WorldWideScience

Sample records for impaired barrier function

  1. Impaired water barrier function in acne vulgaris.

    Science.gov (United States)

    Yamamoto, A; Takenouchi, K; Ito, M

    1995-01-01

    In acne vulgaris, abnormal follicular keratinization is important for comedo formation, yet the precise mechanisms of comedogenesis are not known. The present study examined the interrelationship between sebum secretion rate (SSR), lipid content and water barrier function (WBF) of the stratum corneum (SC) in 36 acne patients and 29 control subjects. All major SC lipid classes were separated and quantified by thin-layer chromatography/photodensitometry. WBF was evaluated by measuring transepidermal water loss (TEWL), and the hygroscopic properties and waterholding capacity of the SC. The SSR over a period of 3 h was significantly higher in patients with moderate acne than in control subjects, but no significant difference was noticed between patients with mild acne and control subjects. Significant differences between patients with both moderate and mild acne and control subjects were noted in the amount of sphingolipids (ceramides and free sphingosine), but not for any other lipid classes. Furthermore in acne patients, lower amounts of sphingolipids were observed corresponding with a diminished WBF. These results suggest that an impaired WBF caused by decreased amounts of ceramides may be responsible for comedo formation, since barrier dysfunction is accompanied by hyperkeratosis of the follicular epithelium.

  2. Exogenous sphingomyelinase causes impaired intestinal epithelial barrier function

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To test the hypothesis that hydrolysis of sphingomyelin to ceramide changes the composition of tight junctions (TJs) with increasing permeability of the intestinal epithelium.METHODS: Monolayers of Caco-2 cells were used as an in vitro model for the intestinal barrier. Permeability was determined by quantification of transepithelial flux and transepithelial resistance. Sphingolipid-rich membrane microdomains were isolated by a discontinuous sucrose gradient and characterized by Western-blot. Lipid content of microdomains was analysed by tandem mass spectrometry. Ceramide was subcellularly localized by immunofluorescent staining.RESULTS: Exogenous sphingomyelinase increased transepithelial permeability and decreased transepithelial resistance at concentrations as low as 0.01 U/mL.Lipid analysis showed rapid accumulation of ceramide in the membrane fractions containing occludin and claudin-4, representing TJs. In these fractions we observed a concomitant decrease of sphingomyelin and cholesterol with increasing concentrations of ceramide.Immunofluorescent staining confirmed clustering of ceramide at the sites of cell-cell contacts. Neutralization of surface ceramide prevented the permeability-increase induced by platelet activating factor.CONCLUSION: Our findings indicate that changes in lipid composition of TJs impair epithelial barrier functions. Generation of ceramide by sphingomyelinases might contribute to disturbed barrier function seen in diseases such as inflammatory, infectious, toxic or radiogenic bowel disease.

  3. Sleep Restriction Impairs Blood–Brain Barrier Function

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping

    2014-01-01

    The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222

  4. Sleep restriction impairs blood-brain barrier function.

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong

    2014-10-29

    The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.

  5. Impaired skin barrier function in mice with colon carcinoma induced by azoxymethane and dextran sodium sulfate.

    Science.gov (United States)

    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

    2015-01-01

    We have previously reported that impaired skin barrier function was induced by small intestinal injury in mice. Therefore, we postulated that other intestinal diseases might also influence skin barrier function. In this study, we evaluated the skin barrier function of hairless mice with colon carcinoma that was induced by azoxymethane (AOM) and dextran sodium sulfate (DSS). In mice treated with these drugs, we observed elevated transepidermal water loss and reduced skin hydration levels, compared to those in the control mice. In addition, plasma nitrogen di/trioxide (NO2(-)/NO3(-)) levels were significantly elevated, and expression of type I collagen was significantly reduced in the treated mice, compared to those in control. These results suggest that impaired skin barrier function occurs in mice when colon carcinoma is present.

  6. The repair of impaired epidermal barrier function in rats by the cutaneous application of linoleic acid.

    Science.gov (United States)

    Prottey, C; Hartop, P J; Black, J G; McCormack, J I

    1976-01-01

    Epidermal barrier function in rats was experimentally impaired by two separate means, namely, by rendering the animals deficient in essential fatty acids and by evoking a primary cutaneous irritant response by treating with a solution of sodium laurate. Impaired barrier function was manifested by a greatly increased rate of transepidermal water loss. Application to the skin of sunflower seed oil, which is rich in linoleic acid, rapidly restored to normal the abnormally high rates of transepidermal water loss in both experimental cases, and it was shown with the essential fatty acid-deficient rats that there was a concomitant incorporation of linoleic acid of the sunflower seed oil into epidermal lipids. Cutaneous application of olive oil, which is low in linoleic acid but rich in the non-essential oleic acid, did not influence epidermal barrier function. A close relationship of barrier function and essential fatty acids is indicated.

  7. Cigarette smoke impairs airway epithelial barrier function and cell-cell contact recovery.

    Science.gov (United States)

    Heijink, I H; Brandenburg, S M; Postma, D S; van Oosterhout, A J M

    2012-02-01

    Cigarette smoking, the major cause of chronic obstructive pulmonary disease (COPD), induces aberrant airway epithelial structure and function. The underlying mechanisms are unresolved so far. We studied effects of cigarette smoke extract (CSE) on epithelial barrier function and wound regeneration in human bronchial epithelial 16HBE cells and primary bronchial epithelial cells (PBECs) from COPD patients, nonsmokers and healthy smokers. We demonstrate that CSE rapidly and transiently impairs 16HBE barrier function, largely due to disruption of cell-cell contacts. CSE induced a similar, but stronger and more sustained, defect in PBECs. Application of the specific epidermal growth factor receptor (EGFR) inhibitor AG1478 showed that EGFR activation contributes to the CSE-induced defects in both 16HBE cells and PBECs. Furthermore, our data indicate that the endogenous protease calpain mediates these defects through tight junction protein degradation. CSE also delayed the reconstitution of 16HBE intercellular contacts during wound healing and attenuated PBEC barrier function upon wound regeneration. These findings were comparable between PBECs from smokers, healthy smokers and COPD patients. In conclusion, we demonstrate for the first time that CSE reduces epithelial integrity, probably by EGFR and calpain-dependent disruption of intercellular contacts. This may increase susceptibility to environmental insults, e.g. inhaled pathogens. Thus, EGFR may be a promising target for therapeutic strategies to improve mucosal barrier function in cigarette smoking-related disease.

  8. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Directory of Open Access Journals (Sweden)

    Siming Yang

    2017-08-01

    Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.

  9. Cigarette smoke impairs airway epithelial barrier function and cell-cell contact recovery

    NARCIS (Netherlands)

    Heijink, I H; Brandenburg, S M; Postma, D S; van Oosterhout, A J M

    2012-01-01

    Cigarette smoking, the major cause of chronic obstructive pulmonary disease (COPD), induces aberrant airway epithelial structure and function. The underlying mechanisms are unresolved so far. We studied effects of cigarette smoke extract (CSE) on epithelial barrier function and wound regeneration in

  10. Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease.

    Science.gov (United States)

    Williams, Benjamin B; Tebbutt, Niall C; Buchert, Michael; Putoczki, Tracy L; Doggett, Karen; Bao, Shisan; Johnstone, Cameron N; Masson, Frederick; Hollande, Frederic; Burgess, Antony W; Scott, Andrew M; Ernst, Matthias; Heath, Joan K

    2015-08-01

    The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD) and colitis-associated cancer (CAC). Glycoprotein A33 (GPA33) is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33(-/-) mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33(-/-) mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS) to injure the intestinal epithelium. Gpa33(-/-) mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM) followed by two cycles of DSS. In contrast, Gpa33(-/-) mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33(-/-) mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33(-/-) mice provide a valuable model to study the mechanisms linking intestinal

  11. Blood-brain barrier P-glycoprotein function is not impaired in early Parkinson's disease

    NARCIS (Netherlands)

    Bartels, A. L.; van Berckel, B. N. M.; Lubberink, M.; Luurtsema, G.; Lammertsma, A. A.; Leenders, K. L.

    2008-01-01

    The cause of Parkinson's disease (PD) is unknown. Genetic susceptibility and exposure to environmental toxins contribute to specific neuronal loss in PD. Decreased blood-brain barrier (BBB) P-glycoprotein (P-gp) efflux function has been proposed as a possible causative link between toxin exposure an

  12. Knockdown of Filaggrin Impairs Diffusion Barrier Function and Increases UV Sensitivity in a Human Skin Model

    NARCIS (Netherlands)

    M. Mildner; J. Jin; L. Eckhart; S. Kezic; F. Gruber; C. Barresi; C. Stremnitzer; M. Buchberger; V. Mlitz; C. Ballaun; B. Sterniczky; D. Födinger; E. Tschachler

    2010-01-01

    Loss-of-function mutations in the filaggrin gene are associated with ichthyosis vulgaris and atopic dermatitis. To investigate the impact of filaggrin deficiency on the skin barrier, filaggrin expression was knocked down by small interfering RNA (siRNA) technology in an organotypic skin model in vit

  13. Salvianolic Acid B Restored Impaired Barrier Function via Downregulation of MLCK by microRNA-1 in Rat Colitis Model.

    Science.gov (United States)

    Xiong, Yongjian; Wang, Jingyu; Chu, Hongwei; Chen, Dapeng; Guo, Huishu

    2016-01-01

    Salvianolic acid B (Sal B) is isolated from the traditional Chinese medical herb Salvia miltiorrhiza and is reported to have a wide range of therapeutic benefits. The aim of this study was to investigate the effects of Sal B on epithelial barrier dysfunction in rat colitis and to uncover related mechanisms. Rat colitis model was established by intracolonic administration of 2, 4, 6-trinitrobenzene sulfonic acid (TNBS). The intestinal barrier function was evaluated by measuring the serum recovery of fluorescein isothiocyanate-4 kD dextran in vivo and transepithelial electrical resistance in vitro respectively. The protein expression related to intestinal barrier function was studied using western blotting. The effects of Sal B on inflammatory responses, oxidative damage and colitis recurrence were also studied in this study. The intestinal barrier dysfunction in colitis was reversed by Sal B, accompanied with the decrease of tight junction proteins, and the effect could be blocked by microRNA-1(miR-1) inhibition. The inflammatory responses, oxidative damage and colitis recurrence were also decreased by Sal B. The colitis symptoms and recurrences were ameliorated by Sal B, and restoration of impaired barrier function via downregulation of MLCK by miR-1 maybe involved in this effect. This study provides some novel insights into both of the pathological mechanisms and treatment alternatives of inflammatory bowel disease.

  14. Caspase-14 Expression Impairs Retinal Pigment Epithelium Barrier Function: Potential Role in Diabetic Macular Edema

    Directory of Open Access Journals (Sweden)

    Selina Beasley

    2014-01-01

    Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.

  15. Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease

    Directory of Open Access Journals (Sweden)

    Benjamin B. Williams

    2015-08-01

    Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms

  16. Blood-brain barrier P-glycoprotein function is not impaired in early Parkinson's disease.

    Science.gov (United States)

    Bartels, A L; van Berckel, B N M; Lubberink, M; Luurtsema, G; Lammertsma, A A; Leenders, K L

    2008-08-01

    The cause of Parkinson's disease (PD) is unknown. Genetic susceptibility and exposure to environmental toxins contribute to specific neuronal loss in PD. Decreased blood-brain barrier (BBB) P-glycoprotein (P-gp) efflux function has been proposed as a possible causative link between toxin exposure and PD neurodegeneration. In the present study BBB P-gp function was investigated in vivo in 10 early stage PD patients and 8 healthy control subjects using (R)-[(11)C]-verapamil and PET. Cerebral volume of distribution (V(d)) of verapamil was used as measure of P-gp function. Both region of interest (ROI) analysis and voxel analysis using statistical parametric mapping (SPM) were performed to assess regional brain P-gp function. In addition, MDR1 genetic polymorphism was assessed. In the present study, a larger variation in V(d) of (R)-[(11)C]-verapamil was seen in the PD group as compared to the control group. However, decreased BBB P-gp function in early stage PD patients could not be confirmed.

  17. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat

    NARCIS (Netherlands)

    Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.

    2010-01-01

    Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading

  18. Serotonergic reinforcement of intestinal barrier function is impaired in irritable bowel syndrome.

    Science.gov (United States)

    Keszthelyi, D; Troost, F J; Jonkers, D M; van Eijk, H M; Lindsey, P J; Dekker, J; Buurman, W A; Masclee, A A M

    2014-08-01

    Alterations in serotonergic (5-HT) metabolism and/or intestinal integrity have been associated with irritable bowel syndrome (IBS). To assess the effects of the precursor of 5-HT, 5-hydroxytryptophan (5-HTP), on mucosal 5-HT availability and intestinal integrity, and to assess potential differences between healthy controls and IBS patients. Fifteen IBS patients and 15 healthy volunteers participated in this randomised double-blind placebo-controlled study. Intestinal integrity was assessed by dual-sugar test and by determining the mucosal expression of tight junction proteins after ingestion of an oral bolus of 100 mg 5-HTP or placebo. Mucosal serotonergic metabolism was assessed in duodenal biopsy samples. 5-HTP administration significantly increased mucosal levels of 5-HIAA, the main metabolite of 5-HT, in both healthy controls (7.1 ± 1.7 vs. 2.5 ± 0.7 pmol/mg, 5-HTP vs. placebo, P = 0.02) and IBS patients (20.0 ± 4.8 vs. 8.1 ± 1.3 pmol/mg, 5-HTP vs. placebo, P = 0.02), with the latter group showing a significantly larger increase. Lactulose/L-rhamnose ratios were significantly lower after administration of 5-HTP (P HTP resulted in a further decrease in occludin expression. Oral 5-HTP induced alterations in mucosal 5-HT metabolism. In healthy controls, a reinforcement of the intestinal barrier was seen whereas such reaction was absent in IBS patients. This could indicate the presence of a serotonin-mediated mechanism aimed to reinforce intestinal barrier function, which seems to dysfunction in IBS patients. © 2014 John Wiley & Sons Ltd.

  19. Altered intestinal microbial flora and impaired epithelial barrier structure and function in CKD: the nature, mechanisms, consequences and potential treatment.

    Science.gov (United States)

    Vaziri, Nosratola D; Zhao, Ying-Yong; Pahl, Madeleine V

    2016-05-01

    Chronic kidney disease (CKD) results in systemic inflammation and oxidative stress which play a central role in CKD progression and its adverse consequences. Although many of the causes and consequences of oxidative stress and inflammation in CKD have been extensively explored, little attention had been paid to the intestine and its microbial flora as a potential source of these problems. Our recent studies have revealed significant disruption of the colonic, ileal, jejunal and gastric epithelial tight junction in different models of CKD in rats. Moreover, the disruption of the epithelial barrier structure and function found in uremic animals was replicated in cultured human colonocytes exposed to uremic human plasma in vitro We have further found significant changes in the composition and function of colonic bacterial flora in humans and animals with advanced CKD. Together, uremia-induced impairment of the intestinal epithelial barrier structure and function and changes in composition of the gut microbiome contribute to the systemic inflammation and uremic toxicity by accommodating the translocation of endotoxin, microbial fragments and other noxious luminal products in the circulation. In addition, colonic bacteria are the main source of several well-known pro-inflammatory uremic toxins such as indoxyl sulfate, p-cresol sulfate, trimethylamine-N-oxide and many as-yet unidentified retained compounds in end-stage renal disease patients. This review is intended to provide an overview of the effects of CKD on the gut microbiome and intestinal epithelial barrier structure and their role in the pathogenesis of systemic inflammation and uremic toxicity. In addition, potential interventions aimed at mitigating these abnormalities are briefly discussed.

  20. Impaired endothelial barrier function in apolipoprotein M-deficient mice is dependent on sphingosine-1-phosphate receptor 1.

    Science.gov (United States)

    Christensen, Pernille M; Liu, Catherine H; Swendeman, Steven L; Obinata, Hideru; Qvortrup, Klaus; Nielsen, Lars B; Hla, Timothy; Di Lorenzo, Annarita; Christoffersen, Christina

    2016-06-01

    Apolipoprotein M (ApoM) transports sphingosine-1-phosphate (S1P) in plasma, and ApoM-deficient mice (Apom(-/-)) have ∼50% reduced plasma S1P levels. There are 5 known S1P receptors, and S1P induces adherens junction formation between endothelial cells through the S1P1 receptor, which in turn suppresses vascular leak. Increased vascular permeability is a hallmark of inflammation. The purpose of this study was to explore the relationships between vascular leakage in ApoM deficiency and S1P1 function in normal physiology and in inflammation. Vascular permeability in the lungs was assessed by accumulation of dextran molecules (70 kDa) and was increased ∼40% in Apom(-/-) mice compared to WT (C57Bl6/j) mice. Reconstitution of plasma ApoM/S1P or treatment with an S1P1 receptor agonist (SEW2871) rapidly reversed the vascular leakage to a level similar to that in WT mice, suggesting that it is caused by decreased plasma levels of S1P and reduced S1P1 stimulation. In a carrageenan-induced model of inflammation, Apom(-/-) mice had increased vascular leakage compared with that in WT mice. Adenoviral overexpression of ApoM in Apom(-/-) mice decreased the vascular leakage compared to adenoviral overexpression of green fluorescent protein. The study suggests that vascular leakage of albumin-sized particles in ApoM deficiency is S1P- and S1P1-dependent and this dependency exacerbates the response to inflammatory stimuli.-Christensen, P. M., Liu, C. H., Swendeman, S. L., Obinata, H., Qvortrup, K., Nielsen, L B., Hla, T., Di Lorenzo, A., Christoffersen, C. Impaired endothelial barrier function in apolipoprotein M-deficient mice is dependent on sphingosine-1-phosphate receptor 1. © FASEB.

  1. Impaired endothelial barrier function in apolipoprotein M–deficient mice is dependent on sphingosine-1-phosphate receptor 1

    Science.gov (United States)

    Christensen, Pernille M.; Liu, Catherine H.; Swendeman, Steven L.; Obinata, Hideru; Qvortrup, Klaus; Nielsen, Lars B.; Hla, Timothy; Christoffersen, Christina

    2016-01-01

    Apolipoprotein M (ApoM) transports sphingosine-1-phosphate (S1P) in plasma, and ApoM-deficient mice (Apom−/−) have ∼50% reduced plasma S1P levels. There are 5 known S1P receptors, and S1P induces adherens junction formation between endothelial cells through the S1P1 receptor, which in turn suppresses vascular leak. Increased vascular permeability is a hallmark of inflammation. The purpose of this study was to explore the relationships between vascular leakage in ApoM deficiency and S1P1 function in normal physiology and in inflammation. Vascular permeability in the lungs was assessed by accumulation of dextran molecules (70 kDa) and was increased ∼40% in Apom−/− mice compared to WT (C57Bl6/j) mice. Reconstitution of plasma ApoM/S1P or treatment with an S1P1 receptor agonist (SEW2871) rapidly reversed the vascular leakage to a level similar to that in WT mice, suggesting that it is caused by decreased plasma levels of S1P and reduced S1P1 stimulation. In a carrageenan-induced model of inflammation, Apom−/− mice had increased vascular leakage compared with that in WT mice. Adenoviral overexpression of ApoM in Apom−/− mice decreased the vascular leakage compared to adenoviral overexpression of green fluorescent protein. The study suggests that vascular leakage of albumin-sized particles in ApoM deficiency is S1P- and S1P1-dependent and this dependency exacerbates the response to inflammatory stimuli.—Christensen, P. M., Liu, C. H., Swendeman, S. L., Obinata, H., Qvortrup, K., Nielsen, L B., Hla, T., Di Lorenzo, A., Christoffersen, C. Impaired endothelial barrier function in apolipoprotein M-deficient mice is dependent on sphingosine-1-phosphate receptor 1. PMID:26956418

  2. Salvianolic acid B restored impaired barrier function via downregulation of MLCK by microRNA-1 in rat inflammatory bowel disease

    Directory of Open Access Journals (Sweden)

    Yongjian eXiong

    2016-05-01

    Full Text Available Salvianolic acid B (Sal B is isolated from the traditional Chinese medical herb Salvia miltiorrhiza and is reported to have a wide range of therapeutic benefits. The aim of this study was to investigate the effects of Sal B on epithelial barrier dysfunction in rat inflammatory bowel disease (IBD and to uncover related mechanisms. Rat IBD model was established by intracolonic administration of 2, 4, 6-trinitrobenzene sulfonic acid (TNBS. The intestinal barrier function was evaluated by measuring the serum recovery of fluorescein isothiocyanate-4 kD dextran in vivo and transepithelial electrical resistance in vitro respectively. The protein expression related to intestinal barrier function was studied using western blotting. Besides, the effects of Sal B on inflammatory responses, oxidative damage and IBD recurrence were also studied in this study. The intestinal barrier dysfunction in IBD was reversed by Sal B, accompanied with the decrease of tight junction proteins, and the effect could be blocked by microRNA-1(miR-1 inhibition. The inflammatory responses, oxidative damage and IBD recurrence were also decreased by Sal B. The IBD symptoms and recurrences were ameliorated by Sal B, and restoration of impaired barrier function via dowunregulation of MLCK by miR-1 maybe involved in this effect. This study provides some novel insights into the both of the pathological mechanisms and treatment alternatives of IBD.

  3. Geniposide ameliorates TNBS-induced experimental colitis in rats via reducing inflammatory cytokine release and restoring impaired intestinal barrier function.

    Science.gov (United States)

    Xu, Bin; Li, Yan-Li; Xu, Ming; Yu, Chang-Chun; Lian, Meng-Qiao; Tang, Ze-Yao; Li, Chuan-Xun; Lin, Yuan

    2017-03-06

    Geniposide is an iridoid glycosides purified from the fruit of Gardenia jasminoides Ellis, which is known to have antiinflammatory, anti-oxidative and anti-tumor activities. The present study aimed to investigate the effects of geniposide on experimental rat colitis and to reveal the related mechanisms. Experimental rat colitis was induced by rectal administration of a TNBS solution. The rats were treated with geniposide (25, 50 mg·kg(-1)·d(-1), ig) or with sulfasalazine (SASP, 100 mg·kg(-1)·d(-1), ig) as positive control for 14 consecutive days. A Caco-2 cell monolayer exposed to lipopolysaccharides (LPS) was used as an epithelial barrier dysfunction model. Transepithelial electrical resistance (TER) was measured to evaluate intestinal barrier function. In rats with TNBS-induced colitis, administration of geniposide or SASP significantly increased the TNBS-decreased body weight and ameliorated TNBS-induced experimental colitis and related symptoms. Geniposide or SASP suppressed inflammatory cytokine (TNF-α, IL-1β, and IL-6) release and neutrophil infiltration (myeloperoxidase activity) in the colon. In Caco-2 cells, geniposide (25-100 μmol/L) ameliorated LPS-induced endothelial barrier dysfunction via dose-dependently increasing transepithelial electrical resistance (TER). The results from both in vivo and in vitro studies revealed that geniposide down-regulated NF-κB, COX-2, iNOS and MLCK protein expression, up-regulated the expression of tight junction proteins (occludin and ZO-1), and facilitated AMPK phosphorylation. Both AMPK siRNA transfection and AMPK overexpression abrogated the geniposide-reduced MLCK protein expression, suggesting that geniposide ameliorated barrier dysfunction via AMPK-mediated inhibition of the MLCK pathway. In conclusion, geniposide ameliorated TNBS-induced experimental rat colitis by both reducing inflammation and modulating the disrupted epithelial barrier function via activating the AMPK signaling pathway..

  4. Mice lacking myosin IXb, an inflammatory bowel disease susceptibility gene, have impaired intestinal barrier function and superficial ulceration in the ileum.

    Science.gov (United States)

    Hegan, Peter S; Chandhoke, Surjit K; Barone, Christina; Egan, Marie; Bähler, Martin; Mooseker, Mark S

    2016-04-01

    Genetic studies have implicated MYO9B, which encodes myosin IXb (Myo9b), a motor protein with a Rho GTPase activating domain (RhoGAP), as a susceptibility gene for inflammatory bowel disease (IBD). Moreover, we have recently shown that knockdown of Myo9b in an intestinal epithelial cell line impairs wound healing and barrier function. Here, we investigated whether mice lacking Myo9b have impaired intestinal barrier function and features of IBD. Myo9b knock out (KO) mice exhibit impaired weight gain and fecal occult blood (indicator of gastrointestinal bleeding), and increased intestinal epithelial cell apoptosis could be detected along the entire intestinal axis. Histologic analysis revealed intestinal mucosal damage, most consistently observed in the ileum, which included superficial ulceration and neutrophil infiltration. Focal lesions contained neutrophils and ultrastructural examination confirmed epithelial discontinuity and the deposition of extracellular matrix. We also observed impaired mucosal barrier function in KO mice. Transepithelial electrical resistance of KO ileum is >3 fold less than WT ileum. The intestinal mucosa is also permeable to high molecular weight dextran, presumably due to the presence of mucosal surface ulcerations. There is loss of tight junction-associated ZO-1, decreased lateral membrane associated E-cadherin, and loss of terminal web associated cytokeratin filaments. Consistent with increased Rho activity in the KO, there is increased subapical expression of activated myosin II (Myo2) based on localization of phosphorylated Myo2 regulatory light chain. Except for a delay in disease onset in the KO, no difference in dextran sulfate sodium-induced colitis and lethality was observed between wild-type and Myo9b KO mice.

  5. Elastase 2 is expressed in human and mouse epidermis and impairs skin barrier function in Netherton syndrome through filaggrin and lipid misprocessing.

    Science.gov (United States)

    Bonnart, Chrystelle; Deraison, Céline; Lacroix, Matthieu; Uchida, Yoshikazu; Besson, Céline; Robin, Aurélie; Briot, Anaïs; Gonthier, Marie; Lamant, Laurence; Dubus, Pierre; Monsarrat, Bernard; Hovnanian, Alain

    2010-03-01

    The human epidermis serves 2 crucial barrier functions: it protects against water loss and prevents penetration of infectious agents and allergens. The physiology of the epidermis is maintained by a balance of protease and antiprotease activities, as illustrated by the rare genetic skin disease Netherton syndrome (NS), in which impaired inhibition of serine proteases causes severe skin erythema and scaling. Here, utilizing mass spectrometry, we have identified elastase 2 (ELA2), which we believe to be a new epidermal protease that is specifically expressed in the most differentiated layer of living human and mouse epidermis. ELA2 localized to keratohyalin granules, where it was found to directly participate in (pro-)filaggrin processing. Consistent with the observation that ELA2 was hyperactive in skin from NS patients, transgenic mice overexpressing ELA2 in the granular layer of the epidermis displayed abnormal (pro-)filaggrin processing and impaired lipid lamellae structure, which are both observed in NS patients. These anomalies led to dehydration, implicating ELA2 in the skin barrier defect seen in NS patients. Thus, our work identifies ELA2 as a major new epidermal protease involved in essential pathways for skin barrier function. These results highlight the importance of the control of epidermal protease activity in skin homeostasis and designate ELA2 as a major protease driving the pathogenesis of NS.

  6. Hydroxyethyl starch (HES 130/0.4 impairs intestinal barrier integrity and metabolic function: findings from a mouse model of the isolated perfused small intestine.

    Directory of Open Access Journals (Sweden)

    Yuk Lung Wong

    Full Text Available The application of hydroxyethyl starch (HES for volume resuscitation is controversially discussed and clinical studies have suggested adverse effects of HES substitution, leading to increased patient mortality. Although, the intestine is of high clinical relevance and plays a crucial role in sepsis and inflammation, information about the effects of HES on intestinal function and barrier integrity is very scarce. We therefore evaluated the effects of clinically relevant concentrations of HES on intestinal function and barrier integrity employing an isolated perfused model of the mouse small intestine.An isolated perfused model of the mouse small intestine was established and intestines were vascularly perfused with a modified Krebs-Henseleit buffer containing 3% Albumin (N=7 or 3% HES (130/0.4; N=7. Intestinal metabolic function (galactose uptake, lactate-to-pyruvate ratio, edema formation (wet-to-dry weight ratio, morphology (histological and electron microscopical analysis, fluid shifts within the vascular, lymphatic and luminal compartments, as well as endothelial and epithelial barrier permeability (FITC-dextran translocation were evaluated in both groups.Compared to the Albumin group, HES perfusion did not significantly change the wet-to-dry weight ratio and lactate-to-pyruvate ratio. However, perfusing the small intestine with 3% HES resulted in a significant loss of vascular fluid (p<0.01, an increased fluid accumulation in the intestinal lumen (p<0.001, an enhanced translocation of FITC-dextran from the vascular to the luminal compartment (p<0.001 and a significantly impaired intestinal galactose uptake (p<0.001. Morphologically, these findings were associated with an aggregation of intracellular vacuoles within the intestinal epithelial cells and enlarged intercellular spaces.A vascular perfusion with 3% HES impairs the endothelial and epithelial barrier integrity as well as metabolic function of the small intestine.

  7. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  8. [Vascular endothelial Barrier Function].

    Science.gov (United States)

    Ivanov, A N; Puchinyan, D M; Norkin, I A

    2015-01-01

    Endothelium is an important regulator of selective permeability of the vascular wall for different molecules and cells. This review summarizes current data on endothelial barrier function. Endothelial glycocalyx structure, its function and role in the molecular transport and leukocytes migration across the endothelial barrier are discussed. The mechanisms of transcellular transport of macromolecules and cell migration through endothelial cells are reviewed. Special section of this article addresses the structure and function of tight and adherens endothelial junction, as well as their importance for the regulation of paracellular transport across the endothelial barrier. Particular attention is paid to the signaling mechanism of endothelial barrier function regulation and the factors that influence on the vascular permeability.

  9. Increased expression of nerve growth factor correlates with visceral hypersensitivity and impaired gut barrier function in diarrhoea-predominant irritable bowel syndrome: a preliminary explorative study.

    Science.gov (United States)

    Xu, X J; Zhang, Y L; Liu, L; Pan, L; Yao, S K

    2017-01-01

    Neural-immune-endocrine network mechanism has attracted increased attention in diarrhoea-predominant irritable bowel syndrome (IBS-D). Pre-clinical evidence indicates that nerve growth factor (NGF) mediates visceral hypersensitivity and gut barrier dysfunction, via interactions with mast cells and sensory nerve fibres. To explore the role of nerve growth factor, as well as mast cell-nerve growth factor-nerve interaction in IBS-D pathophysiology. In this cross-sectional study, IBS-D patients and healthy controls first underwent clinical and psychological assessments. Visceral sensitivity to rectal distension was tested. As gut barrier function markers, serum diamine oxidase and d-lactate were detected. Rectosigmoid biopsies were taken for the analyses of nerve growth factor expression, mast cell count and activation, and sensory nerve fibres expressing transient receptor potential vanilloid 1 and calcitonin gene-related peptide. Correlations between these parameters were examined in patients. Thirty-eight IBS-D patients (28 males, 10 females; average age 30.2 years) and 20 healthy controls (12 males, 8 females; average age 26.8 years) participated in the study. The patients presented increased psychological symptoms, visceral hypersensitivity and impaired gut barrier function. NGF gene expression, mast cell count and sensory nerve fibres were significantly increased in the patients (P sensitivity thresholds were negatively associated with NGF expression (Bonferroni corrected P function in IBS-D. © 2016 John Wiley & Sons Ltd.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Filaggrin and Skin Barrier Function.

    Science.gov (United States)

    Kezic, Sanja; Jakasa, Ivone

    2016-01-01

    The skin barrier function is greatly dependent on the structure and composition of the uppermost layer of the epidermis, the stratum corneum (SC), which is made up of flattened anucleated cells surrounded by highly organized and continuous lipid matrix. The interior of the corneocytes consists mainly of keratin filaments aggregated by filaggrin (FLG) protein. Next, together with several other proteins, FLG is cross-linked into a mechanically robust cornified cell envelope providing a scaffold for the extracellular lipid matrix. In addition to its role for the SC structural and mechanical integrity, FLG degradation products account in part for the water-holding capacity and maintenance of acidic pH of the SC, both crucial for the epidermal barrier homoeostasis by regulating activity of multiple enzymes that control desquamation, lipid synthesis and inflammation. The major determinant of FLG expression in the skin are loss-of-function mutations in FLG, the strongest genetic risk factor for atopic dermatitis (AD), an inflammatory skin disease characterized by a reduced skin barrier function. The prevalence of FLG mutations varies greatly among different populations and ranges from about 10% in Northern Europeans to less than 1% in the African populations. An impaired skin barrier facilitates absorption of potentially hazardous chemicals, which might cause adverse effects in the skin, such as contact dermatitis, or systemic toxicity after their passage into blood. In another direction, a leaky epidermal barrier will lead to enhanced loss of water from the skin. A recent study has shown that even subtle increase in epidermal water loss in newborns increases the risk for AD. Although there are multiple modes of action by which FLG might affect skin barrier it is still unclear whether and how FLG deficiency leads to the reduced skin barrier function. This chapter summarizes the current knowledge in this field obtained from clinical studies, and animal and in vitro models

  12. Impaired barrier function by dietary fructo-oligosaccharides (FOS in rats is accompanied by increased colonic mitochondrial gene expression

    Directory of Open Access Journals (Sweden)

    Kramer Evelien

    2008-03-01

    well as three other peptide hormone genes; peptide YY, pancreatic polypeptide and cholecystokinin. Conclusion We conclude that altered energy metabolism may underly colonic barrier function disruption due to FOS feeding in rats.

  13. Human apolipoprotein E ɛ4 expression impairs cerebral vascularization and blood–brain barrier function in mice

    Science.gov (United States)

    Alata, Wael; Ye, Yue; St-Amour, Isabelle; Vandal, Milène; Calon, Frédéric

    2015-01-01

    Human apolipoprotein E (APOE) exists in three isoforms ɛ2, ɛ3, and ɛ4, of which APOE4 is the main genetic risk factor of Alzheimer's disease (AD). As cerebrovascular defects are associated with AD, we tested whether APOE genotype has an impact on the integrity and function of the blood–brain barrier (BBB) in human APOE-targeted replacement mice. Using the quantitative in situ brain perfusion technique, we first found lower (13.0% and 17.0%) brain transport coefficient (Clup) of [3H]-diazepam in APOE4 mice at 4 and 12 months, compared with APOE2 and APOE3 mice, reflecting a decrease in cerebral vascularization. Accordingly, results from immunohistofluorescence experiments revealed a structurally reduced cerebral vascularization (26% and 38%) and thinner basement membranes (30% and 35%) in 12-month-old APOE4 mice compared with APOE2 and APOE3 mice, suggesting vascular atrophy. In addition, APOE4 mice displayed a 29% reduction in [3H]-d-glucose transport through the BBB compared with APOE2 mice without significant changes in the expression of its transporter GLUT1 in brain capillaries. However, an increase of 41.3% of receptor for advanced glycation end products (RAGE) was found in brain capillaries of 12-month-old APOE4 mice. In conclusion, profound divergences were observed between APOE genotypes at the cerebrovascular interface, suggesting that APOE4-induced BBB anomalies may contribute to AD development. PMID:25335802

  14. Human apolipoprotein E ɛ4 expression impairs cerebral vascularization and blood-brain barrier function in mice.

    Science.gov (United States)

    Alata, Wael; Ye, Yue; St-Amour, Isabelle; Vandal, Milène; Calon, Frédéric

    2015-01-01

    Human apolipoprotein E (APOE) exists in three isoforms ɛ2, ɛ3, and ɛ4, of which APOE4 is the main genetic risk factor of Alzheimer's disease (AD). As cerebrovascular defects are associated with AD, we tested whether APOE genotype has an impact on the integrity and function of the blood-brain barrier (BBB) in human APOE-targeted replacement mice. Using the quantitative in situ brain perfusion technique, we first found lower (13.0% and 17.0%) brain transport coefficient (Clup) of [(3)H]-diazepam in APOE4 mice at 4 and 12 months, compared with APOE2 and APOE3 mice, reflecting a decrease in cerebral vascularization. Accordingly, results from immunohistofluorescence experiments revealed a structurally reduced cerebral vascularization (26% and 38%) and thinner basement membranes (30% and 35%) in 12-month-old APOE4 mice compared with APOE2 and APOE3 mice, suggesting vascular atrophy. In addition, APOE4 mice displayed a 29% reduction in [(3)H]-d-glucose transport through the BBB compared with APOE2 mice without significant changes in the expression of its transporter GLUT1 in brain capillaries. However, an increase of 41.3% of receptor for advanced glycation end products (RAGE) was found in brain capillaries of 12-month-old APOE4 mice. In conclusion, profound divergences were observed between APOE genotypes at the cerebrovascular interface, suggesting that APOE4-induced BBB anomalies may contribute to AD development.

  15. Lipopolysaccharide impairs amyloid beta efflux from brain: altered vascular sequestration, cerebrospinal fluid reabsorption, peripheral clearance and transporter function at the blood–brain barrier

    Directory of Open Access Journals (Sweden)

    Erickson Michelle A

    2012-06-01

    Full Text Available Abstract Background Defects in the low density lipoprotein receptor-related protein-1 (LRP-1 and p-glycoprotein (Pgp clearance of amyloid beta (Aβ from brain are thought to contribute to Alzheimer’s disease (AD. We have recently shown that induction of systemic inflammation by lipopolysaccharide (LPS results in impaired efflux of Aβ from the brain. The same treatment also impairs Pgp function. Here, our aim is to determine which physiological routes of Aβ clearance are affected following systemic inflammation, including those relying on LRP-1 and Pgp function at the blood–brain barrier. Methods CD-1 mice aged between 6 and 8 weeks were treated with 3 intraperitoneal injections of 3 mg/kg LPS at 0, 6, and 24 hours and studied at 28 hours. 125I-Aβ1-42 or 125I-alpha-2-macroglobulin injected into the lateral ventricle of the brain (intracerebroventricular (ICV or into the jugular vein (intravenous (IV was used to quantify LRP-1-dependent partitioning between the brain vasculature and parenchyma and peripheral clearance, respectively. Disappearance of ICV-injected 14 C-inulin from brain was measured to quantify bulk flow of cerebrospinal fluid (CSF. Brain microvascular protein expression of LRP-1 and Pgp was measured by immunoblotting. Endothelial cell localization of LRP-1 was measured by immunofluorescence microscopy. Oxidative modifications to LRP-1 at the brain microvasculature were measured by immunoprecipitation of LRP-1 followed by immunoblotting for 4-hydroxynonenal and 3-nitrotyrosine. Results We found that LPS: caused an LRP-1-dependent redistribution of ICV-injected Aβ from brain parenchyma to brain vasculature and decreased entry into blood; impaired peripheral clearance of IV-injected Aβ; inhibited reabsorption of CSF; did not significantly alter brain microvascular protein levels of LRP-1 or Pgp, or oxidative modifications to LRP-1; and downregulated LRP-1 protein levels and caused LRP-1 mislocalization in cultured brain

  16. Lacking power impairs executive functions

    NARCIS (Netherlands)

    Smith, P.K.; Jostmann, N.B.; Galinsky, A.D.; Dijk, W.W. van

    2008-01-01

    Four experiments explored whether lacking power impairs executive functioning, testing the hypothesis that the cognitive presses of powerlessness increase vulnerability to performance decrements during complex executive tasks. In the first three experiments, low power impaired performance on executi

  17. Skin Barrier Function and Allergens

    DEFF Research Database (Denmark)

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...

  18. Functional barriers: Properties and evaluation

    NARCIS (Netherlands)

    Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

    2005-01-01

    Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of t

  19. Cryotherapy impairs proprioception function?

    OpenAIRE

    Cordeiro, Nuno; Henriques, Sara

    2014-01-01

    INTRODUCTION: Cryotherapy application over a joint causes a nerve conduction velocity decrease and proprioceptive changes. OBJECTIVE: This study aims to determine if cryotherapy impairs proprioception acuity. METHODS: Proprioception was assessed by joint position sense (JPS), measured with an isokinetic dynamometer Biodex System 3, in twenty one females on experimental group, before 15 minutes cryotherapy (T0) and immediately after (T1). A control group (n=20) performed also the JPS...

  20. UNDERSTANDING THE BARRIERS: GROCERY STORES AND VISUALLY IMPAIRED SHOPPERS

    Directory of Open Access Journals (Sweden)

    Doaa Khattab

    2015-11-01

    Grocery stores include many different zones and services with the aisles area being one of the main barriers to access for people with impaired vision.  This area features many different sections such as canned goods, dry packaged goods, spices, drinks and snacks, baking supplies, baby items, cereals, cleaning products, pet supplies, and health and beauty items.  For visually impaired individuals, however, it can be hard to reach these various sections and to find the relevant products.  The purpose of this paper is to present a study that sought to understand the barriers that shoppers with vision impairment (VI face in the grocery store`s built environment. The research approach was based on the application of the ethnography method, Think-aloud Protocol (TAP, Interviews, and behavioural mapping method.

  1. Wet Work and Barrier Function.

    Science.gov (United States)

    Fartasch, Manigé

    2016-01-01

    Wet work defined as unprotected exposure to humid environments/water; high frequencies of hand washing procedures or prolonged glove occlusion is believed to cause irritant contact dermatitis in a variety of occupations. This review considers the recent studies on wet-work exposure and focuses on its influence on barrier function. There are different methods to study the effect of wet work on barrier function. On the one hand, occupational cohorts at risk can be monitored prospectively by skin bioengineering technology and clinical visual scoring systems; on the other hand, experimental test procedures with defined application of water, occlusion and detergents are performed in healthy volunteers. Both epidemiological studies and the results of experimental procedures are compared and discussed. A variety of epidemiological studies analyze occupational cohorts at risk. The measurement of transepidermal water loss, an indicator of the integrity of the epidermal barrier, and clinical inspection of the skin have shown that especially the frequencies of hand washing and water contact/contact to aqueous mixtures seem to be the main factors for the occurrence of barrier alterations. On the other hand, in a single cross-sectional study, prolonged glove wearing (e.g. occlusion for 6 h per shift in clean-room workers) without exposure to additional hazardous substances seemed not to affect the skin negatively. But regarding the effect of occlusion, there is experimental evidence that previously occluded skin challenged with sodium lauryl sulfate leads to an increased susceptibility to the irritant with an aggravation of the irritant reaction. These findings might have relevance for the real-life situation in so far as after occupational glove wearing, the skin is more susceptible to potential hazards to the skin even during leisure hours.

  2. Impairment of intestinal barrier and secretory function as well as egg excretion during intestinal schistosomiasis occur independently of mouse mast cell protease-1.

    NARCIS (Netherlands)

    Rychter, J.; van Nassauw, L.; Brown, J.K.; van Marck, E.; Knight, P.A.; Miller, H.R.P.; Kroese, A.; Timmermans, J.P.

    2010-01-01

    Deposition of Schistosoma mansoni eggs in the intestinal mucosa is associated with recruitment of mucosal mast cells (MMC) expressing mouse mast cell protease-1 (mMCP-1). We investigated the involvement of mMCP-1 in intestinal barrier disruption and egg excretion by examining BALB/c mice lacking mMC

  3. Blood-brain barrier impairment in MPS III patients.

    Science.gov (United States)

    Garbuzova-Davis, Svitlana; Mirtyl, Santhia; Sallot, Sebastian A; Hernandez-Ontiveros, Diana G; Haller, Edward; Sanberg, Paul R

    2013-11-13

    Mucopolysaccharidosis type III (MPS III) is an autosomal recessive disorder caused by deficiency of a specific enzyme leading to heparan sulfate (HS) accumulation within cells and to eventual progressive cerebral and systemic organ abnormalities. Different enzyme deficiencies comprise the MPS III subcategories (A, B, C, D). Since neuropathological manifestations are common to all MPS III types, determining blood-brain barrier (BBB) condition may be critical to understand potential additional disease mechanisms. We investigated BBB integrity in various brain structures of post-mortem tissues from an eleven year old Caucasian female with MPS III A and from a twenty four year old Caucasian female with MPS III D. Control tissues were obtained post-mortem from three Caucasians without neurological deficits: a twelve year old male, a twenty four year old female, and a twenty seven year old female. BBB capillary ultrastructure (electron microscopy) and capillary functional integrity (IgG leakage, tight junction proteins, and lysosomal accumulation within endothelium) were examined. Compromised BBB integrity was found in both MPS III cases. Major study findings were: (1) capillary endothelial and pericyte cell damage; (2) mucopolysaccharide bodies in a majority of endothelial cells and pericytes rupturing cell membranes; (3) severe extracellular edema; (4) IgG microvascular leakage and reductions of occludin and claudin-5 with variations between MPS III types; (5) extensive lysosomal accumulation in capillary endothelium. These new findings of BBB structural and functional impairment, although from only two cases, MPS III A and III D, may have implications for disease pathogenesis and should be considered in treatment development for MPS III.

  4. Blood-CNS Barrier Impairment in ALS Patients versus an Animal Model

    Directory of Open Access Journals (Sweden)

    Svitlana eGarbuzova-Davis

    2014-02-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a severe neurodegenerative disease with a compli-cated and poorly understood pathogenesis. Recently, alterations in the blood-Central Nervous System barrier (B-CNS-B have been recognized as a key factor possibly aggravating motor neuron damage. The majority of findings on ALS microvascular pathology have been deter-mined in mutant SOD1 rodent models, identifying barrier damage during disease develop-ment which might similarly occur in familial ALS patients carrying the SOD1 mutation. However, our knowledge of B-CNS-B competence in sporadic ALS (SALS has been limited. We recently showed structural and functional impairment in postmortem gray and white mat-ter microvessels of medulla and spinal cord tissue from SALS patients, suggesting pervasive barrier damage. Although numerous signs of barrier impairment (endothelial cell degenera-tion, capillary leakage, perivascular edema, downregulation of tight junction proteins, and microhemorrhages are indicated in both mutant SOD1 animal models of ALS and SALS pa-tients, other pathogenic barrier alterations have as yet only been identified in SALS patients. Pericyte degeneration, perivascular collagen IV expansion, and white matter capillary abnor-malities in SALS patients are significant barrier related pathologies yet to be noted in ALS SOD1 animal models. In the current review, these important differences in blood-CNS barrier damage between ALS patients and animal models, which may signify altered barrier transport mechanisms, are discussed. Understanding discrepancies in barrier condition between ALS patients and animal models may be crucial for developing effective therapies.

  5. Impaired function of the blood-testis barrier during aging is preceded by a decline in cell adhesion proteins and GTPases.

    Directory of Open Access Journals (Sweden)

    Catriona Paul

    Full Text Available With increasing age comes many changes in the testis, including germ cell loss. Cell junctions in the testis tether both seminiferous epithelial and germ cells together and assist in the formation of the blood-testis barrier (BTB, which limits transport of biomolecules, ions and electrolytes from the basal to the adluminal compartment and protects post-meiotic germ cells. We hypothesize that as male rats age the proteins involved in forming the junctions decrease and that this alters the ability of the BTB to protect the germ cells. Pachytene spermatocytes were isolated from Brown Norway rat testes at 4 (young and 18 (aged months of age using STA-PUT velocity sedimentation technique. RNA was extracted and gene expression was assessed using Affymetrix rat 230 2.0 whole rat genome microarrays. Microarray data were confirmed by q-RT-PCR and protein expression by Western blotting. Of the genes that were significantly decreased by at least 1.5 fold, 70 were involved in cell adhesion; of these, at least 20 are known to be specifically involved in junction dynamics within the seminiferous epithelium. The mRNA and protein levels of Jam2, Ocln, cdh2 (N-cadherin, ctnna (α-catenin, and cldn11 (involved in adherens junctions, among others, were decreased by approximately 50% in aged spermatocytes. In addition, the GTPases Rac1 and cdc42, involved in the recruitment of cadherins to the adherens junctions, were similarly decreased. It is therefore not surprising that with lower expression of these proteins that the BTB becomes diminished with age. We saw, using a FITC tracer, a gradual collapse of the BTB between 18 and 24 months. This provides the opportunity for harmful substances and immune cells to cross the BTB and cause the disruption of spermatogenesis that is observed with increasing age.

  6. Involvement of cytoskeletal proteins in the barrier function of the human erythrocyte membrane. I. Impairment of resealing and formation of aqueous pores in the ghost membrane after modification of SH groups.

    Science.gov (United States)

    Klonk, S; Deuticke, B

    1992-04-29

    Resealed human erythrocyte ghosts prepared by a two-step procedure were shown to have small residual barrier defects with the properties of aqueous pores, such as size discrimination of hydrophilic nonelectrolytes (erythritol to sucrose), indicative of an apparent pore radius of about 0.7 nm, and a low activation energy (about 12-20 kJ/mol (mannitol, sucrose)) of the leak fluxes. As in other cases (Deuticke et al. (1991) Biochim. Biophys. Acta 1067, 111-122) these leak fluxes can be inhibited by phloretin. Treatment of such resealed ghosts with the mild SH oxidizing agent, diamide, induces additional membrane leaks to the same extent and with the same properties as in native erythrocytes (Deuticke et al. (1983) Biochim. Biophys. Acta 731, 196-210), including reversibility of the leak by SH reducing agents, inhibition by phloretin and stimulation by alkanols. In contrast, resealed ghosts prepared either from diamide-treated erythrocytes or by adding diamide to the 'open' membranes prior to reconstitution of high ionic strength and raising the temperature, exhibit a state of greater leakiness. This leakiness is somewhat different in its origin from the former class of leaks, since it can also be produced by N-ethylmaleimide, which is essentially ineffective when added to the membrane in its 'tight' state. The leaks induced in the 'open' state of the membrane, which can be regarded as a consequence of an impaired resealing, are nevertheless reversible by reducing agents added after resealing and are comparable in many, but not all their characteristics to leaks induced in the 'tight' state of the membrane. Resealing in the presence of the isothiocyanostilbenes DIDS or SITS mimicks the leak forming effect of diamide by modifying a small population of SH groups, while amino groups seem not to be involved. The findings indicate and substantiate an important role of the redox state of membrane skeletal protein sulfhydryls in the maintenance and the re-establishment of the

  7. CD36 deficiency impairs the small intestinal barrier and induces subclinical inflammation in mice

    Science.gov (United States)

    Cifarelli, Vincenza; Ivanov, Stoyan; Xie, Yan; Son, Ni-Huiping; Saunders, Brian T.; Pietka, Terri A.; Shew, Trevor M.; Yoshino, Jun; Sundaresan, Sinju; Davidson, Nicholas O.; Goldberg, Ira J.; Gelman, Andrew E.; Zinselmeyer, Bernd H.; Randolph, Gwendalyn J.; Abumrad, Nada A.

    2016-01-01

    Background & Aims CD36 has immuno-metabolic actions and is abundant in the small intestine on epithelial, endothelial and immune cells. We examined the role of CD36 in gut homeostasis using mice null for CD36 (CD36KO) and with CD36 deletion specific to enterocytes (Ent-CD36KO) or endothelial cells (EC-CD36KO). Methods Intestinal morphology was evaluated using immunohistochemistry and electron microscopy (EM). Intestinal inflammation was determined from neutrophil infiltration and expression of cytokines, toll-like receptors and COX-2. Barrier integrity was assessed from circulating lipopolysaccharide (LPS) and dextran administered intragastrically. Epithelial permeability to luminal dextran was visualized using two photon microscopy. Results The small intestines of CD36KO mice fed a chow diet showed several abnormalities including extracellular matrix (ECM) accumulation with increased expression of ECM proteins, evidence of neutrophil infiltration, inflammation and compromised barrier function. EM showed shortened desmosomes with decreased desmocollin 2 expression. Systemically, leukocytosis and neutrophilia were present together with 80% reduction of anti-inflammatory Ly6Clow monocytes. Bone marrow transplants supported the primary contribution of non-hematopoietic cells to the inflammatory phenotype. Specific deletion of endothelial but not of enterocyte CD36 reproduced many of the gut phenotypes of germline CD36KO mice including fibronectin deposition, increased interleukin 6, neutrophil infiltration, desmosome shortening and impaired epithelial barrier function. Conclusions CD36 loss results in chronic neutrophil infiltration of the gut, impairs barrier integrity and systemically causes subclinical inflammation. Endothelial cell CD36 deletion reproduces the major intestinal phenotypes. The findings suggest an important role of the endothelium in etiology of gut inflammation and loss of epithelial barrier integrity. PMID:28066800

  8. 38 CFR 4.10 - Functional impairment.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Functional impairment. 4... RATING DISABILITIES General Policy in Rating § 4.10 Functional impairment. The basis of disability... addition to the etiological, anatomical, pathological, laboratory and prognostic data required for...

  9. Skin Barrier Function Is Not Impaired and Kallikrein 7 Gene Polymorphism Is Frequently Observed in Korean X-linked Ichthyosis Patients Diagnosed by Fluorescence in Situ Hybridization and Array Comparative Genomic Hybridization.

    Science.gov (United States)

    Lee, Noo Ri; Yoon, Na Young; Jung, Minyoung; Kim, Ji-Yun; Seo, Seong Jun; Wang, Hye-Young; Lee, Hyeyoung; Sohn, Young Bae; Choi, Eung Ho

    2016-08-01

    X-linked ichthyosis (XLI) is a recessively inherited ichthyosis. Skin barrier function of XLI patients reported in Western countries presented minimally abnormal or normal. Here, we evaluated the skin barrier properties and a skin barrier-related gene mutation in 16 Korean XLI patients who were diagnosed by fluorescence in situ hybridization and array comparative genomic hybridization analysis. Skin barrier properties were measured, cytokine expression levels in the stratum corneum (SC) were evaluated with the tape stripped specimen from skin surface, and a genetic test was done on blood. XLI patients showed significantly lower SC hydration, but normal basal trans-epidermal water loss and skin surface pH as compared to a healthy control group. Histopathology of ichthyosis epidermis showed no acanthosis, and levels of the pro-inflammatory cytokines in the corneal layer did not differ between control and lesional/non-lesional skin of XLI patients. Among the mutations in filaggrin (FLG), kallikrein 7 (KLK7), and SPINK5 genes, the prevalence of KLK7 gene mutations was significantly higher in XLI patients (50%) than in controls (0%), whereas FLG and SPINK5 prevalence was comparable. Korean XLI patients exhibited unimpaired skin barrier function and frequent association with the KLK7 gene polymorphism, which may differentiate them from Western XLI patients.

  10. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  11. [Functional impairment associated with cognitive impairment in hospitalised elderly].

    Science.gov (United States)

    Ocampo-Chaparro, José Mauricio; Mosquera-Jiménez, José Ignacio; Davis, Annabelle S; Reyes-Ortiz, Carlos A

    2017-06-24

    The aim of this study was to analyse the effect of cognitive impairment on functional decline in hospitalised patients aged ≥60 years. Measurements at admission included demographic data, Charlson's comorbidity index, and cognitive impairment (according to education level). Data were also collected on hospital length of stay, depression, and delirium developed during hospitalisation. The outcome, Barthel Index (BI), was measured at admission, discharge, and 1-month post-discharge. Patients with BI≤75 at admission (n=54) or with a missing BI value were excluded (n=1). Multivariate logistic regression analyses were conducted to explore predictive factors with functional decline (BI≤75) from admission to discharge, and 1-month later. Of the 133 patients included, 24.8% and 19.6% had a BI≤75 at discharge and at 1-month, respectively. Compared with men, women had more than double risk for functional decline at discharge and 1-month (P<.05). Compared with those without delirium and without cognitive impairment, those with delirium and cognitive impairment had an increased risk for functional decline (BI≤75) at discharge (OR 5.15, 95% CI; 1.94-13.67), and at 1-month (OR 6.26, 95% CI; 2.30-17.03). Similarly, those with comorbidity (≥2) had increased functional decline at discharge (OR 2.36, 95% CI; 1.14-4.87), and at 1-month after discharge (OR 2.71, 95% CI; 1.25-5.89). Delirium during hospitalisation, together with cognitive impairment on admission, was a strong predictor of functional decline. Copyright © 2017 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.

  12. Eating disorder severity and functional impairment

    DEFF Research Database (Denmark)

    Davidsen, Annika Helgadóttir; Hoyt, William T.; Poulsen, Stig Bernt

    2017-01-01

    diagnosed with bulimia nervosa, binge eating disorder or eating disorder not otherwise specified. Regression analysis was applied to assess the effect of the hypothesized moderators and mediators. Eating disorder severity was measured with the Eating Disorder Examination Questionnaire, functional impairment...

  13. Permanent isolation surface barrier: Functional performance

    Energy Technology Data Exchange (ETDEWEB)

    Wing, N.R.

    1993-10-01

    This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release.

  14. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  15. Impaired Leydig cell function in infertile men

    DEFF Research Database (Denmark)

    Andersson, A-M; Jørgensen, N; Frydelund-Larsen, L

    2004-01-01

    To investigate whether an impaired Leydig cell function is present in severely oligospermic men, serum testosterone (T), LH, estradiol (E(2)), and SHBG levels in 357 idiopathic infertile men were compared with levels in 318 proven fertile men. In addition, the T/LH ratio, E(2)/T ratio...... of the fertile levels.Thus, the group of infertile men showed significant signs of impaired Leydig cell function in parallel to their impaired spermatogenesis. The association of decreased spermatogenesis and impaired Leydig cell function might reflect a disturbed paracrine communication between the seminiferous......, and calculated free T index (cFT) were compared between the two groups.A shift toward lower serum T levels, cFT, and T/LH ratio and higher serum LH, E(2), and E(2)/T levels was observed in the group of infertile men. On average, the infertile men had 18, 26, and 34% lower serum T, cFT, and T/LH levels...

  16. Barriers and Enablers for Visually Impaired Students at a UK Higher Education Institution

    Science.gov (United States)

    Bishop, Daniel; Rhind, Daniel J. A.

    2011-01-01

    The present study explored the factors which represent barriers and enablers to participation in Higher Education for students who are visually impaired. Semi-structured interviews were conducted with nine visually impaired students who were studying at a Higher Education Institution in the United Kingdom. Interpretative Phenomenological Analysis…

  17. Ceramides and barrier function in healthy skin

    OpenAIRE

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue; Høgh, Julie Kaae; Jemec, GBE; Agner, T

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal ...

  18. Ceramides and barrier function in healthy skin

    OpenAIRE

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue; Høgh, Julie Kaae; Jemec, GBE; Agner, T

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal ...

  19. Bacillus anthracis lethal toxin reduces human alveolar epithelial barrier function.

    Science.gov (United States)

    Langer, Marybeth; Duggan, Elizabeth Stewart; Booth, John Leland; Patel, Vineet Indrajit; Zander, Ryan A; Silasi-Mansat, Robert; Ramani, Vijay; Veres, Tibor Zoltan; Prenzler, Frauke; Sewald, Katherina; Williams, Daniel M; Coggeshall, Kenneth Mark; Awasthi, Shanjana; Lupu, Florea; Burian, Dennis; Ballard, Jimmy Dale; Braun, Armin; Metcalf, Jordan Patrick

    2012-12-01

    The lung is the site of entry for Bacillus anthracis in inhalation anthrax, the deadliest form of the disease. Bacillus anthracis produces virulence toxins required for disease. Alveolar macrophages were considered the primary target of the Bacillus anthracis virulence factor lethal toxin because lethal toxin inhibits mouse macrophages through cleavage of MEK signaling pathway components, but we have reported that human alveolar macrophages are not a target of lethal toxin. Our current results suggest that, unlike human alveolar macrophages, the cells lining the respiratory units of the lung, alveolar epithelial cells, are a target of lethal toxin in humans. Alveolar epithelial cells expressed lethal toxin receptor protein, bound the protective antigen component of lethal toxin, and were subject to lethal-toxin-induced cleavage of multiple MEKs. These findings suggest that human alveolar epithelial cells are a target of Bacillus anthracis lethal toxin. Further, no reduction in alveolar epithelial cell viability was observed, but lethal toxin caused actin rearrangement and impaired desmosome formation, consistent with impaired barrier function as well as reduced surfactant production. Therefore, by compromising epithelial barrier function, lethal toxin may play a role in the pathogenesis of inhalation anthrax by facilitating the dissemination of Bacillus anthracis from the lung in early disease and promoting edema in late stages of the illness.

  20. N-Butylphthalide Alleviates Blood-Brain Barrier Impairment in Rats Exposed to Carbon Monoxide

    Directory of Open Access Journals (Sweden)

    Mingjun Bi

    2016-10-01

    Full Text Available Carbon monoxide (CO poisoning is one of the most important health concerns and may result in neuropathologic changes and neurologic sequelae. However, few studies have addressed the correlation between CO poisoning and blood-brain barrier (BBB impairment. In this study, we investigated the effects of N-butylphthalide (NBP on the expressions of zonula occludens-1 (ZO-1, claudin-5 and aquaporin-4 (AQP-4 proteins in a CO poisoning rat model. The results indicated that the brain water content was obviously increased, and the tight junctions (TJs between endothelial cells were disrupted, resulting in significant cerebral edema and BBB dysfunction in a rat model of CO poisoning. Meanwhile, the ultrastructure of endothelial cells and pericytes was seriously damaged, and the expressions of ZO-1 and claudin-5 were decreased at an early stage (<7 days. NBP treatment could efficiently maintain the ultrastructural and functional integrity of BBB, alleviate cerebral edema. Besides, NBP could also markedly increase the levels of both ZO-1 and claudin-5 proteins compared with those in rats exposed to CO (P<0.05, whereas NBP had no apparent regulatory effect on AQP-4 expression. Taken together, this study highlights the importance of ZO-1 and claudin-5 proteins in maintaining BBB ultrastructure and function after CO poisoning. NBP, as a novel treatment approach, may effectively inhibit the down-regulation of ZO-1 and claudin-5 proteins (but not AQP-4, thereby preserving the barrier function and reducing cerebral edema after CO poisoning.

  1. New treatments for restoring impaired epidermal barrier permeability: skin barrier repair creams.

    Science.gov (United States)

    Draelos, Zoe Diana

    2012-01-01

    Skin health depends on an intact barrier composed of protein-rich corneocytes surrounded by the lamellar intercellular lipids. This barrier provides waterproof protection for the body, preventing infection, regulating electrolyte balance, maintaining body temperature, and providing a mechanism for sensation. Damage to the skin barrier results in skin disease that can be treated by a variety of externally applied substances, such as ceramides, hyaluronic acid, licorice extracts, dimethicone, petrolatum, and paraffin wax. These substances are found in moisturizers that are sold as cosmetics and in prescriptions as 510(k) devices. This contribution examines the formulation and effect of skin barrier creams.

  2. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue;

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  3. The Clinical Functional Impairment Scale Development.

    Science.gov (United States)

    Sandler, Adrian; Wright, Mary Ellen; Denslow, Sheri

    2017-10-01

    The purpose of the project was to review content validity and assess the span of responses for the newly developed Clinical Functional Impairment Scale (CFIS). A cross-sectional, content validity process using focus groups of developmental, behavioral pediatric clinicians was conducted. After qualitative analysis of the focus group data, adjustments were made in the CFIS based on the recommendations of the content experts. A survey was conducted of clinicians participating in the online Society of Developmental and Behavioral Pediatrics Discussion Board. Clinicians reviewed 2 case studies and used the CFIS to score severity and interval change of predetermined functional impairments. The amount of spread in the answers was assessed by calculating the index of dispersion. Qualitative analysis of the focus groups resulted in adjustment to the CFIS to 20 functional impairments, with a 5-point Likert scale of severity and a 7-point Likert scale of interval change. Ninety-four clinicians participated in the survey. The index of dispersion ranged from 0.49 to 0.88. The interval ratings of severity and interval change had lower dispersion ranges. The CFIS uses a mutual prioritization by the family and clinician of the child's functional impairments. The study demonstrated that the clinicians' ratings of the case studies were more variable in the initial symptom severity score than their ratings of symptom severity and interval change in symptoms. Further testing of the CFIS is planned using face-to-face clinical encounters and including parent/caregiver ratings of severity and interval change.

  4. Insulin analogues may accelerate progression of diabetic retinopathy after impairment of inner blood-retinal barrier.

    Science.gov (United States)

    Kaya, Abdullah; Kar, Taner; Aksoy, Yakup; Özalper, Veysel; Başbuğ, Barbaros

    2013-12-01

    Diabetic retinopathy regresses after spontaneous infarction or surgical ablation of pituitary gland. Growth hormone deficiency seems to be a protective factor for development of diabetic retinopathy in dwarfs. Despite the same glycemic control, development of diabetic retinopathy is significantly higher in pubertal subjects than pre-pubertal subjects. These evidences indicate a strong relationship between growth hormone and progression of diabetic retinopathy. Insulin like growth factor-1 (IGF-1) is the most important mediator of effects of growth hormone (GH). It stimulates IGF-1 receptor. Insulin analogues also stimulate IGF-1 receptor. Therefore insulin analogues may show similar effects like growth hormone and deteriorate diabetic retinopathy. However we suggest that impairment degree of inner blood-retinal barrier should be considered for this claim. We hypothesize that insulin analogues have dual effects (beneficial and worsening) depending on stage of impairment of inner blood-retinal barrier. Insulin analogues protect pericytes and blood-retinal barrier by decreasing blood glucose level. Analogues may pass into the retinal tissue in very low amounts when inner blood-retinal barrier is intact. Therefore, insulin analogues may not deteriorate diabetic retinopathy but also have beneficial effect by protecting blood-retinal barrier at this stage. However, they may pass into the retinal tissue in much more amounts when inner blood-retinal barrier impairs. Analogues may deteriorate cellular composition of retina through stimulation of IGF-1 receptors. A number of different cell types, including glia, retinal pigment epithelial cells and fibroblast-like cells have been identified in diabetic epiretinal tissues. Insulin analogues may cause proliferation in these cells. A type of glial cell named Non-astrocytic Inner Retinal Glia-like (NIRG) cell was identified to be stimulated and proliferate by IGF-1. IGF has been reported to generate traction force in retinal

  5. Can probiotics modulate human disease by impacting intestinal barrier function?

    NARCIS (Netherlands)

    Bron, Peter A.; Kleerebezem, Michiel; Brummer, Robert Jan; Cani, Patrice D.; Mercenier, Annick; MacDonald, Thomas T.; Garcia-Ródenas, Clara L.; Wells, Jerry M.

    2017-01-01

    Intestinal barrier integrity is a prerequisite for homeostasis of mucosal function, which is balanced to maximise absorptive capacity, while maintaining efficient defensive reactions against chemical and microbial challenges. Evidence is mounting that disruption of epithelial barrier integrity is

  6. Gastric barrier function and toxic damage.

    Science.gov (United States)

    Niv, Yaron; Banić, Marko

    2014-01-01

    Gastric epithelium is the first significant barrier between the inner body and the potentially toxic material in the lumen. Nutrients affect gastric barrier continuously--alcohol, coffee, spices, salted food, etc. Also, very potent noxious agents are widely prescribed drugs--nonsteroidal anti-inflammatory drugs (NSAIDs), aspirin and selective serotonin reuptake inhibitors. Helicobacter pylori is a well-known and well-investigated pathogen associated with serious gastric damage and gastric carcinoma. For its defense and maintenance of homeostasis and integrity, except acid secretion and maintenance of low luminal pH, gastric mucosa also has a specific structure, and its function is influenced by different control mechanisms. These include control of mucosal blood flow, control of mucus and bicarbonate secretion, constant cell renewal, and neuronal and hormonal control of defense mechanisms. These mechanisms are mediated by prostaglandins, nitric oxide, growth factors, heat-shock proteins and a neuropeptide called calcitonin gene-related protein. Adrenal glucocorticoids and the central nervous system also play an important role in regulating gastro-protection, especially hypothalamus and the dorsal vagal complex. Gastric mucosa is also an important component of the body's immune system and gut-associated lymphoid tissue which serves as the initiation site for antigen-specific humoral and cell-mediated immune response. Treatment options for gastric barrier dysfunction and damage due to aforementioned noxious agents are guided by the nature of damage and our understanding of the pathophysiological mechanisms involved. Currently, management is guideline driven and depends upon eradication treatment in patients infected with H. pylori and treatment or prevention of aspirin or NSAID ulceration. © 2014 S. Karger AG, Basel.

  7. Ceramides and barrier function in healthy skin.

    Science.gov (United States)

    Mutanu Jungersted, Jakob; Hellgren, Lars I; Høgh, Julie K; Drachmann, T; Jemec, Gregor B E; Agner, Tove

    2010-07-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found for men than for women (p = 0.02).

  8. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

  9. Impairment of brain endothelial glucose transporter by methamphetamine causes blood-brain barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Murrin L Charles

    2011-03-01

    Full Text Available Abstract Background Methamphetamine (METH, an addictive psycho-stimulant drug with euphoric effect is known to cause neurotoxicity due to oxidative stress, dopamine accumulation and glial cell activation. Here we hypothesized that METH-induced interference of glucose uptake and transport at the endothelium can disrupt the energy requirement of the blood-brain barrier (BBB function and integrity. We undertake this study because there is no report of METH effects on glucose uptake and transport across the blood-brain barrier (BBB to date. Results In this study, we demonstrate that METH-induced disruption of glucose uptake by endothelium lead to BBB dysfunction. Our data indicate that a low concentration of METH (20 μM increased the expression of glucose transporter protein-1 (GLUT1 in primary human brain endothelial cell (hBEC, main component of BBB without affecting the glucose uptake. A high concentration of 200 μM of METH decreased both the glucose uptake and GLUT1 protein levels in hBEC culture. Transcription process appeared to regulate the changes in METH-induced GLUT1 expression. METH-induced decrease in GLUT1 protein level was associated with reduction in BBB tight junction protein occludin and zonula occludens-1. Functional assessment of the trans-endothelial electrical resistance of the cell monolayers and permeability of dye tracers in animal model validated the pharmacokinetics and molecular findings that inhibition of glucose uptake by GLUT1 inhibitor cytochalasin B (CB aggravated the METH-induced disruption of the BBB integrity. Application of acetyl-L-carnitine suppressed the effects of METH on glucose uptake and BBB function. Conclusion Our findings suggest that impairment of GLUT1 at the brain endothelium by METH may contribute to energy-associated disruption of tight junction assembly and loss of BBB integrity.

  10. Barriers to and facilitators of sports participation in people with visual impairments

    NARCIS (Netherlands)

    Jaarsma, Eva A; Dekker, Rienk; Koopmans, Steven A; Dijkstra, Pieter U; Geertzen, Joannes

    2014-01-01

    We examined barriers to and facilitators of sports participation in people with visual impairments. Participants registered at Royal Visio, Bartiméus, and the Eye Association were invited to complete a questionnaire (telephone or online). Six hundred forty-eight of the invited participants (13%) com

  11. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  12. Alterations of blood brain barrier function in hyperammonemia: an overview.

    Science.gov (United States)

    Skowrońska, Marta; Albrecht, Jan

    2012-02-01

    Ammonia is a neurotoxin involved in the pathogenesis of neurological conditions associated with hyperammonemia, including hepatic encephalopathy, a condition associated with acute--(ALF) or chronic liver failure. This article reviews evidence that apart from directly affecting the metabolism and function of the central nervous system cells, ammonia influences the passage of different molecules across the blood brain barrier (BBB). A brief description is provided of the tight junctions, which couple adjacent cerebral capillary endothelial cells to each other to form the barrier. Ammonia modulates the transcellular passage of low-to medium-size molecules, by affecting their carriers located at the BBB. Ammonia induces interrelated aberrations of the transport of the large neutral amino acids and aromatic amino acids (AAA), whose influx is augmented by exchange with glutamine produced in the course of ammonia detoxification, and maybe also modulated by the extracellularly acting gamma-glutamyl moiety transferring enzyme, gamma-glutamyl-transpeptidase. Impaired AAA transport affects neurotransmission by altering intracerebral synthesis of catecholamines (serotonin and dopamine), and producing "false neurotransmitters" (octopamine and phenylethylamine). Ammonia also modulates BBB transport of the cationic amino acids: the nitric oxide precursor, arginine, and ornithine, which is an ammonia trap, and affects the transport of energy metabolites glucose and creatine. Moreover, ammonia acting either directly or in synergy with liver injury-derived inflammatory cytokines also evokes subtle increases of the transcellular passage of molecules of different size (BBB "leakage"), which appears to be responsible for the vasogenic component of cerebral edema associated with ALF.

  13. Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

    Science.gov (United States)

    Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

    2016-08-01

    OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility.

  14. Evaluation of functional impairment in psoriasis

    Directory of Open Access Journals (Sweden)

    Gaikwad Rohini

    2006-01-01

    Full Text Available Background: Psoriasis is a chronic disease, the course of which is punctuated by exacerbations and remissions. The impact of a chronic, relapsing, and disfiguring disease such as psoriasis on occupational, social, and other areas of functioning is substantial and needs attention. Aim: The purpose of this study was to assess the level and nature of functional impairment in psoriasis. Methods: Forty-three consecutive patients attending the dermatology clinic of a rural hospital were studied for psychiatric comorbidity and the level of functioning, using a semistructured questionnaire. Results: Psoriasis affected social functioning of 48% patients, led to decreased work efficiency in 51.1%, and to subjective distress at work in 62.8% of patients. Stress in home environment and interpersonal relationships was reported by 69.8%. Social and occupational functioning worsened with increasing severity of psoriasis after 1-year duration of illness. Patients complaining of pruritis frequently had anxiety disorders. Psychiatric comorbidity was detected in 67.4% cases. Conclusion : Substantial proportion of patients suffered deterioration of functioning, especially with increasing duration of illness. Thus, timely attention by dermatologists is needed in order to limit the disability caused by psoriasis. To achieve this, liaison with psychiatrist would be crucial along with illness education and emotional support.

  15. Epithelial IL-18 Equilibrium Controls Barrier Function in Colitis

    NARCIS (Netherlands)

    Nowarski, Roni; Jackson, Ruaidhrí; Gagliani, Nicola; de Zoete, Marcel R; Palm, Noah W; Bailis, Will; Low, Jun Siong; Harman, Christian C D; Graham, Morven; Elinav, Eran; Flavell, Richard A

    2015-01-01

    The intestinal mucosal barrier controlling the resident microbiome is dependent on a protective mucus layer generated by goblet cells, impairment of which is a hallmark of the inflammatory bowel disease, ulcerative colitis. Here, we show that IL-18 is critical in driving the pathologic breakdown of

  16. Epithelial IL-18 Equilibrium Controls Barrier Function in Colitis

    NARCIS (Netherlands)

    Nowarski, Roni; Jackson, Ruaidhrí; Gagliani, Nicola; de Zoete, Marcel R|info:eu-repo/dai/nl/30483419X; Palm, Noah W; Bailis, Will; Low, Jun Siong; Harman, Christian C D; Graham, Morven; Elinav, Eran; Flavell, Richard A

    2015-01-01

    The intestinal mucosal barrier controlling the resident microbiome is dependent on a protective mucus layer generated by goblet cells, impairment of which is a hallmark of the inflammatory bowel disease, ulcerative colitis. Here, we show that IL-18 is critical in driving the pathologic breakdown of

  17. Inferential Functioning in Visually Impaired Children

    Science.gov (United States)

    Puche-Navarro, Rebeca; Millan, Rafael

    2007-01-01

    The current study explores the inferential abilities of visually impaired children in a task presented in two formats, manipulative and verbal. The results showed that in the group of visually impaired children, just as with children with normal sight, there was a wide range of inference types. It was found that the visually impaired children…

  18. Insulin resistance impairs nigrostriatal dopamine function.

    Science.gov (United States)

    Morris, J K; Bomhoff, G L; Gorres, B K; Davis, V A; Kim, J; Lee, P-P; Brooks, W M; Gerhardt, G A; Geiger, P C; Stanford, J A

    2011-09-01

    Clinical studies have indicated a link between Parkinson's disease (PD) and Type 2 Diabetes. Although preclinical studies have examined the effect of high-fat feeding on dopamine function in brain reward pathways, the effect of diet on neurotransmission in the nigrostriatal pathway, which is affected in PD and parkinsonism, is less clear. We hypothesized that a high-fat diet, which models early-stage Type 2 Diabetes, would disrupt nigrostriatal dopamine function in young adult Fischer 344 rats. Rats were fed a high fat diet (60% calories from fat) or a normal chow diet for 12 weeks. High fat-fed animals were insulin resistant compared to chow-fed controls. Potassium-evoked dopamine release and dopamine clearance were measured in the striatum using in vivo electrochemistry. Dopamine release was attenuated and dopamine clearance was diminished in the high-fat diet group compared to chow-fed rats. Magnetic resonance imaging indicated increased iron deposition in the substantia nigra of the high fat group. This finding was supported by alterations in the expression of several proteins involved in iron metabolism in the substantia nigra in this group compared to chow-fed animals. The diet-induced systemic and basal ganglia-specific changes may play a role in the observed impairment of nigrostriatal dopamine function. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Barrier function in the peripheral and central nervous system-a review.

    Science.gov (United States)

    Reinhold, A K; Rittner, H L

    2017-01-01

    The peripheral (PNS) and central nervous system (CNS) are delicate structures, highly sensitive to homeostatic changes-and crucial for basic vital functions. Thus, a selection of barriers ensures the protection of the nervous system from noxious blood-borne or surrounding stimuli. In this chapter, anatomy and functioning of the blood-nerve (BNB), the blood-brain (BBB), and the blood-spinal cord barriers (BSCB) are presented and the key tight junction (TJ) proteins described: claudin-1, claudin-3, claudin-5, claudin-11, claudin-12, claudin-19, occludin, Zona occludens-1 (ZO-1), and tricellulin are by now identified as relevant for nerval barriers. Different diseases can lead to or be accompanied by neural barrier disruption, and impairment of these barriers worsens pathology. Peripheral nerve injury and inflammatory polyneuropathy cause an increased permeability of BNB as well as BSCB, while, e.g., diseases of the CNS such as amyotrophic lateral sclerosis, multiple sclerosis, spinal cord injury, or Alzheimer's disease can progress and worsen through barrier dysfunction. Moreover, the complex role and regulation of the BBB after ischemic stroke is described. On the other side, PNS and CNS barriers hamper the delivery of drugs in diseases when the barrier is intact, e.g., in certain neurodegenerative diseases or inflammatory pain. Understanding of the barrier - regulating processes has already lead to the discovery of new molecules as drug enhancers. In summary, the knowledge of all of these mechanisms might ultimately lead to the invention of drugs to control barrier function to help ameliorating or curing neurological diseases.

  20. Human skin penetration and local effects of topical nano zinc oxide after occlusion and barrier impairment.

    Science.gov (United States)

    Leite-Silva, V R; Sanchez, W Y; Studier, H; Liu, D C; Mohammed, Y H; Holmes, A M; Ryan, E M; Haridass, I N; Chandrasekaran, N C; Becker, W; Grice, J E; Benson, H A E; Roberts, M S

    2016-07-01

    Public health concerns continue to exist over the safety of zinc oxide nanoparticles that are commonly used in sunscreen formulations. In this work, we assessed the effects of two conditions which may be encountered in everyday sunscreen use, occlusion and a compromised skin barrier, on the penetration and local toxicity of two topically applied zinc oxide nanoparticle products. Caprylic/capric triglyceride (CCT) suspensions of commercially used zinc oxide nanoparticles, either uncoated or with a silane coating, were applied to intact and barrier impaired skin of volunteers, without and with occlusion for a period of six hours. The exposure time was chosen to simulate normal in-use conditions. Multiphoton tomography with fluorescence lifetime imaging was used to noninvasively assess zinc oxide penetration and cellular metabolic changes that could be indicative of toxicity. We found that zinc oxide nanoparticles did not penetrate into the viable epidermis of intact or barrier impaired skin of volunteers, without or with occlusion. We also observed no apparent toxicity in the viable epidermis below the application sites. These findings were validated by ex vivo human skin studies in which zinc penetration was assessed by multiphoton tomography with fluorescence lifetime imaging as well as Zinpyr-1 staining and toxicity was assessed by MTS assays in zinc oxide treated skin cryosections. In conclusion, applications of zinc oxide nanoparticles under occlusive in-use conditions to volunteers are not associated with any measurable zinc oxide penetration into, or local toxicity in the viable epidermis below the application site.

  1. The important role of stratum corneum lipids for the cutaneous barrier function.

    Science.gov (United States)

    van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

    2014-03-01

    The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias.

  2. Impaired endothelial function in lone atrial fibrillation

    Directory of Open Access Journals (Sweden)

    Polovina Marija

    2013-01-01

    Full Text Available Background/Aim. Impaired endothelial function has been previously documented in patients with atrial fibrillation (AF and underlying comorbidities or older patients with idiopathic AF. The aim of this study was to evaluate systemic endothelial function in younger AF patients (less than 7 days lone AF. The second group comprised of 28 healthy controls in sinus rhythm (the mean age 43 ± 13, 53% male, matched by age, gender and atherosclerotic risk factors. All the participants underwent physical examination, laboratory analysis [including determination of C-reactive protein (CRP], standard echocardiography and exercise-stress testing. Brachial artery FMD and endothelium independent dilation (NMD were assessed with a high-resolution ultrasound probe and arterial diameters taken from 5 consecutive cardiac cycles were averaged for each measurement to accommodate to beat-to-beat flow variations in AF. Results. There were no differences between the 2 groups regarding age, gender and most clinical, laboratory and echocardiographic characteristics (all p > 0.05, apart from the increased heart rate (p = 0.018, body mass index (p = 0.027, CRP levels (p = 0.007 and left atrial anteroposterior dimension (p 0.05. In the multivariate analysis, the independent FMD determinants in our study population were the presence of AF, smoking and total cholesterol levels (all p < 0.001. In patients with AF, the strongest independent FMD determinant was arrhythmia duration (p < 0.001, followed by smoking (p = 0.013 and total cholesterol levels (p = 0.045. Conclusions. Our findings confirm that sustained AF is associated with systemic endothelial dysfunction even in relatively young patients with no cardiovascular disorders or risk factors. AF is an independent contributor to lower FMD and a prolonged arrhythmia duration may confer the risk for more profound endothelial damage.

  3. Structure and function of the epidermis related to barrier properties.

    Science.gov (United States)

    Baroni, Adone; Buommino, Elisabetta; De Gregorio, Vincenza; Ruocco, Eleonora; Ruocco, Vincenzo; Wolf, Ronni

    2012-01-01

    The most important function of the skin is the formation of a barrier between the "inside" and the "outside" of the organism, which prevents invasion of pathogens and fends off chemical assaults as well as the unregulated loss of water and solutes. The physical barrier is mainly localized in the stratum corneum, which consists of protein-enriched cells and lipid-enriched intercellular domains. Any modifications in epidermal differentiation and lipid composition results in altered barrier function, a central event in various skin alterations and diseases. This contribution presents a brief description of the structure of the skin, paying attention to the most important components responsible for skin barrier function. Copyright © 2012. Published by Elsevier Inc.

  4. The Flux-Flux Correlation Function for Anharmonic Barriers

    CERN Document Server

    Goussev, Arseni; Waalkens, Holger; Wiggins, Stephen

    2010-01-01

    The flux-flux correlation function formalism is a standard and widely used approach for the computation of reaction rates. In this paper we introduce a method to compute the classical and quantum flux-flux correlation functions for anharmonic barriers essentially analytically through the use of the classical and quantum normal forms. In the quantum case we show that the quantum normal form reduces the computation of the flux-flux correlation function to that of an effective one dimensional anharmonic barrier. The example of the computation of the quantum flux-flux correlation function for a fourth order anharmonic barrier is worked out in detail, and we present an analytical expression for the quantum mechanical microcanonical flux-flux correlation function. We then give a discussion of the short-time and harmonic limits.

  5. Prophylactic treatment with growth hormone improves intestinal barrier function and alleviates bacterial translocation in stressed rats

    Institute of Scientific and Technical Information of China (English)

    丁连安; 黎介寿; 李幼生; 刘放南; 谭力

    2004-01-01

    Background Damage to the gut barrier often occurs during critical illnesses. In such cases, it is very important to alleviate impairment of the intestinal barrier and protect intestinal barrier function. This study investigated the protective effect of growth hormone on intestinal barrier function in rats under stress.Methods This study consisted of prospective, randomized, and controlled animal experiments. Twenty-five Sprague-Dawley rats served as total parenteral nutrition (TPN) models and were divided into three groups: TPN group, sepsis (Sep) group, and growth hormone (GH) group. Another 8 rats served as normal controls. Each group received different stress stimuli. Rats were fed for 7 days, and samples were taken for examination 24 hours after garaging with dual saccharides. Results The architecture of the small intestinal mucosa in the Sep group showed the most severe damage among all groups. Nitric oxide levels in blood plasma and immunoglobulin A levels in the intestinal mucosa of the GH group were significantly lower than in the Sep group (P<0.02). There were no significant changes in CD3 counts and in the CD4/CD8 ratio between the four groups. Dual sugar tests and bacteriological examinations revealed that intestinal permeability and rate of bacterial translocation in the GH group were lower than in the Sep group (P<0.01, respectively).Conclusion Prophylactic treatment with growth hormone can alleviate damage to intestinal barrier function caused by trauma and endotoxemia in rats under stress.

  6. Barriers to accessing eye care services among visually impaired populations in rural Andhra Pradesh, South India

    Directory of Open Access Journals (Sweden)

    Kovai Vilas

    2007-01-01

    Full Text Available Purpose: To understand the reasons why people in rural south India with visual impairment arising from various ocular diseases do not seek eye care. Materials and Methods: A total of 5,573 persons above the age of 15 were interviewed and examined in the South Indian state of Andhra Pradesh covering the districts of Adilabad, West Godavari and Mahaboobnagar. A pre-tested structured questionnaire on barriers to eye care was administered by trained field investigators. Results: Of the eligible subjects, 1234 (22.1%, N=5573 presented with distant visual acuity < 20/60 or equivalent visual field loss in the better eye. Of these, 898 (72.7%, N=1234 subjects had not sought treatment despite noticing a decrease in vision citing personal, economic and social reasons. The analysis also showed that the odds of seeking treatment was significantly higher for literates [odds ratio (OR 1.91, 95% confidence interval (CI 1.38 to 2.65], for those who would be defined as blind by visual acuity category (OR 1.35, 95% CI 0.96 to 1.90 and for those with cataract and other causes of visual impairment (OR 1.50, 95% CI 1.11 to 2.03. Barriers to seeking treatment among those who had not sought treatment despite noticing a decrease in vision over the past five years were personal in 52% of the respondents, economic in 37% and social in 21%. Conclusion: Routine planning for eye care services in rural areas of India must address the barriers to eye care perceived by communities to increase the utilization of services.

  7. Minocycline ameliorates prenatal valproic acid induced autistic behaviour, biochemistry and blood brain barrier impairments in rats.

    Science.gov (United States)

    Kumar, Hariom; Sharma, Bhupesh

    2016-01-01

    Autism is a neurodevelopment disorder. One percent worldwide population suffers with autism and males suffer more than females. Microglia plays an important role in neurodevelopment, neuropsychiatric and neurodegenerative disorders. The present study has been designed to investigate the role of minocycline in prenatal valproic acid induced autism in rats. Animals with prenatal valproic acid have reduced social interaction (three chamber social behaviour apparatus), spontaneous alteration (Y-Maze), exploratory activity (Hole board test), intestinal motility, serotonin levels (both in prefrontal cortex and ileum) and prefrontal cortex mitochondrial complex activity (complexes I, II, IV). Furthermore, prenatal valproic acid treated animals have shown an increase in locomotion (actophotometer), anxiety (elevated plus maze), brain oxidative stress (thiobarbituric acid reactive species, glutathione, catalase), nitrosative stress (nitrite/nitrate), inflammation (both in brain and ileum myeloperoxidase activity), calcium and blood brain barrier permeability. Treatment with minocycline significantly attenuated prenatal valproic acid induced reduction in social interaction, spontaneous alteration, exploratory activity intestinal motility, serotonin levels and prefrontal cortex mitochondrial complex activity. Furthermore, minocycline has also attenuated prenatal valproic acid induced increase in locomotion, anxiety, brain oxidative and nitrosative stress, inflammation, calcium and blood brain barrier permeability. Thus, it may be concluded that prenatal valproic acid has induced autistic behaviour, biochemistry and blood brain barrier impairment in animals, which were significantly attenuated by minocycline. Minocycline should be explored further for its therapeutic benefits in autism.

  8. Cordycepin attenuates traumatic brain injury-induced impairments of blood-brain barrier integrity in rats.

    Science.gov (United States)

    Yuan, Jing; Wang, Aihua; He, Yan; Si, Zhihua; Xu, Shan; Zhang, Shanchao; Wang, Kun; Wang, Dawei; Liu, Yiming

    2016-10-01

    Loss of blood-brain barrier (BBB) integrity is a downstream event caused by traumatic brain injury (TBI). BBB integrity is affected by certain physiological conditions, including inflammation and oxidative stress. Cordycepin is a susbtance with anti-inflammatory and anti-oxidative effects. Therefore, it is necessary to investigate whether cordycepin affects TBI-induced impairments of BBB integrity. Using TBI rats as the in vivo model and applying multiple techniques, including stroke severity evaluation, Evans blue assessment, quantitative real-time PCR, Western blotting and ELISA, we investigated the dose-dependent protective effects of cordycepin on the TBI-induced impairments of BBB integrity. Cordycepin treatment attenuated the TBI-induced impairments in a dose-dependent manner, and played a role in protecting BBB integrity. Cordycepin was able to alleviate TBI-induced loss of tight junction proteins zonula occludens protein-1 (ZO-1) and occludin, which are important for BBB integrity. Moreover, cordycepin suppressed pro-inflammatory factors, including IL-1β, iNOS, MPO and MMP-9, and promoted anti-inflammation-associated factors arginase 1 and IL-10. Furthermore, cordycepin inhibited NADPH oxidase (NOX) expression and activity following TBI, probably through NOX1, but not NOX2 and NOX4. Cordycepin has protective effects against brain damages induced by TBI. The protection of cordycepin on BBB integrity was probably achieved through recovery of tight junction proteins, inhibition of local inflammation, and prevention of NOX activity. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Karyopherins regulate nuclear pore complex barrier and transport function.

    Science.gov (United States)

    Kapinos, Larisa E; Huang, Binlu; Rencurel, Chantal; Lim, Roderick Y H

    2017-09-01

    Nucleocytoplasmic transport is sustained by karyopherins (Kaps) and a Ran guanosine triphosphate (RanGTP) gradient that imports nuclear localization signal (NLS)-specific cargoes (NLS-cargoes) into the nucleus. However, how nuclear pore complex (NPC) barrier selectivity, Kap traffic, and NLS-cargo release are systematically linked and simultaneously regulated remains incoherent. In this study, we show that Kapα facilitates Kapβ1 turnover and occupancy at the NPC in a RanGTP-dependent manner that is directly coupled to NLS-cargo release and NPC barrier function. This is underpinned by the binding affinity of Kapβ1 to phenylalanine-glycine nucleoporins (FG Nups), which is comparable with RanGTP·Kapβ1, but stronger for Kapα·Kapβ1. On this basis, RanGTP is ineffective at releasing standalone Kapβ1 from NPCs. Depleting Kapα·Kapβ1 by RanGTP further abrogates NPC barrier function, whereas adding back Kapβ1 rescues it while Kapβ1 turnover softens it. Therefore, the FG Nups are necessary but insufficient for NPC barrier function. We conclude that Kaps constitute integral constituents of the NPC whose barrier, transport, and cargo release functionalities establish a continuum under a mechanism of Kap-centric control. © 2017 Kapinos et al.

  10. [Impaired cognitive function in hepatitis C - a review.

    DEFF Research Database (Denmark)

    Renvillard, Signe Groth; Leutscher, Peter; Hjerrild, Simon;

    2010-01-01

    Impaired cognitive function is commonly seen in patients with hepatitis C-virus (HCV). This might be due to a toxic effect of the virus itself or to neuroinflammatory processes with a direct damaging cerebral effect. The symptoms appear in the pre-cirrhotic stage and impair the patient's level...

  11. An Update of the Defensive Barrier Function of Skin

    OpenAIRE

    Lee, Seung Hun; Jeong, Se Kyoo; Ahn, Sung Ku

    2006-01-01

    Skin, as the outermost organ in the human body, continuously confronts the external environment and serves as a primary defense system. The protective functions of skin include UV-protection, anti-oxidant and antimicrobial functions. In addition to these protections, skin also acts as a sensory organ and the primary regulator of body temperature. Within these important functions, the epidermal permeability barrier, which controls the transcutaneous movement of water and other electrolytes, is...

  12. The mass and temperature functions in a moving barrier model

    CERN Document Server

    Popolo, A D

    2002-01-01

    In this paper, I use the extension of the excursion set model of Sheth & Tormen (2002) and the barrier shape obtained in Del Popolo & Gambera (1998) to calculate the unconditional halo mass function, and the conditional mass function in several cosmological models. I show that the barrier obtained in Del Popolo & Gambera (1998), which takes account of tidal interaction between proto-haloes, is a better description of the mass functions than the spherical collapse and is in good agreement with numerical simulations (Tozzi & Governato 1998, and Governato et al. 1999). The results are also in good agreement with those obtained by Sheth & Tormen (2002), only slight differences are observed expecially at the low mass end. I moreover calculate, and compare with simulations, the temperature function obtained by means of the mass functions previously calculated and also using an improved version of the M-T relation, which accounts for the fact that massive clusters accrete matter quasi-continuousl...

  13. Promoting effect of lactoferrin on barrier function and epithelial differentiation of human keratinocytes.

    Science.gov (United States)

    Uchida, Ryo; Aoki, Reiji; Aoki-Yoshida, Ayako; Tajima, Atsushi; Takayama, Yoshiharu

    2017-02-01

    The purpose of this study was to elucidate the effects of bovine lactoferrin on keratinocyte differentiation and barrier function. Addition of bovine lactoferrin to differentiating HaCaT human keratinocytes led to increased transepithelial electrical resistance (TER), a marker of epithelial barrier function. This elevation was followed by upregulation of two differentiation markers, involucrin and filaggrin. The expression level of sterol regulatory element-binding protein-1 was also enhanced by bovine lactoferrin. The lactoferrin-induced upregulation of involucrin and filaggrin expression were confirmed in normal human epidermal keratinocytes (NHEK). Treatment with SB203580, a p38 mitogen-activated protein kinase (MAPK) α inhibitor, impaired the upregulation of involucrin and filaggrin expression in response to lactoferrin. The elevation of p38 MAPK phosphorylation was further enhanced by lactoferrin in the initial stage of differentiation of HaCaT keratinocytes. The findings suggest that bovine lactoferrin promotes epithelial differentiation by a p38-MAPK-dependent mechanism.

  14. Typical diffusion behaviour in packaging polymers - Application to functional barriers

    NARCIS (Netherlands)

    Dole, P.; Feigenbaum, A.E.; Cruz, C. de la; Pastorelli, S.; Paseiro, P.; Hankemeier, T.; Voulzatis, Y.; Aucejo, S.; Saillard, P.; Papaspyrides, C.

    2006-01-01

    When plastics are collected for recycling, possibly contaminated articles might be recycled into food packaging, and thus the contaminants might subsequently migrate into the food. Multilayer functional barriers may be used to delay and to reduce such migration. The contribution of the work reported

  15. Disruption of barrier function in dermatophytosis and pityriasis versicolor.

    Science.gov (United States)

    Lee, Weon Ju; Kim, Jun Young; Song, Chang Hyun; Jung, Hong Dae; Lee, Su Hyun; Lee, Seok-Jong; Kim, Do Won

    2011-11-01

    Dermatophytes have the ability to form molecular attachments to keratin and use it as a source of nutrients, colonizing keratinized tissues, including the stratum corneum of the skin. Malassezia species also affect the stratum corneum of the skin. Therefore, dermatophytosis and pityriasis versicolor of the skin are thought to be important factors of profound changes in skin barrier structure and function. We aimed to describe the changes in transepidermal water loss (TEWL), stratum corneum hydration, and skin pH in the lesions of the dermatophytosis and pityriasis versicolor. Thirty-six patients with dermatophytosis (14 with tinea cruris, 13 with tinea corporis and nine with tinea pedis or tinea manus) and 11 patients with pityriasis versicolor were included in this study. TEWL, stratum corneum conductance and skin pH were determined by biophysical methods to examine whether our patients exhibited changes in barrier function. Dermatophytosis and pityriasis versicolor except tinea pedis and tinea manus showed highly significant increase in TEWL compared with adjacent infection-free skin. Hydration was significantly reduced in lesional skin compared with adjacent infection-free skin. From this study, infections with dermatophytes and Malassezia species on the body can alter biophysical properties of the skin, especially the function of stratum corneum as a barrier to water loss. On the contrary, infections with dermatophytes on the palms and soles little affect the barrier function of the skin. © 2011 Japanese Dermatological Association.

  16. The Functional Requirements and Design Basis for Information Barriers

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, James L.

    2012-05-01

    This report summarizes the results of the Information Barrier Working Group workshop held at Sandia National Laboratory in Albuquerque, NM, February 2-4, 1999. This workshop was convened to establish the functional requirements associated with warhead radiation signature information barriers, to identify the major design elements of any such system or approach, and to identify a design basis for each of these major elements. Such information forms the general design basis to be used in designing, fabricating, and evaluating the complete integrated systems developed for specific purposes.

  17. Functional impairment, stress, and psychosocial intervention in bipolar disorder.

    Science.gov (United States)

    Miklowitz, David J

    2011-12-01

    The longitudinal course of bipolar disorder (BD) is highly impairing. This article reviews recent research on functional impairment in the course of BD, the roles of social and intrafamilial stress in relapse and recovery, and the role of adjunctive psychosocial interventions in reducing risk and enhancing functioning. Comparative findings in adult and childhood BD are highlighted. Life events and family-expressed emotion have emerged as significant predictors of the course of BD. Studies of social information processing suggest that impairments in the recognition of facial emotions may characterize both adult- and early-onset bipolar patients. Newly developed psychosocial interventions, particularly those that focus on family and social relationships, are associated with more rapid recovery from episodes and better psychosocial functioning. Family-based psychoeducational approaches are promising as early interventions for children with BD or children at risk of developing the disorder. For adults, interpersonal therapy, mindfulness-based strategies, and cognitive remediation may offer promise in enhancing functioning.

  18. Predictors of functional disability in mild cognitive impairment and dementia

    NARCIS (Netherlands)

    van Rossum, M. E.; Koek, H. L.

    2016-01-01

    Objective Knowledge about factors predicting functional disability in mild cognitive impairment (MCI) and dementia would help health care providers to identify those patients who are at high risk of functional disability. Previous research is scarce and focused on only a small number of possible pre

  19. Functional Impairment and Occupational Outcome in Adults with ADHD

    Science.gov (United States)

    Gjervan, Bjorn; Torgersen, Terje; Nordahl, Hans M.; Rasmussen, Kirsten

    2012-01-01

    Objective: ADHD is associated with poor functional outcomes. The objectives were to investigate the prevalence of functional impairment and occupational status in a clinically referred sample of adults with ADHD and explore factors predicting occupational outcome. Method: A sample of 149 adults with a confirmed diagnosis of ADHD participated in…

  20. The blood-nerve barrier: structure and functional significance.

    Science.gov (United States)

    Weerasuriya, Ananda; Mizisin, Andrew P

    2011-01-01

    The blood-nerve barrier (BNB) defines the physiological space within which the axons, Schwann cells, and other associated cells of a peripheral nerve function. The BNB consists of the endoneurial microvessels within the nerve fascicle and the investing perineurium. The restricted permeability of these two barriers protects the endoneurial microenvironment from drastic concentration changes in the vascular and other extracellular spaces. It is postulated that endoneurial homeostatic mechanisms regulate the milieu intérieur of peripheral axons and associated Schwann cells. These mechanisms are discussed in relation to nerve development, Wallerian degeneration and nerve regeneration, and lead neuropathy. Finally, the putative factors responsible for the cellular and molecular control of BNB permeability are discussed. Given the dynamic nature of the regulation of the permeability of the perineurium and endoneurial capillaries, it is suggested that the term blood-nerve interface (BNI) better reflects the functional significance of these structures in the maintenance of homeostasis within the endoneurial microenvironment.

  1. Alterations of Blood Brain Barrier Function in Hyperammonemia: An Overview

    OpenAIRE

    2011-01-01

    Ammonia is a neurotoxin involved in the pathogenesis of neurological conditions associated with hyperammonemia, including hepatic encephalopathy, a condition associated with acute—(ALF) or chronic liver failure. This article reviews evidence that apart from directly affecting the metabolism and function of the central nervous system cells, ammonia influences the passage of different molecules across the blood brain barrier (BBB). A brief description is provided of the tight junctions, which c...

  2. The Small GTPase Rap1 Is a Novel Regulator of RPE Cell Barrier Function

    Science.gov (United States)

    Wittchen, Erika S.

    2011-01-01

    Purpose. To determine whether the small GTPase Rap1 regulates the formation and maintenance of the retinal pigment epithelial (RPE) cell junctional barrier. Methods. An in vitro model was used to study RPE barrier properties. To dissect the role of Rap1, two techniques were used to inhibit Rap1 function: overexpression of RapGAP, which acts as a negative regulator of endogenous Rap1 activity, and treatment with engineered, adenovirally-transduced microRNAs to knockdown Rap1 protein expression. Transepithelial electrical resistance (TER) and real-time cellular analysis (RTCA) of impedance were used as readouts for barrier properties. Immunofluorescence microscopy was used to visualize localization of cadherins under steady state conditions and also during junctional reassembly after calcium switch. Finally, choroidal endothelial cell (CEC) migration across RPE monolayers was quantified under conditions of Rap1 inhibition in RPE. Results. Knockdown of Rap1 or inhibition of its activity in RPE reduces TER and electrical impedance of the RPE monolayers. The loss of barrier function is also reflected by the mislocalization of cadherins and formation of gaps within the monolayer. TER measurement and immunofluorescent staining of cadherins after a calcium switch indicate that junctional reassembly kinetics are also impaired. Furthermore, CEC transmigration is significantly higher in Rap1-knockdown RPE monolayers compared with control. Conclusions. Rap1 GTPase is an important regulator of RPE cell junctions, and is required for maintenance of barrier function. This observation that RPE monolayers lacking Rap1 allow greater transmigration of CECs suggests a possible role for potentiating choroidal neovascularization during the pathology of neovascular age-related macular degeneration. PMID:21873678

  3. Treatment Concerns and Functional Impairment in Pediatric Anxiety.

    Science.gov (United States)

    Wu, Monica S; Salloum, Alison; Lewin, Adam B; Selles, Robert R; McBride, Nicole M; Crawford, Erika A; Storch, Eric A

    2016-08-01

    Although there are efficacious, evidence-based treatments for anxiety disorders, youth often experience delays in seeking therapy. Myriad reasons may contribute to this lag in treatment initiation, with some youth possessing concerns about therapy. Treatment concerns are broadly characterized by worries/ambivalence about seeking treatment, including concerns about the negative reactions, consequences, and inconvenience of treatment. As no studies exist for youth with anxiety disorders, this study examined the phenomenology of treatment concerns in 119 treatment-seeking, anxious youth and utilized a structural equation model to examine the relationship between child anxiety, depressive symptoms, treatment concerns, and anxiety-related functional impairment. Over 90 % of the children positively endorsed some type of treatment-related fear, with the most frequently expressed concern being that therapy would take too much time (50.4 %). Based on the model, both child anxiety and depressive symptoms predicted functional impairment, and treatment concerns mediated the relationship between child anxiety and functional impairment.

  4. [Cannabis use and impairment of respiratory function].

    Science.gov (United States)

    Underner, M; Urban, T; Perriot, J; Peiffer, G; Meurice, J-C

    2013-04-01

    Cannabis is the most commonly smoked illicit substance in many countries including France. It can be smoked alone in plant form (marijuana) but in our country it is mainly smoked in the form of cannabis resin mixed with tobacco. The technique of inhaling cannabis differs from that of tobacco, increasing the time that the smoke spends in contact with the bronchial mucosal and its impact on respiratory function. One cigarette composed of cannabis and tobacco is much more harmful than a cigarette containing only tobacco. In cannabis smokers there is an increased incidence of respiratory symptoms and episodes of acute bronchitis. Cannabis produces a rapid bronchodilator effect; chronic use provokes a reduction in specific conductance and increase in airways resistance. Studies on the decline of Forced Expiratory Volume are discordant. Cannabis smoke and tetrahydrocannabinol irritate the bronchial tree. They bring about histological signs of airways inflammation and alter the fungicidal and antibacterial activity of alveolar macrophages. Inhalation of cannabis smoke is a risk factor for lung cancer. Stopping smoking cannabis will bring about important benefits for lung function. This should encourage clinicians to offer patients support in quitting smoking.

  5. A University Web Portal redesign applying accessibility patterns. Breaking Down Barriers for Visually Impaired Users

    Directory of Open Access Journals (Sweden)

    Hernán Sosa

    2015-08-01

    Full Text Available Definitely, the WWW and ICTs have become the preferred media for the interaction between society and its citizens, and public and private organizations have today the possibility of deploying their activities through the Web. In particular, university education is a domain where the benefits of these technological resources can strongly contribute in caring for students. However, most university Web portals are inaccessible to their user community (students, professors, and non-teaching staff, between others, since these portals do not take into account the needs of people with different capabilities. In this work, we propose an accessibility pattern driven process to the redesign of university Web portals, aiming to break down barriers for visually impaired users. The approach is implemented to a real case study: the Web portal of Universidad Nacional de la Patagonia Austral (UNPA. The results come from applying accessibility recommendations and evaluation tools (automatic and manual from internationally recognized organizations, to both versions of the Web portal: the original and the redesign one.

  6. The Involvement of Budapest Residents with Visual Impairments in Leisure Sports: Barriers and Facilitators

    Directory of Open Access Journals (Sweden)

    Gombás Judit

    2016-06-01

    Full Text Available Since the political and economic changes that occurred in 1989-1990, Hungary has been in a state of transition from a socialist regime to a democratic culture. In an effort to comply with the rules of democracy, equal opportunities for people with disabilities are demanded on various platforms. However, inclusion in sports is still uncommon, and physical education (P.E. teachers, trainers, sports scientists, etc. are not provided with in-depth education on adapted sports. The present study examines the involvement of Hungarian adults with VI (visual impairments in leisure sports and investigates facilitators and barriers which members of the target group face. First, the educational opportunities (segregation or inclusion provided for Hungarian children with VI are introduced. The historical and legislative backgrounds are presented in order to give a clear review of the social context. Findings of a survey on the activity levels of Hungarian adults with vision loss are introduced, which reflect the target group’s willingness to get involved in leisure activities and also pinpoint factors which hinder their participation (e.g., professionals’ unfamiliarity with the special needs of those with VI and adapted sports opportunities.

  7. Intestinal barrier function and the brain-gut axis.

    Science.gov (United States)

    Alonso, Carmen; Vicario, María; Pigrau, Marc; Lobo, Beatriz; Santos, Javier

    2014-01-01

    The luminal-mucosal interface of the intestinal tract is the first relevant location where microorganism-derived antigens and all other potentially immunogenic particles face the scrutiny of the powerful mammalian immune system. Upon regular functioning conditions, the intestinal barrier is able to effectively prevent most environmental and external antigens to interact openly with the numerous and versatile elements that compose the mucosal-associated immune system. This evolutionary super system is capable of processing an astonishing amount of antigens and non-immunogenic particles, approximately 100 tons in one individual lifetime, only considering food-derived components. Most important, to develop oral tolerance and proper active immune responses needed to prevent disease and inflammation, this giant immunogenic load has to be managed in a way that physiological inflammatory balance is constantly preserved. Adequate functioning of the intestinal barrier involves local and distant regulatory networks integrating the so-called brain-gut axis. Along this complex axis both brain and gut structures participate in the processing and execution of response signals to external and internal changes coming from the digestive tract, using multidirectional pathways to communicate. Dysfunction of brain-gut axis facilitates malfunctioning of the intestinal barrier, and vice versa, increasing the risk of uncontrolled immunological reactions that may trigger mucosal and brain low-grade inflammation, a putative first step to the initiation of more permanent gut disorders. In this chapter, we describe the structure, function and interactions of intestinal barrier, microbiota and brain-gut axis in both healthy and pathological conditions.

  8. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    enzymatic systems; however, the precise function remains unknown. ACBP is expressed at relatively high levels in the epidermis, particularly in the suprabasal layers, which are highly active in lipid synthesis. Targeted disruption of the ACBP gene in mice leads to a pronounced skin and fur phenotype, which...... levels of non-esterified very long chain fatty acids in the stratum corneum of ACBP(-/-) mice. Here we review the current knowledge of ACBP with special focus on the function of ACBP in the epidermal barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis...

  9. Hypercholesterolemia Impaired Sperm Functionality in Rabbits

    Science.gov (United States)

    Monclus, Maria A.; Cabrillana, Maria E.; Clementi, Marisa A.; Espínola, Leandro S.; Cid Barría, Jose L.; Vincenti, Amanda E.; Santi, Analia G.; Fornés, Miguel W.

    2010-01-01

    Hypercholesterolemia represents a high risk factor for frequent diseases and it has also been associated with poor semen quality that may lead to male infertility. The aim of this study was to analyze semen and sperm function in diet-induced hypercholesterolemic rabbits. Twelve adult White New Zealand male rabbits were fed ad libitum a control diet or a diet supplemented with 0.05% cholesterol. Rabbits under cholesterol-enriched diet significantly increased total cholesterol level in the serum. Semen examination revealed a significant reduction in semen volume and sperm motility in hypercholesterolemic rabbits (HCR). Sperm cell morphology was seriously affected, displaying primarily a “folded head”-head fold along the major axe-, and the presence of cytoplasmic droplet on sperm flagellum. Cholesterol was particularly increased in acrosomal region when detected by filipin probe. The rise in cholesterol concentration in sperm cells was determined quantitatively by Gas chromatographic-mass spectrometric analyses. We also found a reduction of protein tyrosine phosphorylation in sperm incubated under capacitating conditions from HCR. Interestingly, the addition of Protein Kinase A pathway activators -dibutyryl-cyclic AMP and iso-butylmethylxanthine- to the medium restored sperm capacitation. Finally, it was also reported a significant decrease in the percentage of reacted sperm in the presence of progesterone. In conclusion, our data showed that diet-induced hypercholesterolemia adversely affects semen quality and sperm motility, capacitation and acrosomal reaction in rabbits; probably due to an increase in cellular cholesterol content that alters membrane related events. PMID:20976152

  10. Dietary phosphorus acutely impairs endothelial function.

    Science.gov (United States)

    Shuto, Emi; Taketani, Yutaka; Tanaka, Rieko; Harada, Nagakatsu; Isshiki, Masashi; Sato, Minako; Nashiki, Kunitaka; Amo, Kikuko; Yamamoto, Hironori; Higashi, Yukihito; Nakaya, Yutaka; Takeda, Eiji

    2009-07-01

    Excessive dietary phosphorus may increase cardiovascular risk in healthy individuals as well as in patients with chronic kidney disease, but the mechanisms underlying this risk are not completely understood. To determine whether postprandial hyperphosphatemia may promote endothelial dysfunction, we investigated the acute effect of phosphorus loading on endothelial function in vitro and in vivo. Exposing bovine aortic endothelial cells to a phosphorus load increased production of reactive oxygen species, which depended on phosphorus influx via sodium-dependent phosphate transporters, and decreased nitric oxide production via inhibitory phosphorylation of endothelial nitric oxide synthase. Phosphorus loading inhibited endothelium-dependent vasodilation of rat aortic rings. In 11 healthy men, we alternately served meals containing 400 mg or 1200 mg of phosphorus in a double-blind crossover study and measured flow-mediated dilation of the brachial artery before and 2 h after the meals. The high dietary phosphorus load increased serum phosphorus at 2 h and significantly decreased flow-mediated dilation. Flow-mediated dilation correlated inversely with serum phosphorus. Taken together, these findings suggest that endothelial dysfunction mediated by acute postprandial hyperphosphatemia may contribute to the relationship between serum phosphorus level and the risk for cardiovascular morbidity and mortality.

  11. Hypercholesterolemia impaired sperm functionality in rabbits.

    Directory of Open Access Journals (Sweden)

    Tania E Saez Lancellotti

    Full Text Available Hypercholesterolemia represents a high risk factor for frequent diseases and it has also been associated with poor semen quality that may lead to male infertility. The aim of this study was to analyze semen and sperm function in diet-induced hypercholesterolemic rabbits. Twelve adult White New Zealand male rabbits were fed ad libitum a control diet or a diet supplemented with 0.05% cholesterol. Rabbits under cholesterol-enriched diet significantly increased total cholesterol level in the serum. Semen examination revealed a significant reduction in semen volume and sperm motility in hypercholesterolemic rabbits (HCR. Sperm cell morphology was seriously affected, displaying primarily a "folded head"-head fold along the major axe-, and the presence of cytoplasmic droplet on sperm flagellum. Cholesterol was particularly increased in acrosomal region when detected by filipin probe. The rise in cholesterol concentration in sperm cells was determined quantitatively by Gas chromatographic-mass spectrometric analyses. We also found a reduction of protein tyrosine phosphorylation in sperm incubated under capacitating conditions from HCR. Interestingly, the addition of Protein Kinase A pathway activators -dibutyryl-cyclic AMP and iso-butylmethylxanthine- to the medium restored sperm capacitation. Finally, it was also reported a significant decrease in the percentage of reacted sperm in the presence of progesterone. In conclusion, our data showed that diet-induced hypercholesterolemia adversely affects semen quality and sperm motility, capacitation and acrosomal reaction in rabbits; probably due to an increase in cellular cholesterol content that alters membrane related events.

  12. Intracellular mediators of JAM-A-dependent epithelial barrier function.

    Science.gov (United States)

    Monteiro, Ana C; Parkos, Charles A

    2012-06-01

    Junctional adhesion molecule-A (JAM-A) is a critical signaling component of the apical junctional complex, a structure composed of several transmembrane and scaffold molecules that controls the passage of nutrients and solutes across epithelial surfaces. Observations from JAM-A-deficient epithelial cells and JAM-A knockout animals indicate that JAM-A is an important regulator of epithelial paracellular permeability; however, the mechanism(s) linking JAM-A to barrier function are not understood. This review highlights recent findings relevant to JAM-A-mediated regulation of epithelial permeability, focusing on the role of upstream and downstream signaling candidates. We draw on what is known about proteins reported to associate with JAM-A in other pathways and on known modulators of barrier function to propose candidate effectors that may mediate JAM-A regulation of epithelial paracellular permeability. Further investigation of pathways highlighted in this review may provide ideas for novel therapeutics that target debilitating conditions associated with barrier dysfunction, such as inflammatory bowel disease.

  13. Claudin Loss-of-Function Disrupts Tight Junctions and Impairs Amelogenesis

    Directory of Open Access Journals (Sweden)

    Claire Bardet

    2017-05-01

    Full Text Available Claudins are a family of proteins that forms paracellular barriers and pores determining tight junctions (TJ permeability. Claudin-16 and -19 are pore forming TJ proteins allowing calcium and magnesium reabsorption in the thick ascending limb of Henle's loop (TAL. Loss-of-function mutations in the encoding genes, initially identified to cause Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis (FHHNC, were recently shown to be also involved in Amelogenesis Imperfecta (AI. In addition, both claudins were expressed in the murine tooth germ and Claudin-16 knockout (KO mice displayed abnormal enamel formation. Claudin-3, an ubiquitous claudin expressed in epithelia including kidney, acts as a barrier-forming tight junction protein. We determined that, similarly to claudin-16 and claudin-19, claudin-3 was expressed in the tooth germ, more precisely in the TJ located at the apical end of secretory ameloblasts. The observation of Claudin-3 KO teeth revealed enamel defects associated to impaired TJ structure at the secretory ends of ameloblasts and accumulation of matrix proteins in the forming enamel. Thus, claudin-3 protein loss-of-function disturbs amelogenesis similarly to claudin-16 loss-of-function, highlighting the importance of claudin proteins for the TJ structure. These findings unravel that loss-of-function of either pore or barrier-forming TJ proteins leads to enamel defects. Hence, the major structural function of claudin proteins appears essential for amelogenesis.

  14. Lipids and skin barrier function - a clinical perspective

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

    2008-01-01

    and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...... and healthy controls have suggested a possible role for ceramide 1 and to some extent ceramide 3 in the pathogenesis of the disease. Therapies used in diseases involving barrier disruption have been sparely investigated from a lipid perspective. It has been suggested that ultraviolet light as a treatment......The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...

  15. Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

    Directory of Open Access Journals (Sweden)

    David eBueno

    2014-10-01

    Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

  16. Tactile and proprioceptive temporal discrimination are impaired in functional tremor.

    Directory of Open Access Journals (Sweden)

    Michele Tinazzi

    Full Text Available In order to obtain further information on the pathophysiology of functional tremor, we assessed tactile discrimination threshold and proprioceptive temporal discrimination motor threshold values in 11 patients with functional tremor, 11 age- and sex-matched patients with essential tremor and 13 healthy controls.Tactile discrimination threshold in both the right and left side was significantly higher in patients with functional tremor than in the other groups. Proprioceptive temporal discrimination threshold for both right and left side was significantly higher in patients with functional and essential tremor than in healthy controls. No significant correlation between discrimination thresholds and duration or severity of tremor was found.Temporal processing of tactile and proprioceptive stimuli is impaired in patients with functional tremor. The mechanisms underlying this impaired somatosensory processing and possible ways to apply these findings clinically merit further research.

  17. Metformin Improves Ileal Epithelial Barrier Function in Interleukin-10 Deficient Mice.

    Science.gov (United States)

    Xue, Yansong; Zhang, Hanying; Sun, Xiaofei; Zhu, Mei-Jun

    2016-01-01

    The impairment of intestinal epithelial barrier is the main etiologic factor of inflammatory bowel disease. The proper intestinal epithelial proliferation and differentiation is crucial for maintaining intestinal integrity. Metformin is a common anti-diabetic drug. The objective is to evaluate the protective effects of metformin on ileal epithelial barrier integrity using interleukin-10 deficient (IL10KO) mice. Wild-type and IL10KO mice were fed with/without metformin for 6 weeks and then ileum was collected for analyses. The mediatory role of AMP-activated protein kinase (AMPK) was further examined by gain and loss of function study in vitro. Compared to wild-type mice, IL10KO mice had increased proliferation, reduced goblet cell and Paneth cell lineage differentiation in the ileum tissue, which was accompanied with increased crypt expansion. Metformin supplementation mitigated intestinal cell proliferation, restored villus/crypt ratio, increased goblet cell and Paneth cell differentiation and improved barrier function. In addition, metformin supplementation in IL10KO mice suppressed macrophage pro-inflammatory activity as indicated by reduced M1 macrophage abundance and decreased pro-inflammatory cytokine IL-1β, TNF-α and IFN-γ expressions. As a target of metformin, AMPK phosphorylation was enhanced in mice treated with metformin, regardless of mouse genotypes. In correlation, the mRNA level of differentiation regulator including bmp4, bmpr2 and math1 were also increased in IL10KO mice supplemented with metformin, which likely explains the enhanced epithelial differentiation in IL10KO mice with metformin. Consistently, in Caco-2 cells, metformin promoted claudin-3 and E-cadherin assembly and mitigated TNF-α-induced fragmentation of tight junction proteins. Gain and loss of function assay also demonstrated AMPK was correlated with epithelial differentiation and proliferation. Metformin supplementation promotes secretory cell lineage differentiation, suppresses

  18. Fabrication of pseudo-ceramide-based lipid microparticles for recovery of skin barrier function.

    Science.gov (United States)

    Kim, Do-Hoon; Park, Woo Ram; Kim, Jeong Hwan; Cho, Eun Chul; An, Eun Jung; Kim, Jin-Woong; Oh, Seong-Geun

    2012-06-01

    The recovery of skin barrier functions was investigated with pseudo-ceramide-based lipid microparticles. The microparticles were prepared by using a fluid bed technique where lipid components (a pseudo-ceramide, cholesterol and a fatty acid) were coated on a sugar seed, and a polymer was subsequently coated on the lipid microparticles. The microparticles contained large amount of pseudo-ceramide, and the pseudo-ceramide was in the form of lamellar structures mixed with other lipid components. In addition, the microparticles were stably dispersed in aqueous media or emulsion systems without any disruption of the microparticles' structures, thereby supplying sufficient amount of the pseudo-ceramide to skins for improving skin barrier functions such as preventing water loss. Such a role of the microparticles was proven by evaluating in vivo the efficacy of the lipid microparticles in reducing a trans-epidermal water loss (TEWL) of impaired murine skins. As a result, the novel pseudo-ceramide-based lipid microparticles for barrier recovery may potentially be applied in the field of dermatology, cosmetics and pharmaceuticals. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Crossing the entropy barrier of dynamical zeta functions

    Energy Technology Data Exchange (ETDEWEB)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

  20. Executive Functioning in Children with Specific Language Impairment

    Science.gov (United States)

    Henry, Lucy A.; Messer, David J.; Nash, Gilly

    2012-01-01

    Background: A limited range of evidence suggests that children with specific language impairment (SLI) have difficulties with higher order thinking and reasoning skills (executive functioning, EF). This study involved a comprehensive investigation of EF in this population taking into account the contributions of age, nonverbal IQ and verbal…

  1. Executive Function Impairments in High IQ Adults with ADHD

    Science.gov (United States)

    Brown, Thomas E.; Reichel, Philipp C.; Quinlan, Donald M.

    2009-01-01

    Objectives: To demonstrate that high IQ adults diagnosed with ADHD suffer from executive function (EF) impairments that: a) can be identified with a combination of standardized measures and self-report data; and b) occur more commonly in this group than in the general population. Method: 157 ADHD adults with IQ greater than or equal to 120 were…

  2. Executive function behaviours in children with specific language impairment (SLI)

    NARCIS (Netherlands)

    Cuperus, J.M.; Vugs, B.A.M.; Scheper, A.R.; Hendriks, M.P.H.

    2014-01-01

    Background: There is growing evidence that linguistic and non-linguistic factors may contribute to the problems associated with specific language impairment (SLI). One factor that has been implicated is executive functioning (EF). Most studies investigating EF in children with SLI use performance ba

  3. Limb distribution, motor impairment, and functional classification of cerebral palsy

    NARCIS (Netherlands)

    J.A. Gorter; P.L. Rosenbaum

    2004-01-01

    This study explored the relationships between the Gross Motor Function Classification System (GMFCS), limb distribution, and type of motor impairment. Data used were collected in the Ontario Motor Growth study, a longitudinal cohort study with a population-based sample of children with cerebral pals

  4. Disease activity in eosinophilic esophagitis is associated with impaired esophageal barrier integrity.

    Science.gov (United States)

    Warners, Marijn J; van Rhijn, Bram D; Verheij, Joanne; Smout, Andreas J P M; Bredenoord, Albert J

    2017-09-01

    In eosinophilic esophagitis (EoE), the esophageal barrier integrity is impaired. Integrity can be assessed with different techniques. To assess the correlations between esophageal eosinophilia and various measures of mucosal integrity and to evaluate whether endoscopic impedance measurements can predict disease activity, endoscopies and mucosal integrity measurements were performed in adult EoE patients with active disease (≥15 eosinophils/high-power field) at baseline (n = 32) and after fluticasone (n = 15) and elemental dietary treatment (n = 14) and in controls (n = 19). Mucosal integrity was evaluated during endoscopy using electrical tissue spectroscopy (ETIS) measuring mucosal impedance and transepithelial electrical resistance (TER) and transepithelial molecule-flux through biopsy specimens in Ussing chambers. We included 61 measurements; 32 of patients at baseline and 29 after treatment, 3 patients dropped out. After treatment, 20 patients were in remission (≤15 eosinophils/high-power field) and these measurements were compared with 41 measurements of patients with active disease (at baseline or after failed treatment). All four mucosal integrity measures showed significant impairment in active EoE compared with remission. Eosinophilia was negatively correlated with ETIS and TER and positively with transepithelial molecule flux (P ≤ 0.001). The optimal ETIS cutoff to predict disease activity was 6,000 Ω·m with a sensitivity of 79% [95% confidence interval (CI) 54-94%], specificity of 84% (95% CI 69-94%), positive predictive values of 89% (95% CI 77-95%) and negative predictive values of 71% (95% CI 54-84%). In EoE patients, markers of mucosal integrity correlate with esophageal eosinophilia. Additionally, endoscopic mucosal impedance measurements can predict disease activity.NEW & NOTEWORTHY In adult patients with eosinophilic esophagitis (EoE), the mucosal integrity, measured by making use of four different parameters, correlates strongly with

  5. Vascular function and mild renal impairment in stable coronary artery disease

    NARCIS (Netherlands)

    van der Harst, P; Smilde, TDJ; Buikema, H; Voors, AA; Navis, G; van Veldhuisen, DJ; van Gilst, WH

    2006-01-01

    Objective - In patients with coronary artery disease, the concomitant presence of renal function impairment is associated with decreased survival. We aimed to assess whether in coronary artery diseased patients renal function impairment is associated with systemic vascular function, functional param

  6. Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

    Directory of Open Access Journals (Sweden)

    Pasricha J

    1991-01-01

    Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

  7. FUNCTIONAL IMPAIRMENTS OF GASTROINTESTINAL MOTILITY AND GASTROINTESTINAL TRACT MICROBIOTA

    Directory of Open Access Journals (Sweden)

    A.V. Malkoch

    2009-01-01

    Full Text Available Functional dysmotility is one of the most common evidence of pathology in gastrointestinal tract (GIT. GIT motility regulation is multilevel in nature at the level of central and peripheral nervous system, vegetative nervous system as well as locally directly in the intestinal tract. Gastrointestinal tract microbiota significantly contributes to the local regulation of motility both by forming fecal masses and secreting various metabolites, particularly short chain fatty acids whose composition and number depends on the nutritive factors of microbiota. For normal functioning and metabolism, saprophitic microbiota needs a significant number of undigestible carbohydrates, i.e. prebiotics. Prebiotics are an integral component of the complex therapy for functional impairments of gastrointestinal tract.Key words: gastrointestinal tract, motility, functional impairments, mictobiota, short chain fatty acids, prebiotics, lactulose.

  8. Diabetes mellitus induced impairment of male reproductive functions: a review.

    Science.gov (United States)

    Jangir, Ram Niwas; Jain, Gyan Chand

    2014-05-01

    Diabetes mellitus (DM) represents one of the greatest threats to human health all over the world. The incidence of DM is rising rapidly also including children and young persons of reproductive age. Diabetes has been associated with reproductive impairment in both men and women. Diabetes may affect male reproductive functions at multiple levels as a result of its effects on the endocrine control of spermatogenesis, steroidogenesis, sperm maturation, impairment of penile erection and ejaculation. A large number of studies both on diabetic men and experimental diabetic animals have been published on the impact of DM on male reproductive functions during the past few years but many of them have conflicting results. The present review summarizes the research finding of a large number of research papers on the reproductive functions especially on hypothalmo-pituitary-gonadal axis, spermatogenesis, histopathology of testis, synthesis and secretion of testosterone, sperm quality, ejaculatory function and fertility both in diabetic men and experimental diabetic animals.

  9. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  10. Impact of Cognitive Impairment on Functional Outcome in Stroke

    Directory of Open Access Journals (Sweden)

    Nurdan Paker

    2010-01-01

    Full Text Available The aim of this study was to investigate the effect of the cognitive impairment on functional status in patients with subacute stroke. Fifty-two patients with subacute stroke were included in the study. Mini mental state examination (MMSE test was used for the evaluation of cognitive status. Patients were separated into two groups according to their cognitive functions. Functional follow-up parameters were activities of daily living (ADL, global recovery and ambulation status. All patients were evaluated on admission to rehabilitation unit, at discharge and 6 months after discharge. Forty-four patients were completed the study. Mean age was 66 and 57 years; disease duration on admission was 4,8 and 3,5 months in the cognitively impaired and normal groups, respectively. Significant improvement was found in terms of functional follow-up parameters in both groups at discharge (<.05. Functional follow-up parameters did not show statistically significant difference between the groups. But community ambulation rate was higher in cognitively normal group at the sixth month visit. As a result of this study, inpatient rehabilitation was effective both cognitively normal and impaired subacute stroke patients.

  11. New Trends in Quantitative Assessment of the Corneal Barrier Function

    Directory of Open Access Journals (Sweden)

    Anton Guimerà

    2014-05-01

    Full Text Available The cornea is a very particular tissue due to its transparency and its barrier function as it has to resist against the daily insults of the external environment. In addition, maintenance of this barrier function is of crucial importance to ensure a correct corneal homeostasis. Here, the corneal epithelial permeability has been assessed in vivo by means of non-invasive tetrapolar impedance measurements, taking advantage of the huge impact of the ion fluxes in the passive electrical properties of living tissues. This has been possible by using a flexible sensor based in SU-8 photoresist. In this work, a further analysis focused on the validation of the presented sensor is performed by monitoring the healing process of corneas that were previously wounded. The obtained impedance measurements have been compared with the damaged area observed in corneal fluorescein staining images. The successful results confirm the feasibility of this novel method, as it represents a more sensitive in vivo and non-invasive test to assess low alterations of the epithelial permeability. Then, it could be used as an excellent complement to the fluorescein staining image evaluation.

  12. Functional assessment taxonomy relevant to low-back impairments.

    Science.gov (United States)

    Halpern, M

    2001-09-01

    A taxonomy of functional assessment constructs was developed to help the Social Security Administration refine the measurements of work disability. This report addresses content validity of the new taxonomy by examining the relevance of its constructs to a specific disability, and by examining the relationship between these constructs and constructs in other taxonomies. Seven experts linked the new taxonomy to consequences of low-back impairments. The selected constructs were compared to those reported independently by patients (Harper AC, Harper DA, Lambert L, Andrews HB, Lo SK, Ross FM, Straker LM. Pain 1992; 50(2): 189-195). The International Classification of Impairments, Disabilities and Handicaps served to bridge the two exercises. The findings reveal that it is feasible to use the taxonomy to define the impact of a specific disability and consequently link it to a set of standard measurements. Low-back impairments may be best assessed through measures of physical functional limitations, vocational impact, and interpersonal and emotional behavior. The study did not yield cognitive and intellectual measures that were relevant to this impairment.

  13. The smallest detectable difference of mandibular function impairment in patients with a painfully restricted temporomandibular joint

    NARCIS (Netherlands)

    Kropmans, T.J.B.; Dijkstra, P.U.; van Veen, A.; Stegenga, B; de Bont, Lambertus

    Mandibular functions such as speech, laughing, yawning, mastication, and taking a large bite may be impaired if temporomandibular disorders exist. The Mandibular Function Impairment Questionnaire is a validated instrument that scores perceived difficulty of representative mandibular functions in

  14. Extracommunicative functions of language: verbal interference causes selective categorization impairments.

    Science.gov (United States)

    Lupyan, Gary

    2009-08-01

    In addition to its communicative functions, language has been argued to have a variety of extracommunicative functions, as assessed by its causal involvement in putatively nonlinguistic tasks. In the present work, I argue that language may be critically involved in the ability of human adults to categorize objects on a specific dimension (e.g., color) while abstracting over other dimensions (e.g., size). This ability is frequently impaired in aphasic patients. The present work demonstrates that normal participants placed under conditions of verbal interference show a pattern of deficits strikingly similar to that of aphasic patients: impaired taxonomic categorization along perceptual dimensions, and preserved thematic categorization. A control experiment using a visuospatial-interference task failed to find this selective pattern of deficits. The present work has implications for understanding the online role of language in normal cognition and supports the claim that language is causally involved in nonverbal cognition.

  15. Measuring functional status in children with genetic impairments.

    Science.gov (United States)

    Msall, M E; Tremont, M R

    1999-06-25

    One of the consequences of genetic impairments in early childhood is their long-term effect on children's developmental skills in communication, learning, and adaptive behaviors. Functional assessment provides families and clinicians with a common language for describing a child's strengths and limitations in self-care (feeding, dressing, grooming, bathing, continence), mobility, and communication/social cognition. The National Center for Medical Rehabilitation Research described a model of disablement that includes five dimensions: pathophysiology, impairment, functional limitations, disability, and societal limitations. Using this framework, along with the Functional Independence Measure for children, the WeeFIM(R), we describe functional strengths and challenges in children with Down syndrome, spina bifida, congenital limb anomalies, congenital heart disease, urea cycle disorders, severe multiple developmental disabilities, and DiGeorge malformation sequence. We also briefly describe several pediatric functional/adaptive assessment instruments used by developmental professionals (Battelle Developmental Inventory, Vineland Adaptive Behavior Scales, Amount of Assistance Questionnaire). By tracking functional status, health professionals can prioritize secondary and tertiary prevention strategies that optimize self-care, mobility, communication, and learning. When functional limitations interfere with the acquisition of these essential skills, family and community support programs can be maximized.

  16. Barrier Functionality of Porcine and Bovine Brain Capillary Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Ailar Nakhlband

    2011-09-01

    Full Text Available Introduction: To date, isolated cell based blood-brain barrier (BBB models have been widely used for brain drug delivery and targeting, due to their relatively proper bioelectrical and permeability properties. However, primary cultures of brain capillary endothelial cells (BCECs isolated from different species vary in terms of bioelectrical and permeability properties. Methods: To pursue this, in the current investigation, primary porcine and bovine BCECs (PBCECs and BBCECs, respectively were isolated and used as an in vitro BBB model. The bioelectrical and permeability properties were assessed in BCECs co-cultured with C6 cells with/without hydrocortisone (550 nM. The bioelectrical properties were further validated by means of the permeability coefficients of transcellular and paracellular markers. Results: The primary PBCECs displayed significantly higher trans-endothelial electrical resistance (~900 W.cm2 than BBCECs (~700 W.cm2 - both co-cultured with C6 cells in presence of hydrocortisone. Permeability coefficients of propranolol/diazepam and mannitol/sucrose in PBCECs were ~21 and ~2 (×10-6 cm.sec-1, where these values for BBCECs were ~25 and ~5 (×10-6 cm.sec-1. Conclusion: Upon our bioelectrical and permeability findings, both models display discriminative barrier functionality but porcine BCECs seem to provide a better platform than bovine BCECs for drug screening and brain targeting.

  17. Functional Literacy for Students with Visual Impairments and Significant Cognitive Disabilities: The Perspective of Teachers of Students with Visual Impairments

    Science.gov (United States)

    Zebehazy, Kim T.

    2014-01-01

    This study reports opinions and practices of teachers of students with visual impairments (TSVIs) in 34 states regarding functional literacy for students with visual impairments (VIs) and significant cognitive disabilities (SCDs). The survey asked TSVIs to select a definition of functional literacy, indicate agreement with a series of literacy…

  18. Impairments of Motor Function While Multitasking in HIV

    Directory of Open Access Journals (Sweden)

    Cherie L. Marvel

    2017-04-01

    Full Text Available Human immunodeficiency virus (HIV became a treatable illness with the introduction of combination antiretroviral therapy (CART. As a result, patients with regular access to CART are expected to live decades with HIV. Long-term HIV infection presents unique challenges, including neurocognitive impairments defined by three major stages of HIV-associated neurocognitive disorders (HAND. The current investigation aimed to study cognitive and motor impairments in HIV using a novel multitasking paradigm. Unlike current standard measures of cognitive and motor performance in HIV, multitasking increases real-world validity by mimicking the dual motor and cognitive demands that are part of daily professional and personal settings (e.g., driving, typing and writing. Moreover, multitask assessments can unmask compensatory mechanisms, normally used under single task conditions, to maintain performance. This investigation revealed that HIV+ participants were impaired on the motor component of the multitask, while cognitive performance was spared. A patient-specific positive interaction between motor performance and working memory recall was driven by poor HIV+ multitaskers. Surprisingly, HAND stage did not correspond with multitask performance and a variety of commonly used assessments indicated normal motor function among HIV+ participants with poor motor performance during the experimental task. These results support the use of multitasks to reveal otherwise hidden impairment in chronic HIV by expanding the sensitivity of clinical assessments used to determine HAND stage. Future studies should examine the capability of multitasks to predict performance in personal, professional and health-related behaviors and prognosis of patients living with chronic HIV.

  19. Impairments of Motor Function While Multitasking in HIV.

    Science.gov (United States)

    Kronemer, Sharif I; Mandel, Jordan A; Sacktor, Ned C; Marvel, Cherie L

    2017-01-01

    Human immunodeficiency virus (HIV) became a treatable illness with the introduction of combination antiretroviral therapy (CART). As a result, patients with regular access to CART are expected to live decades with HIV. Long-term HIV infection presents unique challenges, including neurocognitive impairments defined by three major stages of HIV-associated neurocognitive disorders (HAND). The current investigation aimed to study cognitive and motor impairments in HIV using a novel multitasking paradigm. Unlike current standard measures of cognitive and motor performance in HIV, multitasking increases real-world validity by mimicking the dual motor and cognitive demands that are part of daily professional and personal settings (e.g., driving, typing and writing). Moreover, multitask assessments can unmask compensatory mechanisms, normally used under single task conditions, to maintain performance. This investigation revealed that HIV+ participants were impaired on the motor component of the multitask, while cognitive performance was spared. A patient-specific positive interaction between motor performance and working memory recall was driven by poor HIV+ multitaskers. Surprisingly, HAND stage did not correspond with multitask performance and a variety of commonly used assessments indicated normal motor function among HIV+ participants with poor motor performance during the experimental task. These results support the use of multitasks to reveal otherwise hidden impairment in chronic HIV by expanding the sensitivity of clinical assessments used to determine HAND stage. Future studies should examine the capability of multitasks to predict performance in personal, professional and health-related behaviors and prognosis of patients living with chronic HIV.

  20. Functional Food Market Development in Serbia: Motivations and Barriers

    Directory of Open Access Journals (Sweden)

    Žaklina Stojanović

    2013-11-01

    Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.

  1. Targeting Functional Impairments in the Treatment of Children and Adolescents with ADHD.

    Science.gov (United States)

    Sasser, Tyler; Schoenfelder, Erin N; Stein, Mark A

    2017-02-01

    The diagnostic criteria for attention-deficit hyperactivity disorder (ADHD) require both symptoms and impairment to be present. Impairment in functioning is commonly the primary reason for referral, and is also a better predictor of long-term outcomes than ADHD symptoms. And yet, only recently has research begun to examine the impact of ADHD treatments on functional impairment using efficient and psychometrically sound outcome measures. In this article, we identify several noteworthy multidimensional measures of functional impairment (ADHD FX, Barkley Functional Impairment Scale [BFIS], Impairment Rating Scale [IRS], Weiss Functional Impairment Rating Scale [WFIRS]) utilized in recent clinical trials for ADHD, and describe their psychometric properties and clinical utility. We also review existing evidence on the impact of pharmacological and behavioral treatments on different domains of functional impairment in ADHD youth as measured by these specific measures. Further research is needed to evaluate longitudinal effects of ADHD treatments on functional impairment, and the use of these measures in adaptive treatment designs.

  2. Executive Function Is Selectively Impaired in Old Age Bipolar Depression

    Science.gov (United States)

    Caixeta, Leonardo; Soares, Vânia L. D.; Vieira, Renata T.; Soares, Cândida D.; Caixeta, Victor; Ferreira, Sandra B.; Aversi-Ferreira, Tales A.

    2017-01-01

    Background: Little is known about the cognitive signature of bipolar disorder (BD) in elderly brains. The neuropsychological features of depressive elderly with early-onset BD are largely unknown. This issue is relevant because cognitive impairment can produce an additional impact on the already compromised functionality of elderly with BD. The aim of this study is to assess executive functions (EFs) in the depressive phase of elderly outpatients with early-onset BD. Methods: Forty-nine elderly outpatients with early-onset BD were assessed with several neuropsychological tests for EF in the depressive phase of the disorder. Results: Executive dysfunction is very common in old age bipolar depression. Thirteen patients (26.5%) had a pseudodementia presentation. The worst performances were observed in the following tests: Trail Making B, Stroop Test 3, Backward Digit Span and Wisconsin Card Sorting Test. Conclusion: Executive dysfunction profile in elderly BD is complex and heterogeneous, but most cases display difficulties in working memory, inhibitory control, mental flexibility, and information processing speed. The performance of elderly with bipolar depression in executive assessment can be divided into two main categories: (1) Single EF domain impairment; and (2) Multiple EF domain impairment with or without a pseudodementia syndrome. Executive dysfunction in old age bipolar depression may be explained by lack of sufficient mental energy to run those cognitive processes that require larger amounts of effort to be performed.

  3. Impairment of B-cell functions during HIV-1 infection.

    Science.gov (United States)

    Amu, Sylvie; Ruffin, Nicolas; Rethi, Bence; Chiodi, Francesca

    2013-09-24

    A variety of B-cell dysfunctions are manifested during HIV-1 infection, as reported early during the HIV-1 epidemic. It is not unusual that the pathogenic mechanisms presented to elucidate impairment of B-cell responses during HIV-1 infection focus on the impact of reduced T-cell numbers and functions, and lack of germinal center formation in lymphoid tissues. To our understanding, however, perturbation of B-cell phenotype and function during HIV-1 infection may begin at several different B-cell developmental stages. These impairments can be mediated by intrinsic B-cell defects as well as by the lack of proper T-cell help. In this review, we will highlight some of the pathways and molecular interactions leading to B-cell impairment prior to germinal center formation and B-cell activation mediated through the B-cell receptor in response to HIV-1 antigens. Recent studies indicate a regulatory role for B cells on T-cell biology and immune responses. We will discuss some of these novel findings and how these regulatory mechanisms could potentially be affected by the intrinsic defects of B cells taking place during HIV-1 infection.

  4. Serum vitamin D and functional impairment in octogenarian women.

    Science.gov (United States)

    Navarro-Martínez, Rut; Fernández-Garrido, Julio; Buigues, Cristina; Martinez-Martinez, Mary; Cantero-Díaz, Liliana; Santamaría-Carrillo, Yolanda; Serra-Catalá, Nuria; Peris, Carlos; Cauli, Omar

    2016-05-01

    Serum vitamin D deficiency has been associated with frailty in people aged 65 and over, however its relationship with functional impairment has not been investigated in octogenerian (aged 80-90 years) institutionalized women. We assessed functional impairment in this latter group by measuring frailty syndrome and other geriatric and psychological assessment scales: the Tinetti gait and balance index to determine the risk for falls, the Barthel index to measure the basic activities of daily living, the Lawton index for instrumental activities, the mini-mental score examination test for cognitive impairment, the Yesavage scale for geriatric depression, and the Norton scale for the risk of ulceration. Frail individuals had significantly reduced serum vitamin D concentrations (measured as total 25-hydroxyvitamin D; 25(OH)D) compared to robust individuals, but reduced 25(OH)D concentration did not significantly correlate with frailty syndrome severity, and mean 25(OH)D concentrations were within the recommended levels in all groups. The 25(OH)D concentration did not correlate with any of the blood analytical parameters measured and with the geriatric assessment scales used, suggesting a selective relationship with frailty. These results highlight the need to individualize treatment such as vitamin D supplementation in order to treat frailty syndrome. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Assessing depression related severity and functional impairment: the Overall Depression Severity and Impairment Scale (ODSIS.

    Directory of Open Access Journals (Sweden)

    Masaya Ito

    Full Text Available The Overall Depression Severity and Impairment Scale (ODSIS is a brief, five-item measure for assessing the frequency and intensity of depressive symptoms, as well as functional impairments in pleasurable activities, work or school, and interpersonal relationships due to depression. Although this scale is expected to be useful in various psychiatric and mental health settings, the reliability, validity, and interpretability have not yet been fully examined. This study was designed to examine the reliability, factorial, convergent, and discriminant validity of a Japanese version of the ODSIS, as well as its ability to distinguish between individuals with and without a major depressive disorder diagnosis.From a pool of registrants at an internet survey company, 2830 non-clinical and clinical participants were selected randomly (619 with major depressive disorder, 619 with panic disorder, 576 with social anxiety disorder, 645 with obsessive-compulsive disorder, and 371 non-clinical panelists. Participants were asked to respond to the ODSIS and conventional measures of depression, functional impairment, anxiety, neuroticism, satisfaction with life, and emotion regulation.Exploratory and confirmatory factor analysis of three split subsamples indicated the unidimensional factor structure of ODSIS. Multi-group confirmatory factor analysis showed invariance of factor loadings between non-clinical and clinical subsamples. The ODSIS also showed excellent internal consistency and test-retest intraclass correlation coefficients. Convergence and discriminance of the ODSIS with various measures were in line with our expectations. Receiver operating characteristic curve analyses showed that the ODSIS was able to detect a major depressive syndrome accurately.This study supports the reliability and validity of ODSIS in a non-western population, which can be interpreted as demonstrating cross-cultural validity.

  6. Impairments that Influence Physical Function among Survivors of Childhood Cancer

    Directory of Open Access Journals (Sweden)

    Carmen L. Wilson

    2015-01-01

    Full Text Available Children treated for cancer are at increased risk of developing chronic health conditions, some of which may manifest during or soon after treatment while others emerge many years after therapy. These health problems may limit physical performance and functional capacity, interfering with participation in work, social, and recreational activities. In this review, we discuss treatment-induced impairments in the endocrine, musculoskeletal, neurological, and cardiopulmonary systems and their influence on mobility and physical function. We found that cranial radiation at a young age was associated with a broad range of chronic conditions including obesity, short stature, low bone mineral density and neuromotor impairments. Anthracyclines and chest radiation are associated with both short and long-term cardiotoxicity. Although numerous chronic conditions are documented among individuals treated for childhood cancer, the impact of these conditions on mobility and function are not well characterized, with most studies limited to survivors of acute lymphoblastic leukemia and brain tumors. Moving forward, further research assessing the impact of chronic conditions on participation in work and social activities is required. Moreover, interventions to prevent or ameliorate the loss of physical function among children treated for cancer are likely to become an important area of survivorship research.

  7. The Early Indicators of Functional Decrease in Mild Cognitive Impairment

    Science.gov (United States)

    Kubicki, Alexandre; Fautrelle, Lilian; Bourrelier, Julien; Rouaud, Olivier; Mourey, France

    2016-01-01

    Objectives: Motor deficiency is associated with cognitive frailty in patients with Mild Cognitive Impairments (MCI). In this study we aimed to test the integrity in muscle synergies involved in an arm-pointing movement in functionally unimpaired MCI patients. We hypothesized that early motor indicators exist in this population at a preclinical level. Methods: Electromyographic signals were collected for 11 muscles in 3 groups: Young Adults (YA), Older Adults (OA), and MCI patients. The OA and MCI groups presented the same functional status. Each subject performed 20 arm-pointing movements from a standing position. Results: The main differences were (1) an earlier activation of the left Obliquus internus in MCI compared with OA group, (2) an earlier activation for the MCI compared with both OA and YA. The temporal differences in muscle synergies between MCI and OA groups were linked with executive functions of MCI patients, assessed by the trail making test. Moreover, the results show a delayed activation of the right Biceps Femoris and the right Erector Spinae at l3 in MCI and OA compared with YA. Interpretation: The motor program changes highlighted in our patient MCI group suggest that discrete modifications of the motor command seem to exist even in the absence of functional impairment. Instead of showing an indication of delayed muscle activation in the MCI patients, our results highlight some early activation of several trunk muscles. PMID:27570509

  8. Influence of cognitive impairment, functional impairment and care setting on dementia care mapping results.

    Science.gov (United States)

    Edelman, P; Kuhn, D; Fulton, B R

    2004-11-01

    Quality of life (QOL) for people with dementia has become a major focus over the past decade. Dementia care mapping (DCM) is an observational measure of quality of care given by staff in formal care settings, as well as a measure of QOL that has been used in many studies of people with dementia in residential care settings. However, the method itself has not been rigorously studied in a scientific manner. For this report, mapping data were collected for 166 persons with dementia in three types of care settings: special care facilities that are licensed nursing homes, assisted living facilities, and adult day centers. The relationships between DCM and several independent variables including cognitive status, functional status, care setting, depression, length of stay, and co-morbid illnesses were assessed. Both cognitive status and functional status were found to be associated with DCM scores. Moreover, DCM was sensitive in differentiating among persons with four levels of cognitive impairment. Implications for practice are discussed.

  9. Food Derived Bioactive Peptides and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Olga Martínez-Augustin

    2014-12-01

    Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  10. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Jungersted, J M; Scheer, H; Mempel, M

    2010-01-01

    Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now, no studies...... have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype....

  11. Endothelial NOS (NOS3) impairs myocardial function in developing sepsis.

    Science.gov (United States)

    van de Sandt, Annette M; Windler, Rainer; Gödecke, Axel; Ohlig, Jan; Zander, Simone; Reinartz, Michael; Graf, Jürgen; van Faassen, Ernst E; Rassaf, Tienush; Schrader, Jürgen; Kelm, Malte; Merx, Marc W

    2013-03-01

    Endothelial nitric oxide synthase (NOS)3-derived nitric oxide (NO) modulates inotropic response and diastolic interval for optimal cardiac performance under non-inflammatory conditions. In sepsis, excessive NO production plays a key role in severe hypotension and myocardial dysfunction. We aimed to determine the role of NOS3 on myocardial performance, NO production, and time course of sepsis development. NOS3(-/-) and C57BL/6 wildtype mice were rendered septic by cecum ligation and puncture (CLP). Cardiac function was analyzed by serial echocardiography, in vivo pressure and isolated heart measurements. Cardiac output (CO) increased to 160 % of baseline at 10 h after sepsis induction followed by a decline to 63 % of baseline after 18 h in wildtype mice. CO was unaltered in septic NOS3(-/-) mice. Despite the hyperdynamic state, cardiac function and mean arterial pressure were impaired in septic wildtype as early as 6 h post CLP. At 12 h, cardiac function in septic wildtype was refractory to catecholamines in vivo and respective isolated hearts showed impaired pressure development and limited coronary flow reserve. Hemodynamics remained stable in NOS3(-/-) mice leading to significant survival benefit. Unselective NOS inhibition in septic NOS3(-/-) mice diminished this survival benefit. Plasma NO( x )- and local myocardial NO( x )- and NO levels (via NO spin trapping) demonstrated enhanced NO( x )- and bioactive NO levels in septic wildtype as compared to NOS3(-/-) mice. Significant contribution by inducible NOS (NOS2) during this early phase of sepsis was excluded. Our data suggest that NOS3 relevantly contributes to bioactive NO pool in developing sepsis resulting in impaired cardiac contractility.

  12. The effect of acetaminophen on the expression of BCRP in trophoblast cells impairs the placental barrier to bile acids during maternal cholestasis

    Energy Technology Data Exchange (ETDEWEB)

    Blazquez, Alba G., E-mail: albamgb@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain); Briz, Oscar, E-mail: obriz@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain); Gonzalez-Sanchez, Ester, E-mail: u60343@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); Perez, Maria J., E-mail: mjperez@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); University Hospital of Salamanca, IECSCYL-IBSAL, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain); Ghanem, Carolina I., E-mail: cghanem@ffyb.uba.ar [Instituto de Investigaciones Farmacologicas, Facultad de Farmacia y Bioquimica, CONICET, Universidad de Buenos Aires, Buenos Aires (Argentina); Marin, Jose J.G., E-mail: jjgmarin@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain)

    2014-05-15

    Acetaminophen is used as first-choice drug for pain relief during pregnancy. Here we have investigated the effect of acetaminophen at subtoxic doses on the expression of ABC export pumps in trophoblast cells and its functional repercussion on the placental barrier during maternal cholestasis. The incubation of human choriocarcinoma cells (JAr, JEG-3 and BeWo) with acetaminophen for 48 h resulted in no significant changes in the expression and/or activity of MDR1 and MRPs. In contrast, in JEG-3 cells, BCRP mRNA, protein, and transport activity were reduced. In rat placenta, collected at term, acetaminophen administration for the last three days of pregnancy resulted in enhanced mRNA, but not protein, levels of Mrp1 and Bcrp. In fact, a decrease in Bcrp protein was found. Using in situ perfused rat placenta, a reduction in the Bcrp-dependent fetal-to-maternal bile acid transport after treating the dams with acetaminophen was found. Complete biliary obstruction in pregnant rats induced a significant bile acid accumulation in fetal serum and tissues, which was further enhanced when the mothers were treated with acetaminophen. This drug induced increased ROS production in JEG-3 cells and decreased the total glutathione content in rat placenta. Moreover, the NRF2 pathway was activated in JEG-3 cells as shown by an increase in nuclear NRF2 levels and an up-regulation of NRF2 target genes, NQO1 and HMOX-1, which was not observed in rat placenta. In conclusion, acetaminophen induces in placenta oxidative stress and a down-regulation of BCRP/Bcrp, which may impair the placental barrier to bile acids during maternal cholestasis. - Highlights: • Acetaminophen induces changes in placental BCRP expression in vitro. • This drug reduces the ability of placental cells to export BCRP substrates. • Acetaminophen induces changes in Bcrp expression in rat placenta. • Placental barrier to bile acids is impaired in rats treated with this drug.

  13. Balance Functional Assessment in People with Visual Impairment

    Directory of Open Access Journals (Sweden)

    Rutkowska Izabela

    2015-12-01

    Full Text Available The aims of this study were twofold: to assess the level of balance of people with visual impairment against the BOT-2 standard scores for the able-bodied, and to identify in which trials subjects had the greatest difficulties in maintaining balance with respect to the degree of vision loss and age categories. One hundred twenty-seven subjects with visual impairment aged 6-16 years, participated in the study (68 girls and 59 boys. The division for partially sighted people (61 and the blind (66 was made according to the WHO classification. Functional balance assessment was made using a balance subtest from the Bruininks-Oseretsky test. Significant relationships were noticed between age and the level of balance (χ2 = 8.35 p <0,05, as well as between the degree of vision loss and the level of balance (χ2 = 24.53 p <0,001. The level of balance of almost all blind subjects was below (20% or well-below (60% the average for the able-bodied. The subjects’ ability to maintain balance was not dependent on gender and was associated primarily with the degree of visual impairment and age. Partially sighted people had better balance than the blind and the decrease in visual acuity resulted in reduction of balance skills. The lowest level of balance was observed in blind students aged 7-11 years. Elaborating physical fitness improvement programs for children and adolescents with visual impairment, diversity of age, the degree of vision loss and limitations of ablility to maintain balance should be taken into account.

  14. Effect of Topical Iloprost and Nitroglycerin on Gastric Microcirculation and Barrier Function during Hemorrhagic Shock in Dogs.

    Science.gov (United States)

    Truse, Richard; Hinterberg, Jonas; Schulz, Jan; Herminghaus, Anna; Weber, Andreas; Mettler-Altmann, Tabea; Bauer, Inge; Picker, Olaf; Vollmer, Christian

    2017-01-01

    Topical drug application is used to avoid systemic side effects. The aim of this study was to analyze whether locally applied iloprost or nitroglycerin influence gastric mucosal perfusion, oxygenation, and barrier function during physiological and hemorrhagic conditions. In repeated experiments, 5 anesthetized dogs received iloprost, nitroglycerin, or normal saline during physiological and hemorrhagic (-20% blood volume) conditions. Macro- and microcirculatory variables were recorded continuously. Gastric barrier function was assessed via translocation of sucrose into the blood. During hemorrhage, gastric mucosal oxygenation decreased from 77 ± 4 to 37 ± 7%. This effect was attenuated by nitroglycerin (78 ± 6 to 47 ± 13%) and iloprost (82 ± 4 to 54 ± 9%). Sucrose plasma levels increased during hemorrhage from 7 ± 4 to 55 ± 15 relative amounts. This was alleviated by nitroglycerin (5 ± 8 to 29 ± 38 relative amounts). These effects were independent of systemic hemodynamic variables. During hemorrhage, topical nitroglycerin and iloprost improve regional gastric oxygenation without affecting perfusion. Nitroglycerin attenuated the shock-induced impairment of the mucosal barrier integrity. Thus, local drug application improves gastric microcirculation without compromising systemic hemodynamic variables, and it may also protect mucosal barrier function. © 2017 S. Karger AG, Basel.

  15. Identifying Changeable Barriers to Family Involvement in the Nursing Home for Cognitively Impaired Residents

    Science.gov (United States)

    Port, Cynthia Lindman

    2004-01-01

    Purpose: Barriers to family involvement in the nursing home with the potential for change through intervention are examined, including transportation, caregiver health, relationships with staff, and resident characteristics. Design and Methods: Data were collected for 93 family caregiver-resident pairs by means of telephone interviews and chart…

  16. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation p

  17. Impaired cognitive function and mental performance in mild dehydration.

    Science.gov (United States)

    Wilson, M-M G; Morley, J E

    2003-12-01

    Dehydration is a reliable predictor of impaired cognitive status. Objective data, using tests of cortical function, support the deterioration of mental performance in mildly dehydrated younger adults. Dehydration frequently results in delirium as a manifestation of cognitive dysfunction. Although, the occurrence of delirium suggests transient acute global cerebral dysfunction, cognitive impairment may not be completely reversible. Animal studies have identified neuronal mitochondrial damage and glutamate hypertransmission in dehydrated rats. Additional studies have identified an increase in cerebral nicotinamide adenine dinucleotide phosphate-diaphorase activity (nitric oxide synthase, NOS) with dehydration. Available evidence also implicates NOS as a neurotransmitter in long-term potentiation, rendering this a critical enzyme in facilitating learning and memory. With ageing, a reduction of NOS activity has been identified in the cortex and striatum of rats. The reduction of NOs synthase activity that occurs with ageing may blunt the rise that occurs with dehydration, and possibly interfere with memory processing and cognitive function. Dehydration has been shown to be a reliable predictor of increasing frailty, deteriorating mental performance and poor quality of life. Intervention models directed toward improving outcomes in dehydration must incorporate strategies to enhance prompt recognition of cognitive dysfunction.

  18. Impaired olfactory function in patients with polycystic ovary syndrome.

    Science.gov (United States)

    Koseoglu, Sezen Bozkurt; Koseoglu, Sabri; Deveer, Ruya; Derin, Serhan; Kececioglu, Mehmet; Sahan, Murat

    2016-06-01

    Polycystic ovary syndrome (PCOS) is an endocrine disorder which affects 6.6% of women of child-bearing age. Although olfactory dysfunction is frequent in the population and it negatively affects quality of life, neither physicians or patients consider this important. This case-control study included 30 patients diagnosed with PCOS, and 25 healthy age-matched controls. Sniffin' sticks tests (BurghartGmbH, Wedel, Germany) were used to analyze olfactory functions, and the Beck Depression Inventory was used to evaluate depressive symptoms. The total odor score was significantly lower in the PCOS group compared to the control group (pdepression score was higher in the PCOS group (pDepression Score. Patients with PCOS have impaired olfactory function. This might be related to depressive disorders that are also observed in those patients.

  19. Does acute exposure to aldehydes impair pulmonary function and structure?

    Science.gov (United States)

    Abreu, Mariana de; Neto, Alcendino Cândido; Carvalho, Giovanna; Casquillo, Natalia Vasconcelos; Carvalho, Niedja; Okuro, Renata; Ribeiro, Gabriel C Motta; Machado, Mariana; Cardozo, Aléxia; Silva, Aline Santos E; Barboza, Thiago; Vasconcellos, Luiz Ricardo; Rodrigues, Danielle Araujo; Camilo, Luciana; Carneiro, Leticia de A M; Jandre, Frederico; Pino, Alexandre V; Giannella-Neto, Antonio; Zin, Walter A; Corrêa, Leonardo Holanda Travassos; Souza, Marcio Nogueira de; Carvalho, Alysson R

    2016-07-15

    Mixtures of anhydrous ethyl alcohol and gasoline substituted for pure gasoline as a fuel in many Brazilian vehicles. Consequently, the concentrations of volatile organic compounds (VOCs) such as ketones, other organic compounds, and particularly aldehydes increased in many Brazilian cities. The current study aims to investigate whether formaldehyde, acetaldehyde, or mixtures of both impair lung function, morphology, inflammatory and redox responses at environmentally relevant concentrations. For such purpose, C57BL/6 mice were exposed to either medical compressed air or to 4 different mixtures of formaldehyde and acetaldehyde. Eight hours later animals were anesthetized, paralyzed and lung mechanics and morphology, inflammatory cells and IL-1β, KC, TNF-α, IL-6, CCL2, MCP-1 contents, superoxide dismutase and catalalase activities were determined. The extra pulmonary respiratory tract was also analyzed. No differences could be detected between any exposed and control groups. In conclusion, no morpho-functional alterations were detected in exposed mice in relation to the control group.

  20. Skin Barrier Function and Its Importance at the Start of the Atopic March

    Science.gov (United States)

    Hogan, Mary Beth; Peele, Kathy; Wilson, Nevin W.

    2012-01-01

    Atopic dermatitis can be due to a variety of causes from nonatopic triggers to food allergy. Control of egress of water and protection from ingress of irritants and allergens are key components of cutaneous barrier function. Current research suggests that a degraded barrier function of the skin allows the immune system inappropriate access to environmental allergens. Epidermal aeroallergen exposure may allow sensitization to allergen possibly initiating the atopic march. Further research into connections between epidermal barrier function and possible allergen sensitization will be important to undertake. Future clinical trials focused on skin barrier protection may be of value as a possible intervention in prevention of the initiation of the atopic march. PMID:22619686

  1. Functional connectivity correlates of response inhibition impairment in anorexia nervosa.

    Science.gov (United States)

    Collantoni, Enrico; Michelon, Silvia; Tenconi, Elena; Degortes, Daniela; Titton, Francesca; Manara, Renzo; Clementi, Maurizio; Pinato, Claudia; Forzan, Monica; Cassina, Matteo; Santonastaso, Paolo; Favaro, Angela

    2016-01-30

    Anorexia nervosa (AN) is a disorder characterized by high levels of cognitive control and behavioral perseveration. The present study aims at exploring inhibitory control abilities and their functional connectivity correlates in patients with AN. Inhibitory control - an executive function that allows the realization of adaptive behavior according to environmental contingencies - has been assessed by means of the Stop-Signal paradigm. The study involved 155 patients with lifetime AN and 102 healthy women. A subsample underwent resting-state functional magnetic resonance imaging and was genotyped for COMT and 5-HTTLPR polymorphisms. AN patients showed an impaired response inhibition and a disruption of the functional connectivity of the ventral attention circuit, a neural network implicated in behavioral response when a stimulus occurs unexpected. The 5-HTTLPR genotype appears to significantly interact with the functional connectivity of ventral attention network in explaining task performance in both patients and controls, suggesting a role of the serotoninergic system in mechanisms of response selection. The disruption of the ventral attention network in patients with AN suggests lower efficiency of bottom-up signal filtering, which might be involved in difficulties to adapt behavioral responses to environmental needs. Our findings deserve further research to confirm their scientific and therapeutic implications.

  2. Structural Equation Modeling of Motor Impairment, Gross Motor Function, and the Functional Outcome in Children with Cerebral Palsy

    Science.gov (United States)

    Park, Eun-Young; Kim, Won-Ho

    2013-01-01

    Physical therapy intervention for children with cerebral palsy (CP) is focused on reducing neurological impairments, improving strength, and preventing the development of secondary impairments in order to improve functional outcomes. However, relationship between motor impairments and functional outcome has not been proved definitely. This study…

  3. Neuropsychologic function of children with severe hearing impairment.

    Science.gov (United States)

    Wilson, J J; Rapin, I; Wilson, B C; Van Denburg, F V

    1975-12-01

    A neuropsychologic and medical study was carried out on a selected sample of 34 hearing-impaired children aged seven to 10 years at the onset of the study. In 16 children the cause of the hearing loss was thought to be exogenous. Eight of these had evidence for organic brain dysfunction. Nine children were thought to have genetic etiologies, and in nine no cause could be determined (sporadic hearing loss). Medical examination revealed several unsuspected abnormalities, particularly visual ones. Motor and visual motor deficits were frequent among hearing-impaired children with brain damage. The Performance Scale of the Wechsler Intelligence Scale for Children, and Raven's Coloured Progressive Matrices, as well as the Paper Folding item of the Hiskey-Nebraska Test of Learning Aptitude appeared sensitive to the presence of brain damage. The mean score for the WISC Performance Scale fell within the average range for hearing children, supporting previous findings of cognitive competence of the deaf. In this sample, Hiskey-Nebraska scores tended to be lower than WISC scores. Reasons for this discrepancy were suggested and did not appear to be accounted for by brain damage. Deficits in items requiring visual memory, sequencing, and categorization were relatively prevalent but showed no etiologic predilection. They were thought to be related to the consequence of hearing loss rather than to brain damage. Difficulty with stereognosis highlighted the problem of deciding why a hearing-impaired child might fail a particular task. This difficulty suggested that failure might not indicate a deficit in the function the task was designed to measure, but rather, reliance on an inefficient strategy for success.

  4. Social cognitive impairments and negative symptoms in schizophrenia: are there subtypes with distinct functional correlates?

    Science.gov (United States)

    Bell, Morris D; Corbera, Silvia; Johannesen, Jason K; Fiszdon, Joanna M; Wexler, Bruce E

    2013-01-01

    Social cognitive impairments and negative symptoms are core features of schizophrenia closely associated with impaired community functioning. However, little is known about whether these are independent dimensions of illness and if so, whether individuals with schizophrenia can be meaningfully classified based on these dimensions (SANS) and potentially differentially treated. Five social cognitive measures plus Scale for the Assessment of Negative Symptoms (SANS) and Positive and Negative Syndrome Scale (PANSS) scores in a sample of 77 outpatients produced 2 distinct factors--a social cognitive factor and a negative symptom factor. Factor scores were used in a cluster analysis, which yielded 3 well-defined groupings--a high negative symptom group (HN) and 2 low negative symptom groups, 1 with higher social cognition (HSC) and 1 with low social cognition (LSC). To make these findings more practicable for research and clinical settings, a rule of thumb for categorizing using only the Mayer-Salovey-Caruso Emotional Intelligence Test and PANSS negative component was created and produced 84.4% agreement with the original cluster groups. An additional 63 subjects were added to cross validate the rule of thumb. When samples were combined (N = 140), the HSC group had significantly better quality of life and Global Assessment of Functioning (GAF) scores, higher rates of marriage and more hospitalizations. The LSC group had worse criminal and substance abuse histories. With 2 common assessment instruments, people with schizophrenia can be classified into 3 subgroups that have different barriers to community integration and could potentially benefit from different treatments.

  5. Medroxyprogesterone acetate impairs human dendritic cell activation and function.

    Science.gov (United States)

    Quispe Calla, N E; Ghonime, M G; Cherpes, T L; Vicetti Miguel, R D

    2015-05-01

    Does medroxyprogesterone acetate (MPA) impair human dendritic cell (DC) activation and function? In vitro MPA treatment suppressed expression of CD40 and CD80 by human primary DCs responding to Toll-like receptor 3 (TLR3) agonist stimulation (i.e. DC activation). Moreover, this MPA-mediated decrease in CD40 expression impaired DC capacity to stimulate T cell proliferation (i.e. DC function). MPA is the active molecule in Depo-Provera(®) (DMPA), a commonly used injectable hormonal contraceptive (HC). Although DMPA treatment of mice prior to viral mucosal tissue infection impaired the capacity of DCs to up-regulate CD40 and CD80 and prime virus-specific T cell proliferation, neither DC activation marker expression nor the ability of DCs to promote T cell proliferation were affected by in vitro progesterone treatment of human DCs generated from peripheral blood monocytes. This cross-sectional study examined MPA-mediated effects on the activation and function of human primary untouched peripheral blood DCs. Human DCs isolated from peripheral blood mononuclear cells by negative immunomagnetic selection were incubated for 24 h with various concentrations of MPA. After an additional 24 h incubation with the TLR3 agonist polyinosinic:polycytidylic acid (poly I:C), flow cytometry was used to evaluate DC phenotype (i.e. expression of CD40, CD80, CD86, and HLA-DR). In separate experiments, primary untouched human DCs were sequentially MPA-treated, poly I:C-activated, and incubated for 7 days with fluorescently labeled naïve allogeneic T cells. Flow cytometry was then used to quantify allogeneic T cell proliferation. Several pharmacologically relevant concentrations of MPA dramatically reduced CD40 and CD80 expression in human primary DCs responding to the immunostimulant poly I:C. In addition, MPA-treated DCs displayed a reduced capacity to promote allogeneic CD4(+) and CD8(+) T cell proliferation. In other DC: T cell co-cultures, the addition of antibody blocking the CD40

  6. The Reliability of the CVI Range: A Functional Vision Assessment for Children with Cortical Visual Impairment

    Science.gov (United States)

    Newcomb, Sandra

    2010-01-01

    Children who are identified as visually impaired frequently have a functional vision assessment as one way to determine how their visual impairment affects their educational performance. The CVI Range is a functional vision assessment for children with cortical visual impairment. The purpose of the study presented here was to examine the…

  7. The Reliability of the CVI Range: A Functional Vision Assessment for Children with Cortical Visual Impairment

    Science.gov (United States)

    Newcomb, Sandra

    2010-01-01

    Children who are identified as visually impaired frequently have a functional vision assessment as one way to determine how their visual impairment affects their educational performance. The CVI Range is a functional vision assessment for children with cortical visual impairment. The purpose of the study presented here was to examine the…

  8. Executive functioning in preschoolers with specific language impairment

    Directory of Open Access Journals (Sweden)

    Constance eVissers

    2015-10-01

    Full Text Available The pathogenesis of Specific Language Impairment (SLI is still largely beyond our understanding. In this review, a neuropsychological perspective on language impairments in SLI is taken, focusing specifically on executive functioning (EF in preschoolers (age range: 2.6-6.1 years with SLI. Based on the studies described in this review, it can be concluded that similar to school-aged children with SLI, preschoolers with SLI show difficulties in working memory, inhibition and shifting, as revealed by both performance based measures and behavioural ratings. It seems plausible that a complex, reciprocal relationship exists between language and EF throughout development. Future research is needed to examine if, and if yes how, language and EF interact in SLI. Broad neuropsychological assessment in which both language and EF are taken into account may contribute to early detection of SLI. This in turn can lead to early and tailored treatment of children with (suspected SLI aimed not only at stimulating language development but also at strengthening EF.

  9. Impaired quality and efficiency of sleep impairs cognitive functioning in Addison's disease.

    Science.gov (United States)

    Henry, Michelle; Ross, Ian Louis; Wolf, Pedro Sofio Abril; Thomas, Kevin Garth Flusk

    2017-04-01

    Standard replacement therapy for Addison's disease (AD) does not restore a normal circadian rhythm. Periods of sub- and supra- physiological cortisol levels experienced by patients with AD likely induce disrupted sleep. Given that healthy sleep plays an important role in memory consolidation, the novelty of the current study was to characterise, using objective measures, the relationship between sleep and memory in patients with AD, and to examine the hypothesis that poor sleep is a biological mechanism underlying memory impairment in those patients. We used a within-subjects design. Ten patients with AD and 10 matched healthy controls completed standardised neuropsychological tests assessing declarative memory (Rey Auditory Verbal Learning Test) and procedural memory (Finger Tapping Task) before and after a period of actigraphy-measured sleep, and before and after a period of waking. Relative to healthy controls, patients with AD experienced disrupted sleep characterised by poorer sleep efficiency and more time spent awake. Patients also showed impaired verbal learning and memory relative to healthy controls (p=0.007). Furthermore, whereas healthy controls' declarative memory performance benefited from a period of sleep compared to waking (p=0.032), patients with AD derived no such benefit from sleep (p=0.448). Regarding the procedural memory task, analyses detected no significant between-group differences (all p's<0.065), and neither group showed significant sleep-enhanced performance. We demonstrated, using actigraphy and standardized measures of memory performance, an association between sleep disturbances and cognitive deficits in patients with AD. These results suggest that, in patients with AD, the source of memory deficits is, at least to some extent, disrupted sleep patterns that interfere with optimal consolidation of previously-learned declarative information. Hence, treating the sleep disturbances that are frequently experienced by patients with AD may

  10. Cyclosporin A induces hyperpermeability of the blood-brain barrier by inhibiting autocrine adrenomedullin-mediated up-regulation of endothelial barrier function.

    Science.gov (United States)

    Dohgu, Shinya; Sumi, Noriko; Nishioku, Tsuyoshi; Takata, Fuyuko; Watanabe, Takuya; Naito, Mikihiko; Shuto, Hideki; Yamauchi, Atsushi; Kataoka, Yasufumi

    2010-10-10

    Cyclosporin A, a potent immunosuppressant, can often produce neurotoxicity in patients, although its penetration into the brain is restricted by the blood-brain barrier (BBB). Brain pericytes and astrocytes, which are periendothelial accessory structures of the BBB, can be involved in cyclosporin A-induced BBB disruption. However, the mechanism by which cyclosporin A causes BBB dysfunction remains unknown. Here, we show that in rodent brain endothelial cells, cyclosporin A decreased transendothelial electrical resistance (TEER) by inhibiting intracellular signal transduction downstream of adrenomedullin, an autocrine regulator of BBB function. Cyclosporin A stimulated adrenomedullin release from brain endothelial cells, but did not affect binding of adrenomedullin to its receptors. This cyclosporin A-induced decrease in TEER was attenuated by exogenous addition of adrenomedullin. Cyclosporin A dose-dependently decreased the total cAMP concentration in brain endothelial cells. A combination of cyclosporin A (1microM) with an adenylyl cyclase inhibitor, 9-(tetrahydro-2-furanyl)-9H-purin-6-amine (SQ22536; 10microM), or a protein kinase A (PKA) inhibitor, N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; 1microM), markedly increased sodium fluorescein permeability in brain endothelial cells, whereas each drug alone had no effect. Thus, these data suggest that cyclosporin A inhibits the adenylyl cyclase/cyclic AMP/PKA signaling pathway activated by adrenomedullin, leading to impairment of brain endothelial barrier function. Copyright 2010. Published by Elsevier B.V.

  11. Reorganization of functional networks in mild cognitive impairment.

    Directory of Open Access Journals (Sweden)

    Javier M Buldú

    Full Text Available Whether the balance between integration and segregation of information in the brain is damaged in Mild Cognitive Impairment (MCI subjects is still a matter of debate. Here we characterize the functional network architecture of MCI subjects by means of complex networks analysis. Magnetoencephalograms (MEG time series obtained during a memory task were evaluated by synchronization likelihood (SL, to quantify the statistical dependence between MEG signals and to obtain the functional networks. Graphs from MCI subjects show an enhancement of the strength of connections, together with an increase in the outreach parameter, suggesting that memory processing in MCI subjects is associated with higher energy expenditure and a tendency toward random structure, which breaks the balance between integration and segregation. All features are reproduced by an evolutionary network model that simulates the degenerative process of a healthy functional network to that associated with MCI. Due to the high rate of conversion from MCI to Alzheimer Disease (AD, these results show that the analysis of functional networks could be an appropriate tool for the early detection of both MCI and AD.

  12. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of U...... therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

  13. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of ...... therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

  14. Breaking the sound barrier: oral health education for children with hearing impairment.

    Science.gov (United States)

    Shetty, Vabitha; Kumar, Jithendra; Hegde, Amitha

    2014-01-01

    In our study, a visual oral health education (OHE) program was specially designed for children with hearing impairment. Its efficacy in improving their oral health status was evaluated after periods of reinforcement and nonreinforcement. One hundred and ten institutionalized children with moderate-to-severe hearing impairment aged 6-14 years were selected for the study. Oral health status was evaluated at the start of the study (pre-OHE level) using the Modified Gingival Index (MGI) and the Turesky-Gilmore-Glickman modification of the Quigley Hein Plaque Index (MQPI). Salivary Streptococcus mutans levels of the children were also evaluated. Brushing skills were assessed using the Simmons index at the start of the study. Significant decreases were observed in the mean values of both the MGI and MQPI from the baseline up to the values obtained at the end of both periods of reinforcement and nonreinforcement. Significant reduction in S. mutans counts was observed, from Pre-OHE levels up to the levels at the end of the period of nonreinforcement. Brushing skills of children improved significantly at the end of study, notably in areas where brushing was previously deemed unsatisfactory. The OHE program specially formulated for the hearing impaired children was effective in improving their oral health status significantly.

  15. Endothelial RIG-I activation impairs endothelial function

    Energy Technology Data Exchange (ETDEWEB)

    Asdonk, Tobias, E-mail: tobias.asdonk@ukb.uni-bonn.de [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Motz, Inga; Werner, Nikos [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Coch, Christoph; Barchet, Winfried; Hartmann, Gunther [Institute for Clinical Chemistry and Clinical Pharmacology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Nickenig, Georg; Zimmer, Sebastian [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer RIG-I activation impairs endothelial function in vivo. Black-Right-Pointing-Pointer RIG-I activation alters HCAEC biology in vitro. Black-Right-Pointing-Pointer EPC function is affected by RIG-I stimulation in vitro. -- Abstract: Background: Endothelial dysfunction is a crucial part of the chronic inflammatory atherosclerotic process and is mediated by innate and acquired immune mechanisms. Recent studies suggest that pattern recognition receptors (PRR) specialized in immunorecognition of nucleic acids may play an important role in endothelial biology in a proatherogenic manner. Here, we analyzed the impact of endothelial retinoic acid inducible gene I (RIG-I) activation upon vascular endothelial biology. Methods and results: Wild type mice were injected intravenously with 32.5 {mu}g of the RIG-ligand 3pRNA (RNA with triphosphate at the 5 Prime end) or polyA control every other day for 7 days. In 3pRNA-treated mice, endothelium-depended vasodilation was significantly impaired, vascular oxidative stress significantly increased and circulating endothelial microparticle (EMP) numbers significantly elevated compared to controls. To gain further insight in RIG-I dependent endothelial biology, cultured human coronary endothelial cells (HCAEC) and endothelial progenitor cells (EPC) were stimulated in vitro with 3pRNA. Both cells types express RIG-I and react with receptor upregulation upon stimulation. Reactive oxygen species (ROS) formation is enhanced in both cell types, whereas apoptosis and proliferation is not significantly affected in HCAEC. Importantly, HCAEC release significant amounts of proinflammatory cytokines in response to RIG-I stimulation. Conclusion: This study shows that activation of the cytoplasmatic nucleic acid receptor RIG-I leads to endothelial dysfunction. RIG-I induced endothelial damage could therefore be an important pathway in atherogenesis.

  16. Inorganic arsenic impairs differentiation and functions of human dendritic cells

    Energy Technology Data Exchange (ETDEWEB)

    Macoch, Mélinda; Morzadec, Claudie [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Fardel, Olivier [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Pôle Biologie, Centre Hospitalier Universitaire (CHU) Rennes, 2 rue Henri Le Guilloux, 35033 Rennes (France); Vernhet, Laurent, E-mail: laurent.vernhet@univ-rennes1.fr [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France)

    2013-01-15

    Experimental studies have demonstrated that the antileukemic trivalent inorganic arsenic prevents the development of severe pro-inflammatory diseases mediated by excessive Th1 and Th17 cell responses. Differentiation of Th1 and Th17 subsets is mainly regulated by interleukins (ILs) secreted from dendritic cells (DCs) and the ability of inorganic arsenic to impair interferon-γ and IL-17 secretion by interfering with the physiology of DCs is unknown. In the present study, we demonstrate that high concentrations of sodium arsenite (As(III), 1–2 μM) clinically achievable in plasma of arsenic-treated patients, block differentiation of human peripheral blood monocytes into immature DCs (iDCs) by inducing their necrosis. Differentiation of monocytes in the presence of non-cytotoxic concentrations of As(III) (0.1 to 0.5 μM) only slightly impacts endocytotic activity of iDCs or expression of co-stimulatory molecules in cells activated with lipopolysaccharide. However, this differentiation in the presence of As(III) strongly represses secretion of IL-12p70 and IL-23, two major regulators of Th1 and Th17 activities, from iDCs stimulated with different toll-like receptor (TLR) agonists in metalloid-free medium. Such As(III)-exposed DCs also exhibit reduced mRNA levels of IL12A and/or IL12B genes when activated with TLR agonists. Finally, differentiation of monocytes with non-cytotoxic concentrations of As(III) subsequently reduces the ability of activated DCs to stimulate the release of interferon-γ and IL-17 from Th cells. In conclusion, our results demonstrate that clinically relevant concentrations of inorganic arsenic markedly impair in vitro differentiation and functions of DCs, which may contribute to the putative beneficial effects of the metalloid towards inflammatory autoimmune diseases. Highlights: ► Inorganic arsenic impairs differentiation and functions of human dendritic cells (DCs) ► Arsenite (> 1 μM) blocks differentiation of dendritic cells by

  17. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    OpenAIRE

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation plays a pivotal role in the development of epidermal and SC features of AD skin and that AD epidermal features can be maintained in vitro when AD skin biopsies are used to generate explant-HSEs. The...

  18. The "Alarmins" HMBG1 and IL-33 Downregulate Structural Skin Barrier Proteins and Impair Epidermal Growth

    DEFF Research Database (Denmark)

    Nygaard, Uffe; van den Bogaard, Ellen H; Niehues, Hanna;

    2016-01-01

    investigated the impact of HMGB1 and IL-33 on gene transcription, protein expression and epidermal differentiation across 3 distinct keratinocyte in vitro models. Primary keratinocytes from healthy donors were used in submerged monolayer cultures, 3D human epidermis equivalents and 3D human skin equivalents......The epidermal-derived "alarmins" high-mobility group box 1 (HMGB1) protein and interleukin-33 (IL-33) are upregulated in patients with atopic dermatitis. How-ever, their capacity as pro-inflammatory cytokines and their derived effects on skin barrier regulation are poorly elucidated. We...

  19. Melamine Impairs Renal and Vascular Function in Rats.

    Science.gov (United States)

    Tian, Xiao Yu; Wong, Wing Tak; Lau, Chi Wai; Wang, Yi-Xiang; Cheang, Wai San; Liu, Jian; Lu, Ye; Huang, Huihui; Xia, Yin; Chen, Zhen Yu; Mok, Chuen-Shing; Lau, Chau-Ming; Huang, Yu

    2016-06-21

    Melamine incident, linked to nephrotoxicity and kidney stone in infants previously exposed to melamine-contaminated milk products, was unprecedentedly grave in China in 2008 as little was known about the mechanistic process leading to renal dysfunction in affected children. This study investigates whether neonatal ingestion of melamine leads to renal and vascular dysfunction in adulthood; and whether ingestion of melamine in pregnant rats leads to renal dysfunction in their offspring. A combination of approaches employed includes functional studies in rat renal arteries, renal blood flow measurement by functional magnetic resonance imaging, assay for pro-inflammatory and fibrotic biomarkers, immunohistochemistry, and detection of plasma and renal melamine. We provide mechanistic evidence showing for the first time that melamine reduces renal blood flow and impairs renal and vascular function associated with overexpression of inflammatory markers, transforming growth factor-β1, bone morphogenic protein 4 and cyclooxygenase-2 in kidney and renal vasculature. Melamine also induces renal inflammation and fibrosis. More importantly, melamine causes nephropathies in offsprings from pregnant rat exposed to melamine during pregnancy, as well as in neonatal rat exposed to melamine afterbirth, thus supporting the clinical observations of kidney stone and acute renal failure in infants consuming melamine-contaminated milk products.

  20. Impairment of T cell function in parasitic infections.

    Directory of Open Access Journals (Sweden)

    Vasco Rodrigues

    2014-02-01

    Full Text Available In mammals subverted as hosts by protozoan parasites, the latter and/or the agonists they release are detected and processed by sensors displayed by many distinct immune cell lineages, in a tissue(s-dependent context. Focusing on the T lymphocyte lineage, we review our present understanding on its transient or durable functional impairment over the course of the developmental program of the intracellular parasites Leishmania spp., Plasmodium spp., Toxoplasma gondii, and Trypanosoma cruzi in their mammalian hosts. Strategies employed by protozoa to down-regulate T lymphocyte function may act at the initial moment of naïve T cell priming, rendering T cells anergic or unresponsive throughout infection, or later, exhausting T cells due to antigen persistence. Furthermore, by exploiting host feedback mechanisms aimed at maintaining immune homeostasis, parasites can enhance T cell apoptosis. We will discuss how infections with prominent intracellular protozoan parasites lead to a general down-regulation of T cell function through T cell anergy and exhaustion, accompanied by apoptosis, and ultimately allowing pathogen persistence.

  1. β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

    Science.gov (United States)

    Shao, Yujing; Guo, Yuming; Wang, Zhong

    2013-07-01

    This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P cells (P cells at 14 dpi (P cells (P cells (P Salmonella Typhimurium in comparison with Salmonella Typhimurium challenge alone. β-1,3/1,6-Glucan addition had significant inhibitory effects (P Salmonella colonization levels and liver Salmonella invasion of the Salmonella Typhimurium-infected birds compared with the PC group. Intestinal tight junction proteins claudin-1, claudin-4, and occludin mRNA expression in the jejunum at 14 dpi was significantly decreased by Salmonella Typhimurium challenge alone (P Salmonella Typhimurium-infected birds in comparison with the PC group. Our results indicate that dietary β-1,3/1,6-glucan can alleviate intestinal mucosal barrier impairment in broiler chickens challenged with Salmonella Typhimurium.

  2. Alterations of intestinal mucosa structure and barrier function following traumatic brain injury in rats

    Institute of Scientific and Technical Information of China (English)

    Chun-Hua Hang; Ji-Xin Shi; Jie-Shou Li; Wei Wu; Hong-Xia Yin

    2003-01-01

    AIM: Gastrointestinal dysfunction is a common complication in patients with traumatic brain injury (TBI). However, the effect of traumatic brain injury on intestinal mucosa has not been studied previously. The aim of the current study was to explore the alterations of intestinal mucosa morphology and barrier function, and to determine how rapidly the impairment of gut barrier function occurs and how long it persists following traumatic brain injury.METHODS: Male Wistar rats were randomly divided into six groups (6 rats each group) including controls without brain injury and traumatic brain injury groups at hours 3,12, 24, and 72, and on day 7. The intestinal mucosa structure was detected by histopathological examination and electron microscopy. Gut barrier dysfunction was evaluated by detecting serum endotoxin and intestinal permeability. The level of serum endotoxin and intestinal permeability was measured by using chromogenic limulus amebocyte lysate and lactulose/mannitol (L/M) ratio, respectively.RESULTS: After traumatic brain injury, the histopathological alterations of gut mucosa occurred rapidly as early as 3 hours and progressed to a serious state, including shedding of epithelial cells, fracture of villi, focal ulcer, fusion of adjacent villi, dilation of central chyle duct, mucosal atrophy,and vascular dilation, congestion and edema in the villous interstitium and lamina propria. Apoptosis of epithelial cells,fracture and sparseness of microvilli, loss of tight junction between enterocytes, damage of mitochondria and endoplasm, were found by electron microscopy. The villous height, crypt depth and surface area in jejunum decreased progressively with the time of brain injury. As compared with that of control group (183.7±41.8 EU/L), serum endotoxin level was signnificantly increased at 3, 12, and 24 hours following TBI (434.8±54.9 EU/L, 324.2±61.7 EU/L and 303.3±60.2 EU/L, respectively), and peaked at 72 hours (560.5±76.2 EU/L), then declined on day 7

  3. Neuropsychological functioning in youth with obsessive compulsive disorder: an examination of executive function and memory impairment.

    Science.gov (United States)

    Lewin, Adam B; Larson, Michael J; Park, Jennifer M; McGuire, Joseph F; Murphy, Tanya K; Storch, Eric A

    2014-04-30

    Preliminary research suggests neuropsychological deficits in youth with obsessive-compulsive disorder (OCD) similar to those in adults; however, small samples and methodological confounds limit interpretation. We aimed to examine the rates and clinical correlates of cognitive sequelae in youth with OCD, focusing on executive functioning and memory abilities. Youth ages 7-17 years with OCD (N=96) completed a hypothesis-driven neuropsychological battery (including the Rey-Osterreith Complex Figure, California Verbal Learning Test, and subtests of the Delis-Kaplan Executive Function System and Wide Range Assessment of Memory and Learning) that primarily assessed executive functioning, memory and processing speed. Cognitive sequelae were identified in 65% of youth (37% using a more stringent definition of impairment). Magnitude of cognitive sequelae was not associated with OCD severity or age; however, greater neuropsychological impairments were found amongst youth prescribed atypical neuroleptics and those diagnosed with comorbid tic disorders. Comorbidity burden was associated with presence of neuropsychological impairment, but was not specific to any single test. Findings suggest that the presence of cognitive sequelae is prevalent amongst treatment-seeking youth with OCD. Deficits were found in executive functioning and non-verbal memory performance but these impairments were not associated with OCD severity.

  4. Pulmonary function impairment measured by pulmonary function tests in long-term survivors of childhood cancer

    NARCIS (Netherlands)

    Mulder, R.L.; Thönissen, N.M.; van der Pal, H.J.H.; Bresser, P.; Hanselaar, W.; Koning, C.C.E.; Oldenburger, F.; Heij, H.A.; Caron, H.N.; Kremer, L.C.M.

    2011-01-01

    Childhood cancer survivors (CCSs) have an increased risk of morbidity and mortality. The prevalence and risk factors of pulmonary function impairment were investigated in a large cohort of CCSs treated with potentially pulmotoxic therapy with a minimal follow-up of 5 years after diagnosis. The study

  5. Compensating for Executive Function Impairments after TBI: A Single Case Study of Functional Intervention.

    Science.gov (United States)

    Turkstra, Lyn S.; Flora, Tracy L.

    2002-01-01

    Compensatory strategies were designed to enable a client with traumatic brain injury to obtain professional employment. In a series of speech-language therapy sessions, compensatory strategies targeting impairments in executive function were developed, refined, and trained in mock-interview situations. Significant improvements were noted in…

  6. Assistive Devices for Children with Functional Impairments: Impact on Child and Caregiver Function

    Science.gov (United States)

    Henderson, Stacey; Skelton, Heather; Rosenbaum, Peter

    2008-01-01

    Functional impairments can limit a child's ability to participate in the experiences of childhood. This "deprivation" can, in turn, have a negative effect on such children's development, academic performance, and quality of life, as well as on the lives of their caregivers and families. Many adults use assistive devices to overcome functional…

  7. Multiple sclerosis impairs regional functional connectivity in the cerebellum

    Directory of Open Access Journals (Sweden)

    Anne-Marie Dogonowski

    2014-01-01

    Full Text Available Resting-state functional magnetic resonance imaging (rs-fMRI has been used to study changes in long-range functional brain connectivity in multiple sclerosis (MS. Yet little is known about how MS affects functional brain connectivity at the local level. Here we studied 42 patients with MS and 30 matched healthy controls with whole-brain rs-fMRI at 3 T to examine local functional connectivity. Using the Kendall's Coefficient of Concordance, regional homogeneity of blood-oxygen-level-dependent (BOLD-signal fluctuations was calculated for each voxel and used as a measure of local connectivity. Patients with MS showed a decrease in regional homogeneity in the upper left cerebellar hemisphere in lobules V and VI relative to healthy controls. Similar trend changes in regional homogeneity were present in the right cerebellar hemisphere. The results indicate a disintegration of regional processing in the cerebellum in MS. This might be caused by a functional disruption of cortico-ponto-cerebellar and spino-cerebellar inputs, since patients with higher lesion load in the left cerebellar peduncles showed a stronger reduction in cerebellar homogeneity. In patients, two clusters in the left posterior cerebellum expressed a reduction in regional homogeneity with increasing global disability as reflected by the Expanded Disability Status Scale (EDSS score or higher ataxia scores. The two clusters were mainly located in Crus I and extended into Crus II and the dentate nucleus but with little spatial overlap. These findings suggest a link between impaired regional integration in the cerebellum and general disability and ataxia.

  8. Mental disorders, functional impairment, and nerve growth factor

    Directory of Open Access Journals (Sweden)

    Salles FHM

    2016-12-01

    21.0 software. NGF serum levels were increased significantly in patients with obsessive–compulsive disorder compared with patients with no obsessive–compulsive disorder (P=0.015. An increase in serum NGF levels in generalized anxiety disorder patients was observed compared with patients with no generalized anxiety disorder (P=0.047. NGF was negatively associated with autonomy (P=0.024, r=–0.136, work (P=0.040, r=–0.124, and cognition (P=0.024, r=–0.137, thereby showing that changes in serum levels of NGF are associated with functionality in mental disorders. Keywords: NGF, mental disorders, functional impairment

  9. Human intestinal barrier function in health and disease

    NARCIS (Netherlands)

    König, Julia; Wells, Jerry; Cani, Patrice D.; García-Ródenas, Clara L.; MacDonald, Tom; Mercenier, Annick; Whyte, Jacqueline; Troost, Freddy J.; Brummer, Robert-Jan

    2016-01-01

    The gastrointestinal tract consists of an enormous surface area that is optimized to efficiently absorb nutrients, water, and electrolytes from food. At the same time, it needs to provide a tight barrier against the ingress of harmful substances, and protect against a reaction to omnipresent

  10. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.

  11. Neuropsychiatric symptoms and functional connectivity in mild cognitive impairment

    Science.gov (United States)

    Munro, Catherine E.; Donovan, Nancy J.; Guercio, Brendan J.; Wigman, Sarah E.; Schultz, Aaron P.; Amariglio, Rebecca E.; Rentz, Dorene M.; Johnson, Keith A.; Sperling, Reisa A.; Marshall, Gad A.

    2015-01-01

    Background Neuropsychiatric symptoms (NPS), such as apathy and depression, commonly accompany cognitive and functional decline in early Alzheimer’s disease (AD). Prior studies have shown associations between affective NPS symptoms and neurodegeneration of medial frontal and inferior temporal regions in mild cognitive impairment (MCI) and AD dementia. Objective To investigate the association between functional connectivity in four brain networks and NPS in elderly with MCI. Methods NPS were assessed using the Neuropsychiatric Inventory in 42 subjects with MCI. Resting-state functional connectivity in four networks (default mode network, fronto-parietal control network (FPCN), dorsal attention network, and ventral attention network) was assessed using seed-based magnetic resonance imaging. Factor analysis was used to identify two factors of NPS: Affective and Hyperactivity. Linear regression models were utilized with the neuropsychiatric factors as the dependent variable and the four networks as the predictors of interest. Covariates included age, sex, premorbid intelligence, processing speed, memory, head movement, and signal-to-noise ratio. These analyses were repeated with the individual items of the Affective factor, using the same predictors. Results There was a significant association between greater Affective factor symptoms and reduced FPCN connectivity (p=0.03). There was no association between the Hyperactivity factor and any of the networks. Secondary analyses revealed an association between greater apathy and reduced FPCN connectivity (p=0.005), but none in other networks. Conclusions Decreased connectivity in the FPCN may be associated with greater affective symptoms, particularly apathy, early in AD. These findings extend prior studies, using different functional imaging modalities in individuals with greater disease severity. PMID:25854929

  12. Intermittent Hypoxia Impairs Endothelial Function in Early Preatherosclerosis.

    Science.gov (United States)

    Tuleta, I; França, C N; Wenzel, D; Fleischmann, B; Nickenig, G; Werner, N; Skowasch, D

    2015-01-01

    Intermittent hypoxia seems to be a major pathomechanism of obstructive sleep apnea-associated progression of atherosclerosis. The goal of the present study was to assess the influence of hypoxia on endothelial function depending on the initial stage of vasculopathy. We used 16 ApoE-/- mice were exposed to a 6-week-intermittent hypoxia either immediately (early preatherosclerosis) or after 5 weeks of high-cholesterol diet (advanced preatherosclerosis). Another 16 ApoE-/- mice under normoxia served as corresponding controls. Endothelial function was measured by an organ bath technique. Blood plasma CD31+/annexin V+ endothelial microparticles as well as sca1/flk1+ endothelial progenitor cells in blood and bone marrow were analyzed by flow cytometry. The findings were that intermittent hypoxia impaired endothelial function (56.6±6.2% of maximal phenylephrine-induced vasoconstriction vs. 35.2±4.1% in control) and integrity (increased percentage of endothelial microparticles: 0.28±0.05% vs. 0.15±0.02% in control) in early preatherosclerosis. Peripheral repair capacity expressed as the number of endothelial progenitor cells in blood was attenuated under hypoxia (2.0±0.5% vs. 5.3±1.9% in control), despite the elevated number of these cells in the bone marrow (2.0±0.4% vs. 1.1±0.2% in control). In contrast, endothelial function, as well as microparticle and endothelial progenitor cell levels were similar under hypoxia vs. control in advanced preatherosclerosis. We conclude that hypoxia aggravates endothelial dysfunction and destruction in early preatherosclerosis.

  13. Impaired mitochondrial functions in organophosphate induced delayed neuropathy in rats.

    Science.gov (United States)

    Masoud, Anwar; Kiran, Ravi; Sandhir, Rajat

    2009-12-01

    Acute exposure to organophosphates induces a delayed neurodegenerative condition known as organophosphate-induced delayed neuropathy (OPIDN). The mechanism of OPIDN has not been fully understood as it does not involve cholinergic crisis. The present study has been designed to evaluate the role of mitochondrial dysfunctions in the development of OPIDN. OPIDN was induced in rats by administering acute dose of monocrotophos (MCP, 20 mg/kg body weight, orally) or dichlorvos (DDVP, 200 mg/kg body weight, subcutaneously), 15-20 min after treatment with antidotes [atropine (20 mg/kg body weight) and 2-PAM (100 mg/kg body weight) intraperitoneally]. MDA levels were observed to be higher and thiol content was lower in mitochondria from brain regions of OP exposed animals. This was accompanied by decreased activities of the mitochondrial enzymes; NADH dehydrogenase, succinate dehydrogenase, and cytochrome oxidase. In addition, mitochondrial functions assessed by MTT reduction also confirmed mitochondrial dysfunctions following development of OPIDN. The spatial long-term memory evaluated using elevated plus-maze test was observed to be deficit in OPIDN. The results suggest impaired mitochondrial functions as a mechanism involved in the development of organophosphate induced delayed neuropathy.

  14. Impaired fetal adrenal function in intrahepatic cholestasis of pregnancy

    Science.gov (United States)

    Wang, Chunfang; Chen, Xiaojun; Zhou, Shu-Feng; Li, Xiaotian

    2011-01-01

    Summary Background Intrahepatic cholestasis of pregnancy (ICP) is a pregnancy-associated liver disease of unknown etiology. The aim of this study was to investigate the change in maternal and fetal adrenal function in clinical and experimental ICP. Material/Methods The maternal and fetal serum levels of cortisol and dehydroepiandrosterone sulfate (DHEAS) were determined in 14 women with ICP and in pregnant rats with estrogen-induced intrahepatic cholestasis. Results In women with ICP, the fetal serum cortisol and DHEAS levels were significantly higher than those in women with normal pregnancy, after correcting the impact of gestational age at delivery. The relationship between fetal cortisol and maternal cholic acid levels was bidirectional; the fetal cortisol tended to increase in mild ICP, while it decreased in severe ICP. In pregnant rats with estrogen-induced cholestasis, the fetal cortisol level was significantly lower in the group with oxytocin injection, compared with the group without oxytocin injection (191.92±18.86 vs. 272.71±31.83 ng/ml, P<0.05). In contrast, the fetal cortisol concentration was increased after oxytocin injection in normal control rats. Conclusions The data indicate that fetal stress-responsive system is stimulated in mild ICP, but it is suppressed in severe ICP, which might contribute to the occurrence of unpredictable sudden fetal death. Further studies are warranted to explore the role of impaired fetal adrenal function in the pathogenesis of ICP and the clinical implications. PMID:21525808

  15. Acrolein impairs the cholesterol transport functions of high density lipoproteins.

    Science.gov (United States)

    Chadwick, Alexandra C; Holme, Rebecca L; Chen, Yiliang; Thomas, Michael J; Sorci-Thomas, Mary G; Silverstein, Roy L; Pritchard, Kirkwood A; Sahoo, Daisy

    2015-01-01

    High density lipoproteins (HDL) are considered athero-protective, primarily due to their role in reverse cholesterol transport, where they transport cholesterol from peripheral tissues to the liver for excretion. The current study was designed to determine the impact of HDL modification by acrolein, a highly reactive aldehyde found in high abundance in cigarette smoke, on the cholesterol transport functions of HDL. HDL was chemically-modified with acrolein and immunoblot and mass spectrometry analyses confirmed apolipoprotein crosslinking, as well as acrolein adducts on apolipoproteins A-I and A-II. The ability of acrolein-modified HDL (acro-HDL) to serve as an acceptor of free cholesterol (FC) from COS-7 cells transiently expressing SR-BI was significantly decreased. Further, in contrast to native HDL, acro-HDL promotes higher neutral lipid accumulation in murine macrophages as judged by Oil Red O staining. The ability of acro-HDL to mediate efficient selective uptake of HDL-cholesteryl esters (CE) into SR-BI-expressing cells was reduced compared to native HDL. Together, the findings from our studies suggest that acrolein modification of HDL produces a dysfunctional particle that may ultimately promote atherogenesis by impairing functions that are critical in the reverse cholesterol transport pathway.

  16. Impaired PGC-1alpha function in muscle in Huntington's disease.

    Science.gov (United States)

    Chaturvedi, Rajnish K; Adhihetty, Peter; Shukla, Shubha; Hennessy, Thomas; Calingasan, Noel; Yang, Lichuan; Starkov, Anatoly; Kiaei, Mahmoud; Cannella, Milena; Sassone, Jenny; Ciammola, Andrea; Squitieri, Fernando; Beal, M Flint

    2009-08-15

    We investigated the role of PPAR gamma coactivator 1alpha (PGC-1alpha) in muscle dysfunction in Huntington's disease (HD). We observed reduced PGC-1alpha and target genes expression in muscle of HD transgenic mice. We produced chronic energy deprivation in HD mice by administering the catabolic stressor beta-guanidinopropionic acid (GPA), a creatine analogue that reduces ATP levels, activates AMP-activated protein kinase (AMPK), which in turn activates PGC-1alpha. Treatment with GPA resulted in increased expression of AMPK, PGC-1alpha target genes, genes for oxidative phosphorylation, electron transport chain and mitochondrial biogenesis, increased oxidative muscle fibers, numbers of mitochondria and motor performance in wild-type, but not in HD mice. In muscle biopsies from HD patients, there was decreased PGC-1alpha, PGC-1beta and oxidative fibers. Oxygen consumption, PGC-1alpha, NRF1 and response to GPA were significantly reduced in myoblasts from HD patients. Knockdown of mutant huntingtin resulted in increased PGC-1alpha expression in HD myoblast. Lastly, adenoviral-mediated delivery of PGC-1alpha resulted increased expression of PGC-1alpha and markers for oxidative muscle fibers and reversal of blunted response for GPA in HD mice. These findings show that impaired function of PGC-1alpha plays a critical role in muscle dysfunction in HD, and that treatment with agents to enhance PGC-1alpha function could exert therapeutic benefits. Furthermore, muscle may provide a readily accessible tissue in which to monitor therapeutic interventions.

  17. Sorafenib in Liver Function Impaired Advanced Hepatocellular Carcinoma

    Institute of Scientific and Technical Information of China (English)

    You-xin Ji; Lei Sun; Zong-chun Zhang; Zhong-fa Zhang; Ke-tao Lan; Ke-ke Nie; Chuan-xin Geng; Shi-chao Liu; Ling Zhang; Xing-jun Zhuang; Xiao Zou

    2014-01-01

    Objective To explore the efficacy and safty of sorafenib in Child-Pugh class B to class C hepatocellular carcinoma (HCC). Methods In this three-center open-label study from November 2011 to May 2013, we randomly assigned 189 patients with advanced Child-Pugh class B or C HCC patients into two groups, one group with 95 patient to receive sorafenib (400 mg a time, twice a day) and the other group with 94 patients to receive best supportive care. The primary end points were progression-free survival and overall survival. Results The median progression-free survival was 2.2 months and 1.9 months in the sorafenib group and best supportive care group respectively (Hazard ratio in the sorafenib group, 0.55; 95% confidence interval, 0.40-0.75;P=0.002). The median overall survival was 4.0 months and 3.5 months in the sorafenib group and best supportive care group respectively (Hazard ratio in the sorafenib group, 0.48;95%confidence interval, 0.35-0.68;P Conclusions Sorafenib is safe in patients with liver function impaired advanced HCC. It is effective in terms of progression-free survival and overall survival compared with best supportive care. Liver functions are the important predictive factors.

  18. Barrier function in reconstructed epidermis and its resemblance to native human skin

    NARCIS (Netherlands)

    Ponec, M.; Gibbs, S.; Pilgram, G.; Boelsma, E.; Koerten, H.; Bouwstra, J.; Mommaas, M.

    2001-01-01

    One of the prerequisites for the use of human skin equivalents for scientific and screening purposes is that their barrier function is similar to that of native skin. Using human epidermis reconstructed on de-epidermized dermis we demonstrated that the formation of the stratum corneum (SC) barrier i

  19. Barrier function in reconstructed epidermis and its resemblance to native human skin

    NARCIS (Netherlands)

    Ponec, M.; Gibbs, S.; Pilgram, G.; Boelsma, E.; Koerten, H.; Bouwstra, J.; Mommaas, M.

    2001-01-01

    One of the prerequisites for the use of human skin equivalents for scientific and screening purposes is that their barrier function is similar to that of native skin. Using human epidermis reconstructed on de-epidermized dermis we demonstrated that the formation of the stratum corneum (SC) barrier

  20. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function.

    Science.gov (United States)

    Boer, Magdalena; Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola

    2016-02-01

    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part - stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  1. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  2. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  3. Optimization Design Model of Functional Gradient Thermal Barrier Coating Material by Using Parallel Computation

    Directory of Open Access Journals (Sweden)

    Chen Zhao

    2016-01-01

    Full Text Available It is important for huge ship to find the ceramic/metal functional gradient thermal barrier coating materials. A parallel computation model is built for optimization design of three-dimensional ceramic/metal functionally gradient thermal barrier coating material. According to the control equation and initial-boundary conditions, the heat transfer problem is considered, and numerical algorithms of optimization design is constructed by adapting difference method. The numerical results shows that gradient thermal barrier coating material can improve the function of material.

  4. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of U...... therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy....

  5. Reconstructive procedures for impaired upper airway function: laryngeal respiration

    Directory of Open Access Journals (Sweden)

    Müller, Andreas

    2005-09-01

    Full Text Available The larynx is the "bottleneck" of the human airway. For this reason, the effects of stenosing laryngeal pathologies on the vital factor respiratory gas exchange are particularly critical. Internal stabilization is a prerequisite for recovery of the laryngeal respiratory function in severe forms of inspiratory collapse (laryngomalacia. Effective laser surgery techniques have been developed to this end in recent years.Glottis-dilating surgery in cases of bilateral vocal cord motion impairment is now moving in the direction of endoscopic laser cordotomy or cordectomy, whereas arytenoidectomy and open surgical procedures are now used only rarely due to higher secondary morbidity rates. In individual cases, in particular if functional recovery is expected, temporary laterofixation of a vocal cord using an endoscopic suturing technique can be a helpful approach.Extensive laryngeal defects can be covered by means of composite grafts with mucosal lining, a supporting skeleton and their own vascularization. Autologous transplantation of the larynx, with its complex surgical and immunological problems, has become a manageable procedure. The problems of post-transplantation reinnervation and risk assessment of immunosuppression-induced recurrence of the tumor are still under consideration. Reanimation of the bilaterally paralyzed larynx by means of neurorrhaphy (neurosuture, neural grafting and, more recently, functional electrostimulation (pacemaker represents a challenge for the coming years. In most cases of paralysis of the recurrent laryngeal nerve, a part of the muscles is maintained by synkinetic reinnervation when therapy is carried out, which however also prevents effective vocal cord movement due to simultaneous activity of agonists and antagonists. Modulation of reinnervation by means of electrostimulation and modern genetic therapy approaches justify hopes of better outcomes in the future.

  6. Microbubbles shunting via a patent foramen ovale impair endothelial function

    Directory of Open Access Journals (Sweden)

    Henry Fok

    2015-08-01

    Full Text Available Objectives Exposure to intravascular microbubbles after diving and during medical procedures alters endothelial function. The aim of this study was to investigate whether a patent foramen ovale altered forearm endothelial function by facilitating microbubbles transfer. Design Patients attended on two separate visits, at least seven days apart receiving agitated saline or no active intervention in random order. On both days, flow-mediated dilatation of the brachial artery was measured using vascular ultrasound. On the intervention visit, agitated saline was injected and the passage of microbubbles into the arterial circulation was confirmed by echocardiography. Serial flow-mediated dilatation measurements were made after agitated saline and at the same time points after no intervention. Setting St Thomas’ Hospital in London. Participants Patients with a patent foramen ovale (PFO+n = 14, 9 male, mean ± SD age 42.2 ± 10.5 years and patients without a patent foramen ovale (PFO− n = 10, 7 male, mean ± SD age 49.4 ± 18.4 years were recruited. Main outcome measures Change in brachial artery flow-mediated dilatation. Results In patent foramen ovale + patients, flow-mediated dilatation did not change significantly on the control day but after agitated saline reduced by 2.3 ± 0.3%, 20 minutes after bubble injection (P < 0.005 vs. corresponding change in flow-mediated dilatation during control study. There was no significant change in flow-mediated dilatation for patent foramen ovale− patients at either visit. Conclusion These results suggest that the presence of a patent foramen ovale facilitated impairment of endothelial function acutely by the transfer of microbubbles into the arterial circulation. As a patent foramen ovale is a common condition, this may be relevant to microbubbles exposure in medical procedures and in decompression illness.

  7. Fast-twitch glycolytic skeletal muscle is predisposed to age-induced impairments in mitochondrial function

    DEFF Research Database (Denmark)

    Jacobs, Robert A; Díaz, Víctor; Soldini, Lavinia

    2013-01-01

    The etiology of mammalian senescence is suggested to involve the progressive impairment of mitochondrial function; however, direct observations of age-induced alterations in actual respiratory chain function are lacking. Accordingly, we assessed mitochondrial function via high-resolution respirom...

  8. Elevated copper impairs hepatic nuclear receptor function in Wilson's disease.

    Science.gov (United States)

    Wooton-Kee, Clavia Ruth; Jain, Ajay K; Wagner, Martin; Grusak, Michael A; Finegold, Milton J; Lutsenko, Svetlana; Moore, David D

    2015-09-01

    Wilson's disease (WD) is an autosomal recessive disorder that results in accumulation of copper in the liver as a consequence of mutations in the gene encoding the copper-transporting P-type ATPase (ATP7B). WD is a chronic liver disorder, and individuals with the disease present with a variety of complications, including steatosis, cholestasis, cirrhosis, and liver failure. Similar to patients with WD, Atp7b⁻/⁻ mice have markedly elevated levels of hepatic copper and liver pathology. Previous studies have demonstrated that replacement of zinc in the DNA-binding domain of the estrogen receptor (ER) with copper disrupts specific binding to DNA response elements. Here, we found decreased binding of the nuclear receptors FXR, RXR, HNF4α, and LRH-1 to promoter response elements and decreased mRNA expression of nuclear receptor target genes in Atp7b⁻/⁻ mice, as well as in adult and pediatric WD patients. Excessive hepatic copper has been described in progressive familial cholestasis (PFIC), and we found that similar to individuals with WD, patients with PFIC2 or PFIC3 who have clinically elevated hepatic copper levels exhibit impaired nuclear receptor activity. Together, these data demonstrate that copper-mediated nuclear receptor dysfunction disrupts liver function in WD and potentially in other disorders associated with increased hepatic copper levels.

  9. Reductive stress impairs myoblasts mitochondrial function and triggers mitochondrial hormesis.

    Science.gov (United States)

    Singh, François; Charles, Anne-Laure; Schlagowski, Anna-Isabel; Bouitbir, Jamal; Bonifacio, Annalisa; Piquard, François; Krähenbühl, Stephan; Geny, Bernard; Zoll, Joffrey

    2015-07-01

    Even though oxidative stress damage from excessive production of ROS is a well known phenomenon, the impact of reductive stress remains poorly understood. This study tested the hypothesis that cellular reductive stress could lead to mitochondrial malfunction, triggering a mitochondrial hormesis (mitohormesis) phenomenon able to protect mitochondria from the deleterious effects of statins. We performed several in vitro experiments on L6 myoblasts and studied the effects of N-acetylcysteine (NAC) at different exposure times. Direct NAC exposure (1mM) led to reductive stress, impairing mitochondrial function by decreasing maximal mitochondrial respiration and increasing H₂O₂production. After 24h of incubation, the reactive oxygen species (ROS) production was increased. The resulting mitochondrial oxidation activated mitochondrial biogenesis pathways at the mRNA level. After one week of exposure, mitochondria were well-adapted as shown by the decrease of cellular ROS, the increase of mitochondrial content, as well as of the antioxidant capacities. Atorvastatin (ATO) exposure (100μM) for 24h increased ROS levels, reduced the percentage of live cells, and increased the total percentage of apoptotic cells. NAC exposure during 3days failed to protect cells from the deleterious effects of statins. On the other hand, NAC pretreatment during one week triggered mitochondrial hormesis and reduced the deleterious effect of statins. These results contribute to a better understanding of the redox-dependant pathways linked to mitochondria, showing that reductive stress could trigger mitochondrial hormesis phenomenon.

  10. Impairment of striatal mitochondrial function by acute paraquat poisoning.

    Science.gov (United States)

    Czerniczyniec, Analía; Lanza, E M; Karadayian, A G; Bustamante, J; Lores-Arnaiz, S

    2015-10-01

    Mitochondria are essential for survival. Their primary function is to support aerobic respiration and to provide energy for intracellular metabolic pathways. Paraquat is a redox cycling agent capable of generating reactive oxygen species. The aim of the present study was to evaluate changes in cortical and striatal mitochondrial function in an experimental model of acute paraquat toxicity and to compare if the brain areas and the molecular mechanisms involved were similar to those observed after chronic exposure. Sprague-Dawley rats received paraquat (25 mg/Kg i.p.) or saline and were sacrificed after 24 h. Paraquat treatment decreased complex I and IV activity by 37 and 21 % respectively in striatal mitochondria. Paraquat inhibited striatal state 4 and state 3 KCN-sensitive respiration by 80 % and 62 % respectively, indicating a direct effect on respiratory chain. An increase of 2.2 fold in state 4 and 2.3 fold in state 3 in KCN-insensitive respiration was observed in striatal mitochondria from paraquat animals, suggesting that paraquat redox cycling also consumed oxygen. Paraquat treatment increased hydrogen peroxide production (150 %), TBARS production (42 %) and cardiolipin oxidation/depletion (12 %) in striatal mitochondria. Also, changes in mitochondrial polarization was induced after paraquat treatment. However, no changes were observed in any of these parameters in cortical mitochondria from paraquat treated-animals. These results suggest that paraquat treatment induced a clear striatal mitochondrial dysfunction due to both paraquat redox cycling reactions and impairment of the mitochondrial electron transport, causing oxidative damage. As a consequence, mitochondrial dysfunction could probably lead to alterations in cellular bioenergetics.

  11. Impaired default network functional connectivity in autosomal dominant Alzheimer disease

    Science.gov (United States)

    Chhatwal, Jasmeer P.; Schultz, Aaron P.; Johnson, Keith; Benzinger, Tammie L.S.; Jack, Clifford; Ances, Beau M.; Sullivan, Caroline A.; Salloway, Stephen P.; Ringman, John M.; Koeppe, Robert A.; Marcus, Daniel S.; Thompson, Paul; Saykin, Andrew J.; Correia, Stephen; Schofield, Peter R.; Rowe, Christopher C.; Fox, Nick C.; Brickman, Adam M.; Mayeux, Richard; McDade, Eric; Bateman, Randall; Fagan, Anne M.; Goate, Allison M.; Xiong, Chengjie; Buckles, Virginia D.; Morris, John C.

    2013-01-01

    Objective: To investigate default mode network (DMN) functional connectivity MRI (fcMRI) in a large cross-sectional cohort of subjects from families harboring pathogenic presenilin-1 (PSEN1), presenilin-2 (PSEN2), and amyloid precursor protein (APP) mutations participating in the Dominantly Inherited Alzheimer Network. Methods: Eighty-three mutation carriers and 37 asymptomatic noncarriers from the same families underwent fMRI during resting state at 8 centers in the United States, United Kingdom, and Australia. Using group-independent component analysis, fcMRI was compared using mutation status and Clinical Dementia Rating to stratify groups, and related to each participant's estimated years from expected symptom onset (eYO). Results: We observed significantly decreased DMN fcMRI in mutation carriers with increasing Clinical Dementia Rating, most evident in the precuneus/posterior cingulate and parietal cortices (p < 0.001). Comparison of asymptomatic mutation carriers with noncarriers demonstrated decreased fcMRI in the precuneus/posterior cingulate (p = 0.014) and right parietal cortex (p = 0.0016). We observed a significant interaction between mutation carrier status and eYO, with decreases in DMN fcMRI observed as mutation carriers approached and surpassed their eYO. Conclusion: Functional disruption of the DMN occurs early in the course of autosomal dominant Alzheimer disease, beginning before clinically evident symptoms, and worsening with increased impairment. These findings suggest that DMN fcMRI may prove useful as a biomarker across a wide spectrum of disease, and support the feasibility of DMN fcMRI as a secondary endpoint in upcoming multicenter clinical trials in Alzheimer disease. PMID:23884042

  12. FUNCTIONAL PERFORMANCE, PARTICIPATION AND AUTONOMY AFTER DISCHARGE FROM PROSTHETIC REHABILITATION : BARRIERS, FACILITATORS AND OUTCOMES

    NARCIS (Netherlands)

    van Twillert, Sacha; Stuive, Ilse; Geertzen, Jan H. B.; Postema, Klaas; Lettinga, Ant T.

    2014-01-01

    Objective: To examine functional performance, participation and autonomy after discharge from prosthetic rehabilitation and to identify the barriers and facilitators affecting these outcomes. Design: Concurrent mixed-methods design. Quantitative and qualitative data were collected at discharge from

  13. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    National Research Council Canada - National Science Library

    Jungersted, J. M; Scheer, H; Mempel, M; Baurecht, H; Cifuentes, L; Hogh, J. K; Hellgren, L. I; Jemec, G. B. E; Agner, T; Weidinger, S

    2010-01-01

    ..., Høgh JK, Hellgren LI, Jemec GBE, Agner T, Weidinger S. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema. Allergy 2010; 65: 911-918. Background...

  14. Interleukin-13 promotes expression of Alix to compromise renal tubular epithelial barrier function.

    Science.gov (United States)

    Xu, Chen; Sun, Guangdong; Yang, Jie; Sun, Qianmei; Tong, Zhaohui

    2015-05-01

    The epithelial barrier dysfunction plays a critical role in a number of kidney diseases. The mechanism is unclear. Alix is a protein involving in protein degradation in epithelial cells. This study aims to investigate that interleukin (IL)-13 inhibits Alix to compromise the kidney epithelial barrier function. In this study, the murine collecting duct cell line (M-1) was cultured in Transwell inserts to investigate the significance of Alix in compromising the epithelial barrier functions. T cell (Teff cells) proliferation assay was employed to assess the antigenicity of ovalbumin (OVA) that was transported across the M-1 monolayer barrier. The results showed that M-1 cells express Alix. Exposure to interleukin (IL)-13 markedly decreased the expression of Alix in M-1 cells, which compromised the M-1 monolayer barrier functions by showing the increases in the permeability to OVA. Over-expression of Alix abolished the IL-13-induced M-1 monolayer barrier dysfunction. Knockdown of Alix significantly increased M-1 monolayer permeability. The OVA collected from the Transwell basal chambers induced the OVA-specific T cell proliferation. We conclude that IL-13 compromises M-1 epithelial barrier functions via inhibiting Alix expression.

  15. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris

    OpenAIRE

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    Objective: To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Methods: Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Results: Erythema, burning, ...

  16. Nanofiber mat spinal cord dressing-released glutamate impairs blood-spinal cord barrier

    Directory of Open Access Journals (Sweden)

    Dorota Sulejczak

    2016-12-01

    Full Text Available An excessive glutamate level can result in excitotoxic damage and death of central nervous system (CNS cells, and is involved in the pathogenesis of many CNS diseases. It may also be related to a failure of the blood-spinal cord barrier (BSCB. This study was aimed at examining the effects of extended administration of monosodium glutamate on the BSCB and spinal cord cells in adult male Wistar rats. The glutamate was delivered by subarachnoidal application of glutamate-carrying electrospun nanofiber mat dressing at the lumbar enlargement level. Half of the rats with the glutamate-loaded mat application were treated systemically with the histone deacetylase inhibitor valproic acid. A group of intact rats and a rat group with subarachnoidal application of an ‘empty’ (i.e., carrying no glutamate nanofiber mat dressing served as controls. All the rats were euthanized three weeks later and lumbar fragments of their spinal cords were harvested for histological, immunohistochemical and ultrastructural studies. The samples from controls revealed normal parenchyma and BSCB morphology, whereas those from rats with the glutamate-loaded nanofiber mat dressing showed many intraparenchymal microhemorrhages of variable sizes. The capillaries in the vicinity of the glutamate-carrying dressing (in the meninges and white matter alike were edematous and leaky, and their endothelial cells showed degenerative changes: extensive swelling, enhanced vacuo­lization and the presence of vascular intraluminal projections. However, endothelial tight junctions were generally well preserved. Some endothelial cells were dying by necrosis or apoptosis. The adjacent parenchyma showed astrogliosis with astrocytic hypertrophy and swelling of perivascular astrocytic feet. Neurons in the parenchyma revealed multiple symptoms of degeneration, including, inter alia, perikaryal, dendritic and axonal swelling, and destruction of organelles. All the damage symptoms were slightly less

  17. A new role for reticulon-4B/NOGO-B in the intestinal epithelial barrier function and inflammatory bowel disease.

    Science.gov (United States)

    Rodríguez-Feo, Juan Antonio; Puerto, Marta; Fernández-Mena, Carolina; Verdejo, Cristina; Lara, José Manuel; Díaz-Sánchez, María; Álvarez, Emilio; Vaquero, Javier; Marín-Jiménez, Ignacio; Bañares, Rafael; Menchén, Luis

    2015-06-15

    Inflammatory bowel disease (IBD) is characterized by an impaired intestinal barrier function. We aimed to investigate the role of reticulon-4B (RTN-4B/NOGO-B), a structural protein of the endoplasmic reticulum, in intestinal barrier function and IBD. We used immunohistochemistry, confocal microscopy, real-time PCR, and Western blotting to study tissue distribution and expression levels of RTN-4B/NOGO-B in control and IBD samples from mouse and humans. We also targeted RTN-4B/NOGO-B using siRNAs in cultured human intestinal epithelial cell (IECs). Epithelial barrier permeability was assessed by transepithelial electrical resistance (TEER) measurement. RTN-4B/NOGO-B is expressed in the intestine mainly by IECs. Confocal microscopy revealed a colocalization of RTN-4B, E-cadherin, and polymerized actin fibers in tissue and cultured IECs. RTN-4B mRNA and protein expression were lower in the colon of IL-10(-/-) compared with wild-type mice. Colocalization of RTN-4B/E-cadherin/actin was reduced in the colon of IL-10(-/-) mice. Analysis of endoscopic biopsies from IBD patients showed a significant reduction of RTN-4B/NOGO-B expression in inflamed mucosa compared with control. Treatment of IECs with H2O2 reduced TEER values and triggered phosphorylation of RTN-4B in serine 107 residues as well as downregulation of RTN-4B expression. Acute RTN-4B/NOGO-B knockdown by siRNAs resulted in a decreased TEER values and reduction of E-cadherin and α-catenin expression and in the amount of F-actin-rich filaments in IECs. Epithelial RTN-4B/NOGO-B was downregulated in human and experimental IBD. RTN-4B participates in the intestinal epithelial barrier function, most likely via its involvement in E-cadherin, α-catenin expression, and actin cytoskeleton organization at sites of cell-to-cell contacts.

  18. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  19. Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

    Directory of Open Access Journals (Sweden)

    Lefeng Wang

    2017-01-01

    Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

  20. Impaired muscle function in women with fibromyalgia is not due to pain.

    OpenAIRE

    Forsbakk, Camilla Swan

    2010-01-01

    Background: Fibromyalgia syndrome (FM) is associated with widespread pain over the entire body. Moreover, an impaired muscle function is frequently reported in FM patients. Several causes are supposed to cause these impairments, and causes can be multiply. However, the results are inconclusive.Objective: To investigate why women with FM have an impaired muscle function.Material and methods: Fifty women in the age 35-65 participated in an intervention study existing of 12 weeks indoor cycling....

  1. Skin Barrier Function and Its Importance at the Start of the Atopic March

    Directory of Open Access Journals (Sweden)

    Mary Beth Hogan

    2012-01-01

    Full Text Available Atopic dermatitis can be due to a variety of causes from nonatopic triggers to food allergy. Control of egress of water and protection from ingress of irritants and allergens are key components of cutaneous barrier function. Current research suggests that a degraded barrier function of the skin allows the immune system inappropriate access to environmental allergens. Epidermal aeroallergen exposure may allow sensitization to allergen possibly initiating the atopic march. Further research into connections between epidermal barrier function and possible allergen sensitization will be important to undertake. Future clinical trials focused on skin barrier protection may be of value as a possible intervention in prevention of the initiation of the atopic march.

  2. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  3. Cognitive Ability as a Resource for Everyday Functioning among Older Adults Who Are Visually Impaired

    Science.gov (United States)

    Heyl, Vera; Wahl, Hans-Werner

    2010-01-01

    This article reports on a study that investigated the role of cognitive resources in the everyday functioning of 121 older adults who were visually impaired and 150 sighted older adults, with a mean age of 82 years. Cognitive performance and everyday functioning were most strongly related in the group who were visually impaired. The authors…

  4. Executive Function and Behavioral Problems in Students with Visual Impairments at Mainstream and Special Schools

    Science.gov (United States)

    Heyl, Vera; Hintermair, Manfred

    2015-01-01

    Introduction: In this study, executive function of school-aged children with visual impairments (that is, those who are blind or have low vision) is examined in the context of behavioral problems and communicative competence. Methods: Teachers assessed the executive function of a sample of 226 visually impaired students from mainstream schools and…

  5. Obesity's Effects on the Onset of Functional Impairment among Older Adults

    Science.gov (United States)

    Jenkins, Kristi Rahrig

    2004-01-01

    Purpose: This study has two purposes. First, it determines if there is a relationship between body weight and the onset of functional impairment across time among this sample of older adults. More specifically, it examines if obese older adults are more likely to experience the onset of functional impairment. Second, it explores how health…

  6. A new all-round density functional based on spin states and SN2 barriers

    Science.gov (United States)

    Swart, Marcel; Solà, Miquel; Bickelhaupt, F. Matthias

    2009-09-01

    We report here a new empirical density functional that is constructed based on the performance of OPBE and PBE for spin states and SN2 reaction barriers and how these are affected by different regions of the reduced gradient expansion. In a previous study [Swart, Solà, and Bickelhaupt, J. Comput. Methods Sci. Eng. 9, 69 (2009)] we already reported how, by switching between OPBE and PBE, one could obtain both the good performance of OPBE for spin states and reaction barriers and that of PBE for weak interactions within one and the same (SSB-sw) functional. Here we fine tuned this functional and include a portion of the KT functional and Grimme's dispersion correction to account for π-π stacking. Our new SSB-D functional is found to be a clear improvement and functions very well for biological applications (hydrogen bonding, π-π stacking, spin-state splittings, accuracy of geometries, reaction barriers).

  7. Serum-borne bioactivity caused by pulmonary multiwalled carbon nanotubes induces neuroinflammation via blood–brain barrier impairment

    Science.gov (United States)

    Aragon, Mario J.; Topper, Lauren; Tyler, Christina R.; Sanchez, Bethany; Zychowski, Katherine; Young, Tamara; Herbert, Guy; Hall, Pamela; Erdely, Aaron; Eye, Tracy; Bishop, Lindsey; Saunders, Samantha A.; Muldoon, Pretal P.; Ottens, Andrew K.; Campen, Matthew J.

    2017-01-01

    Pulmonary exposure to multiwalled carbon nanotubes (MWCNTs) causes indirect systemic inflammation through unknown pathways. MWCNTs translocate only minimally from the lungs into the systemic circulation, suggesting that extrapulmonary toxicity may be caused indirectly by lung-derived factors entering the circulation. To assess a role for MWCNT-induced circulating factors in driving neuroinflammatory outcomes, mice were acutely exposed to MWCNTs (10 or 40 µg/mouse) via oropharyngeal aspiration. At 4 h after MWCNT exposure, broad disruption of the blood-brain barrier (BBB) was observed across the capillary bed with the small molecule fluorescein, concomitant with reactive astrocytosis. However, pronounced BBB permeation was noted, with frank albumin leakage around larger vessels (>10 µm), overlain by a dose-dependent astroglial scar-like formation and recruitment of phagocytic microglia. As affirmed by elevated inflammatory marker transcription, MWCNT-induced BBB disruption and neuroinflammation were abrogated by pretreatment with the rho kinase inhibitor fasudil. Serum from MWCNT-exposed mice induced expression of adhesion molecules in primary murine cerebrovascular endothelial cells and, in a wound-healing in vitro assay, impaired cell motility and cytokinesis. Serum thrombospondin-1 level was significantly increased after MWCNT exposure, and mice lacking the endogenous receptor CD36 were protected from the neuroinflammatory and BBB permeability effects of MWCNTs. In conclusion, acute pulmonary exposure to MWCNTs causes neuroinflammatory responses that are dependent on the disruption of BBB integrity. PMID:28223486

  8. Serum-borne bioactivity caused by pulmonary multiwalled carbon nanotubes induces neuroinflammation via blood-brain barrier impairment.

    Science.gov (United States)

    Aragon, Mario J; Topper, Lauren; Tyler, Christina R; Sanchez, Bethany; Zychowski, Katherine; Young, Tamara; Herbert, Guy; Hall, Pamela; Erdely, Aaron; Eye, Tracy; Bishop, Lindsey; Saunders, Samantha A; Muldoon, Pretal P; Ottens, Andrew K; Campen, Matthew J

    2017-03-07

    Pulmonary exposure to multiwalled carbon nanotubes (MWCNTs) causes indirect systemic inflammation through unknown pathways. MWCNTs translocate only minimally from the lungs into the systemic circulation, suggesting that extrapulmonary toxicity may be caused indirectly by lung-derived factors entering the circulation. To assess a role for MWCNT-induced circulating factors in driving neuroinflammatory outcomes, mice were acutely exposed to MWCNTs (10 or 40 µg/mouse) via oropharyngeal aspiration. At 4 h after MWCNT exposure, broad disruption of the blood-brain barrier (BBB) was observed across the capillary bed with the small molecule fluorescein, concomitant with reactive astrocytosis. However, pronounced BBB permeation was noted, with frank albumin leakage around larger vessels (>10 µm), overlain by a dose-dependent astroglial scar-like formation and recruitment of phagocytic microglia. As affirmed by elevated inflammatory marker transcription, MWCNT-induced BBB disruption and neuroinflammation were abrogated by pretreatment with the rho kinase inhibitor fasudil. Serum from MWCNT-exposed mice induced expression of adhesion molecules in primary murine cerebrovascular endothelial cells and, in a wound-healing in vitro assay, impaired cell motility and cytokinesis. Serum thrombospondin-1 level was significantly increased after MWCNT exposure, and mice lacking the endogenous receptor CD36 were protected from the neuroinflammatory and BBB permeability effects of MWCNTs. In conclusion, acute pulmonary exposure to MWCNTs causes neuroinflammatory responses that are dependent on the disruption of BBB integrity.

  9. TGF-beta is required for vascular barrier function, endothelial survival and homeostasis of the adult microvasculature.

    Directory of Open Access Journals (Sweden)

    Tony E Walshe

    Full Text Available Pericyte-endothelial cell (EC interactions are critical to both vascular development and vessel stability. We have previously shown that TGF-beta signaling between EC and mural cells participates in vessel stabilization in vitro. We therefore investigated the role of TGF-beta signaling in maintaining microvessel structure and function in the adult mouse retinal microvasculature. TGF-beta signaling was inhibited by systemic expression of soluble endoglin (sEng and inhibition was demonstrated by reduced phospho-smad2 in the adult retina. Blockade of TGF-beta signaling led to increased vascular and neural cell apoptosis in the retina, which was associated with decreased retinal function, as measured by electroretinogram (ERG. Perfusion of the inner retinal vasculature was impaired and was accompanied by defective autoregulation and loss of capillary integrity. Fundus angiography and Evans blue permeability assay revealed a breakdown of the blood-retinal-barrier that was characterized by decreased association between the tight junction proteins zo-1 and occludin. Inhibition of TGF-beta signaling in cocultures of EC and 10T1/2 cells corroborated the in vivo findings, with impaired EC barrier function, dissociation of EC from 10T1/2 cells, and endothelial cell death, supporting the role of EC-mesenchymal interactions in TGF-beta signaling. These results implicate constitutive TGF-beta signaling in maintaining the integrity and function of the adult microvasculature and shed light on the potential role of TGF-beta signaling in vasoproliferative and vascular degenerative retinal diseases.

  10. MicroRNAs control intestinal epithelial differentiation, architecture, and barrier function.

    Science.gov (United States)

    McKenna, Lindsay B; Schug, Jonathan; Vourekas, Anastassios; McKenna, Jaime B; Bramswig, Nuria C; Friedman, Joshua R; Kaestner, Klaus H

    2010-11-01

    Whereas the importance of microRNA (miRNA) for the development of several tissues is well established, its role in the intestine is unknown. We aimed to quantify the complete miRNA expression profile of the mammalian intestinal mucosa and to determine the contribution of miRNAs to intestinal homeostasis using genetic means. We determined the miRNA transcriptome of the mouse intestinal mucosa using ultrahigh throughput sequencing. Using high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), we identified miRNA-messenger RNA target relationships in the jejunum. We employed gene ablation of the obligatory miRNA-processing enzyme Dicer1 to derive mice deficient for all miRNAs in intestinal epithelia. miRNA abundance varies dramatically in the intestinal mucosa, from 1 read per million to 250,000. Of the 453 miRNA families identified, mmu-miR-192 is the most highly expressed in both the small and large intestinal mucosa, and there is a 53% overlap in the top 15 expressed miRNAs between the 2 tissues. The intestinal epithelium of Dicer1(loxP/loxP);Villin-Cre mutant mice is disorganized, with a decrease in goblet cells, a dramatic increase in apoptosis in crypts of both jejunum and colon, and accelerated jejunal cell migration. Furthermore, intestinal barrier function is impaired in Dicer1-deficient mice, resulting in intestinal inflammation with lymphocyte and neutrophil infiltration. Our list of miRNA-messenger RNA targeting relationships in the small intestinal mucosa provides insight into the molecular mechanisms behind the phenotype of Dicer1 mutant mice. We have identified all intestinal miRNAs and shown using gene ablation of Dicer1 that miRNAs play a vital role in the differentiation and function of the intestinal epithelium. Copyright © 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

  11. Early Predictors of Impaired Social Functioning in Male Rhesus Macaques (Macaca mulatta)

    Science.gov (United States)

    Del Rosso, Laura A.; Seil, Shannon K.; Calonder, Laura A.; Madrid, Jesus E.; Bone, Kyle J.; Sherr, Elliott H.; Garner, Joseph P.; Capitanio, John P.; Parker, Karen J.

    2016-01-01

    Autism spectrum disorder (ASD) is characterized by social cognition impairments but its basic disease mechanisms remain poorly understood. Progress has been impeded by the absence of animal models that manifest behavioral phenotypes relevant to ASD. Rhesus monkeys are an ideal model organism to address this barrier to progress. Like humans, rhesus monkeys are highly social, possess complex social cognition abilities, and exhibit pronounced individual differences in social functioning. Moreover, we have previously shown that Low-Social (LS) vs. High-Social (HS) adult male monkeys exhibit lower social motivation and poorer social skills. It is not known, however, when these social deficits first emerge. The goals of this study were to test whether juvenile LS and HS monkeys differed as infants in their ability to process social information, and whether infant social abilities predicted later social classification (i.e., LS vs. HS), in order to facilitate earlier identification of monkeys at risk for poor social outcomes. Social classification was determined for N = 25 LS and N = 25 HS male monkeys that were 1–4 years of age. As part of a colony-wide assessment, these monkeys had previously undergone, as infants, tests of face recognition memory and the ability to respond appropriately to conspecific social signals. Monkeys later identified as LS vs. HS showed impairments in recognizing familiar vs. novel faces and in the species-typical adaptive ability to gaze avert to scenes of conspecific aggression. Additionally, multivariate logistic regression using infant social ability measures perfectly predicted later social classification of all N = 50 monkeys. These findings suggest that an early capacity to process important social information may account for differences in rhesus monkeys’ motivation and competence to establish and maintain social relationships later in life. Further development of this model will facilitate identification of novel biological targets

  12. Apoptosis of the fibrocytes type 1 in the spiral ligament and blood labyrinth barrier disturbance cause hearing impairment in murine cerebral malaria

    Directory of Open Access Journals (Sweden)

    Schmutzhard Joachim

    2012-02-01

    Full Text Available Abstract Background Experimental murine malaria has been shown to result in significant hearing impairment. Microscopic evaluation of the temporal bones of these animals has revealed regular morphology of the cochlea duct. Furthermore, the known vascular pathologic changes being associated with malaria could not be found. Immunohistochemistry for ICAM1 showed a strong marking in the stria vascularis, indicating a disturbance of the endocochlear potential. The aim of this study was to evaluate the role of apoptosis and the disturbance of the blood labyrinth barrier in the murine malaria associated hearing impairment. Methods The temporal bones of seven mice with cerebral malaria-four with hearing impairment, three without hearing impairment-were evaluated with immunohistochemistry for cleaved caspase 3 to detect apoptosis and connexin 26, a gap junction protein being a cornerstone in the endocochlear potassium recirculation. Furthermore five animals with cerebral malaria were treated with Evans blue prior to sacrification to detect disturbances of the blood labyrinth barrier. Results Cleaved caspase 3 could clearly be detected by immunohistochemistry in the fibrocytes of the spiral ligament, more intensively in animals with hearing impairment, less intensively in those without. Apoptosis signal was equally distributed in the spiral ligament as was the connexin 26 gap junction protein. The Evans blue testing revealed a strong signal in the malaria animals and no signal in the healthy control animals. Conclusion Malfunction of the fibrocytes type 1 in the spiral ligament and disruption of the blood labyrinth barrier, resulting in a breakdown of the endocochlear potential, are major causes for hearing impairment in murine cerebral malaria.

  13. Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Directory of Open Access Journals (Sweden)

    Hee Soon Shin

    2015-01-01

    Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

  14. Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers.

    Science.gov (United States)

    Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

    2015-01-01

    Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

  15. Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Science.gov (United States)

    Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

    2015-01-01

    Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

  16. Intestinal epithelial barrier function and tight junction proteins with heat and exercise

    DEFF Research Database (Denmark)

    Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L

    2016-01-01

    (passive hyperthermia) heat stress on tight junction barrier function in in vitro and in vivo (animals and humans) models. Our secondary focus is to review changes in tight junction proteins in response to exercise or hyperthermic conditions. Finally, we discuss some pharmacological or nutritional...... interventions that may affect the cellular mechanisms involved in maintaining homeostasis of the intestinal epithelial tight junction barrier during heat stress or exercise....

  17. Cognitive function following stroke and vascular cognitive impairment

    NARCIS (Netherlands)

    de Haan, Edward H.; Nys, Gudrun M.; Van Zandvoort, Martine J.

    2006-01-01

    Purpose of review This review of the cognitive status following stroke and vascular cognitive impairment starts by questioning the concept of vascular dementia and related concepts. Our position is that in many cases these labels promote a superficial conceptualization of an inherently complex and h

  18. Clinical Assessment of Functional Movement in Adults with Visual Impairments

    Science.gov (United States)

    Ray, Christopher T.; Horvat, Michael; Williams, Michael; Blasch, Bruce B.

    2007-01-01

    Adults with visual impairments have significantly more health risks than do sighted adults because of a number of factors, including the lower mineral density of their femoral neck bones, which is indicative of reduced weight-bearing exercise; their lesser maximal strength; and their higher rates of stroke, osteoporosis, depression, hypertension,…

  19. Recycling Energy to Restore Impaired Ankle Function during Human Walking

    NARCIS (Netherlands)

    Collins, S.H.; Kuo, A.D.

    2010-01-01

    Background: Humans normally dissipate significant energy during walking, largely at the transitions between steps. The ankle then acts to restore energy during push-off, which may be the reason that ankle impairment nearly always leads to poorer walking economy. The replacement of lost energy is nec

  20. Global Functioning of COPD Patients With and Without Functional Balance Impairment: An Exploratory Analysis Based on the ICF Framework.

    Science.gov (United States)

    Cruz, Joana; Marques, Alda; Jácome, Cristina; Gabriel, Raquel; Figueiredo, Daniela

    2015-04-01

    Balance impairment is a common manifestation in older people with COPD and may contribute to overall functional decline; however, the relationship between balance and global functioning has not been studied. This study aimed to explore the global functioning of COPD patients with and without functional balance impairment. Functional balance was assessed with the Timed Up-and-Go (TUG) test and global functioning with the Comprehensive ICF Core Set for Obstructive Pulmonary Diseases. Participants (n = 134) were divided in 2 groups according to their performance in TUG (with and without balance impairment) and the ICF Core Set results were compared between groups. Fifty-four (40.3%) participants had functional balance impairment. The groups presented a similar extent of problems in several categories of the ICF components. However, participants with balance impairment were more severely affected (p social life, and a more negative perception of Environmental factors related to products and technology of buildings for private use and social support services (p balance impairment have more functional problems and are more severely restricted in daily life than patients without compromised balance. Understanding the relationship between balance control and global functioning will contribute to guide interventions aimed at maintaining functioning and minimizing disability.

  1. Update on pulmonary edema: the role and regulation of endothelial barrier function.

    Science.gov (United States)

    Patterson, C E; Lum, H

    2001-01-01

    Discovery of the pathophysiologic mechanisms leading to pulmonary edema and identification of effective strategies for prevention remain significant clinical concerns. Endothelial barrier function is a key component for maintenance of the integrity of the vascular boundary in the lung, particularly since the gas exchange surface area of the alveolar-capillary membrane is large. This review is focused on new insights in the pulmonary endothelial response to injury and recovery, reversible activation by edemagenic agents, and the biochemical/structural basis for regulation of endothelial barrier function. This information is discussed in the context of fundamental concepts of lung fluid balance and pulmonary function.

  2. Clinical implications of the sugar absorption test : Intestinal permeability test to assess mucosal barrier function

    NARCIS (Netherlands)

    Uil, JJ; VanElburg, RM; VanOverbeek, FM; Mulder, CJJ; VanbergeHenegouwen, GP; Heymans, HSA

    1997-01-01

    Background: Functional integrity as an aspect of the mucosal barrier function of the small bowel can be estimated by the intestinal permeability for macromolecules. In the first part of this paper, an overview of intestinal permeability and its measurement is given. Methods: In the second part of th

  3. Hearing impairment and cognitive function among a community-dwelling population in Japan

    Directory of Open Access Journals (Sweden)

    Namba Atsushi

    2011-10-01

    Full Text Available Abstract Background Hearing impairment is a prevalent and chronic condition in older people. This study investigated the relationship between cognitive function and hearing impairment in a Japanese population. Methods A pure-tone average (0.5-2.0 kHz was used to evaluate hearing impairment in 846 participants of the Iwaki Health Promotion Project who were aged at least 50 years old (310 men and 536 women. We also administered the Mini-Mental State Examination (MMSE, the Center for Epidemiologic Studies for Depression (CES-D scale, Starkstein's apathy scale (AS and the Short Form Health Survey Version 2 (SF-36v2. A multiple linear regression analysis assessed the association between hearing impairment and mental correlates. Results The overall prevalence of hearing impairment in this study population was 37.7%. The participants with hearing impairment were older and less educated compared to those with no hearing problems. We observed significant differences in the MMSE and AS scores between the mild/moderate to severe groups versus the non-impaired group. After adjusting for age, gender and amount of education, hearing impairment was significantly associated with MMSE and AS scores, but not with CES-D scores. Hearing impairment was significantly related to the social functioning (SF and role emotional (RE scores of the SF-36v2. Conclusions Hearing impairment is common among older people and is associated with cognitive impairment, apathy and a poor health-related quality of life. Screening for and correcting hearing impairments might improve the quality of life and functional status of older patients.

  4. Modulation of ocular surface glycocalyx barrier function by a galectin-3 N-terminal deletion mutant and membrane-anchored synthetic glycopolymers.

    Directory of Open Access Journals (Sweden)

    Jerome Mauris

    Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.

  5. Impaired Executive Functions in Subjects with Frequent Nightmares as Reflected by Performance in Different Neuropsychological Tasks

    Science.gov (United States)

    Simor, Peter; Pajkossy, Peter; Horvath, Klara; Bodizs, Robert

    2012-01-01

    Nightmare disorder is a prevalent parasomnia characterized by vivid and highly unpleasant dream experiences during night time sleep. The neural background of disturbed dreaming was proposed to be associated with impaired prefrontal and fronto-limbic functioning during REM sleep. We hypothesized that the impaired prefrontal and fronto-limbic…

  6. Pathophysiology of impaired hand function in children with unilateral cerebral palsy

    NARCIS (Netherlands)

    Gordon, A.M.; Bleyenheuft, Y.; Steenbergen, B.

    2013-01-01

    Unilateral spastic cerebral palsy, caused by damage to the developing central nervous system, is characterized by motor impairments mainly lateralized to one side of the body, with hand impairments greatly contributing to functional limitations. The integrity of the motor areas and the corticospinal

  7. Pathophysiology of impaired hand function in children with unilateral cerebral palsy.

    NARCIS (Netherlands)

    Gordon, A.M.; Bleyenheuft, Y.; Steenbergen, B.

    2013-01-01

    Unilateral spastic cerebral palsy, caused by damage to the developing central nervous system, is characterized by motor impairments mainly lateralized to one side of the body, with hand impairments greatly contributing to functional limitations. The integrity of the motor areas and the corticospinal

  8. Pathophysiology of impaired hand function in children with unilateral cerebral palsy.

    NARCIS (Netherlands)

    Gordon, A.M.; Bleyenheuft, Y.; Steenbergen, B.

    2013-01-01

    Unilateral spastic cerebral palsy, caused by damage to the developing central nervous system, is characterized by motor impairments mainly lateralized to one side of the body, with hand impairments greatly contributing to functional limitations. The integrity of the motor areas and the corticospinal

  9. Pathophysiology of impaired hand function in children with unilateral cerebral palsy

    NARCIS (Netherlands)

    Gordon, A.M.; Bleyenheuft, Y.; Steenbergen, B.

    2013-01-01

    Unilateral spastic cerebral palsy, caused by damage to the developing central nervous system, is characterized by motor impairments mainly lateralized to one side of the body, with hand impairments greatly contributing to functional limitations. The integrity of the motor areas and the corticospinal

  10. Levels of Functional Impairment Following a Civilian Disaster: The Beverly Hills Supper Club Fire.

    Science.gov (United States)

    Green, Bonnie L.; And Others

    1983-01-01

    Studied levels of psychological functioning of survivors (N=147) of the Beverly Hills Supper Club fire. Results showed the group as a whole was more impaired than the comparison sample. Survivors who were at the fire were less impaired than survivors not at the fire. (WAS)

  11. Cognitive Impairment in MS Linked to Structural and Functional Connectivity

    Science.gov (United States)

    2016-10-01

    performance over time. This is a sensitive indicator of cognitive impairment in individuals with neurological disorders including MS. Multiple types of...in individuals with neurological disorders including MS. Multiple types of brain imaging will be used to acquire data from participants, including... person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB control

  12. The patterns of cognitive and functional impairment in amnestic and non-amnestic mild cognitive impairment in geriatric depression.

    Science.gov (United States)

    Reinlieb, Michelle; Ercoli, Linda M; Siddarth, Prabha; St Cyr, Natalie; Lavretsky, Helen

    2014-12-01

    Depressed older adults are at risk for the development of mild cognitive impairment (MCI), but few studies have characterized MCI subtypes in geriatric depression. The objective of this study was to identify the clinical patterns of MCI in late-life depression. Baseline demographic, clinical, and neuropsychological test data collected as part of a randomized antidepressant trial for geriatric depression. UCLA-based outpatient clinic. One hundred thirty-eight older adults with major depression. A neuropsychological test battery and comprehensive evaluations of depression, apathy, quality of life, medical burden, and vascular risk factors. Seventy-one participants (51%) had MCI and 67 (49%) were cognitively normal. Of subjects with MCI, 14 (20%) had amnestic MCI and 57 (80%) had non-amnestic MCI. Overall, patients with MCI had greater depression severity, poorer quality of life, and worse performance on the Mini-Mental State Exam than patients without MCI. Patients with non-amnestic MCI had significantly greater depression severity than patients without MCI. Across all subjects, depression severity correlated with impaired performance in language and visuospatial functioning. Our findings suggest that MCI is associated with greater severity of depression, poorer quality of life, and worse global cognitive function. Overall, subtypes of MCI in geriatric depression differ in the patterns of functional impairment, which may require different therapeutic approaches. Copyright © 2014 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

  13. A novel porcine in vitro model of the blood-cerebrospinal fluid barrier with strong barrier function.

    Directory of Open Access Journals (Sweden)

    Mira Schroten

    Full Text Available Epithelial cells of the plexus choroideus form the structural basis of the blood-cerebrospinal fluid barrier (BCSFB. In vitro models of the BCSFB presenting characteristics of a functional barrier are of significant scientific interest as tools for examination of BCSFB function. Due to a lack of suitable cell lines as in vitro models, primary porcine plexus epithelial cells were subjected to a series of selective cultivation steps until a stable continuous subcultivatable epithelial cell line (PCP-R was established. PCP-R cells grow in a regular polygonal pattern with a doubling time of 28-36 h. At a cell number of 1.5×10(5 in a 24-well plate confluence is reached in 56-72 h. Cells are cytokeratin positive and chromosomal analysis revealed 56 chromosomes at peak (84th subculture. Employing reverse transcription PCR mRNA expression of several transporters and components of cell junctions could be detected. The latter includes tight junction components like Claudin-1 and -3, ZO-1, and Occludin, and the adherens junction protein E-cadherin. Cellular localization studies of ZO-1, Occludin and Claudin-1 by immunofluorescence and morphological analysis by electron microscopy demonstrated formation of a dense tight junction structure. Importantly, when grown on cell culture inserts PCP-R developed typical characteristics of a functional BCSFB including high transepithelial electrical resistance above 600 Ω×cm(2 as well as low permeability for macromolecules. In summary, our data suggest the PCP-R cell line as a suitable in vitro model of the porcine BCSFB.

  14. Musical tasks targeting preserved and impaired functions in two dementias.

    Science.gov (United States)

    Halpern, Andrea R; Golden, Hannah L; Magdalinou, Nadia; Witoonpanich, Pirada; Warren, Jason D

    2015-03-01

    Studies of musical abilities in dementia have for the most part been rather general assessments of abilities, for instance, assessing retention of music learned premorbidly. Here, we studied patients with dementias with contrasting cognitive profiles to explore specific aspects of music cognition under challenge. Patients suffered from Alzheimer's disease (AD), in which a primary impairment is in forming new declarative memories, or Lewy body disease (PD/LBD), a type of parkinsonism in which executive impairments are prominent. In the AD patients, we examined musical imagery. Behavioral and neural evidence confirms involvement of perceptual networks in imagery, and these are relatively spared in early stages of the illness. Thus, we expected patients to have relatively intact imagery in a mental pitch comparison task. For the LBD patients, we tested whether executive dysfunction would extend to music. We probed inhibitory skills by asking for a speeded pitch or timbre judgment when the irrelevant dimension was held constant or also changed. Preliminary results show that AD patients score similarly to controls in the imagery tasks, but PD/LBD patients are impaired relative to controls in suppressing some irrelevant musical dimensions, particularly when the required judgment varies from trial to trial. © 2014 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals Inc. on behalf of The New York Academy of Sciences.

  15. Brain injury impairs working memory and prefrontal circuit function

    Directory of Open Access Journals (Sweden)

    Colin James Smith

    2015-11-01

    Full Text Available More than 2.5 million Americans suffer a traumatic brain injury (TBI each year. Even mild to moderate traumatic brain injury causes long-lasting neurological effects. Despite its prevalence, no therapy currently exists to treat the underlying cause of cognitive impairment suffered by TBI patients. Following lateral fluid percussion injury (LFPI, the most widely used experimental model of TBI, we investigated alterations in working memory and excitatory/inhibitory synaptic balance in the prefrontal cortex. LFPI impaired working memory as assessed with a T-maze behavioral task. Field excitatory postsynaptic potentials recorded in the prefrontal cortex were reduced in slices derived from brain-injured mice. Spontaneous and miniature excitatory postsynaptic currents onto layer 2/3 neurons were more frequent in slices derived from LFPI mice while inhibitory currents onto layer 2/3 neurons were smaller after LFPI. Additionally, an increase in action potential threshold and concomitant decrease in firing rate was observed in layer 2/3 neurons in slices from injured animals. Conversely, no differences in excitatory or inhibitory synaptic transmission onto layer 5 neurons were observed; however, layer 5 neurons demonstrated a decrease in input resistance and action potential duration after LFPI. These results demonstrate synaptic and intrinsic alterations in prefrontal circuitry that may underlie working memory impairment caused by TBI.

  16. Recycling energy to restore impaired ankle function during human walking.

    Directory of Open Access Journals (Sweden)

    Steven H Collins

    Full Text Available BACKGROUND: Humans normally dissipate significant energy during walking, largely at the transitions between steps. The ankle then acts to restore energy during push-off, which may be the reason that ankle impairment nearly always leads to poorer walking economy. The replacement of lost energy is necessary for steady gait, in which mechanical energy is constant on average, external dissipation is negligible, and no net work is performed over a stride. However, dissipation and replacement by muscles might not be necessary if energy were instead captured and reused by an assistive device. METHODOLOGY/PRINCIPAL FINDINGS: We developed a microprocessor-controlled artificial foot that captures some of the energy that is normally dissipated by the leg and "recycles" it as positive ankle work. In tests on subjects walking with an artificially-impaired ankle, a conventional prosthesis reduced ankle push-off work and increased net metabolic energy expenditure by 23% compared to normal walking. Energy recycling restored ankle push-off to normal and reduced the net metabolic energy penalty to 14%. CONCLUSIONS/SIGNIFICANCE: These results suggest that reduced ankle push-off contributes to the increased metabolic energy expenditure accompanying ankle impairments, and demonstrate that energy recycling can be used to reduce such cost.

  17. Impaired functional differentiation for categories of objects in the ventral visual stream: A case of developmental visual impairment.

    Science.gov (United States)

    Martinaud, Olivier; Pouliquen, Dorothée; Parain, Dominique; Goldenberg, Alice; Gérardin, Emmanuel; Hannequin, Didier; Altarelli, Irène; Ramus, Franck; Hertz-Pannier, Lucie; Dehaene-Lambertz, Ghislaine; Cohen, Laurent

    2015-10-01

    We report the case of a 14-year-old girl suffering from severe developmental visual impairment along with delayed language and cognitive development, and featuring a clear-cut dissociation between spared dorsal and impaired ventral visual pathways. Visual recognition of objects, including faces and printed words, was affected. In contrast, movement perception and visually guided motor control were preserved. Structural MRI was normal on inspection, but Voxel Based Morphometry (VBM) revealed reduced grey matter density in the mesial occipital and ventral occipito-temporal cortex. Functional MRI during the perception of line drawings uncovered impaired differentiation which is normally observed at even younger ages: no local category preferences could be identified within the occipito-temporal cortex for faces, houses, words or tools. In contrast, movement-related activations appeared to be normal. Finally, those abnormalities evolved on the background of chronic bilateral occipital epileptic activity, including continuous spike-wave discharges during sleep, which may be considered as the primary cause of non-specific intellectual disability and visual impairment.

  18. Fusion excitation function measurement for 6Li+64Ni at near-barrier energies

    Directory of Open Access Journals (Sweden)

    Shaikh Md. Moin

    2015-01-01

    Full Text Available Total fusion excitation function has been measured for the reaction of weakly bound 6Li projectile on medium mass 64Ni target at energies near the Coulomb barrier of the system. Online characteristic γ-ray detection method has been used to identify and determine the cross sections of the residues. No suppression of total fusion cross section (σTF is observed at above barrier energies. But enhancement of measured cross section with respect to the one-dimensional barrier penetration model (1-DBPM calculation is observed at below barrier energies. The enhancement can not be explained by coupled channels calculation with dominant projectile and target excitations as well as one-neutron stripping reaction.

  19. Families' perception of children / adolescents with language impairment through the International Classification of Functioning, Disability, and Health (ICF-CY).

    Science.gov (United States)

    Ostroschi, Daniele Theodoro; Zanolli, Maria de Lurdes; Chun, Regina Yu Shon

    2017-05-22

    To investigate the perception of family members regarding linguistic conditions and social participation of children and adolescents with speech and language impairments using the International Classification of Functioning, Disability and Health - Children and Youth Version (ICF-CY). Quali-quantitative approach research, in which a survey of medical records of 24 children/adolescents undergoing speech-language therapy and interviews with their family members was conducted. A descriptive analysis of the participants' profiles was performed, followed by a categorization of responses using the ICF-CY. All family members mentioned various aspects of speech/language categorized by the ICF-CY. Initially, they approached it as an organic issue, categorized under the component of Body Functions and Structures. Most reported different repercussions of the speech-language impairments on the domains, such as dealing with stress and speaking, qualified from mild to severe. Participants reported Environmental Factors categorized as facilitators in the immediate family's attitudes and as barriers in the social attitudes. These findings, according to the use of the ICF-CY, demonstrate that the children/adolescents' speech-language impairments, from the families' perception, are primarily understood in the body dimension. However, guided by a broader approach to health, the findings in the Activities and Participation and Environmental Factors demonstrate a broader understanding of the participants of the speech-language impairments. The results corroborate the importance of using the ICF-CY as a health care analysis tool, by incorporating functionality and participation aspects and providing subsidies for the construction of unique therapeutic projects in a broader approach to the health of the group studied.

  20. A search for parameters of universal sub-barrier fusion excitation function

    Science.gov (United States)

    Qu, W. W.; Zhang, G. L.; Wolski, R.

    2016-11-01

    Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections.

  1. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

    2010-01-01

    Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...... differences were observed for ceramide 2, 3, 5 and 6. FLGmut individuals had significantly higher skin pH values than individuals not carrying FLG mutations. Patients with AD with FLG mutations had significantly higher erythema compared to patients with AD without FLG mutations. Conclusion: Our results...

  2. The impact of individual depressive symptoms on impairment of psychosocial functioning.

    Directory of Open Access Journals (Sweden)

    Eiko I Fried

    Full Text Available Previous studies have established that scores on Major Depressive Disorder scales are correlated with measures of impairment of psychosocial functioning. It remains unclear, however, whether individual depressive symptoms vary in their effect on impairment, and if so, what the magnitude of these differences might be. We analyzed data from 3,703 depressed outpatients in the first treatment stage of the Sequenced Treatment Alternatives to Relieve Depression (STAR*D study. Participants reported on the severity of 14 depressive symptoms, and stated to what degree their depression impaired psychosocial functioning (in general, and in the five domains work, home management, social activities, private activities, and close relationships. We tested whether symptoms differed in their associations with impairment, estimated unique shared variances of each symptom with impairment to assess the degree of difference, and examined whether symptoms had variable impacts across impairment domains. Our results show that symptoms varied substantially in their associations with impairment, and contributed to the total explained variance in a range from 0.7% (hypersomnia to 20.9% (sad mood. Furthermore, symptoms had significantly different impacts on the five impairment domains. Overall, sad mood and concentration problems had the highest unique associations with impairment and were among the most debilitating symptoms in all five domains. Our findings are in line with a growing chorus of voices suggesting that symptom sum-scores obfuscate relevant differences between depressed patients and that substantial rewards will come from close attention to individual depression symptoms.

  3. Characterization of mitochondrial function in cells with impaired cystic fibrosis transmembrane conductance regulator (CFTR) function.

    Science.gov (United States)

    Atlante, Anna; Favia, Maria; Bobba, Antonella; Guerra, Lorenzo; Casavola, Valeria; Reshkin, Stephan Joel

    2016-06-01

    Evidence supporting the occurrence of oxidative stress in Cystic Fibrosis (CF) is well established and the literature suggests that oxidative stress is inseparably linked to mitochondrial dysfunction. Here, we have characterized mitochondrial function, in particular as it regards the steps of oxidative phosphorylation and ROS production, in airway cells either homozygous for the F508del-CFTR allele or stably expressing wt-CFTR. We find that oxygen consumption, ΔΨ generation, adenine nucleotide translocator-dependent ADP/ATP exchange and both mitochondrial Complex I and IV activities are impaired in CF cells, while both mitochondrial ROS production and membrane lipid peroxidation increase. Importantly, treatment of CF cells with the small molecules VX-809 and 4,6,4'-trimethylangelicin, which act as "correctors" for F508del CFTR by rescuing the F508del CFTR-dependent chloride secretion, while having no effect per sè on mitochondrial function in wt-CFTR cells, significantly improved all the above mitochondrial parameters towards values found in the airway cells expressing wt-CFTR. This novel study on mitochondrial bioenergetics provides a springboard for future research to further understand the molecular mechanisms responsible for the involvement of mitochondria in CF and identify the proteins primarily responsible for the F508del-CFTR-dependent mitochondrial impairment and thus reveal potential novel targets for CF therapy.

  4. Examination of the restoration of epithelial barrier function following superficial keratectomy.

    Science.gov (United States)

    Hutcheon, Audrey E K; Sippel, Kimberly C; Zieske, James D

    2007-01-01

    The goal of the present study was to determine the rate of restoration of the corneal epithelial barrier following a superficial keratectomy using a functional assay of tight junction integrity. Adult Sprague-Dawley rats were anesthetized and a 3-mm superficial keratectomy was performed. The eyes were allowed to heal from 4 h to 8 weeks and the rate of epithelial wound closure was determined. To examine the restoration of the barrier function, EZ-Link Sulfo-NHS-LC-Biotin (LC-Biotin) was applied to all eyes, experimental and control, for 15 min at the time of sacrifice. This compound does not penetrate through intact tight junctions. Indirect immunofluorescence was performed with anti-laminin, a marker of basement membrane; fluorescein-conjugated streptavidin to detect the biotinylated marker; and anti-occludin and anti-ZO-1, markers of tight junctions. Epithelial wound closure was observed at 36-42 h after wounding. LC-Biotin did not penetrate the intact epithelium. Upon wounding, LC-Biotin penetrated into the stroma subjacent and slightly peripheral to the wound area. This pattern was present from 4-48 h post-wounding. The area of LC-Biotin localization decreased with time and the functional barrier was restored by 72 h. Occludin and ZO-1 were present at all time points. The number of cell layers expressing these proteins appeared to increase at 48 and 72 h. Continuous laminin localization was not observed until at least 7 days after wounding. Barrier function is restored within 1-1.5 days after epithelial wound closure. The loss of barrier function does not extend beyond the edge of the original wound. The restoration of barrier function does not appear to correlate with reassembly of the basement membrane in this model.

  5. Increase in short-chain ceramides correlates with an altered lipid organization and decreased barrier function in atopic eczema patients

    NARCIS (Netherlands)

    M. Janssens (Michelle); J. van Smeden (Jeroen); G.S. Gooris (Gert); W. Bras (Wim); G. Portale (Guiseppe); P.J. Caspers (Peter); R. Vreeken (Rob); T. Hankemeier (Thomas); S. Kezic (Sanja); R. Wolterbeek (Ron); A.P.M. Lavrijsen (Adriana); J.A. Bouwstra (Joke)

    2012-01-01

    textabstractA hallmark of atopic eczema (AE) is skin barrier dysfunction. Lipids in the stratum corneum (SC), primarily ceramides, fatty acids, and cholesterol, are crucial for the barrier function, but their role in relation to AE is indistinct. Filaggrin is an epithelial barrier protein with a

  6. Relative importance of energy dependent diffuseness parameter and barrier position in the analysis of fusion excitation function data

    Directory of Open Access Journals (Sweden)

    Kharab Rajesh

    2014-03-01

    Full Text Available We have investigated the relative importance of the energy dependence of diffuseness parameter and barrier position in the description of the fusion excitation function data of some heavy ion systems in near barrier energy region. The effects of the energy dependent diffuseness parameter are found to be much more prominent in comparison to those of barrier position.

  7. Examination of the Restoration of Epithelial Barrier Function Following Superficial Keratectomy

    OpenAIRE

    Hutcheon, Audrey E. K.; Sippel, Kimberly C.; Zieske, James D.

    2006-01-01

    The goal of the present study was to determine the rate of restoration of the corneal epithelial barrier following a superficial keratectomy using a functional assay of tight junction integrity. Adult Sprague-Dawley rats were anesthetized and a 3-mm superficial keratectomy was performed. The eyes were allowed to heal from 4 hours to 8 weeks and the rate of epithelial wound closure was determined. To examine the restoration of the barrier function, EZ-Link Sulfo-NHS-LC-Biotin (LC-Biotin) was a...

  8. Functional barrier in two-layer recycled PP films for food packaging applications

    Science.gov (United States)

    Scarfato, P.; Di Maio, L.; Milana, M. R.; Feliciani, R.; Denaro, M.; Incarnato, L.

    2014-05-01

    A preliminary study on bi-layer virgin/contaminated polypropylene co-extruded films was performed in order to evaluate the possibility to realize an effective functional barrier in PP-based multi-layer systems. In particular, the specific migration in 10% v/v aqueous ethanol of two surrogate contaminants (phenyl-cyclohexane and benzophenone) contained in the contaminated layer across the PP functional barrier was measured at different times and the results were compared with those obtained from a contaminated mono-layer polypropylene film. Moreover, the thermal and mechanical performances of the produced films were investigated.

  9. The dividend function in the jump-diffusion dual model with barrier dividend strategy

    Institute of Scientific and Technical Information of China (English)

    LI Bo; WU Rong

    2008-01-01

    A dual model of the perturbed classical compound Poisson risk model is considered under a constant dividend barrier.A new method is used in deriving the boundary condition of the equation for the expectation function by studying the local time of a related process.We obtain the expression for the expected discount dividend function in terms of those in the corresponding perturbed compound Poisson risk model without barriers.A special case in which the gain size is phase-type distributed is illustrated.We also consider the existence of the optimal dividend level.

  10. Rab5-mediated VE-cadherin internalization regulates the barrier function of the lung microvascular endothelium.

    Science.gov (United States)

    Yang, Junjun; Yao, Wei; Qian, Guisheng; Wei, Zhenghua; Wu, Guangyu; Wang, Guansong

    2015-12-01

    The small GTPase Rab5 has been well defined to control the vesicle-mediated plasma membrane protein transport to the endosomal compartment. However, its function in the internalization of vascular endothelial (VE)-cadherin, an important component of adherens junctions, and as a result regulating the endothelial cell polarity and barrier function remain unknown. Here, we demonstrated that lipopolysaccharide (LPS) simulation markedly enhanced the activation and expression of Rab5 in human pulmonary microvascular endothelial cells (HPMECs), which is accompanied by VE-cadherin internalization. In parallel, LPS challenge also induced abnormal cell polarity and dysfunction of the endothelial barrier in HPMECs. LPS stimulation promoted the translocation of VE-cadherin from the plasma membrane to intracellular compartments, and intracellularly expressed VE-cadherin was extensively colocalized with Rab5. Small interfering RNA (siRNA)-mediated depletion of Rab5a expression attenuated the disruption of LPS-induced internalization of VE-cadherin and the disorder of cell polarity. Furthermore, knockdown of Rab5 inhibited the vascular endothelial hyperpermeability and protected endothelial barrier function from LPS injury, both in vitro and in vivo. These results suggest that Rab5 is a critical mediator of LPS-induced endothelial barrier dysfunction, which is likely mediated through regulating VE-cadherin internalization. These findings provide evidence, implicating that Rab5a is a potential therapeutic target for preventing endothelial barrier disruption and vascular inflammation.

  11. Does Impaired Gallbladder Function Contribute to the Development of Barrett's Esophagus and Esophageal Adenocarcinoma?

    LENUS (Irish Health Repository)

    Nassr, Ayman O

    2011-06-01

    Esophageal adenocarcinoma is aetiologically associated with gastro-esophageal reflux, but the mechanisms responsible for the metaplasia-dysplasia sequence are unknown. Bile components are implicated. Impaired gallbladder function may contribute to duodenogastric reflux (DGR) and harmful GERD.

  12. Neuropsychiatric symptoms and global functional impairment along the Alzheimer’s continuum

    Science.gov (United States)

    Wadsworth, Lauren P.; Lorius, Natacha; Donovan, Nancy J.; Locascio, Joseph J.; Rentz, Dorene M.; Johnson, Keith A.; Sperling, Reisa A.; Marshall, Gad A.

    2013-01-01

    Background/Aims Neuropsychiatric symptoms in Alzheimer’s disease (AD) are highly prevalent. We sought to determine whether neuropsychiatric symptoms were related to global functional impairment at baseline and over a 3 year period in normal older control (NC), mild cognitive impairment (MCI), and mild AD dementia subjects. Methods Eight hundred and twelve subjects (229 NC, 395 MCI, 188 AD) from the Alzheimer’s Disease Neuroimaging Initiative study underwent 3 years of cognitive and behavioral assessments. Results Greater hallucinations, anxiety, and apathy were associated with greater global functional impairment at baseline, while baseline hallucinations and apathy were associated with greater global functional impairment over time across all subjects. The following neuropsychiatric symptoms were not significantly associated with global functioning: delusions, agitation, depression, euphoria, disinhibition, irritability, aberrant motor behaviors, sleep, and appetite. Conclusions These results suggest that increased baseline hallucinations and apathy are associated with current and future disease progression in AD. PMID:22922821

  13. A functional mechanistic study of the effect of emollients on the structure and function of the skin barrier.

    Science.gov (United States)

    Danby, S G; Chalmers, J; Brown, K; Williams, H C; Cork, M J

    2016-11-01

    Preventing relapses of atopic dermatitis (AD) through the regular use of topical products to repair the skin barrier defect is an emerging concept. It is still unclear if some commonly used emollients exert a positive effect on the skin barrier. To determine the skin barrier effects of emollients commonly prescribed in the U.K. Two cohorts of volunteers with quiescent AD undertook observer-blind forearm-controlled studies. The first cohort (18 volunteers) treated the volar side of one forearm with two fingertip units of Doublebase(™) gel twice daily for 4 weeks. The second cohort (19 volunteers) undertook the same regimen using Diprobase(®) cream. Transepidermal water loss (TEWL), stratum corneum integrity and hydration, skin surface pH and redness were determined at the test sites before and after treatment. Neither Diprobase(®) cream nor Doublebase(™) gel significantly affected the underlying skin barrier function. Both emollients were associated with significantly increased skin surface pH immediately after application (by 0·8 ± 0·19 and 1·0 ± 0·18 units, respectively), and no erythema. Diprobase(®) cream artificially and transiently (6 h) improved permeability barrier function by 2·9-3·1 g m(-2)  h(-1) TEWL and increased skin hydration by 6·0-6·2 units. Doublebase(™) gel, containing humectants, was associated with a greater (between 10·1 and 13·0 units during the first 6 h) and more sustained increase in hydration, lasting more than 12 h following repeated use. Diprobase(®) cream and Doublebase(™) gel are not associated with skin barrier harm and appear to be appropriate for AD treatment. While displaying emollient properties, neither formulation displayed an ability to actively improve sustained skin barrier function. © 2016 British Association of Dermatologists.

  14. Effects of Fe particle irradiation on human endothelial barrier structure and function

    Science.gov (United States)

    Sharma, Preety; Guida, Peter; Grabham, Peter

    2014-07-01

    Space travel involves exposure to biologically effective heavy ion radiation and there is consequently a concern for possible degenerative disorders in humans. A significant target for radiation effects is the microvascular system, which is crucial to healthy functioning of the tissues. Its pathology is linked to disrupted endothelial barrier function and is not only a primary event in a range of degenerative diseases but also an important influencing factor in many others. Thus, an assessment of the effects of heavy ion radiation on endothelial barrier function would be useful for estimating the risks of space travel. This study was aimed at understanding the effects of high LET Fe particles (1 GeV/n) and is the first investigation of the effects of charged particles on the function of the human endothelial barrier. We used a set of established and novel endpoints to assess barrier function after exposure. These include, trans-endothelial electrical resistance (TEER), morphological effects, localization of adhesion and cell junction proteins (in 2D monolayers and in 3D tissue models), and permeability of molecules through the endothelial barrier. A dose of 0.50 Gy was sufficient to cause a progressive reduction in TEER measurements that were significant 48 hours after exposure. Concurrently, there were morphological changes and a 14% loss of cells from monolayers. Gaps also appeared in the normally continuous cell-border localization of the tight junction protein - ZO-1 but not the Platelet endothelial cell adhesion molecule (PECAM-1) in both monolayers and in 3D vessel models. Disruption of barrier function was confirmed by increased permeability to 3 kDa and 10 kDa dextran molecules. A dose of 0.25 Gy caused no detectible change in cell number, morphology, or TEER, but did cause barrier disruption since there were gaps in the cell border localization of ZO-1 and an increased permeability to 3 kDa dextran. These results indicate that Fe particles potently have

  15. Health functioning impairments associated with posttraumatic stress disorder, anxiety disorders, and depression.

    Science.gov (United States)

    Zayfert, Claudia; Dums, Aricca R; Ferguson, Robert J; Hegel, Mark T

    2002-04-01

    Although anxiety disorders have been associated with impairments in self-reported health functioning, the relative effect of various anxiety disorders has not been studied. We compared health functioning of patients with a principal diagnosis of posttraumatic stress disorder (PTSD), panic disorder (PD), generalized anxiety disorder (GAD), and major depressive disorder (MDD). Patients with PTSD and MDD were equally impaired on overall mental health functioning, and both were significantly worse than patients with PD and GAD. PTSD was associated with significantly worse physical health functioning relative to PD, GAD, and MDD. Hierarchical regression showed that the association of PTSD with physical health functioning was unique and was not caused by the effects of age, depression, or comorbid anxiety disorders. Both PTSD and comorbid anxiety accounted for unique variance in mental functioning. These results highlight the association of PTSD with impaired physical and mental functioning and suggest that effective treatment of PTSD may affect overall health.

  16. The parametrization of Coulomb barrier heights and positions using a new universal function in the proximity potential

    Science.gov (United States)

    Zhang, G. L.; Pan, M.

    2016-10-01

    The Coulomb barrier heights are calculated by using the proximity potential with a new universal function in comparison with the results of proximity potentials Prox77, AW95, Bass73, BW91, CW76, DP and Ng80. It is found that the new results of Coulomb barrier heights are better than those of most proximity potentials. Then this proximity potential with the new universal function was used to calculate the Coulomb barrier positions and heights from light fusion systems to heavy fusion systems. The parametrized formulas are obtained for Coulomb barrier height and position, and can reproduce most of calculated barrier heights and positions within the accuracy of ± 1%.

  17. Functions of an engineered barrier system for a nuclear waste repository in basalt

    Energy Technology Data Exchange (ETDEWEB)

    Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.

    1980-01-01

    Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance.

  18. Adiponectin in Fresh Frozen Plasma Contributes to Restoration of Vascular Barrier Function After Hemorrhagic Shock.

    Science.gov (United States)

    Deng, Xiyun; Cao, Yanna; Huby, Maria P; Duan, Chaojun; Baer, Lisa; Peng, Zhanglong; Kozar, Rosemary A; Doursout, Marie-Francoise; Holcomb, John B; Wade, Charles E; Ko, Tien C

    2016-01-01

    Hemorrhagic shock is the leading cause of preventable deaths in civilian and military trauma. Use of fresh frozen plasma (FFP) in patients requiring massive transfusion is associated with improved outcomes. FFP contains significant amounts of adiponectin, which is known to have vascular protective function. We hypothesize that FFP improves vascular barrier function largely via adiponectin. Plasma adiponectin levels were measured in 19 severely injured patients in hemorrhagic shock (HS). Compared with normal individuals, plasma adiponectin levels decreased to 49% in HS patients before resuscitation (P < 0.05) and increased to 64% post-resuscitation (but not significant). In a HS mouse model, we demonstrated a similar decrease in plasma adiponectin to 54% but a significant increase to 79% by FFP resuscitation compared with baseline (P < 0.05). HS disrupted lung vascular barrier function, leading to an increase in permeability. FFP resuscitation reversed these HS-induced effects. Immunodepletion of adiponectin from FFP abolished FFP's effects on blocking endothelial hyperpermeability in vitro, and on improving lung vascular barrier function in HS mice. Replenishment with adiponectin rescued FFP's effects. These findings suggest that adiponectin is an important component in FFP resuscitation contributing to the beneficial effects on vascular barrier function after HS.

  19. Multiple sclerosis impairs regional functional connectivity in the cerebellum

    DEFF Research Database (Denmark)

    Dogonowski, Anne-Marie; Andersen, Kasper Winther; Madsen, Kristoffer Hougaard

    2013-01-01

    Resting-state functional magnetic resonance imaging (rs-fMRI) has been used to study changes in long-range functional brain connectivity in multiple sclerosis (MS). Yet little is known about how MS affects functional brain connectivity at the local level. Here we studied 42 patients with MS and 30...

  20. Microbial products induce claudin-2 to compromise gut epithelial barrier function.

    Directory of Open Access Journals (Sweden)

    Xiaoyu Liu

    Full Text Available The epithelial barrier dysfunction is an important pathogenic feature in a number of diseases. The underlying mechanism is to be further investigated. The present study aims to investigate the role of tight junction protein claudin-2 (Cldn2 in the compromising epithelial barrier function. In this study, the expression of Cldn2 in the epithelial layer of mice and patients with food allergy was observed by immunohistochemistry. The induction of Cldn2 was carried out with a cell culture model. The Cldn2-facilitated antigen internalization was observed by confocal microscopy. The epithelial barrier function in the gut epithelial monolayer was assessed by recording the transepithelial resistance and assessing the permeability to a macromolecular tracer. The results showed that the positive immune staining of Cldn2 was observed in the epithelial layer of the small intestine that was weakly stained in naïve control mice, and strongly stained in sensitized mice as well as patients with food allergy. Exposure to cholera toxin or Staphylococcal enterotoxin B induced the expression of Cldn2 in HT-29 or T84 cells. Cldn2 could bind protein antigen to form complexes to facilitate the antigen transport across the epithelial barrier. Blocking Cldn2 prevented the allergen-related hypersensitivity the intestine. We conclude that the tight junction protein Cldn2 is involved in the epithelial barrier dysfunction.

  1. Functional imaging correlates of impaired distractor suppression following sleep deprivation.

    Science.gov (United States)

    Kong, Danyang; Soon, Chun Siong; Chee, Michael W L

    2012-05-15

    Sleep deprivation (SD) has been shown to affect selective attention but it is not known how two of its component processes: target enhancement and distractor suppression, are affected. To investigate, young volunteers either attended to houses or were obliged to ignore them (when attending to faces) while viewing superimposed face-house pictures. MR signal enhancement and suppression in the parahippocampal place area (PPA) were determined relative to a passive viewing control condition. Sleep deprivation was associated with lower PPA activation across conditions. Critically SD specifically impaired distractor suppression in selective attention, leaving target enhancement relatively preserved. These findings parallel some observations in cognitive aging. Additionally, following SD, attended houses were not significantly better recognized than ignored houses in a post-experiment test of recognition memory contrasting with the finding of superior recognition of attended houses in the well-rested state. These results provide evidence for co-encoding of distracting information with targets into memory when one is sleep deprived.

  2. Impaired executive functions in experimental model of temporal lobe epilepsy

    Directory of Open Access Journals (Sweden)

    Fabiane Ochai Ramos

    2016-06-01

    Full Text Available ABSTRACT Objective The present study aimed to investigate cognitive and behavioural changes consistent with attention deficit hyperactivity disorder (ADHD -like behavior in male Wistar rats with temporal lobe epilepsy (TLE. Method Male Wistar rats at 25 day of age were submitted to animal model of TLE by pilocarpine injection (350 mg/kg, ip and a control group received saline 0.9%. The animals were continuously video monitored up to the end of experiments. The behavioural tests (open field, elevated plus maze and operant conditioning box started from 60 days postnatal. Results Animals with TLE exhibited elevated locomotor activity, reduced level of anxiety-related behavior, impulsivity and impaired visuospatial working memory. Conclusion Taken as a whole, we concluded that animals with TLE exhibited some cognitive and behavioural changes consistent with ADHD-like behavior.

  3. Abnormal Functional Lateralization and Activity of Language Brain Areas in Typical Specific Language Impairment (Developmental Dysphasia)

    Science.gov (United States)

    de Guibert, Clement; Maumet, Camille; Jannin, Pierre; Ferre, Jean-Christophe; Treguier, Catherine; Barillot, Christian; Le Rumeur, Elisabeth; Allaire, Catherine; Biraben, Arnaud

    2011-01-01

    Atypical functional lateralization and specialization for language have been proposed to account for developmental language disorders, yet results from functional neuroimaging studies are sparse and inconsistent. This functional magnetic resonance imaging study compared children with a specific subtype of specific language impairment affecting…

  4. Transient impairments in single muscle fibre contractile function after prolonged cycling in elite endurance athletes

    DEFF Research Database (Denmark)

    Hvid, L G; Gejl, Kasper Degn; Bech, R D

    2013-01-01

    Prolonged muscle activity impairs whole-muscle performance and function. However, little is known about the effects of prolonged muscle activity on the contractile function of human single muscle fibres. The purpose of this study was to investigate the effects of prolonged exercise and subsequent...... recovery on the contractile function of single muscle fibres obtained from elite athletes....

  5. Occupational functioning and work impairment in association with personality disorder trait-scores.

    Science.gov (United States)

    Hengartner, Michael P; Müller, Mario; Rodgers, Stephanie; Rössler, Wulf; Ajdacic-Gross, Vladeta

    2014-02-01

    According to the DSM, functional impairment is a main criterion for the general definition of personality disorders (PDs), but research suggests that some PDs might not be related to impaired functioning. Occupational functioning has rarely been examined in all ten DSM PDs. We analysed 511 adults aged 20-41 years from the general population of the canton of Zurich, Switzerland, using data from the Epidemiology Survey of the Zurich Programme for Sustainable Development of Mental Health Services. All PDs were assessed with dimensional trait-scores and associations with indicators of occupational functioning were analysed with generalised linear models. Each PD revealed at least a weak association with some form of occupational impairment. Most PDs, especially from cluster A and B, were significantly related to occupational dysfunction, in particular low education level, conflicts in the workplace, dismissal or demotion, and unemployment. In contrast, obsessive-compulsive PD was mostly unrelated to occupational functioning. A total personality pathology dose-response relationship was observed for low education level, conflicts in the workplace, dismissal or demotion, and unemployment. Impairment in occupational functioning is an important aspect particularly of cluster A and B PDs. Assuming that functional impairment is a predictor of illness severity, we advocate that clinicians should carefully explore indicators of occupational functioning in the diagnosis, prognosis, and treatment of PDs. The findings discussed herein have implications for general treatment, interventions in the work environment, or re-integration of patients into the labour force.

  6. Blood-Brain Barrier P-Glycoprotein Function in Neurodegenerative Disease

    NARCIS (Netherlands)

    Bartels, A. L.

    2011-01-01

    Protection of the brain is strengthened by active transport and ABC transporters. P-glycoprotein (P-gp) at the blood-brain barrier (BBB) functions as an active efflux pump by extruding a substrate from the brain, which is important for maintaining loco-regional homeostasis in the brain and protectio

  7. Lactulose as a marker of intestinal barrier function in pigs after weaning

    NARCIS (Netherlands)

    Wijtten, P.J.A.; Verstijnen, J.J.; Kempen, van T.A.T.G.; Perdok, H.B.; Gort, G.; Verstegen, M.W.A.

    2011-01-01

    Intestinal barrier function in pigs after weaning is almost exclusively determined in terminal experiments with Ussing chambers. Alternatively, the recovery in urine of orally administered lactulose can be used to assess intestinal permeability in living animals. This experiment was designed to

  8. BBB on chip: microfluidic platform to mechanically and biochemically modulate blood-brain barrier function

    NARCIS (Netherlands)

    Griep, L.M.; Wolbers, F.; de Wagenaar, B.; ter Braak, Paulus Martinus; Weksler, B.B.; Romero, A.; Couraud, P.O.; Vermes, I.; van der Meer, Andries Dirk; van den Berg, Albert

    The blood-brain barrier (BBB) is a unique feature of the human body, preserving brain homeostasis and preventing toxic substances to enter the brain. However, in various neurodegenerative diseases, the function of the BBB is disturbed. Mechanisms of the breakdown of the BBB are incompletely

  9. Guidance document on fat reduction factor, functional barrier concept, phthalates and primary aromatic amines

    DEFF Research Database (Denmark)

    Hoekstra, Eddo J.; Petersen, Jens Højslev; Bustos, Juana

    and the functional barrier, and the restrictions for certain phthalates and primary aromatic amines. The Regulation applies from 1 May 2011. The network of the European Union Reference Laboratory and the National Reference Laboratories for food contact materials created a Task Force in order to give guidance...

  10. Lactulose as a marker of intestinal barrier function in pigs after weaning

    NARCIS (Netherlands)

    Wijtten, P.J.A.; Verstijnen, J.J.; Kempen, van T.A.T.G.; Perdok, H.B.; Gort, G.; Verstegen, M.W.A.

    2011-01-01

    Intestinal barrier function in pigs after weaning is almost exclusively determined in terminal experiments with Ussing chambers. Alternatively, the recovery in urine of orally administered lactulose can be used to assess intestinal permeability in living animals. This experiment was designed to stud

  11. Guidance document on fat reduction factor, functional barrier concept, phthalates and primary aromatic amines

    DEFF Research Database (Denmark)

    Hoekstra, Eddo J.; Petersen, Jens Højslev; Bustos, Juana

    and the functional barrier, and the restrictions for certain phthalates and primary aromatic amines. The Regulation applies from 1 May 2011. The network of the European Union Reference Laboratory and the National Reference Laboratories for food contact materials created a Task Force in order to give guidance...

  12. Cichorium intybus root extract: A "vitamin D-like" active ingredient to improve skin barrier function.

    Science.gov (United States)

    Maia Campos, P M B G; G Mercurio, D; O Melo, M; Closs-Gonthier, B

    2017-02-01

    During the aging process, the human skin suffers many alterations including dryness, skin barrier function damage. The skin barrier function is important to the prevention of skin alterations and maintenance of homeostasis. So, the objective of this study was to assess the clinical efficacy on skin barrier function of Cichorium intybus root extract in cosmetic formulations with or without UV filters. Fifty women, aged between 45 and 60 years, were divided into two groups. One group received vehicle formulations containing UV filters, and the other group received formulations without UV filters. Both groups received a formulation containing the extract and the vehicle. The formulations were applied twice daily to the upper arms after washing with sodium lauryl sulphate. Transepidermal water loss (TEWL) and skin microrelief were evaluated before and after a 14- and 28-day period of treatment. The control regions and regions where the vehicles were applied showed an increase in the TEWL. For the formulations containing the extract, decreased TEWL and improved microrelief were observed when compared to the vehicle and control areas after a 28-day period. In conclusion, Cichorium intybus root extract showed protective and restructuring effects on the skin and stands out as an innovative ingredient to improve skin barrier function.

  13. Stratum corneum model membranes : molecular organization in relation to skin barrier function

    NARCIS (Netherlands)

    Groen, Daniël

    2011-01-01

    The stratum corneum (SC), the thin uppermost layer of the skin, consists of dead flattened skin cells (corneocytes) embedded in a lipid matrix. The lipid matrix is considered to play a crucial role in the skin barrier function. It consists of ceramides (CER), cholesterol (CHOL) and free fatty acids

  14. BBB on chip: microfluidic platform to mechanically and biochemically modulate blood-brain barrier function

    NARCIS (Netherlands)

    Griep, L.M.; Wolbers, F.; Wagenaar, de B.; Braak, ter P.M.; Weksler, B.B.; Romero, A.; Couraud, P.O.; Vermes, I.; Meer, van der A.D.; Berg, van den A.

    2013-01-01

    The blood-brain barrier (BBB) is a unique feature of the human body, preserving brain homeostasis and preventing toxic substances to enter the brain. However, in various neurodegenerative diseases, the function of the BBB is disturbed. Mechanisms of the breakdown of the BBB are incompletely understo

  15. Systemic cisplatin exposure during infancy and adolescence causes impaired cognitive function in adulthood

    Science.gov (United States)

    Lomeli, Naomi; Bota, Daniela A.

    2017-01-01

    Cancer survivors diagnosed during infancy and adolescence may be at risk for chemotherapy-related cognitive impairments (CRCI), however the effects of pediatric chemotherapy treatment on adulthood cognitive function are not well understood. Impairments in memory, attention and executive function affect 15–50% of childhood leukemia survivors related to methotrexate exposure. Systemic cisplatin is used to treat a variety of childhood and adult cancers, yet the risk and extent of cognitive impairment due to platinum-based chemotherapy in pediatric patients is unknown. Systemic cisplatin penetrates the CNS, induces hippocampal synaptic damage, and leads to neuronal and neural stem/progenitor cell (NSC) loss. Survivors of non-leukemic cancers may be at risk for significant cognitive impairment related to cisplatin-driven neurotoxicity. We sought to examine the long-term effects of systemic cisplatin administration on cognitive function when administered during infancy and adolescence in a rat model. We performed cognitive testing in adult rats exposed to systemic cisplatin during either infancy or adolescence. Rats treated as adolescents showed significantly poor retrieval of a novel object as compared to controls. Further, cisplatin-treated infants and adolescents showed poor contextual discrimination as compared to controls, and an impaired response to cued fear conditioning. Ultimately, systemic cisplatin exposure resulted in more profound impairments in cognitive function in rats treated during adolescence than in those treated during infancy. Further, exposure to cisplatin during adolescence affected both hippocampus and amygdala dependent cognitive function, suggesting a more global cognitive dysfunction at this age. PMID:27851909

  16. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function.

    Science.gov (United States)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis; Park, Kyungho; Roelandt, Truus; Oda, Yuko; Hupe, Melanie; Crumrine, Debra; Lee, Hae-Jin; Gschwandtner, Maria; Thyssen, Jacob P; Trullas, Carles; Tschachler, Erwin; Feingold, Kenneth R; Elias, Peter M

    2013-02-01

    Systemic antagonists of the histamine type 1 and 2 receptors (H1/2r) are widely used as anti-pruritics and central sedatives, but demonstrate only modest anti-inflammatory activity. Because many inflammatory dermatoses result from defects in cutaneous barrier function, and because keratinocytes express both Hr1 and Hr2, we hypothesized that H1/2r antagonists might be more effective if they were used topically to treat inflammatory dermatoses. Topical H1/2r antagonists additively enhanced permeability barrier homeostasis in normal mouse skin by the following mechanisms: (i) stimulation of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased inflammation and enhanced barrier function. These results could shift current paradigms of antihistamine utilization from a predominantly systemic to a topical approach.

  17. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling

    OpenAIRE

    Kai Wang; Xiaolu Jin; Yifan Chen; Zehe Song; Xiasen Jiang; Fuliang Hu; Conlon, Michael A.; Topping, David L.

    2016-01-01

    Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE) on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ) loci occludin and zona occludens (ZO)-1. Confocal m...

  18. Impaired baroreflex function in mice overexpressing alpha-synuclein

    Directory of Open Access Journals (Sweden)

    Sheila eFleming

    2013-07-01

    Full Text Available Cardiovascular autonomic dysfunction, such as orthostatic hypotension consequent to baroreflex failure and cardiac sympathetic denervation, is frequently observed in the synucleinopathy Parkinson’s disease (PD. In the present study, the baroreceptor reflex was assessed in mice overexpressing human wildtype alpha-synuclein (Thy1-aSyn, a genetic mouse model of synucleinopathy. The beat-to-beat change in heart rate, computed from R-R interval, in relation to blood pressure was measured in anesthetized and conscious mice equipped with arterial blood pressure telemetry transducers during transient bouts of hypertension and hypotension. Compared to wildtype, tachycardia following nitroprusside-induced hypotension was significantly reduced in Thy1-aSyn mice. Thy1-aSyn mice also showed an abnormal cardiovascular response (i.e., diminished tachycardia to muscarinic blockade with atropine. We conclude that Thy1-aSyn mice have impaired basal and dynamic range of sympathetic and parasympathetic-mediated changes in heart rate and will be a useful model for long-term study of cardiovascular autonomic dysfunction associated with PD.

  19. Cryopreservation of human skeletal muscle impairs mitochondrial function

    DEFF Research Database (Denmark)

    Larsen, Steen; Wright-Paradis, C; Gnaiger, E

    2012-01-01

    Previous studies have investigated if cryopreservation is a viable approach for functional mitochondrial analysis. Different tissues have been studied, and conflicting results have been published. The aim of the present study was to investigate if mitochondria in human skeletal muscle maintain...... loss from the mitochondria. The results from this study demonstrate that normal mitochondrial functionality is not maintained in cryopreserved human skeletal muscle samples....... functionality after long term cryopreservation (1 year). Skeletal muscle samples were preserved in dimethyl sulfoxide (DMSO) for later analysis. Human skeletal muscle fibres were thawed and permeabilised with saponin, and mitochondrial respiration was measured by high-resolution respirometry. The capacity...

  20. Cryopreservation of human skeletal muscle impairs mitochondrial function

    DEFF Research Database (Denmark)

    Larsen, S; Wright-Paradis, C; Gnaiger, E

    2012-01-01

    Previous studies have investigated if cryopreservation is a viable approach for functional mitochondrial analysis. Different tissues have been studied, and conflicting results have been published. The aim of the present study was to investigate if mitochondria in human skeletal muscle maintain...... functionality after long term cryopreservation (1 year). Skeletal muscle samples were preserved in dimethyl sulfoxide (DMSO) for later analysis. Human skeletal muscle fibres were thawed and permeabilised with saponin, and mitochondrial respiration was measured by high-resolution respirometry. The capacity...... loss from the mitochondria. The results from this study demonstrate that normal mitochondrial functionality is not maintained in cryopreserved human skeletal muscle samples....

  1. Body Dysmorphic Symptoms, Functional Impairment, and Depression: The Role of Appearance-Based Teasing.

    Science.gov (United States)

    Weingarden, Hilary; Renshaw, Keith D

    2016-01-01

    Body dysmorphic disorder is associated with elevated social and occupational impairment and comorbid depression, but research on risk factors for body dysmorphic symptoms and associated outcomes is limited. Appearance-based teasing may be a potential risk factor. To examine the specificity of this factor, the authors assessed self-reported appearance-based teasing, body dysmorphic, and obsessive-compulsive symptom severity, functional impairment (i.e., social, occupational, family impairment), and depression in a nonclinical sample of undergraduates. As hypothesized, appearance-based teasing was positively correlated with body dysmorphic symptoms. The correlation between teasing and body dysmorphic symptoms was stronger than that between teasing and obsessive-compulsive symptom severity. Last, body dysmorphic symptom severity and appearance-based teasing interacted in predicting functional impairment and depression. Specifically, appearance-based teasing was positively associated with depression and functional impairment only in those with elevated body dysmorphic symptoms. When a similar moderation was tested with obsessive-compulsive, in place of body dysmorphic, symptom severity, the interaction was nonsignificant. Findings support theory that appearance-based teasing is a specific risk factor for body dysmorphic symptoms and associated functional impairment.

  2. Comorbid Cognitive Impairment and Functional Trajectories in Low Vision Rehabilitation for Macular Disease

    Science.gov (United States)

    Whitson, Heather E.; Ansah, Deidra; Sanders, Linda L; Whitaker, Diane; Potter, Guy G.; Cousins, Scott W.; Steffens, David C.; Landerman, Lawrence R.; Pieper, Carl F.; Cohen, Harvey Jay

    2011-01-01

    Background and Aims Comorbid cognitive impairment is common among visually impaired older adults. This study investigated whether baseline cognitive status predicts functional trajectories among older adults in low vision rehabilitation (LVR) for macular disease. Methods The Telephone Interview for Cognitive Status – modified (TICS-m) was administered to macular disease patients aged ≥ 65 years receiving outpatient LVR. Mixed models assessed the rate of change in instrumental activities of daily living and visual function measures over a mean follow-up of 115 days. Results Of 91 participants, 17 (18.7%) had cognitive impairment (TICS-m score ≤ 27) and 23 (25.3%) had marginal impairment (TICS-m scores 28 to 30). Controlling for age and gender, baseline cognitive status did not predict most functional outcomes. However, participants with marginal cognitive impairment experienced worse functional trajectories in ability to prepare meals (p=0.03).and activities that require distance vision (p = 0.05). Conclusion Patients with mild to moderate cognitive impairment should not be excluded from LVR, but programs should be prepared to detect and accommodate a range of cognitive ability. PMID:22526069

  3. Wild jujube polysaccharides protect against experimental inflammatory bowel disease by enabling enhanced intestinal barrier function.

    Science.gov (United States)

    Yue, Yuan; Wu, Shuangchan; Li, Zhike; Li, Jian; Li, Xiaofei; Xiang, Jin; Ding, Hong

    2015-08-01

    Dietary polysaccharides provide various beneficial effects for our health. We investigated the protective effects of wild jujube (Ziziphus jujuba Mill. var. spinosa (Bunge) Hu ex H. F. Chou) sarcocarp polysaccharides (WJPs) against experimental inflammatory bowel disease (IBD) by enabling enhanced intestinal barrier function. Colitis was induced in rats by the intrarectal administration of TNBS. We found that WJPs markedly ameliorated the colitis severity, including less weight loss, decreased disease activity index scores, and improved mucosal damage in colitis rats. Moreover, WJPs suppressed the inflammatory response via attenuation of TNF-α, IL-1β, IL-6 and MPO activity in colitis rats. And then, to determine the effect of WJPs on the intestinal barrier, we measured the effect of WJPs on the transepithelial electrical resistance (TER) and FITC-conjugated dextran permeability in Caco-2 cell stimulation with TNF-α. We further demonstrated that the alleviation of WJPs to colon injury was associated with barrier function by assembly of tight junction proteins. Moreover, the effect of WJPs on TER was eliminated by the specific inhibitor of AMPK. AMPK activity was also up-regulated by WJPs in Caco-2 cell stimulation with TNF-α and in colitis rats. This study demonstrates that WJPs protect against IBD by enabling enhanced intestinal barrier function involving the activation of AMPK.

  4. Translational Medicine Study on Cardiac Microvascular Endothelial Barrier Function and Myocardial Ischemia/Re-perfusion Injury

    Institute of Scientific and Technical Information of China (English)

    Yeong Yeh Lee

    2015-01-01

    Vascular endothelial barrier is defined as the ability of endothelial cells and their components that make up the microvascular wall structure in controlling the cellular components and marco-molecular substances in blood from penetrating vascular walls. It is the place for the selective exchange of oxygen, nutrients and metabolites, and has kernel effect in maintaining myocardial micro-environmental homeostasis. In clinic, microvascular permeability is commonly used as the index for evaluating endothelial barrier function. Myocardial microvascular endothelial cells, inter-endothelial connexin and basilar membrane (BM) interact synergically to constitute the basis for barrier function, which has a selective permeability effect on interaction between nutrient substances and other myocardial cell molecules. Increase of microvascular permeability is closely associated with cardiovascular events like coronary heart disease (CHD) and myocardial ischemia, and is the risk factor for CHD attack. And deep exploration of the mechanism of endothelial permeability and positive selection of new-type re-perfusion complementary drugs for alleviating endothelial permeability can be beneifcial in improving the prognosis of patients with acute myocardial infarction (AMI). Therefore, from the view of translational medicine, this study mainly summarized the increase of microvascular permeability and its pathological signiifcance after AMI, physiological and pathological mechanisms of regulating microvascular permeability and complementary therapies for AMI re-perfusion as well as microvascular endothelial barrier function, hoping to provide a basis for improving the prognosis of patients with AMI.

  5. Translational Medicine Study on Cardiac Microvascular Endothelial Barrier Function and Myocardial Ischemia/Re-perfusion Injury

    Directory of Open Access Journals (Sweden)

    Yeong Yeh Lee

    2015-09-01

    Full Text Available Vascular endothelial barrier is defined as the ability of endothelial cells and their components that make up the microvascular wall structure in controlling the cellular components and marco-molecular substances in blood from penetrating vascular walls. It is the place for the selective exchange of oxygen, nutrients and metabolites, and has kernel effect in maintaining myocardial micro-environmental homeostasis. In clinic, microvascular permeability is commonly used as the index for evaluating endothelial barrier function. Myocardial microvascular endothelial cells, inter-endothelial connexin and basilar membrane (BM interact synergically to constitute the basis for barrier function, which has a selective permeability effect on interaction between nutrient substances and other myocardial cell molecules. Increase of microvascular permeability is closely associated with cardiovascular events like coronary heart disease (CHD and myocardial ischemia, and is the risk factor for CHD attack. And deep exploration of the mechanism of endothelial permeability and positive selection of new-type re-perfusion complementary drugs for alleviating endothelial permeability can be beneficial in improving the prognosis of patients with acute myocardial infarction (AMI. Therefore, from the view of translational medicine, this study mainly summarized the increase of microvascular permeability and its pathological significance after AMI, physiological and pathological mechanisms of regulating microvascular permeability and complementary therapies for AMI re-perfusion as well as microvascular endothelial barrier function, hoping to provide a basis for improving the prognosis of patients with AMI.

  6. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function

    Science.gov (United States)

    Reunanen, Justus; Meijerink, Marjolein; Pietilä, Taija E.; Kainulainen, Veera; Klievink, Judith; Huuskonen, Laura; Aalvink, Steven; Skurnik, Mikael; Boeren, Sjef; Satokari, Reetta; Mercenier, Annick; Palva, Airi; Smidt, Hauke; de Vos, Willem M.; Belzer, Clara

    2017-01-01

    Gut barrier function is key in maintaining a balanced response between the host and its microbiome. The microbiota can modulate changes in gut barrier as well as metabolic and inflammatory responses. This highly complex system involves numerous microbiota-derived factors. The gut symbiont Akkermansia muciniphila is positively correlated with a lean phenotype, reduced body weight gain, amelioration of metabolic responses and restoration of gut barrier function by modulation of mucus layer thickness. However, the molecular mechanisms behind its metabolic and immunological regulatory properties are unexplored. Herein, we identify a highly abundant outer membrane pili-like protein of A. muciniphila MucT that is directly involved in immune regulation and enhancement of trans-epithelial resistance. The purified Amuc_1100 protein and enrichments containing all its associated proteins induced production of specific cytokines through activation of Toll-like receptor (TLR) 2 and TLR4. This mainly leads to high levels of IL-10 similar to those induced by the other beneficial immune suppressive microorganisms such as Faecalibacterium prausnitzii A2-165 and Lactobacillus plantarum WCFS1. Together these results indicate that outer membrane protein composition and particularly the newly identified highly abundant pili-like protein Amuc_1100 of A. muciniphila are involved in host immunological homeostasis at the gut mucosa, and improvement of gut barrier function. PMID:28249045

  7. Distinct Shifts in Microbiota Composition during Drosophila Aging Impair Intestinal Function and Drive Mortality

    Directory of Open Access Journals (Sweden)

    Rebecca I. Clark

    2015-09-01

    Full Text Available Alterations in the composition of the intestinal microbiota have been correlated with aging and measures of frailty in the elderly. However, the relationships between microbial dynamics, age-related changes in intestinal physiology, and organismal health remain poorly understood. Here, we show that dysbiosis of the intestinal microbiota, characterized by an expansion of the Gammaproteobacteria, is tightly linked to age-onset intestinal barrier dysfunction in Drosophila. Indeed, alterations in the microbiota precede and predict the onset of intestinal barrier dysfunction in aged flies. Changes in microbial composition occurring prior to intestinal barrier dysfunction contribute to changes in excretory function and immune gene activation in the aging intestine. In addition, we show that a distinct shift in microbiota composition follows intestinal barrier dysfunction, leading to systemic immune activation and organismal death. Our results indicate that alterations in microbiota dynamics could contribute to and also predict varying rates of health decline during aging in mammals.

  8. Distinct Shifts in Microbiota Composition during Drosophila Aging Impair Intestinal Function and Drive Mortality.

    Science.gov (United States)

    Clark, Rebecca I; Salazar, Anna; Yamada, Ryuichi; Fitz-Gibbon, Sorel; Morselli, Marco; Alcaraz, Jeanette; Rana, Anil; Rera, Michael; Pellegrini, Matteo; Ja, William W; Walker, David W

    2015-09-08

    Alterations in the composition of the intestinal microbiota have been correlated with aging and measures of frailty in the elderly. However, the relationships between microbial dynamics, age-related changes in intestinal physiology, and organismal health remain poorly understood. Here, we show that dysbiosis of the intestinal microbiota, characterized by an expansion of the Gammaproteobacteria, is tightly linked to age-onset intestinal barrier dysfunction in Drosophila. Indeed, alterations in the microbiota precede and predict the onset of intestinal barrier dysfunction in aged flies. Changes in microbial composition occurring prior to intestinal barrier dysfunction contribute to changes in excretory function and immune gene activation in the aging intestine. In addition, we show that a distinct shift in microbiota composition follows intestinal barrier dysfunction, leading to systemic immune activation and organismal death. Our results indicate that alterations in microbiota dynamics could contribute to and also predict varying rates of health decline during aging in mammals.

  9. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  10. Assessment of posttraumatic stress disorder-related functional impairment: A review

    Directory of Open Access Journals (Sweden)

    Paola Rodriguez, PhD

    2012-06-01

    Full Text Available In 2010, the Department of Veterans Affairs (VA and Department of Defense (DOD jointly published the revised VA/DOD Clinical Practice Guideline for Management of Posttraumatic Stress. The Clinical Practice Guideline (CPG provides evidence-based recommendations for diagnosing and treating a spectrum of stress-related disorders. Included in the CPG were recommendations for assessing posttraumatic stress disorder (PTSD and other stress disorder-related functional impairment. This article complements those CPG recommendations by providing information that may further guide clinicians in the assessment of functional impairment related to PTSD and other stress-related disorders. We briefly review some of the empirical literature on the association between PTSD and functional impairment and some of the more frequently used methods and measures for assessing functional impairment and introduce a new measure currently being developed by our group. We suggest that information obtained via patient self-report and/or clinician rating be supplemented whenever possible with collateral data from friends, family members, coworkers, or supervisors to provide a complete picture of current and premorbid functional status. Finally, we explore several important issues that we encourage clinicians to keep in mind when assessing functional impairment among Veterans and Active Duty service members.

  11. Signaling pathways induced by serine proteases to increase intestinal epithelial barrier function.

    Science.gov (United States)

    Lahey, Kelcie A; Ronaghan, Natalie J; Shang, Judie; Dion, Sébastien P; Désilets, Antoine; Leduc, Richard; MacNaughton, Wallace K

    2017-01-01

    Changes in barrier function of the gastrointestinal tract are thought to contribute to the inflammatory bowel diseases Crohn's disease and ulcerative colitis. Previous work in our lab demonstrated that apical exposure of intestinal epithelial cell lines to serine proteases results in an increase in transepithelial electrical resistance (TER). However, the underlying mechanisms governing this response are unclear. We aimed to determine the requirement for proteolytic activity, epidermal growth factor receptor (EGFR) activation, and downstream intracellular signaling in initiating and maintaining enhanced barrier function following protease treatment using a canine intestinal epithelial cell line (SCBN). We also examined the role of phosphorylation of myosin regulatory light chain on the serine protease-induced increase in TER through. It was found that proteolytic activity of the serine proteases trypsin and matriptase is required to initiate and maintain the protease-mediated increase in TER. We also show that MMP-independent EGFR activation is essential to the sustained phase of the protease response, and that Src kinases may mediate EGFR transactivation. PI3-K and ERK1/2 signaling were important in reaching a maximal increase in TER following protease stimulation; however, their upstream activators are yet to be determined. CK2 inhibition prevented the increase in TER induced by serine proteases. The bradykinin B(2) receptor was not involved in the change in TER in response to serine proteases, and no change in phosphorylation of MLC was observed after trypsin or matriptase treatment. Taken together, our data show a requirement for ongoing proteolytic activity, EGFR transactivation, as well as downstream PI3-K, ERK1/2, and CK2 signaling in protease-mediated barrier enhancement of intestinal epithelial cells. The pathways mediating enhanced barrier function by proteases may be novel therapeutic targets for intestinal disorders characterized by disrupted epithelial

  12. Mental disorders, functional impairment, and nerve growth factor

    Science.gov (United States)

    Salles, Fanny Helena Martins; Soares, Pedro San Martin; Wiener, Carolina David; Mondin, Thaise Campos; da Silva, Paula Moraes; Jansen, Karen; de Mattos Souza, Luciano Dias; da Silva, Ricardo Azevedo; Oses, Jean Pierre

    2017-01-01

    Nerve growth factor (NGF) is an important member of the neurotrophin family and its alteration has been associated with psychiatric disorders. Functionality consists of the activities that an individual can perform, as well as their social participation, which is an important factor in analyzing the carrier living conditions of subjects with psychiatric suffering. Several studies have evaluated functionality in bipolar disorder; however, no studies have evaluated the functionality in other mental disorders. There are also few studies investigating the association between functionality and the biological bases of mental disorders. This study aimed to evaluate the serum NGF levels in psychiatric patients and to verify a possible association between the serum neurotrophic levels and functionality. This was a cross-sectional study with a convenient sample obtained from the Public Mental Health Service from the south of Brazil. The final sample was composed of 286 patients enrolled from July 2013 to October 2014. Data was collected using a sociodemographic questionnaire, and the diagnosis was confirmed using the Mini International Neuropsychiatric Interview (M.I.N.I) and a Functioning Assessment Short Test. The serum NGF levels were determined using the enzyme-linked immunosorbent assay method. Statistical analyses were performed using IBM SPSS Statistic 21.0 software. NGF serum levels were increased significantly in patients with obsessive–compulsive disorder compared with patients with no obsessive–compulsive disorder (P=0.015). An increase in serum NGF levels in generalized anxiety disorder patients was observed compared with patients with no generalized anxiety disorder (P=0.047). NGF was negatively associated with autonomy (P=0.024, r=−0.136), work (P=0.040, r=−0.124), and cognition (P=0.024, r=−0.137), thereby showing that changes in serum levels of NGF are associated with functionality in mental disorders. PMID:28053561

  13. Epileptiform activity and spreading depolarization in the blood-brain barrier-disrupted peri-infarct hippocampus are associated with impaired GABAergic inhibition and synaptic plasticity.

    Science.gov (United States)

    Lippmann, Kristina; Kamintsky, Lyn; Kim, Soo Young; Lublinsky, Svetlana; Prager, Ofer; Nichtweiss, Julia Friederike; Salar, Seda; Kaufer, Daniela; Heinemann, Uwe; Friedman, Alon

    2017-05-01

    Peri-infarct opening of the blood-brain barrier may be associated with spreading depolarizations, seizures, and epileptogenesis as well as cognitive dysfunction. We aimed to investigate the mechanisms underlying neural network pathophysiology in the blood-brain barrier-dysfunctional hippocampus. Photothrombotic stroke within the rat neocortex was associated with increased intracranial pressure, vasogenic edema, and peri-ischemic blood-brain barrier dysfunction that included the ipsilateral hippocampus. Intrahippocampal recordings revealed electrographic seizures within the first week in two-thirds of animals, accompanied by a reduction in gamma and increase in theta frequency bands. Synaptic interactions were studied in parasagittal hippocampal slices at 24 h and seven days post-stroke. Field potential recordings in CA1 and CA3 uncovered multiple population spikes, epileptiform episodes, and spreading depolarizations at 24 h. Input-output analysis revealed that fEPSP-spike coupling was significantly enhanced at seven days. In addition, CA1 feedback and feedforward inhibition were diminished. Slices generating epileptiform activity at seven days revealed impaired bidirectional long-term plasticity following high and low-frequency stimulation protocols. Microarray and PCR data confirmed changes in expression of astrocyte-related genes and suggested downregulation in expression of GABAA-receptor subunits. We conclude that blood-brain barrier dysfunction in the peri-infarct hippocampus is associated with early disinhibition, hyperexcitability, and abnormal synaptic plasticity.

  14. Barrier Lyapunov function-based model-free constraint position control for mechanical systems

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seong Ik; Ha, Hyun Uk; Lee, Jang Myung [Pusan National University, Busan (Korea, Republic of)

    2016-07-15

    In this article, a motion constraint control scheme is presented for mechanical systems without a modeling process by introducing a barrier Lyapunov function technique and adaptive estimation laws. The transformed error and filtered error surfaces are defined to constrain the motion tracking error in the prescribed boundary layers. Unknown parameters of mechanical systems are estimated using adaptive laws derived from the Lyapunov function. Then, robust control used the conventional sliding mode control, which give rise to excessive chattering, is changed to finite time-based control to alleviate undesirable chattering in the control action and to ensure finite-time error convergence. Finally, the constraint controller from the barrier Lyapunov function is designed and applied to the constraint of the position tracking error of the mechanical system. Two experimental examples for the XY table and articulated manipulator are shown to evaluate the proposed control scheme.

  15. Hemodialysis does not impair ventricular functions over 2 years.

    Science.gov (United States)

    Duran, Mustafa; Unal, Aydin; Inanc, Mehmet Tugrul; Kocyigit, Ismail; Oguz, Fatih; Ocak, Ayse; Ozdogru, İbrahim; Kasapkara, Ahmet; Karakaya, Ekrem; Oymak, Oktay

    2011-07-01

    We aimed to evaluate the long-term effect of hemodialysis (HD) treatment on left and right ventricular (LV and RV) functions in patients with end-stage renal disease. The study population consisted of 22 patients with newly diagnosed end-stage renal disease. Before an arteriovenous fistula was surgically created for HD, the patients were evaluated by echocardiography for systolic and diastolic functions. After the first HD session (mean 24.22 ± 2.14 months), the second echocardiographic evaluations were performed. Left ventricular and RV functions before and after long-term HD treatment were compared. The mean age was 55 ± 13 years and 10 (45%) of the patients were female. After long-term HD treatment, the isovolumic relaxation time was significantly decreased; however, the peak early (E) and late (A) diastolic mitral inflow velocities, E/A ratio, and deceleration time of E wave were not significantly different from the baseline measurements. Also, there was no significantly change in the early diastolic velocity (Ea) of the lateral mitral anulus and the E/Ea ratio. Pulmonary vein peak diastolic velocity, peak atrial reversal velocity, and peak atrial reversal velocity duration remained almost unchanged even though the pulmonary vein peak systolic velocity and the pulmonary vein peak systolic velocity/pulmonary vein peak diastolic velocity ratio were significantly lower after long-term HD treatment. In addition, LV systolic functions, LV diameters, LV mass index, left atrium size, and RV diastolic functions were not statistically different after long-term HD treatment. The myocardium is exposed to hemodynamic, metabolic, and neuro-humoral abnormalities during HD treatment; however, the long-term effects of HD on ventricular functions are not clearly known. The present study showed that the long-term effects of HD on LV and RV functions were insignificant in patients with end-stage renal disease. We have demonstrated that the LV and RV functions did not change

  16. [Review of functional impairment associated with acute illness in the elderly].

    Science.gov (United States)

    Osuna-Pozo, Carmen María; Ortiz-Alonso, Javier; Vidán, Maite; Ferreira, Guillermo; Serra-Rexach, José Antonio

    2014-01-01

    Hospitalization is a risk for elderly population, with a high probability of having adverse events. The most important one is functional impairment, due to its high prevalence and the serious impact it has on the quality of life. The main risk factors for functional decline associated with hospitalization are, age, immobility, cognitive impairment, and functional status prior to admission. It is necessary to detect patients at risk in order to implement the necessary actions to prevent this deterioration, with physical exercise and multidisciplinary geriatric care being the most important. Copyright © 2013 SEGG. Published by Elsevier Espana. All rights reserved.

  17. Impaired cognitive function in women with congenital adrenal hyperplasia

    DEFF Research Database (Denmark)

    Johannsen, Trine H.; Ripa, Caroline P.L.; Reinisch, June M.

    2006-01-01

    CONTEXT: Congenital adrenal hyperplasia (CAH) is a disorder with a wide spectrum of severity. OBJECTIVE: The objective of this study was to investigate cognitive function in CAH women. DESIGN: This was a case-control study. SETTING: This study was conducted at a tertiary center for pediatric...

  18. Impaired Sertoli cell function in males diagnosed with Noonan syndrome.

    NARCIS (Netherlands)

    Marcus, K.A.; Sweep, C.G.J.; Burgt, I van der; Noordam, C.

    2008-01-01

    In order to study male gonadal function in Noonan syndrome, clinical and laboratory data, including inhibin B, were gathered in nine pubertal males diagnosed with Noonan syndrome. Bilateral testicular maldescent was observed in four, and unilateral cryptorchidism occurred in two. Puberty was delayed

  19. Sexual functioning is impaired in adults with congenital heart disease

    NARCIS (Netherlands)

    P. Opic (Petra); J.W. Roos-Hesselink (Jolien); J.A.A.E. Cuypers (Judith); M. Witsenburg (Maarten); A.E. van den Bosch (Annemien); R.T. van Domburg (Ron); A.J.J.C. Bogers (Ad); E.M.W.J. Utens (Elisabeth)

    2013-01-01

    textabstractBackground: To investigate the overall sexual functioning and disease specific sexual problems in congenital heart disease (ConHD) patients, for both genders and different cardiac diagnostic groups, and compare these with Dutch normative data. Also disease specific sexual problems were

  20. Impaired orofacial motor functions on chronic temporomandibular disorders.

    Science.gov (United States)

    Ferreira, Cláudia Lúcia Pimenta; Machado, Bárbara Cristina Zanandréa; Borges, Carina Giovana Pissinatti; Rodrigues Da Silva, Marco Antonio M; Sforza, Chiarella; De Felício, Cláudia Maria

    2014-08-01

    Because temporomandibular disorders (TMDs) rehabilitation continues to be a challenge, a more comprehensive picture of the orofacial functions in patients with chronic pain is required. This study assessed the orofacial functions, including surface electromyography (EMG) of dynamic rhythmic activities, in patients with moderate-severe signs and symptoms of chronic TMD. It was hypothesized that orofacial motor control differs between patients with moderate-severe chronic TMD and healthy subjects. Seventy-six subjects (46 with TMD and 30 control) answered questionnaires of severity of TMD and chewing difficulties. Orofacial functions and EMG during chewing were assessed. Standardized EMG indices were obtained by quantitative analysis of the differential EMG signals of the paired masseter and temporal muscles, and used to describe muscular action during chewing. TMD patients showed significant greater difficulty in chewing; worse orofacial scores; longer time for free mastication; a less accurate recruitment of the muscles on the working and balancing sides, reduced symmetrical mastication index (SMI) and increased standardized activity during EMG test than healthy subjects. SMI, TMD severity and orofacial myofunctional scores were correlated (Porofacial functions and increased activity of the muscles of balancing sides during unilateral chewing characterized the altered orofacial motor control in patients with moderate-severe chronic TMD. Implications for rehabilitation are discussed.

  1. Cartilage destruction in rheumatoid arthritis, its association with functional impairments

    Directory of Open Access Journals (Sweden)

    Natalia Vladimirovna Chichasova

    2014-12-01

    Full Text Available The paper discusses the mechanisms of destructive processes in rheumatoid arthritis (RA. At the present stage, in addition to suppress inflammation, the goals of treatment are to prevent cartilage and bone destruction in the affected joints. Prediction of destructive processes in RA plays an important role as the irreversibility of functional changes in RA directly correlates with the degree of joint injury. The paper discusses the mechanisms of articular cartilage and bone destruction and the significance of different biochemical markers for estimating the degree of injury and for predicting further destruction of small hand and foot joints. In RA, the investigators identify not only clinical (activity indicators, but also biological (bone, cartilage, and synovium damage markers predictors for joint injury: CТXII is a marker for cartilage degradation (collagen type II and CTXI is a marker for bone degradation (collagen type I and their trends over 4–12 or more weeks. Although the occurrence of erosions is considered to be a major manifestation of joint destruction progression in RA, the functional activity in its early stages is shown to depend on the estimate of joint space narrowing (cartilage degradation to a greater extent than on that of erosions when evaluating the destruction by the modified Sharp method. Several randomized placebocontrolled studies (RPCSs have assessed the association of patients' functional capacity with joint space narrowing or with the number of erosions. In RA, cartilage degradation has been demonstrated to play a larger role in irreversible function loss than bone destruction.The possibility of suppressing cartilage degradation, which is indicated in RPCSs of the efficacy of adalimumab, correlates with a better functional outcome in patients with RA. Serum markers for cartilage metabolism may be not only predictors for further radiographic progression, but also be used to evaluate therapeutic effectiveness.

  2. Israeli adolescents with ongoing exposure to terrorism: suicidal ideation, posttraumatic stress disorder, and functional impairment.

    Science.gov (United States)

    Chemtob, Claude M; Pat-Horenczyk, Ruth; Madan, Anita; Pitman, Seth R; Wang, Yanping; Doppelt, Osnat; Burns, Kelly Dugan; Abramovitz, Robert; Brom, Daniel

    2011-12-01

    In this study, we examined the relationships among terrorism exposure, functional impairment, suicidal ideation, and probable partial or full posttraumatic stress disorder (PTSD) from exposure to terrorism in adolescents continuously exposed to this threat in Israel. A convenience sample of 2,094 students, aged 12 to 18, was drawn from 10 Israeli secondary schools. In terms of demographic factors, older age was associated with increased risk for suicidal ideation, OR = 1.33, 95% CI [1.09, 1.62], p terrorism was associated with increased risk for each of the measured outcomes including probable partial or full PTSD, functional impairment, and suicidal ideation. When age, gender, level of exposure to terrorism, probable partial or full PTSD, and functional impairment were examined together, only terrorism exposure and functional impairment were associated with suicidal ideation. This study underscores the importance and feasibility of examining exposure to terrorism and functional impairment as risk factors for suicidal ideation. Copyright © 2011 International Society for Traumatic Stress Studies.

  3. Functional impairment of hematopoietic progenitor cells in patients with coronary heart disease.

    Science.gov (United States)

    Liguori, Antonio; Fiorito, Carmela; Balestrieri, Maria Luisa; Crimi, Ettore; Bruzzese, Giuseppe; Williams-Ignarro, Sharon; D'Amora, Maurizio; Sommese, Linda; Grimaldi, Vincenzo; Minucci, Pellegrino Biagio; Giovane, Alfonso; Farzati, Bartolomeo; Ignarro, Louis J; Napoli, Claudio

    2008-03-01

    The circulating form of endothelial progenitors cells (EPCs) are derived from bone marrow (BM)-derived hematopoietic stem cells (HSCs). Enhanced mobilization of EPCs was shown to be linked to cardiac diseases. This study investigated whether reduced EPC levels in advanced coronary heart disease (CHD) are secondary to a functional exhaustion of HSCs in the BM or to reduced mobilization. Number and functional properties of EPCs were assessed in 15 healthy controls, and 40 patients with CHD. The colony-forming unit (CFU) capacity of BM-derived mononuclear cells and the CD34+ HSC number were examined in four healthy volunteers, and 15 CHD patients. EPC number was reduced in CHD patients (P < 0.01 vs. controls). Moreover, the migratory capacity was significantly impaired in EPCs of CHD patients (P < 0.05 vs. controls). On multivariate analysis, CHD was an independent predictor of functional EPC impairment. CFUs were reduced in CHD patients (59.6 +/- 21.2 vs. 75.4 +/- 25.8 in controls, P < 0.05). CHD was also predictor of impaired CFU capacity. In this small clinical study, CHD is associated with selective impairment of HSC function in the BM and in the peripheral blood, which may contribute to impairment of cardiac function.

  4. Specific Language Impairment and Executive Functioning: Parent and Teacher Ratings of Behavior

    Science.gov (United States)

    Wittke, Kacie; Spaulding, Tammie J.; Schechtman, Calli J.

    2013-01-01

    Purpose: The current study used the Behavior Rating Inventory of Executive Function--Preschool Version (BRIEF-P; Gioia, Espy, & Isquith, 2003), a rating scale designed to investigate executive behaviors in everyday activities, to examine the executive functioning of preschool children with specific language impairment (SLI) relative to their…

  5. Predictors of impaired work functioning in employees with major depression in remission

    NARCIS (Netherlands)

    Vries, G. de; Koeter, M.W.; Nieuwenhuijsen, K.; Hees, H.L.; Schene, A.H.

    2015-01-01

    OBJECTIVES: This study aims to (i) assess work functioning in employees returning to work with a major depression in remission, (ii) study the predictors of impaired work functioning. METHODS: Participants diagnosed with major depressive disorder (MDD), on long term sick leave (mean 27 weeks) and

  6. Predictors of impaired work functioning in employees with major depression in remission

    NARCIS (Netherlands)

    Vries, G. de; Koeter, M.W.; Nieuwenhuijsen, K.; Hees, H.L.; Schene, A.H.

    2015-01-01

    OBJECTIVES: This study aims to (i) assess work functioning in employees returning to work with a major depression in remission, (ii) study the predictors of impaired work functioning. METHODS: Participants diagnosed with major depressive disorder (MDD), on long term sick leave (mean 27 weeks) and tr

  7. COURSE AND RISK FACTORS OF FUNCTIONAL IMPAIRMENT IN SUBTHRESHOLD DEPRESSION AND ANXIETY

    NARCIS (Netherlands)

    Karsten, Julie; Penninx, Brenda W. J. H.; Verboom, Charlotte E.; Nolen, Willem A.; Hartman, Catharina A.

    2013-01-01

    Background Although persons with subthreshold depression or anxiety are known to be at risk for full-syndromal disorders, little is known about their functioning over time. In this study, we investigate the functional impairment of persons with subthreshold depression or anxiety over time, compared

  8. Family Functioning, Social Impairment, and Symptoms Among Adolescents with Bipolar Disorder

    Science.gov (United States)

    Keenan-Miller, Danielle; Peris, Tara; Axelson, David; Kowatch, Robert A.; Miklowitz, David J.

    2012-01-01

    Objective: Impaired social functioning is common among youth with bipolar disorder (BD), emerges in multiple settings, and persists over time. However, little is known about factors associated with poor peer and family functioning in the early-onset form of BD. Using a sample of adolescents with BD I or II, we examined which symptoms of BD,…

  9. Physical activity and executive functions in the elderly with mild cognitive impairment

    NARCIS (Netherlands)

    Scherder, EJA; Van Paasschen, J; Deijen, JB; Van der Knokke, S; Orlebeke, JFK; Burgers, [No Value; Devriese, PP; Swaab, DF; Sergeant, JA

    2005-01-01

    The primary goal of the present study was to examine whether in the elderly with mild cognitive impairment (MCI), the effect of physical activity measured directly following treatment, was reflected in an improvement in cognitive functioning in general or in executive functions (EF) in particular. S

  10. Physical activity and executive functions in the elderly with mild cognitive impairment.

    NARCIS (Netherlands)

    Scherder, E.J.A.; Paasschen, J. van; Deijen, J.-B.; Knokke, S. van der; Orlebeke, J.F.K.; Burgers, I.; DeVriesse, P.-P.; Swaab, D.F.; Sergeant, J.A.

    2005-01-01

    The primary goal of the present study was to examine whether in the elderly with mild cognitive impairment (MCI), the effect of physical activity measured directly following treatment, was reflected in an improvement in cognitive functioning in general or in executive functions (EF) in particular. S

  11. The ameliorative effects of exercise on cognitive impairment and white matter injury from blood-brain barrier disruption induced by chronic cerebral hypoperfusion in adolescent rats.

    Science.gov (United States)

    Lee, Jae-Min; Park, Jong-Min; Song, Min Kyung; Oh, Yoo Joung; Kim, Chang-Ju; Kim, Youn-Jung

    2017-01-18

    Vascular dementia is the progressive change in blood vessels that leads to neuronal injuries in vulnerable areas induced by chronic cerebral hypoperfusion (CCH). CCH induces disruption of blood-brain barrier (BBB), and this BBB disruption can initiate the cognitive impairment and white matter injury. In the present study, we evaluated the effect of treadmill exercise on the cognitive impairment, white matter injury, and BBB disruption induced by CCH. Vascular dementia was induced by permanent bilateral common carotid arteries occlusion (BCCAO) in rats. The rats in the exercise group were made to run on a treadmill for 30min once a day for 14 weeks, starting 4 weeks after birth. Our results revealed that treadmill exercise group was alleviated the cognitive impairment and myelin degradation induced by CCH. The disruption of BBB after CCH indicates degradation of occludin, zonula occluden-1 (ZO-1), and up-regulation of matrix metalloproteinases (MMPs). Treadmill exercise may provide protective effects on BBB disruption from degradation of occludin, ZO-1, and overexpression of MMP-9 after CCH. These findings suggest that treadmill exercise ameliorates cognitive impairment and white matter injury from BBB disruption induced by CCH in rats. The present study will be valuable for means of prophylactic and therapeutic intervention for patients with CCH.

  12. Differential Item Functioning Comparisons on a Performance-Based Alternate Assessment for Students with Severe Cognitive Impairments, Autism and Orthopedic Impairments

    Science.gov (United States)

    Laitusis, Cara Cahalan; Maneckshana, Behroz; Monfils, Lora; Ahlgrim-Delzell, Lynn

    2009-01-01

    The purpose of this study was to examine Differential Item Functioning (DIF) by disability groups on an on-demand performance assessment for students with severe cognitive impairments. Researchers examined the presence of DIF for two comparisons. One comparison involved students with severe cognitive impairments who served as the reference group…

  13. Differential Item Functioning Comparisons on a Performance-Based Alternate Assessment for Students with Severe Cognitive Impairments, Autism and Orthopedic Impairments

    Science.gov (United States)

    Laitusis, Cara Cahalan; Maneckshana, Behroz; Monfils, Lora; Ahlgrim-Delzell, Lynn

    2009-01-01

    The purpose of this study was to examine Differential Item Functioning (DIF) by disability groups on an on-demand performance assessment for students with severe cognitive impairments. Researchers examined the presence of DIF for two comparisons. One comparison involved students with severe cognitive impairments who served as the reference group…

  14. Cyclohexanone contamination from extracorporeal circuits impairs cardiovascular function.

    Science.gov (United States)

    Thompson-Torgerson, Caitlin S; Champion, Hunter C; Santhanam, Lakshmi; Harris, Z Leah; Shoukas, Artin A

    2009-06-01

    Extracorporeal circulation provides critical life support in the face of cardiopulmonary or renal failure, but it also introduces a host of unique morbidities characterized by edema formation, cardiac insufficiency, autonomic dysfunction, and altered vasomotor function. We tested the hypothesis that cyclohexanone (CHX), a solvent used in production of extracorporeal circuits and intravenous (IV) bags, leaches into the contained fluids and can replicate these clinical morbidities. Crystalloid fluid samples from circuits and IV bags were analyzed by gas chromatography-mass spectrometry to provide a range of clinical CHX exposure levels, revealing CHX contamination of sampled fluids (9.63-3,694 microg/l). In vivo rat studies were conducted (n = 49) to investigate the effects of a bolus IV infusion of CHX vs. saline alone on cardiovascular function, baroreflex responsiveness, and edema formation. Cardiovascular function was evaluated by cardiac output, heart rate, stroke volume, vascular resistance, arterial pressure, and ventricular contractility. Baroreflex function was assessed by mean femoral arterial pressure responses to bilateral carotid occlusion. Edema formation was assessed by the ratio of wet to dry organ weights for lungs, liver, kidneys, and skin. CHX infusion led to systemic hypotension; pulmonary hypertension; depressed contractility, heart rate, stroke volume, and cardiac output; and elevated vascular resistance (P < 0.05). Mean arterial pressure responsiveness to carotid occlusion was dampened after CHX infusion (from +17.25 +/- 1.8 to +5.61 +/- 3.2 mmHg; P < 0.05). CHX infusion led to significantly higher wet-to-dry weight ratios vs. saline only (3.8 +/- 0.06 vs. 3.5 +/- 0.05; P < 0.05). CHX can reproduce clinical cardiovascular, neurological, and edema morbidities associated with extracorporeal circulatory treatment.

  15. Cerebellar damage impairs internal predictions for sensory and motor function

    OpenAIRE

    Therrien, Amanda S.; Bastian, Amy J.

    2015-01-01

    The cerebellum is connected to cerebral areas that subserve a range of sensory and motor functions. In this review, we summarize new literature demonstrating deficits in visual perception, proprioception, motor control, and motor learning performance following cerebellar damage. In particular, we highlight novel results that together suggest a general role of the cerebellum in estimating and predicting movement dynamics of the body and environmental stimuli. These findings agree with the hypo...

  16. Short stature and functional impairment: a systematic review.

    Science.gov (United States)

    Wheeler, Patricia G; Bresnahan, Karen; Shephard, Barbara A; Lau, Joseph; Balk, Ethan M

    2004-03-01

    To review the available evidence on the association between primary short stature and intellectual and physical dysfunction among children. Systematic searches were performed through October 2001 of English-language studies of children with short stature and functional limitations. Included studies evaluated children with isolated short stature, constitutional growth delay, growth hormone deficiency, or multiple hormone deficiency. Evaluated outcomes included intelligence, academic achievement, visual-motor skills, psychomotor development, and behavior problems. Eleven studies evaluated academic achievement, and 22 evaluated intelligence. No substantial deviation from normal was seen among short children, but many studies found that children with short stature had significantly lower intelligence and academic achievement scores than controls. Three studies found significant visual-motor skill reduction among short children. One study of psychomotor development found a delay in meeting early developmental landmarks among children with Russell-Silver syndrome. Five studies evaluating teacher-rated behavior found that short children had no more behavior problems than controls. While, on average, children with short stature score lower than their peers on functional tests, few short children scored outside the normal range. Furthermore, there is no evidence to explain the cause of any deficits, and limited data suggest that treatment of short stature does not improve children's functional status. Nevertheless, treatment may be warranted in children with severe short stature to alleviate restrictions on activities of daily living. Further research focusing on physical limitations due to short stature is needed to address these issues.

  17. Functional impairment of precerebral arteries in Huntington disease.

    Science.gov (United States)

    Kobal, Jan; Cankar, Ksenija; Pretnar, Janja; Zaletel, Marjan; Kobal, Lucijan; Teran, Natasa; Melik, Ziva

    2017-01-15

    Cardiovascular pathology of Huntington disease (HD) appears to be complex; while microvascular dysfunction seems to appear early, deaths from cardiomyopathy and stroke might occur in the late phase of HD. Our study evaluated global risk factors for coronary heart disease (CHD), structure and function of precerebral arteries in 41 HD subjects and 41 matched controls. HD subjects were divided into groups by the United Huntington disease rating scale (presymptomatic-PHD, early-EHD, midstage-MHD and late-LHD). CHD risk factors assessment and Doppler examination of precerebral arteries were performed, including measurements of the carotid artery intima-media thickness (IMT), and parameters indicating local carotid artery distensibility (stiffness index β, pulse wave velocity, pressure strain elasticity module and carotid artery compliance). In the HD and controls we identified a comparable number of non-obstructive plaques (50% lumen narrowing) were found. There was significantly increased IMT in MHD. In PHD and EHD the parameters of arterial stiffness were significantly higher and the carotid artery compliance was significantly lower. Our results reveal functional vascular pathology in PHD, EHD, and MHD. Precerebral arteries dysfunction in HD therefore appears to be mostly functional and in agreement with recently described autonomic nervous system changes in HD. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Internal resistor of multi-functional tunnel barrier for selectivity and switching uniformity in resistive random access memory.

    Science.gov (United States)

    Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang

    2014-01-01

    In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.

  19. Hydrophobicity of mucosal surface and its relationship to gut barrier function.

    Science.gov (United States)

    Qin, Xiaofa; Caputo, Francis J; Xu, Da-Zhong; Deitch, Edwin A

    2008-03-01

    Loss of the gut barrier has been implicated in the pathogenesis of the multiple organ dysfunction syndrome, and, thus, understanding the intestinal barrier is of potential clinical importance. An important, but relatively neglected, component of the gut barrier is the unstirred mucus layer, which through its hydrophobic and other properties serves as an important barrier to bacterial and other factors within the gut lumen. Thus, the goal of this study was to establish a reproducible method of measuring mucosal hydrophobicity and test the hypothesis that conditions that decrease mucosal hydrophobicity are associated with increased gut permeability. Hydrophobicity was measured in various segments of normal gut by measuring the contact angle of an aqueous droplet placed on the mucosal surface using a commercial goniometer. Second, the effect of the mucolytic agent N-acetyl cysteine on mucosal hydrophobicity and gut permeability was measured, as was the effects of increasing periods of in vivo gut ischemia on these parameters. Gut ischemia was induced by superior mesenteric artery occlusion, and gut permeability was measured by the mucosal-to-serosal passage of fluoresceine isothiocyanate-dextran (4.3 kDa) (FD4) across the everted sacs of ileum. Intestinal mucosal hydrophobicity showed a gradual increase from the duodenum to the end of the ileum and remained at high level in the cecum, colon, and rectum. Both N-acetyl cysteine treatment and ischemia caused a dose-dependent decrease in mucosal hydrophobicity, which significantly correlated increased gut permeability. Mucosal hydrophobicity of the intestine can be reproducibly measured, and decreases in mucosal hydrophobicity closely correlate with increased gut permeability. These results suggest that mucosal hydrophobicity can be a reliable method of measuring the barrier function of the unstirred mucus layer and a useful parameter in evaluating the pathogenesis of gut barrier dysfunction.

  20. Psychiatric disorders in children attending a Nigerian primary care unit: functional impairment and risk factors

    Directory of Open Access Journals (Sweden)

    Tunde-Ayinmode Mosunmola

    2012-07-01

    Full Text Available Abstract Background There is dearth of data on the level of functional impairment and risk factors for psychiatric morbidity in children attending primary care services in developing countries like Nigeria. The risk factors for psychiatric morbidity and functional impairment in children attending the primary care unit of a teaching hospital in Ilorin, Nigeria was therefore investigated to obtain data that could be used in improving service provision by primary care physicians. Methods A cross-sectional two-stage design was employed for the study. The first stage involved administration of the Child Behavior Questionnaire (CBQ to 350 children while the children’s version of the schedule for affective disorders and schizophrenia was used for the second stage involving 157 children, all high scorers on CBQ (score of ≥ 7 and 30% of low scorers (score  In addition, the Children Global Assessment Scale was used to assess the functional status of the children (score of ≤ 70 indicates functional impairment while the mothers’ mental health status was assessed with the 12-item version of the General Health Questionnaire, a score of 3 or more on this instrument indicate presence of mental morbidity. Results It was observed that 11.4% of the children had diagnosable psychiatric disorders and 7.1% were functionally impaired; and those with psychiatric disorders were more functionally impaired than those without. Thus, significant negative correlation was noted between CBQ scores and CGAS (r = 0.53; p  Conclusions Child psychiatric disorders are prevalent in the primary care unit studied. Many of the risk factors identified in the study population are modifiable. Collaborative efforts between psychiatrists and primary care physicians could therefore help to reduce level of risk and functional impairment and psychiatric morbidity among children attending the primary care unit studied. It could also help improve referral rates of

  1. Functional impairments as symptoms in the symptom cluster analysis of patients newly diagnosed with advanced cancer.

    Science.gov (United States)

    Fodeh, Samah J; Lazenby, Mark; Bai, Mei; Ercolano, Elizabeth; Murphy, Terrence; McCorkle, Ruth

    2013-10-01

    Symptoms and subsequent functional impairment have been associated with the biological processes of disease, including the interaction between disease and treatment in a measurement model of symptoms. However, hitherto cluster analysis has primarily focused on symptoms. This study among patients within 100 days of diagnosis with advanced cancer explored whether self-reported physical symptoms and functional impairments formed clusters at the time of diagnosis. We applied cluster analysis to self-reported symptoms and activities of daily living of 111 patients newly diagnosed with advanced gastrointestinal (GI), gynecological, head and neck, and lung cancers. Based on content expert evaluations, the best techniques and variables were identified, yielding the best solution. The best cluster solution used a K-means algorithm and cosine similarity and yielded five clusters of physical as well as emotional symptoms and functional impairments. Cancer site formed the predominant organizing principle of composition for each cluster. The top five symptoms and functional impairments in each cluster were Cluster 1 (GI): outlook, insomnia, appearance, concentration, and eating/feeding; Cluster 2 (GI): appetite, bowel, insomnia, eating/feeding, and appearance; Cluster 3 (gynecological): nausea, insomnia, eating/feeding, concentration, and pain; Cluster 4 (head and neck): dressing, eating/feeding, bathing, toileting, and walking; and Cluster 5 (lung): cough, walking, eating/feeding, breathing, and insomnia. Functional impairments in patients newly diagnosed with late-stage cancers behave as symptoms during the diagnostic phase. Health care providers need to expand their assessments to include both symptoms and functional impairments. Early recognition of functional changes may accelerate diagnosis at an earlier cancer stage. Copyright © 2013 U.S. Cancer Pain Relief Committee. Published by Elsevier Inc. All rights reserved.

  2. 神经酰胺与皮肤屏障%Ceramide and Skin Barrier Function

    Institute of Scientific and Technical Information of China (English)

    吴金燕; 蒋献

    2011-01-01

    Ceramide is one of the lipids in human stratum corneum. The alteration of the ceramide will lead to the change of the lipids, and then the destruction of skin barrier function happens. It plays an important role in the proliferation, differentiation and apoptosis of keratinocytes. Many dermatogic diseases can destroy skin barrier function, and the destruction of barrier function will also result in skin diseases or aggravate the diseases. In a word, increasing attentions are paid to the ceramide's function in the skin.%神经酰胺是人体角质层脂质的主要成分,在皮肤的合成和分布有一定的规律.其质和量的变化可以导致脂质结构的改变,从而影响皮肤屏障功能.不同亚型神经酰胺作用不同,在角质形成细胞增殖、分化及凋亡中起重要作用,是皮肤屏障损伤修复后期重要的效应物质.许多皮肤病可导致角质层屏障功能的破坏,而屏障功能的破坏又是一些皮肤病的病因或加重因素.故神经酰胺在皮肤中的作用越来越受重视.

  3. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2016-05-01

    Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

  4. Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.

    Science.gov (United States)

    Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard

    2016-01-01

    Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.

  5. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling.

    Science.gov (United States)

    Wang, Kai; Jin, Xiaolu; Chen, Yifan; Song, Zehe; Jiang, Xiasen; Hu, Fuliang; Conlon, Michael A; Topping, David L

    2016-05-07

    Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE) on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ) loci occludin and zona occludens (ZO)-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet) exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

  6. Myeloperoxidase impairs the contractile function in isolated human cardiomyocytes.

    Science.gov (United States)

    Kalász, Judit; Pásztor, Enikő T; Fagyas, Miklós; Balogh, Ágnes; Tóth, Attila; Csató, Viktória; Édes, István; Papp, Zoltán; Borbély, Attila

    2015-07-01

    We set out to characterize the mechanical effects of myeloperoxidase (MPO) in isolated left-ventricular human cardiomyocytes. Oxidative myofilament protein modifications (sulfhydryl (SH)-group oxidation and carbonylation) induced by the peroxidase and chlorinating activities of MPO were additionally identified. The specificity of the MPO-evoked functional alterations was tested with an MPO inhibitor (MPO-I) and the antioxidant amino acid Met. The combined application of MPO and its substrate, hydrogen peroxide (H2O2), largely reduced the active force (Factive), increased the passive force (Fpassive), and decreased the Ca(2+) sensitivity of force production (pCa50) in permeabilized cardiomyocytes. H2O2 alone had significantly smaller effects on Factive and Fpassive and did not alter pCa50. The MPO-I blocked both the peroxidase and the chlorinating activities, whereas Met selectively inhibited the chlorinating activity of MPO. All of the MPO-induced functional effects could be prevented by the MPO-I and Met. Both H2O2 alone and MPO + H2O2 reduced the SH content of actin and increased the carbonylation of actin and myosin-binding protein C to the same extent. Neither the SH oxidation nor the carbonylation of the giant sarcomeric protein titin was affected by these treatments. MPO activation induces a cardiomyocyte dysfunction by affecting Ca(2+)-regulated active and Ca(2+)-independent passive force production and myofilament Ca(2+) sensitivity, independent of protein SH oxidation and carbonylation. The MPO-induced deleterious functional alterations can be prevented by the MPO-I and Met. Inhibition of MPO may be a promising therapeutic target to limit myocardial contractile dysfunction during inflammation.

  7. Testing a Model of Functional Impairment in Telephone Crisis Support Workers.

    Science.gov (United States)

    Kitchingman, Taneile A; Wilson, Coralie J; Caputi, Peter; Wilson, Ian; Woodward, Alan

    2016-11-21

    It is well known that helping professionals experience functional impairment related to elevated symptoms of psychological distress as a result of frequent empathic engagement with distressed others. Whether telephone crisis support workers are impacted in a similar way is not currently reported in the literature. The purpose of this study was to test a hypothesized model of factors contributing to functional impairment in telephone crisis support workers. A national sample of 210 telephone crisis support workers completed an online survey including measures of emotion regulation, symptoms of general psychological distress and suicidal ideation, intentions to seek help for symptoms, and functional impairment. Structural equation modeling was used to test the fit of the data to the hypothesized model. Goodness-of-fit indices were adequate and supported the interactive effects of emotion regulation, general psychological distress, suicidal ideation, and intentions to seek help for ideation on functional impairment. These results warrant the deliberate management of telephone crisis support workers' impairment through service selection, training, supervision, and professional development strategies. Future research replicating and extending this model will further inform the modification and/or development of strategies to optimize telephone crisis support workers' well-being and delivery of support to callers.

  8. Impaired Functional Connectivity in the Prefrontal Cortex: A Mechanism for Chronic Stress-Induced Neuropsychiatric Disorders

    Science.gov (United States)

    Negrón-Oyarzo, Ignacio; Aboitiz, Francisco; Fuentealba, Pablo

    2016-01-01

    Chronic stress-related psychiatric diseases, such as major depression, posttraumatic stress disorder, and schizophrenia, are characterized by a maladaptive organization of behavioral responses that strongly affect the well-being of patients. Current evidence suggests that a functional impairment of the prefrontal cortex (PFC) is implicated in the pathophysiology of these diseases. Therefore, chronic stress may impair PFC functions required for the adaptive orchestration of behavioral responses. In the present review, we integrate evidence obtained from cognitive neuroscience with neurophysiological research with animal models, to put forward a hypothesis that addresses stress-induced behavioral dysfunctions observed in stress-related neuropsychiatric disorders. We propose that chronic stress impairs mechanisms involved in neuronal functional connectivity in the PFC that are required for the formation of adaptive representations for the execution of adaptive behavioral responses. These considerations could be particularly relevant for understanding the pathophysiology of chronic stress-related neuropsychiatric disorders. PMID:26904302

  9. Impaired Functional Connectivity in the Prefrontal Cortex: A Mechanism for Chronic Stress-Induced Neuropsychiatric Disorders

    Directory of Open Access Journals (Sweden)

    Ignacio Negrón-Oyarzo

    2016-01-01

    Full Text Available Chronic stress-related psychiatric diseases, such as major depression, posttraumatic stress disorder, and schizophrenia, are characterized by a maladaptive organization of behavioral responses that strongly affect the well-being of patients. Current evidence suggests that a functional impairment of the prefrontal cortex (PFC is implicated in the pathophysiology of these diseases. Therefore, chronic stress may impair PFC functions required for the adaptive orchestration of behavioral responses. In the present review, we integrate evidence obtained from cognitive neuroscience with neurophysiological research with animal models, to put forward a hypothesis that addresses stress-induced behavioral dysfunctions observed in stress-related neuropsychiatric disorders. We propose that chronic stress impairs mechanisms involved in neuronal functional connectivity in the PFC that are required for the formation of adaptive representations for the execution of adaptive behavioral responses. These considerations could be particularly relevant for understanding the pathophysiology of chronic stress-related neuropsychiatric disorders.

  10. Distinct patterns of brain function in children with isolated spelling impairment: new insights.

    Science.gov (United States)

    Gebauer, Daniela; Enzinger, Christian; Kronbichler, Martin; Schurz, Matthias; Reishofer, Gernot; Koschutnig, Karl; Kargl, Reinhard; Purgstaller, Christian; Fazekas, Franz; Fink, Andreas

    2012-06-01

    Studies investigating reading and spelling difficulties heavily focused on the neural correlates of reading impairments, whereas spelling impairments have been largely neglected so far. Hence, the aim of the present study was to investigate brain structure and function of children with isolated spelling difficulties. Therefore, 31 children, aged ten to 15 years, were investigated by means of functional MRI and DTI. This study revealed that children with isolated spelling impairment exhibit a stronger right hemispheric activation compared to children with reading and spelling difficulties and controls, when engaged in an orthographic decision task, presumably reflecting a highly efficient serial grapheme-phoneme decoding compensation strategy. In addition, children with spelling impairment activated bilateral inferior and middle frontal gyri during processing correctly spelled words and misspelled words, whereas the other two groups showed bilateral activation only in the misspelled condition, suggesting that additional right frontal engagement could be related to generally higher task demand and effort. DTI analyses revealed stronger frontal white matter integrity (fractional anisotropy) in controls (compared to spelling and reading impaired children), whereas no structural differences between controls and spelling impaired children were observed. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Pain and functional impairment 6 years after inguinal herniorrhaphy

    DEFF Research Database (Denmark)

    Aasvang, Eske Kvanner; Bay-Nielsen, Morten; Kehlet, Henrik

    2006-01-01

    To determine the incidence of pain related sexual dysfunction 1 year after inguinal herniorrhaphy and to assess the impact pain has on sexual function. In contrast to the well-described about 10% risk of chronic wound related pain after inguinal herniorrhaphy, chronic genital pain, dysejaculation...... and subsequent sexual dysfunction represent a clinically significant problem in about 3% of younger male patients with a previous inguinal herniorrhaphy. Intraoperative nerve damage and disposition to other chronic pain conditions are among the most likely pathogenic factors.......To determine the incidence of pain related sexual dysfunction 1 year after inguinal herniorrhaphy and to assess the impact pain has on sexual function. In contrast to the well-described about 10% risk of chronic wound related pain after inguinal herniorrhaphy, chronic genital pain, dysejaculation......, and sexual dysfunction have only been described sporadically. The aim was therefore to describe these symptoms in a questionnaire study. A nationwide detailed questionnaire study in September 2004 of pain related sexual dysfunction in all men aged 18-40 years undergoing inguinal herniorrhaphy between October...

  12. Impaired mitochondrial function in human placenta with increased maternal adiposity.

    Science.gov (United States)

    Mele, James; Muralimanoharan, Sribalasubashini; Maloyan, Alina; Myatt, Leslie

    2014-09-01

    The placenta plays a key role in regulation of fetal growth and development and in mediating in utero developmental programming. Obesity, which is associated with chronic inflammation and mitochondrial dysfunction in many tissues, exerts a programming effect in pregnancy. We determined the effect of increasing maternal adiposity and of fetal sex on placental ATP generation, mitochondrial biogenesis, expression of electron transport chain subunits, and mitochondrial function in isolated trophoblasts. Placental tissue was collected from women with prepregnancy BMI ranging from 18.5 to 45 following C-section at term with no labor. Increasing maternal adiposity was associated with excessive production of reactive oxygen species and a significant reduction in placental ATP levels in placentae with male and female fetuses. To explore the potential mechanism of placental mitochondrial dysfunction, levels of transcription factors regulating the expression of genes involved in electron transport and mitochondrial biogenesis were measured. Our in vitro studies showed significant reduction in mitochondrial respiration in cultured primary trophoblasts with increasing maternal obesity along with an abnormal metabolic flexibility of these cells. This reduction in placental mitochondrial respiration in pregnancies complicated by maternal obesity could compromise placental function and potentially underlie the increased susceptibility of these pregnancies to fetal demise in late gestation and to developmental programming.

  13. Severe traumatic hemorrhagic shock induces compromised immune barrier function of the mesenteric lymph node leading to an increase in intestinal bacterial translocation.

    Science.gov (United States)

    Zhang, Jian; Zhang, Yun; Xu, Tao; Pan, Sheng-Jing; Nie, Gang; Miao, Xiao-Yan; Qiu, Jun-Yu; Yu, Wen-Qiao; Zhang, Shao-Yang; Liang, Ting-Bo

    2017-01-01

    Critically ill patients have increased susceptibility to translocation of gut bacteria. However, the mechanisms are complicated and remain unclear, and the aim of this study was to explore these mechanisms. Rats exposed to different levels of shock were orally administrated with bioluminescent Citrobacter. We found that severe shock caused an increase in bacterial translocation to the visceral organs, such as liver, spleen and blood, compared with mild shock. Surprisingly, bacterial translocation to mesenteric lymph node (MLN) was unchanged between the two shock groups. Various methods, including flow cytometry, a co-culture model and western blots, were used to evaluate MLN-associated immune function. Specifically, we focused on mesenteric lymph node dendritic cells (MLN-DCs), the critical antigen presenting cells involved in the construction of the immune barrier in MLN. We also found that severe shock impaired the phenotypic maturation of MLN-DCs and induced a tolerogenic phenotype. Furthermore, co-culture assays of DCs with naive CD4(+) T cells showed that DCs subject to severe shock were more inclined to polarize native CD4(+) T cells into Th2 and Treg cells. This study successfully reproduced the clinical phenomenon of severe shock resulting in increased bacterial translocation to extraintestinal tissues, and this may be related to the compromised immune barrier function of MLN, as maturation and function of MLN-DC's were badly impaired.

  14. Obsessive-compulsive disorder is associated with broad impairments in executive function: A meta-analysis

    Science.gov (United States)

    Snyder, Hannah R.; Kaiser, Roselinde H.; Warren, Stacie L.; Heller, Wendy

    2014-01-01

    Obsessive-compulsive disorder (OCD) is a serious and often chronically disabling condition. The current dominant model of OCD focuses on abnormalities in prefrontal-striatal circuits that support executive function (EF). While there is growing evidence for EF impairments associated with OCD, results have been inconsistent, making the nature and magnitude of these impairments controversial. The current meta-analysis uses random-effects models to synthesize 110 previous studies that compared participants with OCD to healthy control participants on at least one neuropsychological measure of EF. The results indicate that individuals with OCD are impaired on tasks measuring most aspects of EF, consistent with broad impairment in EF. EF deficits were not explained by general motor slowness or depression. Effect sizes were largely stable across variation in demographic and clinical characteristics of samples, although medication use, age, and gender moderated some effects. PMID:25755918

  15. Vibration control for a rigid-flexible manipulator with full state constraints via Barrier Lyapunov Function

    Science.gov (United States)

    Cao, Fangfei; Liu, Jinkun

    2017-10-01

    Considering full state constraints, this paper designs a boundary controller for a two-link rigid-flexible manipulator via Barrier Lyapunov Function. The dynamic model of the two-link rigid-flexible manipulator is described by coupled ordinary differential equations- partial differential equations (ODEs-PDEs). Based on the original model without neglecting the high-frequency modes, boundary controller is proposed to regulate the joint positions and eliminate the elastic vibration simultaneously. To ensure that the full state constraints which include position, speed and vibration constraints are not transgressed, a Barrier Lyapunov Function is employed in the proposed controller. The asymptotic stability of the closed-loop system is rigorously proved by the LaSalle's Invariance Principle. Simulations are given to verify the effectiveness of the proposed controller with state constraints.

  16. Mutant Parkin impairs mitochondrial function and morphology in human fibroblasts.

    Directory of Open Access Journals (Sweden)

    Anne Grünewald

    Full Text Available BACKGROUND: Mutations in Parkin are the most common cause of autosomal recessive Parkinson disease (PD. The mitochondrially localized E3 ubiquitin-protein ligase Parkin has been reported to be involved in respiratory chain function and mitochondrial dynamics. More recent publications also described a link between Parkin and mitophagy. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we investigated the impact of Parkin mutations on mitochondrial function and morphology in a human cellular model. Fibroblasts were obtained from three members of an Italian PD family with two mutations in Parkin (homozygous c.1072delT, homozygous delEx7, compound-heterozygous c.1072delT/delEx7, as well as from two relatives without mutations. Furthermore, three unrelated compound-heterozygous patients (delEx3-4/duplEx7-12, delEx4/c.924C>T and delEx1/c.924C>T and three unrelated age-matched controls were included. Fibroblasts were cultured under basal or paraquat-induced oxidative stress conditions. ATP synthesis rates and cellular levels were detected luminometrically. Activities of complexes I-IV and citrate synthase were measured spectrophotometrically in mitochondrial preparations or cell lysates. The mitochondrial membrane potential was measured with 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide. Oxidative stress levels were investigated with the OxyBlot technique. The mitochondrial network was investigated immunocytochemically and the degree of branching was determined with image processing methods. We observed a decrease in the production and overall concentration of ATP coinciding with increased mitochondrial mass in Parkin-mutant fibroblasts. After an oxidative insult, the membrane potential decreased in patient cells but not in controls. We further determined higher levels of oxidized proteins in the mutants both under basal and stress conditions. The degree of mitochondrial network branching was comparable in mutants and

  17. Acidic bile salts modulate the squamous epithelial barrier function by modulating tight junction proteins.

    Science.gov (United States)

    Chen, Xin; Oshima, Tadayuki; Tomita, Toshihiko; Fukui, Hirokazu; Watari, Jiro; Matsumoto, Takayuki; Miwa, Hiroto

    2011-08-01

    Experimental models for esophageal epithelium in vitro either suffer from poor differentiation or complicated culture systems. An air-liquid interface system with normal human bronchial epithelial cells can serve as a model of esophageal-like squamous epithelial cell layers. Here, we explore the influence of bile acids on barrier function and tight junction (TJ) proteins. The cells were treated with taurocholic acid (TCA), glycocholic acid (GCA), or deoxycholic acid (DCA) at different pH values, or with pepsin. Barrier function was measured by transepithelial electrical resistance (TEER) and the diffusion of paracellular tracers (permeability). The expression of TJ proteins, including claudin-1 and claudin-4, was examined by Western blotting of 1% Nonidet P-40-soluble and -insoluble fractions. TCA and GCA dose-dependently decreased TEER and increased paracellular permeability at pH 3 after 1 h. TCA (4 mM) or GCA (4 mM) did not change TEER and permeability at pH 7.4 or pH 4. The combination of TCA and GCA at pH 3 significantly decreased TEER and increased permeability at lower concentrations (2 mM). Pepsin (4 mg/ml, pH 3) did not have any effect on barrier function. DCA significantly decreased the TEER and increased permeability at pH 6, a weakly acidic condition. TCA (4 mM) and GCA (4 mM) significantly decreased the insoluble fractions of claudin-1 and claudin-4 at pH 3. In conclusion, acidic bile salts disrupted the squamous epithelial barrier function partly by modulating the amounts of claudin-1 and claudin-4. These results provide new insights for understanding the role of TJ proteins in esophagitis.

  18. Wigner function studies of spin transport in dilute magnetic semiconductor barrier structures

    Science.gov (United States)

    Grubin, Harold L.

    2004-12-01

    The spin dependent Wigner function is implemented to obtain the IV characteristics of a double barrier resonant tunneling diode with DMS layers. The structure distinguishes between spin-up and spin-down carriers, each of which experiences resonance at different magnetic field dependent bias levels. The results demonstrate the magnetic field dependence of the IV characteristics and illustrate the magnetic field dependence of relative spin-up and spin-down carriers.

  19. Functional impairment, disability, and frailty in adults aging with HIV-infection.

    Science.gov (United States)

    Erlandson, Kristine M; Schrack, Jennifer A; Jankowski, Catherine M; Brown, Todd T; Campbell, Thomas B

    2014-09-01

    The integration of antiretroviral therapy (i.e., ART) into HIV care has dramatically extended the life expectancy of those living with HIV. However, in comparison to similar HIV-uninfected populations, HIV-infected persons experience an excess of morbidity and mortality with an early onset of aging complications including neurocognitive decline, osteoporosis, impaired physical function, frailty, and falls. Recent consensus guidelines encourage clinicians and researchers to consider functional impairment of HIV-infected adults as a measure to understand the impact of aging across a range of abilities. Despite the importance of assessing function in persons aging with HIV infection, a lack of consistent terminology and standardization of assessment tools has limited the application of functional assessments in clinical or research settings. Herein, we distinguish between different approaches used to assess function, describe what is known about function in the aging HIV population, and consider directions for future research.

  20. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  1. Body image in adult women: Associations with health behaviors, quality of life, and functional impairment.

    Science.gov (United States)

    Becker, Carolyn B; Verzijl, Christina L; Kilpela, Lisa S; Wilfred, Salome A; Stewart, Tiffany

    2017-05-01

    This study examined body image in adult women along with probable correlates including health behaviors, negative affect, quality of life, and functional impairment. Adult women ( N = 738, age = 25-86 years) completed an online survey assessing these domains. Women across all ages reported similar body image concerns. Negative body image significantly correlated with poorer wellness behaviors, negative affect, quality of life, and functional impairment. The inverse held for positive body image. The majority of correlations remained even when controlling for negative affect. Further research is warranted to investigate nature of the correlational relationships identified in this study.

  2. Impaired renal allograft function is associated with increased arterial stiffness in renal transplant recipients

    DEFF Research Database (Denmark)

    Kneifel, M; Scholze, A; Burkert, A;

    2006-01-01

    It is important whether impairment of renal allograft function may deteriorate arterial stiffness in renal transplant recipients. In a cross-sectional study, arterial vascular characteristics were non-invasively determined in 48 patients with renal allograft using applanation tonometry and digital...... of large arteries S1 and small arteries S2 in renal transplant recipients (each p renal allograft (p ...-Wallis test between groups). It is concluded that impairment of renal allograft function is associated with an increased arterial stiffness in renal transplant recipients....

  3. AKAP9, a Regulator of Microtubule Dynamics, Contributes to Blood-Testis Barrier Function.

    Science.gov (United States)

    Venkatesh, Deepak; Mruk, Dolores; Herter, Jan M; Cullere, Xavier; Chojnacka, Katarzyna; Cheng, C Yan; Mayadas, Tanya N

    2016-02-01

    The blood-testis barrier (BTB), formed between adjacent Sertoli cells, undergoes extensive remodeling to facilitate the transport of preleptotene spermatocytes across the barrier from the basal to apical compartments of the seminiferous tubules for further development and maturation into spermatozoa. The actin cytoskeleton serves unique structural and supporting roles in this process, but little is known about the role of microtubules and their regulators during BTB restructuring. The large isoform of the cAMP-responsive scaffold protein AKAP9 regulates microtubule dynamics and nucleation at the Golgi. We found that conditional deletion of Akap9 in mice after the initial formation of the BTB at puberty leads to infertility. Akap9 deletion results in marked alterations in the organization of microtubules in Sertoli cells and a loss of barrier integrity despite a relatively intact, albeit more apically localized F-actin and BTB tight junctional proteins. These changes are accompanied by a loss of haploid spermatids due to impeded meiosis. The barrier, however, progressively reseals in older Akap9 null mice, which correlates with a reduction in germ cell apoptosis and a greater incidence of meiosis. However, spermiogenesis remains defective, suggesting additional roles for AKAP9 in this process. Together, our data suggest that AKAP9 and, by inference, the regulation of the microtubule network are critical for BTB function and subsequent germ cell development during spermatogenesis.

  4. [Barriers and challenges of the functional healthcare risk management units in hospitals of Madrid health service].

    Science.gov (United States)

    Pardo-Hernández, A; Navarro-Royo, C; Arguedas-Sanz, R; Albeniz-Lizarraga, C; Morón-Merchante, J

    2014-01-01

    To identify the barriers and challenges for the effective development of risk management units in hospitals of the Madrid Health Service. Descriptive cross-sectional study aimed at the management teams and members of the functional units of 31 hospitals in the Madrid Health Service. A self-administered questionnaire requesting answers in free text was used, identifying up to five barriers and challenges, and their prioritization by awarding from 1-5 points according to their importance. A discourse analysis was then conducted, grouping common themes and sorting them according to their score. The overall response rate was 94%. The most frequently identified barriers were lack of time (21%), inadequate safety culture (13%), lack of publication of their activities (10%), and lack of training (10%). The most important challenge was developing the training (18%), followed by improving the culture (17%), communication of safety activities (11%), and achieve leadership from the managers of the services (11%). According to the study conditions, the main identified barrier identified was the lack of available time, and the principal challenge found was promoting a proactive learning culture. Copyright © 2013 SECA. Published by Elsevier Espana. All rights reserved.

  5. Psychological Stress-Derived Prolactin Modulates Occludin Expression in Vaginal Epithelial Cells to Compromise Barrier Function

    Directory of Open Access Journals (Sweden)

    Xueyan Li

    2015-08-01

    Full Text Available Background/Aims: The causative factors of the vaginitis are not fully understood yet. Epithelial barrier dysfunction plays a critical role in the pathogenesis of vaginitis. This study aims to investigate the role of prolactin (PRL in the causing the vaginal epithelial barrier dysfunction. Methods: Adult rats were treated with water-avoid-stress. The serum levels of PRL were determined by ELISA. T84 cell (T84 cells; a vaginal epithelial cell line monolayers were prepared to be used assessing the epithelial barrier functions. The expression of occludin in T84 cells was assessed by Chromatin immunoprecipitation assay, methylation specifIc PCR, real time quantitative RT-PCR and Western blotting. Results: The results showed that psychological stress markedly increased the serum levels of PRL in the rat vaginal epithelia. Exposure of T84 cells to PRL in the culture markedly increased the phosphorylation of STAT3 and suppressed the expression of occludin in the cells; the transepithelial electric resistance was decreased and the permeability to a macromolecular tracer was increased in the T84 monolayers, which was mimicked by blocking STAT3, or abolished by over expression of occludin in the epithelial cells. Conclusions: Psychological stress-derived PRL induces vaginal epithelial barrier dysfunction by inhibiting the expression of occludin.

  6. Investigating the barrier function of skin lipid models with varying compositions.

    Science.gov (United States)

    Groen, Daniël; Poole, Dana S; Gooris, Gert S; Bouwstra, Joke A

    2011-10-01

    The lipids in the uppermost layer of the skin, the stratum corneum (SC), play an important role in the barrier function. The main lipid classes in stratum corneum are ceramides, cholesterol, and free fatty acids. In previous publications, a lipid model was presented, referred to as the stratum corneum substitute (SCS), that closely mimics the SC lipid organization and SC barrier function. In the present study, we use the SCS to study the effect of changes in lipid organization on the lipid barrier function using benzoic acid as permeation compound. First, in the SCS, we increased the level of one of the three major lipid classes keeping the ratio between the other lipid classes constant. An increased cholesterol level resulted in an increase in phase-separated cholesterol and a reduction in the permeability. An increase in ceramide or free fatty acid level resulted in the formation of additional phases, but had no significant influence on the permeability. We also examined models that mimic selected changes in lipid composition reported for dry or diseased skin. The SCS that mimics the composition in recessive X-linked ichthyosis skin displayed a twofold increase in permeability. This increase is possibly related to the formation of an additional, less ordered phase in this model. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Kinetin Improves Barrier Function of the Skin by Modulating Keratinocyte Differentiation Markers

    Science.gov (United States)

    An, Sungkwan; Cha, Hwa Jun; Ko, Jung-Min; Han, Hyunjoo; Kim, Su Young; Kim, Kyung-Suk; Lee, Song Jeong; An, In-Sook; Kim, Sangwon; Youn, Hae Jeong

    2017-01-01

    Background Kinetin is a plant hormone that regulates growth and differentiation. Keratinocytes, the basic building blocks of the epidermis, function in maintaining the skin barrier. Objective We examined whether kinetin induces skin barrier functions in vitro and in vivo. Methods To evaluate the efficacy of kinetin at the cellular level, expression of keratinocyte differentiation markers was assessed. Moreover, we examined the clinical efficacy of kinetin by evaluating skin moisture, transepidermal water loss (TEWL), and skin surface roughness in patients who used kinetin-containing cream. We performed quantitative real-time polymerase chain reaction to measure the expression of keratinocyte differentiation markers in HaCaT cells following treatment. A clinical trial was performed to assess skin moisture, TEWL, and evenness of skin texture in subjects who used kinetin-containing cream for 4 weeks. Results Kinetin increased involucrin, and keratin 1 mRNA in HaCaT cells. Moreover, use of a kinetin-containing cream improved skin moisture and TEWL while decreasing roughness of skin texture. Conclusion Kinetin induced the expression of keratinocyte differentiation markers, suggesting that it may affect differentiation to improve skin moisture content, TEWL, and other signs of skin aging. Therefore, kinetin is a potential new component for use in cosmetics as an anti-aging agent that improves the barrier function of skin. PMID:28223740

  8. Checkpoint Kinase 1 Activation Enhances Intestinal Epithelial Barrier Function via Regulation of Claudin-5 Expression.

    Directory of Open Access Journals (Sweden)

    Akihiro Watari

    Full Text Available Several stressors are known to influence epithelial tight junction (TJ integrity, but the association between DNA damage and TJ integrity remains unclear. Here we examined the effects of daunorubicin and rebeccamycin, two anti-tumor chemicals that induce DNA damage, on TJ integrity in human intestinal epithelial cells. Daunorubicin and rebeccamycin dose-dependently enhanced transepithelial electrical resistance (TER and decreased flux of the 4 kDa FITC-dextran in Caco-2 cell monolayer. Daunorubicin- or rebeccamycin-induced enhancement of the TJ barrier function partly rescued attenuation of the barrier function by the inflammatory cytokines TNF-α and IFN-γ. Daunorubicin and rebeccamycin increased claudin-5 expression and the product was distributed in the actin cytoskeleton fraction, which was enriched with TJ proteins. Caffeine, which is an inhibitor of ataxia telangiectasia mutated protein (ATM and ataxia telangiectasia mutated and Rad3-related protein (ATR, and the Chk1 inhibitor inhibited the TER increases induced by daunorubicin and rebeccamycin, whereas a Chk2 inhibitor did not. Treatment with Chk1 siRNA also significantly inhibited the TER increases. Induction of claudin-5 expression was inhibited by Chk1 inhibitor and by siRNA treatment. Our results suggest that Chk1 activation by daunorubicin and rebeccamycin induced claudin-5 expression and enhanced TJ barrier function in Caco-2 cell monolayer, which suggests a link between DNA damage and TJ integrity in the human intestine.

  9. Checkpoint Kinase 1 Activation Enhances Intestinal Epithelial Barrier Function via Regulation of Claudin-5 Expression.

    Science.gov (United States)

    Watari, Akihiro; Hasegawa, Maki; Yagi, Kiyohito; Kondoh, Masuo

    2016-01-01

    Several stressors are known to influence epithelial tight junction (TJ) integrity, but the association between DNA damage and TJ integrity remains unclear. Here we examined the effects of daunorubicin and rebeccamycin, two anti-tumor chemicals that induce DNA damage, on TJ integrity in human intestinal epithelial cells. Daunorubicin and rebeccamycin dose-dependently enhanced transepithelial electrical resistance (TER) and decreased flux of the 4 kDa FITC-dextran in Caco-2 cell monolayer. Daunorubicin- or rebeccamycin-induced enhancement of the TJ barrier function partly rescued attenuation of the barrier function by the inflammatory cytokines TNF-α and IFN-γ. Daunorubicin and rebeccamycin increased claudin-5 expression and the product was distributed in the actin cytoskeleton fraction, which was enriched with TJ proteins. Caffeine, which is an inhibitor of ataxia telangiectasia mutated protein (ATM) and ataxia telangiectasia mutated and Rad3-related protein (ATR), and the Chk1 inhibitor inhibited the TER increases induced by daunorubicin and rebeccamycin, whereas a Chk2 inhibitor did not. Treatment with Chk1 siRNA also significantly inhibited the TER increases. Induction of claudin-5 expression was inhibited by Chk1 inhibitor and by siRNA treatment. Our results suggest that Chk1 activation by daunorubicin and rebeccamycin induced claudin-5 expression and enhanced TJ barrier function in Caco-2 cell monolayer, which suggests a link between DNA damage and TJ integrity in the human intestine.

  10. Increased intestinal barrier function in the small intestine of formula-fed neonatal piglets.

    Science.gov (United States)

    Huygelen, V; De Vos, M; Willemen, S; Tambuyzer, B; Casteleyn, C; Knapen, D; Van Cruchten, S; Van Ginneken, C

    2012-12-01

    Within-litter birth weight variation is adversely correlated to piglet survival and postnatal growth. A less efficient epithelial barrier function in light piglets may partly explain this inverse relationship between birth weight and zootechnical performance. A compromised epithelial barrier increases paracellular permeability; consequently, toxins, allergenic compounds, or bacteria may enter systemic circulation and induce inflammatory responses. Dietary effects on function of gut epithelium of piglet are largely unknown. This study investigated epithelial barrier function of the small intestine of normal birth weight (NBW) piglets (1.46 ± 0.10 kg) and low birth weight (LBW) piglets (excretion was measured using enzymatic spectrophotometry. Irrespective of birth weight, lactulose levels of FOR10 (4.4 ± 2.3 mmol/L) tended to be lower (P = 0.07) than SOW10 (26.4 ± 10.2 mmol/L) indicating a reduced paracellular intestinal permeability in FOR10. This reduction was associated with a 6-fold elevated (P < 0.01) protein expression of occludin, an important tight junction protein, in FOR10 compared to SOW10. Mannitol levels in FOR10 (31.0 ± 18.2 mmol/L) did not differ (P = 0.28) from SOW10 (61.1 ± 10.2 mmol/L). However, shorter villi (P < 0.01) in FOR10 indicated a reduced absorptive capacity. In conclusion, formula feeding caused minor symptoms of gastrointestinal dysfunction compared to sow-fed piglets irrespective of their birth weight.

  11. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2016-12-21

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds.

  12. Impaired Arterial Smooth Muscle Cell Vasodilatory Function In Methamphetamine Users

    Directory of Open Access Journals (Sweden)

    Ghaemeh Nabaei

    2017-02-01

    Full Text Available Objectives: Methamphetamine use is a strong risk factor for stroke. This study was designed to evaluate arterial function and structure in methamphetamine users ultrasonographically. Methods: In a cross-sectional study, 20 methamphetamine users and 21 controls, aged between 20 and 40years, were enrolled. Common carotid artery intima-media thickness (CCA-IMT marker of early atherogenesis, flow-mediated dilatation (FMD determinants of endothelium-dependent vasodilation, and nitroglycerine-mediated dilatation (NMD independent marker of vasodilation were measured in two groups. Results: There were no significant differences between the two groups regarding demographic and metabolic characteristics. The mean (±SD CCA-IMT in methamphetamine users was 0.58±0.09mm, versus 0.59±0.07mm in the controls (p=0.84. Likewise, FMD% was not significantly different between the two groups [7.6±6.1% in methamphetamine users vs. 8.2±5.1% in the controls; p=0.72], nor were peak flow and shear rate after hyperemia. However, NMD% was considerably decreased in the methamphetamine users [8.5±7.8% in methamphetamine users vs. 13.4±6.2% in controls; p=0.03]. Conclusion: According to our results, NMD is reduced among otherwise healthy methamphetamine users, which represents smooth muscle dysfunction in this group. This may contribute to the high risk of stroke among methamphetamine users.

  13. Structural and Functional Brain Correlates of Cognitive Impairment in Euthymic Patients with Bipolar Disorder

    Science.gov (United States)

    Goikolea, José M.; Bonnin, Caterina M.; Sarró, Salvador; Segura, Barbara; Amann, Benedikt L.; Monté, Gemma C.; Moro, Noemi; Fernandez-Corcuera, Paloma; Maristany, Teresa; Salvador, Raymond; Vieta, Eduard; Pomarol-Clotet, Edith; McKenna, Peter J.

    2016-01-01

    Introduction Cognitive impairment in the euthymic phase is a well-established finding in bipolar disorder. However, its brain structural and/or functional correlates are uncertain. Methods Thirty-three euthymic bipolar patients with preserved memory and executive function and 28 euthymic bipolar patients with significant memory and/or executive impairment, as defined using two test batteries, the Rivermead Behavioural Memory Test (RBMT) and the Behavioural Assessment of the Dysexecutive Syndrome (BADS), plus 28 healthy controls underwent structural MRI using voxel-based morphometry (VBM). Twenty-seven of the cognitively preserved patients, 23 of the cognitively impaired patients and 28 controls also underwent fMRI during performance of the n-back working memory task. Results No clusters of grey or white matter volume difference were found between the two patient groups. During n-back performance, the cognitively impaired patients showed hypoactivation compared to the cognitively preserved patients in a circumscribed region in the right dorsolateral prefrontal cortex. Both patient groups showed failure of de-activation in the medial frontal cortex compared to the healthy controls. Conclusions Cognitive impairment in euthymic bipolar patients appears from this study to be unrelated to structural brain abnormality, but there was some evidence for an association with altered prefrontal function. PMID:27448153

  14. Racial and ethnic differences in obesity and overweight as predictors of the onset of functional impairment.

    Science.gov (United States)

    Wei, Liang; Wu, Bei

    2014-01-01

    To examine racial and ethnic differences in the effects of body mass index (BMI) on the onset of functional impairment over 10 years of follow-up. Longitudinal analyses of a cohort from a nationally representative survey of community-dwelling American adults. Six waves (1996-2006) of the Health and Retirement Study (HRS). Two groups of HRS participants aged 50 and older without functional impairment at baseline (1996): 5,884 with no mobility difficulty and 8,484 with no activity of daily living (ADL) difficulty. Mobility difficulty was a composite measure of difficulty walking several blocks, walking one block, climbing several flights of stairs, and climbing one flight of stairs. ADL difficulty was measured as difficulty in dressing, bathing or showering, eating, and getting in and out of bed without help. The association between baseline BMI and risk of developing functional impairment was estimated using generalized estimating equation models. Overweight and obesity were significant predictors of functional impairment. Overweight and obese Hispanics were 41% and 91% more likely, respectively, to develop ADL disability than whites in the same BMI categories. Overweight and severely obese blacks were also more likely than their white counterparts to develop ADL disability. Risk of developing ADL difficulty was higher for Hispanics than for blacks in the obese category. No significant differences in onset of mobility difficulty were found between racial or ethnic groups within any BMI category. Blacks and Hispanics were at higher risk than whites of ADL but not mobility impairment. In addition to weight control, prevention efforts should promote exercise to reduce functional impairment, especially for blacks and Hispanics, who are at higher risk. © 2013, Copyright the Authors Journal compilation © 2013, The American Geriatrics Society.

  15. Racial/Ethnic Differences in Obesity and Overweight as Predictors of the Onset of Functional Impairment

    Science.gov (United States)

    Wei, Liang; Wu, Bei

    2014-01-01

    Objectives To examine racial/ethnic differences in the effects of body mass index (BMI) on the onset of functional impairment over 10 years of follow-up. Design Longitudinal analyses of a cohort from a nationally representative survey of community-dwelling American adults. Setting Six waves (1996-2006) of US Health and Retirement Study (HRS). Participants Two groups of HRS participants aged ≥50 without functional impairment at baseline (1996): 5,884 with no mobility difficulty, and 8,484 with no Activities of Daily Living (ADLs) difficulty. Measurements Mobility difficulty was a composite measure of difficulty in walking several blocks, walking one block, climbing several flights of stairs, and climbing one floor of stairs. ADL difficulty was measured by difficulty in dressing, bathing or showing, eating, and getting in or out of bed without help. The association between the baseline BMI categories and risk to develop functional impairment was estimated using generalized estimating equations (GEE) models. Results Overweight and obesity were significant predictors for functional impairment. Compared to the Whites in the same overweight and obese categories, Hispanics were 41% and 91% more likely to develop ADL disability. Blacks in the overweight and severely obese categories were also more likely than their White counterparts to develop ADL disability. Risk of developing ADL difficulty was higher for Hispanics than for Blacks in the obese category. For onset of mobility difficulty, no significant differences were found across racial/ethnic groups within any BMI Category. Conclusion Blacks and Hispanics were at higher risk than Whites for ADL but not mobility impairment. In addition to weight control, prevention efforts should promote exercise to reduce functional impairment, especially for Blacks and Hispanics, who are at higher risk. PMID:24384026

  16. Impairment of male reproductive function after sleep deprivation.

    Science.gov (United States)

    Alvarenga, Tathiana A; Hirotsu, Camila; Mazaro-Costa, Renata; Tufik, Sergio; Andersen, Monica L

    2015-05-01

    To evaluate the influence of sleep loss on sexual behavior, hormone levels, sperm parameters, and testis-specific gene expression in male rats. Experimental research. Animal laboratory. Male adult Wistar-Hannover rats. Sexually experienced rats were subjected to paradoxic sleep deprivation (PSD) for 96 hours or sleep restriction (SR) for 21 days or kept in their home cage as control (CTRL). Sexual behavior, hormone levels, sperm parameters and expression of stress and nitric oxide-related genes were evaluated. PSD significantly decreased sexual behavior compared with the CTRL group, whereas SR had no effect. The PSD group had significantly lower testosterone levels than the CTRL group. Both PSD and SR groups had lower sperm viabilities than the CTRL group. The decrease in the number of live sperm compared with the CTRL group was larger in the PSD group than in the SR group. Regarding testicular gene expression, both PSD and SR led to an increase of iNOS and hydroxysteroid 11β-dehydrogenase 1 expressions compared with the CTRL group. These changes were more pronounced in the PSD group. A significant increase in endothelial nitric oxide synthase expression was observed in the PSD groups compared with the CTRL group. No changes were observed in dimethylarginine dimethylaminohydrolase 1 and casein kinase 2β-polypeptide expressions. Sleep loss can promote marked changes in the male reproductive system of rats, particularly affecting spermatic function in part by interfering in the testicular nitric oxide pathway. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  17. Eltrombopag, a thrombopoietin mimetic, crosses the blood-brain barrier and impairs iron-dependent hippocampal neuron dendrite development.

    Science.gov (United States)

    Bastian, T W; Duck, K A; Michalopoulos, G C; Chen, M J; Liu, Z-J; Connor, J R; Lanier, L M; Sola-Visner, M C; Georgieff, M K

    2017-03-01

    Essentials Potential neurodevelopmental side effects of thrombopoietin mimetics need to be considered. The effects of eltrombopag (ELT) on neuronal iron status and dendrite development were assessed. ELT crosses the blood-brain barrier and causes iron deficiency in developing neurons. ELT blunts dendrite maturation, indicating a need for more safety studies before neonatal use.

  18. Intrinsic motivation as a mediator between metacognition deficits and impaired functioning in psychosis.

    Science.gov (United States)

    Luther, Lauren; Firmin, Ruth L; Vohs, Jenifer L; Buck, Kelly D; Rand, Kevin L; Lysaker, Paul H

    2016-09-01

    Poor functioning has long been observed in individuals with psychosis. Recent studies have identified metacognition - one's ability to form complex ideas about oneself and others and to use that information to respond to psychological and social challenges-as being an important determinant of functioning. However, the exact process by which deficits in metacognition lead to impaired functioning remains unclear. This study first examined whether low intrinsic motivation, or the tendency to pursue novel experiences and to engage in self-improvement, mediates the relationship between deficits in metacognition and impaired functioning. We then examined whether intrinsic motivation significantly mediated the relationship when controlling for age, education, symptoms, executive functioning, and social cognition. Mediation models were examined in a cross-sectional data set. One hundred and seventy-five individuals with a psychotic disorder completed interview-based measures of metacognition, intrinsic motivation, symptoms, and functioning and performance-based measures of executive functioning and social cognition. Analyses revealed that intrinsic motivation mediated the relationship between metacognition deficits and impaired functioning (95% CI of indirect effect [0.12-0.43]), even after controlling for the aforesaid variables (95% CI of indirect effect [0.04-0.29]). Results suggest that intrinsic motivation may be a mechanism that underlies the link between deficits in metacognition and impaired functioning and indicate that metacognition and intrinsic motivation may be important treatment targets to improve functioning in individuals with psychosis. The findings of this study suggest that deficits in metacognition may indirectly lead to impaired functioning through their effect on intrinsic motivation in individuals with psychosis. Psychological treatments that target deficits in both metacognition and intrinsic motivation may help to alleviate impaired functioning in

  19. Major Depressive Disorder Is Associated with Broad Impairments on Neuropsychological Measures of Executive Function: A Meta-Analysis and Review

    Science.gov (United States)

    Snyder, Hannah R.

    2013-01-01

    Cognitive impairments are now widely acknowledged as an important aspect of major depressive disorder (MDD), and it has been proposed that executive function (EF) may be particularly impaired in patients with MDD. However, the existence and nature of EF impairments associated with depression remain strongly debated. Although many studies have…

  20. Clinical measurement of various aspects of hearing impairment and their relation to auditory functioning: the development of an Auditory Profile

    NARCIS (Netherlands)

    van Esch, T.E.M.

    2013-01-01

    In terms of disability and handicap, problems in auditory function involve much more than a reduced sensitivity to soft sounds, the most commonly used measure of hearing impairment. In daily life, many hearing-impaired (HI) listeners suffer more from impaired processing of audible sounds, than from

  1. Suitability of polystyrene as a functional barrier layer in coloured food contact materials.

    Science.gov (United States)

    Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy

    2015-01-01

    Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.

  2. Polynomial-time interior-point algorithm based on a local self-concordant finite barrier function

    Institute of Scientific and Technical Information of China (English)

    JIN Zheng-jing; BAI Yan-qin

    2009-01-01

    The choice of self-concordant functions is the key to efficient algorithms for linear and quadratic convex optimizations,which provide a method with polynomial-time iterations to solve linear and quadratic convex optimization problems.The parameters of a self-concordant barrier function can be used to compute the complexity bound of the proposed algorithm.In this paper,it is proved that the finite barrier function is a local self-concordant barrier function.By deriving the local values of parameters of this barrier function,the desired complexity bound of an interior-point algorithm based on this local serf-concordant function for linear optimization problem is obtained.The bound matches the best known bound for smallupdate methods.

  3. Modafinil treatment prevents REM sleep deprivation-induced brain function impairment by increasing MMP-9 expression.

    Science.gov (United States)

    He, Bin; Peng, Hua; Zhao, Ying; Zhou, Hui; Zhao, Zhongxin

    2011-12-01

    Previous work showed that sleep deprivation (SD) impairs hippocampal-dependent cognitive function and synaptic plasticity, and a novel wake-promoting agent modafinil prevents SD-induced memory impairment in rat. However, the mechanisms by which modafinil prevented REM-SD-induced impairment of brain function remain poorly understood. In the present study, rats were sleep-deprived by using the modified multiple platform method and brain function was detected. The results showed that modafinil treatment prevented REM-SD-induced impairment of cognitive function. Modafinil significantly reduced the number of errors compared to placebo and upregulated synapsin I expression in the dorsal hippocampal CA3 region. A synaptic plasticity-related gene, MMP-9 expression was also upregulated in modafinil-treated rats. Importantly, downregulation of MMP-9 expression by special siRNA decreased synapsin I protein levels and synapse numbers. Therefore, we demonstrated that modafinil increased cognition function and synaptic plasticity, at least in part by increasing MMP-9 expression in REM-SD rats.

  4. A Study of Impairing Injuries in Real World Crashes Using the Injury Impairment Scale (IIS) and the Predicted Functional Capacity Index (PFCI-AIS)

    Science.gov (United States)

    Barnes, Jo; Morris, Andrew

    2009-01-01

    The ability to predict impairment outcomes in large databases using a simplified technique allows researchers to focus attention on preventing costly impairing injuries. The dilemma that exists for researchers is to determine which method is the most reliable and valid. This study examines available methods to predict impairment and explores the differences between the IIS and pFCI applied to real world crash injury data. Occupant injury data from the UK Co-operative Crash Injury Study (CCIS) database have been coded using AIS 1990 and AIS 2005. The data have subsequently been recoded using the associated impairment scales namely the Injury Impairment Scale (IIS) and the predicted Functional Capacity Index (pFCI) to determine the predicted impairment levels of injuries at one year post crash. Comparisons between the levels of impairment were made and any differences further explored. Injury data for the period February 2006 to September 2008 from the CCIS database were used in the analysis which involved a dataset of 2,437 occcupants who sustained over 8000 injuries. This study found some differences between the impairment scales for injuries coded to the AIS 1990 and AIS 2005 coding dictionaries. The pFCI predicts 31.5% of injuries to be impairing in AIS 2005, less than the IIS (38.5%) using AIS 1990. Using CCIS data the pFCI predicted that only 6% of the occupants with a coded injury would have an impairing injury compared to 24% of occupants using the IIS. The main body regions identified as having the major differences between the two impairment scales for car occupants were the head and spine. Follow up data were then used for a small number of cases (n=31, lower extremity and whiplash injuries) to examine any differences in predicted impairment versus perceived impairment. These data were selected from a previous study conducted between 2003 and 2006 and identified the discrepancy between predicted impairment and actual perceived impairment as defined by the

  5. Epidermal growth factor receptor signalling contributes to house dust mite-induced epithelial barrier dysfunction

    NARCIS (Netherlands)

    Heijink, I H; van Oosterhout, A; Kapus, A

    2010-01-01

    Impaired airway epithelial barrier function has emerged as a key factor in the pathogenesis of allergic asthma. We aimed to discern the involvement of the epidermal growth factor receptor (EGFR) in allergen-induced epithelial barrier impairment, as we previously observed that house dust mite (HDM) s

  6. School functioning in adolescents with chronic pain: the role of depressive symptoms in school impairment.

    Science.gov (United States)

    Logan, Deirdre E; Simons, Laura E; Kaczynski, Karen J

    2009-09-01

    To explore associations between depressive symptoms and school functioning, including school attendance, academic performance, self-perceived academic competence, and teacher-rated school adjustment among predominantly Caucasian and female adolescent chronic pain patients. A total of 217 clinically referred adolescents (aged 12-17 years) and their parents completed measures of pain characteristics, depression, and school functioning. Additional data were collected from school records and teacher reports. Depressive symptoms strongly correlated with school functioning indicators. In linear regression analyses, higher levels of depressive symptoms predicted more school impairment. A model testing whether depressive symptoms mediated the association between current pain intensity and parent perceptions of the interference of pain on school functioning was supported by the data. Depressive symptoms play a key role in influencing the extent of school impairment in adolescents with chronic pain. Interventions to alleviate depressive symptoms may enhance treatments designed to improve school functioning in this population.

  7. Density-Functional-Based Determination of the CH3-CH4 Hydrogen Exchange Reaction Barrier

    CERN Document Server

    Pederson, M R

    1994-01-01

    Due to the overbinding that is inherent in existing {\\em local} approximations to the density-functional formalism, certain reaction energies have not been accessible. Since the generalized gradient approximation significantly decreases the overbinding, prospects for density-functional-based reaction dynamics are promising. Results on the generalized-gradient based determination of the CH3-CH4 hydrogen exchange reaction are presented. Including all Born-Oppenheimer effects an energy barrier of 9.5 kcal/Mole is found which is a very significant improvement over the local-density approximation.

  8. Acute Effects of Viral Exposure on P-Glycoprotein Function in the Mouse Fetal Blood-Brain Barrier

    Directory of Open Access Journals (Sweden)

    Enrrico Bloise

    2017-02-01

    Full Text Available Background/Aims: Viral infection during pregnancy is known to affect the fetal brain. The toll-like receptor (TLR-3 is a pattern recognition receptor activated by viruses known to elicit adverse fetal neurological outcomes. The P-glycoprotein (P-gp efflux transporter protects the developing fetus by limiting the transfer of substrates across both the placenta and the fetal blood-brain barrier (BBB. As such, inhibition of P-gp at these blood-barrier sites may result in increased exposure of the developing fetus to environmental toxins and xenobiotics present in the maternal circulation. We hypothesized that viral exposure during pregnancy would impair P-gp function in the placenta and in the developing BBB. Here we investigated whether the TLR-3 ligand, polyinosinic:polycytidylic acid (PolyI:C, increased accumulation of one P-gp substrate in the fetus and in the developing fetal brain. Methods: Pregnant C57BL/6 mice (GD15.5 were injected (i.p. with PolyI:C (5 mg/kg or 10 mg/kg or vehicle (saline. [3H]digoxin (P-gp substrate was injected (i.v. 3 or 23h post-treatment and animals were euthanized 1h later. Maternal plasma, ‘fetal-units’ (fetal membranes, amniotic fluid and whole fetus, and fetal brains were collected. Results: PolyI:C exposure (4h significantly elevated maternal plasma IL-6 (P<0.001 and increased [3H]digoxin accumulation in the fetal brain (P<0.05. In contrast, 24h after PolyI:C exposure, no effect on IL-6 or fetal brain accumulation of P-gp substrate was observed. Conclusion: Viral infection modeled by PolyI:C causes acute increases in fetal brain accumulation of P-gp substrates and by doing so, may increase fetal brain exposure to xenobiotics and environmental toxins present in the maternal circulation.

  9. Evaluation of In Vitro Anti-Inflammatory Activities and Protective Effect of Fermented Preparations of Rhizoma Atractylodis Macrocephalae on Intestinal Barrier Function against Lipopolysaccharide Insult

    Directory of Open Access Journals (Sweden)

    Shambhunath Bose

    2013-01-01

    Full Text Available Lipopolysaccharide (LPS, a potent inducer of systemic inflammatory responses, is known to cause impairment of intestinal barrier function. Here, we evaluated the in vitro protective effect of an unfermented formulation of Rhizoma Atractylodis Macrocephalae (RAM, a traditional Chinese herbal medicine widely used in the treatment of many digestive and gastrointestinal disorders, and two fermented preparations of RAM, designated as FRAM-1 (prepared in Luria-Bertani broth and FRAM-2 (prepared in glucose, on intestinal epithelial cells (IECs against LPS insult. In general, fermented formulations, especially FRAM-2, but not unfermented RAM, exerted an appreciable protective effect on IECs against LPS-induced perturbation of membrane resistance and permeability. Both fermented formulations exhibited appreciable anti-inflammatory activities in terms of their ability to inhibit LPS-induced gene expression and induced production of a number of key inflammatory mediators and cytokines in RAW 264.7 macrophage cells. However, in most cases, FRAM-2 exhibited stronger anti-inflammatory effects than FRAM-1. Our findings also suggest that suppression of nuclear factor-κβ (NF-κβ activity might be one of the possible mechanisms by which the fermented RAM exerts its anti-inflammatory effects. Collectively, our results highlight the benefits of using fermented products of RAM to protect against LPS-induced inflammatory insult and impairment in intestinal barrier function.

  10. Establishment of a novel in vitro model of stratified epithelial wound healing with barrier function.

    Science.gov (United States)

    Gonzalez-Andrades, Miguel; Alonso-Pastor, Luis; Mauris, Jérôme; Cruzat, Andrea; Dohlman, Claes H; Argüeso, Pablo

    2016-01-13

    The repair of wounds through collective movement of epithelial cells is a fundamental process in multicellular organisms. In stratified epithelia such as the cornea and skin, healing occurs in three steps that include a latent, migratory, and reconstruction phases. Several simple and inexpensive assays have been developed to study the biology of cell migration in vitro. However, these assays are mostly based on monolayer systems that fail to reproduce the differentiation processes associated to multilayered systems. Here, we describe a straightforward in vitro wound assay to evaluate the healing and restoration of barrier function in stratified human corneal epithelial cells. In this assay, circular punch injuries lead to the collective migration of the epithelium as coherent sheets. The closure of the wound was associated with the restoration of the transcellular barrier and the re-establishment of apical intercellular junctions. Altogether, this new model of wound healing provides an important research tool to study the mechanisms leading to barrier function in stratified epithelia and may facilitate the development of future therapeutic applications.

  11. Topical Formulation Containing Beeswax-Based Nanoparticles Improved In Vivo Skin Barrier Function.

    Science.gov (United States)

    Souza, Carla; de Freitas, Luis Alexandre Pedro; Maia Campos, Patrícia Maria Berardo Gonçalves

    2017-02-17

    Lipid nanoparticles have shown many advantages for treatment/prevention of skin disorders with damaged skin barrier function. Beeswax is a favorable candidate for the development of nanosystems in the cosmetic and dermatological fields because of its advantages for the development of products for topical application. In the present study, beeswax-based nanoparticles (BNs) were prepared using the hot melt microemulsion technique and incorporated to a gel-cream formulation. The formulation was subsequently evaluated for its rheological stability and effect on stratum corneum water content (SCWC) and transepidermal water loss (TEWL) using in vivo biophysical techniques. BNs resulted in mean particle size of 95.72 ± 9.63 nm and zeta potential of -9.85 ± 0.57 mV. BN-loaded formulation showed shear thinning behavior, well adjusted by the Herschel-Bulkley model, and a small thixotropy index that were stable for 28 days at different temperatures. BN-loaded formulation was also able to simultaneously decrease the TEWL and increase the SCWC values 28 days after treatment. In conclusion, the novel beeswax-based nanoparticles showed potential for barrier recovery and open the perspective for its commercial use as a novel natural active as yet unexplored in the field of dermatology and cosmetics for treatment of skin diseases with damaged skin barrier function.

  12. Impaired executive function following ischemic stroke in the rat medial prefrontal cortex.

    Science.gov (United States)

    Cordova, Chris A; Jackson, Danielle; Langdon, Kristopher D; Hewlett, Krista A; Corbett, Dale

    2014-01-01

    Small (lacunar) infarcts frequently arise in frontal and midline thalamic regions in the absence of major stroke. Damage to these areas often leads to impairment of executive function likely as a result of interrupting connections of the prefrontal cortex. Thus, patients experience frontal-like symptoms such as impaired ability to shift ongoing behavior and attention. In contrast, executive dysfunction has not been demonstrated in rodent models of stroke, thereby limiting the development of potential therapies for human executive dysfunction. Male Sprague-Dawley rats (n=40) underwent either sham surgery or bilateral endothelin-1 injections in the mediodorsal nucleus of the thalamus or in the medial prefrontal cortex. Executive function was assessed using a rodent attention set shifting test that requires animals to shift attention to stimuli in different stimulus dimensions. Medial prefrontal cortex ischemia impaired attention shift performance between different stimulus dimensions while sparing stimulus discrimination and attention shifts within a stimulus dimension, indicating a selective attention set-shift deficit. Rats with mediodorsal thalamic lacunar damage did not exhibit a cognitive impairment relative to sham controls. The selective attention set shift impairment observed in this study is consistent with clinical data demonstrating selective executive disorders following stroke within specific sub-regions of frontal cortex. These data contribute to the development and validation of a preclinical animal model of executive dysfunction, that can be employed to identify potential therapies for ameliorating cognitive deficits following stroke.

  13. Motor function at school age in children with a preschool diagnosis of developmental language impairment.

    Science.gov (United States)

    Webster, Richard I; Majnemer, Annette; Platt, Robert W; Shevell, Michael I

    2005-01-01

    To evaluate fine motor (FM) and gross motor (GM) function shortly after school entry in children with a preschool diagnosis of developmental language impairment (DLI). A cohort of children (n = 70) diagnosed at pre-school age with DLI was reevaluated in elementary school. Language, cognitive, and motor outcomes were assessed through the use of the Battelle Developmental Inventory (BDI). Language was further assessed through the use of the Vineland Adaptive Behavior Scale, Peabody Picture Vocabulary, and Expressive One Word Picture Vocabulary Tests. Performance below -1.5 SD of the normative mean on any test was considered to represent impairment. Forty-three children (mean age, 7.4 +/- 0.7 years) underwent reassessment at a mean of 3.8 +/- 0.7 years after initial preschool assessment. Mean scores for BDI motor domains (FM, 78.3 +/- 11.4; GM, 84.9 +/- 13.3) fell below normative values. Twenty-two children (52%) had motor impairment (FM, 17 of 42; GM, 15 of 42); 35 of 43 (81%) continued to have language impairment. BDI communication raw scores correlated most strongly with FM (rho = 0.73, P < .001) and GM (rho = 0.58, P = .003) raw scores but showed only moderate correlations with cognitive raw scores (rho = 0.41, P = .05). Impaired motor function is an important comorbidity in DLI. Factors critical to motor performance may also contribute to language deficits in DLI.

  14. Gender differences in somatic symptoms, quality of life, and functional impairment in depressive patients

    Directory of Open Access Journals (Sweden)

    R Sreevani

    2015-01-01

    Full Text Available Objectives: Investigate gender related differences in somatic symptoms, severity of depression, quality of life (QOL, and functional impairment, and correlate somatic symptoms with QOL and functional impairment. Methods: This cross-sectional study was conducted with 100 consecutive outpatients seeking treatment for depressive disorder at district hospital psychiatric outpatient clinic, Kolar, Karnataka, India. This study utilised the Beck Depression Inventory II, Physical Distress Scale, Work and Social Adjustment Scale, and World Health Organization QOL BREF instrument. Results: Mean constipation scores and back pain scores were higher in women compared to men. There were no statistically significant differences between male and female patients with regard to depression scores, total somatic symptom scores, QOL, and functional impairment scores. Somatic symptoms scores are positively correlated with depression scores and functional impairment scores, and negatively correlated with QOL scores. Conclusion: Women had higher constipation and back pain scores compared to men. If the symptoms of same disease differ between men and women, this has important implications for the history collection, diagnosis, and treatment process.

  15. "CONGENTIAL PANHYPOPITUITARISM ASSOCIATED WITH IMPAIRED LIVER FUNCTION TESTS AND CONGENITAL HEART DISEASE"

    Directory of Open Access Journals (Sweden)

    Z. Khalili-Matinzadeh

    2006-06-01

    Full Text Available The term congenital hypopituitarism defines deficiency of all of the pituitary hormones. Hypoglycemia and microphallus (in males are common findings, and some infants have shown evidence of the neonatal hepatitis syndrome. We report a case of congenital panhypopituitarism with deficiency of six major hormones and association with severe hypoglycemia, impaired liver function tests and congenital heart disease.

  16. Does Change in Functional Performance Affect Quality of Life in Persons with Orthopaedic Impairment?

    Science.gov (United States)

    Ostir, Glenn V.; Berges, Ivonne-Marie; Smith, Pamela M.; Smith, David; Rice, Janida L.; Ottenbacher, Kenneth J.

    2006-01-01

    Background and Purpose: Examine the association between change in functional status and quality of life for individuals with orthopaedic impairments approximately 90 days after discharge from in-patient medical rehabilitation. Methods: A retrospective study from 2001 to 2002 using information from the IT HealthTrack database. The study included…

  17. Impaired testicular function in patients with carcinoma-in-situ of the testis

    DEFF Research Database (Denmark)

    Petersen, P M; Giwercman, A; Hansen, S W;

    1999-01-01

    in patients without (median, 9.1 x 10(6)/mL and 32 x 10(6), respectively), whereas the levels of FSH were significantly higher (P spermatogenesis but also Leydig cell function is impaired in testes with CIS...

  18. Impaired skin capillary recruitment in essential hypertension is caused by both functional and structural capillary rarefaction

    NARCIS (Netherlands)

    Serne, EH; Gans, ROB; ter Maaten, JC; Tangelder, GJ; Donker, AJM; Stehouwer, CDA

    2001-01-01

    Capillary rarefaction occurs in many tissues in patients with essential hypertension and may contribute to an increased vascular resistance and impaired muscle metabolism. Rarefaction may be caused by a structural (anatomic) absence of capillaries, functional nonperfusion, or both. The aim of this s

  19. Distinguishing Sluggish Cognitive Tempo from ADHD in Children and Adolescents: Executive Functioning, Impairment, and Comorbidity

    Science.gov (United States)

    Barkley, Russell A.

    2013-01-01

    Controversy continues as to whether sluggish cognitive tempo (SCT) is a subtype of attention-deficit/hyperactivity disorder (ADHD) or a distinct disorder. This study examined differences between these disorders in demographics, executive functioning (EF), impairment, and prior professional diagnoses to address the issue. There were 1,800 children…

  20. Aberrant Topologies and Reconfiguration Pattern of Functional Brain Network in Children with Second Language Reading Impairment

    Science.gov (United States)

    Liu, Lanfang; Li, Hehui; Zhang, Manli; Wang, Zhengke; Wei, Na; Liu, Li; Meng, Xiangzhi; Ding, Guosheng

    2016-01-01

    Prior work has extensively studied neural deficits in children with reading impairment (RI) in their native language but has rarely examined those of RI children in their second language (L2). A recent study revealed that the function of the local brain regions was disrupted in children with RI in L2, but it is not clear whether the disruption…

  1. Mitochondrial function and morphology are impaired in parkin-mutant fibroblasts.

    NARCIS (Netherlands)

    Mortiboys, H.; Thomas, K.J.; Koopman, W.J.H.; Klaffke, S.; Abou-Sleiman, P.; Olpin, S.; Wood, N.W.; Willems, P.H.G.M.; Smeitink, J.A.M.; Cookson, M.R.; Bandmann, O.

    2008-01-01

    OBJECTIVE: There are marked mitochondrial abnormalities in parkin-knock-out Drosophila and other model systems. The aim of our study was to determine mitochondrial function and morphology in parkin-mutant patients. We also investigated whether pharmacological rescue of impaired mitochondrial functio

  2. Developmental Language Impairment through the Lens of the ICF: An Integrated Account of Children's Functioning

    Science.gov (United States)

    Dempsey, Lynn; Skarakis-Doyle, Elizabeth

    2010-01-01

    The conceptual framework of the World Health Organization's International Classification of Functioning, Disability and Health (ICF) has the potential to advance understanding of developmental language impairment (LI) and enhance clinical practice. The framework provides a systematic way of unifying numerous lines of research, which have linked a…

  3. Impact of low vision rehabilitation on functional vision performance of children with visual impairment

    Directory of Open Access Journals (Sweden)

    Suma Ganesh

    2013-01-01

    Conclusions: In our study group, there was a significant improvement in functional vision post visual rehabilitation, especially with those activities which are related to their academic output. It is important for these children to have an early visual rehabilitation to decrease the impairment associated with these decreased visual output and to enhance their learning abilities.

  4. Somatisation and functional impairment in adolescents : Longitudinal link with mothers' reactions

    NARCIS (Netherlands)

    Rousseau, Sofie; Grietens, Hans; Vanderfaeillie, Johan; Hoppenbrouwers, Karel; Desoete, Annemie; Van Leeuwen, Karla

    2014-01-01

    Adolescents' somatisation (i.e., the psychological tendency to experience and report multiple physical complaints for which no definite medical cause can be found; SOM) and functional impairment (i.e., all bothersome aftermath of somatisation; FI) were studied in relation to mothers' protection, enc

  5. Degree of Exposure to Domestic Violence, Psychopathology, and Functional Impairment in Children and Adolescents

    Science.gov (United States)

    Fernandez, Eduard Bayarri; Ezpeleta, Lourdes; Granero, Roser; de la Osa, Nuria; Domenech, Josep Maria

    2011-01-01

    There are discrepancies about whether children who witness and suffer domestic violence (DV) have similar outcomes in terms of psychopathology. This work examines the relationship between different types of exposure to DV and child psychopathology and functional impairment. One hundred and forty-four Spanish children aged from 4 to 17 years and…

  6. Theory of Mind deficits and social emotional functioning in preschoolers with specific language impairment

    NARCIS (Netherlands)

    Vissers, C.T.W.M.; Koolen, S.

    2016-01-01

    Children with Specific Language Impairment (SLI) often experience emotional and social difficulties. In general, problems in social emotional functioning can be cognitively explained in terms of Theory of Mind (ToM). In this mini-review, an overview is provided of studies on social-emotional functio

  7. Chronic Pain, Quality of Life, and Functional Impairment After Surgery Due to Small Bowel Obstruction

    DEFF Research Database (Denmark)

    Jeppesen, Maja; Tolstrup, Mai-Britt; Gögenur, Ismail

    2016-01-01

    BACKGROUND: Emergency laparotomy is a high-risk procedure regarding short-term outcomes; however, long-term outcomes are not well described. The aim of this study was to determine the frequency of chronic postoperative pain, pain-related functional impairment, and incisional hernias and to evalua...

  8. Interleukin-8 transcripts in mononuclear cells determine impaired graft function after kidney transplantation

    DEFF Research Database (Denmark)

    Borst, Christoffer; Xia, Shengqiang; Bistrup, Claus

    2015-01-01

    OBJECTIVE: Interleukin-8 (IL-8) has been associated with ischemia reperfusion injury after renal allograft transplantation. Impaired allograft function may cause major impact on patient morbidity and health care costs. We investigated whether transcript levels in mononuclear cells including IL-8 ...

  9. Working Memory Functioning in Children with Learning Disorders and Specific Language Impairment

    Science.gov (United States)

    Schuchardt, Kirsten; Bockmann, Ann-Katrin; Bornemann, Galina; Maehler, Claudia

    2013-01-01

    Purpose: On the basis of Baddeley's working memory model (1986), we examined working memory functioning in children with learning disorders with and without specific language impairment (SLI). We pursued the question whether children with learning disorders exhibit similar working memory deficits as children with additional SLI. Method: In…

  10. Renal hemodynamic effects of candesartan in normal and impaired renal function in humans

    NARCIS (Netherlands)

    Buter, H; Navis, G; deZeeuw, D; deJong, PE

    1997-01-01

    The effects of angiotensin II type I receptor antagonist candesartan cilexitil, 8 mg once daily, were studied after single dose and after five days treatment in 17 hypertensive patients [median mean arterial pressure (MAP) 118 mm Hg, range 84 to 134] with renal function impairment of different sever

  11. Language and executive functioning in the context of specific language impairment and bilingualism

    NARCIS (Netherlands)

    Laloi, A.

    2015-01-01

    The present thesis has investigated how French-speaking monolingual and bilingual children with SLI (specific language impairment) performed on various tasks examining language and executive functioning (EF) abilities, in comparison to monolingual and bilingual peers without SLI. Language was invest

  12. Aberrant Topologies and Reconfiguration Pattern of Functional Brain Network in Children with Second Language Reading Impairment

    Science.gov (United States)

    Liu, Lanfang; Li, Hehui; Zhang, Manli; Wang, Zhengke; Wei, Na; Liu, Li; Meng, Xiangzhi; Ding, Guosheng

    2016-01-01

    Prior work has extensively studied neural deficits in children with reading impairment (RI) in their native language but has rarely examined those of RI children in their second language (L2). A recent study revealed that the function of the local brain regions was disrupted in children with RI in L2, but it is not clear whether the disruption…

  13. [Early identification of impaired renal function in obese children with non-alcoholic fatty liver disease].

    Science.gov (United States)

    Lin, Hu; Fu, Junfen; Chen, Xuefeng; Huang, Ke; Wu, Wei; Liang, Li

    2013-07-01

    To early assess the impaired renal function in the obese children with non-alcoholic fatty liver disease (NAFLD) and to identify the relationship between NAFLD and impairment of renal function. Three hundred and eighty-six obese children were enrolled and divided into NAFLD group and simple obesity group (control) according to the diagnostic criteria. Clinical biochemical parameters and early impaired renal functions were evaluated and compared. Among all patients 234 obese children aged over 10 y were subdivided into 3 groups: NAFLD combined with metabolic syndrome (NAFLD+MS) group, NAFLD group and simple obesity group (control), and the above indexes were compared among 3 groups. The urinary microalbumin levels in NAFLD, NAFLD+MS (>10y) and NAFLD groups (>10y) were significantly higher than those in controls. Additionally, the positive correlations of urinary microalbumin with systolic pressure, triglyceride and 2h-postprandial blood glucose were found. There is early renal dysfunction in children with NAFLD and those accompanied with MS, which may be associated with hypertension and glucose-lipid metabolic disorder. The results indicate that NAFLD is not only an early sign of early impaired renal function but also an early stage of chronic kidney disease (CKD) in obese children.

  14. Co-Localisation of Abnormal Brain Structure and Function in Specific Language Impairment

    Science.gov (United States)

    Badcock, Nicholas A.; Bishop, Dorothy V. M.; Hardiman, Mervyn J.; Barry, Johanna G.; Watkins, Kate E.

    2012-01-01

    We assessed the relationship between brain structure and function in 10 individuals with specific language impairment (SLI), compared to six unaffected siblings, and 16 unrelated control participants with typical language. Voxel-based morphometry indicated that grey matter in the SLI group, relative to controls, was increased in the left inferior…

  15. Degree of Exposure to Domestic Violence, Psychopathology, and Functional Impairment in Children and Adolescents

    Science.gov (United States)

    Fernandez, Eduard Bayarri; Ezpeleta, Lourdes; Granero, Roser; de la Osa, Nuria; Domenech, Josep Maria

    2011-01-01

    There are discrepancies about whether children who witness and suffer domestic violence (DV) have similar outcomes in terms of psychopathology. This work examines the relationship between different types of exposure to DV and child psychopathology and functional impairment. One hundred and forty-four Spanish children aged from 4 to 17 years and…

  16. Functional requirements for assistive technology for people with cognitive impairments and dementia

    NARCIS (Netherlands)

    Meiland, F.J.M.; Boer, M.E. de; Hoof, J. van; Leeuw, J. van der; Witte, L. de; Blom, M.; Karkowski, I.P.; Mulvenna, M.D.; Droes, R.M.

    2012-01-01

    The amount of technological aids on the market to support people in their everyday functioning is increasing. For example mobile telephone, electronic diary, skyping and domotics. Many of these aids are too complicated to operate for people with cognitive impairments, like dementia. For technology

  17. Contribution of corticospinal tract and functional connectivity in hand motor impairment after stroke.

    Directory of Open Access Journals (Sweden)

    Charlotte Rosso

    Full Text Available BACKGROUND: Motor outcome after stroke is associated with reorganisation of cortical networks and corticospinal tract (CST integrity. However, the relationships between motor severity, CST damage, and functional brain connectivity are not well understood. Here, the main objective was to study the effect of CST damage on the relationship between functional motor network connectivity and hand motor function in two groups of stroke patients: the severely (n=8 and the mildly impaired (n=14. METHODS: Twenty-two carotid stroke patients with motor deficits were studied with magnetic resonance imaging (MRI at 3 weeks, at 3 and 6 months. Healthy subjects (n=28 were scanned once. The CST injury was assessed by fractional anisotropy values. Functional connectivity was studied from a whole-hand grip task fMRI in a cortical and cerebellar motor network. Functional connectivity indexes were computed between these regions at each time point. The relationship between hand motor strength, ipsilesional CST damage and functional connectivity from the primary motor cortex (M1 was investigated using global and partial correlations. FINDINGS: In mildly impaired patients, cortico-cortical connectivity was disturbed at three weeks but returned to a normal pattern after 3 months. Cortico-cerebellar connectivity was still decreased at 6 months. In severely impaired patients, the cortico-cortical connectivity tended to return to a normal pattern, but the cortico-cerebellar connectivity was totally abolished during the follow-up. In the entire group of patients, the hand motor strength was correlated to the ipsilesional functional connectivity from M1. Partial correlations revealed that these associations were not anymore significant when the impact of CST damage was removed, except for the ipsilesional M1-contralateral cerebellum connectivity. CONCLUSION: Functional brain connectivity changes can be observed, even in severely impaired patients with no recovery. Upper limb

  18. Possible relationship between intestinal barrier function and formation of pigment gallstones in hamsters

    Institute of Scientific and Technical Information of China (English)

    Ying Fan; Shuo-Dong Wu; Lei Sun; Bei-Bei Fu; Yang Su

    2008-01-01

    BACKGROUND: The presence of bacteria in bile is an important factor in the formation of pigment gallstones. The bile of healthy people is sterile and bacteria in the biliary system come from endogenous infection from the gut. Yet, the route of bacterial translocation into the bile duct is still unclear. Theoretically, two routes exist:one is through the intestinal barrier and the other is by direct relfux from the sphincter of Oddi. This study was undertaken to explore the relationship between the effectiveness of intestinal barrier and the formation of pigment gallstones in hamsters. METHODS: Thirty-two hamsters were divided into an experimental and a control group, with 16 hamsters in each group. A low protein and high cellulose diet was given for 6 weeks to induce the formation of pigment gallstones in the experimental group (PS) and a normal diet was given to the control group (CON). Morphological changes, changes in the levels of serum endotoxin and diamine oxidase, and changes in the numbers of B lymphocytes, plasma cells and secretory immunoglobin A (sIgA) in the intestinal mucosa were assessed after 6 weeks. RESULTS:Four hamsters died during lithogenesis and body weight decreased in the PS group. Pigment gallstones were found in 11 hamsters at the end of the experiment, giving a lithogenesis rate of 91.67%. The serum endotoxin level before and after gallstone formation in the PS group was 0.2960±0.1734 U/ml and 8.2964±4.6268 U/ml, respectively (P CONCLUSIONS:A low protein and high cellulose diet can markedly reduce intestinal barrier function and facilitate the formation of pigment gallstones. The decrease of intestinal barrier function may take part in the formation of pigment gallstones.

  19. The Role of the WHO ICF as a Framework to Interpret Barriers and to Inclusion: Visually Impaired People's Views and Experiences of Personal Computers

    Science.gov (United States)

    Douglas, Graeme; Corcoran, Christine; Pavey, Sue

    2007-01-01

    This article describes how the World Health Organisation's International Classification of Functioning, Disability, and Health (ICF), 2001, was used as a framework for the design of the interview schedule used in the Network 1000 project. It is argued that the ICF offers a vocabulary to enable visually impaired participants to describe their lives…

  20. The role of executive functions in social impairment in Autism Spectrum Disorder.

    Science.gov (United States)

    Leung, Rachel C; Vogan, Vanessa M; Powell, Tamara L; Anagnostou, Evdokia; Taylor, Margot J

    2016-01-01

    Autism Spectrum Disorder (ASD) is a neurodevelopmental disorder characterized by socio-communicative impairments. Executive dysfunction may explain some key characteristics of ASD, both social and nonsocial hallmarks. Limited research exists exploring the relations between executive function and social impairment in ASD and few studies have used a comparison control group. Thus, the objective of the present study was to investigate the relations between executive functioning using the Behavioral Rating Inventory of Executive Functioning (BRIEF), social impairment as measured by the Social Responsiveness Scale (SRS), and overall autistic symptomology as measured by the Autism Diagnostic Observation Schedule (ADOS) in children and adolescents with and without ASD. Seventy children and adolescents diagnosed with ASD and 71 typically developing controls were included in this study. Findings showed that behavioral regulation executive processes (i.e., inhibition, shifting, and emotional control) predicted social function in all children. However, metacognitive executive processes (i.e., initiation, working memory, planning, organization, and monitoring) predicted social function only in children with ASD and not in typically developing children. Our findings suggest a distinct metacognitive executive function-social symptom link in ASD that is not present in the typical population. Understanding components of executive functioning that contribute to the autistic symptomology, particularly in the socio-communicative domain, is crucial for developing effective interventions that target key executive processes as well as underlying behavioral symptoms.

  1. Relationship between cognitive functioning impairment and nutrition in obesity: Current Perspective

    OpenAIRE

    Macit, Sedanur; Gezmen Karadağ, Makbule

    2015-01-01

    Obesity is one of the serious public health problems and its prevalence has been increasing in recent years. As well as causing health problems, obesity is associated with cognitive function impairment, especially with reduced language, motor capacity skills, and attention named as executive functions. Obesity is also related to decrease in brain volume, dementia, Alzheimer’s disease, sociopathic, aggressive personality traits, anxiety, and major depressive disorder. There are several mechani...

  2. Potential barriers and facilitators for implementation of an integrated care pathway for hearing-impaired persons: an exploratory survey among patients and professionals

    Directory of Open Access Journals (Sweden)

    Verschuure Hans

    2007-04-01

    Full Text Available Abstract Background Because of the increasing costs and anticipated shortage of Ear Nose and Throat (ENT specialists in the care for hearing-impaired persons, an integrated care pathway that includes direct hearing aid provision was developed. While this direct pathway is still under investigation, in a survey we examined expectations and potential barriers and facilitators towards this direct pathway, of patients and professionals involved in the pathway. Methods Two study populations were assessed: members of the health professions involved in the care pathway for hearing-impaired persons (general practitioners (GPs, hearing aid dispensers, ENT-specialists and clinical audiologists and persons with hearing complaints. We developed a comprehensive semi-structured questionnaire for the professionals, regarding expectations, barriers, facilitators and conditions for implementation. We developed two questionnaires for persons with hearing complaints, both regarding evaluations and preferences, and administered them after they had experienced two key elements of the direct pathway: the triage and the hearing aid fitting. Results On average GPs and hearing aid dispensers had positive expectations towards the direct pathway, while ENT-specialists and clinical audiologists had negative expectations. Professionals stated both barriers and facilitators towards the direct pathway. Most professionals either supported implementation of the direct pathway, provided that a number of conditions were satisfied, or did not support implementation, unless roughly the same conditions were satisfied. Professionals generally agreed on which conditions need to be satisfied. Persons with hearing complaints evaluated the present referral pathway and the new direct pathway equally. Many, especially older, participants stated however that they would still visit the GP and ENT-specialist, even when this would not be necessary for reimbursement of the hearing aid, and

  3. The differentiated airway epithelium infected by influenza viruses maintains the barrier function despite a dramatic loss of ciliated cells.

    Science.gov (United States)

    Wu, Nai-Huei; Yang, Wei; Beineke, Andreas; Dijkman, Ronald; Matrosovich, Mikhail; Baumgärtner, Wolfgang; Thiel, Volker; Valentin-Weigand, Peter; Meng, Fandan; Herrler, Georg

    2016-12-22

    Virus-host interactions in the respiratory epithelium during long term influenza virus infection are not well characterized. Therefore, we developed an air-liquid interface culture system for differentiated porcine respiratory epithelial cells to study the effect of virus-induced cellular damage. In our well-differentiated cells, α2,6-linked sialic acid is predominantly expressed on the apical surface and the basal cells mainly express α2,3-linked sialic acid. During the whole infection period, release of infectious virus was maintained at a high titre for more than seven days. The infected epithelial cells were subject to apoptosis resulting in the loss of ciliated cells together with a thinner thickness. Nevertheless, the airway epithelium maintained trans-epithelial electrical resistance and retained its barrier function. The loss of ciliated cells was compensated by the cells which contained the KRT5 basal cell marker but were not yet differentiated into ciliated cells. These specialized cells showed an increase of α2,3-linked sialic acid on the apical surface. In sum, our results help to explain the localized infection of the airway epithelium by influenza viruses. The impairment of mucociliary clearance in the epithelial cells provides an explanation why prior viral infection renders the host more susceptible to secondary co-infection by another pathogen.

  4. Do Personality Traits Predict Functional Impairment and Quality of Life in Adult ADHD? A Controlled Study.

    Science.gov (United States)

    He, J Allison; Antshel, Kevin M; Biederman, Joseph; Faraone, Stephen V

    2015-11-25

    To examine the association of personality traits and characteristics on quality of life and functioning in adults with ADHD. Participants were adults with (n = 206) and without ADHD (n = 123) who completed the Temperament and Character Inventory (TCI), the Quality of Life Enjoyment and Satisfaction Questionnaire (Q-LES-Q), and the Social Adjustment Scale-Self-Report (SAS-SR). Participants also provided information on academic, motor vehicle operation, legal, social, familial, and occupational functioning. Outcomes were examined using stepwise linear regression, logistic regression (for binary outcomes), and negative binomial regression (for count outcomes) controlling for ADHD symptoms, psychiatric comorbidity, and executive dysfunction. Adults with ADHD significantly differed from controls across nearly all TCI personality domains. On average, adults with ADHD endorsed more novelty seeking, harm avoidance, and self-transcendence, and less reward dependence, persistence, self-directedness, and cooperativeness. Personality traits and characteristics, especially self-directedness, significantly predicted functional impairments even after controlling for ADHD symptoms, executive function deficits, and current psychiatric comorbidities. In adults with ADHD, personality traits exert unique associations on quality of life and functional impairment across major life domains, beyond the relations expected of and associated with ADHD symptoms and other associated psychiatric conditions and cognitive vulnerabilities. Addressing personality traits in adults with ADHD may lead to improvements in quality of life and reductions in functional impairment. © The Author(s) 2015.

  5. Abnormal mitochondrial function impairs calcium influx in diabetic mouse pancreatic beta cells

    Institute of Scientific and Technical Information of China (English)

    LI Fei; D. Marshall Porterfield; ZHENG Xi-yan; WANG Wen-jun; XU Yue; ZHANG Zong-ming

    2012-01-01

    Background Abnormal insulin secretion of pancreatic beta cells is now regarded as the more primary defect than the insulin function in the etiology of type 2 diabetes.Previous studies found impaired mitochondrial function and impaired Ca2+ influx in beta cells in diabetic patients and animal models,suggesting a role for these processes in proper insulin secretion.The aim of this study was to investigate the detailed relationship of mitochondrial function,Ca2+ influx,and defective insulin secretion.Methods We investigated mitochondrial function and morphology in pancreatic beta cell of diabetic KK-Ay mice and C57BL/6J mice.Two types of Ca2+ channel activities,L-type and store-operated Ca2+ (SOC),were evaluated using whole-cell patch-clamp recording.The glucose induced Ca2+ influx was measured by a non-invasive micro-test technique (NMT).Results Mitochondria in KK-Ay mice pancreatic beta cells were swollen with disordered cristae,and mitochondrial function decreased compared with C57BL/6J mice.Ca2+ channel activity was increased and glucose induced Ca2+ influx was impaired,but could be recovered by genipin.Conclusion Defective mitochondrial function in diabetic mice pancreatic beta cells is a key cause of abnormal insulin secretion by altering Ca2+ influx,but not via Ca2+ channel activity.

  6. Abnormal functioning of the left temporal lobe in language-impaired children.

    Science.gov (United States)

    Helenius, Päivi; Sivonen, Päivi; Parviainen, Tiina; Isoaho, Pia; Hannus, Sinikka; Kauppila, Timo; Salmelin, Riitta; Isotalo, Leena

    2014-03-01

    Specific language impairment is associated with enduring problems in language-related functions. We followed the spatiotemporal course of cortical activation in SLI using magnetoencephalography. In the experiment, children with normal and impaired language development heard spoken real words and pseudowords presented only once or two times in a row. In typically developing children, the activation in the bilateral superior temporal cortices was attenuated to the second presentation of the same word. In SLI children, this repetition effect was nearly nonexistent in the left hemisphere. Furthermore, the activation was equally strong to words and pseudowords in SLI children whereas in the typically developing children the left hemisphere activation persisted longer for pseudowords than words. Our results indicate that the short-term maintenance of linguistic activation that underlies spoken word recognition is defective in SLI particularly in the left language-dominant hemisphere. The unusually rapid decay of speech-evoked activation can contribute to impaired vocabulary growth.

  7. Functional and structural alterations of epithelial barrier properties of rat ileum following X-irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Dublineau, I. [Inst. de Radioprotection et de Surete Nucleaire (IRSN), Direction de la RadioProtection de l' Homme, Service de Radiobiologie et d' Epidemiologie, Fontenay-aux-Roses, CEDEX (France)]. E-mail: isabelle.dublineau@irsn.fr; Lebrun, F. [Commissariat a l' Energie Atomique (CEA), Dept. de Radiopathologie et de Radiobiologie, Fontenay-aux-Roses, CEDEX (France); Grison, S.; Griffiths, N.M. [Inst. de Radioprotection et de Surete Nucleaire (IRSN), Direction de la RadioProtection de l' Homme, Service de Radiobiologie et d' Epidemiologie, Fontenay-aux-Roses, CEDEX (France)

    2004-02-01

    Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to {sup 14}C-mannitol and {sup 3}H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and {beta}-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and {beta}-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)

  8. Flow directionality, mountain barriers and functional traits determine diatom metacommunity structuring of high mountain streams.

    Science.gov (United States)

    Dong, Xiaoyu; Li, Bin; He, Fengzhi; Gu, Yuan; Sun, Meiqin; Zhang, Haomiao; Tan, Lu; Xiao, Wen; Liu, Shuoran; Cai, Qinghua

    2016-04-19

    Stream metacommunities are structured by a combination of local (environmental filtering) and regional (dispersal) processes. The unique characters of high mountain streams could potentially determine metacommunity structuring, which is currently poorly understood. Aiming at understanding how these characters influenced metacommunity structuring, we explored the relative importance of local environmental conditions and various dispersal processes, including through geographical (overland), topographical (across mountain barriers) and network (along flow direction) pathways in shaping benthic diatom communities. From a trait perspective, diatoms were categorized into high-profile, low-profile and motile guild to examine the roles of functional traits. Our results indicated that both environmental filtering and dispersal processes influenced metacommunity structuring, with dispersal contributing more than environmental processes. Among the three pathways, stream corridors were primary pathway. Deconstructive analysis suggested different responses to environmental and spatial factors for each of three ecological guilds. However, regardless of traits, dispersal among streams was limited by mountain barriers, while dispersal along stream was promoted by rushing flow in high mountain stream. Our results highlighted that directional processes had prevailing effects on metacommunity structuring in high mountain streams. Flow directionality, mountain barriers and ecological guilds contributed to a better understanding of the roles that mountains played in structuring metacommunity.

  9. Autophagy enhances intestinal epithelial tight junction barrier function by targeting claudin-2 protein degradation.

    Science.gov (United States)

    Nighot, Prashant K; Hu, Chien-An Andy; Ma, Thomas Y

    2015-03-13

    Autophagy is an intracellular degradation pathway and is considered to be an essential cell survival mechanism. Defects in autophagy are implicated in many pathological processes, including inflammatory bowel disease. Among the innate defense mechanisms of intestinal mucosa, a defective tight junction (TJ) barrier has been postulated as a key pathogenic factor in the causation and progression of inflammatory bowel disease by allowing increased antigenic permeation. The cross-talk between autophagy and the TJ barrier has not yet been described. In this study, we present the novel finding that autophagy enhances TJ barrier function in Caco-2 intestinal epithelial cells. Nutrient starvation-induced autophagy significantly increased transepithelial electrical resistance and reduced the ratio of sodium/chloride paracellular permeability. Nutrient starvation reduced the paracellular permeability of small-sized urea but not larger molecules. The role of autophagy in the modulation of paracellular permeability was confirmed by pharmacological induction as well as pharmacological and genetic inhibition of autophagy. Consistent with the autophagy-induced reduction in paracellular permeability, a marked decrease in the level of the cation-selective, pore-forming TJ protein claudin-2 was observed after cell starvation. Starvation reduced the membrane presence of claudin-2 and increased its cytoplasmic, lysosomal localization. Therefore, our data show that autophagy selectively reduces epithelial TJ permeability of ions and small molecules by lysosomal degradation of the TJ protein claudin-2.

  10. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. The Importance of Saccular Function to Motor Development in Children with Hearing Impairments

    Directory of Open Access Journals (Sweden)

    Mary S. Shall

    2009-01-01

    Full Text Available Children with hearing deficits frequently have delayed motor development. The purpose of this study was to evaluate saccular function in children with hearing impairments using the Vestibular Evoked Myogenic Potential (VEMP. The impact of the saccular hypofunction on the timely maturation of normal balance strategies was examined using the Movement Assessment Battery for Children (Movement ABC. Thirty-three children with bilateral severe/profound hearing impairment between 4 and 7 years of age were recruited from a three-state area. Approximately half of the sample had one or bilateral cochlear implants, one used bilateral hearing aids, and the rest used no amplification. Parents reported whether the hearing impairment was diagnosed within the first year or after 2 years of age. No VEMP was evoked in two thirds of the hearing impaired (HI children in response to the bone-conducted stimulus. Children who were reportedly hearing impaired since birth had significantly poorer scores when tested with the Movement ABC.

  12. Role of Melatonin, Neuropeptide S and Short Chain Fatty Acids in Regulation of Duodenal Mucosal Barrier Function and Motility

    OpenAIRE

    Wan Saudi, Wan Salman

    2015-01-01

    The duodenal epithelium is regularly exposed to HCl, digestive enzymes, bacteria and toxins, and sometimes also to ethanol and drugs. The imbalance of aggressive factors in the intestinal lumen and mucosal barrier function increases the risk of tissue injury and inflammation. The key components of the duodenal barrier function include mucosal permeability, bicarbonate transport and the secretion or absorption of fluids. This thesis aims to elucidate the role of melatonin, neuropeptide S (NPS)...

  13. An O(√nL) Iteration Large-Step Logarithmic Barrier Function Algorithm for Linear Programming

    OpenAIRE

    TONE, Kaoru

    1989-01-01

    As a natural extension of Roos and Vial's "Long steps with logarithmic penalty barrier function in llnear programming" (1989) and Ye's "An O(n³L) potential reduction algorithm for linear programming" (1989), it will be shown that the classical logarithmic barrier function method can be adjusted so that it generates the optimal solution in O(√nL) iterations, where n is the number of variables and L is the data length.

  14. Faecalibacterium prausnitzii supernatant improves intestinal barrier function in mice DSS colitis.

    Science.gov (United States)

    Carlsson, Anders H; Yakymenko, Olena; Olivier, Isabelle; Håkansson, Fathima; Postma, Emily; Keita, Asa V; Söderholm, Johan D

    2013-10-01

    OBJECTIVE. The intestinal microbiota plays a substantial role in the pathogenesis of inflammatory bowel disease (IBD). Faecalibacterium prausnitzii (FP) is underrepresented in IBD patients and have been suggested to have anti-inflammatory effects in mice. Increased intestinal permeability is common in IBD but the relationship between FP and intestinal barrier function has not been investigated. Our aim was to study treatment with FP supernatant on intestinal barrier function in a dextran sodium sulfate (DSS) colitis mice model. MATERIAL AND METHODS. C57BL/6 mice received 3% DSS in tap water ad libitum during five days to induce colitis. From day 3 the mice received a daily gavage with FP supernatant or broth during seven days. Ileum and colon were mounted in Ussing chambers for permeability studies with (51)Cr-EDTA and Escherichia coli K-12. Colon was saved for Western blot analyses of tight junction proteins. RESULTS. DSS-treated mice showed significant weight loss and colon shortening. Gavage with FP supernatant resulted in a quicker recovery after DSS treatment and less extensive colonic shortening. Ileal mucosa of DSS mice showed a significant increase in (51)Cr-EDTA-passage compared to controls. (51)Cr-EDTA passage was significantly decreased in mice receiving FP supernatant. No significant differences were observed in passage of E. coli K12. Western blots showed a trend to increased claudin-1 and claudin-2 expressions in DSS mice. CONCLUSIONS. Supernatant of FP enhances the intestinal barrier function by affecting paracellular permeability, and may thereby attenuate the severity of DSS-induced colitis in mice. These findings suggest a potential role of FP in the treatment of IBD.

  15. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema.

    Science.gov (United States)

    Jungersted, J M; Scheer, H; Mempel, M; Baurecht, H; Cifuentes, L; Høgh, J K; Hellgren, L I; Jemec, G B E; Agner, T; Weidinger, S

    2010-07-01

    Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). In the FLGmut AD group, significantly lower levels of ceramide 4 and significantly higher levels of ceramide 7 were observed when compared to both healthy control groups. However, ceramide 7 levels also significantly differed between FLGwt AD and FLGwt controls, as did ceramide 1 levels. No significant differences were observed for ceramide 2, 3, 5 and 6. FLGmut individuals had significantly higher skin pH values than individuals not carrying FLG mutations. Patients with AD with FLG mutations had significantly higher erythema compared to patients with AD without FLG mutations. Our results confirm previous observations of altered ceramide levels in AD, which however appear to show no clear relationship with FLG mutations.

  16. Impaired physical function, loss of muscle mass and assessment of biomechanical properties in critical ill patients

    DEFF Research Database (Denmark)

    Poulsen, Jesper Brøndum

    2012-01-01

    Intensive care unit (ICU) admission is associated with muscle weakness and ICU survivors report sustained limitation of physical capacity for years after discharge. Limited information is available on the underlying biomechanical properties responsible for this muscle function impairment....... A plausible contributor to the accentuated catabolic drive in ICU patients is a synergistic response to inflammation and inactivity leading to loss of muscle mass. As these entities are predominantly present in the early phase of ICU stay, interventions employed during this time frame may exhibit the greatest...... potential to counteract loss of muscle mass. Despite the obvious clinical significance of muscle atrophy for the functional impairment observed in ICU survivors, no preventive therapies have been identified as yet. The overall aim of the present dissertation is to characterize aspects of physical function...

  17. Influence of renal impairment on myocardial function in outpatients with systolic heart failure

    DEFF Research Database (Denmark)

    Bosselmann, Helle; Tønder, Niels; Sölétormos, György

    2014-01-01

    BACKGROUND: Renal dysfunction (RD) is associated with poor outcome in systolic heart failure (HF). Left ventricular ejection fraction (LVEF) is not depressed to a greater extent in patients with RD compared to patients with normal renal function, but it is relatively unknown whether other measures...... of myocardial function are impaired by RD. The objective of the present study is to evaluate whether RD in systolic HF is associated with excessive impairment of myocardial function, evaluated by strain analysis and cardiac biomarkers. METHODS: Patients with LVEF ... models were developed to evaluate the associations between eGFR groups, echocardiographic measures and cardiac biomarkers. RESULTS: A total of 149 patients participated in the study. Median age was 69 years, 26% were female; LVEF was 33%. Patients with a low eGFR were older (P

  18. In your eyes: does theory of mind predict impaired life functioning in bipolar disorder?

    Science.gov (United States)

    Purcell, Amanda L; Phillips, Mary; Gruber, June

    2013-12-01

    Deficits in emotion perception and social functioning are strongly implicated in bipolar disorder (BD). Examining theory of mind (ToM) may provide one potential mechanism to explain observed socio-emotional impairments in this disorder. The present study prospectively investigated the relationship between theory of mind performance and life functioning in individuals diagnosed with BD compared to unipolar depression and healthy control groups. Theory of mind (ToM) performance was examined in 26 individuals with remitted bipolar I disorder (BD), 29 individuals with remitted unipolar depression (UD), and 28 healthy controls (CTL) using a well-validated advanced theory of mind task. Accuracy and response latency scores were calculated from the task. Life functioning was measured during a 12 month follow-up session. No group differences for ToM accuracy emerged. However, the BD group exhibited significantly shorter response times than the UD and CTL groups. Importantly, quicker response times in the BD group predicted greater life functioning impairment at a 12-month follow-up, even after controlling for baseline symptoms. The stimuli were static representations of emotional states and do not allow for evaluating the appropriateness of context during emotional communication; due to sample size, neither specific comorbidities nor medication effects were analyzed for the BD and UD groups; preliminary status of theory of mind as a construct. Results suggest that quickened socio-emotional decision making may represent a risk factor for future functional impairment in BD. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Blood-brain barrier P-glycoprotein function in Alzheimer's disease.

    Science.gov (United States)

    van Assema, Daniëlle M E; Lubberink, Mark; Bauer, Martin; van der Flier, Wiesje M; Schuit, Robert C; Windhorst, Albert D; Comans, Emile F I; Hoetjes, Nikie J; Tolboom, Nelleke; Langer, Oliver; Müller, Markus; Scheltens, Philip; Lammertsma, Adriaan A; van Berckel, Bart N M

    2012-01-01

    A major pathological hallmark of Alzheimer's disease is accumulation of amyloid-β in senile plaques in the brain. Evidence is accumulating that decreased clearance of amyloid-β from the brain may lead to these elevated amyloid-β levels. One of the clearance pathways of amyloid-β is transport across the blood-brain barrier via efflux transporters. P-glycoprotein, an efflux pump highly expressed at the endothelial cells of the blood-brain barrier, has been shown to transport amyloid-β. P-glycoprotein function can be assessed in vivo using (R)-[(11)C]verapamil and positron emission tomography. The aim of this study was to assess blood-brain barrier P-glycoprotein function in patients with Alzheimer's disease compared with age-matched healthy controls using (R)-[(11)C]verapamil and positron emission tomography. In 13 patients with Alzheimer's disease (age 65 ± 7 years, Mini-Mental State Examination 23 ± 3), global (R)-[(11)C]verapamil binding potential values were increased significantly (P = 0.001) compared with 14 healthy controls (aged 62 ± 4 years, Mini-Mental State Examination 30 ± 1). Global (R)-[(11)C]verapamil binding potential values were 2.18 ± 0.25 for patients with Alzheimer's disease and 1.77 ± 0.41 for healthy controls. In patients with Alzheimer's disease, higher (R)-[(11)C]verapamil binding potential values were found for frontal, parietal, temporal and occipital cortices, and posterior and anterior cingulate. No significant differences between groups were found for medial temporal lobe and cerebellum. These data show altered kinetics of (R)-[(11)C]verapamil in Alzheimer's disease, similar to alterations seen in studies where P-glycoprotein is blocked by a pharmacological agent. As such, these data indicate that P-glycoprotein function is decreased in patients with Alzheimer's disease. This is the first direct evidence that the P-glycoprotein transporter at the blood-brain barrier is compromised in sporadic

  20. Stereodynamic tetrahydrobiisoindole “NU-BIPHEP(O”s: functionalization, rotational barriers and non-covalent interactions

    Directory of Open Access Journals (Sweden)

    Golo Storch

    2016-07-01

    Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.

  1. Visual impairment, rehabilitation and International Classification of Functioning, Disability and Health

    Directory of Open Access Journals (Sweden)

    Marissa Romano da Silva

    2014-10-01

    Full Text Available Objetive: To describe the characteristics of people with visual impairment who participated in the Visual Rehabilitation Groups, according to the ICD-10 and the International Classification of Functioning, Disability and Health (ICF. Methods: Quantitative, cross-sectional survey, developed in a university rehabilitation research center between october and december 2012. The users from the Visual Rehabilitation Groups were invited; 13 of them agreed to participate. We performed an occupational therapy evaluation – with anamnesis, performance evaluation and functional vision assessment – an analysis of medical charts and patient description with the use of the ICF Results: The major causes of visual impairment were diabetic retinopathy, glaucoma, optical neuritis and keratoconus. Some functions and structures of the body, performance and capabilities in activities and participation, environmental factors facilitators or limiters were highlighted in this study, allowing the description of the characteristics of each participant through the functionality and the improvement of the therapeutic planning. Assistive technologies, optical and non-optical aids used and their everyday benefits were presented. Conclusion: Visual loss, at any level, led to functional impairments, limiting and restricting the participation and performance in everyday activities, interfering with the individuals’ independence, autonomy and quality of life. However, the use of optical aids, non-optical aids and environmental adaptations proved to be beneficial for increasing the functionality, showing the influence of external factors on the performance. Knowing and recognizing the existence of diversities within the visual impairment universe allows us to understand who the treated individual is, avoiding the generalization by the visual condition. The ICF showed to have a fundamental role in this context.

  2. Impaired fasting glycaemia vs impaired glucose tolerance: similar impairment of pancreatic alpha and beta cell function but differential roles of incretin hormones and insulin action

    DEFF Research Database (Denmark)

    Faerch, K; Vaag, A; Holst, Jens Juul;

    2008-01-01

    AIMS/HYPOTHESIS: The impact of strategies for prevention of type 2 diabetes in isolated impaired fasting glycaemia (i-IFG) vs isolated impaired glucose tolerance (i-IGT) may differ depending on the underlying pathophysiology. We examined insulin secretion during OGTTs and IVGTTs, hepatic and peri...

  3. Blood-brain barrier P-glycoprotein function in neurodegenerative disease.

    Science.gov (United States)

    Bartels, A L

    2011-01-01

    Protection of the brain is strengthened by active transport and ABC transporters. P-glycoprotein (P-gp) at the blood-brain barrier (BBB) functions as an active efflux pump by extruding a substrate from the brain, which is important for maintaining loco-regional homeostasis in the brain and protection against toxic compounds. Importantly, dysfunctional BBB P-gp transport is postulated as an important factor contributing to accumulation of aggregated protein in neurodegenerative disorders such as Alzheimer's disease (AD) and Parkinson's disease (PD). Furthermore, P-gp is a major factor in mediating resistance to brain entry of numerous exogenous compounds, including toxins that can be involved in PD pathogenesis. This review highlights the role of altered P-gp function in the pathogenesis and progression of neurodegenerative disease. Also the implications of alterations in P-gp function for the treatment of these diseases are discussed.

  4. Developing a function impairment measure for children affected by political violence: a mixed methods approach in Indonesia

    NARCIS (Netherlands)

    Tol, W.A.; Komproe, I.H.; Jordans, M.J.D.; Susanty, D.; de Jong, J.T.V.M.

    2011-01-01

    Objective: Practitioners in political violence-affected settings would benefit from rating scales that assess child function impairment in a reliable and valid manner when designing and evaluating interventions. We developed a procedure to construct child function impairment rating scales using reso

  5. Developing a function impairment measure for children affected by political violence: a mixed methods approach in Indonesia

    NARCIS (Netherlands)

    Tol, W.A.; Komproe, I.H.; Jordans, M.J.D.; Susanty, D.; de Jong, J.T.V.M.

    2011-01-01

    Objective: Practitioners in political violence-affected settings would benefit from rating scales that assess child function impairment in a reliable and valid manner when designing and evaluating interventions. We developed a procedure to construct child function impairment rating scales using reso

  6. War experiences, general functioning and barriers to care among former child soldiers in Northern Uganda: the WAYS study.

    Science.gov (United States)

    Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio

    2014-12-01

    Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Microbiome Composition and Function Drives Wound-Healing Impairment in the Female Genital Tract.

    Directory of Open Access Journals (Sweden)

    Alexander S Zevin

    2016-09-01

    Full Text Available The mechanism(s by which bacterial communities impact susceptibility to infectious diseases, such as HIV, and maintain female genital tract (FGT health are poorly understood. Evaluation of FGT bacteria has predominantly been limited to studies of species abundance, but not bacterial function. We therefore sought to examine the relationship of bacterial community composition and function with mucosal epithelial barrier health in the context of bacterial vaginosis (BV using metaproteomic, metagenomic, and in vitro approaches. We found highly diverse bacterial communities dominated by Gardnerella vaginalis associated with host epithelial barrier disruption and enhanced immune activation, and low diversity communities dominated by Lactobacillus species that associated with lower Nugent scores, reduced pH, and expression of host mucosal proteins important for maintaining epithelial integrity. Importantly, proteomic signatures of disrupted epithelial integrity associated with G. vaginalis-dominated communities in the absence of clinical BV diagnosis. Because traditional clinical assessments did not capture this, it likely represents a larger underrepresented phenomenon in populations with high prevalence of G. vaginalis. We finally demonstrated that soluble products derived from G. vaginalis inhibited wound healing, while those derived from L. iners did not, providing insight into functional mechanisms by which FGT bacterial communities affect epithelial barrier integrity.

  8. Microbiome Composition and Function Drives Wound-Healing Impairment in the Female Genital Tract

    Science.gov (United States)

    Arnold, Kelly; Romas, Laura; Westmacott, Garrett; McCorrister, Stuart; McKinnon, Lyle R.; Cohen, Craig R.; Mackelprang, Romel; Lingappa, Jairam; Lauffenburger, Doug A.; Klatt, Nichole R.; Burgener, Adam D.

    2016-01-01

    The mechanism(s) by which bacterial communities impact susceptibility to infectious diseases, such as HIV, and maintain female genital tract (FGT) health are poorly understood. Evaluation of FGT bacteria has predominantly been limited to studies of species abundance, but not bacterial function. We therefore sought to examine the relationship of bacterial community composition and function with mucosal epithelial barrier health in the context of bacterial vaginosis (BV) using metaproteomic, metagenomic, and in vitro approaches. We found highly diverse bacterial communities dominated by Gardnerella vaginalis associated with host epithelial barrier disruption and enhanced immune activation, and low diversity communities dominated by Lactobacillus species that associated with lower Nugent scores, reduced pH, and expression of host mucosal proteins important for maintaining epithelial integrity. Importantly, proteomic signatures of disrupted epithelial integrity associated with G. vaginalis-dominated communities in the absence of clinical BV diagnosis. Because traditional clinical assessments did not capture this, it likely represents a larger underrepresented phenomenon in populations with high prevalence of G. vaginalis. We finally demonstrated that soluble products derived from G. vaginalis inhibited wound healing, while those derived from L. iners did not, providing insight into functional mechanisms by which FGT bacterial communities affect epithelial barrier integrity. PMID:27656899

  9. Regional functional connectivity predicts distinct cognitive impairments in Alzheimer’s disease spectrum

    Directory of Open Access Journals (Sweden)

    Kamalini G. Ranasinghe

    2014-01-01

    Full Text Available Understanding neural network dysfunction in neurodegenerative disease is imperative to effectively develop network-modulating therapies. In Alzheimer’s disease (AD, cognitive decline associates with deficits in resting-state functional connectivity of diffuse brain networks. The goal of the current study was to test whether specific cognitive impairments in AD spectrum correlate with reduced functional connectivity of distinct brain regions. We recorded resting-state functional connectivity of alpha-band activity in 27 patients with AD spectrum − 22 patients with probable AD (5 logopenic variant primary progressive aphasia, 7 posterior cortical atrophy, and 10 early-onset amnestic/dysexecutive AD and 5 patients with mild cognitive impairment due to AD. We used magnetoencephalographic imaging (MEGI to perform an unbiased search for regions where patterns of functional connectivity correlated with disease severity and cognitive performance. Functional connectivity measured the strength of coherence between a given region and the rest of the brain. Decreased neural connectivity of multiple brain regions including the right posterior perisylvian region and left middle frontal cortex correlated with a higher degree of disease severity. Deficits in executive control and episodic memory correlated with reduced functional connectivity of the left frontal cortex, whereas visuospatial impairments correlated with reduced functional connectivity of the left inferior parietal cortex. Our findings indicate that reductions in region-specific alpha-band resting-state functional connectivity are strongly correlated with, and might contribute to, specific cognitive deficits in AD spectrum. In the future, MEGI functional connectivity could be an important biomarker to map and follow defective networks in the early stages of AD.

  10. Constipation-Predominant Irritable Bowel Syndrome Females Have Normal Colonic Barrier and Secretory Function.

    Science.gov (United States)

    Peters, Stephanie A; Edogawa, Shoko; Sundt, Wendy J; Dyer, Roy B; Dalenberg, Daniel A; Mazzone, Amelia; Singh, Ravinder J; Moses, Natalie; Smyrk, Thomas C; Weber, Christopher; Linden, David R; MacNaughton, Wallace K; Turner, Jerrold R; Camilleri, Michael; Katzka, David A; Farrugia, Gianrico; Grover, Madhusudan

    2017-06-01

    The objective of this study was to determine whether constipation-predominant irritable bowel syndrome (IBS-C) is associated with changes in intestinal barrier and secretory function. A total of 19 IBS-C patients and 18 healthy volunteers (all females) underwent saccharide excretion assay (0.1 g (13)C mannitol and 1 g lactulose), measurements of duodenal and colonic mucosal barrier (transmucosal resistance (TMR), macromolecular and Escherichia coli Bio-Particle translocation), mucosal secretion (basal and acetylcholine (Ach)-evoked short-circuit current (Isc)), in vivo duodenal mucosal impedance, circulating endotoxins, and colonic tight junction gene expression. There were no differences in the in vivo measurements of barrier function between IBS-C patients and healthy controls: cumulative excretion of (13)C mannitol (0-2 h mean (s.e.m.); IBS-C: 12.1 (0.9) mg vs. healthy: 13.2 (0.8) mg) and lactulose (8-24 h; IBS-C: 0.9 (0.5) mg vs. healthy: 0.5 (0.2) mg); duodenal impedance IBS-C: 729 (65) Ω vs. healthy: 706 (43) Ω; plasma mean endotoxin activity level IBS-C: 0.36 (0.03) vs. healthy: 0.35 (0.02); and in colonic mRNA expression of occludin, zonula occludens (ZO) 1-3, and claudins 1-12 and 14-19. The ex vivo findings were consistent, with no group differences: duodenal TMR (IBS-C: 28.2 (1.9) Ω cm(2) vs. healthy: 29.8 (1.9) Ω cm(2)) and colonic TMR (IBS-C: 19.1 (1.1) Ω cm(2) vs. healthy: 17.6 (1.7) Ω cm(2)); fluorescein isothiocyanate (FITC)-dextran (4 kDa) and E. coli Bio-Particle flux. Colonic basal Isc was similar, but duodenal basal Isc was lower in IBS-C (43.5 (4.5) μA cm(-2)) vs. healthy (56.9 (4.9) μA cm(-2)), P=0.05. Ach-evoked ΔIsc was similar. Females with IBS-C have normal colonic barrier and secretory function. Basal duodenal secretion is decreased in IBS-C.

  11. Cholinergic depletion in nucleus accumbens impairs mesocortical dopamine activation and cognitive function in rats.

    Science.gov (United States)

    Laplante, François; Zhang, Zi-Wei; Huppé-Gourgues, Frédéric; Dufresne, Marc M; Vaucher, Elvire; Sullivan, Ron M

    2012-11-01

    In rats, selective depletion of the cholinergic interneurons in the ventral striatum (nucleus accumbens or N.Acc.) results in heightened behavioural sensitivity to amphetamine and impaired sensorimotor gating processes, suggesting a hyper-responsiveness to dopamine (DA) activity in the N.Acc. We hypothesized that local cholinergic depletion may also trigger distal functional alterations, particularly in prefrontal cortex (PFC). Adult male Sprague-Dawley rats were injected bilaterally in the N.Acc. with an immunotoxin targeting choline acetyltransferase. Two weeks later, cognitive function was assessed using the delayed alternation paradigm in the T-maze. The rats were then implanted with voltammetric recording electrodes in the ventromedial PFC to measure in vivo extracellular DA release in response to mild tail pinch stress. The PFC was also examined for density of tyrosine hydroxylase (TH)-labelled varicosities. In another cohort of control and lesioned rats, we measured post mortem tissue content of DA. Depletion of cholinergic neurons (restricted to N.Acc.) significantly impaired delayed alternation performance across delay intervals. While (basal) post mortem indices of PFC DA function were unaffected by N.Acc. lesions, in vivo mesocortical DA activation was markedly reduced; this deficit correlated significantly with cognitive impairments. TH-labelled varicosities however, were unaffected in cortical layer V relative to controls. These data suggest that selective depletion of cholinergic interneurons in N.Acc. triggers widespread functional impairments in mesocorticolimbic DA function and cognition. The possible relevance of these findings is also discussed in relation to schizophrenia, where reduced density of cholinergic neurons in ventral striatum has been reported. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Depression and pain impair daily functioning and quality of life in patients with major depressive disorder.

    Science.gov (United States)

    Lin, Ching-Hua; Yen, Yung-Chieh; Chen, Ming-Chao; Chen, Cheng-Chung

    2014-09-01

    Depression and pain frequently occur together. The objective of this study was to investigate the effects of depression and pain on the impairment of daily functioning and quality of life (QOL) of depressed patients. We enrolled 131 acutely ill inpatients with major depressive disorder. Depression, pain, and daily functioning were assessed using the 17-item Hamilton Depression Rating Scale, the Short-Form 36 (SF-36) Body Pain Index, and the Work and Social Adjustment Scale. Health-related QOL was assessed using three primary domains of the SF-36: social functioning, vitality, and general health perceptions. Pearson׳s correlation and structural equation modeling were used to examine relationships among the study variables. Five models were proposed. In all, 129 patients completed all the measures. Model 5, both depression and pain impaired daily functioning and QOL, was the most fitted structural equation model (χ(2)=9.2, df=8, p=0.33, GFI=0.98, AGFI=0.94, TLI=0.99, CFI=0.99, RMSEA=0.03). The correlation between pain and depression was weak (r=-0.27, z=-2.95, p=0.003). This was a cross-sectional study with a small sample size. Depression and pain exert a direct influence on the impairment of daily functioning and QOL of depressed patients; this impairment could be expected regardless of increased pain, depression, or both pain and depression. Pain had a somewhat separate entity from depression. Copyright © 2014. Published by Elsevier B.V.

  13. Aids to Overcome Architectural Barriers: Normatives, Contributions and Concessions:Government contribution in removing physical barriers to improve integration of people with impaired mobility—ltalian case%Aids to Overcome Architectural Barriers:Normatives,Contributions and Concessions:Government contribution in removing physical barriers to improve integration of people with impaired mobility—ltalian case

    Institute of Scientific and Technical Information of China (English)

    Elisabetta Turina; Carlo Belletti

    2011-01-01

    In previous articles we described how the Italian system of aid for people with disabilities also provides a system of incentives and subsidies for devices that are very useful,in addition to the provision of aids that are granted free of charge as required under an individual rehabilitation plan.We have also seen as aids for overcoming architectural barriers are (rightly!) in the first place among those who are essential for people with disabilities to lead an independent life and to be able to access public and private places,in particular workplaces.Without removing of architectural barriers it is impossible to achieve many of the rights decreed by the Italian law n.104 and n.68 (work integration of disabled people).Here you can find the incentives provided by Italian law and the features of the two most common systems:stairlifts and platform lifts.

  14. Social and functional health of home care clients with different levels of cognitive impairments.

    Science.gov (United States)

    Garms-Homolová, Vjenka; Notthoff, Nanna; Declercq, Anja; van der Roest, Henriette G; Onder, Graziano; Jónsson, Pálmi; van Hout, Hein

    2017-01-01

    The ability to manage one's life with some degree of independence, to fulfill basic obligations, and to participate in social activities are social functions that delineate the core of 'social health'. We examine to what extent clients of community care in Europe (n = 2884) complete such activities despite their cognitive problems. We focus on mildly and moderately impaired people, aged 65+ years. Data were collected using the interRAI HC-Assessment in IBenC-project. We tested the association between participants' capacity and performance in three LADLs (instrumental activities of daily living) and their cognitive performance and specific memory problems. About 30% of home care clients in Europe suffer from mild-to-moderate cognitive impairment. Their relatively independent coping with requirements of routine activities is strongly determined by overall cognitive performance. Specific memory functions seem unimportant, except for procedural memory. It is striking that all clients, and particularly those with mild-to-moderate cognitive impairment, interact mostly with close relatives and friends. Mild-to-moderate cognitive limitations do not hinder clients from coping semi-independently with routine requirements. When considering the influence of cognitive function on clients' capacity and performance in everyday activities and social relations, a comprehensive construct of cognitive function has to be applied.

  15. Multi-walled carbon nanotube instillation impairs pulmonary function in C57BL/6 mice

    Directory of Open Access Journals (Sweden)

    Walters Dianne M

    2011-08-01

    Full Text Available Abstract Background Multi-walled carbon nanotubes (MWCNTs are widely used in many disciplines due to their unique physical and chemical properties. Therefore, some concerns about the possible human health and environmental impacts of manufactured MWCNTs are rising. We hypothesized that instillation of MWCNTs impairs pulmonary function in C57BL/6 mice due to development of lung inflammation and fibrosis. Methods MWCNTs were administered to C57BL/6 mice by oropharyngeal aspiration (1, 2, and 4 mg/kg and we assessed lung inflammation and fibrosis by inflammatory cell infiltration, collagen content, and histological assessment. Pulmonary function was assessed using a FlexiVent system and levels of Ccl3, Ccl11, Mmp13 and IL-33 were measured by RT-PCR and ELISA. Results Mice administered MWCNTs exhibited increased inflammatory cell infiltration, collagen deposition and granuloma formation in lung tissue, which correlated with impaired pulmonary function as assessed by increased resistance, tissue damping, and decreased lung compliance. Pulmonary exposure to MWCNTs induced an inflammatory signature marked by cytokine (IL-33, chemokine (Ccl3 and Ccl11, and protease production (Mmp13 that promoted the inflammatory and fibrotic changes observed within the lung. Conclusions These results further highlight the potential adverse health effects that may occur following MWCNT exposure and therefore we suggest these materials may pose a significant risk leading to impaired lung function following environmental and occupational exposures.

  16. Functional characterisation of the maturation of the blood-brain barrier in larval zebrafish.

    Directory of Open Access Journals (Sweden)

    Angeleen Fleming

    Full Text Available Zebrafish are becoming increasingly popular as an organism in which to model human disease and to study the effects of small molecules on complex physiological and pathological processes. Since larvae are no more than a few millimetres in length, and can live in volumes as small as 100 microliters, they are particularly amenable to high-throughput and high content compound screening in 96 well plate format. There is a growing literature providing evidence that many compounds show similar pharmacological effects in zebrafish as they do in mammals, and in particular humans. However, a major question regarding their utility for small molecule screening for neurological conditions is whether a molecule will reach its target site within the central nervous system. Studies have shown that Claudin-5 and ZO-1, tight-junction proteins which are essential for blood-brain barrier (BBB integrity in mammals, can be detected in some cerebral vessels in zebrafish from 3 days post-fertilisation (d.p.f. onwards and this timing coincides with the retention of dyes, immunoreactive tracers and fluorescent markers within some but not all cerebral vessels. Whilst these findings demonstrate that features of a BBB are first present at 3 d.p.f., it is not clear how quickly the zebrafish BBB matures or how closely the barrier resembles that of mammals. Here, we have combined anatomical analysis by transmission electron microscopy, functional investigation using fluorescent markers and compound uptake using liquid chromatography/tandem mass spectrometry to demonstrate that maturation of the zebrafish BBB occurs between 3 d.p.f. and 10 d.p.f. and that this barrier shares both structural and functional similarities with that of mammals.

  17. BRONCHOALVEOLAR LAVAGE CELL ANALYSIS AND LUNG-FUNCTION IMPAIRMENT IN PATIENTS WITH SYSTEMIC LUPUS-ERYTHEMATOSUS (SLE)

    NARCIS (Netherlands)

    GROEN, H; ASLANDER, M; BOOTSMA, H; VANDERMARK, TW; KALLENBERG, CGM; POSTMA, DS

    1993-01-01

    We examined the relationship between peripheral blood and bronchoalveolar lavage (BAL) lymphocyte phenotypes and lung function in 19 patients with SLE, and evaluated their association with disease activity. Lung function assessment showed a mildly restrictive pattern with frequent impairment of

  18. Factors contributing to impaired self-awareness of cognitive functioning in an HIV positive and at-risk population

    Science.gov (United States)

    Juengst, Shannon; Skidmore, Elizabeth; Pramuka, Michael; McCue, Michael; Becker, James

    2012-01-01

    Purpose To examine the association between self-awareness of cognitive impairment and age, selected mood disorders, and type and severity of cognitive impairment in a sample of individuals with HIV/AIDS and at risk for HIV. Method 75 subjects, 52 HIV+ and 23 at risk for HIV completed a psychosocial interview, the Patient’s Assessment of Own Functioning (PAOF) questionnaire, and a battery of neuropsychological tests. Based upon the differences between their clinical impairment and self-reported impairment, subjects were classified as being “Underestimators”, “Good Awareness”, or “Impaired Awareness” with regard to self-awareness. Results Those with more severe cognitive impairment were less aware than those with normal or borderline cognitive impairment. A one-way ANOVA suggested that the Impaired Awareness group differed significantly from the Underestimators on the Rey Figure Immediate and Delayed Recall tasks, and from both the Underestimators and Good Awarenesss groups on the Digit Symbol Substitution Task. There were significant differences among all awareness groups on the test of Simple Reaction Time. Furthermore there is some suggestion that age may contribute to impaired self-awareness. The role of HIV in self-awareness remains unclear, as both, individuals with HIV and at risk, demonstrated impaired self-awareness. Conclusions Overall, impaired awareness was associated with poorer test performance, suggesting a relationship between awareness and sustained complex attention and visual spatial processing. This research has implications for understanding factors contributing to poor awareness among individuals with cognitive impairment. PMID:21870997

  19. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  20. Impairment of blood brain barrier is related with the neuroinflammation induced peripheral immune status in intracerebroventricular colchicine injected rats: An experimental study with mannitol.

    Science.gov (United States)

    Sil, Susmita; Ghosh, Arijit; Ghosh, Tusharkanti

    2016-09-01

    The neurodegeneration in AD patients may be associated with changes of peripheral immune responses. Some peripheral immune responses are altered due to neuroinflammation in colchicine induced AD (cAD) rats. The leaky blood brain barrier (BBB) in cAD-rats may be involved in inducing peripheral inflammation, though there is no report in this regard. Therefore, the present study was designed to investigate the role of BBB in cADrats by altering the BBB in a time dependent manner with injection (i.v.) of mannitol (BBB opener). The inflammatory markers in the brain and serum along with the peripheral immune responses were measured after 30 and 60min of mannitol injection in cAD rats. The results showed higher inflammatory markers in the hippocampus and serum along with alterations in peripheral immune parameters in cAD rats. Although the hippocampal inflammatory markers did not further change after mannitol injection in cAD rats, the serum inflammatory markers and peripheral immune responses were altered and these changes were greater after 60min than that of 30min of mannitol injection. The present study shows that the peripheral immune responses in cAD rats after 30 and 60min of mannitol injection are related to magnitude of impairment of BBB in these conditions. It can be concluded from this study that impairment of BBB in cAD rats is related to the changes of peripheral immune responses observed in that condition.

  1. The acoustical Klein-Gordon equation: the wave-mechanical step and barrier potential functions.

    Science.gov (United States)

    Forbes, Barbara J; Pike, E Roy; Sharp, David B

    2003-09-01

    The transformed form of the Webster equation is investigated. Usually described as analogous to the Schrödinger equation of quantum mechanics, it is noted that the second-order time dependency defines a Klein-Gordon problem. This "acoustical Klein-Gordon equation" is analyzed with particular reference to the acoustical properties of wave-mechanical potential functions, U(x), that give rise to geometry-dependent dispersions at rapid variations in tract cross section. Such dispersions are not elucidated by other one-dimensional--cylindrical or conical--duct models. Since Sturm-Liouville analysis is not appropriate for inhomogeneous boundary conditions, the exact solution of the Klein-Gordon equation is achieved through a Green's-function methodology referring to the transfer matrix of an arbitrary string of square potential functions, including a square barrier equivalent to a radiation impedance. The general conclusion of the paper is that, in the absence of precise knowledge of initial conditions on the area function, any given potential function will map to a multiplicity of area functions of identical relative resonance characteristics. Since the potential function maps uniquely to the acoustical output, it is suggested that the one-dimensional wave physics is both most accurately and most compactly described within the Klein-Gordon framework.

  2. Effect of probiotics in combined with alanyl glutamine on gut barrier function in severely ill patients

    Institute of Scientific and Technical Information of China (English)

    Wei-Peng Song; Li Liu

    2015-01-01

    Objective:To study the protectve effect of probiotics in combined with alanyl glutamine (Gln) on gut barrier function in severely ill patients.Methods:A total of 108 critically ill patients with gastrointestinal diseases were included in the study and randomized into the normal PN group (n=36), the probiotics group (n=36), and the combination group (n=36), which were treated by the conventional parenteral nutrition (PN), PN+probiotics, PN+probiotics+Gln, respectively. The actulose/mannitol (L/M) ratio, and serum endotoxin, lactobacillus and gram-negative bacterium concentrations before operation, the 3rd day and the 8th day after operation in the three groups were determined.Results:The L/M ratio and the serum endotoxin concentration the 8th day after operation in the probiotics group were significantly lower than those in the PN group, while those in the combination group were also significantly lower than those in the probiotics group. The lactobacillus concentration in the probiotics was significantly higher than that in the PN group, while that in the combination group were also significantly higher than that in the probiotics group. The comparison of the gram-negative bacterium concentration among the three groups was not statistically significant.Conclusions:The combination of probiotics in combined with Gln in protecting the gut barrier function has a better effect.

  3. Two essential peritrophic matrix proteins mediate matrix barrier functions in the insect midgut.

    Science.gov (United States)

    Agrawal, Sinu; Kelkenberg, Marco; Begum, Khurshida; Steinfeld, Lea; Williams, Clay E; Kramer, Karl J; Beeman, Richard W; Park, Yoonseong; Muthukrishnan, Subbaratnam; Merzendorfer, Hans

    2014-06-01

    The peritrophic matrix (PM) in the midgut of insects consists primarily of chitin and proteins and is thought to support digestion and provide protection from abrasive food particles and enteric pathogens. We examined the physiological roles of 11 putative peritrophic matrix protein (PMP) genes of the red flour beetle, Tribolium castaneum (TcPMPs). TcPMP genes are differentially expressed along the length of the midgut epithelium of feeding larvae. RNAi of individual PMP genes revealed no abnormal developmental phenotypes for 9 of the 11 TcPMPs. However, RNAi for two PMP genes, TcPMP3 and TcPMP5-B, resulted in depletion of the fat body, growth arrest, molting defects and mortality. In situ permeability assays after oral administration of different-sized FITC-dextran beads demonstrated that the exclusion size of the larval peritrophic matrix (PM) decreases progressively from >2 MDa to RNAi for TcPMP3 and TcPMP5-B, these dextrans penetrated the epithelium of the median midgut, indicating loss of structural integrity and barrier function of the larval PM. In contrast, RNAi for TcPMP5-B, but not RNAi for TcPMP3, resulted in breakdown of impermeability to 4 and 40 kDa dextrans in the PM of the posterior midgut. These results suggest that specific PMPs are involved in the regulation of PM permeability, and that a gradient of barrier function is essential for survival and fat body maintenance.

  4. Functional implications of corticospinal tract impairment on gait after spinal cord injury

    DEFF Research Database (Denmark)

    Barthélemy, Dorothy; Knudsen, Hanne; Willerslev-Olsen, Maria

    2013-01-01

    Objective:Maximum toe elevation during walking is an objective measure of foot drop and reflects the impairment of the corticospinal tract (CST) in persons with spinal cord injury (SCI). To determine if this measurement is functionally relevant to ambulatory abilities, we correlated maximum toe...... elevation with clinical physiotherapy tests.Setting:Cross-sectional study, laboratory and clinical settings.Methods:A total of 24 individuals with SCI (American Spinal Injury Association (ASIA) Impairment Scale D) were recruited. Maximum toe elevation during the swing phase of treadmill gait was measured...... with a kinematic system. CST function was assessed in a sitting position by measuring the motor-evoked potentials (MEPs) induced in tibialis anterior muscle with transcranial magnetic stimulation over the motor cortex. Clinical tests performed were 10-m and 6-min walk test (6MWT), Timed-Up and Go (TUG), Walking...

  5. Neurocognitive Function in HIV-Infected Patients: Comparison of Two Methods to Define Impairment

    Science.gov (United States)

    Arenas-Pinto, Alejandro; Winston, Alan; Stöhr, Wolfgang; Day, John; Wiggins, Rebecca; Quah, Say Pheng; Ainsworth, Jonathan; Fleck, Sue; Dunn, David; Accoroni, Alex; Paton, Nicholas I.

    2014-01-01

    Objective To compare two definitions of neurocognitive impairment (NCI) in a large clinical trial of effectively-treated HIV-infected adults at baseline. Methods Hopkins Verbal Learning test-Revised (HVLT-R), Colour Trail (CTT) and Grooved Pegboard (GPT) tests were applied exploring five cognitive domains. Raw scores were transformed into Z-scores and NCI defined as summary NPZ-5 score one standard deviation below the mean of the normative dataset (i.e. <−1SD) or Z-scores <−1SD in at least two individual domains (categorical scale). Principal component analysis (PCA) was performed to explore the contribution of individual tests to the total variance. Results Mean NPZ-5 score was −0.72 (SD 0.98) and 178/548 (32%) participants had NPZ-5 scores <−1SD. When impairment was defined as <−1SD in at least two individual tests, 283 (52%) patients were impaired. Strong correlations between the two components of the HVLT-R test (learning/recall) (r = 0.73), and the CTT and (attention/executive functioning) (r = 0.66) were observed. PCA showed a clustering with three components accounting for 88% of the total variance. When patients who scored <−1SD only in two correlated tests were considered as not impaired, prevalence of NCI was 43%. When correlated test scores were averaged, 36% of participants had NPZ-3 scores <−1SD and 32% underperformed in at least two individual tests. Conclusion Controlling for differential contribution of individual test-scores on the overall performance and the level of correlation between components of the test battery used appear to be important when testing cognitive function. These two factors are likely to affect both summary scores and categorical scales in defining cognitive impairment. Trial registration EUDRACT: 2007-006448-23 and ISRCTN04857074. PMID:25078406

  6. Loss of hippocampal function impairs pattern separation on a mouse touch-screen operant paradigm.

    Science.gov (United States)

    Josey, Megan; Brigman, Jonathan L

    2015-11-01

    The hippocampus is heavily involved in the learning and memory processes necessary to successfully encode environmental stimuli and representations over time. Impairment of hippocampal function is associated with numerous neuropsychiatric diseases and can lead to detriments in the quality of life. In order to take full advantage of preclinical models of these disorders, there is a need for the development of more refined measures of clinically relevant hippocampal behaviors. While arena-based navigation tasks have provided fundamental information regarding the role of the hippocampus in spatial memory, the development of automated operant variants have had mixed results. Recently, an automated touch-screen paradigm has been shown to be highly sensitive to hippocampal function in the rat and eliminated mediating strategies that arose in previous tasks. Here we show that mice with lesions encompassing the entire ventral portion of the dorsal hippocampus are impaired on pattern separation behavior using a delayed nonmatching-to-location (TUNL) adapted for mice. Lesioned mice readily acquired the task at control rates when separations were maximal and delay periods were short while decreasing separations significantly impaired lesion mice. However, in contrast to previously reported results in the rat, consistently increasing delays did not significantly impair performance in the lesion group. Presentation of a variable delay within a session significantly impaired performance in lesion mice across delay periods. The current results demonstrate the utility of a touch-screen paradigm for measuring hippocampal-dependent pattern separation in the mouse and establish the paradigm as an important platform for future studies in disease models.

  7. Neurocognitive function in HIV-infected patients: comparison of two methods to define impairment.

    Directory of Open Access Journals (Sweden)

    Alejandro Arenas-Pinto

    Full Text Available To compare two definitions of neurocognitive impairment (NCI in a large clinical trial of effectively-treated HIV-infected adults at baseline.Hopkins Verbal Learning test-Revised (HVLT-R, Colour Trail (CTT and Grooved Pegboard (GPT tests were applied exploring five cognitive domains. Raw scores were transformed into Z-scores and NCI defined as summary NPZ-5 score one standard deviation below the mean of the normative dataset (i.e. <-1SD or Z-scores <-1SD in at least two individual domains (categorical scale. Principal component analysis (PCA was performed to explore the contribution of individual tests to the total variance.Mean NPZ-5 score was -0.72 (SD 0.98 and 178/548 (32% participants had NPZ-5 scores <-1SD. When impairment was defined as <-1SD in at least two individual tests, 283 (52% patients were impaired. Strong correlations between the two components of the HVLT-R test (learning/recall (r = 0.73, and the CTT and (attention/executive functioning (r = 0.66 were observed. PCA showed a clustering with three components accounting for 88% of the total variance. When patients who scored <-1SD only in two correlated tests were considered as not impaired, prevalence of NCI was 43%. When correlated test scores were averaged, 36% of participants had NPZ-3 scores <-1SD and 32% underperformed in at least two individual tests.Controlling for differential contribution of individual test-scores on the overall performance and the level of correlation between components of the test battery used appear to be important when testing cognitive function. These two factors are likely to affect both summary scores and categorical scales in defining cognitive impairment.EUDRACT: 2007-006448-23 and ISRCTN04857074.

  8. Structural and functional cerebral impairments in cirrhotic patients with a history of overt hepatic encephalopathy

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Hua-Jun [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Zhu, Xi-Qi [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Department of Radiology, The Second Hospital of Nanjing, Medical School of Southeast University, Nanjing 210002 (China); Shu, Hao [Department of Neurology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Yang, Ming; Zhang, Yi; Ding, Jie; Wang, Yu [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Teng, Gao-Jun, E-mail: gjteng@vip.sina.com [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China)

    2012-10-15

    Objective: Diffuse brain atrophy has been observed in cirrhotic patients and recent reports have revealed the persistence of cognitive impairment after clinical resolution of overt hepatic encephalopathy. We sought to explore the continued influence of overt hepatic encephalopathy on neurological function by measuring brain resting-state inherent connectivity, based on an investigation of structural abnormalities. Methods: Neuropsychological tests and structural and functional magnetic resonance scanning were conducted in 20 healthy controls and 21 cirrhotic patients with a history of overt hepatic encephalopathy. The analysis of voxel-based morphometry and functional connectivity were performed to detect the alterations in brain structure and function, respectively. Results: Patients showed significantly worse performance in neuropsychological tests as compared with controls, despite apparently normal mental status. Analysis of voxel-based morphometry revealed a decrease in gray matter volume primarily in the midline regions, bilateral insular cortex and caudates, left parahippocampal gyrus, and right cerebellum posterior lobe, while the volume of the bilateral thalamus showed an increase. Of these regions, the posterior cingulate cortex with peak atrophy was selected as the origin for the analysis of functional connectivity. Typical patterns of a default mode network were identified in both groups. Decreased functional connectivity was found in the medial prefrontal gyrus, left inferior parietal lobule, and left middle temporal gyrus in the patients. Conclusions: Both functional and structural impairments were evident after apparent recovery from overt hepatic encephalopathy, demonstrating that brain dysfunction induced by hepatic encephalopathy persisted after clinical resolution and provided a basis for further evolution of the disease.

  9. Exposure to lipopolysaccharide and/or unconjugated bilirubin impair the integrity and function of brain microvascular endothelial cells.

    Directory of Open Access Journals (Sweden)

    Filipa L Cardoso

    Full Text Available BACKGROUND: Sepsis and jaundice are common conditions in newborns that can lead to brain damage. Though lipopolysaccharide (LPS is known to alter the integrity of the blood-brain barrier (BBB, little is known on the effects of unconjugated bilirubin (UCB and even less on the joint effects of UCB and LPS on brain microvascular endothelial cells (BMEC. METHODOLOGY/PRINCIPAL FINDINGS: Monolayers of primary rat BMEC were treated with 1 µg/ml LPS and/or 50 µM UCB, in the presence of 100 µM human serum albumin, for 4 or 24 h. Co-cultures of BMEC with astroglial cells, a more complex BBB model, were used in selected experiments. LPS led to apoptosis and UCB induced both apoptotic and necrotic-like cell death. LPS and UCB led to inhibition of P-glycoprotein and activation of matrix metalloproteinases-2 and -9 in mono-cultures. Transmission electron microscopy evidenced apoptotic bodies, as well as damaged mitochondria and rough endoplasmic reticulum in BMEC by either insult. Shorter cell contacts and increased caveolae-like invaginations were noticeable in LPS-treated cells and loss of intercellular junctions was observed upon treatment with UCB. Both compounds triggered impairment of endothelial permeability and transendothelial electrical resistance both in mono- and co-cultures. The functional changes were confirmed by alterations in immunostaining for junctional proteins β-catenin, ZO-1 and claudin-5. Enlargement of intercellular spaces, and redistribution of junctional proteins were found in BMEC after exposure to LPS and UCB. CONCLUSIONS: LPS and/or UCB exert direct toxic effects on BMEC, with distinct temporal profiles and mechanisms of action. Therefore, the impairment of brain endothelial integrity upon exposure to these neurotoxins may favor their access to the brain, thus increasing the risk of injury and requiring adequate clinical management of sepsis and jaundice in the neonatal period.

  10. Impaired renal function in owl monkeys (Aotus nancymai infected with Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    R. E. Weller

    1992-01-01

    Full Text Available Impaired renal function was observed in sixteen Aotus nancymai 25 and 3 months following infection with the Uganda Palo Alto strain of Plasmodium falciparum. Decrease were noted in the clearance of endogenous creatinine, creatinine excretion, and urine volume while increases were observed in serum urea nitrogen, urine protein, urine potassium, fractional excretion of phosphorus and potassium, and activities of urinary enzymes. The results were suggestive of glomerulonephropathy and chronic renal disease.

  11. Language and executive functioning in the context of specific language impairment and bilingualism

    OpenAIRE

    Laloi, A.

    2015-01-01

    The present thesis has investigated how French-speaking monolingual and bilingual children with SLI (specific language impairment) performed on various tasks examining language and executive functioning (EF) abilities, in comparison to monolingual and bilingual peers without SLI. Language was investigated in the domains of phonology (novel-word repetition task), vocabulary (picture-pointing and picture-naming tasks) and grammar (elicitation tasks of past tense and object clitics). EF was inve...

  12. The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.

    2009-09-01

    A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected

  13. How hormones influence composition and physiological function of the brain-blood barrier.

    Science.gov (United States)

    Hampl, R; Bičíková, M; Sosvorová, L

    2015-01-01

    Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

  14. Degree of exposure to domestic violence, psychopathology, and functional impairment in children and adolescents.

    Science.gov (United States)

    Bayarri Fernàndez, Eduard; Ezpeleta, Lourdes; Granero, Roser; de la Osa, Núria; Domènech, Josep María

    2011-04-01

    There are discrepancies about whether children who witness and suffer domestic violence (DV) have similar outcomes in terms of psychopathology. This work examines the relationship between different types of exposure to DV and child psychopathology and functional impairment. One hundred and forty-four Spanish children aged from 4 to 17 years and exposed to DV were evaluated using a diagnostic interview and other instruments of psychopathology and functional impairment. The participants were classified in three groups according to the degree of exposure: witness (n = 72), involved (n = 52), and victim (n = 20). According to mothers' self-reports and mother-child combined information, DV equally affects psychopathology and functional impairment regardless of the degree of the exposure. Children's self-reports showed a linear trend to present greater psychopathology as a victim than as a witness. The differential effect of exposure to DV measured in this study depended on the informant, which underlines the importance of obtaining information from the children exposed to violence at home.

  15. Systemic Inflammation and Lung Function Impairment in Morbidly Obese Subjects with the Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    Astrid van Huisstede

    2013-01-01

    Full Text Available Background. Obesity and asthma are associated. There is a relationship between lung function impairment and the metabolic syndrome. Whether this relationship also exists in the morbidly obese patients is still unknown. Hypothesis. Low-grade systemic inflammation associated with the metabolic syndrome causes inflammation in the lungs and, hence, lung function impairment. Methods. This is cross-sectional study of morbidly obese patients undergoing preoperative screening for bariatric surgery. Metabolic syndrome was assessed according to the revised NCEP-ATP III criteria. Results. A total of 452 patients were included. Patients with the metabolic syndrome (n=293 had significantly higher blood monocyte (mean 5.3 versus 4.9, P=0.044 and eosinophil percentages (median 1.0 versus 0.8, P=0.002, while the total leukocyte count did not differ between the groups. The FEV1/FVC ratio was significantly lower in patients with the metabolic syndrome (76.7% versus 78.2%, P=0.032. Blood eosinophils were associated with FEV1/FVC ratio (adj. B −0.113, P=0.018. Conclusion. Although the difference in FEV1/FVC ratio between the groups is relatively small, in this cross-sectional study, and its clinical relevance may be limited, these data indicate that the presence of the metabolic syndrome may influence lung function impairment, through the induction of relative eosinophilia.

  16. Cognitive impairment after traumatic brain injury: a functional magnetic resonance imaging study using the Stroop task

    Energy Technology Data Exchange (ETDEWEB)

    Soeda, Akio; Iwama, Toru [Gifu University School of Medicine, Department of Neurosurgery, Gifu City (Japan); Nakashima, Toshihiko; Okumura, Ayumi; Shinoda, Jun [Kizawa Memorial Hospital, Chubu Medical Center for Prolonged Traumatic Brain Dysfunction, Department of Neurosurgery, Minokamo (Japan); Kuwata, Kazuo [Gifu University School of Medicine, Department of Biochemistry and Biophysics, Gifu (Japan)

    2005-07-01

    The anterior cingulate cortex (ACC) plays a key role in cognition, motor function, and emotion processing. However, little is known about how traumatic brain injury (TBI) affects the ACC system. Our purpose was to compare, by functional magnetic resonance imaging (fMRI) studies, the patterns of cortical activation in patients with cognitive impairment after TBI and those of normal subjects. Cortical activation maps of 11 right-handed healthy control subjects and five TBI patients with cognitive impairment were recorded in response to a Stroop task during a block-designed fMRI experiment. Statistical parametric mapping (SPM99) was used for individual subjects and group analysis. In TBI patients and controls, cortical activation, found in similar regions of the frontal, occipital, and parietal lobes, resembled patterns of activation documented in previous neuroimaging studies of the Stroop task in healthy controls. However, the TBI patients showed a relative decrease in ACC activity compared with the controls. Cognitive impairment in TBI patients seems to be associated with alterations in functional cerebral activity, especially less activation of the ACC. These changes are probably the result of destruction of neural networks after diffuse axonal injury and may reflect cortical disinhibition attributable to disconnection or compensation for an inefficient cognitive process. (orig.)

  17. Early development in Dravet syndrome; visual function impairment precedes cognitive decline.

    Science.gov (United States)

    Chieffo, Daniela; Ricci, Daniela; Baranello, Giovanni; Martinelli, Diego; Veredice, Chiara; Lettori, Donatella; Battaglia, Domenica; Dravet, Charlotte; Mercuri, Eugenio; Guzzetta, Francesco

    2011-01-01

    Aim of the study was to describe prospectively the early neuropsychological evolution including the first pre-cognitive stages of the Severe Myoclonic Epilepsy in Infancy (SMEI) or Dravet syndrome. Five cases, four of whom since before a diagnostic evidence of the Dravet syndrome, were followed up. Full clinical assessment including developmental, visual function and behaviour assessments were serially performed. In four cases, a variable onset age of cognitive decline assessed with developmental scales was preceded some months before by an impairment of visual function; the remaining patient during all the course of follow-up till 51 months of age showed a normal development without visual impairment. A cognitive decline with variable onset was generally confirmed in Dravet syndrome. The previous early impairment of visual function seems to herald the cognitive decline and provides useful prognostic information; furthermore, it possibly suggests some clues for a better understanding of the mechanisms of cognitive deterioration in this syndrome. 2010 Elsevier B.V. All rights reserved.

  18. CD160-associated CD8 T-cell functional impairment is independent of PD-1 expression.

    Directory of Open Access Journals (Sweden)

    Selena Viganò

    2014-09-01

    Full Text Available Expression of co-inhibitory molecules is generally associated with T-cell dysfunction in chronic viral infections such as HIV or HCV. However, their relative contribution in the T-cell impairment remains unclear. In the present study, we have evaluated the impact of the expression of co-inhibitory molecules such as 2B4, PD-1 and CD160 on the functions of CD8 T-cells specific to influenza, EBV and CMV. We show that CD8 T-cell populations expressing CD160, but not PD-1, had reduced proliferation capacity and perforin expression, thus indicating that the functional impairment in CD160(+ CD8 T cells may be independent of PD-1 expression. The blockade of CD160/CD160-ligand interaction restored CD8 T-cell proliferation capacity, and the extent of restoration directly correlated with the ex vivo proportion of CD160(+ CD8 T cells suggesting that CD160 negatively regulates TCR-mediated signaling. Furthermore, CD160 expression was not up-regulated upon T-cell activation or proliferation as compared to PD-1. Taken together, these results provide evidence that CD160-associated CD8 T-cell functional impairment is independent of PD-1 expression.

  19. Environmental Exposure to Cadmium: Health Risk Assessment and its Associations with Hypertension and Impaired Kidney Function

    Science.gov (United States)

    Wu, Haiyun; Liao, Qilin; Chillrud, Steven N.; Yang, Qiang; Huang, Lei; Bi, Jun; Yan, Beizhan

    2016-07-01

    Cadmium (Cd) is a toxic metal. This study was aimed to estimate the potential health risks in a Cd-polluted district in China, and examine the relationship between urinary cadmium(UCd) and hypertension and impaired kidney function at low exposure levels (UCd: GM 1.3 μg/g creatinine). Blood pressure measurement, questionnaires, and collection of urinary samples were conducted from 217 residents. Environmental samples, food, and cigarette samples were collected and detected to estimate the risks posed by Cd and the contribution of inhalation, ingestion, and dermal contact pathways to these risks. A logistic regression model was used in examining associations between exposure and hypertension and impaired kidney function. Results show that this population is at high risk. For non-smokers, incremental lifetime cancer risk (ILCR) and hazard quotient (HQ) are 1.74E-04 and 2.96, and for smokers, they are 1.07E-03 and 52.5, respectively. Among all exposure pathways, smoking and foods cause the major increases in ILCR and HQ. UCd is significantly associated with hypertension (odds ratio (OR) = 1.468 95% confidence interval (CI): 1.104, 1.953; P = 0.008) and impaired kidney function (OR = 1.902, 95% CI: 1.054, 3.432; P = 0.033). The results demonstrate that Cd can potentially lead to adverse health effects.

  20. Dietary choline deprivation impairs rat brain mitochondrial function and behavioral phenotype.

    Science.gov (United States)

    Pacelli, Consiglia; Coluccia, Addolorata; Grattagliano, Ignazio; Cocco, Tiziana; Petrosillo, Giuseppe; Paradies, Giuseppe; De Nitto, Emanuele; Massaro, Antonio; Persichella, Michele; Borracci, Pietro; Portincasa, Piero; Carratù, Maria Rosaria

    2010-06-01

    Dietary choline deprivation (CD) is associated with behavioral changes, but mechanisms underlying these detrimental effects are not well characterized. For instance, no literature data are available concerning the CD effects on brain mitochondrial function related to impairment in cognition. Therefore, we investigated brain mitochondrial function and redox status in male Wistar rats fed a CD diet for 28 d. Moreover, the CD behavioral phenotype was characterized. Compared with rats fed a control diet (CTRL), CD rats showed lower NAD-dependent mitochondrial state III and state IV respiration, 40% lower complex I activity, and significantly higher reactive oxygen species production. Total glutathione was oxidatively consumed more in CD than in CTRL rats and the rate of protein oxidation was 40% higher in CD than in CTRL rats, reflecting an oxidative stress condition. The mitochondrial concentrations of cardiolipin, a phospholipid required for optimal activity of complex I, was 20% lower in CD rats than in CTRL rats. Compared with CTRL rats, the behavioral phenotype of CD rats was characterized by impairment in motor coordination and motor learning assessed with the rotarod/accelerod test. Furthermore, compared with CTRL rats, CD rats were less capable of learning the active avoidance task and the number of attempts they made to avoid foot shock was fewer. The results suggest that CD-induced dysfunction in brain mitochondria may be responsible for impairment in cognition and underline that, similar to the liver, the brain also needs an adequate choline supply for its normal functioning.

  1. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  2. Increase in short-chain ceramides correlates with an altered lipid organization and decreased barrier function in atopic eczema patients.

    Science.gov (United States)

    Janssens, Michelle; van Smeden, Jeroen; Gooris, Gert S; Bras, Wim; Portale, Guiseppe; Caspers, Peter J; Vreeken, Rob J; Hankemeier, Thomas; Kezic, Sanja; Wolterbeek, Ron; Lavrijsen, Adriana P; Bouwstra, Joke A

    2012-12-01

    A hallmark of atopic eczema (AE) is skin barrier dysfunction. Lipids in the stratum corneum (SC), primarily ceramides, fatty acids, and cholesterol, are crucial for the barrier function, but their role in relation to AE is indistinct. Filaggrin is an epithelial barrier protein with a central role in the pathogenesis of AE. Nevertheless, the precise causes of AE-associated barrier dysfunction are largely unknown. In this study, a comprehensive analysis of ceramide composition and lipid organization in nonlesional SC of AE patients and control subjects was performed by means of mass spectrometry, infrared spectroscopy, and X-ray diffraction. In addition, the skin barrier and clinical state of the disease were examined. The level of ceramides with an extreme short chain length is drastically increased in SC of AE patients, which leads to an aberrant lipid organization and a decreased skin barrier function. Changes in SC lipid properties correlate with disease severity but are independent of filaggrin mutations. We demonstrate for the first time that changes in ceramide chain length and lipid organization are directly correlated with the skin barrier defects in nonlesional skin of AE patients. We envisage that these insights will provide a new therapeutic entry in therapy and prevention of AE.

  3. Proteasome function is not impaired in healthy aging of the lung.

    Science.gov (United States)

    Caniard, Anne; Ballweg, Korbinian; Lukas, Christina; Yildirim, Ali Ö; Eickelberg, Oliver; Meiners, Silke

    2015-10-01

    Aging is the progressive loss of cellular function which inevitably leads to death. Failure of proteostasis including the decrease in proteasome function is one hallmark of aging. In the lung, proteasome activity was shown to be impaired in age-related diseases such as chronic obstructive pulmonary disease. However, little is known on proteasome function during healthy aging. Here, we comprehensively analyzed healthy lung aging and proteasome function in wildtype, proteasome reporter and immunoproteasome knockout mice. Wildtype mice spontaneously developed senile lung emphysema while expression and activity of proteasome complexes and turnover of ubiquitinated substrates was not grossly altered in lungs of aged mice. Immunoproteasome subunits were specifically upregulated in the aged lung and the caspase-like proteasome activity concomitantly decreased. Aged knockout mice for the LMP2 or LMP7 immunoproteasome subunits showed no alteration in proteasome activities but exhibited typical lung aging phenotypes suggesting that immunoproteasome function is dispensable for physiological lung aging in mice. Our results indicate that healthy aging of the lung does not involve impairment of proteasome function. Apparently, the reserve capacity of the proteostasis systems in the lung is sufficient to avoid severe proteostasis imbalance during healthy aging.

  4. Impaired thalamocortical connectivity in autism spectrum disorder: a study of functional and anatomical connectivity.

    Science.gov (United States)

    Nair, Aarti; Treiber, Jeffrey M; Shukla, Dinesh K; Shih, Patricia; Müller, Ralph-Axel

    2013-06-01

    The thalamus plays crucial roles in the development and mature functioning of numerous sensorimotor, cognitive and attentional circuits. Currently limited evidence suggests that autism spectrum disorder may be associated with thalamic abnormalities, potentially related to sociocommunicative and other impairments in this disorder. We used functional connectivity magnetic resonance imaging and diffusion tensor imaging probabilistic tractography to study the functional and anatomical integrity of thalamo-cortical connectivity in children and adolescents with autism spectrum disorder and matched typically developing children. For connectivity with five cortical seeds (prefontal, parieto-occipital, motor, somatosensory and temporal), we found evidence of both anatomical and functional underconnectivity. The only exception was functional connectivity with the temporal lobe, which was increased in the autism spectrum disorders group, especially in the right hemisphere. However, this effect was robust only in partial correlation analyses (partialling out time series from other cortical seeds), whereas findings from total correlation analyses suggest that temporo-thalamic overconnectivity in the autism group was only relative to the underconnectivity found for other cortical seeds. We also found evidence of microstructural compromise within the thalamic motor parcel, associated with compromise in tracts between thalamus and motor cortex, suggesting that the thalamus may play a role in motor abnormalities reported in previous autism studies. More generally, a number of correlations of diffusion tensor imaging and functional connectivity magnetic resonance imaging measures with diagnostic and neuropsychological scores indicate involvement of abnormal thalamocortical connectivity in sociocommunicative and cognitive impairments in autism spectrum disorder.

  5. Comparison of Posttranslational Modification and the Functional Impairment of Human Serum Albumin in Commercial Preparations.

    Science.gov (United States)

    Miyamura, Shigeyuki; Imafuku, Tadashi; Anraku, Makoto; Taguchi, Kazuaki; Yamasaki, Keishi; Tominaga, Yuna; Maeda, Hitoshi; Ishima, Yu; Watanabe, Hiroshi; Otagiri, Masaki; Maruyama, Toru

    2016-03-01

    On account of its long circulating half-life, human serum albumin (HSA) is susceptible to posttranslational modifications that can alter its functions. Here, we comprehensively compared the degree of posttranslational modifications with the functional impairment of HSA derived from 5 different commercially available albumin preparations and clarified their relationships. We used electrospray ionization-time of flight mass spectrometry to evaluate the degree of posttranslational modification of the entire HSA molecule that was associated with disease development and found that the fraction of Cys34-cysteinylated HSA (Cys-Cys34-HSA), a major form of oxidative modification, varied substantially among the albumin preparations. Meanwhile, no remarkable difference was found in the degree of glycated or N-terminal truncated HSA among the preparations tested. The nonosmotic pressure maintenance functions of HSA, such as its antioxidative and ligand-binding activities significantly differed among the preparations. Interestingly, the alternations of these functions showed a significantly negative correlation only with the Cys-Cys34-HSA fraction. These findings suggest that the Cys-Cys34-HSA fraction, as estimated by electrospray ionization-time of flight mass spectrometry can be used as a predictive marker for the functional impairment of albumin preparations and that it would be preferable to use albumin preparations with higher contents of functionally effective albumin that correspond to a lower degree of cysteinylation of Cys34 in clinical practice.

  6. Different impairment of immune and inflammation functions in short and long-term after ischemic stroke.

    Science.gov (United States)

    Li, Wen-Xing; Qi, Fei; Liu, Jia-Qian; Li, Gong-Hua; Dai, Shao-Xing; Zhang, Tao; Cheng, Fei; Liu, Dahai; Zheng, Song Guo

    2017-01-01

    Ischemic stroke therapy and prognosis outcomes largely depend on the time periods after symptom onset. This study aims to explore the difference of global gene expression profiles and impairment of biological functions between short-term and long-term after stroke onset. We compared three short-term (3 h, 5 h and 24 h) and a long-term (6-month) gene expression levels by a multi-platform microarray data integration method. RankProd was used to calculate the differentially expressed genes between stroke patients and controls. DAVID Bioinformatics Resources was utilized to determine affected biological functions. Consensus cluster and hierarchical cluster methods were employed to compare the gene expression patterns of the commonly biological functions among these four time course groups. The results showed that severe impairment of inflammation and immune related functions in 5 h and 24 h after symptom onset. However, these functions were less affected in the 3 h and the 6-month groups. In addition, several key genes (CCL20, THBS1, EREG, and IL6 et al.) were dramatically down-regulated in 5 h and 24 h groups, whereas these genes showed no change or even a slight contrary expression in 3 h or 6-month groups. This study has identified the large differences of altered immune and inflammation functions based on gene levels between short and long-term after stroke onset. The findings provide valuable insight into the clinical practice and prognosis evaluation of ischemic stroke.

  7. Impaired High-Density Lipoprotein Anti-Oxidant Function Predicts Poor Outcome in Critically Ill Patients.

    Directory of Open Access Journals (Sweden)

    Lore Schrutka

    Full Text Available Oxidative stress affects clinical outcome in critically ill patients. Although high-density lipoprotein (HDL particles generally possess anti-oxidant capacities, deleterious properties of HDL have been described in acutely ill patients. The impact of anti-oxidant HDL capacities on clinical outcome in critically ill patients is unknown. We therefore analyzed the predictive value of anti-oxidant HDL function on mortality in an unselected cohort of critically ill patients.We prospectively enrolled 270 consecutive patients admitted to a university-affiliated intensive care unit (ICU and determined anti-oxidant HDL function using the HDL oxidant index (HOI. Based on their HOI, the study population was stratified into patients with impaired anti-oxidant HDL function and the residual study population.During a median follow-up time of 9.8 years (IQR: 9.2 to 10.0, 69% of patients died. Cox regression analysis revealed a significant and independent association between impaired anti-oxidant HDL function and short-term mortality with an adjusted HR of 1.65 (95% CI 1.22-2.24; p = 0.001 as well as 10-year mortality with an adj. HR of 1.19 (95% CI 1.02-1.40; p = 0.032 when compared to the residual study population. Anti-oxidant HDL function correlated with the amount of oxidative stress as determined by Cu/Zn superoxide dismutase (r = 0.38; p<0.001.Impaired anti-oxidant HDL function represents a strong and independent predictor of 30-day mortality as well as long-term mortality in critically ill patients.

  8. Mild Cognitive Impairment is Associated with Selected Functional Markers: Integrating Concurrent, Longitudinal, and Stability Effects

    Science.gov (United States)

    Dolcos, Sanda; MacDonald, Stuart W.S.; Braslavsky, Anna; Camicioli, Richard; Dixon, Roger A.

    2013-01-01

    Objective We examined functional performance on multiple indicators for two cognitive status groups: (a) not impaired controls (NIC) and (b) mild cognitive impairment (MCI). We identified functional markers associated with differences, changes, and stability in cognitive status. Method In the Victoria Longitudinal Study (VLS) we examined cognitive status group effects in (a) cross-sectional functional performance, (b) longitudinal stability, (c) longitudinal functional performance change, and (d) functional marker prediction of later cognitive status. We assembled markers from five continuous clusters of MCI-related functional factors: biological vitality, activity lifestyle, psychosocial affect, subjective health, and global cognition. We used a cross-sectional sample and a two-wave longitudinal sample, stratified by age (mid-old, old-old) and cognitive status (MCI, NIC). Results First, cross-sectional results showed that eight markers differentiated MCI and NIC adults, with the latter performing uniformly better. The groups differed on diastolic blood pressure, body mass index, positive and negative affect, MMSE, and the lifestyle indicators of self-maintenance, travel, and novel cognitive activities. Second, Wave1 to Wave2 stabilities in cognitive status classification were high. Third, several markers differentiated the stable (NIC-to-NIC, MCI-to-MCI) from the unstable (NIC-to-MCI, MCI-to-NIC) cognitive status groups. Fourth, five relevant markers for identifying older adults at risk for cognitive status changes were: diastolic blood pressure, self-maintenance activities, novel cognitive activities, positive affect, and global cognitive status. Conclusion Selected risk and protective factors differentiate persons classified with MCI from those not currently cognitively impaired, both cross-sectionally and longitudinally. PMID:22251311

  9. Prenatal cocaine exposure impairs cognitive function of progeny via insulin growth factor II epigenetic regulation.

    Science.gov (United States)

    Zhao, Qian; Hou, Jing; Chen, Bo; Shao, Xue; Zhu, Ruiming; Bu, Qian; Gu, Hui; Li, Yan; Zhang, Baolai; Du, Changman; Fu, Dengqi; Kong, Jueying; Luo, Li; Long, Hailei; Li, Hongyu; Deng, Yi; Zhao, Yinglan; Cen, Xiaobo

    2015-10-01

    Studies have showed that prenatal cocaine exposure (PCOC) can impair cognitive function and social behavior of the offspring; however, the mechanism underlying such effect is poorly understood. Insulin-like growth factor II (Igf-II), an imprinted gene, has a critical role in memory consolidation and enhancement. We hypothesized that epigenetic regulation of hippocampal Igf-II may attribute to the cognitive deficits of PCOC offspring. We used Morris water maze and open-field task to test the cognitive function in PCOC offspring. The epigenetic alteration involved in hippocampal Igf-II expression deficit in PCOC offspring was studied by determining Igf-II methylation status, DNA methyltransferases (DNMT) expressions and L-methionine level. Moreover, IGF-II rescue experiments were performed and the downstream signalings were investigated in PCOC offspring. In behavioral tests, we observed impaired spatial learning and memory and increased anxiety in PCOC offspring; moreover, hippocampal IGF-II mRNA and protein expressions were significantly decreased. Hippocampal methylation of cytosine-phospho-guanine (CpG) dinucleotides in differentially methylated region (DMR) 2 of Igf-II was elevated in PCOC offspring, which may be driven by the upregulation of L-methionine and DNA methyltransferase (DNMT) 1. Importantly, intra-hippocampal injection of recombinant IGF-II reactivated the repressed calcium calmodulin kinase II α (CaMKIIα) and reversed cognitive deficits in PCOC offspring. Collectively, our findings suggest that cocaine exposure during pregnancy impairs cognitive function of offspring through epigenetic modification of Igf-II gene. Enhancing IGF-II signaling may represent a novel therapeutical strategy for cocaine-induced cognitive impairment.

  10. Advances in PET imaging of P-glycoprotein function at the blood-brain barrier.

    Science.gov (United States)

    Syvänen, Stina; Eriksson, Jonas

    2013-02-20

    Efflux transporter P-glycoprotein (P-gp) at the blood-brain barrier (BBB) restricts substrate compounds from entering the brain and may thus contribute to pharmacoresistance observed in patient groups with refractory epilepsy and HIV. Altered P-gp function has also been implicated in neurodegenerative diseases such as Alzheimer's and Parkinson's disease. Positron emission tomography (PET), a molecular imaging modality, has become a promising method to study the role of P-gp at the BBB. The first PET study of P-gp function was conducted in 1998, and during the past 15 years two main categories of P-gp PET tracers have been investigated: tracers that are substrates of P-gp efflux and tracers that are inhibitors of P-gp function. PET, as a noninvasive imaging technique, allows translational research. Examples of this are preclinical investigations of P-gp function before and after administering P-gp modulating drugs, investigations in various animal and disease models, and clinical investigations regarding disease and aging. The objective of the present review is to give an overview of available PET radiotracers for studies of P-gp and to discuss how such studies can be designed. Further, the review summarizes results from PET studies of P-gp function in different central nervous system disorders.

  11. Impairment in Proverb Interpretation as an Executive Function Deficit in Patients with Amnestic Mild Cognitive Impairment and Early Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Thomas Leyhe

    2011-01-01

    Full Text Available Background/Aims: Proverb interpretation is assumed to reflect executive functions. We hypothesized that proverb interpretation is impaired in patients with amnestic mild cognitive impairment (aMCI diagnosed as single-domain impairment by common neuropsychological testing. Methods: We compared performance in a proverb interpretation test in single-domain aMCI patients and patients with early Alzheimer’s disease (EAD. Results: The groups with aMCI and EAD performed significantly worse than healthy controls. Both patient groups gave concrete answers with a similar frequency. However, patients with EAD tended to give senseless answers more frequently. Conclusions: Our data suggest that in patients diagnosed as single-domain aMCI, deterioration of executive functions is detectable with subtle and appropriate neuropsychological testing. Implementation of these procedures may improve the early prediction of AD.

  12. Functional Capacity, Muscle Fat Infiltration, Power Output, and Cognitive Impairment in Institutionalized Frail Oldest Old

    OpenAIRE

    Casas-Herrero, Alvaro; Eduardo L. Cadore; Zambom-Ferraresi, Fabricio; Idoate, Fernando; Millor, Nora; Martínez-Ramirez, Alicia; Gómez, Marisol; Rodriguez-Mañas, Leocadio; Marcellán, Teresa; de Gordoa, Ana Ruiz; Mário C. Marques; Izquierdo, Mikel

    2013-01-01

    This study examined the neuromuscular and functional performance differences between frail oldest old with and without mild cognitive impairment (MCI). In addition, the associations between functional capacities, muscle mass, strength, and power output of the leg muscles were also examined. Forty-three elderly men and women (91.9±4.1 years) were classified into three groups—the frail group, the frail with MCI group (frail+MCI), and the non-frail group. Strength tests were performed for upper ...

  13. MR velocity mapping measurement of renal artery blood flow in patients with impaired kidney function

    DEFF Research Database (Denmark)

    Cortsen, M; Petersen, L.J.; Stahlberg, F

    1996-01-01

    Renal blood flow (RBF) was measured in 9 patients with chronic impaired kidney function using MR velocity mapping and compared to PAH clearance and 99mTc-DTPA scintigraphy. An image plane suitable for flow measurement perpendicular to the renal arteries was chosen from 2-dimensional MR angiography...... by 99mTc-DTPA scintigraphy. A reduction of RBF was found, and there was a significant correlation between PAH clearance multiplied by 1/(1-hematocrit) and RBF determined by MR velocity mapping. Furthermore, a significant correlation between the distribution of renal function and the percent distribution...

  14. Intestinal barrier function in response to abundant or depleted mucosal glutathione in Salmonella-infected rats

    Directory of Open Access Journals (Sweden)

    Vink Carolien

    2009-04-01

    Full Text Available Abstract Background Glutathione, the main antioxidant of intestinal epithelial cells, is suggested to play an important role in gut barrier function and prevention of inflammation-related oxidative damage as induced by acute bacterial infection. Most studies on intestinal glutathione focus on oxidative stress reduction without considering functional disease outcome. Our aim was to determine whether depletion or maintenance of intestinal glutathione changes susceptibility of rats to Salmonella infection and associated inflammation. Rats were fed a control diet or the same diet supplemented with buthionine sulfoximine (BSO; glutathione depletion or cystine (glutathione maintenance. Inert chromium ethylenediamine-tetraacetic acid (CrEDTA was added to the diets to quantify intestinal permeability. At day 4 after oral gavage with Salmonella enteritidis (or saline for non-infected controls, Salmonella translocation was determined by culturing extra-intestinal organs. Liver and ileal mucosa were collected for analyses of glutathione, inflammation markers and oxidative damage. Faeces was collected to quantify diarrhoea. Results Glutathione depletion aggravated ileal inflammation after infection as indicated by increased levels of mucosal myeloperoxidase and interleukin-1β. Remarkably, intestinal permeability and Salmonella translocation were not increased. Cystine supplementation maintained glutathione in the intestinal mucosa but inflammation and oxidative damage were not diminished. Nevertheless, cystine reduced intestinal permeability and Salmonella translocation. Conclusion Despite increased infection-induced mucosal inflammation upon glutathione depletion, this tripeptide does not play a role in intestinal permeability, bacterial translocation and diarrhoea. On the other hand, cystine enhances gut barrier function by a mechanism unlikely to be related to glutathione.

  15. Commensal bacteria-dependent indole production enhances epithelial barrier function