia

    2017-12-01

    Nuñez, Denisse, Paola Olavegoya, Gustavo F. Gonzales, and Cynthia Gonzales-Castañeda. Red maca (Lepidium meyenii), a plant from the Peruvian highlands, promotes skin wound healing at sea level and at high altitude in adult male mice. High Alt Med Biol 18:373-383, 2017.-Wound healing consists of three simultaneous phases: inflammation, proliferation, and remodeling. Previous studies suggest that there is a delay in the healing process in high altitude, mainly due to alterations in the inflammatory phase. Maca (Lepidium meyenii) is a Peruvian plant with diverse biological properties, such as the ability to protect the skin from inflammatory lesions caused by ultraviolet radiation, as well as its antioxidant and immunomodulatory properties. The aim of this study was to determine the effect of high altitude on tissue repair and the effect of the topical administration of the spray-dried extract of red maca (RM) in tissue repair. Studies were conducted in male Balb/c mice at sea level and high altitude. Lesions were inflicted through a 10 mm-diameter excisional wound in the skin dorsal surface. Treatments consisted of either (1) spray-dried RM extract or (2) vehicle (VH). Animals wounded at high altitude had a delayed healing rate and an increased wound width compared with those at sea level. Moreover, wounding at high altitude was associated with an increase in inflammatory cells. Treatment with RM accelerated wound closure, decreased the level of epidermal hyperplasia, and decreased the number of inflammatory cells at the wound site. In conclusion, RM at high altitude generate a positive effect on wound healing, decreasing the number of neutrophils and increasing the number of macrophages in the wound healing at day 7 postwounding. This phenomenon is not observed at sea level.

  12. A Clinicoepidemiological Profile of Chronic Wounds in Wound Healing Department in Shanghai.

    Science.gov (United States)

    Sun, Xiaofang; Ni, Pengwen; Wu, Minjie; Huang, Yao; Ye, Junna; Xie, Ting

    2017-03-01

    The aim of the study was to update the clinical database of chronic wounds in order to derive an evidence based understanding of the condition and hence to guide future clinical management in China. A total of 241 patients from January 1, 2011 to April 30, 2016 with chronic wounds of more than 2 weeks' duration were studied in wound healing department in Shanghai. Results revealed that among all the patients the mean age was 52.5 ± 20.2 years (range 2-92 years). The mean initial area of wounds was 30.3 ± 63.0 cm 2 (range 0.25-468 cm 2 ). The mean duration of wounds was 68.5 ± 175.2 months (range 0.5-840 months). The previously reported causes of chronic wounds were traumatic or surgical wounds (n = 82, 34.0%), followed by pressure ulcers (n = 59, 24.5%). To study the effects of age, patients were divided into 2 groups: less than 60 years (wounds etiology between the 2 age groups was analyzed, and there was significant statistical difference ( P wounds, chi-square test was used. There were significant differences in the factor of wound infection. ( P = .035, 95% CI = 0.031-0.038) Regarding therapies, 72.6% (n = 175) of the patients were treated with negative pressure wound therapy. Among all the patients, 29.9% (n = 72) of them were completely healed when discharged while 62.7% (n = 150) of them improved. The mean treatment cost was 12055.4 ± 9206.3 Chinese Yuan (range 891-63626 Chinese Yuan). In conclusion, traumatic or surgical wounds have recently become the leading cause of chronic wounds in Shanghai, China. Etiology of the 2 age groups was different. Infection could significantly influence the wound outcome.

  13. Physicochemical properties of radiation-sterilized honey alginate wound dressing for exudating wounds

    International Nuclear Information System (INIS)

    Asa, Anie Day DC.; De Guzman, Zenaida M.; Baldos, Davison T.; Asaad, Celia O.

    2013-01-01

    Honey is a well-known natural cure in promoting healing of wounds. Alginate, on the other hand, is a polysaccharide with pharmaceutical applications such as wound dressing and control release drugs. Calcium-alginate wound dressings have a gel-forming capability. in that, upon ion exchange between calcium ions in the dressing, and sodium ions in wound fluid, the dressing transforms into a gel. Cross-linked alginate gels can absorb would fluid, and also maintain a moist environment to the wound area. Combined with anti-microbial properties of honey and absorption and gelling properties of alginate, a honey alginate wound dressing is developed and irradiated for sterility. Its physicochemical properties are then analyzed. The honey-alginate wound dressing has lower pH (4.40±0.02) than alginate alone dressings (5.40±0.04) which is more favorable for wound healing. The dressing also has low moisture content (10.25±1.11%). Analysis of moisture vapour transmission rate shows a general increase with time for 48 hours. The wound dressing also has an absorbency of 19.00±1.80 g/100 cm 2 with a gel fraction of 18.44±0.63%. The rate of absorption analysis, meanwhile, shows a very rapid absorption rate upon exposure to wound fluid. After some time, a decrease in rate is observed which is accounted to the release of honey to the wound environment. For tensile strength, irradiation causes an effect in tensile strength in machine direction but is insignificant for cross machine direction. Physicochemical properties of the radiation-sterilized honey alginate wound dressing e.g. acidic pH, absorbency, moisture vapor permeability and absorption rate ascertain its characteristic as a good wound dressing for exudating wounds. Its low moisture content, meanwhile, allows for longer shelf-life of the developed product. (author)

  14. In situ depot comprising phase-change materials that can sustainably release a gasotransmitter H2S to treat diabetic wounds.

    Science.gov (United States)

    Lin, Wei-Chih; Huang, Chieh-Cheng; Lin, Shu-Jyuan; Li, Meng-Ju; Chang, Yen; Lin, Yu-Jung; Wan, Wei-Lin; Shih, Po-Chien; Sung, Hsing-Wen

    2017-11-01

    Patients with diabetes mellitus are prone to develop refractory wounds. They exhibit reduced synthesis and levels of circulating hydrogen sulfide (H 2 S), which is an ephemeral gaseous molecule. Physiologically, H 2 S is an endogenous gasotransmitter with multiple biological functions. An emulsion method is utilized to prepare a microparticle system that comprises phase-change materials with a nearly constant temperature of phase transitions to encapsulate sodium hydrosulfide (NaHS), a highly water-labile H 2 S donor. An emulsion technique that can minimize the loss of water-labile active compounds during emulsification must be developed. The as-prepared microparticles (NaHS@MPs) provide an in situ depot for the sustained release of exogenous H 2 S under physiological conditions. The sustained release of H 2 S promotes several cell behaviors, including epidermal/endothelial cell proliferation and migration, as well as angiogenesis, by extending the activation of cellular ERK1/2 and p38, accelerating the healing of full-thickness wounds in diabetic mice. These experimental results reveal the strong potential of NaHS@MPs for the sustained release of H 2 S for the treatment of diabetic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. [Current wound care in patients with elephantiasis--third-stage lymphedema].

    Science.gov (United States)

    Rucigaj, Tanja Planinsek; Slana, Ana; Leskovec, Nada Kecelj

    2012-10-01

    Lymphedema resulting from fluid accumulation due to impairment in the lymphatic system drainage leads to enlargement of the body part involved. If left untreated, in its third stage it results in elephantiasis. Elephantiasis is frequently accompanied by papillomatosis and lymphocutaneous fistulas with lymphorrhoea, erosions and ulcers, frequently with the loss of function in the respective part of the body. Unlike other chronic wounds, wound healing in lymphedema is highly dependent on the use of combined therapies because local treatment with modern supportive dressings and compression therapy with adhesive and non-adhesive short-stretch systems is only part of the complete treatment. This treatment also includes sub-bandage foamy materials, kinesitherapy with tapes (kinesiotaping), intermittent local application of high-pressure oxygen, breathing exercise, and manual lymph drainage and exercises.

  16. The Effects of Aloe vera Cream on the Expression of CD4+ and CD8+ Lymphocytes in Skin Wound Healing.

    Science.gov (United States)

    Prakoso, Yos Adi; Kurniasih

    2018-01-01

    The aim of this study is to explore the effect of topical application of Aloe vera on skin wound healing. Thirty-six male Sprague-Dawley rats weighing 150-200 grams were divided into four groups. All groups were anesthetized, shaved, and exposed to round full-thickness punch biopsy on the back: group I (control); group II (treated with 1% Aloe vera cream); group III (treated with 2% Aloe vera cream); and group IV (treated with madecassol®). The treatments were given once a day. Macroscopic and microscopic examination were observed at 5, 10, and 15 days after skin biopsy. Skin specimens were prepared for histopathological study using H&E stain and IHC stain against CD4 + and CD8 + lymphocytes. All the data were analyzed using SPSS16. The result showed that topical application of 1% and 2% Aloe vera cream significantly reduced the percentage of the wound, leucocytes infiltration, angiogenesis, and expression of CD8 + lymphocytes and increased the epidermal thickness and the expression of CD4 + lymphocytes ( p ≤ 0,05). There was no significant difference in the number of fibroblasts in all groups. Topical application of 1% and 2% Aloe vera cream has wound healing potential via their ability to increase the ratio of CD4 + /CD8 + lymphocytes in the wound area.

  17. Image acquisition and planimetry systems to develop wounding techniques in 3D wound model

    Directory of Open Access Journals (Sweden)

    Kiefer Ann-Kathrin

    2017-09-01

    Full Text Available Wound healing represents a complex biological repair process. Established 2D monolayers and wounding techniques investigate cell migration, but do not represent coordinated multi-cellular systems. We aim to use wound surface area measurements obtained from image acquisition and planimetry systems to establish our wounding technique and in vitro organotypic tissue. These systems will be used in our future wound healing treatment studies to assess the rate of wound closure in response to wound healing treatment with light therapy (photobiomodulation. The image acquisition and planimetry systems were developed, calibrated, and verified to measure wound surface area in vitro. The system consists of a recording system (Sony DSC HX60, 20.4 M Pixel, 1/2.3″ CMOS sensor and calibrated with 1mm scale paper. Macro photography with an optical zoom magnification of 2:1 achieves sufficient resolution to evaluate the 3mm wound size and healing growth. The camera system was leveled with an aluminum construction to ensure constant distance and orientation of the images. The JPG-format images were processed with a planimetry system in MATLAB. Edge detection enables definition of the wounded area. Wound area can be calculated with surface integrals. To separate the wounded area from the background, the image was filtered in several steps. Agar models, injured through several test persons with different levels of experience, were used as pilot data to test the planimetry software. These image acquisition and planimetry systems support the development of our wound healing research. The reproducibility of our wounding technique can be assessed by the variability in initial wound surface area. Also, wound healing treatment effects can be assessed by the change in rate of wound closure. These techniques represent the foundations of our wound model, wounding technique, and analysis systems in our ongoing studies in wound healing and therapy.

  18. Impaired wound healing after radiation therapy: A systematic review of pathogenesis and treatment

    Directory of Open Access Journals (Sweden)

    Lia K. Jacobson

    2017-09-01

    Conclusion: Pathogenesis of delayed wound healing and fibrosis following radiotherapy is a complex, interdependent process involving cellular depletion, extracellular matrix changes, microvascular damage, and altered pro-inflammatory mediators. Current treatment is limited, and more Level I studies are needed to develop best-practice recommendations. Investigatory treatment options targeting specific mechanisms of injury may offer potential solutions to this significant clinical and surgical problem.

  19. Clinical Evaluation of Wound Healing in Split-Skin Graft Donor Sites Using Microscopic Quantification of Reepithelialization.

    Science.gov (United States)

    Wehrens, Kim Marlou Emiele; Arnoldussen, Carsten W K P; Booi, Darren Ivar; van der Hulst, Rene R W J

    2016-06-01

    Impaired or delayed wound healing is a common health problem. However, it remains challenging to predict whether wounds in patients will heal without complication or will have a prolonged healing time. In this study, the authors developed an objective screening tool to assess wound healing using microscopic quantification of reepithelialization in a split-thickness skin graft wound model and used this tool to identify risk factors for defective wound healing. Thirty patients (16 male and 14 female) were included in this prospective study. Anterior thigh skin biopsies from the donor site region of partial-thickness skin grafts were dressed with moisture-retentive dressings, and biopsies were examined on days 0, 2, 5, and 10 postoperatively by microscopy. Images were then transferred to a computer for image analysis and epithelial measurements (epithelial thickness and total reepithelialized surface). The effects of gender, age, body mass index, and smoking behavior on these wound healing parameters were determined. The authors found comparable results for the computer and traditional measure methods. However, the time required to perform the measurements using the semiautomated computer method was less than half the time of the traditional method. Image capturing, enhancing, and analysis with the new method required approximately 2 minutes 30 seconds, whereas the traditional methods took up to 7 minutes per image. The total size of the reepithelialized surface (P = .047) and percentage of the biopsy resurfaced with epithelia (P = .011) at day 10 were both significantly higher in male patients compared with female patients. In patients younger than 55 years, reepithelialized areas were significantly thicker than in patients older than 55 years (P = .008), whereas the size of the reepithelialized surface showed no differences. No significant differences in reepithelialization parameters were found concerning body mass index and smoking behavior. Both male gender and

  20. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  1. Granulocyte colony-stimulating factor in toxic epidermal necrolysis (TEN) and Chelsea & Westminster TEN management protocol [corrected].

    Science.gov (United States)

    de Sica-Chapman, A; Williams, G; Soni, N; Bunker, C B

    2010-04-01

    Toxic epidermal necrolysis (TEN) is a rare but life-threatening, allergic drug reaction. Skin blistering with epidermal and mucosal necrolysis with subsequent detachment from an inflamed underlying dermis is a hallmark of the condition. The pathogenesis of TEN is not well understood, accounting for controversies about its management and significant delay in initiating potentially beneficial therapy. There are no management protocols based on a robust evidence base. Prompt recognition of the diagnosis and consensus on early management initiatives are necessary in order to improve outcomes and survival in TEN. To date, TEN management has been directed at arresting the allergic reaction and treating the complications. We have identified a need for specific medical interventions to accelerate wound regeneration. This approach has not previously been adopted in the management of TEN. We observed that in two cases of severe TEN, dramatic re-epithelialization and recovery coincided with the introduction of granulocyte colony-stimulating factor (G-CSF) for neutropenia. We explain how addition of the G-CSF promotes recovery from TEN by enhanced bioregeneration of the damaged tissues through accelerated re-epithelialization. G-CSF has been used for severe neutropenia in TEN, but we recommend and explain why, as in our Chelsea and Westminster protocol, G-CSF should be considered in treating severe TEN irrespective of the severity of neutropenia.

  2. Teaching wound care to family medicine residents on a wound care service

    Directory of Open Access Journals (Sweden)

    Little SH

    2013-08-01

    Full Text Available Sahoko H Little,1,2 Sunil S Menawat,1,3 Michael Worzniak,1 Michael D Fetters2 1Oakwood Annapolis Family Medicine Residency, Wayne, Michigan, USA; 2University of Michigan, Department of Family Medicine, Ann Arbor, Michigan, USA; 3Ghent Family Medicine Residency, Eastern Virginia Medical School, Norfolk, Virginia, USA Abstract: Primary care physicians often care for patients with chronic wounds, and they can best serve patients if they have knowledge and proficient skills in chronic wound care, including sharp debridement. The Oakwood Annapolis Family Medicine Residency in Michigan, USA developed a Wound Care Service, incorporating wound care training during the surgical rotation. Effectiveness of the wound care training was evaluated through pre- and posttesting of residents, to assess changes in knowledge and comfort in treating chronic wounds. The results demonstrate significant improvement in residents’ knowledge and comfort in wound care. This innovation demonstrates the feasibility of educating residents in chronic wound care through hands-on experience. Keywords: wound care education, primary care, residency education, surgery rotation, curriculum development

  3. Fibroblast Senescence and Squamous Cell Carcinoma: How wounding therapies could be protective

    Science.gov (United States)

    Travers, Jeffrey B.; Spandau, Dan F; Lewis, Davina A.; Machado, Christiane; Kingsley, Melanie; Mousdicas, Nico; Somani, Ally-Khan

    2014-01-01

    Background Squamous cell carcinoma (SCC), which has one of the highest incidences of all cancers in the United States, is an age-dependent disease as the majority of these cancers are diagnosed in people over 70 years of age. Recent findings have led to a new hypothesis on the pathogenesis of SCC. Objectives To evaluate the potential of preventive therapies to reduce the incidence of SCC in at-risk geriatric patients. Materials and Methods Survey of current literature on wounding therapies to prevent SCCs. Results This new hypothesis of SCC photocarcinogenesis states that senescent fibroblasts accumulate in geriatric dermis resulting in a reduction in dermal insulin-like growth factor-1 (IGF-1) expression. This lack of IGF-1 expression sensitizes epidermal keratinocytes to fail to suppress UVB-induced mutations leading to increased proclivity to photocarcinogenesis. Recent evidence suggests that dermal wounding therapies, specifically dermabrasion and fractionated laser resurfacing, can decrease the proportion of senescent dermal fibroblasts, increase dermal IGF-1 expression, and correct the inappropriate UVB response found in geriatric skin, thus protecting geriatric keratinocytes from UVB-induced SCC initiation. Conclusions In this review, we will discuss the translation of pioneering basic science results implicating commonly used dermal fibroblast rejuvenation procedures as preventative treatments for SCC. PMID:23437969

  4. Diabetic foot wounds: the value of negative pressure wound therapy with instillation.

    Science.gov (United States)

    Dalla Paola, Luca

    2013-12-01

    Chronic wounds such as diabetic foot wounds are a tremendous burden to the health care system and often require a multidisciplinary approach to prevent amputations. Advanced technologies such as negative pressure wound therapy (NPWT) and bioengineered tissues have been successfully used in the treatment of these types of complex wounds. However, the introduction of NPWT with instillation (NPWTi) has provided an alternative treatment for treating complex and difficult-to-heal wounds. This article provides an overview of NPWT and the new NPWTi system and describes preliminary experience using NPWTi on patients with complicated infected diabetic foot wounds after surgical debridement and in a multidisciplinary setting. © 2013 The Author. International Wound Journal © 2013 John Wiley & Sons Ltd and Medicalhelplines.com Inc.

  5. Biofilms in wounds

    DEFF Research Database (Denmark)

    Cooper, R A; Bjarnsholt, Thomas; Alhede, M

    2014-01-01

    Following confirmation of the presence of biofilms in chronic wounds, the term biofilm became a buzzword within the wound healing community. For more than a century pathogens have been successfully isolated and identified from wound specimens using techniques that were devised in the nineteenth...... extracellular polymeric substances (EPS). Cells within such aggregations (or biofilms) display varying physiological and metabolic properties that are distinct from those of planktonic cells, and which contribute to their persistence. There are many factors that influence healing in wounds and the discovery...... of biofilms in chronic wounds has provided new insight into the reasons why. Increased tolerance of biofilms to antimicrobial agents explains the limited efficacy of antimicrobial agents in chronic wounds and illustrates the need to develop new management strategies. This review aims to explain the nature...

  6. A prospective randomized evaluation of negative-pressure wound dressings for diabetic foot wounds.

    Science.gov (United States)

    Eginton, Mark T; Brown, Kellie R; Seabrook, Gary R; Towne, Jonathan B; Cambria, Robert A

    2003-11-01

    Optimal treatment for large diabetic foot wounds is ill defined. The purpose of this study was to compare the rate of wound healing with the Vacuum Assisted Closure device trade mark (VAC) to conventional moist dressings in the treatment of large diabetic foot wounds. Diabetics with significant soft tissue defects of the foot were considered for enrollment. Patients were randomized to receive either moist gauze dressings or VAC treatments for 2 weeks, after which they were treated with the alternative dressing for an additional 2 weeks. Wounds were photographed weekly and wound dimensions calculated in a blinded fashion with spatial analysis software. Percent change in wound dimensions were calculated and compared for each weekly assessment and over 2 weeks of therapy with each dressing type. Ten patients were enrolled in the trial, but two were lost to follow-up and two were withdrawn. Complete data were available for analysis on seven wounds in six patients. Average length, width, and depth of the wounds at initiation of the trial was 7.7, 3.5, and 3.1 cm, respectively. Only the wound depth was significantly decreased over the weeks of the trial to 1.2 cm ( p VAC dressings decreased the wound volume and depth significantly more than moist gauze dressings (59% vs. 0% and 49% vs. 8%, respectively). VAC dressings were associated with a decrease in all wound dimensions while wound length and width increased with moist dressings. In summary, over the first several weeks of therapy, VAC dressings decreased wound depth and volume more effectively than moist gauze dressings. Negative-pressure wound treatment may accelerate closure of large foot wounds in the diabetic patient.

  7. Recombinant human erythropoietin stimulates angiogenesis and wound healing in the genetically diabetic mouse.

    Science.gov (United States)

    Galeano, Mariarosaria; Altavilla, Domenica; Cucinotta, Domenico; Russo, Giuseppina T; Calò, Margherita; Bitto, Alessandra; Marini, Herbert; Marini, Rolando; Adamo, Elena B; Seminara, Paolo; Minutoli, Letteria; Torre, Valerio; Squadrito, Francesco

    2004-09-01

    The effects of recombinant human erythropoietin (rHuEPO) in diabetes-related healing defects were investigated by using an incisional skin-wound model produced on the back of female diabetic C57BL/KsJ-m(+/+)Lept(db) mice (db(+)/db(+)) and their normoglycemic littermates (db(+/+)m). Animals were treated with rHuEPO (400 units/kg in 100 microl s.c.) or its vehicle alone (100 microl). Mice were killed on different days (3, 6, and 12 days after skin injury) for measurement of vascular endothelial growth factor (VEGF) mRNA expression and protein synthesis, for monitoring angiogenesis by CD31 expression, and for evaluating histological changes. Furthermore, we evaluated wound-breaking strength at day 12. At day 6, rHuEPO injection in diabetic mice resulted in an increase in VEGF mRNA expression (vehicle = 0.33 +/- 0.1 relative amount of mRNA; rHuEPO = 0.9 +/- 0.09 relative amount of mRNA; P < 0.05) and protein wound content (vehicle = 23 +/- 5 pg/wound; rHuEPO = 92 +/- 12 pg/wound; P < 0.05) and caused a marked increase in CD31 gene expression (vehicle = 0.18 +/- 0.05 relative amount of mRNA; rHuEPO = 0.98 +/- 0.21 relative amount of mRNA; P < 0.05) and protein synthesis. Furthermore, rHuEPO injection improved the impaired wound healing and, at day 12, increased the wound-breaking strength in diabetic mice (vehicle = 12 +/- 2 g/mm; rHuEPO 21 +/- 5 g/mm; P < 0.05). Erythropoietin may have a potential application in diabetes-related wound disorders.

  8. Investigation of an angiogenesis-promoting topical treatment for diabetic wounds using multimodal microscopy (Conference Presentation)

    Science.gov (United States)

    Li, Joanne; Bower, Andrew J.; Arp, Zane A.; Olson, Eric; Holland, Claire; Chaney, Eric J.; Marjanovic, Marina; Boppart, Stephen A.

    2016-02-01

    Impaired skin wound healing is a significant co-morbid condition of diabetes that is caused by poor microcirculation among other factors. Hypoxia-inducible factors (HIFs) are transcription factors that mediate the effects of decreased levels of oxygen in biological environments. Inducing mild hypoxia in the tissue could promote angiogenesis, a critical step in the wound healing process in diabetic wounds. To investigate the relationship between hypoxia and diabetic wound healing, a topical treatment consisting of a HIF-activating prolyl-hydroxylase inhibitor was administered to the wounded skin of diabetic (db/db) mice. Studies were conducted in accordance with the GSK Policy on the Care, Welfare and Treatment of Laboratory Animals and were reviewed at GSK or by the ethical review process at the institution where the work was performed. The wounded area was tracked in vivo for 28 days utilizing a custom-built multimodal microscopy system. An increase in vascular density around the wounds of treated animals was observed using phase-variance optical coherence tomography (PV-OCT), in comparison to normal controls. In addition, second harmonic generation (SHG) and fluorescence lifetime imaging microscopy (FLIM) were utilized to examine the collagen regeneration and cellular metabolic activity, respectively, in the wounded skin. The utilization of these light based methods can follow metabolic and morphologic changes in the wound healing process in ways not possible with current evaluation processes. Insights demonstrated in these studies could lead to new endpoints for evaluation of the efficacy of drugs and lead to more direct ways of detecting patient response to treatment.

  9. Innate defense regulator peptide 1018 in wound healing and wound infection.

    Directory of Open Access Journals (Sweden)

    Lars Steinstraesser

    Full Text Available Innate defense regulators (IDRs are synthetic immunomodulatory versions of natural host defense peptides (HDP. IDRs mediate protection against bacterial challenge in the absence of direct antimicrobial activity, representing a novel approach to anti-infective and anti-inflammatory therapy. Previously, we reported that IDR-1018 selectively induced chemokine responses and suppressed pro-inflammatory responses. As there has been an increasing appreciation for the ability of HDPs to modulate complex immune processes, including wound healing, we characterized the wound healing activities of IDR-1018 in vitro. Further, we investigated the efficacy of IDR-1018 in diabetic and non-diabetic wound healing models. In all experiments, IDR-1018 was compared to the human HDP LL-37 and HDP-derived wound healing peptide HB-107. IDR-1018 was significantly less cytotoxic in vitro as compared to either LL-37 or HB-107. Furthermore, administration of IDR-1018 resulted in a dose-dependent increase in fibroblast cellular respiration. In vivo, IDR-1018 demonstrated significantly accelerated wound healing in S. aureus infected porcine and non-diabetic but not in diabetic murine wounds. However, no significant differences in bacterial colonization were observed. Our investigation demonstrates that in addition to previously reported immunomodulatory activities IDR-1018 promotes wound healing independent of direct antibacterial activity. Interestingly, these effects were not observed in diabetic wounds. It is anticipated that the wound healing activities of IDR-1018 can be attributed to modulation of host immune pathways that are suppressed in diabetic wounds and provide further evidence of the multiple immunomodulatory activities of IDR-1018.

  10. Modern and Convensional Wound Dressing to Interleukin 1 and Interleukin 6 in Diabetic wound

    Directory of Open Access Journals (Sweden)

    Werna Nontji

    2015-04-01

    Full Text Available Introduction:Holistic wound care is one of the ways to prevent gangrene and amputation, modern wound dressing is more effective than convensional with increasing transforming growth factor and cytokine, especially interleukin. This study aims to identify the effectiveness of Modern and Convensional Wound Dressing to Interleukin 1 (IL-1 and Interleukin 6 (IL-6 in Diabetic wound. Method:A Quasi eksperimental pre-post with control group design was used. The intervention given was modern wound dressing and Control group by convensional wound dressing, This study was conducted in Makassar with 32 samples (16 in intervention group and 16 in control group. Result: The result of Pooled T- test showed that p = 0.00 (p < 0.05, it means that there was signifi cant correlation between modern wound dressing to IL-6 and IL-1 than Convensional wound dressing. Discussion: Process of wound healing was produced growth factor and cytokine (IL-1 and IL-6, it will stimulated by wound dressing, modern wound dressing (Calcium alginat can absorb wound drainage, non oklusive, non adhesif, and autolytic debridement. Keywords: Modern wound dressing, Interleukin 1 (IL-1, Interleukin 6 (IL-6

  11. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  12. Impaired degradation followed by enhanced recycling of epidermal growth factor receptor caused by hypo-phosphorylation of tyrosine 1045 in RBE cells

    International Nuclear Information System (INIS)

    Gui, Anping; Kobayashi, Akira; Motoyama, Hiroaki; Kitazawa, Masato; Takeoka, Michiko; Miyagawa, Shinichi

    2012-01-01

    Since cholangiocarcinoma has a poor prognosis, several epidermal growth factor receptor (EGFR)-targeted therapies with antibody or small molecule inhibitor treatment have been proposed. However, their effect remains limited. The present study sought to understand the molecular genetic characteristics of cholangiocarcinoma related to EGFR, with emphasis on its degradation and recycling. We evaluated EGFR expression and colocalization by immunoblotting and immunofluorescence, cell surface EGFR expression by fluorescence-activated cell sorting (FACS), and EGFR ubiquitination and protein binding by immunoprecipitation in the human cholangiocarcinoma RBE and immortalized cholangiocyte MMNK-1 cell lines. Monensin treatment and Rab11a depletion by siRNA were adopted for inhibition of EGFR recycling. Upon stimulation with EGF, ligand-induced EGFR degradation was impaired and the expression of phospho-tyrosine 1068 and phospho-p44/42 MAPK was sustained in RBE cells as compared with MMNK-1 cells. In RBE cells, the process of EGFR sorting for lysosomal degradation was blocked at the early endosome stage, and non-degradated EGFR was recycled to the cell surface. A disrupted association between EGFR and the E3 ubiquitin ligase c-Cbl, as well as hypo-phosphorylation of EGFR at tyrosine 1045 (Tyr1045), were also observed in RBE cells. In RBE cells, up-regulation of EGFR Tyr1045 phosphorylation is a potentially useful molecular alteration in EGFR-targeted therapy. The combination of molecular-targeted therapy determined by the characteristics of individual EGFR phosphorylation events and EGFR recycling inhibition show promise in future treatments of cholangiocarcinoma

  13. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  14. [Errors in wound management].

    Science.gov (United States)

    Filipović, Marinko; Novinscak, Tomislav

    2014-10-01

    Chronic ulcers have adverse effects on the patient quality of life and productivity, thus posing financial burden upon the healthcare system. Chronic wound healing is a complex process resulting from the interaction of the patient general health status, wound related factors, medical personnel skill and competence, and therapy related products. In clinical practice, considerable improvement has been made in the treatment of chronic wounds, which is evident in the reduced rate of the severe forms of chronic wounds in outpatient clinics. However, in spite of all the modern approaches, efforts invested by medical personnel and agents available for wound care, numerous problems are still encountered in daily practice. Most frequently, the problems arise from inappropriate education, of young personnel in particular, absence of multidisciplinary approach, and inadequate communication among the personnel directly involved in wound treatment. To perceive them more clearly, the potential problems or complications in the management of chronic wounds can be classified into the following groups: problems mostly related to the use of wound coverage and other etiology related specificities of wound treatment; problems related to incompatibility of the agents used in wound treatment; and problems arising from failure to ensure aseptic and antiseptic performance conditions.

  15. Ibuprofen loaded PLA nanofibrous scaffolds increase proliferation of human skin cells in vitro and promote healing of full thickness incision wounds in vivo.

    Science.gov (United States)

    Mohiti-Asli, M; Saha, S; Murphy, S V; Gracz, H; Pourdeyhimi, B; Atala, A; Loboa, E G

    2017-02-01

    This article presents successful incorporation of ibuprofen in polylactic acid (PLA) nanofibers to create scaffolds for the treatment of both acute and chronic wounds. Nanofibrous PLA scaffolds containing 10, 20, or 30 wt % ibuprofen were created and ibuprofen release profiles quantified. In vitro cytotoxicity to human epidermal keratinocytes (HEK) and human dermal fibroblasts (HDF) of the three scaffolds with varying ibuprofen concentrations were evaluated and compared to pure PLA nanofibrous scaffolds. Thereafter, scaffolds loaded with ibuprofen at the concentration that promoted human skin cell viability and proliferation (20 wt %) were evaluated in vivo in nude mice using a full thickness skin incision model to determine the ability of these scaffolds to promote skin regeneration and/or assist with scarless healing. Both acellular and HEK and HDF cell-seeded 20 wt % ibuprofen loaded nanofibrous bandages reduced wound contraction compared with wounds treated with Tegaderm™ and sterile gauze. Newly regenerated skin on wounds treated with cell-seeded 20 wt % ibuprofen bandages exhibited significantly greater blood vessel formation relative to acellular ibuprofen bandages. We have found that degradable anti-inflammatory scaffolds containing 20 wt % ibuprofen promote human skin cell viability and proliferation in vitro, reduce wound contraction in vivo, and when seeded with skin cells, also enhance new blood vessel formation. The approaches and results reported here hold promise for multiple skin tissue engineering and wound healing applications. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 327-339, 2017. © 2015 Wiley Periodicals, Inc.

  16. Wound treatment on a diabetic rat model by a 808 nm diode laser

    International Nuclear Information System (INIS)

    Lau, Pik Suan; Bidin, Noriah; Krishnan, Ganesan; AnaybBaleg, Sana Mohammed; Baktiar, Harzi; Marsin, Faridah M; Sum, Mohamad Bin Md; Nassir, Zaleha; Chong, Pek Lian; Hamid, Asmah

    2015-01-01

    This paper presents a study on the effect of laser irradiation on wound healing. 808 nm diode laser was employed to facilitate the healing of impaired wounds in experimental diabetes using a rat model. Diabetes was induced in male rats by a streptozotocin injection with a dose of 60 mg kg −1 . The disease was verified via measurement of the blood glucose level, which was set having 20 mmol L −1 stability. The rats were randomly distributed into two groups; one served as a control group and the other group was treated with the laser. The power density of the laser used was 0.5 W cm −2 and the wounds were treated for 8 d with the contact time of one second daily. The energy density used was 0.5 J cm −2 . The healing progress was recorded via a digital camera. The recorded images were then transferred into Inspector Matrox and image J programs for the accurate measurement of the healing area. The tissue details of the wound were studied through histology. The wound contraction rate of laser therapy group was found to be two times faster than control group. This indicates that the 808 nm diode laser can accelerate the wound healing process. (paper)

  17. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Profiling wound healing with wound effluent: Raman spectroscopic indicators of infection

    Science.gov (United States)

    Crane, Nicole J.; Elster, Eric A.

    2012-01-01

    The care of modern traumatic war wounds remains a significant challenge for clinicians. Many of the extremity wounds inflicted during Operation Enduring Freedom and Operation Iraqi Freedom are colonized or infected with multi-drug resistant organisms, particularly Acinetobacter baumannii. Biofilm formation and resistance to current treatments can significantly confound the wound healing process. Accurate strain identification and targeted drug administration for the treatment of wound bioburden has become a priority for combat casualty care. In this study, we use vibrational spectroscopy to examine wound exudates for bacterial load. Inherent chemical differences in different bacterial species and strains make possible the high specificity of vibrational spectroscopy.

  19. Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

    DEFF Research Database (Denmark)

    Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

    2013-01-01

    The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

  20. Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

    Science.gov (United States)

    Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

    2014-01-01

    Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

  1. Development and Characterisation of a Human Chronic Skin Wound Cell Line-Towards an Alternative for Animal Experimentation.

    Science.gov (United States)

    Caley, Matthew; Wall, Ivan B; Peake, Matthew; Kipling, David; Giles, Peter; Thomas, David W; Stephens, Phil

    2018-03-27

    Background : Chronic skin wounds are a growing financial burden for healthcare providers, causing discomfort/immobility to patients. Whilst animal chronic wound models have been developed to allow for mechanistic studies and to develop/test potential therapies, such systems are not good representations of the human chronic wound state. As an alternative, human chronic wound fibroblasts (CWFs) have permitted an insight into the dysfunctional cellular mechanisms that are associated with these wounds. However, such cells strains have a limited replicative lifespan and therefore a limited reproducibility/usefulness. Objectives : To develop/characterise immortalised cell lines of CWF and patient-matched normal fibroblasts (NFs). Methods and Results : Immortalisation with human telomerase resulted in both CWF and NF proliferating well beyond their replicative senescence end-point (respective cell strains senesced as normal). Gene expression analysis demonstrated that, whilst proliferation-associated genes were up-regulated in the cell lines (as would be expected), the immortalisation process did not significantly affect the disease-specific genotype. Immortalised CWF (as compared to NF) also retained a distinct impairment in their wound repopulation potential (in line with CWF cell strains). Conclusions : These novel CWF cell lines are a credible animal alternative and could be a valuable research tool for understanding both the aetiology of chronic skin wounds and for therapeutic pre-screening.

  2. Development and Characterisation of a Human Chronic Skin Wound Cell Line—Towards an Alternative for Animal Experimentation

    Science.gov (United States)

    Wall, Ivan B.; Peake, Matthew; Kipling, David; Giles, Peter; Thomas, David W.

    2018-01-01

    Background: Chronic skin wounds are a growing financial burden for healthcare providers, causing discomfort/immobility to patients. Whilst animal chronic wound models have been developed to allow for mechanistic studies and to develop/test potential therapies, such systems are not good representations of the human chronic wound state. As an alternative, human chronic wound fibroblasts (CWFs) have permitted an insight into the dysfunctional cellular mechanisms that are associated with these wounds. However, such cells strains have a limited replicative lifespan and therefore a limited reproducibility/usefulness. Objectives: To develop/characterise immortalised cell lines of CWF and patient-matched normal fibroblasts (NFs). Methods and Results: Immortalisation with human telomerase resulted in both CWF and NF proliferating well beyond their replicative senescence end-point (respective cell strains senesced as normal). Gene expression analysis demonstrated that, whilst proliferation-associated genes were up-regulated in the cell lines (as would be expected), the immortalisation process did not significantly affect the disease-specific genotype. Immortalised CWF (as compared to NF) also retained a distinct impairment in their wound repopulation potential (in line with CWF cell strains). Conclusions: These novel CWF cell lines are a credible animal alternative and could be a valuable research tool for understanding both the aetiology of chronic skin wounds and for therapeutic pre-screening. PMID:29584680

  3. Microsensor and transcriptomic signatures of oxygen depletion in biofilms associated with chronic wounds: Biofilms and oxygen

    Energy Technology Data Exchange (ETDEWEB)

    James, Garth A. [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Ge Zhao, Alice [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Usui, Marcia [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Underwood, Robert A. [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Nguyen, Hung [The Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University, Pullman Washington; Beyenal, Haluk [The Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University, Pullman Washington; deLancey Pulcini, Elinor [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Agostinho Hunt, Alessandra [Department of Microbiology and Molecular Genetics, 5180 Biomedical and Physical Sciences, Michigan State University, East Lansing Michigan; Bernstein, Hans C. [Pacific Northwest National Laboratory, Chemical and Biological Signature Science, Richland Washington; Fleckman, Philip [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Olerud, John [Division of Dermatology, Department of Medicine, University of Washington, Seattle Washington; Williamson, Kerry S. [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Franklin, Michael J. [Center for Biofilm Engineering, Montana State University, Bozeman Montana; Stewart, Philip S. [Center for Biofilm Engineering, Montana State University, Bozeman Montana

    2016-02-16

    Polymicrobial biofilms have been implicated in delayed wound healing, although the mechanisms by which biofilms impair wound healing are poorly understood. Many species of bacteria produce exotoxins and exoenzymes that may inhibit healing. In addition, oxygen consumption by biofilms may impede wound healing. In this study, we used oxygen microsensors to measure oxygen transects through in vitro-cultured biofilms, biofilms formed in vivo in a diabetic (db/db) mouse model, and ex vivo human chronic wound specimens. The results show that oxygen levels within both euthanized and live mouse wounds had steep gradients that reached minima ranging from 19 to 61% oxygen partial pressure, compared to atmospheric oxygen levels. The oxygen gradients in the mouse wounds were similar to those observed for clinical isolates cultured in vitro and for human ex vivo scabs. No oxygen gradients were observed for heat-killed scabs, suggesting that active metabolism by the viable bacteria contributed to the reduced oxygen partial pressure of the wounds. To characterize the metabolic activities of the bacteria in the mouse wounds, we performed transcriptomics analyses of Pseudomonas aeruginosa biofilms associated with the db/db mice wounds using Affymetrix microarrays. The results demonstrated that the bacteria expressed genes for metabolic activities associated with cell growth. Interestingly, the transcriptome results indicated that the bacteria within the wounds also experienced oxygen-limitation stress. Among the bacterial genes that were expressed in vivo were genes associated with the Anr-mediated hypoxia-stress response. Other bacterial stress response genes highly expressed in vivo were genes associated with stationary-phase growth, osmotic stress, and RpoH-mediated heat shock stress. Overall, the results support the hypothesis that the metabolic activities of bacteria in biofilms act as oxygen sinks in chronic wounds and that the depletion of oxygen contributes to the

  4. A new in vivo model using a dorsal skinfold chamber to investigate microcirculation and angiogenesis in diabetic wounds

    Directory of Open Access Journals (Sweden)

    Langer, Stefan

    2016-02-01

    Full Text Available Introduction: Diabetes mellitus describes a dysregulation of glucose metabolism due to improper insulin secretion, reduced insulin efficacy or both. It is a well-known fact that diabetic patients are likely to suffer from impaired wound healing, as diabetes strongly affects tissue angiogenesis. Until now, no satisfying in vivo murine model has been established to analyze the dynamics of angiogenesis during diabetic wound healing. To help understand the pathophysiology of diabetes and its effect on angiogenesis, a novel in vivo murine model was established using the skinfold chamber in mice.Materials and Methods: Mutant diabetic mice (db; wildtype mice ( and laboratory BALB/c mice were examined. They were kept in single cages with access to laboratory chow with an 12/12 hour day/night circle. Lesions of the panniculus muscle (Ø 2 mm were created in the center of the transparent window chamber and the subsequent muscular wound healing was then observed for a period of 22 days. Important analytic parameters included vessel diameter, red blood cell velocity, vascular permeability, and leakage of muscle capillaries and post capillary venules. The key parameters were functional capillary density (FCD and angiogenesis positive area (APA.Results: We established a model which allows high resolution in vivo imaging of functional angiogenesis in diabetic wounds. As expected, db mice showed impaired wound closure (day 22 compared to wounds of BALB/c or WT mice (day 15. FCD was lower in diabetic mice compared to WT and BALB/c during the entire observation period. The dynamics of angiogenesis also decreased in db mice, as reflected by the lowest APA levels. Significant variations in the skin buildup were observed, with the greatest skin depth in db mice. Furthermore, in db mice, the dermis:subcutaneous ratio was highly shifted towards the subcutaneous layers as opposed to WT or BALB/c mice.Conclusion: Using this new in vivo model of the skinfold chamber, it

  5. Platelets Regulate the Migration of Keratinocytes via Podoplanin/CLEC-2 Signaling during Cutaneous Wound Healing in Mice.

    Science.gov (United States)

    Asai, Jun; Hirakawa, Satoshi; Sakabe, Jun-ichi; Kishida, Tsunao; Wada, Makoto; Nakamura, Naomi; Takenaka, Hideya; Mazda, Osam; Urano, Tetsumei; Suzuki-Inoue, Katsue; Tokura, Yoshiki; Katoh, Norito

    2016-01-01

    Podoplanin is an endogenous ligand for C-type lectin-like receptor 2 (CLEC-2), which is expressed on platelets. Recent evidence indicates that this specific marker of lymphatic endothelial cells is also expressed by keratinocytes at the edge of wounds. However, whether podoplanin or platelets play a role in keratinocyte activity during wound healing remains unknown. We evaluated the effect of podoplanin expression levels on keratinocyte motility using cultured primary normal human epidermal keratinocytes (NHEKs). Down-regulation of podoplanin in NHEKs via transfection with podoplanin siRNA inhibited their migration, indicating that podoplanin plays a mandatory role in this process. In addition, down-regulation of podoplanin was correlated with up-regulation of E-cadherin, suggesting that podoplanin-mediated stimulation of keratinocyte migration is associated with a loss of E-cadherin. Both the addition of platelets and treatment with CLEC-2 inhibited the migration of NHEKs. The down-regulation of RhoA activity and the up-regulation of E-cadherin in keratinocytes were also induced by CLEC-2. In conclusion, these results suggest that podoplanin/CLEC-2 signaling regulates keratinocyte migration via modulating E-cadherin expression through RhoA signaling. Altering the regulation of keratinocyte migration by podoplanin might be a novel therapeutic approach to improve wound healing. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  6. Proteolytic signatures define unique thrombin-derived peptides present in human wound fluid in vivo.

    Science.gov (United States)

    Saravanan, Rathi; Adav, Sunil S; Choong, Yeu Khai; van der Plas, Mariena J A; Petrlova, Jitka; Kjellström, Sven; Sze, Siu Kwan; Schmidtchen, Artur

    2017-10-13

    The disease burden of failing skin repair and non-healing ulcers is extensive. There is an unmet need for new diagnostic approaches to better predict healing activity and wound infection. Uncontrolled and excessive protease activity, of endogenous or bacterial origin, has been described as a major contributor to wound healing impairments. Proteolytic peptide patterns could therefore correlate and "report" healing activity and infection. This work describes a proof of principle delineating a strategy by which peptides from a selected protein, human thrombin, are detected and attributed to proteolytic actions. With a particular focus on thrombin-derived C-terminal peptides (TCP), we show that distinct peptide patterns are generated in vitro by the human S1 peptidases human neutrophil elastase and cathepsin G, and the bacterial M4 peptidases Pseudomonas aeruginosa elastase and Staphylococcus aureus aureolysin, respectively. Corresponding peptide sequences were identified in wound fluids from acute and non-healing ulcers, and notably, one peptide, FYT21 (FYTHVFRLKKWIQKVIDQFGE), was only present in wound fluid from non-healing ulcers colonized by P. aeruginosa and S. aureus. Our result is a proof of principle pointing at the possibility of defining peptide biomarkers reporting distinct proteolytic activities, of potential implication for improved diagnosis of wound healing and infection.

  7. Chitosan preparations for wounds and burns: antimicrobial and wound-healing effects

    Science.gov (United States)

    Dai, Tianhong; Tanaka, Masamitsu; Huang, Ying-Ying; Hamblin, Michael R

    2011-01-01

    Since its discovery approximately 200 years ago, chitosan, as a cationic natural polymer, has been widely used as a topical dressing in wound management owing to its hemostatic, stimulation of healing, antimicrobial, nontoxic, biocompatible and biodegradable properties. This article covers the antimicrobial and wound-healing effects of chitosan, as well as its derivatives and complexes, and its use as a vehicle to deliver biopharmaceuticals, antimicrobials and growth factors into tissue. Studies covering applications of chitosan in wounds and burns can be classified into in vitro, animal and clinical studies. Chitosan preparations are classified into native chitosan, chitosan formulations, complexes and derivatives with other substances. Chitosan can be used to prevent or treat wound and burn infections not only because of its intrinsic antimicrobial properties, but also by virtue of its ability to deliver extrinsic antimicrobial agents to wounds and burns. It can also be used as a slow-release drug-delivery vehicle for growth factors to improve wound healing. The large number of publications in this area suggests that chitosan will continue to be an important agent in the management of wounds and burns. PMID:21810057

  8. Telemedicine for wound management

    Directory of Open Access Journals (Sweden)

    Ravi K Chittoria

    2012-01-01

    Full Text Available The escalating physiological, psychological, social and financial burdens of wounds and wound care on patients, families and society demand the immediate attention of the health care sector. Many forces are affecting the changes in health care provision for patients with chronic wounds, including managed care, the limited number of wound care therapists, an increasingly ageing and disabled population, regulatory and malpractice issues, and compromised care. The physician is also faced with a number of difficult issues when caring for chronic wound patients because their conditions are time consuming and high risk, represent an unprofitable part of care practice and raise issues of liability. Telemedicine enhances communication with the surgical wound care specialist. Digital image for skin lesions is a safe, accurate and cost-effective referral pathway. The two basic modes of telemedicine applications, store and forward (asynchronous transfer and real-time transmission (synchronous transfer, e.g. video conference, are utilized in the wound care setting. Telemedicine technology in the hands of an experienced physician can streamline management of a problem wound. Although there is always an element of anxiety related to technical change, the evolution of wound care telemedicine technology has demonstrated a predictable maturation process.

  9. Anti-aging pharmacology in cutaneous wound healing: effects of metformin, resveratrol, and rapamycin by local application.

    Science.gov (United States)

    Zhao, Pan; Sui, Bing-Dong; Liu, Nu; Lv, Ya-Jie; Zheng, Chen-Xi; Lu, Yong-Bo; Huang, Wen-Tao; Zhou, Cui-Hong; Chen, Ji; Pang, Dan-Lin; Fei, Dong-Dong; Xuan, Kun; Hu, Cheng-Hu; Jin, Yan

    2017-10-01

    Cutaneous wounds are among the most common soft tissue injuries and are particularly hard to heal in aging. Caloric restriction (CR) is well documented to extend longevity; pharmacologically, profound rejuvenative effects of CR mimetics have been uncovered, especially metformin (MET), resveratrol (RSV), and rapamycin (RAPA). However, locally applied impacts and functional differences of these agents on wound healing remain to be established. Here, we discovered that chronic topical administration of MET and RSV, but not RAPA, accelerated wound healing with improved epidermis, hair follicles, and collagen deposition in young rodents, and MET exerted more profound effects. Furthermore, locally applied MET and RSV improved vascularization of the wound beds, which were attributed to stimulation of adenosine monophosphate-activated protein kinase (AMPK) pathway, the key mediator of wound healing. Notably, in aged skin, AMPK pathway was inhibited, correlated with impaired vasculature and reduced healing ability. As therapeutic approaches, local treatments of MET and RSV prevented age-related AMPK suppression and angiogenic inhibition in wound beds. Moreover, in aged rats, rejuvenative effects of topically applied MET and RSV on cell viability of wound beds were confirmed, of which MET showed more prominent anti-aging effects. We further verified that only MET promoted wound healing and cutaneous integrity in aged skin. These findings clarified differential effects of CR-based anti-aging pharmacology in wound healing, identified critical angiogenic and rejuvenative mechanisms through AMPK pathway in both young and aged skin, and unraveled chronic local application of MET as the optimal and promising regenerative agent in treating cutaneous wound defects. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  10. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  11. Epithelial-Mesenchymal Transition in Tissue Repair and Fibrosis

    Science.gov (United States)

    Stone, Rivka C.; Pastar, Irena; Ojeh, Nkemcho; Chen, Vivien; Liu, Sophia; Garzon, Karen I.; Tomic-Canic, Marjana

    2016-01-01

    Epithelial-mesenchymal transition (EMT) describes the global process by which stationary epithelial cells undergo phenotypic changes, including loss of cell-cell adhesion and apical-basal polarity, and acquire mesenchymal characteristics which confer migratory capacity. EMT and its converse, MET (mesenchymal-to-epithelial transition), are integral stages of many physiologic processes, and as such are tightly coordinated by a host of molecular regulators. Converging lines of evidence have identified EMT as a component of cutaneous wound healing, during which otherwise stationary keratinocytes - the resident skin epithelial cells - migrate across the wound bed to restore the epidermal barrier. Moreover, EMT also plays a role in the development of scarring and fibrosis, as the matrix-producing myofibroblast arises from cells of epithelial lineage in response to injury but is pathologically sustained instead of undergoing MET or apoptosis. In this review, we summarize the role of EMT in physiologic repair and pathologic fibrosis of tissues and organs. We conclude that further investigation into the contribution of EMT to the impaired repair of fibrotic wounds may identify components of EMT signaling as common therapeutic targets for impaired healing in many tissues. PMID:27461257

  12. Rapid hemostatic and mild polyurethane-urea foam wound dressing for promoting wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xiangyu; Niu, Yuqing [College of Materials Science and Engineering, Shenzhen University, Shenzhen 518060 (China); Nanshan District Key lab for Biopolymers and Safety Evaluation, Shenzhen 518060 (China); Shenzhen Key Laboratory of Polymer Science and Technology, Shenzhen 518060 (China); Guangdong Research Center for Interfacial Engineering of Functional Materials, Shenzhen 518060 (China); Chen, Kevin C. [Multidisciplinary Research Center, Shantou University, Shantou, Guangdong 515063 (China); Chen, Shiguo, E-mail: csg@szu.edu.cn [College of Materials Science and Engineering, Shenzhen University, Shenzhen 518060 (China); Nanshan District Key lab for Biopolymers and Safety Evaluation, Shenzhen 518060 (China); Shenzhen Key Laboratory of Polymer Science and Technology, Shenzhen 518060 (China); Guangdong Research Center for Interfacial Engineering of Functional Materials, Shenzhen 518060 (China)

    2017-02-01

    A novel rapid hemostatic and mild polyurethane-urea foam (PUUF) wound dressing was prepared by the particle leaching method and vacuum freeze-drying method using 4, 4-Methylenebis(cyclohexyl isocyanate), 4,4-diaminodicyclohexylmethane and poly (ethylene glycol) as raw materials. And X-ray diffraction (XRD), tensile test, differential scanning calorimetry (DSC) and thermogravimetry (TG) were used to its crystallinity, stress and strain behavior, and thermal properties, respectively. Platelet adhesion, fibrinogen adhesion and blood clotting were performed to evaluate its hemostatic effect. And H&E staining and Masson Trichrome staining were used to its wound healing efficacy. The results revealed the pore size of PUUF is 50–130 μm, and its porosity is 71.01%. Porous PUUF exhibited good water uptake that was benefit to adsorb abundant wound exudates to build a regional moist environment beneficial for wound healing. The PUUF wound dressing exhibit better blood coagulation effect than commercial polyurethane dressing (CaduMedi). Though both PUUF and CaduMedi facilitated wound healing generating full re-epithelialization within 13 days, PUUF was milder and lead to more slight inflammatory response than CaduMedi. In addition, PUUF wound dressing exhibited lower cytotoxicity than CaduMedi against NIH3T3 cells. Overall, porous PUUF represents a novel mild wound dressing with excellent water uptake, hemostatic effect and low toxicity, and it can promote wound healing and enhance re-epithelialization. - Highlights: • Rapid hemostatic and mild PUUF wound dressing was fabricated. • Low-toxic PUUF exhibited good water uptake that could build a regional moist environment beneficial for wound healing. • PUUF could promote wound healing and enhance re-epithelialization.

  13. A multi-centre clinical evaluation of reactive oxygen topical wound gel in 114 wounds.

    Science.gov (United States)

    Dryden, M; Dickinson, A; Brooks, J; Hudgell, L; Saeed, K; Cutting, K F

    2016-03-01

    This article reports the outcomes of the use of Surgihoney RO (SHRO), topical wound dressing in a multi-centre, international setting. The aims were to explore the clinical effects of SHRO, including a reduction in bacterial load and biofilm and improvement in healing in a variety of challenging non-healing and clinically infected wounds. This was a non-comparative evaluation, where both acute and chronic wounds with established delayed healing were treated with the dressing. Clinicians prospectively recorded wound improvement or deterioration, level of wound exudate, presence of pain, and presence of slough and necrosis. Analysis of this data provided information on clinical performance of the dressing. Semi-quantitative culture to assess bacterial bioburden was performed where possible. We recruited 104 patients, mean age 61 years old, with 114 wounds. The mean duration of wounds before treatment was 3.7 months and the mean duration of treatment was 25.7 days. During treatment 24 wounds (21%) healed and the remaining 90 (79%) wounds improved following application of the dressing. No deterioration in any wound was observed. A reduction in patient pain, level of wound exudate and in devitalised tissue were consistently reported. These positive improvements in wound progress were reflected in the wound cultures that showed a reduction in bacterial load in 39 out of the 40 swabs taken. There were two adverse events recorded: a stinging sensation following application of the dressing was experienced by 2 patients, and 2 elderly patients died of causes unrelated to the dressing or to the chronic wound. These patients' wounds and their response to SHRO have been included in the analysis. SHRO was well tolerated and shows great promise as an effective potent topical antimicrobial in the healing of challenging wounds. Matthew Dryden has become a shareholder in Matoke Holdings, the manufacturer of Surgihoney RO, since the completion of this study. Keith Cutting is a

  14. Wound healing and all-cause mortality in 958 wound patients treated in home care

    DEFF Research Database (Denmark)

    Zarchi, Kian; Martinussen, Torben; Jemec, Gregor B. E.

    2015-01-01

    to investigate wound healing and all-cause mortality associated with different types of skin wounds. Consecutive skin wound patients who received wound care by home-care nurses from January 2010 to December 2011 in a district in Eastern Denmark were included in this study. Patients were followed until wound...... healing, death, or the end of follow-up on December 2012. In total, 958 consecutive patients received wound care by home-care nurses, corresponding to a 1-year prevalence of 1.2% of the total population in the district. During the study, wound healing was achieved in 511 (53.3%), whereas 90 (9.4%) died...

  15. Increased expression of endosomal members of toll-like receptor family abrogates wound healing in patients with type 2 diabetes mellitus.

    Science.gov (United States)

    Singh, Kanhaiya; Agrawal, Neeraj K; Gupta, Sanjeev K; Mohan, Gyanendra; Chaturvedi, Sunanda; Singh, Kiran

    2016-10-01

    The inflammatory phase of wound healing cascade is an important determinant of the fate of the wound. Acute inflammation is necessary to initiate proper wound healing, while chronic inflammation abrogates wound healing. Different endosomal members of toll-like receptor (TLR) family initiate inflammatory signalling via a range of different inflammatory mediators such as interferons, internal tissue damaged-associated molecular patterns (DAMPs) and hyperactive effector T cells. Sustained signalling of TLR9 and TLR7 contributes to chronic inflammation by activating the plasmacytoid dendritic cells. Diabetic wounds are also characterised by sustained inflammatory phase. The objective of this study was to analyse the differential expression of endosomal TLRs in human diabetic wounds compared with control wounds. We analysed the differential expression of TLR7 and TLR9 both at transcriptional and translational levels in wounds of 84 patients with type 2 diabetes mellitus (T2DM) and 6 control subjects without diabetes using quantitative real-time polymerase chain reaction (RT-PCR), western blot and immunohistochemistry. TLR7 and TLR9 were significantly up-regulated in wounds of the patients with T2DM compared with the controls and were dependent on the infection status of the diabetic wounds, and wounds with microbial infection exhibited lower expression levels of endosomal TLRs. Altered endosomal TLR expression in T2DM subjects might be associated with wound healing impairment. © 2015 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

  16. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  17. Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

    International Nuclear Information System (INIS)

    Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

    2006-01-01

    Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

  18. Psoriasis and wound healing outcomes: A retrospective cohort study examining wound complications and antibiotic use.

    Science.gov (United States)

    Young, Paulina M; Parsi, Kory K; Schupp, Clayton W; Armstrong, April W

    2017-11-15

    Little is known about wound healing in psoriasis. We performed a cohort study examining differences in wound healing complications between patients with and without psoriasis. Psoriasis patients with traumatic wounds were matched 1:3 to non-psoriasis patients with traumatic wounds based on age, gender, and body mass index (BMI). We examined theincidence of wound complications including infection, necrosis, and hematoma as well as incident antibiotic use within three months following diagnosis of a traumatic wound. The study included 164 patients with traumatic wounds, comprised of 41 patients with psoriasis matched to 123 patients without psoriasis. No statistically significant differences were detected in the incidence of overall wound complications between wound patients with psoriasis and wound patients without psoriasis (14.6% versus. 13.0%, HR 1.18, CI 0.39-3.56). After adjustment for diabetes, peripheral vascular disease, and smoking, no statistically significant differences were detected in the incidence of overall wound complications between patients with and without psoriasis (HR 1.11, CI 0.34-3.58). Specifically, the adjusted rates of antibiotic use were not significantly different between those with and without psoriasis (HR 0.65, CI 0.29-1.46). The incidence of wound complications following traumatic wounds of the skin was found to be similar between patients with and without psoriasis.

  19. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  20. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  1. Upregulation of CREM/ICER suppresses wound endothelial CRE-HIF-1α-VEGF-dependent signaling and impairs angiogenesis in type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Milad S. Bitar

    2015-01-01

    Full Text Available Impaired angiogenesis and endothelial dysfunction in type 2 diabetes constitute dominant risk factors for non-healing wounds and most forms of cardiovascular disease. We propose that diabetes shifts the ‘angiogenic balance’ in favor of an excessive anti-angiogenic phenotype. Herein, we report that diabetes impairs in vivo sponge angiogenic capacity by decreasing VEGF expression and fibrovascular invasion, and reciprocally enhances the formation of angiostatic molecules, such as thrombospondins, NFκB and FasL. Defective in vivo angiogenesis prompted cellular studies in cultured endothelial cells derived from subcutaneous sponge implants (SIECs of control and Goto-Kakizaki rats. Ensuing data from diabetic SIECs demonstrated a marked upregulation in cAMP-PKA-CREB signaling, possibly stemming from increased expression of adenylyl cyclase isoforms 3 and 8, and decreased expression of PDE3. Mechanistically, we found that oxidative stress and PKA activation in diabetes enhanced CREM/ICER expression. This reduces IRS2 cellular content by inhibiting cAMP response element (CRE transcriptional activity. Consequently, a decrease in the activity of Akt-mTOR ensued with a concomitant reduction in the total and nuclear protein levels of HIF-1α. Limiting HIF-1α availability for the specific hypoxia response elements in diabetic SIECs elicited a marked reduction in VEGF expression, both at the mRNA and protein levels. These molecular abnormalities were illustrated functionally by a defect in various pro-angiogenic properties, including cell proliferation, migration and tube formation. A genetic-based strategy in diabetic SIECs using siRNAs against CREM/ICER significantly augmented the PKA-dependent VEGF expression. To this end, the current data identify the importance of CREM/ICER as a negative regulator of endothelial function and establish a link between CREM/ICER overexpression and impaired angiogenesis during the course of diabetes. Moreover, it could

  2. Animal models of chronic wound care: the application of biofilms in clinical research

    Directory of Open Access Journals (Sweden)

    Trøstrup H

    2016-11-01

    Full Text Available Hannah Trøstrup,1 Kim Thomsen,1 Henrik Calum,2 Niels Høiby,1,3 Claus Moser1 1Department of Clinical Microbiology, Copenhagen University Hospital, Rigshospitalet, 2Department of Clinical Microbiology, Copenhagen University Hospital, Hvidovre, 3Institute for Immunology and Microbiology, University of Copenhagen, Copenhagen, Denmark Abstract: Chronic wounds are a substantial clinical problem affecting millions of people worldwide. Pathophysiologically, chronic wounds are stuck in the inflammatory state of healing. The role of bacterial biofilms in suppression and perturbation of host response could be an explanation for this observation. An inhibiting effect of bacterial biofilms on wound healing is gaining significant clinical attention over the last few years. There is still a paucity of suitable animal models to recapitulate human chronic wounds. The etiology of the wound (venous insufficiency, ischemia, diabetes, pressure has to be taken into consideration as underlying pathophysiological mechanisms and comorbidities display tremendous variation in humans. Confounders such as infection, smoking, chronological age, sex, medication, metabolic disturbances, and renal impairment add to the difficulty in gaining systematic and comparable studies on nonhealing wounds. Relevant hypotheses based on clinical or in vitro observations can be tested in representative animal models, which provide crucial tools to uncover the pathophysiology of cutaneous skin repair in infectious environments. Disposing factors, species of the infectious agent(s, and time of establishment of the infection are well defined in suitable animal models. In addition, several endpoints can be involved for evaluation. Animals do not display chronic wounds in the way that humans do. However, in many cases, animal models can mirror the pathological conditions observed in humans, although discrepancies between human and animal wound repair are obvious. The use of animal models should

  3. Administration of Menadione, Vitamin K3, Ameliorates Off-Target Effects on Corneal Epithelial Wound Healing Due to Receptor Tyrosine Kinase Inhibition.

    Science.gov (United States)

    Rush, Jamie S; Bingaman, David P; Chaney, Paul G; Wax, Martin B; Ceresa, Brian P

    2016-11-01

    The antiangiogenic receptor tyrosine kinase inhibitor (RTKi), 3-[(4-bromo-2,6-difluorophenyl)methoxy]-5-[[[[4-(1-pyrrolidinyl) butyl] amino] carbonyl]amino]-4-isothiazolecarboxamide hydrochloride, targets VEGFR2 (half maximal inhibitory concentration [IC50] = 11 nM); however, off-target inhibition of epidermal growth factor receptor (EGFR) occurs at higher concentrations. (IC50 = 5.8 μM). This study was designed to determine the effect of topical RTKi treatment on EGF-mediated corneal epithelial wound healing and to develop new strategies to minimize off-target EGFR inhibition. In vitro corneal epithelial wound healing was measured in response to EGF using a transformed human cell line (hTCEpi cells). In vivo corneal wound healing was assessed using a murine model. In these complementary assays, wound healing was measured in the presence of varying RTKi concentrations. Immunoblot analysis was used to examine EGFR and VEGFR2 phosphorylation and the kinetics of EGFR degradation. An Alamar Blue assay measured VEGFR2-mediated cell biology. Receptor tyrosine kinase inhibitor exposure caused dose-dependent inhibition of EGFR-mediated corneal epithelial wound healing in vitro and in vivo. Nanomolar concentrations of menadione, a vitamin K3 analog, when coadministered with the RTKi, slowed EGFR degradation and ameliorated the inhibitory effects on epithelial wound healing both in vitro and in vivo. Menadione did not alter the RTKi's IC50 against VEGFR2 phosphorylation or its inhibition of VEGF-induced retinal endothelial cell proliferation. An antiangiogenic RTKi exhibited off-target effects on the corneal epithelium that can be minimized by menadione without deleteriously affecting its on-target VEGFR2 blockade. These data indicate that menadione has potential as a topical supplement for individuals suffering from perturbations in corneal epithelial homeostasis, especially as an untoward side effect of kinase inhibitors.

  4. Immune sensitization against epidermal antigens in polymorphous light eruption

    International Nuclear Information System (INIS)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

  5. Thermal injury induces impaired function in polymorphonuclear neutrophil granulocytes and reduced control of burn wound infection

    DEFF Research Database (Denmark)

    Calum, H.; Moser, C.; Jensen, P. O.

    2009-01-01

    Severe thermal injury induces immunosuppression, involving all parts of the immune system, especially when large fractions of the total body surface area are affected. An animal model was established to characterize the burn-induced immunosuppression. In our novel mouse model a 6% third-degree burn...... injury was induced in mice with a hot-air blower. The third-degree burn was confirmed histologically. The mice were allocated into five groups: control, shave, burn, infection and burn infection group. At 48 h, a decline in the concentration of peripheral blood leucocytes was observed in the group...... of mice with burn wound. The reduction was ascribed to the decline in concentration of polymorphonuclear neutrophil leucocytes and monocytes. When infecting the skin with Pseudomonas aeruginosa, a dissemination of bacteria was observed only in the burn wound group. Histological characterization...

  6. Molecular pathology of wound healing.

    Science.gov (United States)

    Kondo, Toshikazu; Ishida, Yuko

    2010-12-15

    Skin-wound healing is an orchestrated biological phenomena consisting of three sequential phases, inflammation, proliferation, and maturation. Many biological substances are involved in the process of wound repair, and this short and simplified overview of wound healing can be adopted to determine wound vitality or wound age in forensic medicine. With the development of genetically engineered animals, essential molecules for skin-wound healing have been identified. Especially, cytokines, and growth factors are useful candidates and markers for the determination of wound vitality or age. Moreover, bone marrow-derived progenitor cells would give significant information to wound age determination. In this review article, some interesting observations are presented, possibly contributing to the future practice of forensic pathologists. Copyright © 2010. Published by Elsevier Ireland Ltd.

  7. Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

    African Journals Online (AJOL)

    Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

  8. Accelerated in vivo wound healing evaluation of microbial glycolipid containing ointment as a transdermal substitute.

    Science.gov (United States)

    Gupta, Sonam; Raghuwanshi, Navdeep; Varshney, Ritu; Banat, I M; Srivastava, Amit Kumar; Pruthi, Parul A; Pruthi, Vikas

    2017-10-01

    A potent biosurfactant (BS) producing Bacillus licheniformis SV1 (NCBI GenBank Accession No. KX130852) was isolated from oil contaminated soil sample. Physicochemical investigations (TLC, HPLC, FTIR, GC-MS and NMR) revealed it to be glycolipid in nature. Fibroblast culture assay showed cytocompatibility and increased cell proliferation of 3T3/NIH fibroblast cells treated with this biosurfactant when checked using MTT assay and DAPI fluorescent staining. To evaluate the wound healing potential, BS ointment was formulated and checked for its spreadability and viscosity consistency. In vivo wound healing examination of full thickness skin excision wound rat model demonstrated the prompt re-epithelialization and fibroblast cell proliferation in the early phase while quicker collagen deposition in later phases of wound healing when BS ointment was used. These results validated the potential usage of BS ointment as a transdermal substitute for faster healing of impaired skin wound. Biochemical evaluation also substantiated the highest concentration of hydroxyproline (32.18±0.46, ptreated animal tissue samples compared to the control. Hematoxylin-Eosin (H&E) and Masson's Trichrome staining validated the presence of increased amount of collagen fibers and blood vessels in the test animals treated with BS ointment. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Comparison of conventional gauze therapy with vacuum assisted closure wound therapy in acute traumatic wounds

    International Nuclear Information System (INIS)

    Naqvi, S.H.; Jalil, M.; Butt, Q.; Malik, Z.U

    2013-01-01

    Objective: To compare the Vacuum Assisted Closure (Vac) wound therapy with Conventional Gauze Therapy (CGT) in management of acute traumatic wounds on the basis of time taken to achieve a vital red wound ready for definitive surgical closure. Study Design: Randomized control trial. Place and Duration of Study: Department of Surgery Combined Military Hospital Rawalpindi from Mar 2009 to Sep 2009. Patients and Methods: This study included 82 patients of acute traumatic wounds. Patients were randomly allotted to group A, in which wound was treated with new method of vacuum assisted closure (VAC) wound therapy and to group B, in which wound was managed by conventional gauze therapy (CGT). Outcomes were measured by the presence of vital red wound ready to be closed by surgical intervention. Patients with concomitant systemic pathology were not included in study. Results: Comparison between the two groups revealed mean time for wound healing 13 days in group A and 16.9 days in group B with significant difference (p value =0.029). Conclusion: Vacuum assisted closure wound therapy is an effective method in reducing time of wound healing for definitive surgical closure. (author)

  10. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  11. Wound Disruption Following Colorectal Operations.

    Science.gov (United States)

    Moghadamyeghaneh, Zhobin; Hanna, Mark H; Carmichael, Joseph C; Mills, Steven; Pigazzi, Alessio; Nguyen, Ninh T; Stamos, Michael J

    2015-12-01

    Postoperative wound disruption is associated with high morbidity and mortality. We sought to identify the risk factors and outcomes of wound disruption following colorectal resection. The American College of Surgeons National Surgical Quality Improvement Program (NSQIP) database was used to examine the clinical data of patients who underwent colorectal resection from 2005 to 2013. Multivariate regression analysis was performed to identify risk factors of wound disruption. We sampled a total of 164,297 patients who underwent colorectal resection. Of these, 2073 (1.3 %) had wound disruption. Patients with wound disruption had significantly higher mortality (5.1 vs. 1.9 %, AOR: 1.46, P = 0.01). The highest risk of wound disruption was seen in patients with wound infection (4.8 vs. 0.9 %, AOR: 4.11, P disruption such as chronic steroid use (AOR: 1.71, P disruption compared to open surgery (AOR: 0.61, P disruption occurs in 1.3 % of colorectal resections, and it correlates with mortality of patients. Wound infection is the strongest predictor of wound disruption. Chronic steroid use, obesity, severe COPD, prolonged operation, non-elective admission, and serum albumin level are strongly associated with wound disruption. Utilization of the laparoscopic approach may decrease the risk of wound disruption when possible.

  12. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  13. Predicting complex acute wound healing in patients from a wound expertise centre registry: a prognostic study.

    Science.gov (United States)

    Ubbink, Dirk T; Lindeboom, Robert; Eskes, Anne M; Brull, Huub; Legemate, Dink A; Vermeulen, Hester

    2015-10-01

    It is important for caregivers and patients to know which wounds are at risk of prolonged wound healing to enable timely communication and treatment. Available prognostic models predict wound healing in chronic ulcers, but not in acute wounds, that is, originating after trauma or surgery. We developed a model to detect which factors can predict (prolonged) healing of complex acute wounds in patients treated in a large wound expertise centre (WEC). Using Cox and linear regression analyses, we determined which patient- and wound-related characteristics best predict time to complete wound healing and derived a prediction formula to estimate how long this may take. We selected 563 patients with acute wounds, documented in the WEC registry between 2007 and 2012. Wounds had existed for a median of 19 days (range 6-46 days). The majority of these were located on the leg (52%). Five significant independent predictors of prolonged wound healing were identified: wound location on the trunk [hazard ratio (HR) 0·565, 95% confidence interval (CI) 0·405-0·788; P = 0·001], wound infection (HR 0·728, 95% CI 0·534-0·991; P = 0·044), wound size (HR 0·993, 95% CI 0·988-0·997; P = 0·001), wound duration (HR 0·998, 95% CI 0·996-0·999; P = 0·005) and patient's age (HR 1·009, 95% CI 1·001-1·018; P = 0·020), but not diabetes. Awareness of the five factors predicting the healing of complex acute wounds, particularly wound infection and location on the trunk, may help caregivers to predict wound healing time and to detect, refer and focus on patients who need additional attention. © 2013 The Authors. International Wound Journal © 2013 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

  14. Cellular dysfunction in the diabetic fibroblast: impairment in migration, vascular endothelial growth factor production, and response to hypoxia.

    Science.gov (United States)

    Lerman, Oren Z; Galiano, Robert D; Armour, Mary; Levine, Jamie P; Gurtner, Geoffrey C

    2003-01-01

    Although it is known that systemic diseases such as diabetes result in impaired wound healing, the mechanism for this impairment is not understood. Because fibroblasts are essential for wound repair, we compared the in vitro behavior of fibroblasts cultured from diabetic, leptin receptor-deficient (db/db) mice with wild-type fibroblasts from mice of the same genetic background in processes important during tissue repair. Adult diabetic mouse fibroblast migration exhibited a 75% reduction in migration compared to normal fibroblasts (P under basal or hypoxic conditions, confirming that the results from db/db fibroblasts in mature mice resulted from the diabetic state and were not because of alterations in the leptin-leptin receptor axis. Markers of cellular viability including proliferation and senescence were not significantly different between diabetic and wild-type fibroblasts. We conclude that, in vitro, diabetic fibroblasts show selective impairments in discrete cellular processes critical for tissue repair including cellular migration, VEGF production, and the response to hypoxia. The VEGF abnormalities developed concurrently with the onset of hyperglycemia and were not seen in normoglycemic, leptin receptor-deficient db/db mice. These observations support a role for fibroblast dysfunction in the impaired wound healing observed in human diabetics, and also suggest a mechanism for the poor clinical outcomes that occur after ischemic injury in diabetic patients.

  15. Low levels of glutathione are sufficient for survival of keratinocytes after UV irradiation and for healing of mouse skin wounds.

    Science.gov (United States)

    Telorack, Michèle; Abplanalp, Jeannette; Werner, Sabine

    2016-08-01

    Reduced levels of the cellular antioxidant glutathione are associated with premature skin aging, cancer and impaired wound healing, but the in vivo functions of glutathione in the skin remain largely unknown. Therefore, we analyzed mice lacking the modifier subunit of the glutamate cysteine ligase (Gclm), the enzyme that catalyzes the rate-limiting step of glutathione biosynthesis. Glutathione levels in the skin of these mice were reduced by 70 %. However, neither skin development and homeostasis, nor UVA- or UVB-induced apoptosis in the epidermis were affected. Histomorphometric analysis of excisional wounds did not reveal wound healing abnormalities in young Gclm-deficient mice, while the area of hyperproliferative epithelium as well as keratinocyte proliferation were affected in aged mice. These findings suggest that low levels of glutathione are sufficient for wound repair in young mice, but become rate-limiting upon aging.

  16. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  17. A Comparison Study of Growth Factor Expression following Treatment with Transcutaneous Electrical Nerve Stimulation, Saline Solution, Povidone-Iodine, and Lavender Oil in Wounds Healing

    Directory of Open Access Journals (Sweden)

    Adalet Koca Kutlu

    2013-01-01

    Full Text Available This study compared the effects of transcutaneous electrical nerve stimulation (TENS, saline solution (SS, povidone-iodine (PI, and lavender oil (Lavandula angustifolia through expression of growth factors in a rat model of wound healing. Six experimental groups were established, each containing 8 rats: a healthy group with no incision wounds, an incision-control group, an incision and TENS group, an incision and SS group, an incision and PI group, and an incision and lavender oil group. Experiments continued for 5 days, after which the skin in the excision area was removed. Tissue concentrations of epidermal growth factor (EGF and platelet-derived growth factor (PDGF-A were measured using enzyme-linked immunosorbent assay (ELISA. Tissue expressions of EGF, PDGF-A, and fibroblast growth factor (FGF-2 were determined using immunohistochemistry. Wound closure progressed more rapidly in the TENS and lavender oil groups than in the control and other study groups. In particular, PDGF-A expressions in the dermis and EGF expression in the epidermis were significantly intense in the TENS group (P<0.05. In addition, ELISA levels of growth factors such as PDGF-A and EGF were significantly higher in TENS group compared to the control group (P<0.05. These immunohistochemical and ELISA results suggest that TENS may improve wound healing through increasing growth factors in the dermis and epidermis more than other topical applications.

  18. Recent advances in topical wound care

    Directory of Open Access Journals (Sweden)

    Sujata Sarabahi

    2012-01-01

    Full Text Available There are a wide variety of dressing techniques and materials available for management of both acute wounds and chronic non-healing wounds. The primary objective in both the cases is to achieve a healed closed wound. However, in a chronic wound the dressing may be required for preparing the wound bed for further operative procedures such as skin grafting. An ideal dressing material should not only accelerate wound healing but also reduce loss of protein, electrolytes and fluid from the wound, and help to minimize pain and infection. The present dictum is to promote the concept of moist wound healing. This is in sharp contrast to the earlier practice of exposure method of wound management wherein the wound was allowed to dry. It can be quite a challenge for any physician to choose an appropriate dressing material when faced with a wound. Since wound care is undergoing a constant change and new products are being introduced into the market frequently, one needs to keep abreast of their effect on wound healing. This article emphasizes on the importance of assessment of the wound bed, the amount of drainage, depth of damage, presence of infection and location of wound. These characteristics will help any clinician decide on which product to use and where,in order to get optimal wound healing. However, there are no ′magical dressings′. Dressings are one important aspect that promotes wound healing apart from treating the underlying cause and other supportive measures like nutrition and systemic antibiotics need to be given equal attention.

  19. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  20. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    International Nuclear Information System (INIS)

    Khadjavi, Amina; Magnetto, Chiara; Panariti, Alice; Argenziano, Monica; Gulino, Giulia Rossana; Rivolta, Ilaria; Cavalli, Roberta; Giribaldi, Giuliana; Guiot, Caterina; Prato, Mauro

    2015-01-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  1. Antioxidative study of Cerium Oxide nanoparticle functionalised PCL-Gelatin electrospun fibers for wound healing application

    Directory of Open Access Journals (Sweden)

    Hilal Ahmad Rather

    2018-06-01

    Full Text Available Skin wound healing involves a coordinated cellular response to achieve complete reepithelialisation. Elevated levels of reactive oxygen species (ROS in the wound environment often pose a hindrance in wound healing resulting in impaired wound healing process. Cerium oxide nanoparticles (CeNPs have the ability to protect the cells from oxidative damage by actively scavenging the ROS. Furthermore, matrices like nanofibers have also been explored for enhancing wound healing. In the current study CeNP functionalised polycaprolactone (PCL-gelatin nanofiber (PGNPNF mesh was fabricated by electrospinning and evaluated for its antioxidative potential. Wide angle XRD analysis of randomly oriented nanofibers revealed ∼2.6 times reduced crystallinity than pristine PCL which aided in rapid degradation of nanofibers and release of CeNP. However, bioactive composite made between nanoparticles and PCL-gelatin maintained the fibrous morphology of PGNPNF upto 14 days. The PGNPNF mesh exhibited a superoxide dismutase (SOD mimetic activity due to the incorporated CeNPs. The PGNPNF mesh enhanced proliferation of 3T3-L1 cells by ∼48% as confirmed by alamar blue assay and SEM micrographs of cells grown on the nanofibrous mesh. Furthermore, the PGNPNF mesh scavenged ROS, which was measured by relative DCF intensity and fluorescence microscopy; and subsequently increased the viability and proliferation of cells by three folds as it alleviated the oxidative stress. Overall, the results of this study suggest the potential of CeNP functionalised PCL-gelatin nanofibrous mesh for wound healing applications.

  2. Fatal toxic epidermal necrolysis associated with minoxidil.

    Science.gov (United States)

    Karaoui, Lamis R; Chahine-Chakhtoura, Corinne

    2009-04-01

    Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this

  3. Altered morphology and function of the lacrimal functional unit in protein kinase C{alpha} knockout mice.

    Science.gov (United States)

    Chen, Zhuo; Li, Zhijie; Basti, Surendra; Farley, William J; Pflugfelder, Stephen C

    2010-11-01

    Protein kinase C (PKC) α plays a major role in the parasympathetic neural stimulation of lacrimal gland (LG) secretion. It also has been reported to have antiapoptotic properties and to promote cell survival. Therefore, the hypothesis for the present study was that PKCα knockout ((-/-)) mice have impaired ocular surface-lacrimal gland signaling, rendering them susceptible to desiccating stress and impaired corneal epithelial wound healing. In this study, the lacrimal function unit (LFU) and the stressed wound-healing response were examined in PKCα(-/-) mice. In PKCα(+/+) control mice and PKCα(-/-) mice, tear production, osmolarity, and clearance rate were evaluated before and after experimental desiccating stress. Histology and immunofluorescent staining of PKC and epidermal growth factor were performed in tissues of the LFU. Cornified envelope (CE) precursor protein expression and cell proliferation were evaluated. The time course of healing and degree of neutrophil infiltration was evaluated after corneal epithelial wounding. Compared with the PKCα(+/+) mice, the PKCα(-/-) mice were noted to have significantly increased lacrimal gland weight, with enlarged, carbohydrate-rich, PAS-positive acinar cells; increased corneal epithelia permeability, with reduced CE expression; and larger conjunctival epithelial goblet cells. The PKCα(-/-) mice showed more rapid corneal epithelial healing, with less neutrophil infiltration and fewer proliferating cells than did the PKCα(+/+) mice. The PKCα(-/-) mice showed lower tear production, which appeared to be caused by impaired secretion by the LG and conjunctival goblet cells. Despite their altered tear dynamics, the PKCα(-/-) mice demonstrated more rapid corneal epithelial wound healing, perhaps due to decreased neutrophil infiltration.

  4. MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing.

    Science.gov (United States)

    Jin, Yi; Tymen, Stéphanie D; Chen, Dan; Fang, Zong Juan; Zhao, Yan; Dragas, Dragan; Dai, Yang; Marucha, Phillip T; Zhou, Xiaofeng

    2013-01-01

    Recent studies suggest that microRNAs play important roles in dermal wound healing and microRNA deregulation has been linked with impaired wound repair. Here, using a mouse experimental wound healing model, we identified a panel of 63 differentially expressed microRNAs during dermal wound healing, including members of miR-99 family (miR-99a, miR-99b, miR-100). We further demonstrated that miR-99 family members regulate cell proliferation, cell migration, and AKT/mTOR signaling. Combined experimental and bioinformatics analyses revealed that miR-99 family members regulate AKT/mTOR signaling by targeting multiple genes, including known target genes (e.g., IGF1R, mTOR) and a new target (AKT1). The effects of miR-99 family members on the expression of IGF1R, mTOR and AKT1 were validated at both the mRNA and protein levels. Two adjacent miR-99 family targeting sites were identified in the 3'-UTR of the AKT1 mRNA. The direct interaction of miR-100 with these targeting sites was confirmed using luciferase reporter assays. The microRNA-100-directed recruitment of AKT1 mRNA to the RNAi-induced silencing complex (RISC) was confirmed by a ribonucleoprotein-IP assay. In summary, we identified a panel of differentially expressed microRNAs which may play important roles in wound healing. We provide evidence that miR-99 family members contribute to wound healing by regulating the AKT/mTOR signaling.

  5. Possible role of calcium dependent protein phosphorylation in the modulation of wound induced HRGP gene activation in potatoes after gamma irradiation

    International Nuclear Information System (INIS)

    Ussuf, K.K.; Laxmi, N.H.; Nair, P.M.

    1996-01-01

    Hydroxyproline rich glycoprotein (HRGP) gene is induced in both control and gamma irradiated potato tubers after wounding. The enhanced RNA synthesis in response to wounding correlated well with the accumulation of both HRGP gene transcripts and protein. Initially, the level of HRGP gene expression in gamma irradiated potatoes in response to wounding was 30% more than the corresponding controls. After post irradiation storage of 3-5 weeks, HRGP gene expression in response to wounding was significantly lower than the unirradiated samples. This low level of HRGP gene expression in irradiated potatoes was partially retrieved by 5 mM Ca 2+ treatment. Prior treatment with trifluoperazine, a calcium channel blocker resulted in 35% reduction in wound induced HRGP gene expression in control potatoes, further providing evidence for the involvement of Ca 2+ dependency for HRGP gene activation. A comparative study on in vivo protein phosphorylation induced by wounding in control and irradiated potatoes exhibited significant differences. A good correlation was observed in the modulation of phosphorylation and HRGP gene expression by Ca 2+ in irradiated potatoes. Wound induced signal transduction system and subsequent Ca 2+ dependent protein phosphorylation for the activation of HRGP gene is affected in potatoes after gamma irradiation, thus impairing the wound healing process adversely. (author). 25 refs., 5 figs

  6. Recombinant human erythropoietin improves angiogenesis and wound healing in experimental burn wounds.

    Science.gov (United States)

    Galeano, Mariarosaria; Altavilla, Domenica; Bitto, Alessandra; Minutoli, Letteria; Calò, Margherita; Lo Cascio, Patrizia; Polito, Francesca; Giugliano, Giovanni; Squadrito, Giovanni; Mioni, Chiara; Giuliani, Daniela; Venuti, Francesco S; Squadrito, Francesco

    2006-04-01

    Erythropoietin interacts with vascular endothelial growth factor (VEGF) and stimulates endothelial cell mitosis and motility; thus it may be of importance in the complex phenomenon of wound healing. The purpose of this study was to investigate the effect of recombinant human erythropoietin (rHuEPO) on experimental burn wounds. Randomized experiment. Research laboratory. C57BL/6 male mice weighing 25-30 g. Mice were immersed in 80 degrees C water for 10 secs to achieve a deep-dermal second degree burn. Animals were randomized to receive either rHuEPO (400 units/kg/day for 14 days in 100 microL subcutaneously) or its vehicle alone (100 microl/day distilled water for 14 days subcutaneously). On day 14 the animals were killed. Burn areas were used for histologic examination, evaluation of neoangiogenesis by immunohistochemistry, and expression (Western blot) of the specific endothelial marker CD31 as well as quantification of microvessel density, measurement of VEGF wound content (enzyme-linked immunosorbent assay), expression (Western blot) of endothelial and inducible nitric oxide synthases, and determination of wound nitric oxide (NO) products. rHuEPO increased burn wound reepithelialization and reduced the time to final wound closure. These effects were completely abated by a passive immunization with specific antibodies against erythropoietin. rHuEPO improved healing of burn wound through increased epithelial proliferation, maturation of the extracellular matrix, and angiogenesis. The hematopoietic factor augmented neoangiogenesis as suggested by the marked increase in microvessel density and by the robust expression of the specific endothelial marker CD31. Furthermore, rHuEPO enhanced the wound content of VEGF caused a marked expression of endothelial and inducible nitric oxide synthases and increased wound content of nitric oxide products. Our study suggests that rHuEPO may be an effective therapeutic approach to improve clinical outcomes after thermal injury.

  7. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  8. First experience using cultured epidermal autografts in Taiwan for burn victims of the Formosa Fun Coast Water Park explosion, as part of Japanese medical assistance.

    Science.gov (United States)

    Matsumura, Hajime; Harunari, Nobuyuki; Ikeda, Hiroto

    2016-05-01

    On June 27, 2015, a flammable starch-based powder exploded at Formosa Fun Coast in Taipei, Taiwan, injuring 499 people, and more than 200 people were in critical condition with severe burns. Although a cultured epidermal autograft (CEA) was not approved or used in clinical practice, the Taiwan Food and Drug Administration requested a Japanese CEA manufacturer to donate CEA for the burn victims as part of international medical assistance. The authors cooperated in this project and participated in the patient selection, wound bed management for CEA, and technical assistance for CEA use. Here, we provide an overview of the project. Nine patients were enrolled, and two patients were excluded from the skin biopsy; seven skin biopsies were collected approximately 1 month after the disaster. The average TBSA% burned was 81.0%, and the mean age was 20.1 years. CEA was grafted in five patients; wound closure had been obtained in one patient, and one patient was severely ill at the time of grafting. The CEA was combined with a wide split auto mesh graft or patch graft. The mean re-epithelization rate at 4 weeks after the grafting was 84.2% by patient, and all of the patients survived. Although this project had many obstacles to overcome, CEA grafting was successful and contributed to wound closure and survival. Copyright © 2015 Elsevier Ltd and ISBI. All rights reserved.

  9. Predicting complex acute wound healing in patients from a wound expertise centre registry: a prognostic study

    OpenAIRE

    Ubbink, Dirk T; Lindeboom, Robert; Eskes, Anne M; Brull, Huub; Legemate, Dink A; Vermeulen, Hester

    2015-01-01

    It is important for caregivers and patients to know which wounds are at risk of prolonged wound healing to enable timely communication and treatment. Available prognostic models predict wound healing in chronic ulcers, but not in acute wounds, that is, originating after trauma or surgery. We developed a model to detect which factors can predict (prolonged) healing of complex acute wounds in patients treated in a large wound expertise centre (WEC). Using Cox and linear regression analyses, we ...

  10. Development of the mechanical properties of engineered skin substitutes after grafting to full-thickness wounds.

    Science.gov (United States)

    Sander, Edward A; Lynch, Kaari A; Boyce, Steven T

    2014-05-01

    Engineered skin substitutes (ESSs) have been reported to close full-thickness burn wounds but are subject to loss from mechanical shear due to their deficiencies in tensile strength and elasticity. Hypothetically, if the mechanical properties of ESS matched those of native skin, losses due to shear or fracture could be reduced. To consider modifications of the composition of ESS to improve homology with native skin, biomechanical analyses of the current composition of ESS were performed. ESSs consist of a degradable biopolymer scaffold of type I collagen and chondroitin-sulfate (CGS) that is populated sequentially with cultured human dermal fibroblasts (hF) and epidermal keratinocytes (hK). In the current study, the hydrated biopolymer scaffold (CGS), the scaffold populated with hF dermal skin substitute (DSS), or the complete ESS were evaluated mechanically for linear stiffness (N/mm), ultimate tensile load at failure (N), maximum extension at failure (mm), and energy absorbed up to the point of failure (N-mm). These biomechanical end points were also used to evaluate ESS at six weeks after grafting to full-thickness skin wounds in athymic mice and compared to murine autograft or excised murine skin. The data showed statistically significant differences (p clinical morbidity from graft loss.

  11. Negative pressure wound therapy for the treatment of infected wounds with exposed knee joint after patellar fracture.

    Science.gov (United States)

    Lee, Sang Yang; Niikura, Takahiro; Miwa, Masahiko; Sakai, Yoshitada; Oe, Keisuke; Fukazawa, Takahiro; Kawakami, Yohei; Kurosaka, Masahiro

    2011-06-14

    Treatment of soft tissue defects with exposed bones and joints, resulting from trauma, infection, and surgical complications, represents a major challenge. The introduction of negative pressure wound therapy has changed many wound management practices. Negative pressure wound therapy has recently been used in the orthopedic field for management of traumatic or open wounds with exposed bone, nerve, tendon, and orthopedic implants. This article describes a case of a patient with a large soft tissue defect and exposed knee joint, in which negative pressure wound therapy markedly improved wound healing. A 50-year-old man presented with an ulceration of his left knee with exposed joint, caused by severe wound infections after open reduction and internal fixation of a patellar fracture. After 20 days of negative pressure wound therapy, a granulated wound bed covered the exposed bones and joint.To our knowledge, this is the first report of negative pressure wound therapy used in a patient with a large soft tissue defect with exposed knee joint. Despite the chronic wound secondary to infection, healing was achieved through the use of the negative pressure wound therapy, thus promoting granulation tissue formation and closing the joint. We suggest negative pressure wound therapy as an alternative option for patients with lower limb wounds containing exposed bones and joints when free flap transfer is contraindicated. Our result added to the growing evidence that negative pressure wound therapy is a useful adjunctive treatment for open wounds around the knee joint. Copyright 2011, SLACK Incorporated.

  12. Polymeric hydrogels for burn wound care: Advanced skin wound dressings and regenerative templates.

    Science.gov (United States)

    Madaghiele, Marta; Demitri, Christian; Sannino, Alessandro; Ambrosio, Luigi

    2014-01-01

    Wound closure represents a primary goal in the treatment of very deep and/or large wounds, for which the mortality rate is particularly high. However, the spontaneous healing of adult skin eventually results in the formation of epithelialized scar and scar contracture (repair), which might distort the tissues and cause lifelong deformities and disabilities. This clinical evidence suggests that wound closure attained by means of skin regeneration, instead of repair, should be the true goal of burn wound management. The traditional concept of temporary wound dressings, able to stimulate skin healing by repair, is thus being increasingly replaced by the idea of temporary scaffolds, or regenerative templates, able to promote healing by regeneration. As wound dressings, polymeric hydrogels provide an ideal moisture environment for healing while protecting the wound, with the additional advantage of being comfortable to the patient, due to their cooling effect and non-adhesiveness to the wound tissue. More importantly, recent advances in regenerative medicine demonstrate that bioactive hydrogels can be properly designed to induce at least partial skin regeneration in vivo. The aim of this review is to provide a concise insight on the key properties of hydrogels for skin healing and regeneration, particularly highlighting the emerging role of hydrogels as next generation skin substitutes for the treatment of full-thickness burns.

  13. Polymeric hydrogels for burn wound care: Advanced skin wound dressings and regenerative templates

    Directory of Open Access Journals (Sweden)

    Marta Madaghiele

    2014-10-01

    Full Text Available Wound closure represents a primary goal in the treatment of very deep and/or large wounds, for which the mortality rate is particularly high. However, the spontaneous healing of adult skin eventually results in the formation of epithelialized scar and scar contracture (repair, which might distort the tissues and cause lifelong deformities and disabilities. This clinical evidence suggests that wound closure attained by means of skin regeneration, instead of repair, should be the true goal of burn wound management. The traditional concept of temporary wound dressings, able to stimulate skin healing by repair, is thus being increasingly replaced by the idea of temporary scaffolds, or regenerative templates, able to promote healing by regeneration. As wound dressings, polymeric hydrogels provide an ideal moisture environment for healing while protecting the wound, with the additional advantage of being comfortable to the patient, due to their cooling effect and non-adhesiveness to the wound tissue. More importantly, recent advances in regenerative medicine demonstrate that bioactive hydrogels can be properly designed to induce at least partial skin regeneration in vivo. The aim of this review is to provide a concise insight on the key properties of hydrogels for skin healing and regeneration, particularly highlighting the emerging role of hydrogels as next generation skin substitutes for the treatment of full-thickness burns.

  14. Activation of α7nAChR Promotes Diabetic Wound Healing by Suppressing AGE-Induced TNF-α Production.

    Science.gov (United States)

    Dong, Miao-Wu; Li, Ming; Chen, Jie; Fu, Tong-Tong; Lin, Ke-Zhi; Ye, Guang-Hua; Han, Jun-Ge; Feng, Xiang-Ping; Li, Xing-Biao; Yu, Lin-Sheng; Fan, Yan-Yan

    2016-04-01

    Diabetes frequently presents accumulation of advanced glycation end products (AGEs), which might induce excessive TNF-α production from macrophages to cause impaired wound healing. Recent studies have shown that activation of α7 nicotinic acetylcholine receptor (α7nAChR) on macrophages efficiently suppressed TNF-α synthesis. The aim of this study was to investigate the accumulation of AGEs in the wounds and determine whether PNU282987, an α7nAChR agonist, can improve wound repair by inhibiting AGE-mediated TNF-α production in a streptozotocin (STZ)-induced diabetic mouse model. Animals were assigned into four groups: wounded control group, wounded diabetic group, wounded diabetic group treated intraperitoneally with PNU282987, or wounded diabetic group treated intraperitoneally with vehicle. Compared with the non-diabetic control mice, the diabetic mice exhibited delayed wound healing that was characterized by elevated accumulation of AGEs, increased TNF-α level and macrophage infiltration, and decreased fibroblast number and collagen deposition at the late stage of repair. Besides, macrophages of diabetic wounds showed expression of α7nAChR. During late repair, PNU282987 treatment of diabetic mice significantly reduced the level of TNF-α, accelerated wound healing, and elevated fibroblast number and collagen deposition. To investigate the cellular mechanism of these observations, RAW 264.7 cells, a macrophage cell line, were incubated with AGEs in the presence or absence of PNU282987. TNF-α production from AGE-stimulated macrophages was significantly decreased by PNU282987 in a dose-dependent manner. Furthermore, PNU282987 significantly inhibited AGE-induced nuclear factor-κB (NF-κB) activation and receptor for AGE (RAGE) expression. These results strongly suggest that activating α7nAChR can promote diabetic wound healing by suppressing AGE-induced TNF-α production, which may be closely associated with the blockage of NF-κB activation in macrophages.

  15. [Wound information management system: a standardized scheme for acquisition, storage and management of wound information].

    Science.gov (United States)

    Liu, Hu; Su, Rong-jia; Wu, Min-jie; Zhang, Yi; Qiu, Xiang-jun; Feng, Jian-gang; Xie, Ting; Lu, Shu-liang

    2012-06-01

    To form a wound information management scheme with objectivity, standardization, and convenience by means of wound information management system. A wound information management system was set up with the acquisition terminal, the defined wound description, the data bank, and related softwares. The efficacy of this system was evaluated in clinical practice. The acquisition terminal was composed of the third generation mobile phone and the software. It was feasible to get access to the wound information, including description, image, and therapeutic plan from the data bank by mobile phone. During 4 months, a collection of a total of 232 wound treatment information was entered, and accordingly standardized data of 38 patients were formed automatically. This system can provide standardized wound information management by standardized techniques of acquisition, transmission, and storage of wound information. It can be used widely in hospitals, especially primary medical institutions. Data resource of the system makes it possible for epidemiological study with large sample size in future.

  16. Improved wound care product

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention pertains to use of sodium diacetate (NaHAc 2) as an antimicrobial agent against bacteria growing in biofilms. The aspects of the invention include a wound care product comprising sodium diacetate, a kit comprising a wound care product,and a methodof treating an infected wound....

  17. How wounds heal

    Science.gov (United States)

    ... How puncture wounds heal; How burns heal; How pressure sores heal; How lacerations heal ... bleed. For example, burns, some puncture wounds, and pressure sores do not bleed. Once the scab forms, your ...

  18. In vivo evaluation of adipose- and muscle-derived stem cells as a treatment for nonhealing diabetic wounds using multimodal microscopy

    Science.gov (United States)

    Li, Joanne; Pincu, Yair; Marjanovic, Marina; Bower, Andrew J.; Chaney, Eric J.; Jensen, Tor; Boppart, Marni D.; Boppart, Stephen A.

    2016-08-01

    Impaired skin wound healing is a significant comorbid condition of diabetes, which often results in nonhealing diabetic ulcers due to poor peripheral microcirculation, among other factors. The effectiveness of the regeneration of adipose-derived stem cells (ADSCs) and muscle-derived stem cells (MDSCs) was assessed using an integrated multimodal microscopy system equipped with two-photon fluorescence and second-harmonic generation imaging. These imaging modalities, integrated in a single platform for spatial and temporal coregistration, allowed us to monitor in vivo changes in the collagen network and cell dynamics in a skin wound. Fluorescently labeled ADSCs and MDSCs were applied topically to the wound bed of wild-type and diabetic (db/db) mice following punch biopsy. Longitudinal imaging demonstrated that ADSCs and MDSCs provided remarkable capacity for improved diabetic wound healing, and integrated microscopy revealed a more organized collagen remodeling in the wound bed of treated mice. The results from this study verify the regenerative capacity of stem cells toward healing and, with multimodal microscopy, provide insight regarding their impact on the skin microenvironment. The optical method outlined in this study, which has the potential for in vivo human use, may optimize the care and treatment of diabetic nonhealing wounds.

  19. Filament wound structure and method

    International Nuclear Information System (INIS)

    Dritt, W.S.; Gerth, H.L.; Knight, C.E. Jr.; Pardue, R.M.

    1977-01-01

    A filament wound spherical structure is described comprising a plurality of filament band sets disposed about the surface of a mandrel with each band of each set formed of a continuous filament circumferentially wound about the mandrel a selected number of circuits and with each circuit of filament being wound parallel to and contiguous with an immediate previously wound circuit. Each filament band in each band set is wound at the same helix angle from the axis of revolution of the mandrel and all of the bands of each set are uniformly distributed about the mandrel circumference. The pole-to-equator wall thickness taper associated with each band set, as several contiguous band sets are wound about the mandrel starting at the poles, is accumulative as the band sets are nested to provide a complete filament wound sphere of essentially uniform thickness

  20. Transgenic mouse model expressing tdTomato under involucrin promoter as a tool for analysis of epidermal differentiation and wound healing

    Czech Academy of Sciences Publication Activity Database

    Kašpárek, Petr; Křenek, Pavel; Buryová, Halka; Suchanová, Šárka; Beck, Inken; Sedláček, Radislav

    2012-01-01

    Roč. 21, č. 3 (2012), s. 683-689 ISSN 0962-8819 R&D Projects: GA ČR GC301/08/J053; GA ČR(CZ) GP301/09/P662 Institutional research plan: CEZ:AV0Z50520514; CEZ:AV0Z50520701 Institutional support: RVO:68378050 ; RVO:86652036 Keywords : epidermis * involucrin * tdTomato * wound healing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.609, year: 2012

  1. Wound repair and anti-inflammatory potential of Lonicera japonica in excision wound-induced rats.

    Science.gov (United States)

    Chen, Wei-Cheng; Liou, Shorong-Shii; Tzeng, Thing-Fong; Lee, Shiow-Ling; Liu, I-Min

    2012-11-23

    Lonicera japonica Thunb. (Caprifoliaceae), a widely used traditional Chinese medicinal plant, is used to treat some infectious diseases and it may have uses as a healthy food and applications in cosmetics and as an ornamental groundcover. The ethanol extract of the flowering aerial parts of L. japonica (LJEE) was investigated for its healing efficiency in a rat excision wound model. Excision wounds were inflicted upon three groups of eight rats each. Healing was assessed by the rate of wound contraction in skin wound sites in rats treated with simple ointment base, 10% (w/w) LJEE ointment, or the reference standard drug, 0.2% (w/w) nitrofurazone ointment. The effects of LJEE on the contents of hydroxyproline and hexosamine during healing were estimated. The antimicrobial activity of LJEE against microorganisms was also assessed. The in vivo anti-inflammatory activity of LJEE was investigated to understand the mechanism of wound healing. LJEE exhibited significant antimicrobial activity against Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Candida albicans, and Candida tropicalis. The ointment formulation prepared with 10% (w/w) LJEE exhibited potent wound healing capacity as evidenced by the wound contraction in the excision wound model. The contents of hydroxyproline and hexosamine also correlated with the observed healing pattern. These findings were supported by the histopathological characteristics of healed wound sections, as greater tissue regeneration, more fibroblasts, and angiogenesis were observed in the 10% (w/w) LJEE ointment-treated group. The results also indicated that LJEE possesses potent anti-inflammatory activity, as it enhanced the production of anti-inflammatory cytokines that suppress proinflammatory cytokine production. The results suggest that the antimicrobial and anti-inflammatory activities of LJEE act synergistically to accelerate wound repair.

  2. Combat Wound Initiative program.

    Science.gov (United States)

    Stojadinovic, Alexander; Elster, Eric; Potter, Benjamin K; Davis, Thomas A; Tadaki, Doug K; Brown, Trevor S; Ahlers, Stephen; Attinger, Christopher E; Andersen, Romney C; Burris, David; Centeno, Jose; Champion, Hunter; Crumbley, David R; Denobile, John; Duga, Michael; Dunne, James R; Eberhardt, John; Ennis, William J; Forsberg, Jonathan A; Hawksworth, Jason; Helling, Thomas S; Lazarus, Gerald S; Milner, Stephen M; Mullick, Florabel G; Owner, Christopher R; Pasquina, Paul F; Patel, Chirag R; Peoples, George E; Nissan, Aviram; Ring, Michael; Sandberg, Glenn D; Schaden, Wolfgang; Schultz, Gregory S; Scofield, Tom; Shawen, Scott B; Sheppard, Forest R; Stannard, James P; Weina, Peter J; Zenilman, Jonathan M

    2010-07-01

    The Combat Wound Initiative (CWI) program is a collaborative, multidisciplinary, and interservice public-private partnership that provides personalized, state-of-the-art, and complex wound care via targeted clinical and translational research. The CWI uses a bench-to-bedside approach to translational research, including the rapid development of a human extracorporeal shock wave therapy (ESWT) study in complex wounds after establishing the potential efficacy, biologic mechanisms, and safety of this treatment modality in a murine model. Additional clinical trials include the prospective use of clinical data, serum and wound biomarkers, and wound gene expression profiles to predict wound healing/failure and additional clinical patient outcomes following combat-related trauma. These clinical research data are analyzed using machine-based learning algorithms to develop predictive treatment models to guide clinical decision-making. Future CWI directions include additional clinical trials and study centers and the refinement and deployment of our genetically driven, personalized medicine initiative to provide patient-specific care across multiple medical disciplines, with an emphasis on combat casualty care.

  3. Apitherapeutics and phage-loaded nanofibers as wound dressings with enhanced wound healing and antibacterial activity.

    Science.gov (United States)

    Sarhan, Wessam A; Azzazy, Hassan Me

    2017-09-01

    Develop green wound dressings which exhibit enhanced wound-healing ability and potent antibacterial effects. Honey, polyvinyl alcohol, chitosan nanofibers were electrospun and loaded with bee venom, propolis and/or bacteriophage against the multidrug-resistant Pseudomonas aeruginosa and examined for their antibacterial, wound-healing ability and cytotoxicity. Among different formulations of nanofibers, honey, polyvinyl alcohol, chitosan-bee venom/bacteriophage exhibited the most potent antibacterial activity against all tested bacterial strains (Gram-positive and -negative strains) and achieved nearly complete killing of multidrug-resistant P. aeruginosa. In vivo testing revealed enhanced wound-healing results and cytotoxicity testing proved improved biocompatibility. The developed biocompatible nanofibers represent competitive wound-healing dressings with potent antibacterial and wound-healing activity.

  4. Aged blood factors decrease cellular responses associated with delayed gingival wound repair.

    Directory of Open Access Journals (Sweden)

    María Paz Saldías

    Full Text Available Aging is a gradual biological process characterized by a decrease in cell and organism functions. Gingival wound healing is one of the impaired processes found in old rats. Here, we studied the in vivo wound healing process using a gingival repair rat model and an in vitro model using human gingival fibroblast for cellular responses associated to wound healing. To do that, we evaluated cell proliferation of both epithelial and connective tissue cells in gingival wounds and found decreased of Ki67 nuclear staining in old rats when compared to their young counterparts. We next evaluated cellular responses of primary gingival fibroblast obtained from young subjects in the presence human blood serum of individuals of different ages. Eighteen to sixty five years old masculine donors were classified into 3 groups: "young" from 18 to 22 years old, "middle-aged" from 30 to 48 years old and "aged" over 50 years old. Cell proliferation, measured through immunofluorescence for Ki67 and flow cytometry for DNA content, was decreased when middle-aged and aged serum was added to gingival fibroblast compared to young serum. Myofibroblastic differentiation, measured through alpha-smooth muscle actin (α-SMA, was stimulated with young but not middle-aged or aged serum both the protein levels and incorporation of α-SMA into actin stress fibers. High levels of PDGF, VEGF, IL-6R were detected in blood serum from young subjects when compared to middle-aged and aged donors. In addition, the pro-inflammatory cytokines MCP-1 and TNF were increased in the serum of aged donors. In old rat wound there is an increased of staining for TNF compared to young wound. Moreover, healthy gingiva (non injury shows less staining compared to a wound site, suggesting a role in wound healing. Moreover, serum from middle-aged and aged donors was able to stimulate cellular senescence in young cells as determined by the expression of senescence associated beta-galactosidase and histone H2

  5. The management of perineal wounds

    Directory of Open Access Journals (Sweden)

    Ramesh k Sharma

    2012-01-01

    Full Text Available Management of perineal wounds can be very frustrating as these invariably get contaminated from the ano-genital tracts. Moreover, the apparent skin defect may be associated with a significant three dimensional dead space in the pelvic region. Such wounds are likely to become chronic and recalcitrant if appropriate wound management is not instituted in a timely manner. These wounds usually result after tumor excision, following trauma or as a result of infective pathologies like hideradenitis suppurativa or following thermal burns. Many options are available for management of perineal wounds and these have been discussed with illustrative case examples. A review of literature has been done for listing commonly instituted options for management of the wounds in perineum.

  6. Negative pressure wound therapy via vacuum-assisted closure following partial foot amputation: what is the role of wound chronicity?

    Science.gov (United States)

    Armstrong, David G; Lavery, Lawrence A; Boulton, Andrew J M

    2007-03-01

    Randomised clinical trials (RCTs) to evaluate diabetic foot wound therapies have systematically eliminated large acute wounds from evaluation, focusing only on smaller chronic wounds. The purpose of this study was to evaluate the proportion and rate of wound healing in acute and chronic wounds after partial foot amputation in individuals with diabetes treated with negative pressure wound therapy (NPWT) delivered by the vacuum-assisted closure (VAC) device or with standard wound therapy (SWT). This study constitutes a secondary analysis of patients enrolled in a 16-week RCT of NPWT: 162 open foot amputation wounds (mean wound size = 20.7 cm(2)) were included. Acute wounds were defined as the wounds less than 30 days after amputation, whereas chronic wounds as the wounds greater than 30 days. Inclusion criteria consisted of individuals older than 18 years, presence of a diabetic foot amputation wound up to the transmetatarsal level and adequate perfusion. Wound size and healing were confirmed by independent, blinded wound evaluators. Analyses were done on an intent-to-treat basis. There was a significantly higher proportion of acute wounds (SWT = 59; NPWT = 63) than chronic wounds (SWT = 26; NPWT = 14), evaluated in this clinical trial (P = 0.001). There was no significant difference in the proportion of acute and chronic wounds achieving complete wound closure in either treatment group. Despite this finding, the Kaplan-Meier curves demonstrated statistically significantly faster healing in the NPWT group in both acute (P = 0.030) and chronic wounds (P = 0.033). Among the patients treated with NPWT via the VAC, there was not a significant difference in healing as a function of chronicity. In both the acute and the chronic wound groups, results for patients treated with NPWT were superior to those for the patients treated with SWT. These results appear to indicate that wound duration should not deter the clinician from using this modality to treat complex wounds.

  7. Wound healing in plastic surgery: does age matter? An American College of Surgeons National Surgical Quality Improvement Program study.

    Science.gov (United States)

    Karamanos, Efstathios; Osgood, Geoff; Siddiqui, Aamir; Rubinfeld, Ilan

    2015-03-01

    Increasing age has traditionally been associated with impairment in wound healing after operative interventions. This is based mostly on hearsay and anecdotal information. This idea fits with the authors’ understanding of biology in older organisms. This dictum has not been rigorously tested in clinical practice. The American College of Surgeons National Surgical Quality Improvement Program database was retrospectively queried for all patients undergoing plastic surgery from 2005 to 2010. Variables extracted included basic demographics, comorbidities, previous steroid and tobacco use, wound classification at the end of the surgery, and development of postoperative surgical-site infections. Multivariate analyses were used to investigate the impact of aging in wound dehiscence. A total of 25,967 patients were identified. Overall, the incidence of wound dehiscence was 0.75 percent (n = 196). When patients younger than 30 years were compared to older patient groups, no difference in the probability of developing wound dehiscence was noted. Specifically, the groups of patients aged 61 to 70 years and older than 70 years did not have statistically significant wound healing deficiencies [adjusted OR, 0.63 (95 percent CI, 0.11 to 3.63), adjusted p = 0.609; 2.79 (0.55 to 14.18), adjusted p = 0.217, for 61 to 70 years and older than 70 years, respectively]. Factors independently associated with wound dehiscence included postoperative abscess development, paraplegia, quadriplegia, steroid and tobacco use, deep surgical-site infection development, increasing body mass index, and wound classification at the end of surgery. In patients undergoing plastic surgery, wound dehiscence is a rare complication (0.75 percent). Aging is not associated with an increased incidence of wound dehiscence. Risk, III.

  8. Exploring the concept of a team approach to wound care: Managing wounds as a team.

    Science.gov (United States)

    Moore, Zena; Butcher, Gillian; Corbett, Lisa Q; McGuiness, William; Snyder, Robert J; van Acker, Kristien

    2014-05-01

    Background - The growing prevalence and incidence of nonhealing acute and chronic wounds is a worrying concern. A major challenge is the lack of united services aimed at addressing the complex needs of individuals with wounds. However, the WHO argues that interprofessional collaboration in education and practice is key to providing the best patient care, enhancing clinical and health-related outcomes and strengthening the health system. It is based on this background that the team approach to wound care project was conceptualised. The project was jointly initiated and realised by the Association for the Advancement of Wound Care (AAWC-USA), the Australian Wound Management Association (AWMA) and the European Wound Management Association (EWMA). Aim - The aim of this project was to develop a universal model for the adoption of a team approach to wound care. Objective The overarching objective of this project was to provide recommendations for implementing a team approach to wound care within all clinical settings and through this to develop a model for advocating the team approach toward decision makers in national government levels. Method An integrative literature review was conducted. Using this knowledge, the authors arrived at a consensus on the most appropriate model to adopt and realise a team approach to wound care. Results - Eighty four articles met the inclusion criteria. Following data extraction, it was evident that none of the articles provided a definition for the terms multidisciplinary, interdisciplinary or transdisciplinary in the context of wound care. Given this lack of clarity within the wound care literature, the authors have here developed a Universal Model for the Team Approach to Wound Care to fill this gap in our current understanding. Conclusion - We advocate that the patient should be at the heart of all decision-making, as working with the Universal Model for the Team Approach to Wound Care begins with the needs of the patient. To

  9. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  11. The use of negative pressure wound therapy in the treatment of infected wounds. Case studies

    Directory of Open Access Journals (Sweden)

    Daniel de Alcântara Jones

    Full Text Available ABSTRACT OBJECTIVE: To evaluate the results and benefits obtained from the topical use of negative pressure wound therapy (NPWT in patients with infected wounds. METHODS: This was a retrospective study of 20 patients (17 males and three females, mean age 42 years with infected wounds treated using NPWT. The infected wounds were caused by trauma. The treatment system used was VAC.(r (Vacuum Assisted Closure, KCI, San Antonio, United States applied to the wound in continuous mode from 100 to 125 mmHg. The parameters related to the wounds (location, number of VAC changes, the size of the defects in the soft parts, and the evolution of the state of the wound, length of hospital stay, length of intravenous antibiotic therapy, and complications related to the use of this therapy were evaluated. RESULTS: The mean length of the hospital stay, use of NPWT, and antibacterial therapy were 41 days, 22.5 days, and 20 days respectively. The use of the VAC led to a mean reduction of 29% in the wound area (95.65-68.1 cm2; p < 0.05. Only one patient did not show any improvement in the final appearance of the wound with complete eradication of the infection. No complication directly caused by NPWT was observed. CONCLUSION: NPWT stimulates infection-free scar tissue formation in a short time, and is a quick and comfortable alternative to conventional infected wounds treatment methods.

  12. Sympathetic nerves: How do they affect angiogenesis, particularly during wound healing of soft tissues?

    Science.gov (United States)

    Pan, Liangli; Tang, Jianbing; Liu, Hongwei; Cheng, Biao

    2016-01-01

    Angiogenesis is essential for wound healing, and angiogenesis impairment can result in chronic ulcers. Studies have shown that the sympathetic nervous system has an important role in angiogenesis. In recent years, researchers have focused on the roles of sympathetic nerves in tumor angiogenesis. In fact, sympathetic nerves can affect angiogenesis in the wound healing of soft tissues, and may have a similar mechanism of action as that seen in tumorigenesis. Sympathetic nerves act primarily through interactions between the neurotransmitters released from nerve endings and receptors present in target organs. Among this, activation or inhibition of adrenergic receptors (mainly β-adrenergic receptors) influence formation of new blood vessels considerably. As sympathetic nerves locate near pericytes in microvessel, go along the capillaries and there are adrenergic receptors present in endothelial cells and pericytes, sympathetic nerves may participate in angiogenesis by influencing the endothelial cells and pericytes of new capillaries. Studying the roles of sympathetic nerves on the angiogenesis of wound healing can contribute to understanding the mechanisms of tissue repair, tissue regeneration, and tumorigenesis, thereby providing new therapeutic perspectives.

  13. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  14. NETosis Delays Diabetic Wound Healing in Mice and Humans.

    Science.gov (United States)

    Fadini, Gian Paolo; Menegazzo, Lisa; Rigato, Mauro; Scattolini, Valentina; Poncina, Nicol; Bruttocao, Andrea; Ciciliot, Stefano; Mammano, Fabio; Ciubotaru, Catalin Dacian; Brocco, Enrico; Marescotti, Maria Cristina; Cappellari, Roberta; Arrigoni, Giorgio; Millioni, Renato; Vigili de Kreutzenberg, Saula; Albiero, Mattia; Avogaro, Angelo

    2016-04-01

    Upon activation, neutrophils undergo histone citrullination by protein arginine deiminase (PAD)4, exocytosis of chromatin and enzymes as neutrophil extracellular traps (NETs), and death. In diabetes, neutrophils are primed to release NETs and die by NETosis. Although this process is a defense against infection, NETosis can damage tissue. Therefore, we examined the effect of NETosis on the healing of diabetic foot ulcers (DFUs). Using proteomics, we found that NET components were enriched in nonhealing human DFUs. In an independent validation cohort, a high concentration of neutrophil elastase in the wound was associated with infection and a subsequent worsening of the ulcer. NET components (elastase, histones, neutrophil gelatinase-associated lipocalin, and proteinase-3) were elevated in the blood of patients with DFUs. Circulating elastase and proteinase-3 were associated with infection, and serum elastase predicted delayed healing. Neutrophils isolated from the blood of DFU patients showed an increased spontaneous NETosis but an impaired inducible NETosis. In mice, skin PAD4 activity was increased by diabetes, and FACS detection of histone citrullination, together with intravital microscopy, showed that NETosis occurred in the bed of excisional wounds. PAD4 inhibition by Cl-amidine reduced NETting neutrophils and rescued wound healing in diabetic mice. Cumulatively, these data suggest that NETosis delays DFU healing. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  15. Validation of a laser-assisted wound measurement device in a wound healing model.

    Science.gov (United States)

    Constantine, Ryan S; Bills, Jessica D; Lavery, Lawrence A; Davis, Kathryn E

    2016-10-01

    In the treatment and monitoring of a diabetic or chronic wound, accurate and repeatable measurement of the wound provides indispensable data for the patient's medical record. This study aims to measure the accuracy of the laser-assisted wound measurement (LAWM) device against traditional methods in the measurement of area, depth and volume. We measured four 'healing' wounds in a Play-Doh(®) -based model over five subsequent states of wound healing progression in which the model was irregularly filled in to replicate the healing process. We evaluated the LAWM device against traditional methods including digital photograph assessment with National Institutes of Health ImageJ software, measurements of depth with a ruler and weight-to-volume assessment with dental paste. Statistical analyses included analysis of variance (ANOVA) and paired t-tests. We demonstrate that there are significantly different and nearly statistically significant differences between traditional ruler depth measurement and LAWM device measurement, but there are no statistically significant differences in area measurement. Volume measurements were found to be significantly different in two of the wounds. Rate of percentage change was analysed for volume and depth in the wound healing model, and the LAWM device was not significantly different than the traditional measurement technique. While occasionally inaccurate in its absolute measurement, the LAWM device is a useful tool in the clinician's arsenal as it reliably measures rate of percentage change in depth and volume and offers a potentially aseptic alternative to traditional measurement techniques. © 2014 The Authors. International Wound Journal © 2014 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

  16. Predicting complex acute wound healing in patients from a wound expertise centre registry: a prognostic study

    NARCIS (Netherlands)

    Ubbink, Dirk T.; Lindeboom, Robert; Eskes, Anne M.; Brull, Huub; Legemate, Dink A.; Vermeulen, Hester

    2015-01-01

    It is important for caregivers and patients to know which wounds are at risk of prolonged wound healing to enable timely communication and treatment. Available prognostic models predict wound healing in chronic ulcers, but not in acute wounds, that is, originating after trauma or surgery. We

  17. Predicting complex acute wound healing in patients from a wound expertise centre registry : a prognostic study

    NARCIS (Netherlands)

    Ubbink, Dirk T; Lindeboom, Robert; Eskes, Anne M; Brull, Huub; Legemate, Dink A; Vermeulen, Hester

    2015-01-01

    It is important for caregivers and patients to know which wounds are at risk of prolonged wound healing to enable timely communication and treatment. Available prognostic models predict wound healing in chronic ulcers, but not in acute wounds, that is, originating after trauma or surgery. We

  18. Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

    International Nuclear Information System (INIS)

    Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

    2008-01-01

    The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

  19. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  20. Aloe vera and Vitis vinifera improve wound healing in an in vivo rat burn wound model.

    Science.gov (United States)

    Lin, Li-Xin; Wang, Peng; Wang, Yu-Ting; Huang, Yong; Jiang, Lei; Wang, Xue-Ming

    2016-02-01

    Aloe vera and Vitis vinifera have been traditionally used as wound healing agents. The present study aimed to investigate the effects of aloe emodin and resveratrol in the burn wound healing procedure. Burn wounds are common in developed and developing countries, however, in developing countries, the incidence of severe complications is higher and financial resources are limited. The results of the present study demonstrated that neither aloe emodin or resveratrol were cytotoxic to THP-1 macrophages at concentrations of 1, 100 and 500 ng/ml. A significant increase in wound-healing activity was observed in mice treated with the aloe emodin and resveratrol, compared with those which received control treatments. The levels of IL-1β in the exudates of the burn wound area of the treated mice increased in a time-dependent manner over 7 days following burn wound injury. At 10 days post-injury, steady and progressive wound healing was observed in the control animals. The present study confirmed that increased wound healing occurs following treatment with aloe emodin,, compared with resveratrol, providing support for the use of Aloe vera plants to improve burn wound healing.

  1. Beneficial Regulation of Matrix Metalloproteinases for Skin Health

    Directory of Open Access Journals (Sweden)

    Neena Philips

    2011-01-01

    Full Text Available Matrix metalloproteinases (MMPs are essential to the remodeling of the extracellular matrix. While their upregulation facilitates aging and cancer, they are essential to epidermal differentiation and the prevention of wound scars. The pharmaceutical industry is active in identifying products that inhibit MMPs to prevent or treat aging and cancer and products that stimulate MMPs to prevent epidermal hyperproliferative diseases and wound scars.

  2. Negative Pressure Wound Therapy in Maxillofacial Applications

    Directory of Open Access Journals (Sweden)

    Adam J. Mellott

    2016-09-01

    Full Text Available Negative pressure wound therapy has greatly advanced the field of wound healing for nearly two decades, by providing a robust surgical adjunct technique for accelerating wound closure in acute and chronic wounds. However, the application of negative pressure wound therapy in maxillofacial applications has been relatively under utilized as a result of the physical articulations and contours of the head and neck that make it challenging to obtain an airtight seal for different negative pressure wound therapy systems. Adapting negative pressure wound therapies for maxillofacial applications could yield significant enhancement of wound closure in maxillofacial applications. The current review summarizes the basic science underlying negative pressure wound therapy, as well as specific maxillofacial procedures that could benefit from negative pressure wound therapy.

  3. Scalp Wound Closure with K wires: An alternative easier method to scalp wound closure.

    Science.gov (United States)

    Ramesh, S; Ajik, S

    2012-12-01

    Scalp defects and lacerations present a reconstructive challenge to plastic surgeons. Many methods have been described from the use of skin grafting to rotation flaps. Here we present a method of closure of a contaminated scalp wound with the use of Kirschner wires. In our case, closure of scalp laceration was made possible with the use of 1.4 Kirschner wires and cable tie/ zip tie fasteners. The duration to closure of wound was 10 days. In reconstructing the scalp defect, this method was found to adhere to principles of scalp reconstruction. There were no post operative complications found from the procedure. On initial application on the edge of the wound, tension applied caused the K wires to cut through the wound