WorldWideScience

Sample records for impaired barrier function

  1. Sleep Restriction Impairs Blood–Brain Barrier Function

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J.; Wang, Yuping

    2014-01-01

    The blood–brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. PMID:25355222

  2. Sleep restriction impairs blood-brain barrier function.

    Science.gov (United States)

    He, Junyun; Hsuchou, Hung; He, Yi; Kastin, Abba J; Wang, Yuping; Pan, Weihong

    2014-10-29

    The blood-brain barrier (BBB) is a large regulatory and exchange interface between the brain and peripheral circulation. We propose that changes of the BBB contribute to many pathophysiological processes in the brain of subjects with chronic sleep restriction (CSR). To achieve CSR that mimics a common pattern of human sleep loss, we quantified a new procedure of sleep disruption in mice by a week of consecutive sleep recording. We then tested the hypothesis that CSR compromises microvascular function. CSR not only diminished endothelial and inducible nitric oxide synthase, endothelin1, and glucose transporter expression in cerebral microvessels of the BBB, but it also decreased 2-deoxy-glucose uptake by the brain. The expression of several tight junction proteins also was decreased, whereas the level of cyclooxygenase-2 increased. This coincided with an increase of paracellular permeability of the BBB to the small tracers sodium fluorescein and biotin. CSR for 6 d was sufficient to impair BBB structure and function, although the increase of paracellular permeability returned to baseline after 24 h of recovery sleep. This merits attention not only in neuroscience research but also in public health policy and clinical practice. Copyright © 2014 the authors 0270-6474/14/3414697-10$15.00/0.

  3. Gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice

    Science.gov (United States)

    Fang, Yu; Chen, Hao; Hu, Yuhui; Djukic, Zorka; Tevebaugh, Whitney; Shaheen, Nicholas J.; Orlando, Roy C.; Hu, Jianguo

    2013-01-01

    The barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease. Previous studies have shown that reflux damage is reflected in a decrease in transepithelial electrical resistance associated with tight junction alterations in the esophageal epithelium. To develop novel therapies, it is critical to understand the molecular mechanisms whereby contact with a refluxate impairs esophageal barrier function. In this study, surgical models of duodenal and mixed reflux were developed in mice. Mouse esophageal epithelium was analyzed by gene microarray. Gene set enrichment analysis showed upregulation of inflammation-related gene sets and the NF-κB pathway due to reflux. Significance analysis of microarrays revealed upregulation of NF-κB target genes. Overexpression of NF-κB subunits (p50 and p65) and NF-κB target genes (matrix metalloproteinases-3 and -9, IL-1β, IL-6, and IL-8) confirmed activation of the NF-κB pathway in the esophageal epithelium. In addition, real-time PCR, Western blotting, and immunohistochemical staining also showed downregulation and mislocalization of claudins-1 and -4. In a second animal experiment, treatment with an NF-κB inhibitor, BAY 11-7085 (20 mg·kg−1·day−1 ip for 10 days), counteracted the effects of duodenal and mixed reflux on epithelial resistance and NF-κB-regulated cytokines. We conclude that gastroesophageal reflux activates the NF-κB pathway and impairs esophageal barrier function in mice and that targeting the NF-κB pathway may strengthen esophageal barrier function against reflux. PMID:23639809

  4. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Science.gov (United States)

    Yang, Siming; Gu, Changping; Mandeville, Emiri T.; Dong, Yuanlin; Esposito, Elga; Zhang, Yiying; Yang, Guang; Shen, Yuan; Fu, Xiaobing; Lo, Eng H.; Xie, Zhongcong

    2017-01-01

    Blood–brain barrier (BBB) dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy) under 1.4% isoflurane anesthesia (anesthesia/surgery) for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL)-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification), and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium. PMID:28848542

  5. Anesthesia and Surgery Impair Blood–Brain Barrier and Cognitive Function in Mice

    Directory of Open Access Journals (Sweden)

    Siming Yang

    2017-08-01

    Full Text Available Blood–brain barrier (BBB dysfunction, e.g., increase in BBB permeability, has been reported to contribute to cognitive impairment. However, the effects of anesthesia and surgery on BBB permeability, the underlying mechanisms, and associated cognitive function remain largely to be determined. Here, we assessed the effects of surgery (laparotomy under 1.4% isoflurane anesthesia (anesthesia/surgery for 2 h on BBB permeability, levels of junction proteins and cognitive function in both 9- and 18-month-old wild-type mice and 9-month-old interleukin (IL-6 knockout mice. BBB permeability was determined by dextran tracer (immunohistochemistry imaging and spectrophotometric quantification, and protein levels were measured by Western blot and cognitive function was assessed by using both Morris water maze and Barnes maze. We found that the anesthesia/surgery increased mouse BBB permeability to 10-kDa dextran, but not to 70-kDa dextran, in an IL-6-dependent and age-associated manner. In addition, the anesthesia/surgery induced an age-associated increase in blood IL-6 level. Cognitive impairment was detected in 18-month-old, but not 9-month-old, mice after the anesthesia/surgery. Finally, the anesthesia/surgery decreased the levels of β-catenin and tight junction protein claudin, occludin and ZO-1, but not adherent junction protein VE-cadherin, E-cadherin, and p120-catenin. These data demonstrate that we have established a system to study the effects of perioperative factors, including anesthesia and surgery, on BBB and cognitive function. The results suggest that the anesthesia/surgery might induce an age-associated BBB dysfunction and cognitive impairment in mice. These findings would promote mechanistic studies of postoperative cognitive impairment, including postoperative delirium.

  6. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Science.gov (United States)

    Liu, Xinxin; Zheng, Wei; Sivasankar, M Preeti

    2016-01-01

    Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3) expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001). Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (pacrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (pacrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  7. Acute Acrolein Exposure Induces Impairment of Vocal Fold Epithelial Barrier Function.

    Directory of Open Access Journals (Sweden)

    Xinxin Liu

    Full Text Available Acrolein is a ubiquitous pollutant abundant in cigarette smoke, mobile exhaust, and industrial waste. There is limited literature on the effects of acrolein on vocal fold tissue, although there are clinical reports of voice changes after pollutant exposures. Vocal folds are responsible for voice production. The overall objective of this study was to investigate the effects of acrolein exposure on viable, excised vocal fold epithelial tissue and to characterize the mechanism underlying acrolein toxicity. Vocal fold epithelia were studied because they form the outermost layer of the vocal folds and are a primary recipient of inhaled pollutants. Porcine vocal fold epithelia were exposed to 0, 50, 100, 500, 900 or 1300 μM of acrolein for 3 hours; the metabolic activity, epithelial resistance, epithelial permeability, tight junction protein (occludin and claudin 3 expression, cell membrane integrity and lipid peroxidation were investigated. The data demonstrated that acrolein exposure at 500 μM significantly reduced vocal fold epithelial metabolic activity by 27.2% (p≤0.001. Incubation with 100 μM acrolein caused a marked increase in epithelial permeability by 130.5% (p<0.05 and a reduction in transepithelial electrical resistance (TEER by 180.0% (p<0.001. While the expression of tight junctional protein did not change in acrolein-treated samples, the cell membrane integrity was significantly damaged with a 45.6% increase of lipid peroxidation as compared to controls (p<0.05. Taken together, these data provide evidence that acute acrolein exposure impairs vocal fold epithelial barrier integrity. Lipid peroxidation-induced cell membrane damage may play an important role in reducing the barrier function of the epithelium.

  8. Prolonged phonation impairs the integrity and barrier function of porcine vocal fold epithelium: a preliminary study.

    Science.gov (United States)

    Zhang, Chi; Paddock, Kieran; Chou, Adriana; Scholp, Austin; Gong, Ting; Jiang, Jack J

    2018-04-18

    Voice abuse is known to be a common risk factor of voice disorders and prolonged; high-intensity phonation has been shown to damage the vocal fold epithelium. We aim to evaluate the effects of phonation on the integrity and barrier function of vocal fold epithelium using a porcine laryngeal model. Ex vivo porcine larynges were phonated at low intensity or high intensity for 15, 30, or 60 min within 4 h after harvest. Vocal fold epithelium was visualized using transmission electron microscopy (TEM). The barrier function of vocal fold epithelium was evaluated by measuring the permeability to model molecules, fluorescein (376 Da), and fluorescein isothiocyanate (FITC)-dextrans of 4000 and 10,000 Da (FD4, FD10), in a Franz diffusing cell. Cell death and dilated intercellular space after phonation were observed using TEM. Thickness of vocal fold epithelium was significantly reduced after low-intensity phonation for 30 and 60 min and high-intensity phonation for 15, 30, and 60 min. Epithelial permeability to fluorescein was significantly increased after low-intensity phonation for 30 and 60 min, and high-intensity phonation. Permeability to FD4 was significantly increased after high-intensity phonation for 30 and 60 min. Phonation did not alter the permeability to FD10 significantly. Long-duration phonation destroys the integrity and barrier function of vocal fold epithelium. These effects likely make vocal folds more vulnerable to other environmental irritants, such as tobacco smoke, reflux components, allergens, and inhaled pollutants. Destroyed barrier function may be an important factor in the pathogenesis of voice lesions related to voice abuse.

  9. Caspase-14 Expression Impairs Retinal Pigment Epithelium Barrier Function: Potential Role in Diabetic Macular Edema

    Directory of Open Access Journals (Sweden)

    Selina Beasley

    2014-01-01

    Full Text Available We recently showed that caspase-14 is a novel molecule in retina with potential role in accelerated vascular cell death during diabetic retinopathy (DR. Here, we evaluated whether caspase-14 is implicated in retinal pigment epithelial cells (RPE dysfunction under hyperglycemia. The impact of high glucose (HG, 30 mM D-glucose on caspase-14 expression in human RPE (ARPE-19 cells was tested, which showed significant increase in caspase-14 expression compared with normal glucose (5 mM D-glucose + 25 mM L-glucose. We also evaluated the impact of modulating caspase-14 expression on RPE cells barrier function, phagocytosis, and activation of other caspases using ARPE-19 cells transfected with caspase-14 plasmid or caspase-14 siRNA. We used FITC-dextran flux assay and electric cell substrate impedance sensing (ECIS to test the changes in RPE cell barrier function. Similar to HG, caspase-14 expression in ARPE-19 cells increased FITC-dextran leakage through the confluent monolayer and decreased the transcellular electrical resistance (TER. These effects of HG were prevented by caspase-14 knockdown. Furthermore, caspase-14 knockdown prevented the HG-induced activation of caspase-1 and caspase-9, the only activated caspases by HG. Phagocytic activity was unaffected by caspase-14 expression. Our results suggest that caspase-14 contributes to RPE cell barrier disruption under hyperglycemic conditions and thus plays a role in the development of diabetic macular edema.

  10. HIV-1 impairs human retinal pigment epithelial barrier function: possible association with the pathogenesis of HIV-associated retinopathy.

    Science.gov (United States)

    Tan, Suiyi; Duan, Heng; Xun, Tianrong; Ci, Wei; Qiu, Jiayin; Yu, Fei; Zhao, Xuyan; Wu, Linxuan; Li, Lin; Lu, Lu; Jiang, Shibo; Liu, Shuwen

    2014-07-01

    The breakdown of human retinal pigment epithelial (HRPE) barrier is considered as the etiology of retinopathy, which affects the quality of life of HIV/AIDS patients. Here we demonstrate that HIV-1 could directly impair HRPE barrier function, which leads to the translocation of HIV-1 and bacteria. HRPE cells (D407) were grown to form polarized, confluent monolayers and treated with different HIV-1 infectious clones. A significant increase of monolayer permeability, as measured by trans-epithelial electrical resistance (TEER) and apical-basolateral movements of sodium fluorescein, was observed. Disrupted tightness of HRPE barrier was associated with the downregulation of several tight junction proteins in D407 cells, including ZO-1, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4, and Claudin-5, after exposure to HIV-1, without affecting the viability of cells. HIV-1 gp120 was shown to participate in the alteration of barrier properties, as evidenced by decreased TEER and weakened expression of tight junction proteins in D407 monolayers after exposure to pseudotyped HIV-1, UV-inactivated HIV-1, and free gp120, but not to an envelope (Env)-defective mutant of HIV. Furthermore, exposure to HIV-1 particles could induce the release of pro-inflammatory cytokines in D407, including IL-6 and MCP-1, both of which downregulated the expression of ZO-1 in the HRPE barrier. Disrupted HRPE monolayer allowed translocation of HIV-1 and bacteria across the epithelium. Overall, these findings suggest that HIV-1 may exploit its Env glycoprotein to induce an inflammatory state in HRPE cells, which could result in impairment of HRPE monolayer integrity, allowing virus and bacteria existing in ocular fluids to cross the epithelium and penetrate the HRPE barrier. Our study highlights the role of HIV-1 in the pathogenesis of HIV/AIDS-related retinopathy and suggests potential therapeutic targets for this ocular complication.

  11. Glycoprotein A33 deficiency: a new mouse model of impaired intestinal epithelial barrier function and inflammatory disease

    Directory of Open Access Journals (Sweden)

    Benjamin B. Williams

    2015-08-01

    Full Text Available The cells of the intestinal epithelium provide a selectively permeable barrier between the external environment and internal tissues. The integrity of this barrier is maintained by tight junctions, specialised cell-cell contacts that permit the absorption of water and nutrients while excluding microbes, toxins and dietary antigens. Impairment of intestinal barrier function contributes to multiple gastrointestinal disorders, including food hypersensitivity, inflammatory bowel disease (IBD and colitis-associated cancer (CAC. Glycoprotein A33 (GPA33 is an intestinal epithelium-specific cell surface marker and member of the CTX group of transmembrane proteins. Roles in cell-cell adhesion have been demonstrated for multiple CTX family members, suggesting a similar function for GPA33 within the gastrointestinal tract. To test a potential requirement for GPA33 in intestinal barrier function, we generated Gpa33−/− mice and subjected them to experimental regimens designed to produce food hypersensitivity, colitis and CAC. Gpa33−/− mice exhibited impaired intestinal barrier function. This was shown by elevated steady-state immunosurveillance in the colonic mucosa and leakiness to oral TRITC-labelled dextran after short-term exposure to dextran sodium sulphate (DSS to injure the intestinal epithelium. Gpa33−/− mice also exhibited rapid onset and reduced resolution of DSS-induced colitis, and a striking increase in the number of colitis-associated tumours produced by treatment with the colon-specific mutagen azoxymethane (AOM followed by two cycles of DSS. In contrast, Gpa33−/− mice treated with AOM alone showed no increase in sporadic tumour formation, indicating that their increased tumour susceptibility is dependent on inflammatory stimuli. Finally, Gpa33−/− mice displayed hypersensitivity to food allergens, a common co-morbidity in humans with IBD. We propose that Gpa33−/− mice provide a valuable model to study the mechanisms

  12. Chronic liver injury in mice promotes impairment of skin barrier function via tumor necrosis factor-alpha.

    Science.gov (United States)

    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

    2016-09-01

    Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.

  13. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat

    NARCIS (Netherlands)

    Visser, J. T. J.; Lammers, K.; Hoogendijk, A.; Boer, M. W.; Brugman, S.; Beijer-Liefers, S.; Zandvoort, A.; Harmsen, H.; Welling, G.; Stellaard, F.; Bos, N. A.; Fasano, A.; Rozing, J.

    2010-01-01

    Aims/hypothesis Impaired intestinal barrier function is observed in type I diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading

  14. Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.

    Science.gov (United States)

    Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna

    2018-01-21

    Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Host-dependent zonulin secretion causes the impairment of the small intestine barrier function after bacterial exposure.

    Science.gov (United States)

    El Asmar, Ramzi; Panigrahi, Pinaki; Bamford, Penelope; Berti, Irene; Not, Tarcisio; Coppa, Giovanni V; Catassi, Carlo; Fasano, Alessio; El Asmar, Rahzi

    2002-11-01

    Enteric infections have been implicated in the pathogenesis of both food intolerance and autoimmune diseases secondary to the impairment of the intestinal barrier. On the basis of our recent discovery of zonulin, a modulator of small-intestinal tight junctions, we asked whether microorganisms might induce zonulin secretion and increased small-intestinal permeability. Both ex vivo mammalian small intestines and intestinal cell monolayers were exposed to either pathogenic or nonpathogenic enterobacteria. Zonulin production and changes in paracellular permeability were monitored in Ussing chambers and micro-snapwells. Zonula occludens 1 protein redistribution after bacteria colonization was evaluated on cell monolayers. Small intestines exposed to enteric bacteria secreted zonulin. This secretion was independent of either the species of the small intestines or the virulence of the microorganisms tested, occurred only on the luminal aspect of the bacteria-exposed small-intestinal mucosa, and was followed by a decrease in small-intestinal tissue resistance (transepithelial electrical resistance). The transepithelial electrical resistance decrement was secondary to the zonulin-induced tight junction disassembly, as also shown by the disengagement of the protein zonula occludens 1 protein from the tight junctional complex. This zonulin-driven opening of the paracellular pathway may represent a defensive mechanism, which flushes out microorganisms and contributes to the host response against bacterial colonization of the small intestine.

  16. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  17. Restoration of impaired intestinal barrier function by the hydrolysed casein diet contributes to the prevention of type 1 diabetes in the diabetes-prone BioBreeding rat.

    Science.gov (United States)

    Visser, J T J; Lammers, K; Hoogendijk, A; Boer, M W; Brugman, S; Beijer-Liefers, S; Zandvoort, A; Harmsen, H; Welling, G; Stellaard, F; Bos, N A; Fasano, A; Rozing, J

    2010-12-01

    Impaired intestinal barrier function is observed in type 1 diabetes patients and animal models of the disease. Exposure to diabetogenic antigens from the intestinal milieu due to a compromised intestinal barrier is considered essential for induction of the autoimmune process leading to type 1 diabetes. Since a hydrolysed casein (HC) diet prevents autoimmune diabetes onset in diabetes-prone (DP)-BioBreeding (BB) rats, we studied the role of the HC diet on intestinal barrier function and, therefore, prevention of autoimmune diabetes onset in this animal model. DP-BB rats were fed the HC diet from weaning onwards and monitored for autoimmune diabetes development. Intestinal permeability was assessed in vivo by lactulose-mannitol test and ex vivo by measuring transepithelial electrical resistance (TEER). Levels of serum zonulin, a physiological tight junction modulator, were measured by ELISA. Ileal mRNA expression of Myo9b, Cldn1, Cldn2 and Ocln (which encode the tight junction-related proteins myosin IXb, claudin-1, claudin-2 and occludin) and Il-10, Tgf-ß (also known as Il10 and Tgfb, respectively, which encode regulatory cytokines) was analysed by quantitative PCR. The HC diet reduced autoimmune diabetes by 50% in DP-BB rats. In DP-BB rats, prediabetic gut permeability negatively correlated with the moment of autoimmune diabetes onset. The improved intestinal barrier function that was induced by HC diet in DP-BB rats was visualised by decreasing lactulose:mannitol ratio, decreasing serum zonulin levels and increasing ileal TEER. The HC diet modified ileal mRNA expression of Myo9b, and Cldn1 and Cldn2, but left Ocln expression unaltered. Improved intestinal barrier function might be an important intermediate in the prevention of autoimmune diabetes by the HC diet in DP-BB rats. Effects on tight junctions, ileal cytokines and zonulin production might be important mechanisms for this effect.

  18. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  19. Impaired barrier function by dietary fructo-oligosaccharides (FOS in rats is accompanied by increased colonic mitochondrial gene expression

    Directory of Open Access Journals (Sweden)

    Kramer Evelien

    2008-03-01

    well as three other peptide hormone genes; peptide YY, pancreatic polypeptide and cholecystokinin. Conclusion We conclude that altered energy metabolism may underly colonic barrier function disruption due to FOS feeding in rats.

  20. Diabetes mellitus and impairment of intestinal barier function

    OpenAIRE

    Hoffmanová, Iva

    2015-01-01

    Introduction: Impairment of intestinal barrier function is involved in pathogenesis of immune mediated diseases (such as type 1 diabetes mellitus or celiac disease) and metabolic diseases (such as type 2 diabetes mellitus). Aims of study: The first aim was to analyze impairment of mucosal part of intestinal barrier in both type of diabetes and to describe differences when compared to celiac disease, which is a typical condition associated with impairment of intestinal barrier function. The se...

  1. Impaired endothelial barrier function in apolipoprotein M-deficient mice is dependent on sphingosine-1-phosphate receptor 1

    DEFF Research Database (Denmark)

    Christensen, Pernille M; Liu, Catherine H; Swendeman, Steven L

    2016-01-01

    Apolipoprotein M (ApoM) transports sphingosine-1-phosphate (S1P) in plasma, and ApoM-deficient mice (Apom(-/-)) have ∼50% reduced plasma S1P levels. There are 5 known S1P receptors, and S1P induces adherens junction formation between endothelial cells through the S1P1 receptor, which in turn...... suppresses vascular leak. Increased vascular permeability is a hallmark of inflammation. The purpose of this study was to explore the relationships between vascular leakage in ApoM deficiency and S1P1 function in normal physiology and in inflammation. Vascular permeability in the lungs was assessed...... by accumulation of dextran molecules (70 kDa) and was increased ∼40% in Apom(-/-) mice compared to WT (C57Bl6/j) mice. Reconstitution of plasma ApoM/S1P or treatment with an S1P1 receptor agonist (SEW2871) rapidly reversed the vascular leakage to a level similar to that in WT mice, suggesting that it is caused...

  2. Additive impairment of the barrier function and irritation by biogenic amines and sodium lauryl sulphate: a controlled in vivo tandem irritation study.

    Science.gov (United States)

    Fluhr, J W; Kelterer, D; Fuchs, S; Kaatz, M; Grieshaber, R; Kleesz, P; Elsner, P

    2005-01-01

    Biogenic amines are potential irritants e.g. in fish-, meat-, milk- and egg-processing professions like cooks, butchers and bakers. The aim of this study was to test the irritative and barrier-disrupting properties of the biogenic amines ammonium hydroxide (AM), dimethylamine (DMA) and trimethylamine (TMA). A repeated sequential irritation of 30 min twice per day was performed over a total of 4 days (tandem repeated irritation test) on the back of 20 healthy volunteers of both sexes with AM, DMA, TMA and sodium lauryl sulphate (SLS). The epidermal barrier function was assessed with a Tewameter TM 210, stratum corneum surface pH was measured with a Skin-pH-Meter 900, inflammation was assessed with a Chromameter CR-300 on the a* axis for redness and a visual score was recorded. All tested biogenic amines (AM, DMA and TMA) induced a barrier disruption and a pH increase paralleled with a 1-day-delayed onset of inflammatory signs. These effects were further enhanced and accelerated by a sequential application of SLS together with the biogenic amines, and inflammation occurred earlier than with the single compounds. Acetic acid (AA) in contrast did only show mild barrier disruption and no significant inflammatory signs. Our system allowed a ranking of the different compounds in their irritative potential in the tandem irritation with SLS: SLS > NaOH > TMA > AA > AM > DMA. The results are suggestive that in the food-processing industry the simultaneous contact with biogenic amines and harmful detergents like SLS should be minimized. Copyright 2005 S. Karger AG, Basel.

  3. Skin Barrier Function and Allergens

    DEFF Research Database (Denmark)

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...

  4. Functional barriers: Properties and evaluation

    NARCIS (Netherlands)

    Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

    2005-01-01

    Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of

  5. Reduced Mastication Impairs Memory Function.

    Science.gov (United States)

    Fukushima-Nakayama, Y; Ono, Takehito; Hayashi, M; Inoue, M; Wake, H; Ono, Takashi; Nakashima, T

    2017-08-01

    Mastication is an indispensable oral function related to physical, mental, and social health throughout life. The elderly tend to have a masticatory dysfunction due to tooth loss and fragility in the masticatory muscles with aging, potentially resulting in impaired cognitive function. Masticatory stimulation has influence on the development of the central nervous system (CNS) as well as the growth of maxillofacial tissue in children. Although the relationship between mastication and cognitive function is potentially important in the growth period, the cellular and molecular mechanisms have not been sufficiently elucidated. Here, we show that the reduced mastication resulted in impaired spatial memory and learning function owing to the morphological change and decreased activity in the hippocampus. We used an in vivo model for reduced masticatory stimuli, in which juvenile mice were fed with powder diet and found that masticatory stimulation during the growth period positively regulated long-term spatial memory to promote cognitive function. The functional linkage between mastication and brain was validated by the decrease in neurons, neurogenesis, neuronal activity, and brain-derived neurotrophic factor (BDNF) expression in the hippocampus. These findings taken together provide in vivo evidence for a functional linkage between mastication and cognitive function in the growth period, suggesting a need for novel therapeutic strategies in masticatory function-related cognitive dysfunction.

  6. UNDERSTANDING THE BARRIERS: GROCERY STORES AND VISUALLY IMPAIRED SHOPPERS

    Directory of Open Access Journals (Sweden)

    Doaa Khattab

    2015-11-01

    Grocery stores include many different zones and services with the aisles area being one of the main barriers to access for people with impaired vision.  This area features many different sections such as canned goods, dry packaged goods, spices, drinks and snacks, baking supplies, baby items, cereals, cleaning products, pet supplies, and health and beauty items.  For visually impaired individuals, however, it can be hard to reach these various sections and to find the relevant products.  The purpose of this paper is to present a study that sought to understand the barriers that shoppers with vision impairment (VI face in the grocery store`s built environment. The research approach was based on the application of the ethnography method, Think-aloud Protocol (TAP, Interviews, and behavioural mapping method.

  7. Impaired barrier function in patients with house dust mite-induced allergic rhinitis is accompanied by decreased occludin and zonula occludens-1 expression

    NARCIS (Netherlands)

    Steelant, Brecht; Farré, Ricard; Wawrzyniak, Paulina; Belmans, Jochen; Dekimpe, Emily; Vanheel, Hanne; van Gerven, Laura; Kortekaas Krohn, Inge; Bullens, Dominique M. A.; Ceuppens, Jan L.; Akdis, Cezmi A.; Boeckxstaens, Guy; Seys, Sven F.; Hellings, Peter W.

    2016-01-01

    Tight junction (TJ) defects have recently been associated with asthma and chronic rhinosinusitis. The expression, function, and regulation of nasal epithelial TJs remain unknown in patients with allergic rhinitis (AR). We investigated the expression, function, and regulation of TJs in the nasal

  8. Impaired function of the blood-testis barrier during aging is preceded by a decline in cell adhesion proteins and GTPases.

    Directory of Open Access Journals (Sweden)

    Catriona Paul

    Full Text Available With increasing age comes many changes in the testis, including germ cell loss. Cell junctions in the testis tether both seminiferous epithelial and germ cells together and assist in the formation of the blood-testis barrier (BTB, which limits transport of biomolecules, ions and electrolytes from the basal to the adluminal compartment and protects post-meiotic germ cells. We hypothesize that as male rats age the proteins involved in forming the junctions decrease and that this alters the ability of the BTB to protect the germ cells. Pachytene spermatocytes were isolated from Brown Norway rat testes at 4 (young and 18 (aged months of age using STA-PUT velocity sedimentation technique. RNA was extracted and gene expression was assessed using Affymetrix rat 230 2.0 whole rat genome microarrays. Microarray data were confirmed by q-RT-PCR and protein expression by Western blotting. Of the genes that were significantly decreased by at least 1.5 fold, 70 were involved in cell adhesion; of these, at least 20 are known to be specifically involved in junction dynamics within the seminiferous epithelium. The mRNA and protein levels of Jam2, Ocln, cdh2 (N-cadherin, ctnna (α-catenin, and cldn11 (involved in adherens junctions, among others, were decreased by approximately 50% in aged spermatocytes. In addition, the GTPases Rac1 and cdc42, involved in the recruitment of cadherins to the adherens junctions, were similarly decreased. It is therefore not surprising that with lower expression of these proteins that the BTB becomes diminished with age. We saw, using a FITC tracer, a gradual collapse of the BTB between 18 and 24 months. This provides the opportunity for harmful substances and immune cells to cross the BTB and cause the disruption of spermatogenesis that is observed with increasing age.

  9. Marital Conflict, Depressive Symptoms, and Functional Impairment

    OpenAIRE

    Choi, Heejeong; Marks, Nadine F.

    2008-01-01

    Guided by a stress process perspective, we investigated (a) whether marital conflict might directly lead to changes in depression and functional impairment, (b) whether marital conflict might indirectly lead to changes in functional impairment via depression, and (c) whether marital conflict might indirectly lead to changes in depression via functional impairment. We estimated a latent variable causal model using 3 waves of data from the National Survey of Families and Households (N = 1,832)....

  10. Blood-CNS Barrier Impairment in ALS Patients versus an Animal Model

    Directory of Open Access Journals (Sweden)

    Svitlana eGarbuzova-Davis

    2014-02-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a severe neurodegenerative disease with a compli-cated and poorly understood pathogenesis. Recently, alterations in the blood-Central Nervous System barrier (B-CNS-B have been recognized as a key factor possibly aggravating motor neuron damage. The majority of findings on ALS microvascular pathology have been deter-mined in mutant SOD1 rodent models, identifying barrier damage during disease develop-ment which might similarly occur in familial ALS patients carrying the SOD1 mutation. However, our knowledge of B-CNS-B competence in sporadic ALS (SALS has been limited. We recently showed structural and functional impairment in postmortem gray and white mat-ter microvessels of medulla and spinal cord tissue from SALS patients, suggesting pervasive barrier damage. Although numerous signs of barrier impairment (endothelial cell degenera-tion, capillary leakage, perivascular edema, downregulation of tight junction proteins, and microhemorrhages are indicated in both mutant SOD1 animal models of ALS and SALS pa-tients, other pathogenic barrier alterations have as yet only been identified in SALS patients. Pericyte degeneration, perivascular collagen IV expansion, and white matter capillary abnor-malities in SALS patients are significant barrier related pathologies yet to be noted in ALS SOD1 animal models. In the current review, these important differences in blood-CNS barrier damage between ALS patients and animal models, which may signify altered barrier transport mechanisms, are discussed. Understanding discrepancies in barrier condition between ALS patients and animal models may be crucial for developing effective therapies.

  11. Marital Conflict, Depressive Symptoms, and Functional Impairment

    Science.gov (United States)

    Choi, Heejeong; Marks, Nadine F

    2008-01-01

    Guided by a stress process perspective, we investigated (a) whether marital conflict might directly lead to changes in depression and functional impairment, (b) whether marital conflict might indirectly lead to changes in functional impairment via depression, and (c) whether marital conflict might indirectly lead to changes in depression via…

  12. 38 CFR 4.10 - Functional impairment.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Functional impairment. 4.10 Section 4.10 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS SCHEDULE FOR RATING DISABILITIES General Policy in Rating § 4.10 Functional impairment. The basis of disability...

  13. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  14. Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

    Science.gov (United States)

    Kawano, Ken-Ichi; Umemura, Kazuo

    2013-05-01

    The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

  15. Defective channels lead to an impaired skin barrier.

    Science.gov (United States)

    Blaydon, Diana C; Kelsell, David P

    2014-10-15

    Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

  16. Apoptosis of Endothelial Cells by 13-HPODE Contributes to Impairment of Endothelial Barrier Integrity

    Directory of Open Access Journals (Sweden)

    Valerie E. Ryman

    2016-01-01

    Full Text Available Inflammation is an essential host response during bacterial infections such as bovine mastitis. Endothelial cells are critical for an appropriate inflammatory response and loss of vascular barrier integrity is implicated in the pathogenesis of Streptococcus uberis-induced mastitis. Previous studies suggested that accumulation of linoleic acid (LA oxygenation products derived from 15-lipoxygenase-1 (15-LOX-1 metabolism could regulate vascular functions. The initial LA derivative from the 15-LOX-1 pathway, 13-hydroperoxyoctadecadienoic acid (HPODE, can induce endothelial death, whereas the reduced hydroxyl product, 13-hydroxyoctadecadienoic acid (HODE, is abundantly produced during vascular activation. However, the relative contribution of specific LA-derived metabolites on impairment of mammary endothelial integrity is unknown. Our hypothesis was that S. uberis-induced LA-derived 15-LOX-1 oxygenation products impair mammary endothelial barrier integrity by apoptosis. Exposure of bovine mammary endothelial cells (BMEC to S. uberis did not increase 15-LOX-1 LA metabolism. However, S. uberis challenge of bovine monocytes demonstrated that monocytes may be a significant source of both 13-HPODE and 13-HODE during mastitis. Exposure of BMEC to 13-HPODE, but not 13-HODE, significantly reduced endothelial barrier integrity and increased apoptosis. Changing oxidant status by coexposure to an antioxidant during 13-HPODE treatment prevented adverse effects of 13-HPODE, including amelioration of apoptosis. A better understanding of how the oxidant status of the vascular microenvironment impacts endothelial barrier properties could lead to more efficacious treatments for S. uberis mastitis.

  17. Uniting Control Lyapunov and Control Barrier Functions

    NARCIS (Netherlands)

    Romdlony, Zakiyullah; Jayawardhana, Bayu

    2014-01-01

    In this paper, we propose a nonlinear control design for solving the problem of stabilization with guaranteed safety. The design is based on the merging of a Control Lyapunov Function and a Control Barrier Function. The proposed control method allows us to combine the design of a stabilizer based on

  18. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  19. Permeability Barrier and Microstructure of Skin Lipid Membrane Models of Impaired Glucosylceramide Processing

    OpenAIRE

    Sochorov?, Michaela; Sta?kov?, Kl?ra; Pullmannov?, Petra; Kov??ik, Andrej; Zbytovsk?, Jarmila; V?vrov?, Kate?ina

    2017-01-01

    Ceramide (Cer) release from glucosylceramides (GlcCer) is critical for the formation of the skin permeability barrier. Changes in ?-glucocerebrosidase (GlcCer?ase) activity lead to diminished Cer, GlcCer accumulation and structural defects in SC lipid lamellae; however, the molecular basis for this impairment is not clear. We investigated impaired GlcCer-to-Cer processing in human Cer membranes to determine the physicochemical properties responsible for the barrier defects. Minor impairment (...

  20. Respiratory Symptoms and Pulmonary Function Impairment among ...

    African Journals Online (AJOL)

    Background: The industrial process of detergent production could be deleterious to lung function. This study describes respiratory symptoms and ventilatory function impairment among detergent workers in Jos, Northern Nigeria. Methods: Two hundred detergent plant workers and controls were studied for the presence of ...

  1. Eating disorder severity and functional impairment

    DEFF Research Database (Denmark)

    Davidsen, Annika Helgadóttir; Hoyt, William T.; Poulsen, Stig Bernt

    2017-01-01

    Purpose: The aim was to examine duration of illness and body mass index as possible moderators of the relationship between eating disorder severity and functional impairment, as well as psychological distress as a possible mediator of this relationship. Methods: The study included 159 patients...... was measured with the Sheehan Disability Scale, and psychological distress was measured with the Symptom Check List-90-R. Duration of illness and body mass index were assessed clinically. Results: Duration of illness significantly moderated the relationship between eating disorder severity and functional...... impairment; the relationship was strongest for patients with a shorter duration of illness. Psychological distress partly mediated the relationship between eating disorder severity and functional impairment. Duration of illness significantly moderated the relationship between psychological distress...

  2. Vestibular Function Impairment in Alzheimer's Disease.

    Science.gov (United States)

    Nakamagoe, Kiyotaka; Fujimiya, Suguru; Koganezawa, Tadachika; Kadono, Kotarou; Shimizu, Kotone; Fujizuka, Natsu; Takiguchi, Shino; Ueno, Tomoyuki; Monzen, Tatsuya; Tamaoka, Akira

    2015-01-01

    Falls and fractures due to impaired balance in patients with Alzheimer's disease (AD) have an adverse effect on the clinical course of the disease. To evaluate balance impairment in AD from the viewpoint of vestibular functional impairment. The subjects were 12 patients with AD, 12 dementia-free elderly adults, and 12 younger adults. Vestibular function was assessed using a stepping test, caloric nystagmus, and a visual suppression (VS) test. The stepping test was abnormal in 9 of the 12 patients in the AD group. An abnormal stepping test was not associated with self-reported dizziness or tendency to fall. Significant VS abnormalities were present in the AD group. The suppression rate of VS was lower in AD patients with either a tendency to fall or constructional apraxia than in AD patients without either. The velocity of the rapid phase of caloric nystagmus before the VS test was similar in the AD group and the elderly control group. Significant abnormalities of both caloric nystagmus and VS were not present in either the elderly or the younger control groups. AD could involve impairments in the vestibular control of balance. The VS test is useful for assessing the tendency to fall in AD. Impairment of VS in AD might arise from cerebral vestibular cortex impairment rather than comorbid peripheral vestibular disorders.

  3. Permanent isolation surface barrier: Functional performance

    International Nuclear Information System (INIS)

    Wing, N.R.

    1993-10-01

    This document presents the functional performance parameters for permanent isolation surface barriers. Permanent isolation surface barriers have been proposed for use at the Hanford Site (and elsewhere) to isolate and dispose of certain types of waste in place. Much of the waste that would be disposed of using in-place isolation techniques is located in subsurface structures, such as solid waste burial grounds, tanks, vaults, and cribs. Unless protected in some way, the wastes could be transported to the accessible environment via transport pathways, such as water infiltration, biointrusion, wind and water erosion, human interference, and/or gaseous release

  4. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  5. Loss of Mitochondrial Function Impairs Lysosomes.

    Science.gov (United States)

    Demers-Lamarche, Julie; Guillebaud, Gérald; Tlili, Mouna; Todkar, Kiran; Bélanger, Noémie; Grondin, Martine; Nguyen, Angela P; Michel, Jennifer; Germain, Marc

    2016-05-06

    Alterations in mitochondrial function, as observed in neurodegenerative diseases, lead to disrupted energy metabolism and production of damaging reactive oxygen species. Here, we demonstrate that mitochondrial dysfunction also disrupts the structure and function of lysosomes, the main degradation and recycling organelle. Specifically, inhibition of mitochondrial function, following deletion of the mitochondrial protein AIF, OPA1, or PINK1, as well as chemical inhibition of the electron transport chain, impaired lysosomal activity and caused the appearance of large lysosomal vacuoles. Importantly, our results show that lysosomal impairment is dependent on reactive oxygen species. Given that alterations in both mitochondrial function and lysosomal activity are key features of neurodegenerative diseases, this work provides important insights into the etiology of neurodegenerative diseases. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Functional impairment and mental health functioning among Vietnamese children.

    Science.gov (United States)

    Dang, Hoang-Minh; Weiss, Bahr; Trung, Lam T

    2016-01-01

    Functional impairment is a key indicator of need for mental health services among children and adolescents, often a stronger predictor of service usage than mental health symptoms themselves. Functional impairment may be of particular importance in low- and middle-income countries (LMIC) because of its potential to focus policy on treatment of child mental health problems which is generally given low priority in LMIC. However, few studies have assessed functional impairment in LMIC. The present study assessed rates of functional impairment among children in Vietnam, as a case example of an LMIC, as well as effects of other risk/protective factors of particular relevance to LMIC (e.g., whether the family lived in an urban or rural area; family structure variables such as grandparents living with the family). 1314 parents of children 6-16 years old from 10 Vietnamese provinces were interviewed. The overall rate of functional impairment among Vietnamese children was 20 %, similar to rates in high-income countries such as Germany and the United States, suggesting that LMIC status may not be associated with dramatic increases in functional impairment in children. Functional impairment was significantly greater among mental health cases than non-cases, with increases of over 550 % associated with mental health caseness. A number of other risk factors (e.g., marital status) had smaller but significant effects. Mental health problems are a major but not the sole contributor to functional impairment among Vietnamese children. The pragmatic significance of this research lies in its potential to affect public awareness and policy related to child mental health in LMIC.

  7. Functional impairment and mental health functioning among Vietnamese children

    Science.gov (United States)

    Dang, Hoang-Minh; Weiss, Bahr; Trung, Lam T.

    2015-01-01

    Purpose Functional impairment is a key indicator of need for mental health services among children and adolescents, often a stronger predictor of service usage than mental health symptoms themselves. Functional impairment may be of particular importance in low and middle income countries (LMIC) because of its potential to focus policy on treatment of child mental health problems which is generally given low priority in LMIC. However, few studies have assessed functional impairment in LMIC. The present study assessed rates of functional impairment among children in Vietnam, as a case example of an LMIC, as well as effects of other risk/protective factors of particular relevance to LMIC (e.g., whether the family lived in an urban or rural area; family structure variables such as grandparents living with the family). Methods 1,314 parents of children 6–16 years old from 10 Vietnamese provinces were interviewed. Results The overall rate of functional impairment among Vietnamese children was 20%, similar to rates in high income countries such as Germany and the United States, suggesting that LMIC status may not be associated with dramatic increases in functional impairment in children. Functional impairment was significantly greater among mental health cases than non-cases, with increases of over 550% associated with mental health caseness. A number of other risk factors (e.g., marital status) had smaller but significant effects. Conclusions Mental health problems are a major but not the sole contributor to functional impairment among Vietnamese children. The pragmatic significance of this research lies in its potential to affect public awareness and policy related to child mental health in LMIC. PMID:26315942

  8. Correlates of impaired function in older women.

    Science.gov (United States)

    Ensrud, K E; Nevitt, M C; Yunis, C; Cauley, J A; Seeley, D G; Fox, K M; Cummings, S R

    1994-05-01

    To determine the factors associated with impaired function in older women. Cross-sectional analysis of baseline data collected for a multicenter, prospective study of risk factors for osteoporotic fractures. Four clinical centers in Portland, Oregon, Minneapolis, Minnesota, Baltimore, Maryland, and the Monongahela Valley, Pennsylvania. A total of 9,704 ambulatory, non-black women, aged 65 years and older, recruited from population-based listings. Independent variables, including demographic and historical information (medical conditions, health habits, and medications) and physiologic measures (anthropometry, blood pressure, mental status, vision, and neuromuscular performance) were obtained from a baseline questionnaire, interview, and examination. Measurement of function was assessed by self-reported ability to perform six physical and instrumental activities of daily living (ADL) and impaired function (dependent variable) was defined as difficulty performing three or more physical and instrumental ADLs. In order of decreasing strength of association, hip fracture, osteoarthritis, parkinsonism, slower walking speed, lower hip abduction force, back pain, greater Quetelet index, osteoporosis, former alcohol use, stroke, never drinking alcohol, lower mental status, use of anxiolytics and/or sleeping medications, inability to hold the tandem position, postural dizziness, cataracts, greater waist to hip ratio, lower physical activity in the past year, greater lifetime cigarette consumption, and lower grip strength were independently associated with impaired function in multivariate analyses. Age, low educational level, diabetes, current heavy alcohol use, postural hypotension, depth perception, and contrast sensitivity were not independent predictors. A combination of neuromuscular performance measures, including decreased muscle strength and impaired balance and gait, appeared to account for the effect of age on disability. A combination of many factors, including

  9. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  10. Functional Hubs in Mild Cognitive Impairment

    Science.gov (United States)

    Navas, Adrián; Papo, David; Boccaletti, Stefano; Del-Pozo, F.; Bajo, Ricardo; Maestú, Fernando; Martínez, J. H.; Gil, Pablo; Sendiña-Nadal, Irene; Buldú, Javier M.

    We investigate how hubs of functional brain networks are modified as a result of mild cognitive impairment (MCI), a condition causing a slight but noticeable decline in cognitive abilities, which sometimes precedes the onset of Alzheimer's disease. We used magnetoencephalography (MEG) to investigate the functional brain networks of a group of patients suffering from MCI and a control group of healthy subjects, during the execution of a short-term memory task. Couplings between brain sites were evaluated using synchronization likelihood, from which a network of functional interdependencies was constructed and the centrality, i.e. importance, of their nodes was quantified. The results showed that, with respect to healthy controls, MCI patients were associated with decreases and increases in hub centrality respectively in occipital and central scalp regions, supporting the hypothesis that MCI modifies functional brain network topology, leading to more random structures.

  11. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

  12. Impaired coronary microvascular function in diabetics

    International Nuclear Information System (INIS)

    Tsujimoto, Go

    2000-01-01

    Global and regional myocardial uptake was determined with technetium-99m tetrofosmin and a 4 hour exercise (370 MBq iv) and rest (740 MBq iv) protocol, in 24 patients with non-insulin dependent diabetes mellitus and in 22 control subjects. The purpose of this study was to evaluate impaired coronary microvascular function in diabetics by measurement of % uptake increase in myocardial counts. The parameter of % uptake increase (ΔMTU) was calculated as the ratio of exercise counts to rest myocardial counts with correction of myocardial uptake for dose administered and physical decay between the exercise study and the rest study. Global ΔMTU was significantly lower in the diabetics than in control subjects (14.4±5.4% vs. 21.7±8.5%, p<0.01). Regional ΔMTU in each of 4 left ventricular regions (anterior, septal, inferior, posterolateral) was significantly lower in the diabetic group than in the control group (p<0.01) respectively, but there were no significant differences between ΔMTU in the 4 left ventricular regions in the same group. ΔMTU was useful as a non-invasive means of evaluating impaired coronary microvascular function in diabetics. (author)

  13. Evaluation of functional impairment in psoriasis

    Directory of Open Access Journals (Sweden)

    Gaikwad Rohini

    2006-01-01

    Full Text Available Background: Psoriasis is a chronic disease, the course of which is punctuated by exacerbations and remissions. The impact of a chronic, relapsing, and disfiguring disease such as psoriasis on occupational, social, and other areas of functioning is substantial and needs attention. Aim: The purpose of this study was to assess the level and nature of functional impairment in psoriasis. Methods: Forty-three consecutive patients attending the dermatology clinic of a rural hospital were studied for psychiatric comorbidity and the level of functioning, using a semistructured questionnaire. Results: Psoriasis affected social functioning of 48% patients, led to decreased work efficiency in 51.1%, and to subjective distress at work in 62.8% of patients. Stress in home environment and interpersonal relationships was reported by 69.8%. Social and occupational functioning worsened with increasing severity of psoriasis after 1-year duration of illness. Patients complaining of pruritis frequently had anxiety disorders. Psychiatric comorbidity was detected in 67.4% cases. Conclusion : Substantial proportion of patients suffered deterioration of functioning, especially with increasing duration of illness. Thus, timely attention by dermatologists is needed in order to limit the disability caused by psoriasis. To achieve this, liaison with psychiatrist would be crucial along with illness education and emotional support.

  14. Impairment of brain endothelial glucose transporter by methamphetamine causes blood-brain barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Murrin L Charles

    2011-03-01

    Full Text Available Abstract Background Methamphetamine (METH, an addictive psycho-stimulant drug with euphoric effect is known to cause neurotoxicity due to oxidative stress, dopamine accumulation and glial cell activation. Here we hypothesized that METH-induced interference of glucose uptake and transport at the endothelium can disrupt the energy requirement of the blood-brain barrier (BBB function and integrity. We undertake this study because there is no report of METH effects on glucose uptake and transport across the blood-brain barrier (BBB to date. Results In this study, we demonstrate that METH-induced disruption of glucose uptake by endothelium lead to BBB dysfunction. Our data indicate that a low concentration of METH (20 μM increased the expression of glucose transporter protein-1 (GLUT1 in primary human brain endothelial cell (hBEC, main component of BBB without affecting the glucose uptake. A high concentration of 200 μM of METH decreased both the glucose uptake and GLUT1 protein levels in hBEC culture. Transcription process appeared to regulate the changes in METH-induced GLUT1 expression. METH-induced decrease in GLUT1 protein level was associated with reduction in BBB tight junction protein occludin and zonula occludens-1. Functional assessment of the trans-endothelial electrical resistance of the cell monolayers and permeability of dye tracers in animal model validated the pharmacokinetics and molecular findings that inhibition of glucose uptake by GLUT1 inhibitor cytochalasin B (CB aggravated the METH-induced disruption of the BBB integrity. Application of acetyl-L-carnitine suppressed the effects of METH on glucose uptake and BBB function. Conclusion Our findings suggest that impairment of GLUT1 at the brain endothelium by METH may contribute to energy-associated disruption of tight junction assembly and loss of BBB integrity.

  15. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  17. Designed to deter. Community barriers to physical activity for people with visual or motor impairments.

    Science.gov (United States)

    Kirchner, Corinne E; Gerber, Elaine G; Smith, Brooke C

    2008-04-01

    People with disabilities are more likely to be obese, in poor health, and get less physical activity than the general population. However, research on community factors for physical activity has generally either excluded most people with disabilities, or overlooked relevant factors of community accessibility. This exploratory study investigated environmental factors affecting people with motor impairments and people with visual impairments in urban neighborhoods. Quantitative and qualitative methods were used with a nonrandom sample (n=134) of users of four types of assistive mobility technologies: guide dogs, long canes, and motorized and manual wheelchairs. From July 2005 to August 2006, the sample participated in two telephone surveys. Between the surveys, a stratified random subsample (n =32) engaged in an ethnographic phase of observation and interviews. Most participants in all groups using assistive mobility technologies rated their neighborhoods as accessible, although they also reported many specific barriers. Users of assistive mobility technologies differed in the amount of reported physical activity and on specific barriers. Problems with sidewalk pavement and puddles/poor drainage were the most frequently mentioned environmental barriers, by 90% and 80%, respectively. Users of assistive mobility technologies were more similar on main strategies for dealing with barriers. All groups reported having to plan routes for outings, to alter planned routes, to go more slowly than planned, or to wait for a different time. Despite legislative requirements for accommodation, people with disabilities face barriers to physical activity, both in the built and social environments. Determined people with disabilities were able to overcome barriers, but required additional expenditure of resources to do so. Community design that can include people with disabilities requires detailed understanding of barriers specific both to types of impairments and to different types

  18. Crossing safety barriers: influence of children's morphological and functional variables.

    Science.gov (United States)

    Cordovil, Rita; Vieira, Filomena; Barreiros, João

    2012-05-01

    Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  19. Executive Functioning, Barriers to Adherence, and Nonadherence in Adolescent and Young Adult Transplant Recipients.

    Science.gov (United States)

    Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Reed-Knight, Bonney; Loiselle, Kristin; Mee, Laura L; LaMotte, Julia; Liverman, Rochelle; Blount, Ronald L

    2016-08-01

    OBJECTIVE : To evaluate levels of executive functioning in a sample of adolescent and young adult (AYA) transplant recipients, and to examine executive functioning in association with barriers to adherence and medication nonadherence.  METHOD : In all, 41 caregivers and 39 AYAs were administered self- and proxy-report measures.  RESULTS : AYA transplant recipients have significant impairments in executive functioning abilities. Greater dysfunction in specific domains of executive functioning was significantly associated with more barriers to adherence and greater medication nonadherence.  CONCLUSION : AYA transplant recipients are at increased risk for executive dysfunction. The assessment of executive functioning abilities may guide intervention efforts designed to decrease barriers to adherence and promote developmentally appropriate levels of treatment responsibility. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Impaired neutrophil function in intestinal lymphangiectasia.

    OpenAIRE

    Bolton, R P; Cotter, K L; Losowsky, M S

    1986-01-01

    Impaired neutrophil chemotaxis and phagocytosis were shown in three patients with intestinal lymphangiectasia. Abnormalities in cell associated and serum derived activity occurred, and possible mechanisms are suggested.

  1. Annual research review : conceptualising functional impairment in children and adolescents

    NARCIS (Netherlands)

    Rapee, R.M.; Bogels, S.M.; van der Sluis, Cathy .M.; Craske, M.G.; Ollendick, T.

    2012-01-01

    Functional impairment is a key factor in the clinical importance of mental health problems in children. Yet, the nature of impairment and criteria for defining and assessing impairment in childhood disorders has been surprisingly overlooked in much of the literature. The current article examines the

  2. Annual research review: conceptualising functional impairment in children and adolescents

    NARCIS (Netherlands)

    Rapee, R.M.; Bögels, S.M.; van der Sluis, C.M.; Craske, M.G.; Ollendick, T.

    2012-01-01

    Functional impairment is a key factor in the clinical importance of mental health problems in children. Yet, the nature of impairment and criteria for defining and assessing impairment in childhood disorders has been surprisingly overlooked in much of the literature. The current article examines the

  3. The utilization and barriers of Pap smear among women with visual impairment.

    Science.gov (United States)

    Fang, Wen-Hui; Yen, Chia-Feng; Hu, Jung; Lin, Jin-Ding; Loh, Ching-Hui

    2016-04-12

    Many evidences illustrate that the Pap smear screening successfully reduces if the cervical cancer could be detected and treated sufficiently early. People with disability were higher comorbidity prevalence, and less likely to use preventive health care and health promotion activities. There were also to demonstrate that people with visual impairment has less access to appropriate healthcare services and is less likely to receive screening examinations. In Taiwan, there was no study to explore utilization of Pap smear, associated factors and use barriers about Pap smear screening test among women with visual impairment. The purpose is to explore the utilization and barriers of using Pap smear for women with visual impairment in Taiwan. To identify the barriers of women with visual from process of receiving Pap smear screening test. The cross-sectional study was conducted and the totally 316 participators were selected by stratified proportional and random sampling from 15 to 64 year old women with visual impairment who lived in Taipei County during December 2009 to January 2010. The data was been collected by phone interview and the interviewers were well trained before interview. The mean age was 47.1 years old and the highest percentage of disabled severity was mile (40.2 %). Totally, 66.5 % of participators were ever using Pap smear and 38.9 % used it during pass 1 year. Their first time to accept Pap smear was 38.8 year old. There was near 50 % of them not to be explained by professionals before accepting the Pap smear. For non-using cases, the top two percentage of barriers were "feel still younger" (22.3 %), the second was "there's no sexual experience" (21.4 %). We found the gynecology experiences was key factor for women with visual impairment to use Pap smear, especially the experiences was during 1 year (OR = 4). Associated factors and barriers to receive Pap smear screening test for women with visual impairment can be addressed through interventions

  4. Development of the Barriers to Physical Activity Questionnaire for People with Mobility Impairments.

    Science.gov (United States)

    Vasudevan, Vijay; Rimmer, James H; Kviz, Frederick

    2015-10-01

    Despite the widely known benefits of physical activity, people with disabilities are more likely to be inactive when compared to people without disabilities. Previous questionnaires that measure barriers physical activity for people with disabilities do not measure barriers from an ecological perspective. The purpose of this study was to develop the Barriers to Physical Activity Questionnaire for People with Mobility Impairments (BPAQ-MI) that measures barriers using an ecological framework. This study consisted of two phases. In Phase one, developed the content validity by (a) developing an item bank, (b) identifying missing items and combining items using a Delphi panel, and (c) refine item wording via cognitive interviews. In Phase two, people with mobility impairments took part in in-person interviews to establish test-retest reliability, internal consistency, and construct validity of the BPAQ-MI. Exploratory factor analysis revealed the BPAQ-MI was comprised of eight subscales or factors: health; beliefs and attitudes; family; friends; fitness center built environment; staff and policy; community built environment; and safety. The BPAQ-MI demonstrated very good test-retest reliability. Cronbach's alpha ranged from 0.792 to 0.935. The BPAQ-MI showed significant negative correlations with exercise (minutes/week) and significant positive correlations between BPAQ-MI subscales and inactivity (hours/day). The BPAQ-MI is the first questionnaire that places greater equity at measuring barriers to physical activity across the intrapersonal, interpersonal, organizational, and community domains. The BPAQ-MI has the potential to assist researchers in understanding the complex relationship between barriers and ultimately develop physical activity interventions that address these barriers. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Sensory Impairments and Cognitive Function in Middle-Aged Adults.

    Science.gov (United States)

    Schubert, Carla R; Cruickshanks, Karen J; Fischer, Mary E; Chen, Yanjun; Klein, Barbara E K; Klein, Ronald; Pinto, A Alex

    2017-08-01

    Hearing, visual, and olfactory impairments have been associated with cognitive impairment in older adults but less is known about associations with cognitive function in middle-aged adults. Sensory and cognitive functions were measured on participants in the baseline examination (2005-2008) of the Beaver Dam Offspring Study. Cognitive function was measured with the Trail Making tests A (TMTA) and B (TMTB) and the Grooved Peg Board test. Pure-tone audiometry, Pelli-Robson letter charts, and the San Diego Odor Identification test were used to measure hearing, contrast sensitivity, and olfaction, respectively. There were 2,836 participants aged 21-84 years with measures of hearing, visual, olfactory, and cognitive function at the baseline examination. Nineteen percent of the cohort had one sensory impairment and 3% had multiple sensory impairments. In multivariable adjusted linear regression models that included all three sensory impairments, hearing impairment, visual impairment, and olfactory impairment were each independently associated with poorer performance on the TMTA, TMTB, and Grooved Peg Board (p cognitive function tests independent of the other sensory impairments and factors associated with cognition. Sensory impairments in midlife are associated with subtle deficits in cognitive function which may be indicative of early brain aging. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Standards for the Protection of Skin Barrier Function.

    Science.gov (United States)

    Giménez-Arnau, Ana

    2016-01-01

    The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.

  7. Netrin-1 Ameliorates Blood-Brain Barrier Impairment Secondary to Ischemic Stroke via the Activation of PI3K Pathway

    Directory of Open Access Journals (Sweden)

    Jian Yu

    2017-12-01

    Full Text Available Secondary impairment of blood-brain barrier (BBB occurs in the remote thalamus after ischemic stroke. Netrin-1, an axonal guidance molecule, presents bifunctional effects on blood vessels through receptor-dependent pathways. This study investigates whether netrin-1 protects BBB against secondary injury. Netrin-1 (600 ng/d for 7 days was intracerebroventricularly infused 24 h after middle cerebral artery occlusion (MCAO in hypertensive rats. Neurological function was assessed 8 and 14 days after MCAO, and the permeability of BBB in the ipsilateral thalamus was detected. The viability of brain microvascular endothelial cells was determined after being disposed with netrin-1 (50 ng/mL before oxygen-glucose deprivation (OGD. The role of netrin-1 was further explored by examining its receptors and their function. We found that netrin-1 infusion improved neurological function, attenuated secondary impairment of BBB by up-regulating the levels of tight junction proteins and diminishing extravasation of albumin, with autophagy activation 14 days after MCAO. Netrin-1 also enhanced cell survival and autophagy activity in OGD-treated cells, inhibited by UNC5H2 siRNA transfection. Furthermore, the beneficial effects of netrin-1 were suppressed by PI3K inhibitors 3-Methyladenine and LY294002. Our results showed that netrin-1 ameliorated BBB impairment secondary to ischemic stroke by promoting tight junction function and endothelial survival. PI3K-mediated autophagy activation depending on UNC5H2 receptor could be an underlying mechanism.

  8. Impaired Skin Barrier Due to Sebaceous Gland Atrophy in the Latent Stage of Radiation-Induced Skin Injury: Application of Non-Invasive Diagnostic Methods

    Directory of Open Access Journals (Sweden)

    Hyosun Jang

    2018-01-01

    Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.

  9. Evaluating the role of functional impairment in personality psychopathology.

    Science.gov (United States)

    Boland, Jennifer K; Damnjanovic, Tatjana; Anderson, Jaime L

    2018-03-22

    DSM-5's Section III Alternative Model for Personality Disorder (AMPD) model states that an individual must show impairment in self and interpersonal functioning for PD diagnosis. The current study investigated dimensional personality trait associations with impairment, including differential patterns of impairment across specific PDs, and whether traits have improved our assessment of functional impairment in PDs. Two-hundred and seventy-seven participants were administered measures of Antisocial PD, Avoidant PD, Borderline PD, Narcissistic PD, Obsessive-Compulsive PD, and Schizotypal PD from the perspectives of Section II (PDQ-4) and Section III (PID-5) PD models, as well as measures of functional impairment in interpersonal and intrapersonal domains. Pearson correlations showed associations between ratings of impairment and most Section II and Section III PDs and trait facets, with the exception of narcissistic PD. Hierarchical regression analyses revealed that Section III PDs added predictive validity beyond Section II PDs in predicting impairment, except narcissistic PD. These findings provide support both for the impairment criterion in the AMPD and for the association between trait-based PDs and impairment, and suggest that this trait-based measurement adds uniquely to the understanding of functional impairment. Copyright © 2018. Published by Elsevier B.V.

  10. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  11. Composite of microgels and lipids as biofilm to restore skin barrier function

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

  12. Obstructive sleep apnea and cognitive impairment: Addressing the blood–brain barrier

    Science.gov (United States)

    Lim, Diane C.; Pack, Allan I.

    2013-01-01

    SUMMARY Increasing data support a connection between obstructive sleep apnea (OSA) and cognitive impairment but a causal link has yet to be established. Although neuronal loss has been linked to cognitive impairment, emerging theories propose that changes in synaptic plasticity can cause cognitive impairment. Studies demonstrate that disruption to the blood–brain barrier (BBB), which is uniquely structured to tightly maintain homeostasis inside the brain, leads to changes in the brain’s microenvironment and affects synaptic plasticity. Cyclical intermittent hypoxia is a stressor that could disrupt the BBB via molecular responses already known to occur in either OSA patients or animal models of intermittent hypoxia. However, we do not yet know if or how intermittent hypoxia can cause cognitive impairment by mechanisms operating at the BBB. Therefore, we propose that initially, adaptive homeostatic responses at the BBB occur in response to increased oxygen and nutrient demand, specifically through regulation of influx and efflux BBB transporters that alter microvessel permeability. We further hypothesize that although these responses are initially adaptive, these changes in BBB transporters can have long-term consequences that disrupt the brain’s microenvironment and alter synaptic plasticity leading to cognitive impairment. PMID:23541562

  13. The important role of stratum corneum lipids for the cutaneous barrier function.

    Science.gov (United States)

    van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

    2014-03-01

    The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. The intestinal barrier function and its involvement in digestive disease

    Directory of Open Access Journals (Sweden)

    Eloísa Salvo-Romero

    2015-11-01

    Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.

  15. [Is olfactory function impaired in moderate height?].

    Science.gov (United States)

    Kühn, M; Welsch, H; Zahnert, T; Hummel, Thomas

    2009-09-01

    The human sense of smell seems to be influenced by the surrounding barometric pressure. These factors appear to be especially important during flights, for example, in order to recognize the smell of fire etc. Thus, questions are whether pilots or passengers exhibit an impaired smell sensitivity when tested at moderate heights, or, whether changes in humidity would affect the sense of smell. Using climate chambers, odor discrimination and butanol odor thresholds were tested in 77 healthy normosmic volunteers (5 female, 72 male; aged 25+/-8 years from 18 up to 53 years) under hypobaric (2 700+/-20 m, 20 degrees C+/-1 K, rh=50+/-5%) and hyperbaric, (10+/-0.5 m (2 bar)) and different humidity conditions (30 vs. 80%, 20 degrees C+/-1 K, normobaric). During all conditions cognitive performance was tested. Among other effects, olfactory sensitivity was impaired at threshold, but not suprathreshold level, in a hypobaric compared to a hyperbaric milieu, and thresholds were lower in humid, compared to relatively dry conditions. In conclusion, environmental conditions modulate the sense of smell, and may, consecutively, influence results from olfactory tests. During flight hypobaric conditions, mild hypoxia and dry air may cause impaired sensitivity of smell. Georg Thieme Verlag KG Stuttgart * New York.

  16. Impaired esophageal motor function in eosinophilic esophagitis

    Directory of Open Access Journals (Sweden)

    Cecilio Santander

    2015-10-01

    Full Text Available Eosinophilic esophagitis is a chronic immunoallergic inflammatory disease of the esophagus that represents a major cause of digestive morbidity among the pediatric and young adult populations. Despite the fact that key symptoms in adults include dysphagia and food impaction, many patients lack structural changes in the esophagus to account for their complaints, which suggests the presence of underlying motor disorders and esophageal distensibility impairment. In the last few years the esophageal motility of these patients has been studied using various approaches, most particularly high-resolution manometry, ambulatory manometry, and impedance planimetry. This review focuses on the most relevant findings and scientific evidence regarding esophageal motor disorders in eosinophilic esophagitis.

  17. Impaired esophageal motor function in eosinophilic esophagitis.

    Science.gov (United States)

    Santander, Cecilio; Chavarría-Herbozo, Carlos M; Becerro-González, Irene; Burgos-Santamaría, Diego

    2015-10-01

    Eosinophilic esophagitis is a chronic immunoallergic inflammatory disease of the esophagus that represents a major cause of digestive morbidity among the pediatric and young adult populations. Despite the fact that key symptoms in adults include dysphagia and food impaction, many patients lack structural changes in the esophagus to account for their complaints, which suggests the presence of underlying motor disorders and esophageal distensibility impairment. In the last few years the esophageal motility of these patients has been studied using various approaches, most particularly high-resolution manometry, ambulatory manometry, and impedance planimetry. This review focuses on the most relevant findings and scientific evidence regarding esophageal motor disorders in eosinophilic esophagitis.

  18. Impaired defecatory function after resection of rectal cancer

    International Nuclear Information System (INIS)

    Oya, Masatoshi

    2007-01-01

    Combination of symptoms such as frequent bowel movement, minor fecal incontinence, defecatory urgency, and evacuation difficulty are common after sphincter-preserving surgery for rectal cancer. A number of factors including loss of reservoir function of the rectum and impaired function of the internal anal sphincter are thought to be causative of symptoms. Presentation of impaired anal function before operation, anastomosis close to the anal margin, and anastomotic leakage are known to be associated with poor postoperative function. Colonic J-pouch reconstruction and coloplasty used as methods to increase the neorectal capacity and compensate the loss of reservoir function have been reported to improve postoperative defecatory function. Neoadjuvant radiotherapy and neoadjuvant chemoradiotherapy are known to enhance the severity of impaired defecatory function. In patients who have undergone intersphincteric resection for very low rectal cancer, fecal incontinence is common but is improved with the use of colonic J-pouch reconstruction. (author)

  19. Epicutaneous aeroallergen sensitization in atopic dermatitis infants - determining the role of epidermal barrier impairment.

    Science.gov (United States)

    Boralevi, F; Hubiche, T; Léauté-Labrèze, C; Saubusse, E; Fayon, M; Roul, S; Maurice-Tison, S; Taïeb, A

    2008-02-01

    Sensitization to atopens is an early phenomenon that overlaps with the onset of atopic dermatitis (AD) in infancy. Early epidermal barrier impairment may facilitate the epicutaneous penetration of atopens. To correlate transepidermal water loss (TEWL) and aeroallergen sensitization in infants with AD. In this cross-sectional study we enrolled 59 AD children and 30 controls aged 3-12 months. Transepidermal water loss in uninvolved skin, specific immunoglobulin E, atopy patch test (APT) and skin prick tests were performed with respect to seven aeroallergens, i.e., Dermatophagoides pteronyssinus, D. farinae, cat, dog, birch pollen, ambrosia, and cockroach. Environmental conditions were assessed by a questionnaire, and the house dust mite (HDM) concentration was determined in dust samples. Eighty-nine percent of AD infants had a positive APT vs one out of eleven controls. AD infants had a significantly higher mean TEWL than controls (27.4 vs 11.1 g/m(2)/h, P cats, and dogs at home. This study confirms the high prevalence of delayed sensitization to indoor and outdoor aeroallergens in AD infants, and shows that the higher the TEWL, the higher the prevalence of sensitization to aeroallergens. These data are in favor of a major role of a constitutive epidermal barrier impairment in determining early atopen sensitization in infants with AD.

  20. Stabilization with guaranteed safety using Control Lyapunov–Barrier Function

    NARCIS (Netherlands)

    Romdlony, Muhammad Zakiyullah; Jayawardhana, Bayu

    2016-01-01

    We propose a novel nonlinear control method for solving the problem of stabilization with guaranteed safety for nonlinear systems. The design is based on the merging of the well-known Control Lyapunov Function (CLF) and the recent concept of Control Barrier Function (CBF). The proposed control

  1. Barriers to accessing eye care services among visually impaired populations in rural Andhra Pradesh, South India

    Directory of Open Access Journals (Sweden)

    Kovai Vilas

    2007-01-01

    Full Text Available Purpose: To understand the reasons why people in rural south India with visual impairment arising from various ocular diseases do not seek eye care. Materials and Methods: A total of 5,573 persons above the age of 15 were interviewed and examined in the South Indian state of Andhra Pradesh covering the districts of Adilabad, West Godavari and Mahaboobnagar. A pre-tested structured questionnaire on barriers to eye care was administered by trained field investigators. Results: Of the eligible subjects, 1234 (22.1%, N=5573 presented with distant visual acuity < 20/60 or equivalent visual field loss in the better eye. Of these, 898 (72.7%, N=1234 subjects had not sought treatment despite noticing a decrease in vision citing personal, economic and social reasons. The analysis also showed that the odds of seeking treatment was significantly higher for literates [odds ratio (OR 1.91, 95% confidence interval (CI 1.38 to 2.65], for those who would be defined as blind by visual acuity category (OR 1.35, 95% CI 0.96 to 1.90 and for those with cataract and other causes of visual impairment (OR 1.50, 95% CI 1.11 to 2.03. Barriers to seeking treatment among those who had not sought treatment despite noticing a decrease in vision over the past five years were personal in 52% of the respondents, economic in 37% and social in 21%. Conclusion: Routine planning for eye care services in rural areas of India must address the barriers to eye care perceived by communities to increase the utilization of services.

  2. Metabolic Profiling of Impaired Cognitive Function in Patients Receiving Dialysis

    OpenAIRE

    Kurella Tamura, Manjula; Chertow, Glenn M.; Depner, Thomas A.; Nissenson, Allen R.; Schiller, Brigitte; Mehta, Ravindra L.; Liu, Sai; Sirich, Tammy L.

    2016-01-01

    Retention of uremic metabolites is a proposed cause of cognitive impairment in patients with ESRD. We used metabolic profiling to identify and validate uremic metabolites associated with impairment in executive function in two cohorts of patients receiving maintenance dialysis. We performed metabolic profiling using liquid chromatography/mass spectrometry applied to predialysis plasma samples from a discovery cohort of 141 patients and an independent replication cohort of 180 patients partici...

  3. Functional impairment and hospital readmission in Medicare seniors.

    Science.gov (United States)

    Greysen, S Ryan; Stijacic Cenzer, Irena; Auerbach, Andrew D; Covinsky, Kenneth E

    2015-04-01

    Medicare currently penalizes hospitals for high readmission rates for seniors but does not account for common age-related syndromes, such as functional impairment. To assess the effects of functional impairment on Medicare hospital readmissions given the high prevalence of functional impairments in community-dwelling seniors. We created a nationally representative cohort of 7854 community-dwelling seniors in the Health and Retirement Study, with 22,289 Medicare hospitalizations from January 1, 2000, through December 31, 2010. Outcome was 30-day readmission assessed by Medicare claims. The main predictor was functional impairment determined from the Health and Retirement Study interview preceding hospitalization, stratified into the following 5 levels: no functional impairments, difficulty with 1 or more instrumental activities of daily living, difficulty with 1 or more activities of daily living (ADL), dependency (need for help) in 1 to 2 ADLs, and dependency in 3 or more ADLs. Adjustment variables included age, race/ethnicity, sex, annual income, net worth, comorbid conditions (Elixhauser score from Medicare claims), and prior admission. We performed multivariable logistic regression to adjust for clustering at the patient level to characterize the association of functional impairments and readmission. Patients had a mean (SD) age of 78.5 (7.7) years (range, 65-105 years); 58.4% were female, 84.9% were white, 89.6% reported 3 or more comorbidities, and 86.0% had 1 or more hospitalizations in the previous year. Overall, 48.3% had some level of functional impairment before admission, and 15.5% of hospitalizations were followed by readmission within 30 days. We found a progressive increase in the adjusted risk of readmission as the degree of functional impairment increased: 13.5% with no functional impairment, 14.3% with difficulty with 1 or more instrumental activities of daily living (odds ratio [OR], 1.06; 95% CI, 0.94-1.20), 14.4% with difficulty with 1 or more

  4. [Cannabis use and impairment of respiratory function].

    Science.gov (United States)

    Underner, M; Urban, T; Perriot, J; Peiffer, G; Meurice, J-C

    2013-04-01

    Cannabis is the most commonly smoked illicit substance in many countries including France. It can be smoked alone in plant form (marijuana) but in our country it is mainly smoked in the form of cannabis resin mixed with tobacco. The technique of inhaling cannabis differs from that of tobacco, increasing the time that the smoke spends in contact with the bronchial mucosal and its impact on respiratory function. One cigarette composed of cannabis and tobacco is much more harmful than a cigarette containing only tobacco. In cannabis smokers there is an increased incidence of respiratory symptoms and episodes of acute bronchitis. Cannabis produces a rapid bronchodilator effect; chronic use provokes a reduction in specific conductance and increase in airways resistance. Studies on the decline of Forced Expiratory Volume are discordant. Cannabis smoke and tetrahydrocannabinol irritate the bronchial tree. They bring about histological signs of airways inflammation and alter the fungicidal and antibacterial activity of alveolar macrophages. Inhalation of cannabis smoke is a risk factor for lung cancer. Stopping smoking cannabis will bring about important benefits for lung function. This should encourage clinicians to offer patients support in quitting smoking. Copyright © 2013 SPLF. Published by Elsevier Masson SAS. All rights reserved.

  5. Biomaterial associated impairment of local neutrophil function.

    Science.gov (United States)

    Kaplan, S S; Basford, R E; Kormos, R L; Hardesty, R L; Simmons, R L; Mora, E M; Cardona, M; Griffith, B L

    1990-01-01

    The effect of biomaterials on neutrophil function was studied in vitro to determine if these materials activated neutrophils and to determine the subsequent response of these neutrophils to further stimulation. Two biomaterials--polyurethane, a commonly used substance, and Velcro pile (used in the Jarvik 7 heart)--were evaluated. Two control substances, polyethylene and serum-coated polystyrene, were used for comparison. Neutrophil superoxide release was measured following incubation with these materials for 10, 30, and 120 min in the absence of additional stimulation and after stimulation with formylmethionylleucylphenylalanine (fMLP) or phorbol myristate acetate (PMA). The authors observed that the incubation of neutrophils on both polyurethane and Velcro resulted in substantially increased superoxide release that was greater after the 10 min than after the 30 or 120 min association. These activated neutrophils exhibited a poor additional response to fMLP but responded well to PMA. The effect of implantation of the Novacor left ventricular assist device on peripheral blood neutrophil function was also evaluated. The peripheral blood neutrophils exhibited normal superoxide release and chemotaxis. These studies suggest that biomaterials may have a profound local effect on neutrophils, which may predispose the patient to periprosthetic infection, but that the reactivity of circulating neutrophils is unimpaired.

  6. Barrier functions for Pucci-Heisenberg operators and applications

    OpenAIRE

    Cutri , Alessandra; Tchou , Nicoletta

    2007-01-01

    International audience; The aim of this article is the explicit construction of some barrier functions ("fundamental solutions") for the Pucci-Heisenberg operators. Using these functions we obtain the continuity property, up to the boundary, for the viscosity solution of fully non-linear Dirichlet problems on the Heisenberg group, if the boundary of the domain satisfies some regularity geometrical assumptions (e.g. an exterior Heisenberg-ball condition at the characteristic points). We point ...

  7. [Impaired cognitive function in hepatitis C - a review.

    DEFF Research Database (Denmark)

    Renvillard, Signe Groth; Leutscher, Peter; Hjerrild, Simon

    2010-01-01

    Impaired cognitive function is commonly seen in patients with hepatitis C-virus (HCV). This might be due to a toxic effect of the virus itself or to neuroinflammatory processes with a direct damaging cerebral effect. The symptoms appear in the pre-cirrhotic stage and impair the patient's level...... of functioning. Therefore, doctors in contact with HCV patients should be up to date on the existing knowledge in the field to be able to inform patients about their cognitive deficits and take them into consideration. It is unknown if the cognitive deficits decline when the virus is eradicated. Udgivelsesdato...

  8. Dietary phosphorus acutely impairs endothelial function.

    Science.gov (United States)

    Shuto, Emi; Taketani, Yutaka; Tanaka, Rieko; Harada, Nagakatsu; Isshiki, Masashi; Sato, Minako; Nashiki, Kunitaka; Amo, Kikuko; Yamamoto, Hironori; Higashi, Yukihito; Nakaya, Yutaka; Takeda, Eiji

    2009-07-01

    Excessive dietary phosphorus may increase cardiovascular risk in healthy individuals as well as in patients with chronic kidney disease, but the mechanisms underlying this risk are not completely understood. To determine whether postprandial hyperphosphatemia may promote endothelial dysfunction, we investigated the acute effect of phosphorus loading on endothelial function in vitro and in vivo. Exposing bovine aortic endothelial cells to a phosphorus load increased production of reactive oxygen species, which depended on phosphorus influx via sodium-dependent phosphate transporters, and decreased nitric oxide production via inhibitory phosphorylation of endothelial nitric oxide synthase. Phosphorus loading inhibited endothelium-dependent vasodilation of rat aortic rings. In 11 healthy men, we alternately served meals containing 400 mg or 1200 mg of phosphorus in a double-blind crossover study and measured flow-mediated dilation of the brachial artery before and 2 h after the meals. The high dietary phosphorus load increased serum phosphorus at 2 h and significantly decreased flow-mediated dilation. Flow-mediated dilation correlated inversely with serum phosphorus. Taken together, these findings suggest that endothelial dysfunction mediated by acute postprandial hyperphosphatemia may contribute to the relationship between serum phosphorus level and the risk for cardiovascular morbidity and mortality.

  9. Hypercholesterolemia Impaired Sperm Functionality in Rabbits

    Science.gov (United States)

    Monclus, Maria A.; Cabrillana, Maria E.; Clementi, Marisa A.; Espínola, Leandro S.; Cid Barría, Jose L.; Vincenti, Amanda E.; Santi, Analia G.; Fornés, Miguel W.

    2010-01-01

    Hypercholesterolemia represents a high risk factor for frequent diseases and it has also been associated with poor semen quality that may lead to male infertility. The aim of this study was to analyze semen and sperm function in diet-induced hypercholesterolemic rabbits. Twelve adult White New Zealand male rabbits were fed ad libitum a control diet or a diet supplemented with 0.05% cholesterol. Rabbits under cholesterol-enriched diet significantly increased total cholesterol level in the serum. Semen examination revealed a significant reduction in semen volume and sperm motility in hypercholesterolemic rabbits (HCR). Sperm cell morphology was seriously affected, displaying primarily a “folded head”-head fold along the major axe-, and the presence of cytoplasmic droplet on sperm flagellum. Cholesterol was particularly increased in acrosomal region when detected by filipin probe. The rise in cholesterol concentration in sperm cells was determined quantitatively by Gas chromatographic-mass spectrometric analyses. We also found a reduction of protein tyrosine phosphorylation in sperm incubated under capacitating conditions from HCR. Interestingly, the addition of Protein Kinase A pathway activators -dibutyryl-cyclic AMP and iso-butylmethylxanthine- to the medium restored sperm capacitation. Finally, it was also reported a significant decrease in the percentage of reacted sperm in the presence of progesterone. In conclusion, our data showed that diet-induced hypercholesterolemia adversely affects semen quality and sperm motility, capacitation and acrosomal reaction in rabbits; probably due to an increase in cellular cholesterol content that alters membrane related events. PMID:20976152

  10. Metabolic Profiling of Impaired Cognitive Function in Patients Receiving Dialysis.

    Science.gov (United States)

    Kurella Tamura, Manjula; Chertow, Glenn M; Depner, Thomas A; Nissenson, Allen R; Schiller, Brigitte; Mehta, Ravindra L; Liu, Sai; Sirich, Tammy L

    2016-12-01

    Retention of uremic metabolites is a proposed cause of cognitive impairment in patients with ESRD. We used metabolic profiling to identify and validate uremic metabolites associated with impairment in executive function in two cohorts of patients receiving maintenance dialysis. We performed metabolic profiling using liquid chromatography/mass spectrometry applied to predialysis plasma samples from a discovery cohort of 141 patients and an independent replication cohort of 180 patients participating in a trial of frequent hemodialysis. We assessed executive function with the Trail Making Test Part B and the Digit Symbol Substitution test. Impaired executive function was defined as a score ≥2 SDs below normative values. Four metabolites-4-hydroxyphenylacetate, phenylacetylglutamine, hippurate, and prolyl-hydroxyproline-were associated with impaired executive function at the false-detection rate significance threshold. After adjustment for demographic and clinical characteristics, the associations remained statistically significant: relative risk 1.16 (95% confidence interval [95% CI], 1.03 to 1.32), 1.39 (95% CI, 1.13 to 1.71), 1.24 (95% CI, 1.03 to 1.50), and 1.20 (95% CI, 1.05 to 1.38) for each SD increase in 4-hydroxyphenylacetate, phenylacetylglutamine, hippurate, and prolyl-hydroxyproline, respectively. The association between 4-hydroxyphenylacetate and impaired executive function was replicated in the second cohort (relative risk 1.12; 95% CI, 1.02 to 1.23), whereas the associations for phenylacetylglutamine, hippurate, and prolyl-hydroxyproline did not reach statistical significance in this cohort. In summary, four metabolites related to phenylalanine, benzoate, and glutamate metabolism may be markers of cognitive impairment in patients receiving maintenance dialysis. Copyright © 2016 by the American Society of Nephrology.

  11. Reducing barriers to healthy weight: Planned and responsive adaptations to a lifestyle intervention to serve people with impaired mobility.

    Science.gov (United States)

    Betts, Andrea C; Froehlich-Grobe, Katherine; Driver, Simon; Carlton, Danielle; Kramer, M Kaye

    2018-04-01

    People with impaired mobility (IM) disabilities have a higher prevalence of obesity and obesity-related chronic conditions; however, lifestyle interventions that address the unique needs of people with IM are lacking. This paper describes an adapted evidence-based lifestyle intervention developed through community-based participatory research (CBPR). Individuals with IM, health professionals, disability group representatives, and researchers formed an advisory board to guide the process of thoroughly adapting the Diabetes Prevention Program Group Lifestyle Balance (DPP GLB) intervention after a successful pilot in people with IM. The process involved two phases: 1) planned adaptations to DPP GLB content and delivery, and 2) responsive adaptations to address issues that emerged during intervention delivery. Planned adaptations included combining in-person sessions with conference calls, providing arm-based activity trackers, and adding content on adaptive cooking, adaptive physical activity, injury prevention, unique health considerations, self-advocacy, and caregiver support. During the intervention, participants encountered numerous barriers, including health and mental health issues, transportation, caregivers, employment, adjusting to disability, and functional limitations. We addressed barriers with responsive adaptations, such as supporting electronic self-monitoring, offering make up sessions, and adding content and activities on goal setting, problem solving, planning, peer support, reflection, and motivation. Given the lack of evidence on lifestyle change in people with disabilities, it is critical to involve the community in intervention planning and respond to real-time barriers as participants engage in change. A randomized controlled trial (RCT) is underway to examine the usability, feasibility, and preliminary effectiveness of the adapted intervention. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Assessing functional impairment in siblings living with children with disability.

    Science.gov (United States)

    Goudie, Anthony; Havercamp, Susan; Jamieson, Barry; Sahr, Timothy

    2013-08-01

    The purpose of this study was to empirically test if siblings of children with disability had higher levels of parent-reported behavioral and emotional functional impairment compared with a peer group of siblings residing with only typically developing children. This was a retrospective secondary analysis of data from the Medical Expenditure Panel Survey. We included only households with at least 2 children to ensure sibling relationships. Two groups of siblings were formed: 245 siblings resided in households with a child with disability and 6564 siblings resided in households with typically developing children. Parents responded to questions from the Columbia Impairment Scale to identify functional impairment in their children. On the basis of parent reports and after adjusting for sibling demographic characteristics and household background, siblings of children with disability were more likely than siblings residing with typically developing children to have problems with interpersonal relationships, psychopathological functioning, functioning at school, and use of leisure time (P siblings of children with disability classified with significant functional impairment was 16.0% at the first measurement period and 24.2% at the second (P siblings of typically developing children there was a smaller percentage increase from 9.5% to 10.3% (P mental health services and, as such, early assessment and interventions to limit increasing severity and short- to long-term consequences need to be addressed. Health care professionals need to consider a family-based health care approach for families raising children with disability.

  13. Safety barriers and safety functions a comparison of different applications

    International Nuclear Information System (INIS)

    Harms-Ringdahl, L.

    1998-01-01

    A study is being made with the focus on different theories and applications concerning 'safety barriers' and 'safety functions'. One aim is to compare the characteristics of different kinds of safely functions, which can be purpose, efficiency, reliability, weak points etc. A further aim is to summarize how the combination of different barriers are described and evaluated. Of special interest are applications from nuclear and chemical process safety. The study is based on a literature review, interviews and discussions. Some preliminary conclusions are made. For example, it appears to exist a need for better tools to support the design and evaluation of procedures. There are a great number of theoretical models describing safety functions. However, it still appears to be an interest in further development of models, which might give the basis for improved practical tools. (author)

  14. Influence of visual impairment and hearing impairment on functional dependence status among people in Taiwan—An evaluation using the WHODAS 2.0 score

    Directory of Open Access Journals (Sweden)

    Ko-Fang Chang

    2018-04-01

    Full Text Available Background: Visual impairment (VI and hearing impairment (HI are the two most common types of sensory disability encountered clinically. However, VI and HI result in different limitations in daily life. We assessed the level of functioning in patients with VI or HI based on the International Classification of Functioning, Disability, and Health. Methods: This nationwide, cross-sectional study included 312 people with VI and 540 people with HI. Each participant's degree of functioning and disability was evaluated using the World Health Organization Disability Assessment Schedule 2.0 (WHODAS 2.0. The standardized WHODAS 2.0 scores ranged from 0 (least difficulty to 100 (most difficulty. Results: Patients with VI and those with HI had a mean (±standard error 32-item WHODAS 2.0 score of 42.4 ± 2.9 and 27.1 ± 1.6, respectively. The degree of restriction was positively related to the level of VI. Specifically, the patients with VI and a WHODAS 2.0 score of 33.7–35.3 or higher were likely to experience barriers to accessing mobility products, communication products, and education products. Furthermore, patients with a score of 42.9 or higher might experience barriers to accessing ingestion products and living products. Conclusion: WHODAS 2.0 scores are strongly correlated with the severity of VI. Mild VI should be targeted for treatment and referral as early as possible. Compared with the patients with HI, the patients with VI more frequently experience barriers to accessing environmental factors. Keywords: Disability, Functioning, Hearing impairment, International Classification of Functioning (ICF, Visual impairment, WHODAS 2.0

  15. Interacting with women can impair men's cognitive functioning

    NARCIS (Netherlands)

    Karremans, J.C.T.M.; Verwijmeren, T.; Pronk, T.M.; Reitsma, M.

    2009-01-01

    The present research tested the prediction that mixed-sex interactions may temporarily impair cognitive functioning. Two studies, in which participants interacted either with a same-sex or opposite-sex other, demonstrated that men's (but not women's) cognitive performance declined following a

  16. Attention Deficit Hyperactivity Disorder and Executive Function Impairment: An Overview.

    OpenAIRE

    Carruthers, Lindsey.

    2016-01-01

    As with any cognitive ability, attention is vulnerable to dysfunction. The most common attentional problem is attention deficit hyperactivity disorder (ADHD). This brief overview will highlight the symptoms and deficits associated with ADHD, its prevalence in today’s society, the association between executive function impairment and ADHD using Barkley’s (1997) work, and the personal and societal effects of the disorder.

  17. Executive function behaviours in children with specific language impairment (SLI)

    NARCIS (Netherlands)

    Cuperus, J.M.; Vugs, B.A.M.; Scheper, A.R.; Hendriks, M.P.H.

    2014-01-01

    Background: There is growing evidence that linguistic and non-linguistic factors may contribute to the problems associated with specific language impairment (SLI). One factor that has been implicated is executive functioning (EF). Most studies investigating EF in children with SLI use performance

  18. High School Teachers' Perspectives on Supporting Students with Visual Impairments toward Higher Education: Access, Barriers, and Success

    Science.gov (United States)

    Reed, Maureen; Curtis, Kathryn

    2011-01-01

    The objective of the study presented here was to understand the experiences of teachers in assisting students with visual impairments in making the transition to higher education. The teachers reported barriers in high school that affect students' access to and success in higher education. Furthermore, institutions of higher education provided…

  19. Claudin Loss-of-Function Disrupts Tight Junctions and Impairs Amelogenesis.

    Science.gov (United States)

    Bardet, Claire; Ribes, Sandy; Wu, Yong; Diallo, Mamadou Tidiane; Salmon, Benjamin; Breiderhoff, Tilman; Houillier, Pascal; Müller, Dominik; Chaussain, Catherine

    2017-01-01

    Claudins are a family of proteins that forms paracellular barriers and pores determining tight junctions (TJ) permeability. Claudin-16 and -19 are pore forming TJ proteins allowing calcium and magnesium reabsorption in the thick ascending limb of Henle's loop (TAL). Loss-of-function mutations in the encoding genes, initially identified to cause Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis (FHHNC), were recently shown to be also involved in Amelogenesis Imperfecta (AI). In addition, both claudins were expressed in the murine tooth germ and Claudin-16 knockout (KO) mice displayed abnormal enamel formation. Claudin-3, an ubiquitous claudin expressed in epithelia including kidney, acts as a barrier-forming tight junction protein. We determined that, similarly to claudin-16 and claudin-19, claudin-3 was expressed in the tooth germ, more precisely in the TJ located at the apical end of secretory ameloblasts. The observation of Claudin-3 KO teeth revealed enamel defects associated to impaired TJ structure at the secretory ends of ameloblasts and accumulation of matrix proteins in the forming enamel. Thus, claudin-3 protein loss-of-function disturbs amelogenesis similarly to claudin-16 loss-of-function, highlighting the importance of claudin proteins for the TJ structure. These findings unravel that loss-of-function of either pore or barrier-forming TJ proteins leads to enamel defects. Hence, the major structural function of claudin proteins appears essential for amelogenesis.

  20. Claudin Loss-of-Function Disrupts Tight Junctions and Impairs Amelogenesis

    Directory of Open Access Journals (Sweden)

    Claire Bardet

    2017-05-01

    Full Text Available Claudins are a family of proteins that forms paracellular barriers and pores determining tight junctions (TJ permeability. Claudin-16 and -19 are pore forming TJ proteins allowing calcium and magnesium reabsorption in the thick ascending limb of Henle's loop (TAL. Loss-of-function mutations in the encoding genes, initially identified to cause Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis (FHHNC, were recently shown to be also involved in Amelogenesis Imperfecta (AI. In addition, both claudins were expressed in the murine tooth germ and Claudin-16 knockout (KO mice displayed abnormal enamel formation. Claudin-3, an ubiquitous claudin expressed in epithelia including kidney, acts as a barrier-forming tight junction protein. We determined that, similarly to claudin-16 and claudin-19, claudin-3 was expressed in the tooth germ, more precisely in the TJ located at the apical end of secretory ameloblasts. The observation of Claudin-3 KO teeth revealed enamel defects associated to impaired TJ structure at the secretory ends of ameloblasts and accumulation of matrix proteins in the forming enamel. Thus, claudin-3 protein loss-of-function disturbs amelogenesis similarly to claudin-16 loss-of-function, highlighting the importance of claudin proteins for the TJ structure. These findings unravel that loss-of-function of either pore or barrier-forming TJ proteins leads to enamel defects. Hence, the major structural function of claudin proteins appears essential for amelogenesis.

  1. Risk factors for psychosis: impaired social and role functioning.

    Science.gov (United States)

    Cornblatt, Barbara A; Carrión, Ricardo E; Addington, Jean; Seidman, Larry; Walker, Elaine F; Cannon, Tyronne D; Cadenhead, Kristin S; McGlashan, Thomas H; Perkins, Diana O; Tsuang, Ming T; Woods, Scott W; Heinssen, Robert; Lencz, Todd

    2012-11-01

    Risk for psychosis is currently defined primarily on the basis of attenuated positive symptoms (APS), with no inclusion of the functional deficits characteristic of schizophrenia. Impaired social and role functioning have been of interest for reflecting poor outcome but far less is known about the developmental impact of these deficits as vulnerability or risk factors. Age-appropriate social and role functioning were prospectively assessed in 100 individuals at clinical high risk (CHR) for psychosis included in the 8-site North American Prodromal Longitudinal Study database. A nested case-control design was used to compare changes in social and role functioning in 26 individuals converting to psychosis shortly after baseline assessment and 24 converting over a year later. Individuals in each converter subgroup were directly matched to a non-converter at the same site, controlling for time to conversion, age, gender, and severity of baseline symptoms. At baseline, CHR subjects who later became psychotic were significantly more likely to be impaired socially than matched non-converters. Onset of psychosis did not further disrupt social difficulties. Role functioning showed some of the same trends, but the overall pattern was not as consistent as for the social domain. Controlling for neurocognition did not change the pattern of group differences. Early impaired social functioning appears to be a risk factor for psychosis and, added to APS, could potentially contribute to accurate identification of CHR individuals and provide a new direction for early intervention to reduce long-term disability.

  2. Narcissistic personality disorder: relations with distress and functional impairment.

    Science.gov (United States)

    Miller, Joshua D; Campbell, W Keith; Pilkonis, Paul A

    2007-01-01

    This study examined the construct validity of narcissistic personality disorder (NPD) by examining the relations between NPD and measures of psychologic distress and functional impairment both concurrently and prospectively across 2 samples. In particular, the goal was to address whether NPD typically "meets" criterion C of the DSM-IV definition of Personality Disorder, which requires that the symptoms lead to clinically significant distress or impairment in functioning. Sample 1 (n = 152) was composed of individuals receiving psychiatric treatment, whereas sample 2 (n = 151) was composed of both psychiatric patients (46%) and individuals from the community. Narcissistic personality disorder was linked to ratings of depression, anxiety, and several measures of impairment both concurrently and at 6-month follow-up. However, the relations between NPD and psychologic distress were (a) small, especially in concurrent measurements, and (b) largely mediated by impaired functioning. Narcissistic personality disorder was most strongly related to causing pain and suffering to others, and this relationship was significant even when other Cluster B personality disorders were controlled. These findings suggest that NPD is a maladaptive personality style which primarily causes dysfunction and distress in interpersonal domains. The behavior of narcissistic individuals ultimately leads to problems and distress for the narcissistic individuals and for those with whom they interact.

  3. Characterisation of Physical Frailty and Associated Physical and Functional Impairments in Mild Cognitive Impairment

    Directory of Open Access Journals (Sweden)

    Ma Shwe Zin Nyunt

    2017-12-01

    Full Text Available ObjectiveTo characterize the physical frailty phenotype and its associated physical and functional impairments in mild cognitive impairment (MCI.MethodParticipants with MCI (N = 119, normal low cognition (NLC, N = 138, and normal high cognition (NHC, N = 1,681 in the Singapore Longitudinal Ageing Studies (SLAS-2 were compared on the prevalence of physical frailty, low lean body mass, weakness, slow gait, exhaustion and low physical activity, and POMA balance and gait impairment and fall risk.ResultsThere were significantly higher prevalence of frailty in MCI (18.5%, than in NLC (8.0% and NHC (3.9%, and pre-frailty in MCI (54.6%, NLC (52.9% than in NHC (48.0%. Age, sex, and ethnicity-adjusted OR (95% CI of association with MCI (versus NHC for frailty were 4.65 (2.40–9.04 and for pre-frailty, 1.67 (1.07–2.61. Similar significantly elevated prevalence and adjusted ORs of association with MCI were observed for frailty-associated physical and functional impairments. Further adjustment for education, marital status, living status, comorbidities, and GDS significantly reduced the OR estimates. However, the OR estimates remained elevated for frailty: 3.86 (1.83–8.17, low body mass: 1.70 (1.08–2.67, slow gait: 1.84 (1.17–2.89, impaired gait: 4.17 (1.98–8.81, and elevated fall risk 3.42 (1.22–9.53.ConclusionTwo-thirds of MCI were physically frail or pre-frail, most uniquely due to low lean muscle mass, slow gait speed, or balance and gait impairment. The close associations of frailty and physical and functional impairment with MCI have important implications for improving diagnostic acuity of MCI and targetting interventions among cognitively frail individuals to prevent dementia and disability.

  4. Cocaine impairs serial-feature negative learning and blood-brain barrier integrity.

    Science.gov (United States)

    Davidson, Terry L; Hargrave, Sara L; Kearns, David N; Clasen, Matthew M; Jones, Sabrina; Wakeford, Alison G P; Sample, Camille H; Riley, Anthony L

    2018-05-10

    Previous research has shown that diets high in fat and sugar [a.k.a., Western diets (WD)] can impair performance of rats on hippocampal-dependent learning and memory problems, an effect that is accompanied by selective increases in hippocampal blood brain barrier (BBB) permeability. Based on these types of findings, it has been proposed that overeating of a WD (and its resulting obesity) may be, in part, a consequence of impairments in these anatomical substrates and cognitive processes. Given that drug use (and addiction) represents another behavioral excess, the present experiments assessed if similar outcomes might occur with drug exposure by evaluating the effects of cocaine administration on hippocampal-dependent memory and on the integrity of the BBB. Experiment 1 of the present series of studies found that systemic cocaine administration in rats also appears to have disruptive effects on the same hippocampal-dependent learning and memory mechanism that has been proposed to underlie the inhibition of food intake. Experiment 2 demonstrated that the same regimen of cocaine exposure that produced disruptions in learning and memory in Experiment 1 also produced increased BBB permeability in the hippocampus, but not in the striatum. Although the predominant focus of previous research investigating the etiologies of substance use and abuse has been on the brain circuits that underlie the motivational properties of drugs, the current investigation implicates the possible involvement of hippocampal memory systems in such behaviors. It is important to note that these positions are not mutually exclusive and that neuroadaptations in these two circuits might occur in parallel that generate dysregulated drug use in a manner similar to that of excessive eating. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Impact of Cognitive Impairment on Functional Outcome in Stroke

    Directory of Open Access Journals (Sweden)

    Nurdan Paker

    2010-01-01

    Full Text Available The aim of this study was to investigate the effect of the cognitive impairment on functional status in patients with subacute stroke. Fifty-two patients with subacute stroke were included in the study. Mini mental state examination (MMSE test was used for the evaluation of cognitive status. Patients were separated into two groups according to their cognitive functions. Functional follow-up parameters were activities of daily living (ADL, global recovery and ambulation status. All patients were evaluated on admission to rehabilitation unit, at discharge and 6 months after discharge. Forty-four patients were completed the study. Mean age was 66 and 57 years; disease duration on admission was 4,8 and 3,5 months in the cognitively impaired and normal groups, respectively. Significant improvement was found in terms of functional follow-up parameters in both groups at discharge (<.05. Functional follow-up parameters did not show statistically significant difference between the groups. But community ambulation rate was higher in cognitively normal group at the sixth month visit. As a result of this study, inpatient rehabilitation was effective both cognitively normal and impaired subacute stroke patients.

  6. Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

    Science.gov (United States)

    Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

    2008-11-15

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

  7. A University Web Portal redesign applying accessibility patterns. Breaking Down Barriers for Visually Impaired Users

    Directory of Open Access Journals (Sweden)

    Hernán Sosa

    2015-08-01

    Full Text Available Definitely, the WWW and ICTs have become the preferred media for the interaction between society and its citizens, and public and private organizations have today the possibility of deploying their activities through the Web. In particular, university education is a domain where the benefits of these technological resources can strongly contribute in caring for students. However, most university Web portals are inaccessible to their user community (students, professors, and non-teaching staff, between others, since these portals do not take into account the needs of people with different capabilities. In this work, we propose an accessibility pattern driven process to the redesign of university Web portals, aiming to break down barriers for visually impaired users. The approach is implemented to a real case study: the Web portal of Universidad Nacional de la Patagonia Austral (UNPA. The results come from applying accessibility recommendations and evaluation tools (automatic and manual from internationally recognized organizations, to both versions of the Web portal: the original and the redesign one.

  8. The Involvement of Budapest Residents with Visual Impairments in Leisure Sports: Barriers and Facilitators

    Directory of Open Access Journals (Sweden)

    Gombás Judit

    2016-06-01

    Full Text Available Since the political and economic changes that occurred in 1989-1990, Hungary has been in a state of transition from a socialist regime to a democratic culture. In an effort to comply with the rules of democracy, equal opportunities for people with disabilities are demanded on various platforms. However, inclusion in sports is still uncommon, and physical education (P.E. teachers, trainers, sports scientists, etc. are not provided with in-depth education on adapted sports. The present study examines the involvement of Hungarian adults with VI (visual impairments in leisure sports and investigates facilitators and barriers which members of the target group face. First, the educational opportunities (segregation or inclusion provided for Hungarian children with VI are introduced. The historical and legislative backgrounds are presented in order to give a clear review of the social context. Findings of a survey on the activity levels of Hungarian adults with vision loss are introduced, which reflect the target group’s willingness to get involved in leisure activities and also pinpoint factors which hinder their participation (e.g., professionals’ unfamiliarity with the special needs of those with VI and adapted sports opportunities.

  9. Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

    Directory of Open Access Journals (Sweden)

    David eBueno

    2014-10-01

    Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

  10. The Effects of Anthrax Lethal Toxin on Host Barrier Function

    Directory of Open Access Journals (Sweden)

    David M. Frucht

    2011-06-01

    Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.

  11. Minimal impairment in pulmonary function following laparoscopic surgery

    DEFF Research Database (Denmark)

    Staehr-Rye, Anne K; Rasmussen, L S; Rosenberg, J

    2014-01-01

    BACKGROUND: Pulmonary function may be impaired in connection with laparoscopic surgery, especially in the head-down body position, but the clinical importance has not been assessed in detail. The aim of this study was to assess pulmonary function after laparoscopic hysterectomy and laparoscopic...... cholecystectomy in the 20° head-up position or hysterectomy in the 30° head-down position. The primary outcome was the difference between arterial oxygenation (PaO2 ) 2 h postoperatively and the preoperative value. Two hours and 24 h after surgery, pulmonary shunt and ventilation-perfusion mismatch were assessed.......88). Shunt was significantly greater in the cholecystectomy group 24 h after surgery compared to the hysterectomy group [4%, 95% CI 0 to 9 vs. 0%, 95% CI 0 to 7, P = 0.02]. CONCLUSIONS: Minimal impairment in pulmonary gas exchange was found after laparoscopic surgery. Pulmonary shunt was larger after...

  12. Impaired mitochondrial function in chronically ischemic human heart

    DEFF Research Database (Denmark)

    Stride, Nis Ottesen; Larsen, Steen; Hey-Mogensen, Martin

    2013-01-01

    , and finally to assess myocardial antioxidant levels. Mitochondrial respiration in biopsies from ischemic and nonischemic regions from the left ventricle of the same heart was compared in nine human subjects. Maximal oxidative phosphorylation capacity in fresh muscle fibers was lower in ischemic compared.......05), and the levels of antioxidant protein expression was lower. Diminished mitochondrial respiration capacity and excessive ROS production demonstrate an impaired mitochondrial function in ischemic human heart muscle. No chronic ischemic preconditioning effect was found....

  13. Crossing the entropy barrier of dynamical zeta functions

    International Nuclear Information System (INIS)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F.

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.)

  14. Crossing the entropy barrier of dynamical zeta functions

    Energy Technology Data Exchange (ETDEWEB)

    Aurich, R.; Bolte, J.; Matthies, C.; Sieber, M.; Steiner, F. (Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik)

    1992-01-01

    Dynamical zeta functions are an important tool to quantize chaotic dynamical systems. The basic quantization rules require the computation of the zeta functions on the real energy axis, where the Euler product representations running over the classical periodic orbits usually do not converge due to the existence of the so-called entropy barrier determined by the topological entropy of the classical system. We shown that the convergence properties of the dynamical zeta functions rewritten as Dirichlet series are governed not only by the well-known topological and metric entropy, but depend crucially on subtle statistical properties of the Maslow indices and of the multiplicities of the periodic orbits that are measured by a new parameter for which we introduce the notion of a third entropy. If and only if the third entropy is nonvanishing, one can cross the entropy barrier; if it exceeds a certain value, one can even compute the zeta function in the physical region by means of a convergent Dirichlet series. A simple statistical model is presented which allows to compute the third entropy. Four examples of chaotic systems are studied in detail to test the model numerically. (orig.).

  15. Impairments of Motor Function While Multitasking in HIV.

    Science.gov (United States)

    Kronemer, Sharif I; Mandel, Jordan A; Sacktor, Ned C; Marvel, Cherie L

    2017-01-01

    Human immunodeficiency virus (HIV) became a treatable illness with the introduction of combination antiretroviral therapy (CART). As a result, patients with regular access to CART are expected to live decades with HIV. Long-term HIV infection presents unique challenges, including neurocognitive impairments defined by three major stages of HIV-associated neurocognitive disorders (HAND). The current investigation aimed to study cognitive and motor impairments in HIV using a novel multitasking paradigm. Unlike current standard measures of cognitive and motor performance in HIV, multitasking increases real-world validity by mimicking the dual motor and cognitive demands that are part of daily professional and personal settings (e.g., driving, typing and writing). Moreover, multitask assessments can unmask compensatory mechanisms, normally used under single task conditions, to maintain performance. This investigation revealed that HIV+ participants were impaired on the motor component of the multitask, while cognitive performance was spared. A patient-specific positive interaction between motor performance and working memory recall was driven by poor HIV+ multitaskers. Surprisingly, HAND stage did not correspond with multitask performance and a variety of commonly used assessments indicated normal motor function among HIV+ participants with poor motor performance during the experimental task. These results support the use of multitasks to reveal otherwise hidden impairment in chronic HIV by expanding the sensitivity of clinical assessments used to determine HAND stage. Future studies should examine the capability of multitasks to predict performance in personal, professional and health-related behaviors and prognosis of patients living with chronic HIV.

  16. Impairments of Motor Function While Multitasking in HIV

    Directory of Open Access Journals (Sweden)

    Cherie L. Marvel

    2017-04-01

    Full Text Available Human immunodeficiency virus (HIV became a treatable illness with the introduction of combination antiretroviral therapy (CART. As a result, patients with regular access to CART are expected to live decades with HIV. Long-term HIV infection presents unique challenges, including neurocognitive impairments defined by three major stages of HIV-associated neurocognitive disorders (HAND. The current investigation aimed to study cognitive and motor impairments in HIV using a novel multitasking paradigm. Unlike current standard measures of cognitive and motor performance in HIV, multitasking increases real-world validity by mimicking the dual motor and cognitive demands that are part of daily professional and personal settings (e.g., driving, typing and writing. Moreover, multitask assessments can unmask compensatory mechanisms, normally used under single task conditions, to maintain performance. This investigation revealed that HIV+ participants were impaired on the motor component of the multitask, while cognitive performance was spared. A patient-specific positive interaction between motor performance and working memory recall was driven by poor HIV+ multitaskers. Surprisingly, HAND stage did not correspond with multitask performance and a variety of commonly used assessments indicated normal motor function among HIV+ participants with poor motor performance during the experimental task. These results support the use of multitasks to reveal otherwise hidden impairment in chronic HIV by expanding the sensitivity of clinical assessments used to determine HAND stage. Future studies should examine the capability of multitasks to predict performance in personal, professional and health-related behaviors and prognosis of patients living with chronic HIV.

  17. Wound Healing in Patients With Impaired Kidney Function.

    Science.gov (United States)

    Maroz, Natallia; Simman, Richard

    2013-04-01

    Renal impairment has long been known to affect wound healing. However, information on differences in the spectrum of wound healing depending on the type of renal insufficiency is limited. Acute kidney injury (AKI) may be observed with different wound types. On one hand, it follows acute traumatic conditions such as crush injury, burns, and post-surgical wounds, and on the other hand, it arises as simultaneous targeting of skin and kidneys by autoimmune-mediated vasculitis. Chronic kidney disease (CKD) and end-stage renal disease (ESRD) often occur in older people, who have limited physical mobility and predisposition for developing pressure-related wounds. The common risk factors for poor wound healing, generally observed in patients with CKD and ESRD, include poorly controlled diabetes mellitus, neuropathy, peripheral vascular disease, chronic venous insufficiency, and aging. ESRD patients have a unique spectrum of wounds related to impaired calcium-phosphorus metabolism, including calciphylaxis, in addition to having the risk factors presented by CKD patients. Overall, there is a wide range of uremic toxins: they may affect local mechanisms of wound healing and also adversely affect the functioning of multiple systems. In the present literature review, we discuss the association between different types of renal impairments and their effects on wound healing and examine this association from different aspects related to the management of wounds in renal impairment patients.

  18. Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

    Directory of Open Access Journals (Sweden)

    Pasricha J

    1991-01-01

    Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

  19. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  1. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  2. Lipids and skin barrier function - a clinical perspective

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

    2008-01-01

    The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...

  3. Incidental MRI Findings in Patients with Impaired Cognitive Function

    International Nuclear Information System (INIS)

    Hwang, Yoon Joon

    2013-01-01

    This study aims to evaluate the incidental findings on brain MRI of patients with cognitive function impairments. We analyzed magnetic resonance (MR) findings of 236 patients with decreased cognitive function. MR protocols include conventional T2 weighted axial images, fluid attenuated inversion recovery axial images, T1 weighted coronal 3-dimensional magnetization-prepared rapid acquisition of gradient echo and diffusion tensor images. We retrospectively evaluated the signal changes that suggest acute/subacute infarction and space occupying lesions which show mass effect. Incidental MR findings were seen in 16 patients. Nine patients (3.8%) showed increased signal intensity on trace map of diffusion tensor images suggesting acute/subacute infarctions. Space occupying lesions were detected in 7 patients, and 3 lesions (1.27%) had mass effect and edema and were considered clinically significant lesions that diminish cognitive functions. Several incidental MR findings were detected in patients with decreased cognitive function, and the incidence of aucte/subacute infarctions were higher. Proper evaluations of MRI in patients with impaired cognitive functions will be helpful in early detection and management of ischemic lesions and space occupying lesions.

  4. Neural origins of psychosocial functioning impairments in major depression.

    Science.gov (United States)

    Pulcu, Erdem; Elliott, Rebecca

    2015-09-01

    Major depressive disorder, a complex neuropsychiatric condition, is associated with psychosocial functioning impairments that could become chronic even after symptoms remit. Social functioning impairments in patients could also pose coping difficulties to individuals around them. In this Personal View, we trace the potential neurobiological origins of these impairments down to three candidate domains-namely, social perception and emotion processing, motivation and reward value processing, and social decision making. We argue that the neural basis of abnormalities in these domains could be detectable at different temporal stages during social interactions (eg, before and after decision stages), particularly within frontomesolimbic networks (ie, frontostriatal and amygdala-striatal circuitries). We review some of the experimental designs used to probe these circuits and suggest novel, integrative approaches. We propose that an understanding of the interactions between these domains could provide valuable insights for the clinical stratification of major depressive disorder subtypes and might inform future developments of novel treatment options in return. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Functional abilities in older adults with mild cognitive impairment.

    Science.gov (United States)

    Burton, Catherine L; Strauss, Esther; Bunce, David; Hunter, Michael A; Hultsch, David F

    2009-01-01

    A classification scheme and general set of criteria for diagnosing mild cognitive impairment (MCI) were recently proposed by a multidisciplinary group of experts who met at an international symposium on MCI. One of the proposed criteria included preserved basic activities of daily living and minimal impairment in complex instrumental activities of daily living (IADLs). To investigate whether older adults with MCI classified according to the subtypes identified by the Working Group (i.e. amnestic, single non-memory domain, and multiple domain with or without a memory component) differed from cognitively intact older adults on a variety of measures indexing IADLs and to examine how well measures of IADL predict concurrent MCI status. Two hundred and fifty community-dwelling older adults, ranging in age from 66 to 92, completed self-report measures of IADLs (Lawton and Brody IADL Scale, Scales of Independent Behaviour-Revised--SIB-R) and a measure of everyday problem solving indexing IADLs (Everyday Problems Test--EPT). Ratings of participants' IADL functioning were also obtained from informants (e.g. spouse, adult child and friend). Older adults with multiple-domain MCI demonstrated poorer IADL functioning than older adults with no cognitive impairment on the EPT and the SIB-R (both self- and informant-report versions). The multiple-domain MCI participants also demonstrated poorer IADLs than MCI participants with impairments in a single cognitive domain on the self-reported SIB-R and EPT. The single-domain MCI groups demonstrated poorer IADLs than older adults without cognitive impairment on the informant-reported SIB-R and EPT. No significant group differences were found on the Lawton and Brody IADL Scale. Using the EPT and SIB-R as predictors in a multinomial regression analysis, MCI group status was reliably predicted, but the classification rate was poor. Individuals with MCI demonstrated poorer IADL functioning compared to cognitively intact older adults

  6. Impairments that Influence Physical Function among Survivors of Childhood Cancer

    Directory of Open Access Journals (Sweden)

    Carmen L. Wilson

    2015-01-01

    Full Text Available Children treated for cancer are at increased risk of developing chronic health conditions, some of which may manifest during or soon after treatment while others emerge many years after therapy. These health problems may limit physical performance and functional capacity, interfering with participation in work, social, and recreational activities. In this review, we discuss treatment-induced impairments in the endocrine, musculoskeletal, neurological, and cardiopulmonary systems and their influence on mobility and physical function. We found that cranial radiation at a young age was associated with a broad range of chronic conditions including obesity, short stature, low bone mineral density and neuromotor impairments. Anthracyclines and chest radiation are associated with both short and long-term cardiotoxicity. Although numerous chronic conditions are documented among individuals treated for childhood cancer, the impact of these conditions on mobility and function are not well characterized, with most studies limited to survivors of acute lymphoblastic leukemia and brain tumors. Moving forward, further research assessing the impact of chronic conditions on participation in work and social activities is required. Moreover, interventions to prevent or ameliorate the loss of physical function among children treated for cancer are likely to become an important area of survivorship research.

  7. Cognitive functions in preschool children with specific language impairment.

    Science.gov (United States)

    Reichenbach, Katrin; Bastian, Laura; Rohrbach, Saskia; Gross, Manfred; Sarrar, Lea

    2016-07-01

    A growing body of research has focused on executive functions in children with specific language impairment (SLI). However, results show limited convergence, particularly in preschool age. The current neuropsychological study compared performance of cognitive functions focused on executive components and working memory in preschool children with SLI to typically developing controls. Performance on the measures cognitive flexibility, inhibition, processing speed and phonological short-term memory was assessed. The monolingual, Caucasian study sample consisted of 30 children with SLI (Mage = 63.3 months, SD = 4.3 months) and 30 healthy controls (Mage = 62.2 months, SD = 3.7 months). Groups were matched for age and nonverbal IQ. Socioeconomic status of the participating families was included. Children with SLI had significantly poorer abilities of phonological short-term memory than matched controls. A tendency of poorer abilities in the SLI group was found for inhibition and processing speed. We confirmed phonological short-term memory to be a reliable marker of SLI in preschoolers. Our results do not give definite support for impaired executive function in SLI, possibly owing to limited sensitivity of test instruments in this age group. We argue for a standardization of executive function tests for research use. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Assessing depression related severity and functional impairment: the Overall Depression Severity and Impairment Scale (ODSIS.

    Directory of Open Access Journals (Sweden)

    Masaya Ito

    Full Text Available The Overall Depression Severity and Impairment Scale (ODSIS is a brief, five-item measure for assessing the frequency and intensity of depressive symptoms, as well as functional impairments in pleasurable activities, work or school, and interpersonal relationships due to depression. Although this scale is expected to be useful in various psychiatric and mental health settings, the reliability, validity, and interpretability have not yet been fully examined. This study was designed to examine the reliability, factorial, convergent, and discriminant validity of a Japanese version of the ODSIS, as well as its ability to distinguish between individuals with and without a major depressive disorder diagnosis.From a pool of registrants at an internet survey company, 2830 non-clinical and clinical participants were selected randomly (619 with major depressive disorder, 619 with panic disorder, 576 with social anxiety disorder, 645 with obsessive-compulsive disorder, and 371 non-clinical panelists. Participants were asked to respond to the ODSIS and conventional measures of depression, functional impairment, anxiety, neuroticism, satisfaction with life, and emotion regulation.Exploratory and confirmatory factor analysis of three split subsamples indicated the unidimensional factor structure of ODSIS. Multi-group confirmatory factor analysis showed invariance of factor loadings between non-clinical and clinical subsamples. The ODSIS also showed excellent internal consistency and test-retest intraclass correlation coefficients. Convergence and discriminance of the ODSIS with various measures were in line with our expectations. Receiver operating characteristic curve analyses showed that the ODSIS was able to detect a major depressive syndrome accurately.This study supports the reliability and validity of ODSIS in a non-western population, which can be interpreted as demonstrating cross-cultural validity.

  9. DJ-1 KNOCK-DOWN IMPAIRS ASTROCYTE MITOCHONDRIAL FUNCTION

    Science.gov (United States)

    LARSEN, N. J.; AMBROSI, G.; MULLETT, S. J.; BERMAN, S. B.; HINKLE, D. A.

    2012-01-01

    Mitochondrial dysfunction has long been implicated in the pathogenesis of Parkinson’s disease (PD). PD brain tissues show evidence for mitochondrial respiratory chain Complex I deficiency. Pharmacological inhibitors of Complex I, such as rotenone, cause experimental parkinsonism. The cytoprotective protein DJ-1, whose deletion is sufficient to cause genetic PD, is also known to have mitochondria-stabilizing properties. We have previously shown that DJ-1 is over-expressed in PD astrocytes, and that DJ-1 deficiency impairs the capacity of astrocytes to protect co-cultured neurons against rotenone. Since DJ-1 modulated, astrocyte-mediated neuroprotection against rotenone may depend upon proper astrocytic mitochondrial functioning, we hypothesized that DJ-1 deficiency would impair astrocyte mitochondrial motility, fission/fusion dynamics, membrane potential maintenance, and respiration, both at baseline and as an enhancement of rotenone-induced mitochondrial dysfunction. In astrocyte-enriched cultures, we observed that DJ-1 knock-down reduced mitochondrial motility primarily in the cellular processes of both untreated and rotenone treated cells. In these same cultures, DJ-1 knock-down did not appreciably affect mitochondrial fission, fusion, or respiration, but did enhance rotenone-induced reductions in the mitochondrial membrane potential. In neuron–astrocyte co-cultures, astrocytic DJ-1 knock-down reduced astrocyte process mitochondrial motility in untreated cells, but this effect was not maintained in the presence of rotenone. In the same co-cultures, astrocytic DJ-1 knock-down significantly reduced mitochondrial fusion in the astrocyte cell bodies, but not the processes, under the same conditions of rotenone treatment in which DJ-1 deficiency is known to impair astrocyte-mediated neuroprotection. Our studies therefore demonstrated the following new findings: (i) DJ-1 deficiency can impair astrocyte mitochondrial physiology at multiple levels, (ii) astrocyte

  10. Balance Functional Assessment in People with Visual Impairment

    Directory of Open Access Journals (Sweden)

    Rutkowska Izabela

    2015-12-01

    Full Text Available The aims of this study were twofold: to assess the level of balance of people with visual impairment against the BOT-2 standard scores for the able-bodied, and to identify in which trials subjects had the greatest difficulties in maintaining balance with respect to the degree of vision loss and age categories. One hundred twenty-seven subjects with visual impairment aged 6-16 years, participated in the study (68 girls and 59 boys. The division for partially sighted people (61 and the blind (66 was made according to the WHO classification. Functional balance assessment was made using a balance subtest from the Bruininks-Oseretsky test. Significant relationships were noticed between age and the level of balance (χ2 = 8.35 p <0,05, as well as between the degree of vision loss and the level of balance (χ2 = 24.53 p <0,001. The level of balance of almost all blind subjects was below (20% or well-below (60% the average for the able-bodied. The subjects’ ability to maintain balance was not dependent on gender and was associated primarily with the degree of visual impairment and age. Partially sighted people had better balance than the blind and the decrease in visual acuity resulted in reduction of balance skills. The lowest level of balance was observed in blind students aged 7-11 years. Elaborating physical fitness improvement programs for children and adolescents with visual impairment, diversity of age, the degree of vision loss and limitations of ablility to maintain balance should be taken into account.

  11. Blood-aqueous Barrier Function in a Patient With Choroideremia

    Directory of Open Access Journals (Sweden)

    Muh-Shy Chen

    2010-02-01

    Full Text Available The purpose was to determine whether there was a breakdown of the blood-aqueous barrier in a patient with choroideremia. A 27-year-old man with typical choroideremia underwent standardized ophthalmo-logical evaluation, including quantitative measurement of aqueous flare intensity, by a laser flare-cell meter. The results showed areas of atrophy of the choriocapillaries and retinal pigment epithelium in the mid-periphery and posterior pole, although not in the macula. Fluorescein angiography showed areas of loss of the choriocapillaries and retinal pigment epithelium. The fovea was spared with a surrounding zone of hy-perfluorescence. Electroretinography showed a subnormal photopic amplitude and extinguished scotopic response. Electrooculography revealed that the light peak/dark trough ratio was reduced. Goldmann perimetry showed constricted peripheral fields. Laser photometry showed an increase in the aqueous flare intensity in both eyes, as compared with normal subjects. We conclude that the function of the blood-aqueous barrier might be affected in patients with choroideremia.

  12. Subjective cognitive impairment: functional MRI during a divided attention task.

    Science.gov (United States)

    Rodda, J; Dannhauser, T; Cutinha, D J; Shergill, S S; Walker, Z

    2011-10-01

    Individuals with subjective cognitive impairment (SCI) have persistent memory complaints but normal neurocognitive performance. For some, this may represent a pre-mild cognitive impairment (MCI) stage of Alzheimer's disease (AD). Given that attentional deficits and associated brain activation changes are present early in the course of AD, we aimed to determine whether SCI is associated with brain activation changes during attentional processing. Eleven SCI subjects and 10 controls completed a divided attention task during functional magnetic resonance imaging. SCI and control groups did not differ in sociodemographic, neurocognitive or behavioural measures. When group activation during the divided attention task was compared, the SCI group demonstrated increased activation in left medial temporal lobe, bilateral thalamus, posterior cingulate and caudate. This pattern of increased activation is similar to the pattern of decreased activation reported during divided attention in AD and may indicate compensatory changes. These findings suggest the presence of early functional changes in SCI; longitudinal studies will help to further elucidate the relationship between SCI and AD. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  13. Functional Food Market Development in Serbia: Motivations and Barriers

    Directory of Open Access Journals (Sweden)

    Žaklina Stojanović

    2013-11-01

    Full Text Available The aim of this paper is to present main findings obtained from the empirical analysis of the functional food market in Serbia. The analysis is based on the in-depth interviews with relevant processors and retailers present on the market. The following set of topics are considered: (1 motivations (driving forces and barriers to offer products with nutrition and health (N&H claim and (2 perception of consumer demand toward N&H claimed products. Differences between Serbia and other Western Balkan Countries (WBC are explored by using nonparametric techniques based on the independent samples. Results support overall conclusion that this market segment in Serbia is underdeveloped and rather producer than consumer driven compared to more developed WBC markets.

  14. Impaired olfactory function in patients with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Sezen Bozkurt Koseoglu

    2016-06-01

    Full Text Available Polycystic ovary syndrome (PCOS is an endocrine disorder which affects 6.6% of women of child-bearing age. Although olfactory dysfunction is frequent in the population and it negatively affects quality of life, neither physicians or patients consider this important. This case-control study included 30 patients diagnosed with PCOS, and 25 healthy age-matched controls. Sniffin' sticks tests (BurghartGmbH, Wedel, Germany were used to analyze olfactory functions, and the Beck Depression Inventory was used to evaluate depressive symptoms. The total odor score was significantly lower in the PCOS group compared to the control group (p<0.005. The Beck depression score was higher in the PCOS group (p<0.005. There was a negative correlation between the total odor score and the Beck Depression Score. Patients with PCOS have impaired olfactory function. This might be related to depressive disorders that are also observed in those patients.

  15. Family factors, emotional functioning, and functional impairment in juvenile fibromyalgia syndrome.

    Science.gov (United States)

    Kashikar-Zuck, Susmita; Lynch, Anne M; Slater, Shalonda; Graham, T Brent; Swain, Nicole F; Noll, Robert B

    2008-10-15

    Family factors and emotional functioning can play an important role in the ability of adolescents with juvenile primary fibromyalgia syndrome (JPFS) to cope with their condition and function in their everyday lives. The primary objectives of this study were to determine 1) whether adolescents with JPFS and their caregivers differed from healthy age-matched comparison peers and their caregivers in terms of emotional distress and functional impairment; 2) whether there were any differences in the family environment of adolescents with JPFS compared with healthy comparison peers; and 3) which individual-, caregiver-, and family-level variables were associated with functional impairment in adolescents with JPFS. Participants were 47 adolescents with JPFS recruited from a pediatric rheumatology clinic and 46 comparison peers without chronic illness matched for age, sex, and race. Participants and their caregivers (all mothers) completed a battery of standardized measures administered in their homes. Adolescents with JPFS had greater internalizing and externalizing symptoms than healthy comparison peers. Mothers of adolescents with JPFS reported twice as many pain conditions and significantly greater depressive symptoms than mothers of comparison peers. The JPFS group also had poorer overall family functioning and more conflicted family relationships. In adolescents with JPFS, maternal pain history was associated with significantly higher functional impairment. Increased distress and chronic pain are evident in families of adolescents with JPFS, and family relationships are also impacted. Implications for child functional impairment and the need for inclusion of caregivers in treatment are discussed.

  16. Krüppel-like factor 5 is essential for maintenance of barrier function in mouse colon.

    Science.gov (United States)

    Liu, Yang; Chidgey, Martyn; Yang, Vincent W; Bialkowska, Agnieszka B

    2017-11-01

    Krüppel-like factor 5 (KLF5) is a member of the zinc finger family of transcription factors that regulates homeostasis of the intestinal epithelium. Previous studies suggested an indispensable role of KLF5 in maintaining intestinal barrier function. In the current study, we investigated the mechanisms by which KLF5 regulates colonic barrier function in vivo and in vitro. We used an inducible and a constitutive intestine-specific Klf5 knockout mouse models ( Villin-CreER T2 ;Klf5 fl/fl designated as Klf5 ΔIND and Villin-Cre;Klf5 fl/fl as Klf5 ΔIS ) and studied an inducible KLF5 knockdown in Caco-2 BBe cells using a lentiviral Tet-on system (Caco-2 BBe KLF5ΔIND ). Specific knockout of Klf5 in colonic tissues, either inducible or constitutive, resulted in increased intestinal permeability. The phenotype was accompanied by a significant reduction in Dsg2 , which encodes desmoglein-2, a desmosomal cadherin, at both mRNA and protein levels. Transmission electron microscopy showed alterations of desmosomal morphology in both KLF5 knockdown Caco-2 BBe cells and Klf5 knockout mouse colonic tissues. Inducible knockdown of KLF5 in Caco-2BBe cells grown on Transwell plates led to impaired barrier function as evidenced by decreased transepithelial electrical resistance and increased paracellular permeability to fluorescein isothiocyanate-4 kDa dextran. Furthermore, DSG2 was significantly decreased in KLF5 knockdown cells, and DSG2 overexpression partially rescued the impaired barrier function caused by KLF5 knockdown. Electron microscopy studies demonstrated altered desmosomal morphology after KLF5 knockdown. In combination with chromatin immunoprecipitation analysis and promoter study, our data show that KLF5 regulates intestinal barrier function by mediating the transcription of DSG2 , a gene encoding a major component of desmosome structures. NEW & NOTEWORTHY The study is original research on the direct function of a Krüppel-like factor on intestinal barrier function

  17. Physical activity practice among children and adolescents with visual impairment--influence of parental support and perceived barriers.

    Science.gov (United States)

    Greguol, Márcia; Gobbi, Erica; Carraro, Attilio

    2015-01-01

    To analyze the practice of physical activity among children and adolescents with visual impairments (VI), regarding the possible influence of parental support and perceived barriers. Twenty-two young people with VIs (10 + 2.74 years old) and one of each of their parents were evaluated. They responded to the Physical Activity Questionnaire for Older Children (PAQ-C), Baecke Questionnaire, the Parental Support Scale and a questionnaire about perceived barriers to physical activity. The independent samples t-test, pearson correlation test and chi-square test were performed. Blind young people showed lower physical activity levels. There were significant correlations both between parents' physical activity and the support offered to children and between the PAQ-C results and the importance given by young people to physical activity, but only for those aged between 8 and 10 years old. The main perceived barriers were lack of security, motivation, professional training and information about available physical activity programs. The influence of parental support seems to be an important factor in the adoption of a physically active lifestyle for young people with VI. Parents and children should have more information about the benefits and opportunities of physical activity. Implications for Rehabilitation Young people with visual impairment should be encouraged by parents to practice physical activity. More information should be provided on the benefits of physical activity to both parents and children. Professional training should be available to help support this group become more active.

  18. Applications of Skyrme energy-density functional to fusion reactions spanning the fusion barriers

    International Nuclear Information System (INIS)

    Liu Min; Wang, Ning; Li Zhuxia; Wu Xizhen; Zhao Enguang

    2006-01-01

    The Skyrme energy density functional has been applied to the study of heavy-ion fusion reactions. The barriers for fusion reactions are calculated by the Skyrme energy density functional with proton and neutron density distributions determined by using restricted density variational (RDV) method within the same energy density functional together with semi-classical approach known as the extended semi-classical Thomas-Fermi method. Based on the fusion barrier obtained, we propose a parametrization of the empirical barrier distribution to take into account the multi-dimensional character of real barrier and then apply it to calculate the fusion excitation functions in terms of barrier penetration concept. A large number of measured fusion excitation functions spanning the fusion barriers can be reproduced well. The competition between suppression and enhancement effects on sub-barrier fusion caused by neutron-shell-closure and excess neutron effects is studied

  19. The Reliability of the CVI Range: A Functional Vision Assessment for Children with Cortical Visual Impairment

    Science.gov (United States)

    Newcomb, Sandra

    2010-01-01

    Children who are identified as visually impaired frequently have a functional vision assessment as one way to determine how their visual impairment affects their educational performance. The CVI Range is a functional vision assessment for children with cortical visual impairment. The purpose of the study presented here was to examine the…

  20. [Impaired lung function in patients with moderate chronic obstructive bronchitis].

    Science.gov (United States)

    Nefedov, V B; Popova, L A; Shergina, E A

    2004-01-01

    VC, FVC, FEV1, FEV1/VC%, PEF, MEF25, MEF50, MEF75, TLC, TGV, RV, Raw, Rin, Rex, DLCO-SS, paO2 and paCO2 were determined in 22 patients with moderate chronic obstructive bronchitis (FEV1, 79-50% of the normal value). All the patients were found to have impaired bronchial patency, 90.9% of the patients had lung volume and capacity changes; pulmonary gas exchange dysfunction was present in 72.7%. Bronchial patency impairments were manifested by a decrease in FEV1, FEV1/VC%, PEF, MEF25, MEF50, MEF75, and an increase in Raw, Rin, Rex. Changes in the lung volumes and capacities appeared as higher RV, TGV, TLC, lower VC and FVC. Pulmonary gas exchange dysfunction showed up as a reduction in pO2 and DLCO-SS a reduction and an increase in paCO2. The magnitude of the functional changes observed in most patients was low. Significant and pronounced disorders were seen in one third of the patients.

  1. Influence of visual impairment and hearing impairment on functional dependence status among people in Taiwan-An evaluation using the WHODAS 2.0 score.

    Science.gov (United States)

    Chang, Ko-Fang; Chang, Kwang-Hwa; Chi, Wen-Chou; Huang, Shih-Wei; Yen, Chia-Feng; Liao, Hua-Fang; Liou, Tsan-Hon; Chao, Pin-Zhir; Lin, I-Chan

    2018-04-01

    Visual impairment (VI) and hearing impairment (HI) are the two most common types of sensory disability encountered clinically. However, VI and HI result in different limitations in daily life. We assessed the level of functioning in patients with VI or HI based on the International Classification of Functioning, Disability, and Health. This nationwide, cross-sectional study included 312 people with VI and 540 people with HI. Each participant's degree of functioning and disability was evaluated using the World Health Organization Disability Assessment Schedule 2.0 (WHODAS 2.0). The standardized WHODAS 2.0 scores ranged from 0 (least difficulty) to 100 (most difficulty). Patients with VI and those with HI had a mean (±standard error) 32-item WHODAS 2.0 score of 42.4 ± 2.9 and 27.1 ± 1.6, respectively. The degree of restriction was positively related to the level of VI. Specifically, the patients with VI and a WHODAS 2.0 score of 33.7-35.3 or higher were likely to experience barriers to accessing mobility products, communication products, and education products. Furthermore, patients with a score of 42.9 or higher might experience barriers to accessing ingestion products and living products. WHODAS 2.0 scores are strongly correlated with the severity of VI. Mild VI should be targeted for treatment and referral as early as possible. Compared with the patients with HI, the patients with VI more frequently experience barriers to accessing environmental factors. Copyright © 2017. Published by Elsevier Taiwan LLC.

  2. Decreased function of survival motor neuron protein impairs endocytic pathways.

    Science.gov (United States)

    Dimitriadi, Maria; Derdowski, Aaron; Kalloo, Geetika; Maginnis, Melissa S; O'Hern, Patrick; Bliska, Bryn; Sorkaç, Altar; Nguyen, Ken C Q; Cook, Steven J; Poulogiannis, George; Atwood, Walter J; Hall, David H; Hart, Anne C

    2016-07-26

    Spinal muscular atrophy (SMA) is caused by depletion of the ubiquitously expressed survival motor neuron (SMN) protein, with 1 in 40 Caucasians being heterozygous for a disease allele. SMN is critical for the assembly of numerous ribonucleoprotein complexes, yet it is still unclear how reduced SMN levels affect motor neuron function. Here, we examined the impact of SMN depletion in Caenorhabditis elegans and found that decreased function of the SMN ortholog SMN-1 perturbed endocytic pathways at motor neuron synapses and in other tissues. Diminished SMN-1 levels caused defects in C. elegans neuromuscular function, and smn-1 genetic interactions were consistent with an endocytic defect. Changes were observed in synaptic endocytic proteins when SMN-1 levels decreased. At the ultrastructural level, defects were observed in endosomal compartments, including significantly fewer docked synaptic vesicles. Finally, endocytosis-dependent infection by JC polyomavirus (JCPyV) was reduced in human cells with decreased SMN levels. Collectively, these results demonstrate for the first time, to our knowledge, that SMN depletion causes defects in endosomal trafficking that impair synaptic function, even in the absence of motor neuron cell death.

  3. Homocyst(e)ine impairs endocardial endothelial function.

    Science.gov (United States)

    Tyagi, S C; Smiley, L M; Mujumdar, V S

    1999-12-01

    Homocyst(e)ine injured vascular endothelium and modulated endothelial-dependent vascular function. Endothelium plays an analogous role in both the vessel and the endocardium. Therefore, we hypothesized that homocyst(e)ine modulated endocardial endothelium (EE) dependent cardiac function. The ex vivo cardiac rings from normal male Wistar-Kyoto rats were prepared. The contractile responses of left and right ventricular rings were measured in an isometric myobath, using different concentrations of CaCl2. The response was higher in the left ventricle than right ventricle and was elevated in endocardium without endothelium. The half effective concentration (EC50) and maximum tension generated by homocyst(e)ine were 10(6) and 5-fold lower than endothelin (ET) and angiotensin II (AII), respectively. However, in endothelial-denuded endocardium, homocyst(e)ine response was significantly increased (pine, and endothelial nitric oxide in EE function, cardiac rings were pretreated with AII (10(-10) M) or ET (10(-13) M) and then treated with homocyst(e)ine (10(-8) M). Results suggested that at these concentrations AII, ET, or homocyst(e)ine alone had no effect on cardiac contraction. However, in the presence of 10(-10) M AII or 10(-13) M ET, the cardiac contraction to homocyst(e)ine (10(-8) M) was significantly enhanced (pine. These results suggested that homocyst(e)ine impaired EE-dependent cardiac function and acted synergistically with AII and ET in enhancing the cardiac contraction.

  4. Food Derived Bioactive Peptides and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Olga Martínez-Augustin

    2014-12-01

    Full Text Available A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  5. Impaired quality and efficiency of sleep impairs cognitive functioning in Addison's disease.

    Science.gov (United States)

    Henry, Michelle; Ross, Ian Louis; Wolf, Pedro Sofio Abril; Thomas, Kevin Garth Flusk

    2017-04-01

    Standard replacement therapy for Addison's disease (AD) does not restore a normal circadian rhythm. Periods of sub- and supra- physiological cortisol levels experienced by patients with AD likely induce disrupted sleep. Given that healthy sleep plays an important role in memory consolidation, the novelty of the current study was to characterise, using objective measures, the relationship between sleep and memory in patients with AD, and to examine the hypothesis that poor sleep is a biological mechanism underlying memory impairment in those patients. We used a within-subjects design. Ten patients with AD and 10 matched healthy controls completed standardised neuropsychological tests assessing declarative memory (Rey Auditory Verbal Learning Test) and procedural memory (Finger Tapping Task) before and after a period of actigraphy-measured sleep, and before and after a period of waking. Relative to healthy controls, patients with AD experienced disrupted sleep characterised by poorer sleep efficiency and more time spent awake. Patients also showed impaired verbal learning and memory relative to healthy controls (p=0.007). Furthermore, whereas healthy controls' declarative memory performance benefited from a period of sleep compared to waking (p=0.032), patients with AD derived no such benefit from sleep (p=0.448). Regarding the procedural memory task, analyses detected no significant between-group differences (all p's<0.065), and neither group showed significant sleep-enhanced performance. We demonstrated, using actigraphy and standardized measures of memory performance, an association between sleep disturbances and cognitive deficits in patients with AD. These results suggest that, in patients with AD, the source of memory deficits is, at least to some extent, disrupted sleep patterns that interfere with optimal consolidation of previously-learned declarative information. Hence, treating the sleep disturbances that are frequently experienced by patients with AD may

  6. Critical appraisal of questionnaires to assess functional impairment in individuals with mild cognitive impairment.

    Science.gov (United States)

    Kaur, Navaldeep; Belchior, Patricia; Gelinas, Isabelle; Bier, Nathalie

    2016-09-01

    Mild deficits in instrumental activities of daily living (IADLs) have consistently been reported in the individuals with mild cognitive impairment (MCI). A variety of functional assessment tools, including self-and informant report questionnaires and performance-based measures, have been employed in MCI. Previously, a limited focus has been directed at appraising the quality of questionnaires. The goal of this study was to identify the questionnaires that have been validated in the MCI population. Additionally, the quality of validation studies and psychometric attributes of these questionnaires were appraised. Relevant articles were systematically searched in PsychINFO, Ovid MEDLINE, and CINAHL against specific eligibility criteria. To evaluate the methodology of the psychometric studies, the COSMIN checklist was employed. Also, the psychometric properties of the assessment tools were evaluated based upon Terwee's criteria. A total of five psychometric studies and questionnaires were critically evaluated. Varying psychometric properties were available for the chosen tools. None of the studies received the best possible rating for their methodological quality. It was found that questionnaires with high discriminative ability to distinguish MCI from other diagnostic groups were: Disability Assessment in Dementia-6 (DAD-6), Functional Activity Questionnaire (FAQ), and Alzheimer's Disease Cooperative Study/Activities of Daily Living scale adapted for MCI patients (ADCS-MCI-ADL-24). Psychometric studies with strong methodological rigor are required in the future. Considering the fact that IADL decline has been associated with dementia, early detection of functional difficulties in MCI needs to be encouraged as it will allow suitable and timely interventions to prolong functional independence of affected individuals.

  7. Endothelial RIG-I activation impairs endothelial function

    Energy Technology Data Exchange (ETDEWEB)

    Asdonk, Tobias, E-mail: tobias.asdonk@ukb.uni-bonn.de [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Motz, Inga; Werner, Nikos [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Coch, Christoph; Barchet, Winfried; Hartmann, Gunther [Institute for Clinical Chemistry and Clinical Pharmacology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Nickenig, Georg; Zimmer, Sebastian [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer RIG-I activation impairs endothelial function in vivo. Black-Right-Pointing-Pointer RIG-I activation alters HCAEC biology in vitro. Black-Right-Pointing-Pointer EPC function is affected by RIG-I stimulation in vitro. -- Abstract: Background: Endothelial dysfunction is a crucial part of the chronic inflammatory atherosclerotic process and is mediated by innate and acquired immune mechanisms. Recent studies suggest that pattern recognition receptors (PRR) specialized in immunorecognition of nucleic acids may play an important role in endothelial biology in a proatherogenic manner. Here, we analyzed the impact of endothelial retinoic acid inducible gene I (RIG-I) activation upon vascular endothelial biology. Methods and results: Wild type mice were injected intravenously with 32.5 {mu}g of the RIG-ligand 3pRNA (RNA with triphosphate at the 5 Prime end) or polyA control every other day for 7 days. In 3pRNA-treated mice, endothelium-depended vasodilation was significantly impaired, vascular oxidative stress significantly increased and circulating endothelial microparticle (EMP) numbers significantly elevated compared to controls. To gain further insight in RIG-I dependent endothelial biology, cultured human coronary endothelial cells (HCAEC) and endothelial progenitor cells (EPC) were stimulated in vitro with 3pRNA. Both cells types express RIG-I and react with receptor upregulation upon stimulation. Reactive oxygen species (ROS) formation is enhanced in both cell types, whereas apoptosis and proliferation is not significantly affected in HCAEC. Importantly, HCAEC release significant amounts of proinflammatory cytokines in response to RIG-I stimulation. Conclusion: This study shows that activation of the cytoplasmatic nucleic acid receptor RIG-I leads to endothelial dysfunction. RIG-I induced endothelial damage could therefore be an important pathway in atherogenesis.

  8. Endothelial RIG-I activation impairs endothelial function

    International Nuclear Information System (INIS)

    Asdonk, Tobias; Motz, Inga; Werner, Nikos; Coch, Christoph; Barchet, Winfried; Hartmann, Gunther; Nickenig, Georg; Zimmer, Sebastian

    2012-01-01

    Highlights: ► RIG-I activation impairs endothelial function in vivo. ► RIG-I activation alters HCAEC biology in vitro. ► EPC function is affected by RIG-I stimulation in vitro. -- Abstract: Background: Endothelial dysfunction is a crucial part of the chronic inflammatory atherosclerotic process and is mediated by innate and acquired immune mechanisms. Recent studies suggest that pattern recognition receptors (PRR) specialized in immunorecognition of nucleic acids may play an important role in endothelial biology in a proatherogenic manner. Here, we analyzed the impact of endothelial retinoic acid inducible gene I (RIG-I) activation upon vascular endothelial biology. Methods and results: Wild type mice were injected intravenously with 32.5 μg of the RIG-ligand 3pRNA (RNA with triphosphate at the 5′end) or polyA control every other day for 7 days. In 3pRNA-treated mice, endothelium-depended vasodilation was significantly impaired, vascular oxidative stress significantly increased and circulating endothelial microparticle (EMP) numbers significantly elevated compared to controls. To gain further insight in RIG-I dependent endothelial biology, cultured human coronary endothelial cells (HCAEC) and endothelial progenitor cells (EPC) were stimulated in vitro with 3pRNA. Both cells types express RIG-I and react with receptor upregulation upon stimulation. Reactive oxygen species (ROS) formation is enhanced in both cell types, whereas apoptosis and proliferation is not significantly affected in HCAEC. Importantly, HCAEC release significant amounts of proinflammatory cytokines in response to RIG-I stimulation. Conclusion: This study shows that activation of the cytoplasmatic nucleic acid receptor RIG-I leads to endothelial dysfunction. RIG-I induced endothelial damage could therefore be an important pathway in atherogenesis.

  9. Inorganic arsenic impairs differentiation and functions of human dendritic cells

    Energy Technology Data Exchange (ETDEWEB)

    Macoch, Mélinda; Morzadec, Claudie [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Fardel, Olivier [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Pôle Biologie, Centre Hospitalier Universitaire (CHU) Rennes, 2 rue Henri Le Guilloux, 35033 Rennes (France); Vernhet, Laurent, E-mail: laurent.vernhet@univ-rennes1.fr [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France)

    2013-01-15

    Experimental studies have demonstrated that the antileukemic trivalent inorganic arsenic prevents the development of severe pro-inflammatory diseases mediated by excessive Th1 and Th17 cell responses. Differentiation of Th1 and Th17 subsets is mainly regulated by interleukins (ILs) secreted from dendritic cells (DCs) and the ability of inorganic arsenic to impair interferon-γ and IL-17 secretion by interfering with the physiology of DCs is unknown. In the present study, we demonstrate that high concentrations of sodium arsenite (As(III), 1–2 μM) clinically achievable in plasma of arsenic-treated patients, block differentiation of human peripheral blood monocytes into immature DCs (iDCs) by inducing their necrosis. Differentiation of monocytes in the presence of non-cytotoxic concentrations of As(III) (0.1 to 0.5 μM) only slightly impacts endocytotic activity of iDCs or expression of co-stimulatory molecules in cells activated with lipopolysaccharide. However, this differentiation in the presence of As(III) strongly represses secretion of IL-12p70 and IL-23, two major regulators of Th1 and Th17 activities, from iDCs stimulated with different toll-like receptor (TLR) agonists in metalloid-free medium. Such As(III)-exposed DCs also exhibit reduced mRNA levels of IL12A and/or IL12B genes when activated with TLR agonists. Finally, differentiation of monocytes with non-cytotoxic concentrations of As(III) subsequently reduces the ability of activated DCs to stimulate the release of interferon-γ and IL-17 from Th cells. In conclusion, our results demonstrate that clinically relevant concentrations of inorganic arsenic markedly impair in vitro differentiation and functions of DCs, which may contribute to the putative beneficial effects of the metalloid towards inflammatory autoimmune diseases. Highlights: ► Inorganic arsenic impairs differentiation and functions of human dendritic cells (DCs) ► Arsenite (> 1 μM) blocks differentiation of dendritic cells by

  10. Inorganic arsenic impairs differentiation and functions of human dendritic cells

    International Nuclear Information System (INIS)

    Macoch, Mélinda; Morzadec, Claudie; Fardel, Olivier; Vernhet, Laurent

    2013-01-01

    Experimental studies have demonstrated that the antileukemic trivalent inorganic arsenic prevents the development of severe pro-inflammatory diseases mediated by excessive Th1 and Th17 cell responses. Differentiation of Th1 and Th17 subsets is mainly regulated by interleukins (ILs) secreted from dendritic cells (DCs) and the ability of inorganic arsenic to impair interferon-γ and IL-17 secretion by interfering with the physiology of DCs is unknown. In the present study, we demonstrate that high concentrations of sodium arsenite (As(III), 1–2 μM) clinically achievable in plasma of arsenic-treated patients, block differentiation of human peripheral blood monocytes into immature DCs (iDCs) by inducing their necrosis. Differentiation of monocytes in the presence of non-cytotoxic concentrations of As(III) (0.1 to 0.5 μM) only slightly impacts endocytotic activity of iDCs or expression of co-stimulatory molecules in cells activated with lipopolysaccharide. However, this differentiation in the presence of As(III) strongly represses secretion of IL-12p70 and IL-23, two major regulators of Th1 and Th17 activities, from iDCs stimulated with different toll-like receptor (TLR) agonists in metalloid-free medium. Such As(III)-exposed DCs also exhibit reduced mRNA levels of IL12A and/or IL12B genes when activated with TLR agonists. Finally, differentiation of monocytes with non-cytotoxic concentrations of As(III) subsequently reduces the ability of activated DCs to stimulate the release of interferon-γ and IL-17 from Th cells. In conclusion, our results demonstrate that clinically relevant concentrations of inorganic arsenic markedly impair in vitro differentiation and functions of DCs, which may contribute to the putative beneficial effects of the metalloid towards inflammatory autoimmune diseases. Highlights: ► Inorganic arsenic impairs differentiation and functions of human dendritic cells (DCs) ► Arsenite (> 1 μM) blocks differentiation of dendritic cells by

  11. Executive function impairment in community elderly subjects with questionable dementia.

    Science.gov (United States)

    Lam, Linda C W; Lui, Victor W C; Chiu, Helen F K; Chan, Sandra S M; Tam, Cindy W C

    2005-01-01

    The neurocognitive profile of community-dwelling Chinese subjects with 'questionable' dementia was studied. One hundred and fifty-four ambulatory Chinese subjects were recruited from local social centers for the elderly. Each subject was examined using the Clinical Dementia Rating (CDR), the Cantonese version of the Mini-Mental State Examination (CMMSE), the Chinese version of the Alzheimer's Disease Assessment Scale-Cognitive Subscale (ADAS-Cog), the Category Verbal Fluency Test (CVFT), digit and visual span tests, and the Cambridge Neurological Inventory. The neurocognitive profile of nondemented subjects (CDR 0) was compared with that of subjects with 'questionable' dementia (CDR 0.5). Subjects with 'questionable' dementia were older, and had lower educational levels and global cognitive assessment scores than the controls (CMMSE and ADAS-Cog; t tests, p < 0.001). In addition, they also had significantly lower scores in delayed recall, reverse span, verbal fluency tests and worse performance in complex motor tasks related to executive function (Mann-Whitney tests, p < 0.001). Logistic regression analysis revealed that ADAS-Cog, CVFT, and reverse visual span were significant predictors for the CDR of 'questionable' dementia. Aside from memory impairment, executive function deficits were also present in subjects with 'questionable' dementia. To identify groups cognitively at risk for dementia, concomitant assessments of memory and executive function are suggested.

  12. The effect of acetaminophen on the expression of BCRP in trophoblast cells impairs the placental barrier to bile acids during maternal cholestasis

    International Nuclear Information System (INIS)

    Blazquez, Alba G.; Briz, Oscar; Gonzalez-Sanchez, Ester; Perez, Maria J.; Ghanem, Carolina I.; Marin, Jose J.G.

    2014-01-01

    Acetaminophen is used as first-choice drug for pain relief during pregnancy. Here we have investigated the effect of acetaminophen at subtoxic doses on the expression of ABC export pumps in trophoblast cells and its functional repercussion on the placental barrier during maternal cholestasis. The incubation of human choriocarcinoma cells (JAr, JEG-3 and BeWo) with acetaminophen for 48 h resulted in no significant changes in the expression and/or activity of MDR1 and MRPs. In contrast, in JEG-3 cells, BCRP mRNA, protein, and transport activity were reduced. In rat placenta, collected at term, acetaminophen administration for the last three days of pregnancy resulted in enhanced mRNA, but not protein, levels of Mrp1 and Bcrp. In fact, a decrease in Bcrp protein was found. Using in situ perfused rat placenta, a reduction in the Bcrp-dependent fetal-to-maternal bile acid transport after treating the dams with acetaminophen was found. Complete biliary obstruction in pregnant rats induced a significant bile acid accumulation in fetal serum and tissues, which was further enhanced when the mothers were treated with acetaminophen. This drug induced increased ROS production in JEG-3 cells and decreased the total glutathione content in rat placenta. Moreover, the NRF2 pathway was activated in JEG-3 cells as shown by an increase in nuclear NRF2 levels and an up-regulation of NRF2 target genes, NQO1 and HMOX-1, which was not observed in rat placenta. In conclusion, acetaminophen induces in placenta oxidative stress and a down-regulation of BCRP/Bcrp, which may impair the placental barrier to bile acids during maternal cholestasis. - Highlights: • Acetaminophen induces changes in placental BCRP expression in vitro. • This drug reduces the ability of placental cells to export BCRP substrates. • Acetaminophen induces changes in Bcrp expression in rat placenta. • Placental barrier to bile acids is impaired in rats treated with this drug

  13. The effect of acetaminophen on the expression of BCRP in trophoblast cells impairs the placental barrier to bile acids during maternal cholestasis

    Energy Technology Data Exchange (ETDEWEB)

    Blazquez, Alba G., E-mail: albamgb@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain); Briz, Oscar, E-mail: obriz@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain); Gonzalez-Sanchez, Ester, E-mail: u60343@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); Perez, Maria J., E-mail: mjperez@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); University Hospital of Salamanca, IECSCYL-IBSAL, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain); Ghanem, Carolina I., E-mail: cghanem@ffyb.uba.ar [Instituto de Investigaciones Farmacologicas, Facultad de Farmacia y Bioquimica, CONICET, Universidad de Buenos Aires, Buenos Aires (Argentina); Marin, Jose J.G., E-mail: jjgmarin@usal.es [Laboratory of Experimental Hepatology and Drug Targeting (HEVEFARM), IBSAL, University of Salamanca, Salamanca (Spain); CIBERehd, Instituto de Salud Carlos III, Madrid (Spain)

    2014-05-15

    Acetaminophen is used as first-choice drug for pain relief during pregnancy. Here we have investigated the effect of acetaminophen at subtoxic doses on the expression of ABC export pumps in trophoblast cells and its functional repercussion on the placental barrier during maternal cholestasis. The incubation of human choriocarcinoma cells (JAr, JEG-3 and BeWo) with acetaminophen for 48 h resulted in no significant changes in the expression and/or activity of MDR1 and MRPs. In contrast, in JEG-3 cells, BCRP mRNA, protein, and transport activity were reduced. In rat placenta, collected at term, acetaminophen administration for the last three days of pregnancy resulted in enhanced mRNA, but not protein, levels of Mrp1 and Bcrp. In fact, a decrease in Bcrp protein was found. Using in situ perfused rat placenta, a reduction in the Bcrp-dependent fetal-to-maternal bile acid transport after treating the dams with acetaminophen was found. Complete biliary obstruction in pregnant rats induced a significant bile acid accumulation in fetal serum and tissues, which was further enhanced when the mothers were treated with acetaminophen. This drug induced increased ROS production in JEG-3 cells and decreased the total glutathione content in rat placenta. Moreover, the NRF2 pathway was activated in JEG-3 cells as shown by an increase in nuclear NRF2 levels and an up-regulation of NRF2 target genes, NQO1 and HMOX-1, which was not observed in rat placenta. In conclusion, acetaminophen induces in placenta oxidative stress and a down-regulation of BCRP/Bcrp, which may impair the placental barrier to bile acids during maternal cholestasis. - Highlights: • Acetaminophen induces changes in placental BCRP expression in vitro. • This drug reduces the ability of placental cells to export BCRP substrates. • Acetaminophen induces changes in Bcrp expression in rat placenta. • Placental barrier to bile acids is impaired in rats treated with this drug.

  14. Structural equation modeling of motor impairment, gross motor function, and the functional outcome in children with cerebral palsy.

    Science.gov (United States)

    Park, Eun-Young; Kim, Won-Ho

    2013-05-01

    Physical therapy intervention for children with cerebral palsy (CP) is focused on reducing neurological impairments, improving strength, and preventing the development of secondary impairments in order to improve functional outcomes. However, relationship between motor impairments and functional outcome has not been proved definitely. This study confirmed the construct of motor impairment and performed structural equation modeling (SEM) between motor impairment, gross motor function, and functional outcomes of regarding activities of daily living in children with CP. 98 children (59 boys, 39 girls) with CP participated in this cross-sectional study. Mean age was 11 y 5 mo (SD 1 y 9 mo). The Manual Muscle Test (MMT), the Modified Ashworth Scale (MAS), range of motion (ROM) measurement, and the selective motor control (SMC) scale were used to assess motor impairments. Gross motor function and functional outcomes were measured using the Gross Motor Function Measure (GMFM) and the Functional Skills domain of the Pediatric Evaluation of Disability Inventory (PEDI) respectively. Measurement of motor impairment was consisted of strength, spasticity, ROM, and SMC. The construct of motor impairment was confirmed though an examination of a measurement model. The proposed SEM model showed good fit indices. Motor impairment effected gross motor function (β=-.0869). Gross motor function and motor impairment affected functional outcomes directly (β=0.890) and indirectly (β=-0.773) respectively. We confirmed that the construct of motor impairment consist of strength, spasticity, ROM, and SMC and it was identified through measurement model analysis. Functional outcomes are best predicted by gross motor function and motor impairments have indirect effects on functional outcomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Cholesterol overload impairing cerebellar function: the promise of natural products.

    Science.gov (United States)

    El-Sayyad, Hassan I H

    2015-05-01

    The cerebellum is the part of the brain most involved in controlling motor and cognitive function. The surface becomes convoluted, forming folia that have a characteristic internal structure of three layers including molecular, Purkinje cell, and granular layer. This complex neural network gives rise to a massive signal-processing capability. Cholesterol is a major constituent, derived by de novo synthesis and the blood-brain barrier. Cholesterol is tightly regulated between neurons and glia-that is, astrocytes, microglia, and oligodendrocytes-and is essential for normal brain development. The axon is wrapped by myelin (cholesterol, phospholipids, and glycosphingolipids) and made up of membranes of oligodendrocytes, separated by periodic gaps in the myelin sheath, called nodes of Ranvier. Hypercholesterolemia is associated with increased oxidative stress and the development of neurotoxicity and Alzheimer's disease. Treatment with natural products has been found to support improved brain function and reduce low-density-lipoprotein cholesterol level. Fish oil is one such product; among the many plant products are: Morus alba leaves, fruit, and bark; pomegranate fruit and peel; Barley β - glucans; date palm; and Allium sativum. The therapeutic potential was discussed in relation with the antilipidemic drugs, statins (HMG-CoA reductase inhibitors). Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Mental disorders, functional impairment, and nerve growth factor

    Directory of Open Access Journals (Sweden)

    Salles FHM

    2016-12-01

    21.0 software. NGF serum levels were increased significantly in patients with obsessive–compulsive disorder compared with patients with no obsessive–compulsive disorder (P=0.015. An increase in serum NGF levels in generalized anxiety disorder patients was observed compared with patients with no generalized anxiety disorder (P=0.047. NGF was negatively associated with autonomy (P=0.024, r=–0.136, work (P=0.040, r=–0.124, and cognition (P=0.024, r=–0.137, thereby showing that changes in serum levels of NGF are associated with functionality in mental disorders. Keywords: NGF, mental disorders, functional impairment

  17. Assessing Psychosocial Impairment in Children and Adolescents: A Review of the Barkley Functional Impairment Scale (BFIS)

    Science.gov (United States)

    McGill, Ryan J.

    2014-01-01

    Appraising psychosocial impairment is an essential enterprise of diagnostic decision-making in the field of school psychology. Despite its importance, few practitioners utilize systematic procedures when engaging in this process, despite the fact that a number of impairment measures and scales have been developed specifically for this purpose. The…

  18. Impaired proteasome function in sporadic amyotrophic lateral sclerosis.

    Science.gov (United States)

    Kabashi, Edor; Agar, Jeffrey N; Strong, Michael J; Durham, Heather D

    2012-06-01

    Abstract The ubiquitin-proteasome system, important for maintaining protein quality control, is compromised in experimental models of familial ALS. The objective of this study was to determine if proteasome function is impaired in sporadic ALS. Proteasomal activities and subunit composition were evaluated in homogenates of spinal cord samples obtained at autopsy from sporadic ALS and non-neurological control cases, compared to cerebellum as a clinically spared tissue. The level of 20S α structural proteasome subunits was assessed in motor neurons by immunohistochemistry. Catalysis of peptide substrates of the three major proteasomal activities was substantially reduced in ALS thoracic spinal cord, but not in cerebellum, accompanied by alterations in the constitutive proteasome machinery. Chymotrypsin-like activity was decreased to 60% and 65% of control in ventral and dorsal spinal cord, respectively, concomitant with reduction in the β5 subunit with this catalytic activity. Caspase- and trypsin-like activities were reduced to a similar extent (46% - 68% of control). Proteasome levels, although generally maintained, appeared reduced specifically in motor neurons by immunolabelling. In conclusion, there are commonalities of findings in sporadic ALS patients and presymptomatic SOD1-G93A transgenic mice and these implicate inadequate proteasome function in the pathogenesis of both familial and sporadic ALS.

  19. Acrolein impairs the cholesterol transport functions of high density lipoproteins.

    Science.gov (United States)

    Chadwick, Alexandra C; Holme, Rebecca L; Chen, Yiliang; Thomas, Michael J; Sorci-Thomas, Mary G; Silverstein, Roy L; Pritchard, Kirkwood A; Sahoo, Daisy

    2015-01-01

    High density lipoproteins (HDL) are considered athero-protective, primarily due to their role in reverse cholesterol transport, where they transport cholesterol from peripheral tissues to the liver for excretion. The current study was designed to determine the impact of HDL modification by acrolein, a highly reactive aldehyde found in high abundance in cigarette smoke, on the cholesterol transport functions of HDL. HDL was chemically-modified with acrolein and immunoblot and mass spectrometry analyses confirmed apolipoprotein crosslinking, as well as acrolein adducts on apolipoproteins A-I and A-II. The ability of acrolein-modified HDL (acro-HDL) to serve as an acceptor of free cholesterol (FC) from COS-7 cells transiently expressing SR-BI was significantly decreased. Further, in contrast to native HDL, acro-HDL promotes higher neutral lipid accumulation in murine macrophages as judged by Oil Red O staining. The ability of acro-HDL to mediate efficient selective uptake of HDL-cholesteryl esters (CE) into SR-BI-expressing cells was reduced compared to native HDL. Together, the findings from our studies suggest that acrolein modification of HDL produces a dysfunctional particle that may ultimately promote atherogenesis by impairing functions that are critical in the reverse cholesterol transport pathway.

  20. Innovative probabilistic risk assessment applications: barrier impairments and fracture toughness. Panel Discussion

    International Nuclear Information System (INIS)

    Osterman, Michael; Root, Steven; Li, F.; Modarres, Mohammad; Reinhart, F. Mark; Bradley, Biff; Calhoun, David J.

    2001-01-01

    Full text of publication follows: New probabilistic risk assessment (PRA) applications promise to improve the overall safety and efficiency of nuclear plant operations. This discussion will explore the use of PRA in evaluating barrier integrity with respect to the consequences of natural phenomena such as tornadoes, floods, and harsh environments. Additionally, the session will explore proposals to improve fracture toughness techniques using PRA. (authors)

  1. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation

  2. Functional Anatomy and Oncologic Barriers of the Larynx.

    Science.gov (United States)

    Mor, Niv; Blitzer, Andrew

    2015-08-01

    Laryngeal barriers to tumor spread are a product of laryngeal development, anatomic barriers, and enzymatic activity. Supraglottic and glottic/subglottic development is distinct and partially explains the metastatic behavior of laryngeal carcinoma. Dense connective tissues and elastic fibers provide anatomic barriers within the larynx. Laryngeal cartilage contains dense cartilage, enzyme inhibitors, and an intact perichondrium making it relatively resistant to tumor invasion; however, focal areas of vulnerability are created by ossified cartilage and natural interruptions in the perichondrium. Local inflammation and the enzymatic interplay between tumor and host are important factors in the spread of laryngeal tumor. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Ergonomic adjustments on a website from the usability of functions: Can deficits impair functionalities?

    Directory of Open Access Journals (Sweden)

    Dalila Giovana Pagnoncelli Laperuta

    2017-09-01

    Full Text Available Current study assesses whether deficits and usability of ergonomics impair the functionality of a university website. The concepts of functionality, usability and ergonomics were foregrounded by contextualizing them within a university profile. Later, a satisfaction survey was proposed to users to measure the satisfaction in the use of the website and to map the problems in usability. In addition, an ergonomic inspection was performed on the site by applying Bastien and Scapin´s ergonomic criteria. After analyzing results by descriptive statistics and content analysis, the ergonomic and usability problems were detected, or rather, feedback deficits, minimum action (navigation, flexibility and experience impaired the excellence of website´s functionality, causing dissatisfaction or abandonment of the website by the users. After the analysis of the results, ergonomic adjustments were suggested for the website. They may be a help in new website projects or adjust products in which usability has not been incorporated to the development process.

  4. Improving Access to Accommodations: Reducing Political and Institutional Barriers for Canadian Postsecondary Students with Visual Impairments

    Science.gov (United States)

    Ostrowski, Christopher P.

    2016-01-01

    Challenges to obtaining quality academic accommodations for students with visual impairments in postsecondary education hinder accessibility and the success of such students. The limitations of current policies and practices intended to address the needs of students in Canada are examined and potential solutions are discussed. Further systemic…

  5. Complaints about impairments in executive functions in Parkinson's disease : The association with neuropsychological assessment

    NARCIS (Netherlands)

    Koerts, Janneke; Van Beilen, Marije; Leenders, Klaus L.; Brouwer, Wiebo H.; Tucha, Lara; Tucha, Oliver

    Impairments in executive functions are frequently reported in Parkinson's disease (PD). However, little is known about patients' experience regarding these impairments. This knowledge is crucial because if patients do not experience their cognitive impairments they do not report them to their

  6. Smell and taste function in the visually impaired.

    Science.gov (United States)

    Smith, R S; Doty, R L; Burlingame, G K; McKeown, D A

    1993-11-01

    Surprisingly few quantitative studies have addressed the question of whether visually impaired individuals evidence, perhaps in compensation for their loss of vision, increased acuteness in their other senses. In this experiment we sought to determine whether blind subjects outperform sighted subjects on a number of basic tests of chemosensory function. Over 50 blind and 75 sighted subjects were administered the following olfactory and gustatory tests: the University of Pennsylvania Smell Identification Test (UPSIT); a 16-item odor discrimination test; and a suprathreshold taste test in which measures of taste-quality identification and ratings of the perceived intensity and pleasantness of sucrose, citric acid, sodium chloride, and caffeine were obtained. In addition, 39 blind subjects and 77 sighted subjects were administered a single staircase phenyl ethyl alcohol (PEA) odor detection threshold test. Twenty-three of the sighted subjects were employed by the Philadelphia Water Department and trained to serve on its water quality evaluation panel. The primary findings of the study were that (a) the blind subjects did not outperform sighted subjects on any test of chemosensory function and (b) the trained subjects significantly outperformed the other two groups on the odor detection, odor discrimination, and taste identification tests, and nearly outperformed the blind subjects on the UPSIT. The citric acid concentrations received larger pleasantness ratings from the trained panel members than from the blind subjects, whose ratings did not differ significantly from those of the untrained sighted subjects. Overall, the data imply that blindness, per se, has little influence on chemosensory function and add further support to the notion that specialized training enhances performance on a number of chemosensory tasks.

  7. Emotional functioning, barriers, and medication adherence in pediatric transplant recipients.

    Science.gov (United States)

    McCormick King, Megan L; Mee, Laura L; Gutiérrez-Colina, Ana M; Eaton, Cyd K; Lee, Jennifer L; Blount, Ronald L

    2014-04-01

    This study assessed relationships among internalizing symptoms, barriers to medication adherence, and medication adherence in adolescents with solid organ transplants. The sample included 72 adolescents who had received solid organ transplants. Multiple mediator models were tested via bootstrapping methods. Bivariate correlations revealed significant relationships between barriers and internalizing symptoms of depression, anxiety, and posttraumatic stress, as well as between internalizing symptoms and medication adherence. Barriers indicative of adaptation to the medication regimen (e.g., forgetting, lack of organization) were related to medication adherence and mediated the relationship between internalizing symptoms and medication adherence. These findings indicate that barriers may serve as a more specific factor in the relationship between more general, pervasive internalizing symptoms and medication adherence. Results may help guide areas for clinical assessment, and the focus of interventions for adolescent transplant recipients who are experiencing internalizing symptoms and/or who are nonadherent to their medication regimen.

  8. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  9. Eating disorder severity and functional impairment: moderating effects of illness duration in a clinical sample.

    Science.gov (United States)

    Davidsen, Annika Helgadóttir; Hoyt, William T; Poulsen, Stig; Waaddegaard, Mette; Lau, Marianne

    2017-09-01

    The aim was to examine duration of illness and body mass index as possible moderators of the relationship between eating disorder severity and functional impairment, as well as psychological distress as a possible mediator of this relationship. The study included 159 patients diagnosed with bulimia nervosa, binge eating disorder or eating disorder not otherwise specified. Regression analysis was applied to assess the effect of the hypothesized moderators and mediators. Eating disorder severity was measured with the Eating Disorder Examination Questionnaire, functional impairment was measured with the Sheehan Disability Scale, and psychological distress was measured with the Symptom Check List-90-R. Duration of illness and body mass index were assessed clinically. Duration of illness significantly moderated the relationship between eating disorder severity and functional impairment; the relationship was strongest for patients with a shorter duration of illness. Psychological distress partly mediated the relationship between eating disorder severity and functional impairment. Duration of illness significantly moderated the relationship between psychological distress and functional impairment; the strongest relationship was seen for patients with a shorter duration of illness. Body mass index was not a significant moderator of the relationship between ED severity and functional impairment. Overall, this study established a link between ED severity, psychological distress and functional impairment indicating that both eating disorder severity and psychological distress are more strongly related to impaired role functioning for patients with more recent onset of an eating disorder. More research in the complex relationship between ED severity and functional impairment is needed.

  10. Methamphetamine Effects on Blood-Brain Barrier Structure and Function

    Directory of Open Access Journals (Sweden)

    Nicole Alia Northrop

    2015-03-01

    Full Text Available Methamphetamine (Meth is a widely abuse psychostimulant. Traditionally, studies have focused on the neurotoxic effects of Meth on monoaminergic neurotransmitter terminals. Recently, both in vitro and in vivo studies have investigated the effects of Meth on the BBB and found that Meth produces a decrease in BBB structural proteins and an increase in BBB permeability to various molecules. Moreover, preclinical studies are validated by clinical studies in which human Meth users have increased concentrations of toxins in the brain. Therefore, this review will focus on the structural and functional disruption of the BBB caused by Meth and the mechanisms that contribute to Meth-induced BBB disruption. The review will reveal that the mechanisms by which Meth damages dopamine and serotonin terminals are similar to the mechanisms by which the blood-brain barrier (BBB is damaged. Furthermore, this review will cover the factors that are known to potentiate the effects of Meth on the BBB, such as stress and HIV, both of which are co-morbid conditions associated with Meth abuse. Overall, the goal of this review is to demonstrate that the scope of damage produced by Meth goes beyond damage to monoaminergic neurotransmitter systems to include BBB disruption as well as provide a rationale for investigating therapeutics to treat Meth-induced BBB disruption. Since a breach of the BBB can have a multitude of consequences, therapies directed towards the treatment of BBB disruption may help to ameliorate the long-term neurodegeneration and cognitive deficits produced by Meth and possibly even Meth addiction.

  11. [Functional impairment and radiologic fasciitis under erlotinib therapy].

    Science.gov (United States)

    Osdoit, S; Wierzbicka, E; Guillet, G

    2011-01-01

    Targeted molecules are recent and valuable weapons in the management of certain cancers. Among them, erlotinib is an inhibitor of epidermal growth factor receptor approved in non-small lung cancer and pancreatic cancer after failure of first line treatment. Erlotinib is responsible for many cutaneous side effects. We report a case of acute symptomatic fasciitis that has occurred during erlotinib therapy. To our knowledge it is the first case described. A 56-year-old man was treated with erlotinib for a metastatic non-small lung adenocarcinoma. Shortly after the treatment by erlotinib was introduced, he had a severe acneiform rash resistant to doxycycline treatment. After a year of treatment, he presented intense pain in the legs with functional impairment. Medical imaging confirmed fasciitis. It regressed along with the rash after using strong topical corticosteroids during ten days. Besides bacterial fasciitis, inflammatory and oedematous fasciitis have varied aetiologies. The occurrence of a documented fasciitis during anti EGFR-therapy is original and raises the question of underlying mechanism. We suggest three pathophysiological mechanisms: spreading by contiguity; paraneoplastic fasciitis, or specific lesion of the fascia due to anti-EGFR. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  12. Monocyte function is severely impaired by the fluorochrome calcein acetomethylester

    International Nuclear Information System (INIS)

    Czepluch, Frauke S.; Olieslagers, Serve J.F.; Waltenberger, Johannes

    2007-01-01

    For rapid chemotaxis quantification, cell prelabelling is often performed with the fluorochrome calcein acetomethylester (calcein AM). We investigated whether calcein AM-prelabelling is reliable for monocyte migration analysis. Human monocytes were either preexposed to calcein AM or unlabelled. Monocyte migration towards the potent chemoattractants transforming growth factor-β1 (TGF-β1) and N-formyl-Methionin-Leucin-Phenylalanin (fMLP) was assessed using a 48-well micro-chemotaxis chamber. For quantification, cells were visualized by light microscopy and counted. Surprisingly, random migration of calcein AM-prelabelled cells was significantly impaired compared to the unlabelled control. Accordingly, monocyte chemotaxis towards either TGF-β1 or fMLP dramatically declined. Adherence of calcein AM-labelled monocytes on plastic was also significantly decreased compared to control cells. As adhesion is regarded as an essential component of monocyte migration, the reduced migration observed in calcein AM-labelled monocytes might be explained by a fluorochrome-induced adhesion defect. Therefore, use of the fluorochrome calcein AM cannot be recommended for functional testing of monocytes

  13. Dexamethasone impairs hypoxia-inducible factor-1 function

    International Nuclear Information System (INIS)

    Wagner, A.E.; Huck, G.; Stiehl, D.P.; Jelkmann, W.; Hellwig-Buergel, T.

    2008-01-01

    Hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription-factor composed of α- and β-subunits. HIF-1 is not only necessary for the cellular adaptation to hypoxia, but it is also involved in inflammatory processes and wound healing. Glucocorticoids (GC) are therapeutically used to suppress inflammatory responses. Herein, we investigated whether GC modulate HIF-1 function using GC receptor (GR) possessing (HepG2) and GR deficient (Hep3B) human hepatoma cell cultures as model systems. Dexamethasone (DEX) treatment increased HIF-1α levels in the cytosol of HepG2 cells, while nuclear HIF-1α levels and HIF-1 DNA-binding was reduced. In addition, DEX dose-dependently lowered the hypoxia-induced luciferase activity in a reporter gene system. DEX suppressed the hypoxic stimulation of the expression of the HIF-1 target gene VEGF (vascular endothelial growth factor) in HepG2 cultures. DEX did not reduce hypoxically induced luciferase activity in HRB5 cells, a Hep3B derivative lacking GR. Transient expression of the GR in HRB5 cells restored the susceptibility to DEX. Our study discloses the inhibitory action of GC on HIF-1 dependent gene expression, which may be important with respect to the impaired wound healing in DEX-treated patients

  14. Aspects of studies on the functional impairment electrohypersensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Olle, E-mail: olle.johansson@ki.s [Experimental Dermatology Unit, Department of Neuroscience, Karolinska Institute, 171 77 Stockholm (Sweden); Royal Institute of Technology, 100 44 Stockholm (Sweden)

    2010-04-15

    Persons, claiming to suffer from exposure to electromagnetic fields, have been described in the literature. In Sweden, electrohypersensitivity (EHS) is an officially fully recognized functional impairment (i.e., it is not regarded as a disease). Survey studies show that somewhere between 230,000 - 290,000 Swedish men and women - out of a population of 9,000,000 - report a variety of symptoms when being in contact with electromagnetic field (EMF) sources. Swedish electrohypersensitive people have their own handicap organization, The Swedish Association for the Electrohypersensitive, which has its own website in both Swedish and English. This organization is included in the Swedish Disability Federation (Handikappfoerbundens SamarbetsOrgan; HSO). One aim of our studies has been to investigate possible alterations, in the cellular and neuronal systems of these persons' skin. In summary, it is evident from our preliminary data that various alterations are present in the electrohypersensitive persons' skin that are not indicated in the skin of normal healthy volunteers.

  15. A nuclide transfer model for barriers of the seabed repository using response function

    International Nuclear Information System (INIS)

    Lee, Youn Myoung; Kang, Chul Hyung; Hahn, Pil Soo

    1996-01-01

    A nuclide transfer by utilizing mass transfer coefficient and barrier response function defined for each barrier is proposed, by which the final nuclide transfer rate into the sea water can be evaluated. When simple and immediate quantification of the nuclide release is necessary in the conservative aspect, using this kind of approach may be advantageous since each layered barrier can be treated separately from other media in series in the repository system, making it possible to apply separate solutions in succession to other various media. Although one disadvantage is that while flux continuity can be maintained at the interface by using the exit nuclide flux from the first medium as the source flux for the next one, there may be no guarantee for concentration continuity, this problem could be eliminated assuming that there is no boundary resistance to mass transfer across the interface. Mass transfer coefficient can be determined by the assumption that the nuclide concentration gradient at the interface between adjacent barriers remains constant and barrier response function is obtained from an analytical expression for nuclide flow rate out of each barrier in response to a unit impulse into the barrier multiplied by mass transfer coefficient. Total time-dependent nuclide transfer rate from the barrier can then be obtained by convoluting the response function for the barrier with a previously calculated set of time-varying input of nuclide flow rate for the previous barrier. 18 refs., 5 figs. (author)

  16. Everyday functioning of people with Parkinson's disease and impairments in executive function: a qualitative investigation.

    Science.gov (United States)

    Kudlicka, Aleksandra; Hindle, John V; Spencer, Laura E; Clare, Linda

    2017-06-09

    Executive function is the key area of cognitive impairment in Parkinson's disease. This study investigated how cognitive difficulties impact on everyday life of people with Parkinson's disease and their carers, and whether they explicitly mention executive-type difficulties. Semistructured interviews with 11 people with Parkinson's disease and six carers were analyzed thematically. People with Parkinson's disease performed within the normal range on cognitive screening tests, but all had abnormal scores on tests of executive function. Despite relatively mild executive deficits and no global cognitive impairment, participants described executive-type difficulties as well as a range of problems in other cognitive domains, such as memory, processing speed and apathy. Cognitive difficulties had a far-reaching impact on everyday life and their significance depended on personal circumstances, such as the level of responsibilities of the person with Parkinson's disease and the extent of available support. By presenting subjective accounts of living with Parkinson's disease and cognitive difficulties, this study improves our understanding of how the observed level of cognitive impairment translates into everyday functioning. The study results have implications for recognizing cognitive difficulties and for planning support for people with Parkinson's disease and their families, and can help identify ways of promoting effective self-management. Implications for rehabilitation Treatment of Parkinson's disease tends to focus on the movement disorder, meaning that cognitive difficulties and their impact can be overlooked. Participants in this study had only relatively mild executive deficits but described a range of cognitive problems, including executive-type difficulties. Cognitive difficulties have an emotional impact and can cause a range of challenges in everyday life, adding to the burden of physical symptoms of Parkinson's disease. Results of this study provide insights

  17. Impairment in proverb interpretation as an executive function deficit in patients with amnestic mild cognitive impairment and early Alzheimer's disease.

    Science.gov (United States)

    Leyhe, Thomas; Saur, Ralf; Eschweiler, Gerhard W; Milian, Monika

    2011-01-01

    Proverb interpretation is assumed to reflect executive functions. We hypothesized that proverb interpretation is impaired in patients with amnestic mild cognitive impairment (aMCI) diagnosed as single-domain impairment by common neuropsychological testing. We compared performance in a proverb interpretation test in single-domain aMCI patients and patients with early Alzheimer's disease (EAD). The groups with aMCI and EAD performed significantly worse than healthy controls. Both patient groups gave concrete answers with a similar frequency. However, patients with EAD tended to give senseless answers more frequently. Our data suggest that in patients diagnosed as single-domain aMCI, deterioration of executive functions is detectable with subtle and appropriate neuropsychological testing. Implementation of these procedures may improve the early prediction of AD.

  18. Executive functions in mono- and bilingual children with language impairment - issues for speech-language pathology.

    OpenAIRE

    Sandgren, Olof; Holmström, Ketty

    2015-01-01

    The clinical assessment of language impairment (LI) in bilingual children imposes challenges for speech-language pathology services. Assessment tools standardized for monolingual populations increase the risk of misinterpreting bilingualism as language impairment. This Perspective article summarizes recent studies on the assessment of bilingual LI and presents new results on including nonlinguistic measures of executive functions in the diagnostic assessment. Executive functions shows clinica...

  19. Levomilnacipran Extended-Release Treatment in Patients With Major Depressive Disorder: Improvements in Functional Impairment Categories

    Science.gov (United States)

    Gommoll, Carl P.; Chen, Changzheng; Greenberg, William M.; Ruth, Adam

    2015-01-01

    Objective: In this post hoc analysis, improvement in functional impairment in patients with major depressive disorder (MDD) treated with levomilnacipran extended release (ER) was evaluated by assessing shifts from more severe to less severe functional impairment categories on individual Sheehan Disability Scale (SDS) subscales. Method: SDS data were pooled from 5 phase II/III studies conducted between December 2006 and March 2012 of levomilnacipran ER versus placebo in adult patients with MDD (DSM-IV-TR criteria). Proportions of patients shifting from moderate-extreme baseline impairment (score ≥ 4) to mild-no impairment (score ≤ 3) at end of treatment were assessed for each SDS subscale. Proportions of patients shifting from marked-extreme (score ≥ 7) baseline impairment to moderate-no (score ≤ 6) or mild-no impairment (score ≤ 3) at end of treatment, and shifts in which patients worsened from moderate-no to marked-extreme impairment, were also evaluated. Results: A significantly higher proportion of patients treated with levomilnacipran ER than placebo-treated patients improved from more severe categories of functional impairment at baseline to less severe impairment categories across all SDS subscales: work/school, social life, and family life/home responsibilities (P impairment at baseline improved to mild or no impairment, compared with no more than 40% of placebo patients on any subscale. Almost half (42%–47%) of levomilnacipran ER–treated patients versus only about one-third (29%–34%) of placebo patients improved from marked-extreme to mild or no impairment across functional domains. Conclusions: These results suggest that functional improvement was observed across the SDS functional domains. To our knowledge, this is the first such categorical analysis of functional improvement, as measured by the SDS, for an antidepressant. Trial Registration: ClinicalTrials.gov identifiers: NCT00969709, NCT01377194, NCT00969150, and NCT01034462 and Eudra

  20. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Svenson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses.

  1. Accident Analysis and Barrier Function (AEB) Method. Manual for Incident Analysis

    International Nuclear Information System (INIS)

    Svenson, Ola

    2000-02-01

    The Accident Analysis and Barrier Function (AEB) Method models an accident or incident as a series of interactions between human and technical systems. In the sequence of human and technical errors leading to an accident there is, in principle, a possibility to arrest the development between each two successive errors. This can be done by a barrier function which, for example, can stop an operator from making an error. A barrier function can be performed by one or several barrier function systems. To illustrate, a mechanical system, a computer system or another operator can all perform a given barrier function to stop an operator from making an error. The barrier function analysis consists of analysis of suggested improvements, the effectiveness of the improvements, the costs of implementation, probability of implementation, the cost of maintaining the barrier function, the probability that maintenance will be kept up to standards and the generalizability of the suggested improvement. The AEB method is similar to the US method called HPES, but differs from that method in different ways. To exemplify, the AEB method has more emphasis on technical errors than HPES. In contrast to HPES that describes a series of events, the AEB method models only errors. This gives a more focused analysis making it well suited for checking other HPES-type accident analyses. However, the AEB method is a generic and stand-alone method that has been applied in other fields than nuclear power, such as, in traffic accident analyses

  2. Mechanism of protection of transepithelial barrier function by Lactobacillus salivarius: strain dependence and attenuation by bacteriocin production.

    Science.gov (United States)

    Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W

    2012-11-01

    Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.

  3. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  4. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

  5. The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2011-01-01

    therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

  6. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  7. ROS-activated calcium signaling mechanisms regulating endothelial barrier function.

    Science.gov (United States)

    Di, Anke; Mehta, Dolly; Malik, Asrar B

    2016-09-01

    Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

    DEFF Research Database (Denmark)

    Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

    2007-01-01

    12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

  9. AKAP12 mediates barrier functions of fibrotic scars during CNS repair.

    Directory of Open Access Journals (Sweden)

    Jong-Ho Cha

    Full Text Available The repair process after CNS injury shows a well-organized cascade of three distinct stages: inflammation, new tissue formation, and remodeling. In the new tissue formation stage, various cells migrate and form the fibrotic scar surrounding the lesion site. The fibrotic scar is known as an obstacle for axonal regeneration in the remodeling stage. However, the role of the fibrotic scar in the new tissue formation stage remains largely unknown. We found that the number of A-kinase anchoring protein 12 (AKAP12-positive cells in the fibrotic scar was increased over time, and the cells formed a structure which traps various immune cells. Furthermore, the AKAP12-positive cells strongly express junction proteins which enable the structure to function as a physical barrier. In in vivo validation, AKAP12 knock-out (KO mice showed leakage from a lesion, resulting from an impaired structure with the loss of the junction complex. Consistently, focal brain injury in the AKAP12 KO mice led to extended inflammation and more severe tissue damage compared to the wild type (WT mice. Accordingly, our results suggest that AKAP12-positive cells in the fibrotic scar may restrict excessive inflammation, demonstrating certain mechanisms that could underlie the beneficial actions of the fibrotic scar in the new tissue formation stage during the CNS repair process.

  10. Progressively Disrupted Brain Functional Connectivity Network in Subcortical Ischemic Vascular Cognitive Impairment Patients.

    Science.gov (United States)

    Sang, Linqiong; Chen, Lin; Wang, Li; Zhang, Jingna; Zhang, Ye; Li, Pengyue; Li, Chuanming; Qiu, Mingguo

    2018-01-01

    Cognitive impairment caused by subcortical ischemic vascular disease (SIVD) has been elucidated by many neuroimaging studies. However, little is known regarding the changes in brain functional connectivity networks in relation to the severity of cognitive impairment in SIVD. In the present study, 20 subcortical ischemic vascular cognitive impairment no dementia patients (SIVCIND) and 20 dementia patients (SIVaD) were enrolled; additionally, 19 normal controls were recruited. Each participant underwent a resting-state functional MRI scan. Whole-brain functional networks were analyzed with graph theory and network-based statistics (NBS) to study the functional organization of networks and find alterations in functional connectivity among brain regions. After adjustments for age, gender, and duration of formal education, there were significant group differences for two network functional organization indices, global efficiency and local efficiency, which decreased (NC > SIVCIND > SIVaD) as cognitive impairment worsened. Between-group differences in functional connectivity (NBS corrected, p  impairment worsened, with an increased number of decreased connections between brain regions. We also observed more reductions in nodal efficiency in the prefrontal and temporal cortices for SIVaD than for SIVCIND. These findings indicated a progressively disrupted pattern of the brain functional connectivity network with increased cognitive impairment and showed promise for the development of reliable biomarkers of network metric changes related to cognitive impairment caused by SIVD.

  11. Tests of potential functional barriers for laminated multilayer food packages. Part I: Low molecular weight permeants.

    Science.gov (United States)

    Simal-Gándara, J; Sarria-Vidal, M; Koorevaar, A; Rijk, R

    2000-08-01

    The advent of the functional barrier concept in food packaging has brought with it a requirement for fast tests of permeation through potential barrier materials. In such tests it would be convenient for both foodstuffs and materials below the functional barrier (sub-barrier materials) to be represented by standard simulants. By means of inverse gas chromatography, liquid paraffin spiked with appropriate permeants was considered as a potential simulant of sub-barrier materials based on polypropylene (PP) or similar polyolefins. Experiments were performed to characterize the kinetics of the permeation of low molecular weight model permeants (octene, toluene and isopropanol) from liquid paraffin, through a surrogate potential functional barrier (25 microns-thick oriented PP) into the food stimulants olive oil and 3% (w/v) acetic acid. These permeation results were interpreted in terms of three permeation kinetic models regarding the solubility of a particular model permeant in the post-barrier medium (i.e. the food simulant). The results obtained justify the development and evaluation of liquid sub-barrier simulants that would allow flexible yet rigorous testing of new laminated multilayer packaging materials.

  12. Barriers to the Use of Computer Assistive Technology among Students with Visual Impairment in Ghana: The Case of Akropong School for the Blind

    Science.gov (United States)

    Ampratwum, Joseph; Offei, Yaw Nyadu; Ntoaduro, Afua

    2016-01-01

    The study aimed at exploring barriers to the use of computer assistive technology among students with visual impairment at Akropong School for the Blind. A case study design was adopted and the purposive sampling technique used to select 35 participants for the study. The researchers gathered qualitative data using an in-depth interview guide to…

  13. Recycling Energy to Restore Impaired Ankle Function during Human Walking

    NARCIS (Netherlands)

    Collins, S.H.; Kuo, A.D.

    2010-01-01

    Background: Humans normally dissipate significant energy during walking, largely at the transitions between steps. The ankle then acts to restore energy during push-off, which may be the reason that ankle impairment nearly always leads to poorer walking economy. The replacement of lost energy is

  14. Respiratory symptoms and lung function impairment in underground ...

    African Journals Online (AJOL)

    Background: This is the first study in Ghana in the Obuasi gold mines where the silica content of the respirable dust is 10%, less than in previously studied gold mines, with only 23% of the miners having ever smoked. Objectives: The study was to assess the prevalence of respiratory impairment in the Ghanaian gold miner ...

  15. Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning.

    NARCIS (Netherlands)

    Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W.A.

    2001-01-01

    Compromising alterations in gastrointestinal architecture are common during the weaning transition of pigs. The relation between villous atrophy and epithelial barrier function at weaning is not well understood. This study evaluated in vitro transepithelial transport by Ussing metabolic chambers,

  16. Glucagon-like peptide-2 protects impaired intestinal mucosal barriers in obstructive jaundice rats.

    Science.gov (United States)

    Chen, Jun; Dong, Jia-Tian; Li, Xiao-Jing; Gu, Ye; Cheng, Zhi-Jian; Cai, Yuan-Kun

    2015-01-14

    To observe the protective effect of glucagon-like peptide-2 (GLP-2) on the intestinal barrier of rats with obstructive jaundice and determine the possible mechanisms of action involved in the protective effect. Thirty-six Sprague-Dawley rats were randomly divided into a sham operation group, an obstructive jaundice group, and a GLP-2 group; each group consisted of 12 rats. The GLP-2 group was treated with GLP-2 after the day of surgery, whereas the other two groups were treated with the same concentration of normal saline. Alanine aminotransferase (ALT), total bilirubin, and endotoxin levels were recorded at 1, 3, 7, 10 and 14 d. Furthermore, on the 14(th) day, body weight, the wet weight of the small intestine, pathological changes of the small intestine and the immunoglobulin A (IgA) expressed by plasma cells located in the small intestinal lamina propria were recorded for each group. In the rat model, jaundice was obvious, and the rats' activity decreased 4-6 d post bile duct ligation. Compared with the sham operation group, the obstructive jaundice group displayed increased yellow staining of abdominal visceral serosa, decreased small intestine wet weight, thinning of the intestinal muscle layer and villi, villous atrophy, uneven height, fusion, partial villous epithelial cell shedding, substantial inflammatory cell infiltration and significantly reduced IgA expression. However, no significant gross changes were noted between the GLP-2 and sham groups. With time, the levels of ALT, endotoxin and bilirubin in the GLP-2 group were significantly increased compared with the sham group (P jaundice group than in the GLP-2 group (P jaundice rats, which might be attributed to increased intestinal IgA and reduced bilirubin and endotoxin.

  17. Telephone Crisis Support Workers' Intentions to Use Recommended Skills While Experiencing Functional Impairment.

    Science.gov (United States)

    Kitchingman, Taneile A; Wilson, Coralie J; Woodward, Alan; Caputi, Peter; Wilson, Ian

    2018-05-01

    Empathic engagement with distressed others can lead to elevated symptoms of psychological distress and functional impairment, which preclude helping professionals' delivery of optimal patient care. Whether telephone crisis support workers are impacted in a similar way is not currently reported in the literature. This study examined the relationship between functional impairment and intentions to use recommended support skills in a representative national sample of 210 telephone crisis support workers. Participants completed an online survey including measures of functional impairment and intentions to use recommended telephone crisis support skills with callers reporting suicidal ideation, symptoms of depression, and anxiety. As a group, participants who experienced greater functional impairment during the past month reported significantly lower intentions to use recommended support skills with callers than those who reported lower functional impairment. Future research is needed to clarify the extent to which results generalize to telephone crisis support workers from other organizations. Results warrant further research to (a) identify determinants of telephone crisis support workers' functional impairment, and (b) for the deliberate management of telephone crisis support workers' functional impairment through developing and/or modifying existing service strategies to optimize workers' psychological well-being and delivery of support to callers.

  18. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  19. Nanofiber mat spinal cord dressing-released glutamate impairs blood-spinal cord barrier

    Directory of Open Access Journals (Sweden)

    Dorota Sulejczak

    2016-12-01

    Full Text Available An excessive glutamate level can result in excitotoxic damage and death of central nervous system (CNS cells, and is involved in the pathogenesis of many CNS diseases. It may also be related to a failure of the blood-spinal cord barrier (BSCB. This study was aimed at examining the effects of extended administration of monosodium glutamate on the BSCB and spinal cord cells in adult male Wistar rats. The glutamate was delivered by subarachnoidal application of glutamate-carrying electrospun nanofiber mat dressing at the lumbar enlargement level. Half of the rats with the glutamate-loaded mat application were treated systemically with the histone deacetylase inhibitor valproic acid. A group of intact rats and a rat group with subarachnoidal application of an ‘empty’ (i.e., carrying no glutamate nanofiber mat dressing served as controls. All the rats were euthanized three weeks later and lumbar fragments of their spinal cords were harvested for histological, immunohistochemical and ultrastructural studies. The samples from controls revealed normal parenchyma and BSCB morphology, whereas those from rats with the glutamate-loaded nanofiber mat dressing showed many intraparenchymal microhemorrhages of variable sizes. The capillaries in the vicinity of the glutamate-carrying dressing (in the meninges and white matter alike were edematous and leaky, and their endothelial cells showed degenerative changes: extensive swelling, enhanced vacuo­lization and the presence of vascular intraluminal projections. However, endothelial tight junctions were generally well preserved. Some endothelial cells were dying by necrosis or apoptosis. The adjacent parenchyma showed astrogliosis with astrocytic hypertrophy and swelling of perivascular astrocytic feet. Neurons in the parenchyma revealed multiple symptoms of degeneration, including, inter alia, perikaryal, dendritic and axonal swelling, and destruction of organelles. All the damage symptoms were slightly less

  20. The Deletion of Endothelial Sodium Channel α (αENaC Impairs Endothelium-Dependent Vasodilation and Endothelial Barrier Integrity in Endotoxemia in Vivo

    Directory of Open Access Journals (Sweden)

    Magdalena Sternak

    2018-04-01

    Full Text Available The role of epithelial sodium channel (ENaC activity in the regulation of endothelial function is not clear. Here, we analyze the role of ENaC in the regulation of endothelium-dependent vasodilation and endothelial permeability in vivo in mice with conditional αENaC subunit gene inactivation in the endothelium (endo-αENaCKO mice using unique MRI-based analysis of acetylcholine-, flow-mediated dilation and vascular permeability. Mice were challenged or not with lipopolysaccharide (LPS, from Salmonella typhosa, 10 mg/kg, i.p.. In addition, changes in vascular permeability in ex vivo organs were analyzed by Evans Blue assay, while changes in vascular permeability in perfused mesenteric artery were determined by a FITC-dextran-based assay. In basal conditions, Ach-induced response was completely lost, flow-induced vasodilation was inhibited approximately by half but endothelial permeability was not changed in endo-αENaCKO vs. control mice. In LPS-treated mice, both Ach- and flow-induced vasodilation was more severely impaired in endo-αENaCKO vs. control mice. There was also a dramatic increase in permeability in lungs, brain and isolated vessels as evidenced by in vivo and ex vivo analysis in endotoxemic endo-αENaCKO vs. control mice. The impaired endothelial function in endotoxemia in endo-αENaCKO was associated with a decrease of lectin and CD31 endothelial staining in the lung as compared with control mice. In conclusion, the activity of endothelial ENaC in vivo contributes to endothelial-dependent vasodilation in the physiological conditions and the preservation of endothelial barrier integrity in endotoxemia.

  1. Inhibition of Murine Pulmonary Microvascular Endothelial Cell Apoptosis Promotes Recovery of Barrier Function under Septic Conditions

    Directory of Open Access Journals (Sweden)

    Lefeng Wang

    2017-01-01

    Full Text Available Sepsis is characterized by injury of the pulmonary microvasculature and the pulmonary microvascular endothelial cells (PMVEC, leading to barrier dysfunction and acute respiratory distress syndrome (ARDS. Our recent work identified a strong correlation between PMVEC apoptosis and microvascular leak in septic mice in vivo, but the specific role of apoptosis in septic PMVEC barrier dysfunction remains unclear. Thus, we hypothesize that PMVEC apoptosis is likely required for PMVEC barrier dysfunction under septic conditions in vitro. Septic stimulation (mixture of tumour necrosis factor α, interleukin 1β, and interferon γ [cytomix] of isolated murine PMVEC resulted in a significant loss of barrier function as early as 4 h after stimulation, which persisted until 24 h. PMVEC apoptosis, as reflected by caspase activation, DNA fragmentation, and loss of membrane polarity, was first apparent at 8 h after cytomix. Pretreatment of PMVEC with the pan-caspase inhibitor Q-VD significantly decreased septic PMVEC apoptosis and was associated with reestablishment of PMVEC barrier function at 16 and 24 h after stimulation but had no effect on septic PMVEC barrier dysfunction over the first 8 h. Collectively, our data suggest that early septic murine PMVEC barrier dysfunction driven by proinflammatory cytokines is not mediated through apoptosis, but PMVEC apoptosis contributes to late septic PMVEC barrier dysfunction.

  2. Cognitive Impairment in MS Linked to Structural and Functional Connectivity

    Science.gov (United States)

    2016-10-01

    Weinstock-Guttman B, Zivadinov R. Memory impairment in multiple sclerosis: correlation with deep grey matter and mesial temporal atrophy. J Neurol...2277-2284. 10. Bunce D, Bielak AA, Cherbuin N, Batterham PJ, Wen W, Sachdev P, Anstey KJ. Utility of Intraindividual Reaction Time Variability to...Christensen H, Dear K, Wen W, Sachdev P. White matter hyperintensities and within-person variability in community-dwelling adults aged 60-64 years

  3. Recycling energy to restore impaired ankle function during human walking.

    Directory of Open Access Journals (Sweden)

    Steven H Collins

    Full Text Available BACKGROUND: Humans normally dissipate significant energy during walking, largely at the transitions between steps. The ankle then acts to restore energy during push-off, which may be the reason that ankle impairment nearly always leads to poorer walking economy. The replacement of lost energy is necessary for steady gait, in which mechanical energy is constant on average, external dissipation is negligible, and no net work is performed over a stride. However, dissipation and replacement by muscles might not be necessary if energy were instead captured and reused by an assistive device. METHODOLOGY/PRINCIPAL FINDINGS: We developed a microprocessor-controlled artificial foot that captures some of the energy that is normally dissipated by the leg and "recycles" it as positive ankle work. In tests on subjects walking with an artificially-impaired ankle, a conventional prosthesis reduced ankle push-off work and increased net metabolic energy expenditure by 23% compared to normal walking. Energy recycling restored ankle push-off to normal and reduced the net metabolic energy penalty to 14%. CONCLUSIONS/SIGNIFICANCE: These results suggest that reduced ankle push-off contributes to the increased metabolic energy expenditure accompanying ankle impairments, and demonstrate that energy recycling can be used to reduce such cost.

  4. Brain injury impairs working memory and prefrontal circuit function

    Directory of Open Access Journals (Sweden)

    Colin James Smith

    2015-11-01

    Full Text Available More than 2.5 million Americans suffer a traumatic brain injury (TBI each year. Even mild to moderate traumatic brain injury causes long-lasting neurological effects. Despite its prevalence, no therapy currently exists to treat the underlying cause of cognitive impairment suffered by TBI patients. Following lateral fluid percussion injury (LFPI, the most widely used experimental model of TBI, we investigated alterations in working memory and excitatory/inhibitory synaptic balance in the prefrontal cortex. LFPI impaired working memory as assessed with a T-maze behavioral task. Field excitatory postsynaptic potentials recorded in the prefrontal cortex were reduced in slices derived from brain-injured mice. Spontaneous and miniature excitatory postsynaptic currents onto layer 2/3 neurons were more frequent in slices derived from LFPI mice while inhibitory currents onto layer 2/3 neurons were smaller after LFPI. Additionally, an increase in action potential threshold and concomitant decrease in firing rate was observed in layer 2/3 neurons in slices from injured animals. Conversely, no differences in excitatory or inhibitory synaptic transmission onto layer 5 neurons were observed; however, layer 5 neurons demonstrated a decrease in input resistance and action potential duration after LFPI. These results demonstrate synaptic and intrinsic alterations in prefrontal circuitry that may underlie working memory impairment caused by TBI.

  5. A functional approach to cerebral visual impairments in very preterm/very-low-birth-weight children

    NARCIS (Netherlands)

    Geldof, C.J.A.; van Wassenaer-Leemhuis, A.G.; Dik, M.; Kok, J.H.; Oosterlaan, J.

    2015-01-01

    Background:Cerebral visual impairment (CVI) is a major cause of visual impairment, with very preterm birth/very low birth weight (VP/VLBW) being a major risk factor. There is no generally accepted definition of CVI. This study aims to investigate the usefulness of an empirically-based functional

  6. A functional approach to cerebral visual impairments in very preterm/very-low-birth-weight children

    NARCIS (Netherlands)

    Geldof, Christiaan J. A.; van Wassenaer-Leemhuis, Aleid G.; Dik, Marjolein; Kok, Joke H.; Oosterlaan, Jaap

    2015-01-01

    Cerebral visual impairment (CVI) is a major cause of visual impairment, with very preterm birth/very low birth weight (VP/VLBW) being a major risk factor. There is no generally accepted definition of CVI. This study aims to investigate the usefulness of an empirically-based functional definition of

  7. Mental disorders and personality traits as determinants of impaired work functioning

    NARCIS (Netherlands)

    Michon, H. W. C.; ten Have, M.; Kroon, H.; van Weeghel, J.; de Graaf, R.; Schene, A. H.

    2008-01-01

    Background. Both mental disorders and personality characteristics are associated with impaired work functioning, but these determinants have not yet been studied together. The aim of this paper is to examine the impairing effects that mental disorders and personality characteristics (i.e.

  8. Procedures and Tools Used by Teachers When Completing Functional Vision Assessments with Children with Visual Impairments

    Science.gov (United States)

    Kaiser, Justin T.; Herzberg, Tina S.

    2017-01-01

    Introduction: This study analyzed survey responses from 314 teachers of students with visual impairments regarding the tools and procedures used in completing functional vision assessments (FVAs). Methods: Teachers of students with visual impairments in the United States and Canada completed an online survey during spring 2016. Results: The…

  9. Impact of Sensory Impairments on Functional Disability in Adults With Arthritis

    Science.gov (United States)

    Fisher, Diana E.; Ward, Michael M.; Hoffman, Howard J.; Li, Chuan-Ming; Cotch, Mary Frances

    2015-01-01

    Introduction Mobility is reduced in people with sensory impairments and those with arthritis. The joint impact of these conditions may be underappreciated. This study examines the associations between impairments in vision, hearing, and balance and functional ability in adults with versus without arthritis. Methods Using National Health and Nutrition Examination Survey data from 1999–2004, arthritis status, functional ability, and sensory impairments (vision, hearing, and balance) were assessed from self-reported responses by 6,654 individuals aged ≥50 years (mean age, 63.4 years; 46.3% male). Multivariable regression analyses, conducted in 2014, assessed the associations between sensory impairment and arthritis on functional ability and mobility. Results Among study participants, 41.8% reported having arthritis; of these, 27.1%, 44.9%, and 35.1% reported impaired vision, hearing, or balance, respectively. Having multiple sensory impairments was significantly associated with reduced functional ability in people with arthritis; individuals with three sensory impairments reported the highest levels of disability for all functional domains (compared with no impairment; lower extremity mobility, 80.2% vs 39.1%; general physical activities, 94.7% vs 75.9%; activities of daily living, 69.7% vs 27.2%; instrumental activities of daily living, 77.2% vs 37.4%; leisure and social activities, 66.3% vs 30.6%; impaired gait speed, 48.1% vs 16.3%; all parthritis, had the greatest impact on mobility, with odds of impaired mobility at least twice as high as for individuals without arthritis. Conclusions Addressing sensory deficits, especially difficulties with vision, may improve functional ability, which may be particularly helpful for adults with arthritis. PMID:26410186

  10. Diabetes Mellitus-Associated Functional Hypercortisolism Impairs Sexual Function in Male Late-Onset Hypogonadism.

    Science.gov (United States)

    Tirabassi, G; Corona, G; Lamonica, G R; Lenzi, A; Maggi, M; Balercia, G

    2016-01-01

    Functional hypercortisolism is generated by conditions able to chronically activate hypothalamic-pituitary-adrenal axis and has been proven to have a negative role in several complications. However, no study has evaluated the possible influence of diabetes mellitus-associated functional hypercortisolism on male hypogonadism and sexual function. We aimed to identify any association of hypothalamic-pituitary-adrenal axis dysregulation measures with testosterone and sexual function in men simultaneously affected by diabetes mellitus and late-onset hypogonadism. Fifteen diabetes mellitus and late-onset hypogonadism subjects suffering from functional hypercortisolism and fifteen diabetes mellitus and late-onset hypogonadism subjects who were free of functional hypercortisolism were retrospectively reviewed. Clinical, hormonal, and sexual parameters were considered. Hypercortisolemic subjects showed higher values of body mass index, waist, and glycated hemoglobin and lower ones of testosterone compared to normocortisolemic ones. All sexual parameters, except for orgasmic function, were significantly worse in hypercortisolemic than in normocortisolemic subjects. Hypercortisolemic patients showed higher values of cortisol after dexamethasone and urinary free cortisol as well as a lesser ACTH response after corticotropin releasing hormone test (ACTH area under curve) compared to normocortisolemic ones. No significant association was found at Poisson regression analysis between hormonal and sexual variables in normocortisolemic patients. In hypercortisolemic subjects, negative and significant associations of cortisol response after corticotropin releasing hormone (cortisol area under curve) with erectile function (β: -0.0008; p: 0.015) and total international index of erectile function score (β: -0.0006; p: 0.001) were evident. This study suggests for the first time the impairing influence of the dysregulated hypothalamic-pituitary-adrenal axis on sexual function in

  11. Preserved otolith organ function in caspase-3-deficient mice with impaired horizontal semicircular canal function.

    Science.gov (United States)

    Armstrong, Patrick A; Wood, Scott J; Shimizu, Naoki; Kuster, Kael; Perachio, Adrian; Makishima, Tomoko

    2015-06-01

    Genetically engineered mice are valuable models for elucidation of auditory and vestibular pathology. Our goal was to establish a comprehensive vestibular function testing system in mice using: (1) horizontal angular vestibulo-ocular reflex (hVOR) to evaluate semicircular canal function and (2) otolith-ocular reflex (OOR) to evaluate otolith organ function and to validate the system by characterizing mice with vestibular dysfunction. We used pseudo off-vertical axis rotation to induce an otolith-only stimulus using a custom-made centrifuge. For the OOR, horizontal slow-phase eye velocity and vertical eye position were evaluated as a function of acceleration. Using this system, we characterized hVOR and OOR in the caspase-3 (Casp3) mutant mice. Casp3 (-/-) mice had severely impaired hVOR gain, while Casp3 (+/-) mice had an intermediate response compared to WT mice. Evaluation of OOR revealed that at low-to-mid frequencies and stimulus intensity, Casp3 mutants and WT mice had similar responses. At higher frequencies and stimulus intensity, the Casp3 mutants displayed mildly reduced otolith organ-related responses. These findings suggest that the Casp3 gene is important for the proper function of the semicircular canals but less important for the otolith organ function.

  12. Preserved otolith organ function in caspase-3 deficient mice with impaired horizontal semicircular canal function

    Science.gov (United States)

    Armstrong, Patrick A; Wood, Scott J; Shimizu, Naoki; Kuster, Kael; Perachio, Adrian; Makishima, Tomoko

    2015-01-01

    Genetically engineered mice are valuable models for elucidation of auditory and vestibular pathology. Our goal was to establish a comprehensive vestibular function testing system in mice using: 1) horizontal angular vestibular-ocular reflex (hVOR) to evaluate semicircular canal function, and 2) otolith-ocular reflex (OOR) to evaluate otolith organ function, and to validate the system by characterizing mice with vestibular dysfunction. We used pseudo-off vertical axis rotation (pOVAR) to induce an otolith-only stimulus using a custom-made centrifuge. For the OOR, horizontal slow phase eye velocity (HEV) and vertical eye position (VEP) was evaluated as a function of acceleration. Using this system, we characterized hVOR and OOR in the caspase-3 (Casp3) mutant mice. Casp3 −/− mice had severely impaired hVOR gain, while Casp3 +/− mice had an intermediate response compared to WT mice. Evaluation of OOR revealed that at low to mid frequencies and stimulus intensity, Casp3 mutants and WT mice had similar responses. At higher frequencies and stimulus intensity, the Casp3 mutants displayed mildly reduced otolith organ related responses. These findings suggest that the Casp3 gene is important for the proper function of the semicircular canals but less important for the otolith organ function. PMID:25827332

  13. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  14. Susceptibility of functional impairment scales to noncredible responses in the clinical evaluation of adult ADHD.

    Science.gov (United States)

    Fuermaier, Anselm B M; Tucha, Oliver; Koerts, Janneke; Butzbach, Marah; Weisbrod, Matthias; Aschenbrenner, Steffen; Tucha, Lara

    2018-05-01

    A growing body of research questions the reliance of symptom self-reports in the clinical evaluation of attention-deficit/hyperactivity disorder (ADHD) in adulthood. A recent study suggested that also impairment reports are vulnerable to noncredible responses, as derived from a simulation design using a global functional impairment scale. The present study aims to add evidence to this issue, by using an ADHD specific impairment scale in a simulation design on large samples. Impairment ratings on the Weiss Functional Impairment Rating Scale (WFIRS) of 62 patients with ADHD were compared to 142 healthy individuals who were instructed to show normal behavior. Furthermore, impairment ratings of patients with ADHD were compared to ratings of 330 healthy individuals who were randomly assigned to one of four simulation conditions that were instructed to complete the scale as if they had ADHD. Patients with ADHD reported higher levels of impairment than the healthy control group in all domains of life. Furthermore, individuals instructed to feign ADHD indicated higher levels of impairments in most domains of life compared to control participants and genuine patients with ADHD. The group differences between individuals feigning ADHD and individuals with genuine ADHD, however, were only small to moderate. Further analyses revealed that the WFRIS was not useful to successfully differentiate genuine from feigned ADHD. The present study confirms the conclusion that self-reported impairments are susceptible to noncredible responses and should be used with caution in the clinical evaluation of adult ADHD.

  15. Families' perception of children / adolescents with language impairment through the International Classification of Functioning, Disability, and Health (ICF-CY).

    Science.gov (United States)

    Ostroschi, Daniele Theodoro; Zanolli, Maria de Lurdes; Chun, Regina Yu Shon

    2017-05-22

    To investigate the perception of family members regarding linguistic conditions and social participation of children and adolescents with speech and language impairments using the International Classification of Functioning, Disability and Health - Children and Youth Version (ICF-CY). Quali-quantitative approach research, in which a survey of medical records of 24 children/adolescents undergoing speech-language therapy and interviews with their family members was conducted. A descriptive analysis of the participants' profiles was performed, followed by a categorization of responses using the ICF-CY. All family members mentioned various aspects of speech/language categorized by the ICF-CY. Initially, they approached it as an organic issue, categorized under the component of Body Functions and Structures. Most reported different repercussions of the speech-language impairments on the domains, such as dealing with stress and speaking, qualified from mild to severe. Participants reported Environmental Factors categorized as facilitators in the immediate family's attitudes and as barriers in the social attitudes. These findings, according to the use of the ICF-CY, demonstrate that the children/adolescents' speech-language impairments, from the families' perception, are primarily understood in the body dimension. However, guided by a broader approach to health, the findings in the Activities and Participation and Environmental Factors demonstrate a broader understanding of the participants of the speech-language impairments. The results corroborate the importance of using the ICF-CY as a health care analysis tool, by incorporating functionality and participation aspects and providing subsidies for the construction of unique therapeutic projects in a broader approach to the health of the group studied.

  16. Persistent pain, sensory disturbances and functional impairment after adjuvant chemotherapy for breast cancer

    DEFF Research Database (Denmark)

    Andersen, Kenneth Geving; Jensen, Maj-Britt; Kehlet, Henrik

    2012-01-01

    (CEF) and cyclophosphamide and epirubicin + docetaxel (CE + T) in relation to PPBCT, sensory disturbances, peripheral sensory disturbances and functional impairment. Material and methods. A comparative nationwide cross-sectional questionnaire study on two cohorts treated with CEF respectively CE + T...

  17. Language and executive functioning in the context of specific language impairment and bilingualism

    NARCIS (Netherlands)

    Laloi, A.

    2015-01-01

    The present thesis has investigated how French-speaking monolingual and bilingual children with SLI (specific language impairment) performed on various tasks examining language and executive functioning (EF) abilities, in comparison to monolingual and bilingual peers without SLI. Language was

  18. Does Impaired Gallbladder Function Contribute to the Development of Barrett's Esophagus and Esophageal Adenocarcinoma?

    LENUS (Irish Health Repository)

    Nassr, Ayman O

    2011-06-01

    Esophageal adenocarcinoma is aetiologically associated with gastro-esophageal reflux, but the mechanisms responsible for the metaplasia-dysplasia sequence are unknown. Bile components are implicated. Impaired gallbladder function may contribute to duodenogastric reflux (DGR) and harmful GERD.

  19. Hypersexual behavior in an online sample of males: associations with personal distress and functional impairment.

    Science.gov (United States)

    Spenhoff, Miriam; Kruger, Tillmann H C; Hartmann, Uwe; Kobs, Julia

    2013-12-01

    The population of individuals reporting hypersexual behavior is heterogeneous. Prior research has implicated the importance of personal distress and functional impairment, as both may serve as indicators of problem severity and relevance. Still, little is known about associations with distress and impairment following hypersexuality. The purpose of this study was to investigate personal distress and functional impairment in a community sample of male self-identified "sex addicts" and to explore the associations with related variables. Three hundred forty-nine men completed an online survey that included questions about personal distress, functional impairment, motivation for behavior change, type of hypersexual behaviors, time spent on sexual behavior, and progression of sexual urges. The survey included the Sexual Addiction Screening Test-Revised (SAST-R) core. Specific survey questions about personal distress and functional impairment in six life areas were used to assess these variables. Chi-square and P-values were calculated to explore the interrelations among them. There were 75.3% (N = 253) who reported feeling distressed due to hypersexual behavior. Functional impairment in at least one life area was specified by 77.4% (N = 270), and most participants (56.2%) reported impairment regarding partner relationships. Personal distress and functional impairment in three areas were associated with a strong motivation for behavior change. Distress was associated with online pornography use, masturbation, and/or sexual contact with changing partners. The progression of sexual urges was related to distress, while time spent on sexual behavior was not. There were 92.9% of the distressed participants who scored above the SAST-R core scale cut-off, but also 59.0% of the participants with little or no distress scored in this range. Results underline the particular role of problems in social or intimate relationships in association with hypersexuality. Clustering

  20. Functional Impairment: An Unmeasured Marker of Medicare Costs for Postacute Care of Older Adults.

    Science.gov (United States)

    Greysen, S Ryan; Stijacic Cenzer, Irena; Boscardin, W John; Covinsky, Kenneth E

    2017-09-01

    To assess the effects of preadmission functional impairment on Medicare costs of postacute care up to 365 days after hospital discharge. Longitudinal cohort study. Health and Retirement Study (HRS). Nationally representative sample of 16,673 Medicare hospitalizations of 8,559 community-dwelling older adults from 2000 to 2012. The main outcome was total Medicare costs in the year after hospital discharge, assessed according to Medicare claims data. The main predictor was functional impairment (level of difficulty or dependence in activities of daily living (ADLs)), determined from HRS interview preceding hospitalization. Multivariable linear regression was performed, adjusted for age, race, sex, income, net worth, and comorbidities, with clustering at the individual level to characterize the association between functional impairment and costs of postacute care. Unadjusted mean Medicare costs for 1 year after discharge increased with severity of impairment in a dose-response fashion (P < .001 for trend); 68% had no functional impairment ($25,931), 17% had difficulty with one ADL ($32,501), 7% had dependency in one ADL ($39,928), and 8% had dependency in two or more ADLs ($45,895). The most severely impaired participants cost 77% more than those with no impairment; adjusted analyses showed attenuated effect size (33% more) but no change in trend. Considering costs attributable to comorbidities, only three conditions were more expensive than severe functional impairment (lymphoma, metastatic cancer, paralysis). Functional impairment is associated with greater Medicare costs for postacute care and may be an unmeasured but important marker of long-term costs that cuts across conditions. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

  1. Functional impairment in patients with major depressive disorder: the 2-year PERFORM study.

    Science.gov (United States)

    Hammer-Helmich, Lene; Haro, Josep Maria; Jönsson, Bengt; Tanguy Melac, Audrey; Di Nicola, Sylvie; Chollet, Julien; Milea, Dominique; Rive, Benoît; Saragoussi, Delphine

    2018-01-01

    The Prospective Epidemiological Research on Functioning Outcomes Related to Major depressive disorder (PERFORM) study describes the course of depressive symptoms, perceived cognitive symptoms, and functional impairment over 2 years in outpatients with major depressive disorder (MDD) and investigates the patient-related factors associated with functional impairment. This was a 2-year observational study in 1,159 outpatients with MDD aged 18-65 years who were either initiating antidepressant monotherapy or undergoing their first switch of antidepressant. Functional impairment was assessed by the Sheehan Disability Scale and the Work Productivity and Activity Impairment questionnaire. Patients assessed depression severity using the nine-item Patient Health Questionnaire and severity of perceived cognitive symptoms using the five-item Perceived Deficit Questionnaire. To investigate which patient-related factors were associated with functional impairment, univariate analyses of variance were performed to identify relevant factors that were then included in multivariate analyses of covariance at baseline, month 2, months 6 and 12 combined, and months 18 and 24 combined. The greatest improvement in depressive symptoms, perceived cognitive symptoms, and functional impairment was seen immediately (within 2 months) following initiation or switch of antidepressant therapy, followed by more gradual improvement and long-term stabilization. Improvement in perceived cognitive symptoms was less marked than improvement in depressive symptoms during the acute treatment phase. Functional impairment in patients with MDD was not only associated with severity of depressive symptoms but also independently associated with severity of perceived cognitive symptoms when adjusted for depression severity throughout the 2 years of follow-up. These findings highlight the burden of functional impairment in MDD and the importance of recognizing and managing cognitive symptoms in daily practice.

  2. The Drosophila blood-brain barrier: Development and function of a glial endothelium

    Directory of Open Access Journals (Sweden)

    Stefanie eLimmer

    2014-11-01

    Full Text Available The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  3. The Drosophila blood-brain barrier: development and function of a glial endothelium.

    Science.gov (United States)

    Limmer, Stefanie; Weiler, Astrid; Volkenhoff, Anne; Babatz, Felix; Klämbt, Christian

    2014-01-01

    The efficacy of neuronal function requires a well-balanced extracellular ion homeostasis and a steady supply with nutrients and metabolites. Therefore, all organisms equipped with a complex nervous system developed a so-called blood-brain barrier, protecting it from an uncontrolled entry of solutes, metabolites or pathogens. In higher vertebrates, this diffusion barrier is established by polarized endothelial cells that form extensive tight junctions, whereas in lower vertebrates and invertebrates the blood-brain barrier is exclusively formed by glial cells. Here, we review the development and function of the glial blood-brain barrier of Drosophila melanogaster. In the Drosophila nervous system, at least seven morphologically distinct glial cell classes can be distinguished. Two of these glial classes form the blood-brain barrier. Perineurial glial cells participate in nutrient uptake and establish a first diffusion barrier. The subperineurial glial (SPG) cells form septate junctions, which block paracellular diffusion and thus seal the nervous system from the hemolymph. We summarize the molecular basis of septate junction formation and address the different transport systems expressed by the blood-brain barrier forming glial cells.

  4. Effort, anhedonia, and function in schizophrenia: reduced effort allocation predicts amotivation and functional impairment.

    Science.gov (United States)

    Barch, Deanna M; Treadway, Michael T; Schoen, Nathan

    2014-05-01

    One of the most debilitating aspects of schizophrenia is an apparent interest in or ability to exert effort for rewards. Such "negative symptoms" may prevent individuals from obtaining potentially beneficial outcomes in educational, occupational, or social domains. In animal models, dopamine abnormalities decrease willingness to work for rewards, implicating dopamine (DA) function as a candidate substrate for negative symptoms given that schizophrenia involves dysregulation of the dopamine system. We used the effort-expenditure for rewards task (EEfRT) to assess the degree to which individuals with schizophrenia were wiling to exert increased effort for either larger magnitude rewards or for rewards that were more probable. Fifty-nine individuals with schizophrenia and 39 demographically similar controls performed the EEfRT task, which involves making choices between "easy" and "hard" tasks to earn potential rewards. Individuals with schizophrenia showed less of an increase in effort allocation as either reward magnitude or probability increased. In controls, the frequency of choosing the hard task in high reward magnitude and probability conditions was negatively correlated with depression severity and anhedonia. In schizophrenia, fewer hard task choices were associated with more severe negative symptoms and worse community and work function as assessed by a caretaker. Consistent with patterns of disrupted dopamine functioning observed in animal models of schizophrenia, these results suggest that 1 mechanism contributing to impaired function and motivational drive in schizophrenia may be a reduced allocation of greater effort for higher magnitude or higher probability rewards.

  5. Arctigenin from Fructus Arctii (Seed of Burdock) Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Science.gov (United States)

    Shin, Hee Soon; Jung, Sun Young; Back, Su Yeon; Do, Jeong-Ryong; Shon, Dong-Hwa

    2015-01-01

    Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER) value (as an index of barrier function) and ovalbumin (OVA) permeation (as an index of permeability) to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function. PMID:26550018

  6. Arctigenin from Fructus Arctii (Seed of Burdock Reinforces Intestinal Barrier Function in Caco-2 Cell Monolayers

    Directory of Open Access Journals (Sweden)

    Hee Soon Shin

    2015-01-01

    Full Text Available Fructus Arctii is used as a traditional herbal medicine to treat inflammatory diseases in oriental countries. This study aimed to investigate effect of F. Arctii extract on intestinal barrier function in human intestinal epithelial Caco-2 cells and to reveal the active component of F. Arctii. We measured transepithelial electrical resistance (TEER value (as an index of barrier function and ovalbumin (OVA permeation (as an index of permeability to observe the changes of intestinal barrier function. The treatment of F. Arctii increased TEER value and decreased OVA influx on Caco-2 cell monolayers. Furthermore, we found that arctigenin as an active component of F. Arctii increased TEER value and reduced permeability of OVA from apical to the basolateral side but not arctiin. In the present study, we revealed that F. Arctii could enhance intestinal barrier function, and its active component was an arctigenin on the functionality. We expect that the arctigenin from F. Arctii could contribute to prevention of inflammatory, allergic, and infectious diseases by reinforcing intestinal barrier function.

  7. Burden of impaired sleep quality on work productivity in functional dyspepsia.

    Science.gov (United States)

    Matsuzaki, Juntaro; Suzuki, Hidekazu; Togawa, Koji; Yamane, Tsuyoshi; Mori, Hideki; Komori, Takahiro; Masaoka, Tatsuhiro; Kanai, Takanori

    2018-04-01

    Impaired sleep quality is common, and can reduce work productivity in patients with functional dyspepsia (FD). The objective of this article is to evaluate whether there is a direct association between the presence of FD and the severity of impaired sleep quality, and to calculate the economic loss due to the decreased work productivity associated with sleep quality. In Study 1, using a web-based survey completed by workers with and without FD, we evaluated impaired sleep quality, work and daily productivity, and the severity of reflux and bowel symptoms. In Study 2, the association between the presence of FD and the severity of impaired sleep quality was validated in a hospital-based cohort. In both Study 1 and 2, although impaired sleep quality was more frequent in participants with FD than in those without FD, the independent association between the presence of FD and the severity of impaired sleep quality was not observed after adjustment for the severity of reflux and bowel symptoms. FD participants with impaired sleep quality reported additional economic loss of 53,500 Japanese yen/month. Although the association between impaired sleep quality and FD was indirect, concomitant impaired sleep quality could worsen economic loss.

  8. Does impaired socioemotional functioning account for behavioral dysexecutive disorders? Evidence from a transnosological study.

    Science.gov (United States)

    Narme, Pauline; Roussel, Martine; Mouras, Harold; Krystkowiak, Pierre; Godefroy, Olivier

    2017-01-01

    Behavioral dysexecutive disorders are highly prevalent in patients with neurological diseases but cannot be explained by cognitive dysexecutive impairments. In fact, the underlying mechanisms are poorly understood. Given that socioemotional functioning underlies appropriate behavior, socioemotional impairments may contribute to the appearance of behavioral disorders. To investigate this issue, we performed a transnosological study. Seventy-five patients suffering from various neurological diseases (Alzheimer's disease (AD), Parkinson's disease (PD), frontotemporal lobar degeneration, and stroke) were included in the study. The patients were comprehensively assessed in terms of cognitive and behavioral dysexecutive disorders and socioemotional processes (facial emotion recognition and theory of mind). As was seen for cognitive and behavioral dysexecutive impairments, the prevalence of socioemotional impairments varied according to the diagnosis. Stepwise logistic regressions showed that (i) only cognitive executive indices predicted hypoactivity with apathy/abulia, (ii) theory of mind impairments predicted hyperactivity-distractibility-impulsivity and stereotyped/perseverative behaviors, and (iii) impaired facial emotion recognition predicted social behavior disorders. Several dysexecutive behavioral disorders are associated with an underlying impairment in socioemotional processes but not with cognitive indices of executive functioning (except for apathy). These results strongly suggest that some dysexecutive behavioral disorders are the outward signs of an underlying impairment in socioemotional processes.

  9. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  10. Abnormal Functional Lateralization and Activity of Language Brain Areas in Typical Specific Language Impairment (Developmental Dysphasia)

    Science.gov (United States)

    de Guibert, Clement; Maumet, Camille; Jannin, Pierre; Ferre, Jean-Christophe; Treguier, Catherine; Barillot, Christian; Le Rumeur, Elisabeth; Allaire, Catherine; Biraben, Arnaud

    2011-01-01

    Atypical functional lateralization and specialization for language have been proposed to account for developmental language disorders, yet results from functional neuroimaging studies are sparse and inconsistent. This functional magnetic resonance imaging study compared children with a specific subtype of specific language impairment affecting…

  11. Transient impairments in single muscle fibre contractile function after prolonged cycling in elite endurance athletes

    DEFF Research Database (Denmark)

    Hvid, L G; Gejl, Kasper Degn; Bech, R D

    2013-01-01

    Prolonged muscle activity impairs whole-muscle performance and function. However, little is known about the effects of prolonged muscle activity on the contractile function of human single muscle fibres. The purpose of this study was to investigate the effects of prolonged exercise and subsequent...... recovery on the contractile function of single muscle fibres obtained from elite athletes....

  12. Androgenic anabolic steroids also impair right ventricular function.

    Science.gov (United States)

    Kasikcioglu, Erdem; Oflaz, Huseyin; Umman, Berrin; Bugra, Zehra

    2009-05-01

    Chronic anabolic steroid use suppresses left ventricular functions. However, there is no information regarding the chronic effects of anabolic steroids on right ventricular function which also plays a key role in global cardiac function. The main objective of the present study was to investigate the effects of androgenic anabolic steroids usage among athletes on remodeling the right part of the heart. Androgenic-anabolic steroids-using bodybuilders had smaller diastolic velocities of both ventricles than drug-free bodybuilders and sedentary counterparts. This study shows that androgenic anabolic steroids-using bodybuilders exhibited depressed diastolic functions of both ventricles.

  13. The aftermath of terrorism: posttraumatic stress and functional impairment after the 2011 Oslo bombing.

    Science.gov (United States)

    Solberg, Øivind; Blix, Ines; Heir, Trond

    2015-01-01

    In the present study we wanted to investigate the link between exposure, posttraumatic stress symptomatology, and functional impairment in the aftermath of terrorism. Posttraumatic stress symptomatology and functional impairment related to the Oslo bombing 22nd of July, 2011, in directly and indirectly exposed individuals (N = 1927) were assessed together with demographics, exposure, peri-traumatic reactions, and event centrality approximately 1 year after the attack. Directly and indirectly exposed individuals qualifying for posttraumatic stress disorder (PTSD) reported similar peri-traumatic reactions, event centrality, and functional impairment. However, clusters within the PTSD symptomatology were differentially associated with impairment as a function of their exposure. In the directly exposed group, all clusters within the PTSD symptomatology were associated with impairment in function, while only emotional numbing was associated with impairment within the indirectly exposed group. Considering that terror attacks frequently involve directly exposed individuals and a larger population of indirectly exposed individuals, this finding is of importance, especially in the design of intervention programs and the development of treatment policies.

  14. Rumination prospectively predicts executive functioning impairments in adolescents.

    Science.gov (United States)

    Connolly, Samantha L; Wagner, Clara A; Shapero, Benjamin G; Pendergast, Laura L; Abramson, Lyn Y; Alloy, Lauren B

    2014-03-01

    The current study tested the resource allocation hypothesis, examining whether baseline rumination or depressive symptom levels prospectively predicted deficits in executive functioning in an adolescent sample. The alternative to this hypothesis was also evaluated by testing whether lower initial levels of executive functioning predicted increases in rumination or depressive symptoms at follow-up. A community sample of 200 adolescents (ages 12-13) completed measures of depressive symptoms, rumination, and executive functioning at baseline and at a follow-up session approximately 15 months later. Adolescents with higher levels of baseline rumination displayed decreases in selective attention and attentional switching at follow-up. Rumination did not predict changes in working memory or sustained and divided attention. Depressive symptoms were not found to predict significant changes in executive functioning scores at follow-up. Baseline executive functioning was not associated with change in rumination or depression over time. Findings partially support the resource allocation hypothesis that engaging in ruminative thoughts consumes cognitive resources that would otherwise be allocated towards difficult tests of executive functioning. Support was not found for the alternative hypothesis that lower levels of initial executive functioning would predict increased rumination or depressive symptoms at follow-up. Our study is the first to find support for the resource allocation hypothesis using a longitudinal design and an adolescent sample. Findings highlight the potentially detrimental effects of rumination on executive functioning during early adolescence. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Fibrinogen function is impaired in whole blood from patients with cyanotic congenital heart disease

    DEFF Research Database (Denmark)

    Jensen, A S; Johansson, Pär I.; Bochsen, Louise

    2013-01-01

    haemoptysis. METHODS: In a prospective study 75 adult CCHD patients had haematocrit, platelet count, and plasma fibrinogen concentration examined. Furthermore thrombelastography(TEG) as well as TEG Functional Fibrinogen(TEG FF) assay evaluating fibrinogen function(FLEV) was performed. Data were compared...... with historical data regarding previous haemoptysis in CCHD patients. RESULTS: Haematocrit was 57±8% and platelet counts in the lower normal range. TEG revealed a hypocoagulable condition with impaired clot formation. TEG values were correlated to haematocrit, indicating that elevated haematocrit causes impaired....... CONCLUSION: Patients with CCHD are hypocoagulable mainly due to impaired fibrinogen function. Despite a low platelet count, platelet function does not seem to be severely affected in CCHD patients. Haemostasis, and especially fibrinogen function, is negatively affected by elevated haematocrit, and fibrinogen...

  16. Modulation of ocular surface glycocalyx barrier function by a galectin-3 N-terminal deletion mutant and membrane-anchored synthetic glycopolymers.

    Directory of Open Access Journals (Sweden)

    Jerome Mauris

    Full Text Available BACKGROUND: Interaction of transmembrane mucins with the multivalent carbohydrate-binding protein galectin-3 is critical to maintaining the integrity of the ocular surface epithelial glycocalyx. This study aimed to determine whether disruption of galectin-3 multimerization and insertion of synthetic glycopolymers in the plasma membrane could be used to modulate glycocalyx barrier function in corneal epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Abrogation of galectin-3 biosynthesis in multilayered cultures of human corneal epithelial cells using siRNA, and in galectin-3 null mice, resulted in significant loss of corneal barrier function, as indicated by increased permeability to the rose bengal diagnostic dye. Addition of β-lactose, a competitive carbohydrate inhibitor of galectin-3 binding activity, to the cell culture system, transiently disrupted barrier function. In these experiments, treatment with a dominant negative inhibitor of galectin-3 polymerization lacking the N-terminal domain, but not full-length galectin-3, prevented the recovery of barrier function to basal levels. As determined by fluorescence microscopy, both cellobiose- and lactose-containing glycopolymers incorporated into apical membranes of corneal epithelial cells, independently of the chain length distribution of the densely glycosylated, polymeric backbones. Membrane incorporation of cellobiose glycopolymers impaired barrier function in corneal epithelial cells, contrary to their lactose-containing counterparts, which bound to galectin-3 in pull-down assays. CONCLUSIONS/SIGNIFICANCE: These results indicate that galectin-3 multimerization and surface recognition of lactosyl residues is required to maintain glycocalyx barrier function at the ocular surface. Transient modification of galectin-3 binding could be therapeutically used to enhance the efficiency of topical drug delivery.

  17. Different Functional and Microstructural Changes Depending on Duration of Mild Cognitive Impairment in Parkinson Disease.

    Science.gov (United States)

    Shin, N-Y; Shin, Y S; Lee, P H; Yoon, U; Han, S; Kim, D J; Lee, S-K

    2016-05-01

    The higher cortical burden of Lewy body and Alzheimer disease-type pathology has been reported to be associated with a faster onset of cognitive impairment of Parkinson disease. So far, there has been a few studies only about the changes of gray matter volume depending on duration of cognitive impairment in Parkinson disease. Therefore, our aim was to evaluate the different patterns of structural and functional changes in Parkinson disease with mild cognitive impairment according to the duration of parkinsonism before mild cognitive impairment. Fifty-nine patients with Parkinson disease with mild cognitive impairment were classified into 2 groups on the basis of shorter (parkinsonism before mild cognitive impairment. Fifteen drug-naïve patients with de novo Parkinson disease with intact cognition were included for comparison. Cortical thickness, Tract-Based Spatial Statistics, and seed-based resting-state functional connectivity analyses were performed. Age, sex, years of education, age at onset of parkinsonism, and levodopa-equivalent dose were included as covariates. The group with shorter duration of parkinsonism before mild cognitive impairment showed decreased fractional anisotropy and increased mean and radial diffusivity values in the frontal areas compared with the group with longer duration of parkinsonism before mild cognitive impairment (corrected P parkinsonism before mild cognitive impairment showed decreased resting-state functional connectivity in the default mode network area when the left or right posterior cingulate was used as a seed, and in the dorsolateral prefrontal areas when the left or right caudate was used as a seed (corrected P parkinsonism before mild cognitive impairment showed decreased resting-state functional connectivity mainly in the medial prefrontal cortex when the left or right posterior cingulate was used as a seed, and in the parieto-occipital areas when the left or right caudate was used as a seed (corrected P Parkinson

  18. Functional imaging correlates of impaired distractor suppression following sleep deprivation.

    Science.gov (United States)

    Kong, Danyang; Soon, Chun Siong; Chee, Michael W L

    2012-05-15

    Sleep deprivation (SD) has been shown to affect selective attention but it is not known how two of its component processes: target enhancement and distractor suppression, are affected. To investigate, young volunteers either attended to houses or were obliged to ignore them (when attending to faces) while viewing superimposed face-house pictures. MR signal enhancement and suppression in the parahippocampal place area (PPA) were determined relative to a passive viewing control condition. Sleep deprivation was associated with lower PPA activation across conditions. Critically SD specifically impaired distractor suppression in selective attention, leaving target enhancement relatively preserved. These findings parallel some observations in cognitive aging. Additionally, following SD, attended houses were not significantly better recognized than ignored houses in a post-experiment test of recognition memory contrasting with the finding of superior recognition of attended houses in the well-rested state. These results provide evidence for co-encoding of distracting information with targets into memory when one is sleep deprived. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Estrogen and cognitive functioning in men with mild cognitive impairment.

    Science.gov (United States)

    Sherwin, Barbara B

    2002-01-01

    Although men do not experience an abrupt cessation of gonadal hormone production at midlife as do women, levels of testosterone (T) decrease gradually with aging. Because estradiol (E2) arises mainly from the conversion of T in men, the availability of E2 also decreases with increasing age. In randomized clinical trials, E2 replacement therapy has been shown to maintain aspects of cognition in postmenopausal women, specifically with regard to verbal memory. The present prospective, randomized, cross-over trial is being undertaken in order to determine whether E2 will enhance verbal memory in men with Mild Cognitive Impairment (MCI). Men with MCI will randomly receive E2 or placebo for the first 3 mo of treatment and will then be crossed-over to the other treatment for an additional 3 mo. A battery of neuropsychological tests will be administered at pretreatment and, again, following each 3-mo treatment phase. It is hypothesized that elderly men with MCI will perform better on tests of explicit memory when they are being treated with E2 compared to their performance under placebo conditions.

  20. Impaired baroreflex function in mice overexpressing alpha-synuclein

    Directory of Open Access Journals (Sweden)

    Sheila eFleming

    2013-07-01

    Full Text Available Cardiovascular autonomic dysfunction, such as orthostatic hypotension consequent to baroreflex failure and cardiac sympathetic denervation, is frequently observed in the synucleinopathy Parkinson’s disease (PD. In the present study, the baroreceptor reflex was assessed in mice overexpressing human wildtype alpha-synuclein (Thy1-aSyn, a genetic mouse model of synucleinopathy. The beat-to-beat change in heart rate, computed from R-R interval, in relation to blood pressure was measured in anesthetized and conscious mice equipped with arterial blood pressure telemetry transducers during transient bouts of hypertension and hypotension. Compared to wildtype, tachycardia following nitroprusside-induced hypotension was significantly reduced in Thy1-aSyn mice. Thy1-aSyn mice also showed an abnormal cardiovascular response (i.e., diminished tachycardia to muscarinic blockade with atropine. We conclude that Thy1-aSyn mice have impaired basal and dynamic range of sympathetic and parasympathetic-mediated changes in heart rate and will be a useful model for long-term study of cardiovascular autonomic dysfunction associated with PD.

  1. ICRP and impairment of mental function following prenatal irradiation

    International Nuclear Information System (INIS)

    Mole, R.H.

    1992-01-01

    A brief account is given of mental retardation and intelligence testing in unirradiated human populations, without which it is not possible to judge the 1991 ICRP Recommendations relating to mental impairment. The dose-response used by ICRP (1991) for the reduction of IQ by irradiation in utero has no radiobiological basis because IQ values are derived from intelligence test scores by transforming the scale of measurement. It is also defective because it assumed that IQ is distributed normally whereas this is so only in normal school children, not in a population in general including retarded persons. There seems good evidence for a substantial threshold of dose for both reduction in IQ and increase in severe mental retardation (SMR). The four prenatally irradiated bomb survivors with SMR and intrauterine dose in the dose range 1-49 cGy were not intelligence tested, so the relation between SMR and IQ in that practically important dose range cannot be examined directly, SMR is a deterministic phenomenon, so is not expected to occur unless dose exceeds a threshold. The threshold doses for SMR based on linear dose-responses using ungrouped doses were 46 and 55 cGy DS86 intrauterine dose (Otake et al 1987). The threshold 50 cGy derived here for reduction in IQ is closely similar. Mild mental retardation has not been reported as a diagnosis in bombs survivors exposed in utero. (Author)

  2. [Functional impairment and quality of life after rectal cancer surgery].

    Science.gov (United States)

    Mora, Laura; Zarate, Alba; Serra-Aracil, Xavier; Pallisera, Anna; Serra, Sheila; Navarro-Soto, Salvador

    2018-01-01

    This study determines the quality of life and the anorectal function of these patients. Observational study of two cohorts comparing patients undergoing rectal tumor surgery using TaETM or conventional ETM after a minimum of six months of intestinal transit reconstruction. EORTC-30, EORTC-29 quality of life questionnaires and the anorectal function assessment questionnaire (LARS score) are applied. General variables are also collected. 31 patients between 2011 and 2014: 15 ETM group and 16 TaETM. We do not find statistically significant differences in quality of life questionnaires or in anorectal function. Statistically significant general variables: longer surgical time in the TaETM group. Nosocomial infection and minor suture failure in the TaETM group. The performance of TaETM achieves the same results in terms of quality of life and anorectal function as conventional ETM. Copyright: © 2018 Permanyer.

  3. A search for parameters of universal sub-barrier fusion excitation function

    Energy Technology Data Exchange (ETDEWEB)

    Qu, W.W. [Medical College of Soochow University, School of Radiation Medicine and Protection, Soochow (China); Zhang, G.L. [Beihang University, School of Physics and Nuclear Energy Engineering, Beijing (China); Wolski, R. [Henryk Niewodniczanski Institute of Nuclear Physics PAS, Cracow (Poland)

    2016-11-15

    Many fusion experimental data have been analyzed in terms of a simple universal function which could be used for predictions of fusion cross section below the barrier for arbitrary systems. Sub-barrier fusions based on the concept of Q -fusion value dependence were studied. It is attempted to parameterize the energy-reduced fusion excitation functions around the Coulomb barriers by an analytical phenomenological function. It was found that the speed of driving nuclei towards fusion is faster with the increase of mass asymmetry of colliding systems and those systems with a large difference of the ratio of neutrons to protons. However, a general trend with respect to total mass has not been observed. An exposition of more qualitative conclusions is hindered by apparent inconsistencies of measured fusion cross sections. (orig.)

  4. Body Dysmorphic Symptoms, Functional Impairment, and Depression: The Role of Appearance-Based Teasing.

    Science.gov (United States)

    Weingarden, Hilary; Renshaw, Keith D

    2016-01-01

    Body dysmorphic disorder is associated with elevated social and occupational impairment and comorbid depression, but research on risk factors for body dysmorphic symptoms and associated outcomes is limited. Appearance-based teasing may be a potential risk factor. To examine the specificity of this factor, the authors assessed self-reported appearance-based teasing, body dysmorphic, and obsessive-compulsive symptom severity, functional impairment (i.e., social, occupational, family impairment), and depression in a nonclinical sample of undergraduates. As hypothesized, appearance-based teasing was positively correlated with body dysmorphic symptoms. The correlation between teasing and body dysmorphic symptoms was stronger than that between teasing and obsessive-compulsive symptom severity. Last, body dysmorphic symptom severity and appearance-based teasing interacted in predicting functional impairment and depression. Specifically, appearance-based teasing was positively associated with depression and functional impairment only in those with elevated body dysmorphic symptoms. When a similar moderation was tested with obsessive-compulsive, in place of body dysmorphic, symptom severity, the interaction was nonsignificant. Findings support theory that appearance-based teasing is a specific risk factor for body dysmorphic symptoms and associated functional impairment.

  5. Comparison of Spontaneously Elicited Language Patterns in Specific Language Impairment and High-Functioning Autism.

    Science.gov (United States)

    Craig, Megan; Trauner, Doris

    2018-02-01

    We aimed to characterize differences in the use of language in children with specific language impairment and high-functioning autism by analyzing verbal responses on standardized tests. The overall goal was to provide clinicians with additional tools with which to aid in distinguishing the two neurodevelopmental disorders. This study included 16 children with specific language impairment, 28 children with high-functioning autism, and 52 typically developing participants between the ages of six and 14. Groups were matched for age, and specific language impairment and high-functioning autism groups were matched on verbal and performance IQ. Responses from standardized tests were examined for response length, grammatical errors, filler words, perseverations, revisions (repeated attempts to begin or continue a sentence), off-topic attention shifts (lapses in attention to the task), and rambling. Data were analyzed using parametric and nonparametric methods. Specific language impairment responses were longer and contained more filler words than did those of the other two groups, whereas high-functioning autism responses exhibited more grammatical errors, off-topic attention shifts, and rambling. Specific language impairment and high-functioning autism responses showed higher rates of perseveration compared with controls. There were no significant differences in revisions among the three groups. Differences in language patterns of participants with specific language impairment and high-functioning autism may be useful to the clinician in helping to differentiate isolated language impairment from high-functioning autism. The results also support the conclusion that the two conditions are separable, and each exhibits a different pattern of language dysfunction. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

    2010-01-01

    chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

  7. Damage and recovery of skin barrier function after glycolic acid chemical peeling and crystal microdermabrasion.

    Science.gov (United States)

    Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok

    2004-03-01

    Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.

  8. Older people experiencing homelessness show marked impairment on tests of frontal lobe function.

    Science.gov (United States)

    Rogoz, Astrid; Burke, David

    2016-03-01

    Reported rates of mild and moderate cognitive impairment in older people experiencing homelessness range from 5-80%. The objective of this study was to determine the prevalence and characteristics of cognitive impairment in older people experiencing homelessness in the inner city of Sydney, Australia. Men and women experiencing homelessness aged 45 years and over in the inner city were screened for cognitive impairment. Participants who scored 26 or below on the mini-mental state examination and/or were impaired on any one of the clock-drawing test, the verbal fluency test and the trail-making test, part B were then assessed with a semi-structured interview, including the 21-item Depression Anxiety Stress Scale and the 12-item General Health Questionnaire. Screening of 144 men and 27 women aged between 45 years and 93 years identified cognitive impairment in 78%. Subsequently, high rates of mental and physical illness were identified, and 75% of subjects who were cognitively impaired performed poorly on frontal lobe tests. The trail-making test, part B was the most sensitive measure of frontal function. This study demonstrated that a large majority of older people experiencing homelessness, in the inner city of a high-income country, showed impairment on tests of frontal lobe function, a finding that could have significant implications for any medical or psychosocial intervention. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Functional Neuro-Imaging and Post-Traumatic Olfactory Impairment

    Science.gov (United States)

    Roberts, Richard J.; Sheehan, William; Thurber, Steven; Roberts, Mary Ann

    2010-01-01

    Objective: To evaluate via a research literature survey the anterior neurological significance of decreased olfactory functioning following traumatic brain injuries. Materials and Methods: A computer literature review was performed to locate all functional neuro-imaging studies on patients with post-traumatic anosmia and other olfactory deficits. Results: A convergence of findings from nine functional neuro-imaging studies indicating evidence for reduced metabolic activity at rest or relative hypo-perfusion during olfactory activations. Hypo-activation of the prefrontal regions was apparent in all nine post-traumatic samples, with three samples yielding evidence of reduced activity in the temporal regions as well. Conclusions: The practical ramifications include the reasonable hypothesis that a total anosmic head trauma patient likely has frontal lobe involvement. PMID:21716782

  10. Sexual functioning is impaired in adults with congenital heart disease

    NARCIS (Netherlands)

    P. Opic (Petra); J.W. Roos-Hesselink (Jolien); J.A.A.E. Cuypers (Judith); M. Witsenburg (Maarten); A.E. van den Bosch (Annemien); R.T. van Domburg (Ron); A.J.J.C. Bogers (Ad); E.M.W.J. Utens (Elisabeth)

    2013-01-01

    textabstractBackground: To investigate the overall sexual functioning and disease specific sexual problems in congenital heart disease (ConHD) patients, for both genders and different cardiac diagnostic groups, and compare these with Dutch normative data. Also disease specific sexual problems were

  11. Sexual functioning is impaired in adults with congenital heart disease

    NARCIS (Netherlands)

    Opić, Petra; Roos-Hesselink, Jolien W.; Cuypers, Judith A. A. C.; Witsenburg, Maarten; van den Bosch, Annemien; van Domburg, Ron T.; Bogers, Ad J. J. C.; Utens, Elisabeth M. W. J.

    2013-01-01

    To investigate the overall sexual functioning and disease specific sexual problems in congenital heart disease (ConHD) patients, for both genders and different cardiac diagnostic groups, and compare these with Dutch normative data. Also disease specific sexual problems were investigated. From a

  12. Cryopreservation of human skeletal muscle impairs mitochondrial function

    DEFF Research Database (Denmark)

    Larsen, Steen; Wright-Paradis, C; Gnaiger, E

    2012-01-01

    functionality after long term cryopreservation (1 year). Skeletal muscle samples were preserved in dimethyl sulfoxide (DMSO) for later analysis. Human skeletal muscle fibres were thawed and permeabilised with saponin, and mitochondrial respiration was measured by high-resolution respirometry. The capacity...

  13. Multiple sclerosis impairs regional functional connectivity in the cerebellum

    DEFF Research Database (Denmark)

    Dogonowski, Anne-Marie; Andersen, Kasper Winther; Madsen, Kristoffer Hougaard

    2013-01-01

    in the cerebellum in MS. This might be caused by a functional disruption of cortico-ponto-cerebellar and spino-cerebellar inputs, since patients with higher lesion load in the left cerebellar peduncles showed a stronger reduction in cerebellar homogeneity. In patients, two clusters in the left posterior cerebellum...

  14. Barrier and system performances within a safety case: their functioning and evolution with time

    International Nuclear Information System (INIS)

    Hedin, A.; Voinis, S.; Fillion, E.; Keller, S.; Lalieux, Ph.; Nachmilner, L.; Nys, V.; Rodriguez, J.; Sevougian, D.; Wollrath, J.

    2002-01-01

    The following six questions were used as the basis for the discussions in a Working Group: - What is the role of each barrier as a function of time or in the different time frames? What is its contribution to the overall system performance or safety as a function of time? - Which are the main uncertainties on the performance of barriers in the timescales? To what extent should we enhance the robustness of barriers because of the uncertainties of some component behaviour with time? - What is the requested or required performance versus the expected realistic or conservative behaviour with time? How are these safety margins used as arguments in a safety case? - What is the issue associated with the geosphere stability for different geological systems? - How are barriers and system performances, as a function of time, evaluated (presented and communicated) in a safety case? - What kind of measures are used for siting, designing and optimising robust barriers corresponding to situations that can vary with time? Are human actions considered to be relevant? (authors)

  15. Israeli adolescents with ongoing exposure to terrorism: suicidal ideation, posttraumatic stress disorder, and functional impairment.

    Science.gov (United States)

    Chemtob, Claude M; Pat-Horenczyk, Ruth; Madan, Anita; Pitman, Seth R; Wang, Yanping; Doppelt, Osnat; Burns, Kelly Dugan; Abramovitz, Robert; Brom, Daniel

    2011-12-01

    In this study, we examined the relationships among terrorism exposure, functional impairment, suicidal ideation, and probable partial or full posttraumatic stress disorder (PTSD) from exposure to terrorism in adolescents continuously exposed to this threat in Israel. A convenience sample of 2,094 students, aged 12 to 18, was drawn from 10 Israeli secondary schools. In terms of demographic factors, older age was associated with increased risk for suicidal ideation, OR = 1.33, 95% CI [1.09, 1.62], p terrorism was associated with increased risk for each of the measured outcomes including probable partial or full PTSD, functional impairment, and suicidal ideation. When age, gender, level of exposure to terrorism, probable partial or full PTSD, and functional impairment were examined together, only terrorism exposure and functional impairment were associated with suicidal ideation. This study underscores the importance and feasibility of examining exposure to terrorism and functional impairment as risk factors for suicidal ideation. Copyright © 2011 International Society for Traumatic Stress Studies.

  16. Depression, anxiety and somatization in primary care: syndrome overlap and functional impairment.

    Science.gov (United States)

    Löwe, Bernd; Spitzer, Robert L; Williams, Janet B W; Mussell, Monika; Schellberg, Dieter; Kroenke, Kurt

    2008-01-01

    To determine diagnostic overlap of depression, anxiety and somatization as well as their unique and overlapping contribution to functional impairment. Two thousand ninety-one consecutive primary care clinic patients participated in a multicenter cross-sectional survey in 15 primary care clinics in the United States (participation rate, 92%). Depression, anxiety, somatization and functional impairment were assessed using validated scales from the Patient Health Questionnaire (PHQ) (PHQ-8, eight-item depression module; GAD-7, seven-item Generalized Anxiety Disorder Scale; and PHQ-15, 15-item somatic symptom scale) and the Short-Form General Health Survey (SF-20). Multiple linear regression analyses were used to investigate unique and overlapping associations of depression, anxiety and somatization with functional impairment. In over 50% of cases, comorbidities existed between depression, anxiety and somatization. The contribution of the commonalities of depression, anxiety and somatization to functional impairment substantially exceeded the contribution of their independent parts. Nevertheless, depression, anxiety and somatization did have important and individual effects (i.e., separate from their overlap effect) on certain areas of functional impairment. Given the large syndrome overlap, a potential consideration for future diagnostic classification would be to describe basic diagnostic criteria for a single overarching disorder and to optionally code additional diagnostic features that allow a more detailed classification into specific depressive, anxiety and somatoform subtypes.

  17. High Prolactin Excretion in Patients with Diabetes Mellitus and Impaired Renal Function.

    Science.gov (United States)

    Triebel, Jakob; Moreno-Vega, Aura Ileana; Vázquez-Membrillo, Miguel; Nava, Gabriel; García-Franco, Renata; López-Star, Ellery; Baldivieso-Hurtado, Olivia; Ochoa, Daniel; Macotela, Yazmín; Bertsch, Thomas; Martinez de la Escalera, Gonzalo; Clapp, Carmen

    2015-01-01

    The metabolic clearance of prolactin (PRL) is partially executed by the kidney. Here, we investigate the urine excretion of PRL in patients with Diabetes Mellitus and renal impairment. Serum and urine samples were collected from male, mestizo patients in central Mexico employing a cross-sectional study design. Ninety-eight individuals had either no diabetes and normal renal function (control), diabetes and normal renal function, or diabetes with impaired renal function. PRL was determined by a chemiluminescent immunometric assay; protein, albumin, and creatinine were evaluated using quantitative colorimetric assays. The results were analyzed using ANOVA-testing. Patients with Diabetes Mellitus and renal impairment had significantly higher urine PRL levels than patients with Diabetes Mellitus and normal renal function and control patients. Higher urine PRL levels were associated with lower glomerular filtration rates, higher serum creatinine, and higher urinary albumin-to-creatinine ratios (UACR). Urine PRL levels correlated positively with UACR. Serum PRL levels were similar among groups. Patients with Diabetes Mellitus and impaired renal function demonstrate a high urinary PRL excretion. Urinary PRL excretion in the context of proteinuria could contribute to PRL dysregulation in renal impairment.

  18. Predictors of impaired work functioning in employees with major depression in remission

    NARCIS (Netherlands)

    de Vries, Gabe; Koeter, Maarten W. J.; Nieuwenhuijsen, Karen; Hees, Hiske L.; Schene, Aart H.

    2015-01-01

    This study aims to (i) assess work functioning in employees returning to work with a major depression in remission, (ii) study the predictors of impaired work functioning. Participants diagnosed with major depressive disorder (MDD), on long term sick leave (mean 27 weeks) and treated in a

  19. Predictors of impaired work functioning in employees with major depression in remission

    NARCIS (Netherlands)

    Vries, G. de; Koeter, M.W.; Nieuwenhuijsen, K.; Hees, H.L.; Schene, A.H.

    2015-01-01

    OBJECTIVES: This study aims to (i) assess work functioning in employees returning to work with a major depression in remission, (ii) study the predictors of impaired work functioning. METHODS: Participants diagnosed with major depressive disorder (MDD), on long term sick leave (mean 27 weeks) and

  20. Lower extremity function in normal cognitive aging, mild cognitive impairment, and Alzheimer’s disease

    NARCIS (Netherlands)

    Eggermont, L.H.P.; Gavett, B.E.; Volkers, K.M.; Blankevoort, C.G.; Scherder, E.J.A.; Jefferson, A.L.; Steinberg, E.; Nair, A.; Green, R.C.; Stern, R.A.

    2010-01-01

    Eggermont LH, Gavett BE, Volkers KM, Blankevoort CG, Scherder EJ, Jefferson AL, Steinberg E, Nair A, Green RC, Stern RA. Lower-extremity function in cognitively healthy aging, mild cognitive impairment, and Alzheimer's disease. Objective: To examine differences in lower-extremity function in

  1. Family Functioning, Social Impairment, and Symptoms Among Adolescents with Bipolar Disorder

    Science.gov (United States)

    Keenan-Miller, Danielle; Peris, Tara; Axelson, David; Kowatch, Robert A.; Miklowitz, David J.

    2012-01-01

    Objective: Impaired social functioning is common among youth with bipolar disorder (BD), emerges in multiple settings, and persists over time. However, little is known about factors associated with poor peer and family functioning in the early-onset form of BD. Using a sample of adolescents with BD I or II, we examined which symptoms of BD,…

  2. Specific Language Impairment and Executive Functioning: Parent and Teacher Ratings of Behavior

    Science.gov (United States)

    Wittke, Kacie; Spaulding, Tammie J.; Schechtman, Calli J.

    2013-01-01

    Purpose: The current study used the Behavior Rating Inventory of Executive Function--Preschool Version (BRIEF-P; Gioia, Espy, & Isquith, 2003), a rating scale designed to investigate executive behaviors in everyday activities, to examine the executive functioning of preschool children with specific language impairment (SLI) relative to their…

  3. One Minute of Marijuana Secondhand Smoke Exposure Substantially Impairs Vascular Endothelial Function.

    Science.gov (United States)

    Wang, Xiaoyin; Derakhshandeh, Ronak; Liu, Jiangtao; Narayan, Shilpa; Nabavizadeh, Pooneh; Le, Stephenie; Danforth, Olivia M; Pinnamaneni, Kranthi; Rodriguez, Hilda J; Luu, Emmy; Sievers, Richard E; Schick, Suzaynn F; Glantz, Stanton A; Springer, Matthew L

    2016-07-27

    Despite public awareness that tobacco secondhand smoke (SHS) is harmful, many people still assume that marijuana SHS is benign. Debates about whether smoke-free laws should include marijuana are becoming increasingly widespread as marijuana is legalized and the cannabis industry grows. Lack of evidence for marijuana SHS causing acute cardiovascular harm is frequently mistaken for evidence that it is harmless, despite chemical and physical similarity between marijuana and tobacco smoke. We investigated whether brief exposure to marijuana SHS causes acute vascular endothelial dysfunction. We measured endothelial function as femoral artery flow-mediated dilation (FMD) in rats before and after exposure to marijuana SHS at levels similar to real-world tobacco SHS conditions. One minute of exposure to marijuana SHS impaired FMD to a comparable extent as impairment from equal concentrations of tobacco SHS, but recovery was considerably slower for marijuana. Exposure to marijuana SHS directly caused cannabinoid-independent vasodilation that subsided within 25 minutes, whereas FMD remained impaired for at least 90 minutes. Impairment occurred even when marijuana lacked cannabinoids and rolling paper was omitted. Endothelium-independent vasodilation by nitroglycerin administration was not impaired. FMD was not impaired by exposure to chamber air. One minute of exposure to marijuana SHS substantially impairs endothelial function in rats for at least 90 minutes, considerably longer than comparable impairment by tobacco SHS. Impairment of FMD does not require cannabinoids, nicotine, or rolling paper smoke. Our findings in rats suggest that SHS can exert similar adverse cardiovascular effects regardless of whether it is from tobacco or marijuana. © 2016 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

  4. Impaired work functioning due to common mental disorders in nurses and allied health professionals: the Nurses Work Functioning Questionnaire.

    Science.gov (United States)

    Gärtner, F R; Nieuwenhuijsen, K; van Dijk, F J H; Sluiter, J K

    2012-02-01

    Common mental disorders (CMD) negatively affect work functioning. In the health service sector not only the prevalence of CMDs is high, but work functioning problems are associated with a risk of serious consequences for patients and healthcare providers. If work functioning problems due to CMDs are detected early, timely help can be provided. Therefore, the aim of this study is to develop a detection questionnaire for impaired work functioning due to CMDs in nurses and allied health professionals working in hospitals. First, an item pool was developed by a systematic literature study and five focus group interviews with employees and experts. To evaluate the content validity, additional interviews were held. Second, a cross-sectional assessment of the item pool in 314 nurses and allied health professionals was used for item selection and for identification and corroboration of subscales by explorative and confirmatory factor analysis. The study results in the Nurses Work Functioning Questionnaire (NWFQ), a 50-item self-report questionnaire consisting of seven subscales: cognitive aspects of task execution, impaired decision making, causing incidents at work, avoidance behavior, conflicts and irritations with colleagues, impaired contact with patients and their family, and lack of energy and motivation. The questionnaire has a proven high content validity. All subscales have good or acceptable internal consistency. The Nurses Work Functioning Questionnaire gives insight into precise and concrete aspects of impaired work functioning of nurses and allied health professionals. The scores can be used as a starting point for purposeful interventions.

  5. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  6. Distinct Shifts in Microbiota Composition during Drosophila Aging Impair Intestinal Function and Drive Mortality

    Directory of Open Access Journals (Sweden)

    Rebecca I. Clark

    2015-09-01

    Full Text Available Alterations in the composition of the intestinal microbiota have been correlated with aging and measures of frailty in the elderly. However, the relationships between microbial dynamics, age-related changes in intestinal physiology, and organismal health remain poorly understood. Here, we show that dysbiosis of the intestinal microbiota, characterized by an expansion of the Gammaproteobacteria, is tightly linked to age-onset intestinal barrier dysfunction in Drosophila. Indeed, alterations in the microbiota precede and predict the onset of intestinal barrier dysfunction in aged flies. Changes in microbial composition occurring prior to intestinal barrier dysfunction contribute to changes in excretory function and immune gene activation in the aging intestine. In addition, we show that a distinct shift in microbiota composition follows intestinal barrier dysfunction, leading to systemic immune activation and organismal death. Our results indicate that alterations in microbiota dynamics could contribute to and also predict varying rates of health decline during aging in mammals.

  7. Functional Components of Cognitive Impairment in Multiple Sclerosis: A Cross-Sectional Investigation

    Directory of Open Access Journals (Sweden)

    Jordi A. Matias-Guiu

    2017-11-01

    Full Text Available BackgroundCognitive impairment is frequent and disabling in multiple sclerosis (MS. Changes in information processing speed constitute the most important cognitive deficit in MS. However, given the clinical and topographical variability of the disease, cognitive impairment may vary greatly and appear in other forms in addition to slower information processing speed. Our aim was to determine the frequency of cognitive impairment, the principal cognitive domains, and components involved in MS and to identify factors associated with presence of cognitive impairment in these patients in a large series of patients.MethodsCross-sectional study of 311 patients with MS [236 with relapsing-remitting MS (RRMS, 52 with secondary progressive MS (SPMS, and 23 with primary progressive MS (PPMS]. Patients’ cognitive function was assessed with a comprehensive neuropsychological assessment protocol. Patients displaying deficits in 2 or more cognitive domains were considered to have cognitive impairment associated with MS. We conducted a principal component analysis to detect different cognitive patterns by identifying clusters of tests highly correlated to one another.ResultsCognitive impairment was detected in 41.5% of the sample, and it was more frequent in patients with SPMS and PPMS (P = 0.002. Expanded Disability Status Scale scores and education were independent predictors of cognitive impairment. Principal component analysis identified seven clusters: attention and basic executive function (including information processing speed, planning and high-level executive function, verbal memory and language, executive and visuospatial performance time, fatigue-depression, visuospatial function, and basic attention and verbal/visual working memory. Mean scoring of components 2 (high-order executive functioning and 3 (verbal memory-language was higher in patients with RRMS than in those with PPMS (component 2 and SPMS (component 3.ConclusionMS is linked to

  8. Functions of an engineered barrier system for a nuclear waste repository in basalt

    International Nuclear Information System (INIS)

    Coons, W.E.; Moore, E.L.; Smith, M.J.; Kaser, J.D.

    1980-01-01

    Defined in this document are the functions of components selected for an engineered barrier system for a nuclear waste repository in basalt. The definitions provide a focal point for barrier material research and development by delineating the purpose and operative lifetime of each component of the engineered system. A five-component system (comprised of waste form, canister, buffer, overpack, and tailored backfill) is discussed in terms of effective operation throughout the course of repository history, recognizing that the emplacement environment changes with time. While components of the system are mutually supporting, redundancy is provided by subsystems of physical and chemical barriers which act in concert with the geology to provide a formidable barrier to transport of hazardous materials to the biosphere. The operating philosophy of the conceptual engineered barrier system is clarified by examples pertinent to storage in basalt, and a technical approach to barrier design and material selection is proposed. A method for system validation and qualification is also included which considers performance criteria proposed by external agencies in conjunction with site-specific models and risk assessment to define acceptable levels of system performance

  9. Psychiatric disorders in children attending a Nigerian primary care unit: functional impairment and risk factors

    Directory of Open Access Journals (Sweden)

    Tunde-Ayinmode Mosunmola

    2012-07-01

    Full Text Available Abstract Background There is dearth of data on the level of functional impairment and risk factors for psychiatric morbidity in children attending primary care services in developing countries like Nigeria. The risk factors for psychiatric morbidity and functional impairment in children attending the primary care unit of a teaching hospital in Ilorin, Nigeria was therefore investigated to obtain data that could be used in improving service provision by primary care physicians. Methods A cross-sectional two-stage design was employed for the study. The first stage involved administration of the Child Behavior Questionnaire (CBQ to 350 children while the children’s version of the schedule for affective disorders and schizophrenia was used for the second stage involving 157 children, all high scorers on CBQ (score of ≥ 7 and 30% of low scorers (score  In addition, the Children Global Assessment Scale was used to assess the functional status of the children (score of ≤ 70 indicates functional impairment while the mothers’ mental health status was assessed with the 12-item version of the General Health Questionnaire, a score of 3 or more on this instrument indicate presence of mental morbidity. Results It was observed that 11.4% of the children had diagnosable psychiatric disorders and 7.1% were functionally impaired; and those with psychiatric disorders were more functionally impaired than those without. Thus, significant negative correlation was noted between CBQ scores and CGAS (r = 0.53; p  Conclusions Child psychiatric disorders are prevalent in the primary care unit studied. Many of the risk factors identified in the study population are modifiable. Collaborative efforts between psychiatrists and primary care physicians could therefore help to reduce level of risk and functional impairment and psychiatric morbidity among children attending the primary care unit studied. It could also help improve referral rates of

  10. Functional aging impairs the role of feedback in motor learning.

    Science.gov (United States)

    Liu, Yu; Cao, Chunmei; Yan, Jin H

    2013-10-01

    Optimal motor skill acquisition frequently requires augmented feedback or knowledge of results (KR). However, the effect of functional declines on the benefits of KR remains to be determined. The objective of this research was to examine how cognitive and motor deficits of older adults influence the use of KR for motor skill learning. A total of 57 older adults (mean 73.1 years; SD 4.2) received both cognitive and eye-hand coordination assessments, whereas 55 young controls (mean 25.8 years; SD 3.8) took only the eye-hand coordination test. All young and older participants learned a time-constrained arm movement through KR in three pre-KR and post-KR intervals. In the subsequent no-KR skill retests, absolute and variable time errors were not significantly reduced for the older learners who had KR during skill practice, especially for those with cognitive and motor dysfunctions. The finding suggests that KR results in no measureable improvement for older adults with cognitive and motor functional deficiencies. More importantly, for the older adults, longer post-KR intervals showed greater detrimental effects on feedback-based motor learning than shorter pauses after KR delivery. The findings support the hypothesis about the effects of cognitive and motor deficits on KR in motor skill learning of older adults. The dynamics of cognitive and motor aging, external feedback and internal control mechanisms collectively explain the deterioration in the sensory-motor learning of older adults. The theoretical implications and practical relevance of functional aging for motor skill learning are discussed. © 2013 Japan Geriatrics Society.

  11. Seizure Control and Memory Impairment Are Related to Disrupted Brain Functional Integration in Temporal Lobe Epilepsy.

    Science.gov (United States)

    Park, Chang-Hyun; Choi, Yun Seo; Jung, A-Reum; Chung, Hwa-Kyoung; Kim, Hyeon Jin; Yoo, Jeong Hyun; Lee, Hyang Woon

    2017-01-01

    Brain functional integration can be disrupted in patients with temporal lobe epilepsy (TLE), but the clinical relevance of this disruption is not completely understood. The authors hypothesized that disrupted functional integration over brain regions remote from, as well as adjacent to, the seizure focus could be related to clinical severity in terms of seizure control and memory impairment. Using resting-state functional MRI data acquired from 48 TLE patients and 45 healthy controls, the authors mapped functional brain networks and assessed changes in a network parameter of brain functional integration, efficiency, to examine the distribution of disrupted functional integration within and between brain regions. The authors assessed whether the extent of altered efficiency was influenced by seizure control status and whether the degree of altered efficiency was associated with the severity of memory impairment. Alterations in the efficiency were observed primarily near the subcortical region ipsilateral to the seizure focus in TLE patients. The extent of regional involvement was greater in patients with poor seizure control: it reached the frontal, temporal, occipital, and insular cortices in TLE patients with poor seizure control, whereas it was limited to the limbic and parietal cortices in TLE patients with good seizure control. Furthermore, TLE patients with poor seizure control experienced more severe memory impairment, and this was associated with lower efficiency in the brain regions with altered efficiency. These findings indicate that the distribution of disrupted brain functional integration is clinically relevant, as it is associated with seizure control status and comorbid memory impairment.

  12. Thallium induces hydrogen peroxide generation by impairing mitochondrial function

    International Nuclear Information System (INIS)

    Hanzel, Cecilia E.; Verstraeten, Sandra V.

    2006-01-01

    Thallium (Tl) is highly toxic through yet poorly understood mechanisms. In this study, we comparatively investigated the effects of thallic (Tl(III)) cations on mitochondrial functionality and oxidative stress promotion, and results were compared to those obtained for thallous (Tl(I)) cation. PC12 cells were incubated between 1 and 72 h in the presence of a single dose of Tl(I) or Tl(III) (10-250 μM). A metal concentration- and time-dependent decrease in cell viability was observed evaluated by both MTT reduction and calcein fluorescence. After 24 h in culture, Tl(I) and Tl(III) significantly decreased mitochondrial membrane potential evaluated as the incorporation of rhodamine 123. Along the incubation period assessed, both Tl(I) and Tl(III) (50 and 100 μM) significantly increased mitochondrial H 2 O 2 steady-state levels, being the magnitude of the effect: Tl(III) > Tl(I). Glutathione content, measured by reaction with monochlorobimane, was significantly reduced in Tl-treated cells. Finally, higher oxidant species content in cells cytoplasm was found, which positively correlated with mitochondrial H 2 O 2 content. Together, these results indicate that both ionic species of Tl enhance cells reactive oxygen species production, decreasing mitochondrial functionality. These effects could partially be responsible for the loss of cell viability, and account for the metabolic alterations found in Tl intoxication

  13. Impaired immune function in children and adults with Fanconi anemia.

    Science.gov (United States)

    Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

    2017-11-01

    Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.

  14. Testing a Model of Functional Impairment in Telephone Crisis Support Workers.

    Science.gov (United States)

    Kitchingman, Taneile A; Wilson, Coralie J; Caputi, Peter; Wilson, Ian; Woodward, Alan

    2017-11-01

    It is well known that helping professionals experience functional impairment related to elevated symptoms of psychological distress as a result of frequent empathic engagement with distressed others. Whether telephone crisis support workers are impacted in a similar way is not currently reported in the literature. The purpose of this study was to test a hypothesized model of factors contributing to functional impairment in telephone crisis support workers. A national sample of 210 telephone crisis support workers completed an online survey including measures of emotion regulation, symptoms of general psychological distress and suicidal ideation, intentions to seek help for symptoms, and functional impairment. Structural equation modeling was used to test the fit of the data to the hypothesized model. Goodness-of-fit indices were adequate and supported the interactive effects of emotion regulation, general psychological distress, suicidal ideation, and intentions to seek help for ideation on functional impairment. These results warrant the deliberate management of telephone crisis support workers' impairment through service selection, training, supervision, and professional development strategies. Future research replicating and extending this model will further inform the modification and/or development of strategies to optimize telephone crisis support workers' well-being and delivery of support to callers.

  15. Impaired Functional Connectivity in the Prefrontal Cortex: A Mechanism for Chronic Stress-Induced Neuropsychiatric Disorders

    Directory of Open Access Journals (Sweden)

    Ignacio Negrón-Oyarzo

    2016-01-01

    Full Text Available Chronic stress-related psychiatric diseases, such as major depression, posttraumatic stress disorder, and schizophrenia, are characterized by a maladaptive organization of behavioral responses that strongly affect the well-being of patients. Current evidence suggests that a functional impairment of the prefrontal cortex (PFC is implicated in the pathophysiology of these diseases. Therefore, chronic stress may impair PFC functions required for the adaptive orchestration of behavioral responses. In the present review, we integrate evidence obtained from cognitive neuroscience with neurophysiological research with animal models, to put forward a hypothesis that addresses stress-induced behavioral dysfunctions observed in stress-related neuropsychiatric disorders. We propose that chronic stress impairs mechanisms involved in neuronal functional connectivity in the PFC that are required for the formation of adaptive representations for the execution of adaptive behavioral responses. These considerations could be particularly relevant for understanding the pathophysiology of chronic stress-related neuropsychiatric disorders.

  16. Lactobacillus frumenti Facilitates Intestinal Epithelial Barrier Function Maintenance in Early-Weaned Piglets

    Science.gov (United States)

    Hu, Jun; Chen, Lingli; Zheng, Wenyong; Shi, Min; Liu, Liu; Xie, Chunlin; Wang, Xinkai; Niu, Yaorong; Hou, Qiliang; Xu, Xiaofan; Xu, Baoyang; Tang, Yimei; Zhou, Shuyi; Yan, Yiqin; Yang, Tao; Ma, Libao; Yan, Xianghua

    2018-01-01

    Increased intestinal epithelial barrier function damages caused by early weaning stress have adverse effects on swine health and feed utilization efficiency. Probiotics have emerged as the promising antibiotic alternatives used for intestinal barrier function damage prevention. Our previous data showed that Lactobacillus frumenti was identified as a predominant Lactobacillus in the intestinal microbiota of weaned piglets. However, whether the intestinal epithelial barrier function in piglets was regulated by L. frumenti is still unclear. Here, piglets received a PBS vehicle or PBS suspension (2 ml, 108 CFU/ml) containing the L. frumenti by oral gavage once a day during the period of 6–20 days of age prior to early weaning. Our data demonstrated that oral administration of L. frumenti significantly improved the intestinal mucosal integrity and decreased the serum endotoxin and D-lactic acid levels in early-weaned piglets (26 days of age). The intestinal tight junction proteins (including ZO-1, Occludin, and Claudin-1) were significantly up-regulated by L. frumenti administration. The serum immunoglobulin G (IgG) levels, intestinal secretory immunoglobulin A (sIgA) levels, and interferon-γ (IFN-γ) levels were significantly increased by L. frumenti administration. Furthermore, our data revealed that oral administration of L. frumenti significantly increased the relative abundances of health-promoting microbes (including L. frumenti, Lactobacillus gasseri LA39, Parabacteroides distasonis, and Kazachstania telluris) and decreased the relative abundances of opportunistic pathogens (including Desulfovibrio desulfuricans and Candida humilis). Functional alteration of the intestinal bacterial community by L. frumenti administration was characterized by the significantly increased fatty acids and protein metabolism and decreased diseases-associated metabolic pathways. These findings suggest that L. frumenti facilitates intestinal epithelial barrier function maintenance

  17. Distinct patterns of brain function in children with isolated spelling impairment: new insights.

    Science.gov (United States)

    Gebauer, Daniela; Enzinger, Christian; Kronbichler, Martin; Schurz, Matthias; Reishofer, Gernot; Koschutnig, Karl; Kargl, Reinhard; Purgstaller, Christian; Fazekas, Franz; Fink, Andreas

    2012-06-01

    Studies investigating reading and spelling difficulties heavily focused on the neural correlates of reading impairments, whereas spelling impairments have been largely neglected so far. Hence, the aim of the present study was to investigate brain structure and function of children with isolated spelling difficulties. Therefore, 31 children, aged ten to 15 years, were investigated by means of functional MRI and DTI. This study revealed that children with isolated spelling impairment exhibit a stronger right hemispheric activation compared to children with reading and spelling difficulties and controls, when engaged in an orthographic decision task, presumably reflecting a highly efficient serial grapheme-phoneme decoding compensation strategy. In addition, children with spelling impairment activated bilateral inferior and middle frontal gyri during processing correctly spelled words and misspelled words, whereas the other two groups showed bilateral activation only in the misspelled condition, suggesting that additional right frontal engagement could be related to generally higher task demand and effort. DTI analyses revealed stronger frontal white matter integrity (fractional anisotropy) in controls (compared to spelling and reading impaired children), whereas no structural differences between controls and spelling impaired children were observed. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Effects of industrial detergents on the barrier function of human skin

    DEFF Research Database (Denmark)

    Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner

    2000-01-01

    Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...

  19. The blood-brain barrier and oncology : new insights into function and modulation

    NARCIS (Netherlands)

    Bart, J; Groen, HJM; Hendrikse, NH; van der Graaf, WTA; Vaalburg, W; de Vries, EGE

    2000-01-01

    The efficacy of chemotherapy for malignant primary or metastatic brain tumours is still poor. This is at least partly due to the presence of the blood-brain barrier (BBB). The functionality of the BBB can be explained by physicochemical features and efflux pump mechanisms. An overview of the

  20. Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

    Science.gov (United States)

    Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

    2000-08-01

    The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

  1. Modelling of migration from multi-layers and functional barriers: Estimation of parameters

    NARCIS (Netherlands)

    Dole, P.; Voulzatis, Y.; Vitrac, O.; Reynier, A.; Hankemeier, T.; Aucejo, S.; Feigenbaum, A.

    2006-01-01

    Functional barriers form parts of multi-layer packaging materials, which are deemed to protect the food from migration of a broad range of contaminants, e.g. those associated with reused packaging. Often, neither the presence nor the identity of the contaminants is known, so that safety assessment

  2. Pain and functional impairment 6 years after inguinal herniorrhaphy

    DEFF Research Database (Denmark)

    Aasvang, Eske Kvanner; Bay-Nielsen, Morten; Kehlet, Henrik

    2006-01-01

    2002 and June 2003 (n=1015) based upon the nationwide Danish Hernia Database collaboration. The response rate was 68.4%. Combined frequent and moderate or severe pain from the previous hernia site during activity was reported by 187 patients (18.4%). Pain during sexual activity was reported by 224...... and subsequent sexual dysfunction represent a clinically significant problem in about 3% of younger male patients with a previous inguinal herniorrhaphy. Intraoperative nerve damage and disposition to other chronic pain conditions are among the most likely pathogenic factors.......To determine the incidence of pain related sexual dysfunction 1 year after inguinal herniorrhaphy and to assess the impact pain has on sexual function. In contrast to the well-described about 10% risk of chronic wound related pain after inguinal herniorrhaphy, chronic genital pain, dysejaculation...

  3. Functional impairment in patients with sporadic Inclusion Body Myositis.

    Science.gov (United States)

    Dunlap, Heather V; Macneil, Lauren G; Tarnopolsky, Mark A

    2014-03-01

    We conducted a retrospective chart review of 53 patients diagnosed with sporadic Inclusion Body Myositis (sIBM) who have been followed at the McMaster Neuromuscular Clinic since 1996. We reviewed patient medical histories in order to compare our findings with similar cohorts, and analyzed quantitative strength data to determine functionality in guiding decisions related to gait assistive devices. Patient information was acquired through retrospective clinic chart review. Our study found knee extension strength decreased significantly as patients transitioned to using more supportive gait assistive devices (P cane)(P Falls and fear of falling poses a significant threat to patient physical well-being. The prevalence of dysphagia increased as patients required more supportive gait devices, and finally a significant negative correlation was found between time after onset and creatine kinase (CK) levels (P falling would be beneficial in preventing future falls and improving long-term patient outcomes.

  4. Barriers to timely diagnosis and treatment for children with hearing impairment in a southern Indian city: a qualitative study of parents and clinic staff.

    Science.gov (United States)

    Merugumala, Sri Vamshi; Pothula, Vijay; Cooper, Max

    2017-10-01

    In low income countries, deaf children are identified late due to the absence of a universal screening. Hearing impairment is a common yet neglected disability in India that leads to loss of speech and language. This qualitative study explored barriers to accessing appropriate hearing services in one city in southern India. To identify the barriers in timely management of deafness, 25 semi-structured interviews were conducted. Data were examined using Applied Thematic Analysis. Seventeen mothers of deaf children, primarily from low socioeconomic backgrounds, and eight staff members at a charitable hearing centre in Hyderabad. Barriers to accessing hearing services included failure to recognise deafness, the dominant role of elders in household decisions, belief that deafness would resolve, reassurance from a child's overall good health, lack of funds and transportation barriers to reach the centre particularly from rural areas. Parents frequently learned about services through word of mouth. The challenges to accessing appropriate services for deafness operate prior to presentation and include educational, cultural, navigational and financial barriers especially for those of lower socioeconomic status and residents of rural areas. The findings highlighted the need to raise awareness and implement wider screening programmes for early interventions.

  5. Longitudinal Modeling of Functional Decline Associated with Pathologic Alzheimer's Disease in Older Persons without Cognitive Impairment.

    Science.gov (United States)

    Wang, Dai; Schultz, Tim; Novak, Gerald P; Baker, Susan; Bennett, David A; Narayan, Vaibhav A

    2018-01-01

    Therapeutic research on Alzheimer's disease (AD) has moved to intercepting the disease at the preclinical phase. Most drugs in late development have focused on the amyloid hypothesis. To understand the magnitude of amyloid-related functional decline and to identify the functional domains sensitive to decline in a preclinical AD population. Data were from the Religious Orders Study and the Rush Memory and Aging Project. Cognitive decline was measured by a modified version of the Alzheimer's Disease Cooperative Study Preclinical Alzheimer Cognitive Composite. The trajectories of functional decline, as measured by the instrumental and basic activities of daily living, were longitudinally modeled in 484 participants without cognitive impairment at baseline and having both a final clinical and a postmortem neuropathology assessment of AD. Individuals with different final clinical diagnoses had different trajectories of cognitive and functional decline. Individuals with AD dementia, minor cognitive impairment, and no cognitive impairment had the most, intermediate, and least declines. While individuals with pathologic AD had significantly more cognitive decline over time than those without, the magnitude of difference in functional decline between these two groups was small. Functional domains such as handling finance and handling medications were more sensitive to decline. Demonstrating the functional benefit of an amyloid-targeting drug represents a significant challenge as elderly people experience functional decline due to a wide range of reasons with limited manifestation attributable to AD neuropathology. More sensitive functional scales focusing on the functional domains sensitive to decline in preclinical AD are needed.

  6. Functional Impairment and Changes in Depression Subtypes for Women in STAR*D: A Latent Transition Analysis

    Science.gov (United States)

    Rothschild, Anthony J.; Lapane, Kate L.

    2016-01-01

    Abstract Objective: To characterize the association between functional impairment and major depression subtypes at baseline and to characterize changes in subtypes by functional impairment level in women receiving citalopram in level 1 of the Sequenced Treatment Alternatives to Relieve Depression trial. Method: Women who completed baseline and week 12 study visits were included. Items from the self-reported Quick Inventory of Depressive Symptomatology were used to define the latent depression subtypes. The Work and Social Adjustment Scale was used to classify baseline functional impairment. A latent transition analysis model provided estimates of the prevalence of subtype membership and transition probabilities by functional impairment level. Results: Of the 755 women included, 69% had major functional impairment at baseline. Regardless of functional impairment level, the subtypes were differentiated by depression severity, appetite changes, psychomotor disturbances, and insomnia. Sixty-seven percent of women with normal/significant functional impairment and 60% of women with major impairment were likely to transition to a symptom resolution subtype at week 12. Women with baseline major impairment who were in the severe with psychomotor agitation subtype at the beginning of the study were least likely to transition to the symptom resolution subtype (4% chance). Conclusions: Functional impairment level was related to both the baseline depression subtype and the likelihood of moving to a different subtype. These results underscore the need to incorporate not only depression symptoms but also functioning in the assessment and treatment of depression. PMID:26488110

  7. Leptin concentration and risk of impaired physical function in older adults: the Seniors-ENRICA cohort.

    Science.gov (United States)

    Lana, Alberto; Struijk, Ellen; Guallar-Castillón, Pilar; Martín-Moreno, Jose María; Rodríguez Artalejo, Fernando; Lopez-Garcia, Esther

    2016-11-01

    leptin resistance, which may develop during the ageing process, stimulates the production of pro-inflammatory cytokines and insulin resistance that could impair the muscle function. However, the role of leptin on physical functioning among older adults has not yet been elucidated. to examine the association between serum leptin levels and physical function impairment in older adults. prospective study of 1,556 individuals 60 years and older from the Seniors-ENRICA cohort, who were free of physical function limitation at baseline. serum leptin was measured in 2008-10, and incident functional limitation was assessed through 2012. Self-reported limitations in agility and mobility were assessed with the Rosow and Breslau scale, limitation in the lower extremity function was measured with the Short Physical Performance Battery, and impairment in the overall physical performance with the physical component summary of the SF-12. after adjustment for potential confounders and compared to individuals in the lowest quartile of leptin concentration, those in the highest quartile showed increased risk of impaired physical function; the odds ratio (95% confidence interval) and P-trend was: 1.95 (1.11-3.43), P = 0.006 for self-reported impaired mobility; 1.76 (1.08-2.87), P = 0.02 for self-reported impaired agility; 1.48 (1.02-2.15), P = 0.04 for limitation in the lower extremity function; and 1.97 (1.20-3.22), P = 0.01, for decreased overall physical performance. These associations were only modestly explained by C-reactive protein and insulin resistance. Moreover, the associations held across groups with varying health status and were independent of estimated total body fat. higher leptin concentration was associated with increased risk of impaired physical function. Preserving metabolic function during the old age could help delaying physical function decline. © The Author 2016. Published by Oxford University Press on behalf of the British Geriatrics Society. All

  8. Coherence and Coupling Functions Reveal Microvascular Impairment in Treated Hypertension

    Directory of Open Access Journals (Sweden)

    Valentina Ticcinelli

    2017-10-01

    Full Text Available The complex interactions that give rise to heart rate variability (HRV involve coupled physiological oscillators operating over a wide range of different frequencies and length-scales. Based on the premise that interactions are key to the functioning of complex systems, the time-dependent deterministic coupling parameters underlying cardiac, respiratory and vascular regulation have been investigated at both the central and microvascular levels. Hypertension was considered as an example of a globally altered state of the complex dynamics of the cardiovascular system. Its effects were established through analysis of simultaneous recordings of the electrocardiogram (ECG, respiratory effort, and microvascular blood flow [by laser Doppler flowmetry (LDF]. The signals were analyzed by methods developed to capture time-dependent dynamics, including the wavelet transform, wavelet-based phase coherence, non-linear mode decomposition, and dynamical Bayesian inference, all of which can encompass the inherent frequency and coupling variability of living systems. Phases of oscillatory modes corresponding to the cardiac (around 1.0 Hz, respiratory (around 0.25 Hz, and vascular myogenic activities (around 0.1 Hz were extracted and combined into two coupled networks describing the central and peripheral systems, respectively. The corresponding spectral powers and coupling functions were computed. The same measurements and analyses were performed for three groups of subjects: healthy young (Y group, 24.4 ± 3.4 y, healthy aged (A group, 71.1 ± 6.6 y, and aged treated hypertensive patients (ATH group, 70.3 ± 6.7 y. It was established that the degree of coherence between low-frequency oscillations near 0.1 Hz in blood flow and in HRV time series differs markedly between the groups, declining with age and nearly disappearing in treated hypertension. Comparing the two healthy groups it was found that the couplings to the cardiac rhythm from both respiration and

  9. Respiratory impairment and the aging lung: a novel paradigm for assessing pulmonary function.

    Science.gov (United States)

    Vaz Fragoso, Carlos A; Gill, Thomas M

    2012-03-01

    Older persons have an increased risk of developing respiratory impairment because the aging lung is likely to have experienced exposures to environmental toxins as well as reductions in physiological capacity. Systematic review of risk factors and measures of pulmonary function that are most often considered when defining respiratory impairment in aging populations. Across the adult life span, there are frequent exposures to environmental toxins, including tobacco smoke, respiratory infections, air pollution, and occupational dusts. Concurrently, there are reductions in physiological capacity that may adversely affect ventilatory control, respiratory muscle strength, respiratory mechanics, and gas exchange. Recent work has provided a strong rationale for defining respiratory impairment as an age-adjusted reduction in spirometric measures of pulmonary function that are independently associated with adverse health outcomes. Specifically, establishing respiratory impairment based on spirometric Z-scores has been shown to be strongly associated with respiratory symptoms, frailty, and mortality. Alternatively, respiratory impairment may be defined by the peak expiratory flow, as measured by a peak flow meter. The peak expiratory flow, when expressed as a Z-score, has been shown to be strongly associated with disability and mortality. However, because it has a reduced diagnostic accuracy, peak expiratory flow should only define respiratory impairment when spirometry is not readily available or an older person cannot adequately perform spirometry. Aging is associated with an increased risk of developing respiratory impairment, which is best defined by spirometric Z-scores. Alternatively, in selected cases, respiratory impairment may be defined by peak expiratory flow, also expressed as a Z-score.

  10. Impaired insight into illness and cognitive insight in schizophrenia spectrum disorders: Resting state functional connectivity

    Science.gov (United States)

    Gerretsen, Philip; Menon, Mahesh; Mamo, David C.; Fervaha, Gagan; Remington, Gary; Pollock, Bruce G.; Graff-Guerrero, Ariel

    2015-01-01

    Background Impaired insight into illness (clinical insight) in schizophrenia has negative effects on treatment adherence and clinical outcomes. Schizophrenia is described as a disorder of disrupted brain connectivity. In line with this concept, resting state networks (RSNs) appear differentially affected in persons with schizophrenia. Therefore, impaired clinical, or the related construct of cognitive insight (which posits that impaired clinical insight is a function of metacognitive deficits), may reflect alterations in RSN functional connectivity (fc). Based on our previous research, which showed that impaired insight into illness was associated with increased left hemisphere volume relative to right, we hypothesized that impaired clinical insight would be associated with increased connectivity in the DMN with specific left hemisphere brain regions. Methods Resting state MRI scans were acquired for participants with schizophrenia or schizoaffective disorder (n = 20). Seed-to-voxel and ROI-to-ROI fc analyses were performed using the CONN-fMRI fc toolbox v13 for established RSNs. Clinical and cognitive insight were measured with the Schedule for the Assessment of Insight—Expanded Version and Beck Cognitive Insight Scale, respectively, and included as the regressors in fc analyses. Results As hypothesized, impaired clinical insight was associated with increased connectivity in the default mode network (DMN) with the left angular gyrus, and also in the self-referential network (SRN) with the left insula. Cognitive insight was associated with increased connectivity in the dorsal attention network (DAN) with the right inferior frontal cortex (IFC) and left anterior cingulate cortex (ACC). Conclusion Increased connectivity in DMN and SRN with the left angular gyrus and insula, respectively, may represent neural correlates of impaired clinical insight in schizophrenia spectrum disorders, and is consistent with the literature attributing impaired insight to left

  11. Gamma Radiation (5-10 Gy) Impairs Neuronal Function in the Guinea Pig Hippocampus

    Science.gov (United States)

    1993-01-01

    Radiation (5-10 Gy) Impairs Neuronal Function in the Guinea Pig Hippocampus TERRY C. PELLMAR AND DENNIS L. LEPINSKI Ph.vsiology Department..Irmned Forces...L. Gamma Radiation ioral effects. Within hours of irradiation with 10 Gy and (5- 10 Gy) Impairs Neuronal Function in the Guinea Pig Hippo- less...acti v- Guinea pigs were exposed to 5 and 10 Gy ’y radiation. Hippo- ity (9) are evident. campal brain slices were isolated 30 min, I day, 3 days and 5

  12. Moderate acute pancreatitis with pleural effusion and impaired kidney functions

    Science.gov (United States)

    Lumbantoruan, O. H.; Dairi, L. B.

    2018-03-01

    Acute pancreatitis is a pancreatic inflammatory reaction that is clinically characterized by acute abdominal pain accompanied by elevated amylase and lipase enzymes. A 57-year-old female patient came to the emergency department with the main complaint of localized pain in the epigastric region within the last three days. Blood pressure 130/90mmHg, pulse 90x/i, RR 20x/i, temperature 37°C, sub-icteric on the eyes and tenderness in the epigastric region. Laboratory findings were leukocytosis, increased amylase, and lipase, elevated liver enzymes, hypoalbuminemia, elevated Kidney Functions, acidosis, and hypoglycemia. Abdominal CT-Scan revealed a partially lobulated edge with solid and necrotic components of the caput pancreas and widespread suspicion to the pancreatic corpus. The mass appeared to cause widening of the biliary and intrahepatic systems with minimal right pleural effusion. The liverwas slightly enlarged. The patient was with acute pancreatitis and treated with the installation of an open nasogastric tube, and resuscitated with ringer lactate fluid followed by IVFD D5%. Patients fasted for three days before giving a low fat, protein diet, antibiotic and proton pump inhibitors for seven days. After nine days, amylase and lipase levels decreased with significant clinical improvement. The next three days, the patient was discharged.

  13. Impaired Arterial Smooth Muscle Cell Vasodilatory Function In Methamphetamine Users

    Directory of Open Access Journals (Sweden)

    Ghaemeh Nabaei

    2017-02-01

    Full Text Available Objectives: Methamphetamine use is a strong risk factor for stroke. This study was designed to evaluate arterial function and structure in methamphetamine users ultrasonographically. Methods: In a cross-sectional study, 20 methamphetamine users and 21 controls, aged between 20 and 40years, were enrolled. Common carotid artery intima-media thickness (CCA-IMT marker of early atherogenesis, flow-mediated dilatation (FMD determinants of endothelium-dependent vasodilation, and nitroglycerine-mediated dilatation (NMD independent marker of vasodilation were measured in two groups. Results: There were no significant differences between the two groups regarding demographic and metabolic characteristics. The mean (±SD CCA-IMT in methamphetamine users was 0.58±0.09mm, versus 0.59±0.07mm in the controls (p=0.84. Likewise, FMD% was not significantly different between the two groups [7.6±6.1% in methamphetamine users vs. 8.2±5.1% in the controls; p=0.72], nor were peak flow and shear rate after hyperemia. However, NMD% was considerably decreased in the methamphetamine users [8.5±7.8% in methamphetamine users vs. 13.4±6.2% in controls; p=0.03]. Conclusion: According to our results, NMD is reduced among otherwise healthy methamphetamine users, which represents smooth muscle dysfunction in this group. This may contribute to the high risk of stroke among methamphetamine users.

  14. A preliminary investigation of sleep quality in functional neurological disorders: Poor sleep appears common, and is associated with functional impairment.

    Science.gov (United States)

    Graham, Christopher D; Kyle, Simon D

    2017-07-15

    Functional neurological disorders (FND) are disabling conditions for which there are few empirically-supported treatments. Disturbed sleep appears to be part of the FND context; however, the clinical importance of sleep disturbance (extent, characteristics and impact) remains largely unknown. We described sleep quality in two samples, and investigated the relationship between sleep and FND-related functional impairment. We included a sample recruited online via patient charities (N=205) and a consecutive clinical sample (N=20). Participants completed validated measures of sleep quality and sleep characteristics (e.g. total sleep time, sleep efficiency), mood, and FND-related functional impairment. Poor sleep was common in both samples (89% in the clinical range), which was characterised by low sleep efficiency (M=65.40%) and low total sleep time (M=6.05h). In regression analysis, sleep quality was negatively associated with FND-related functional impairment, accounting for 16% of the variance and remaining significant after the introduction of mood variables. These preliminary analyses suggest that subjective sleep disturbance (low efficiency, short sleep) is common in FND. Sleep quality was negatively associated with the functional impairment attributed to FND, independent of depression. Therefore, sleep disturbance may be a clinically important feature of FND. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Impairment of male reproductive function after sleep deprivation.

    Science.gov (United States)

    Alvarenga, Tathiana A; Hirotsu, Camila; Mazaro-Costa, Renata; Tufik, Sergio; Andersen, Monica L

    2015-05-01

    To evaluate the influence of sleep loss on sexual behavior, hormone levels, sperm parameters, and testis-specific gene expression in male rats. Experimental research. Animal laboratory. Male adult Wistar-Hannover rats. Sexually experienced rats were subjected to paradoxic sleep deprivation (PSD) for 96 hours or sleep restriction (SR) for 21 days or kept in their home cage as control (CTRL). Sexual behavior, hormone levels, sperm parameters and expression of stress and nitric oxide-related genes were evaluated. PSD significantly decreased sexual behavior compared with the CTRL group, whereas SR had no effect. The PSD group had significantly lower testosterone levels than the CTRL group. Both PSD and SR groups had lower sperm viabilities than the CTRL group. The decrease in the number of live sperm compared with the CTRL group was larger in the PSD group than in the SR group. Regarding testicular gene expression, both PSD and SR led to an increase of iNOS and hydroxysteroid 11β-dehydrogenase 1 expressions compared with the CTRL group. These changes were more pronounced in the PSD group. A significant increase in endothelial nitric oxide synthase expression was observed in the PSD groups compared with the CTRL group. No changes were observed in dimethylarginine dimethylaminohydrolase 1 and casein kinase 2β-polypeptide expressions. Sleep loss can promote marked changes in the male reproductive system of rats, particularly affecting spermatic function in part by interfering in the testicular nitric oxide pathway. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  16. A study of the barrier function of the upper respiratory tract covering epithelium in the event of combined respiratory tract injuries

    International Nuclear Information System (INIS)

    Ivanov, Z.; Kolev, K.; Dermendzhiev, Kh.; Nikolova, M.; Kantardzhiev, V.

    1976-01-01

    Functional and morphologic impairment of upper respiratory tract mucous membranes after chronic exposure to the three major occupational noxious agents in ore mining - radon-222, silica dust, and respirable dust - has been studied experimentally. Over a 6-month period, rats were given daily treatments, with the agents applied either individually or in combination. Radon-222 (at 1 x 10 -10 Ci/l, corresponding to the maximum permissible concentrotion in uranium mine atmospheres) and respirable dust (dispersed silicogen at 100 mg/m 3 ) were administered four hours daily in toxicological chambers. Monodisperse silica dust was given by tracheal tube, at 50 mg in 1 ml of saline per rat. At the end of the treatment period, the barrier function of the respiratory epithelium was tested, and found to have been affected, by measuring beta radioactivity in blood following introduction into -the animal's nasopharynx of a 32 P-labelled staphylococcus culture. The most severe degree if impairment was found to result from simultaneous exposure to radon and respirable dust. Any of ti'e agents given individually caused a similar degree of impairment. Intratracheal administration of silicic acid anhydride appeared to have no deleterious consequences. The evidence for functional impairment was supported by histologic findings, indicating Jevelopment of ulcerous bronchitis, metaplasia of cylindrical epithelium, etc., after both individual and combined radon exposure. (A.B.)

  17. Relational Intimacy Mediates Sexual Outcomes Associated With Impaired Sexual Function: Examination in a Clinical Sample.

    Science.gov (United States)

    Witherow, Marta Parkanyi; Chandraiah, Shambhavi; Seals, Samantha R; Sarver, Dustin E; Parisi, Kathryn E; Bugan, Antal

    2017-06-01

    Relational intimacy is hypothesized to underlie the association between female sexual functioning and various sexual outcomes, and married women and women with sexual dysfunction have been generally absent from prior studies investigating these associations, thus restricting generalizability. To investigate whether relational intimacy mediates sexual outcomes (sexual satisfaction, coital frequency, and sexual distress) in a sample of married women with and without impaired sexual functioning presenting in clinical settings. Using a cross-sectional design, 64 heterosexual married women with (n = 44) and without (n = 20) impaired sexual functioning completed a battery of validated measurements assessing relational intimacy, sexual dysfunction, sexual frequency, satisfaction, and distress. Intimacy measurements were combined using latent factor scores before analysis. Bias-corrected mediation models of the indirect effect were used to test mediation effects. Moderated mediation models examined whether indirect effects were influenced by age and marital duration. Patients completed the Female Sexual Function Index, the Couple's Satisfaction Index, the Sexual Satisfaction Scale for Women, the Inclusion of the Other in the Self Scale, and the Miller Social Intimacy Test. Mediation models showed that impaired sexual functioning is associated with all sexual outcomes directly and indirectly through relational intimacy. Results were predominantly independent of age and marital duration. Findings have important treatment implications for modifying interventions to focus on enhancing relational intimacy to improve the sexual functioning of women with impaired sexual functioning. The importance of the role relational intimacy plays in broad sexual outcomes of women with impaired sexual functioning is supported in clinically referred and married women. Latent factor scores to improve estimation of study constructs and the use of contemporary mediation analysis also are

  18. Intrinsic motivation as a mediator between metacognition deficits and impaired functioning in psychosis.

    Science.gov (United States)

    Luther, Lauren; Firmin, Ruth L; Vohs, Jenifer L; Buck, Kelly D; Rand, Kevin L; Lysaker, Paul H

    2016-09-01

    Poor functioning has long been observed in individuals with psychosis. Recent studies have identified metacognition - one's ability to form complex ideas about oneself and others and to use that information to respond to psychological and social challenges-as being an important determinant of functioning. However, the exact process by which deficits in metacognition lead to impaired functioning remains unclear. This study first examined whether low intrinsic motivation, or the tendency to pursue novel experiences and to engage in self-improvement, mediates the relationship between deficits in metacognition and impaired functioning. We then examined whether intrinsic motivation significantly mediated the relationship when controlling for age, education, symptoms, executive functioning, and social cognition. Mediation models were examined in a cross-sectional data set. One hundred and seventy-five individuals with a psychotic disorder completed interview-based measures of metacognition, intrinsic motivation, symptoms, and functioning and performance-based measures of executive functioning and social cognition. Analyses revealed that intrinsic motivation mediated the relationship between metacognition deficits and impaired functioning (95% CI of indirect effect [0.12-0.43]), even after controlling for the aforesaid variables (95% CI of indirect effect [0.04-0.29]). Results suggest that intrinsic motivation may be a mechanism that underlies the link between deficits in metacognition and impaired functioning and indicate that metacognition and intrinsic motivation may be important treatment targets to improve functioning in individuals with psychosis. The findings of this study suggest that deficits in metacognition may indirectly lead to impaired functioning through their effect on intrinsic motivation in individuals with psychosis. Psychological treatments that target deficits in both metacognition and intrinsic motivation may help to alleviate impaired functioning in

  19. Residual symptoms and specific functional impairments in euthymic patients with bipolar disorder.

    Science.gov (United States)

    Samalin, Ludovic; de Chazeron, Ingrid; Vieta, Eduard; Bellivier, Frank; Llorca, Pierre-Michel

    2016-03-01

    The aims of the present study were to confirm the impact of residual symptoms on overall functioning in a large sample of euthymic patients with bipolar disorder in real-life conditions and to explore the relationship between residual symptoms and specific areas of functional impairment. This was a multicenter, cross-sectional, non-interventional study of euthymic outpatients with bipolar disorder. The Functioning Assessment Short Test was used to assess overall and specific domains of functioning (autonomy, occupational functioning, cognitive functioning, financial issues, interpersonal relationships, and leisure time). Various residual symptoms were assessed (residual mood symptoms, emotional dysregulation, sleep and sexual disorders, stigma, and perceived cognitive impairment). Logistic regression was used to determine the best model of association between functional domains and residual symptoms. Almost half of the 468 patients included (42%) had poor overall functioning. Residual depressive symptoms appeared to have an impact on overall functioning and in nearly all areas of functioning. In addition, specific residual symptoms had significantly more negative effects on some domains of functioning in euthymic patients with bipolar disorder (residual manic symptoms and occupational stigma on autonomy, emotional inhibition on occupational functioning, residual manic symptoms on financial issues, family stigma on interpersonal relationships, and sexual function and occupational stigma on leisure time). Our findings highlight the importance of evaluating overall functioning in clinical practice as well as functional domains. They also indicate that some residuals symptoms in patients with bipolar disorder should be targeted in personalized treatment plans, in order to improve functioning in the domains in which the patient is most impaired. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

    DEFF Research Database (Denmark)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

    2013-01-01

    antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

  1. Clinical measurement of various aspects of hearing impairment and their relation to auditory functioning: the development of an Auditory Profile

    NARCIS (Netherlands)

    van Esch, T.E.M.

    2013-01-01

    In terms of disability and handicap, problems in auditory function involve much more than a reduced sensitivity to soft sounds, the most commonly used measure of hearing impairment. In daily life, many hearing-impaired (HI) listeners suffer more from impaired processing of audible sounds, than from

  2. Major Depressive Disorder Is Associated with Broad Impairments on Neuropsychological Measures of Executive Function: A Meta-Analysis and Review

    Science.gov (United States)

    Snyder, Hannah R.

    2013-01-01

    Cognitive impairments are now widely acknowledged as an important aspect of major depressive disorder (MDD), and it has been proposed that executive function (EF) may be particularly impaired in patients with MDD. However, the existence and nature of EF impairments associated with depression remain strongly debated. Although many studies have…

  3. Glucose Transporters at the Blood-Brain Barrier: Function, Regulation and Gateways for Drug Delivery.

    Science.gov (United States)

    Patching, Simon G

    2017-03-01

    Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.

  4. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  5. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Science.gov (United States)

    Ling, Xiang; Linglong, Peng; Weixia, Du; Hong, Wei

    2016-01-01

    Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ). Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC). It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P zonulin release (P zonulin (P zonulin protein release and improvement of intestinal TJ integrity.

  6. Gender differences in associations between DSM-5 posttraumatic stress disorder symptom clusters and functional impairment in war veterans.

    Science.gov (United States)

    Meyer, Eric C; Konecky, Brian; Kimbrel, Nathan A; DeBeer, Bryann B; Marx, Brian P; Schumm, Jeremiah; Penk, Walter E; Gulliver, Suzy Bird; Morissette, Sandra B

    2018-05-01

    Understanding the links between posttraumatic stress disorder (PTSD) symptoms and functional impairment is essential for assisting veterans in transitioning to civilian life. Moreover, there may be differences between men and women in the relationships between PTSD symptoms and functional impairment. However, no prior studies have examined the links between functional impairment and the revised symptom clusters as defined in the Diagnostic and Statistical Manual of Mental Disorders, 5th ed. (DSM-5; American Psychiatric Association, 2013) or whether the associations between PTSD symptom clusters and functional impairment differ by gender. We examined the associations between the DSM-5 PTSD symptom clusters and functional impairment in 252 trauma-exposed Iraq and Afghanistan war veterans (79 females). Regression analyses included demographic factors and exposure to both combat and military sexual trauma as covariates. In the total sample, both the intrusions cluster (β = .18, p = .045) and the negative alterations in cognition and mood cluster (β = .45, p < .001) were associated with global functional impairment. Among male veterans, global functional impairment was associated only with negative alterations in cognition and mood (β = .52, p < .001). However, by contrast, among female veterans, only marked alterations in arousal and reactivity were associated with global functional impairment (β = .35, p = .027). These findings suggest that there may be important gender differences with respect to the relationship between PTSD symptoms and functional impairment. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  7. A prospective study of the impact of diabetes mellitus on restrictive and obstructive lung function impairment: The Saku study.

    Science.gov (United States)

    Sonoda, Nao; Morimoto, Akiko; Tatsumi, Yukako; Asayama, Kei; Ohkubo, Takayoshi; Izawa, Satoshi; Ohno, Yuko

    2018-05-01

    To assess the impact of diabetes on restrictive and obstructive lung function impairment. This 5-year prospective study included 7524 participants aged 40-69years without lung function impairment at baseline who underwent a comprehensive medical check-up between April 2008 and March 2009 at Saku Central Hospital. Diabetes was defined by fasting plasma glucose ≥7.0mmol/l (126mg/dl), HbA1c≥6.5% (48mmol/mol), or a history of diabetes, as determined by interviews conducted by the physicians. Restrictive and obstructive lung function impairment were defined as forced vital capacity (FVC) impairment or until March 2014. During the follow-up period, 171 and 639 individuals developed restrictive and obstructive lung function impairment, respectively. Individuals with diabetes had a 1.6-fold higher risk of restrictive lung function impairment than those without diabetes after adjusting for sex, age, height, abdominal obesity, smoking status, exercise habits, systolic blood pressure, HDL-cholesterol, log-transformed high-sensitivity C-reactive protein, and baseline lung function [multivariable-adjusted HR and 95% CI; 1.57 (1.04-2.36)]. In contrast, individuals with diabetes did not have a significantly higher risk of obstructive lung function impairment [multivariable-adjusted HR and 95% CI; 0.93 (0.72-1.21)]. Diabetes was associated with restrictive lung function impairment but not obstructive lung function impairment. Copyright © 2017. Published by Elsevier Inc.

  8. Chronic hindlimb ischemia impairs functional vasodilation and vascular reactivity in mouse feed arteries

    Directory of Open Access Journals (Sweden)

    Trevor R Cardinal

    2011-12-01

    Full Text Available Vasodilation of lower leg arterioles is impaired in animal models of chronic peripheral ischemia. In addition to arterioles, feed arteries are a critical component of the vascular resistance network, accounting for as much as 50% of the pressure drop across the arterial circulation. Despite the critical importance of feed arteries in blood flow control, the impact of ischemia on feed artery vascular reactivity is unknown. At 14 days following unilateral resection of the femoral-saphenous artery-vein pair, functional vasodilation of the profunda femoris artery was severely impaired, 11 ± 9% versus 152 ± 22%. Although endothelial and smooth muscle-dependent vasodilation were both impaired in ischemic arteries compared to control arteries (Ach: 40 ± 14% vs 81 ± 11%, SNP: 43 ± 12% vs and 85 ± 11%, the responses to acetylcholine and sodium nitroprusside were similar, implicating impaired smooth muscle-dependent vasodilation. Conversely, vasoconstriction responses to norepinephrine were not different between ischemic and control arteries, -68 ± 3% versus -66 ± 3%, indicating that smooth muscle cells were functional following the ischemic insult. Finally, maximal dilation responses to acetylcholine, in vitro, were significantly impaired in the ischemic artery compared to control, 71 ± 9% versus 97 ± 2%, despite a similar generation of myogenic tone to the same intravascular pressure (80 mmHg. These data indicate that ischemia impairs feed artery vasodilation by impairing the vascular wall’s responsiveness to vasodilating stimuli. Future studies to examine the mechanistic basis for these observations or treatment strategies to improve feed artery vasodilation following ischemia could provide the foundation for an alternative therapeutic paradigm for peripheral arterial occlusive disease.

  9. Impaired renal allograft function is associated with increased arterial stiffness in renal transplant recipients

    DEFF Research Database (Denmark)

    Kneifel, M; Scholze, A; Burkert, A

    2006-01-01

    It is important whether impairment of renal allograft function may deteriorate arterial stiffness in renal transplant recipients. In a cross-sectional study, arterial vascular characteristics were non-invasively determined in 48 patients with renal allograft using applanation tonometry and digital...

  10. Impaired skin capillary recruitment in essential hypertension is caused by both functional and structural capillary rarefaction

    NARCIS (Netherlands)

    Serne, EH; Gans, ROB; ter Maaten, JC; Tangelder, GJ; Donker, AJM; Stehouwer, CDA

    Capillary rarefaction occurs in many tissues in patients with essential hypertension and may contribute to an increased vascular resistance and impaired muscle metabolism. Rarefaction may be caused by a structural (anatomic) absence of capillaries, functional nonperfusion, or both. The aim of this

  11. The lifestyle of patients with chronic fatigue syndrome and the effect on fatigue and functional impairments

    NARCIS (Netherlands)

    Goedendorp, M. M.; Knoop, H.; Schippers, G. M.; Bleijenberg, G.

    2009-01-01

    Background: Little is known about the lifestyle of patients with chronic fatigue syndrome (CFS) and its influence on symptoms of CFS. The present study aimed to investigate the lifestyle of patients with CFS, and to assess whether lifestyle factors are related to fatigue and functional impairments.

  12. The lifestyle of patients with chronic fatigue syndrome and the effect on fatigue and functional impairments.

    NARCIS (Netherlands)

    Goedendorp, M.M.; Knoop, H.; Schippers, G.M.; Bleijenberg, G.

    2009-01-01

    BACKGROUND: Little is known about the lifestyle of patients with chronic fatigue syndrome (CFS) and its influence on symptoms of CFS. The present study aimed to investigate the lifestyle of patients with CFS, and to assess whether lifestyle factors are related to fatigue and functional impairments.

  13. Working Memory Functioning in Children with Learning Disorders and Specific Language Impairment

    Science.gov (United States)

    Schuchardt, Kirsten; Bockmann, Ann-Katrin; Bornemann, Galina; Maehler, Claudia

    2013-01-01

    Purpose: On the basis of Baddeley's working memory model (1986), we examined working memory functioning in children with learning disorders with and without specific language impairment (SLI). We pursued the question whether children with learning disorders exhibit similar working memory deficits as children with additional SLI. Method: In…

  14. "CONGENTIAL PANHYPOPITUITARISM ASSOCIATED WITH IMPAIRED LIVER FUNCTION TESTS AND CONGENITAL HEART DISEASE"

    Directory of Open Access Journals (Sweden)

    Z. Khalili-Matinzadeh

    2006-06-01

    Full Text Available The term congenital hypopituitarism defines deficiency of all of the pituitary hormones. Hypoglycemia and microphallus (in males are common findings, and some infants have shown evidence of the neonatal hepatitis syndrome. We report a case of congenital panhypopituitarism with deficiency of six major hormones and association with severe hypoglycemia, impaired liver function tests and congenital heart disease.

  15. Impaired hematopoietic stem cell functioning after serial transplantation and during normal aging

    NARCIS (Netherlands)

    Kamminga, LM; Van Os, R; Ausema, A; Noach, EJK; Weersing, E; Dontje, B; Vellenga, E; De Haan, G

    Adult somatic stem cells possess extensive self-renewal capacity, as their primary role is to replenish aged and functionally impaired tissues. We have previously shown that the stem cell pool in short-lived DBA/2 (D2) mice is reduced during aging, in contrast to long-lived C57BL/6 (136) mice. This

  16. Aberrant Topologies and Reconfiguration Pattern of Functional Brain Network in Children with Second Language Reading Impairment

    Science.gov (United States)

    Liu, Lanfang; Li, Hehui; Zhang, Manli; Wang, Zhengke; Wei, Na; Liu, Li; Meng, Xiangzhi; Ding, Guosheng

    2016-01-01

    Prior work has extensively studied neural deficits in children with reading impairment (RI) in their native language but has rarely examined those of RI children in their second language (L2). A recent study revealed that the function of the local brain regions was disrupted in children with RI in L2, but it is not clear whether the disruption…

  17. Lower-Extremity Function in Cognitively Healthy Aging, Mild Cognitive Impairment, and Alzheimer's Disease

    NARCIS (Netherlands)

    Eggermont, Laura H.; Gavett, Brandon E.; Volkers, Karin M.; Blankevoort, Christiaan G.; Scherder, Erik J.; Jefferson, Angela L.; Steinberg, Eric; Nair, Anil; Green, Robert C.; Stern, Robert A.

    Eggermont LH, Gavett BE, Volkers KM, Blankevoort CG, Scherder EJ, Jefferson AL, Steinberg E, Nair A, Green RC, Stern RA. Lower-extremity function in cognitively healthy aging, mild cognitive impairment, and Alzheimer's disease. Arch Phys Med Rehabil 2010;91:584-8. Objective: To examine differences

  18. Memory Functioning and Mental Verbs Acquisition in Children with Specific Language Impairment

    Science.gov (United States)

    Spanoudis, George C.; Natsopoulos, Demetrios

    2011-01-01

    Memory and language operate in synergy. Recent literature stresses the importance of memory functioning in interpreting language deficits. Two groups of 50 children each, ages 8-12 were studied. The first group included children with specific language impairment, while the participants in the second group were typically developing children. The…

  19. Validation of the baseline severity stratification of objective functional impairment in lumbar degenerative disc disease.

    Science.gov (United States)

    Stienen, Martin N; Smoll, Nicolas R; Joswig, Holger; Corniola, Marco V; Schaller, Karl; Hildebrandt, Gerhard; Gautschi, Oliver P

    2017-05-01

    OBJECTIVE The Timed Up and Go (TUG) test is a simple, objective, and standardized method to measure objective functional impairment (OFI) in patients with lumbar degenerative disc disease (DDD). The objective of the current work was to validate the OFI baseline severity stratification (BSS; with levels of "none," "mild," "moderate," and "severe"). METHODS Data were collected in a prospective IRB-approved 2-center study. Patients were assessed with a comprehensive panel of scales for measuring pain (visual analog scale [VAS] for back and leg pain), functional impairment (Roland-Morris Disability Index [RMDI] and Oswestry Disability Index [ODI]), and health-related quality of life (HRQOL; EQ-5D and SF-12). OFI BSS was determined using age- and sex-adjusted cutoff values. RESULTS A total of 375 consecutive patients scheduled for lumbar spine surgery were included. Each 1-step increase on the OFI BSS corresponded to an increase of 0.53 in the back pain VAS score, 0.69 in the leg pain VAS score, 1.81 points in the RMDI, and 5.93 points in the ODI, as well as to a decrease in HRQOL of -0.073 in the EQ-5D, -1.99 in the SF-12 physical component summary (PCS), and -1.62 in the SF-12 mental component summary (MCS; all p measure of functional impairment for use in daily clinical practice. The presence of OFI indicates the presence of significant functional impairment on subjective outcome measures.

  20. Degree of Exposure to Domestic Violence, Psychopathology, and Functional Impairment in Children and Adolescents

    Science.gov (United States)

    Fernandez, Eduard Bayarri; Ezpeleta, Lourdes; Granero, Roser; de la Osa, Nuria; Domenech, Josep Maria

    2011-01-01

    There are discrepancies about whether children who witness and suffer domestic violence (DV) have similar outcomes in terms of psychopathology. This work examines the relationship between different types of exposure to DV and child psychopathology and functional impairment. One hundred and forty-four Spanish children aged from 4 to 17 years and…

  1. Adaptive developmental assessment of young children with cognitive and/or functional impairments

    NARCIS (Netherlands)

    Visser, L.; Ruiter, S.A.J.; Timmerman, M.E.; Van der Meulen, B.F.; Ruijssenaars, A.J.J.M.

    2011-01-01

    The instrument being developed aims to give additional and more refined information about the developmental course of a child with a cognitive and / or functional impairment than is possible with existing tests. It will help tune interventions to the developmental course and potentials of a child.

  2. Application of the Mitrofanoff principle in children with severe impairment of bladder function

    NARCIS (Netherlands)

    Heij, H. A.; Ekkelkamp, S.; Moorman-Voestermans, C. G.; Vos, A.

    1997-01-01

    Treatment of children with severe impairment of bladder function requires a large-volume, low-pressure reservoir combined with a continent, easily catheterizable valve. The Mitrofanoff principle (MP) appears to meet these requirements. Between 1986 and 1993, the MP was applied in 15 children (4

  3. Postural Care for People with Intellectual Disabilities and Severely Impaired Motor Function: A Scoping Review

    Science.gov (United States)

    Robertson, Janet; Baines, Susannah; Emerson, Eric; Hatton, Chris

    2018-01-01

    Background: Poor postural care can have severe and life-threatening complications. This scoping review aims to map and summarize existing evidence regarding postural care for people with intellectual disabilities and severely impaired motor function. Method: Studies were identified via electronic database searches (MEDLINE, CINAHL, PsycINFO and…

  4. Co-Localisation of Abnormal Brain Structure and Function in Specific Language Impairment

    Science.gov (United States)

    Badcock, Nicholas A.; Bishop, Dorothy V. M.; Hardiman, Mervyn J.; Barry, Johanna G.; Watkins, Kate E.

    2012-01-01

    We assessed the relationship between brain structure and function in 10 individuals with specific language impairment (SLI), compared to six unaffected siblings, and 16 unrelated control participants with typical language. Voxel-based morphometry indicated that grey matter in the SLI group, relative to controls, was increased in the left inferior…

  5. Pharmacokinetics and pharmacodynamics of candesartan cilexetil in patients with normal to severely impaired renal function

    NARCIS (Netherlands)

    Buter, H; Navis, GY; Woittiez, AJJ; de Zeeuw, D; de Jong, PE

    Objective: We studied the pharmacokinetics and pharmacodynamics of single and multiple doses of candesartan cilexetil 8 mg per day in hypertensive patients with different degrees of renal function impairment. Candesartan is an angiotensin II subtype I (AT1) receptor antagonist that is administered

  6. Long-term effect of botulinum toxin on impairment and functional health in cervical dystonia

    NARCIS (Netherlands)

    Brans, J. W.; Lindeboom, R.; Aramideh, M.; Speelman, J. D.

    1998-01-01

    We investigated the long-term effect of botulinum toxin type A (BTA) on impairment as well as functional health in terms of disability, handicap, and quality of life in 64 patients with cervical dystonia. These patients, who first participated in a double-blind trial, were followed for another 12

  7. Impact of low vision rehabilitation on functional vision performance of children with visual impairment.

    Science.gov (United States)

    Ganesh, Suma; Sethi, Sumita; Srivastav, Sonia; Chaudhary, Amrita; Arora, Priyanka

    2013-09-01

    To evaluate the impact of low vision rehabilitation on functional vision of children with visual impairment. The LV Prasad-Functional Vision Questionnaire, designed specifically to measure functional performance of visually impaired children of developing countries, was used to assess the level of difficulty in performing various tasks pre and post visual rehabilitation in children with documented visual impairment. Chi-square test was used to assess the impact of rehabilitation intervention on functional vision performance; a P visual acuity prior to the introduction of low vision devices (LVDs) was 0.90 ± 0.05 for distance and for near it was 0.61 ± 0.05. After the intervention, the acuities improved significantly for distance (0.2 ± 0.27; P visual rehabilitation was especially found in those activities related to their studying lifestyle like copying from the blackboard (P visual rehabilitation, especially with those activities which are related to their academic output. It is important for these children to have an early visual rehabilitation to decrease the impairment associated with these decreased visual output and to enhance their learning abilities.

  8. Impact of low vision rehabilitation on functional vision performance of children with visual impairment

    Directory of Open Access Journals (Sweden)

    Suma Ganesh

    2013-01-01

    Conclusions: In our study group, there was a significant improvement in functional vision post visual rehabilitation, especially with those activities which are related to their academic output. It is important for these children to have an early visual rehabilitation to decrease the impairment associated with these decreased visual output and to enhance their learning abilities.

  9. Do people with chronic pain have impaired executive function? A meta-analytical review.

    Science.gov (United States)

    Berryman, Carolyn; Stanton, Tasha R; Bowering, K Jane; Tabor, Abby; McFarlane, Alexander; Moseley, G Lorimer

    2014-11-01

    A widely held belief within the clinical community is that chronic pain is associated with cognitive impairment, despite the absence of a definitive systematic review or meta-analysis on the topic. The current systematic review and meta-analysis aimed to establish the current evidence concerning the difference in executive function between people with chronic pain and healthy controls. Six databases were searched for citations related to executive function and chronic pain from inception to June 24, 2013. Two reviewers independently assessed studies for eligibility and extracted relevant data according to the Cochrane Collaboration and Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Twenty five studies were included in the review and twenty two studies in the meta-analysis. A small to moderate impairment in executive function performance was found in people with chronic pain across cognitive components, although all studies had a high risk of bias. The current evidence suggests impairment of executive function in people with chronic pain, however, important caveats exist. First, executive function involves many cognitive components and there is no standard test for it. Second, moderators of executive function, such as medication and sleep, were seldom controlled for in studies of executive function performance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Why is impaired sexual function distressing to women? The primacy of pleasure in female sexual dysfunction.

    Science.gov (United States)

    Stephenson, Kyle R; Meston, Cindy M

    2015-03-01

    Recent research has highlighted a complex association between female sexual function and subjective distress regarding sexual activity. These findings are difficult to explain given limited knowledge as to the mechanisms through which impaired sexual function causes distress. The current study assessed whether a number of specific consequences of impaired sexual function, including decreased physical pleasure, disruption of sexual activity, and negative partner responses, mediated the association between sexual function and distress. Eighty-seven women in sexually active relationships reporting impairments in sexual function completed validated self-report measures and daily online assessments of sexual experiences. Participants completed the Sexual Satisfaction Scale for Women, the Female Sexual Function Index, and the Measure of Sexual Consequences. Results suggested that decreased physical pleasure and disruption of sexual activity, but not partner responses, statistically mediated the association between sexual function and distress. Sexual consequences represent potential maintaining factors of sexual dysfunction that are highly distressing to women. Results are discussed in the context of theoretical models of sexual dysfunction and related treatments. © 2014 International Society for Sexual Medicine.

  11. The effect of negative affect on cognition: Anxiety, not anger, impairs executive function.

    Science.gov (United States)

    Shields, Grant S; Moons, Wesley G; Tewell, Carl A; Yonelinas, Andrew P

    2016-09-01

    It is often assumed that negative affect impairs the executive functions that underlie our ability to control and focus our thoughts. However, support for this claim has been mixed. Recent work has suggested that different negative affective states like anxiety and anger may reflect physiologically separable states with distinct effects on cognition. However, the effects of these 2 affective states on executive function have never been assessed. As such, we induced anxiety or anger in participants and examined the effects on executive function. We found that anger did not impair executive function relative to a neutral mood, whereas anxiety did. In addition, self-reports of induced anxiety, but not anger, predicted impairments in executive function. These results support functional models of affect and cognition, and highlight the need to consider differences between anxiety and anger when investigating the influence of negative affect on fundamental cognitive processes such as memory and executive function. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  12. The role of executive functions in social impairment in Autism Spectrum Disorder.

    Science.gov (United States)

    Leung, Rachel C; Vogan, Vanessa M; Powell, Tamara L; Anagnostou, Evdokia; Taylor, Margot J

    2016-01-01

    Autism Spectrum Disorder (ASD) is a neurodevelopmental disorder characterized by socio-communicative impairments. Executive dysfunction may explain some key characteristics of ASD, both social and nonsocial hallmarks. Limited research exists exploring the relations between executive function and social impairment in ASD and few studies have used a comparison control group. Thus, the objective of the present study was to investigate the relations between executive functioning using the Behavioral Rating Inventory of Executive Functioning (BRIEF), social impairment as measured by the Social Responsiveness Scale (SRS), and overall autistic symptomology as measured by the Autism Diagnostic Observation Schedule (ADOS) in children and adolescents with and without ASD. Seventy children and adolescents diagnosed with ASD and 71 typically developing controls were included in this study. Findings showed that behavioral regulation executive processes (i.e., inhibition, shifting, and emotional control) predicted social function in all children. However, metacognitive executive processes (i.e., initiation, working memory, planning, organization, and monitoring) predicted social function only in children with ASD and not in typically developing children. Our findings suggest a distinct metacognitive executive function-social symptom link in ASD that is not present in the typical population. Understanding components of executive functioning that contribute to the autistic symptomology, particularly in the socio-communicative domain, is crucial for developing effective interventions that target key executive processes as well as underlying behavioral symptoms.

  13. Proton nuclear magnetic resonance study on the barrier function of pig corneal epithelium and endothelium

    International Nuclear Information System (INIS)

    Yokoi, Norihiko; Kinoshita, Shigeru; Morimoto, Taketoshi; Yoshizaki, Kazuo.

    1995-01-01

    Using gadolinium diethylenetriaminepentaacetic acid (Gd-DTPA) as a tracer, the barrier function of the corneal epithelium and endothelium was evaluated by proton nuclear magnetic resonance. Whole pig eyes and cornea excised with scleral rim, which had been incubated in dextran-added Gd-DTPA solution, were subjected to T 1 relaxation measurement and magnetic resonance imaging (MRI). After incubation, the T 1 relaxation rate (1/T 1 ) of the excised cornea increased to a steady value, whereas that of the cornea from the whole eye increased only slightly. These results indicated that the increase in the T 1 relaxation rate of the excised cornea was attributable to Gd-DTPA penetration from the corneal endothelium and that the corneal epithelium exhibited a strong barrier function against Gd-DTPA entry. The MRI study also confirmed the strong barrier, enhanced signals being detected within the aqueous fluid in the T 1 -weighted image only when the corneal epithelium was abraded. Since Gd-DTPA scarcely penetrates the intact corneal epithelium, Gd-DTPA-enhanced MRI shows potential as a quantitative tracer in evaluating epithelial barrier disruption. (author)

  14. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Effect of atomoxetine on executive function impairments in adults with ADHD.

    Science.gov (United States)

    Brown, Thomas E; Holdnack, James; Saylor, Keith; Adler, Lenard; Spencer, Thomas; Williams, David W; Padival, Anoop K; Schuh, Kory; Trzepacz, Paula T; Kelsey, Douglas

    2011-02-01

    To assess the effect of atomoxetine on ADHD-related executive functions over a 6-month period using the Brown Attention-Deficit Disorder Scale (BADDS) for Adults, a normed, 40-item, self-report scale in a randomized, double-blind, placebo-controlled clinical trial. In a randomized, double-blind clinical trial, adults with ADHD received either atomoxetine 25 to 100 mg/day or placebo for 6 months. Patients completed the BADDS to report their current daily functioning in 5 clusters of ADHD-related impairments of executive functioning: (1) Organizing and Activating to Work; (2) Focusing for Tasks; (3) Regulating Alertness and Effort; (4) Modulating Emotions; and (5) Utilizing Working Memory. Mean scores were significantly more improved in the atomoxetine group compared to the placebo group: total score, -27.0 versus -19.0 (p executive function impairments in adults with ADHD as assessed by the BADDS.

  16. Impaired behavioral and neurocognitive function in preschool children with obstructive sleep apnea.

    Science.gov (United States)

    Landau, Yael E; Bar-Yishay, Orit; Greenberg-Dotan, Sari; Goldbart, Aviv D; Tarasiuk, Ariel; Tal, Asher

    2012-02-01

    We aimed to examine the hypothesis that behavioral and neurocognitive functions of preschool children with Obstructive Sleep Apnea Syndrome (OSAS) are impaired compared to healthy children, and improve after adenotonsillectomy (TA). A comprehensive assessment battery was used to assess cognitive and behavioral functions, and quality of life in children with OSAS compared to matched controls. 45 children (mean age 45.5 ± 9 months, 73% boys, BMI 15.7 ± 2) with OSAS were compared to 26 healthy children (mean age 48.6 ± 8 months, 46% boys, BMI 16.4 ± 2). Mean AHI in the OSAS group was 13.2 ± 10.7 (ranging from 1.2 to 57). Significantly impaired planning and fluency (executive function) were found in children with OSAS, as well as impaired attention and receptive vocabulary. Parents and teachers described the OSAS group as having significantly more behavior problems. Quality of life questionnaire in children with OSAS (mean 2.3, range 0.7-4.3) was significantly worse compared to controls (mean 0, range: 0-4), P improvement was documented in verbal and motor fluency, sustained attention, and vocabulary. After TA, fewer behavioral problems were seen. Preschool children with OSAS present significantly impaired executive functions, impaired attention and receptive vocabulary, and more behavior problems. One year after TA, the prominent improvements were in behavior and quality of life. These findings suggest that the impact of OSAS on behavioral and cognitive functions begins in early childhood. Copyright © 2011 Wiley Periodicals, Inc.

  17. Predictors of impaired work functioning in employees with major depression in remission.

    Science.gov (United States)

    de Vries, Gabe; Koeter, Maarten W J; Nieuwenhuijsen, Karen; Hees, Hiske L; Schene, Aart H

    2015-10-01

    This study aims to (i) assess work functioning in employees returning to work with a major depression in remission, (ii) study the predictors of impaired work functioning. Participants diagnosed with major depressive disorder (MDD), on long term sick leave (mean 27 weeks) and treated in a specialized mental healthcare setting, were selected from an intervention study sample. They were eligible for this study if they were remitted from their depression and had returned to work for at least 50% of their contract hours at 18 month follow-up. Work functioning was assessed with the Work Limitations Questionnaire (WLQ) and the Need For Recovery scale (NFR). Potential predictors of impaired work functioning were demographic characteristics (assessed at baseline), health characteristics (assessed at baseline, six and twelve month follow-up), and personality- and work characteristics (assessed at 18 month follow-up). After their return to work with MDD in remission, employees were on average still impaired in their work functioning. Personality characteristics were the strongest predictor of this impaired work functioning, followed by health and work characteristics. In the final prediction model, only a passive reaction coping style remained as predictor. We used self-report data with respect to work functioning and work characteristics and not an assessment by a supervisor. Personality trait, coping style, and ability to manage the work environment should be addressed in mental health and return-to-work interventions. Subsequent improved work functioning may be beneficial for mental health and may reduce societal costs. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. [Family functionality regarding the elderly with cognitive impairments: the caretaker's perception].

    Science.gov (United States)

    dos Santos, Ariene Angelini; Pavarini, Sofia Cristina Iost

    2012-10-01

    The objectives of this study were to characterize the caregivers of elderly individuals with cognitive impairment living in different contexts of social vulnerability, and assess the family functionality of the elderly as perceived by the caregivers. Family functionality was evaluated using the Family APGAR instrument, assessed during home interviews with 72 caretakers. All the ethical aspects were observed. Spearman's correlation and the Mann-Whitney test were used, with 5% significance level (poverload in the context of elderly persons with dementia.

  19. The progress of functional neuroimaging in the study of mild cognitive impairment

    International Nuclear Information System (INIS)

    Li Zugui

    2006-01-01

    Mild cognitive impairment (MCI) represents a transitional state between healthy aging and very mild Alzheimer's disease. MCI patients have a substantially higher rate of progression to Alzheimer's disease compared with cognitively normal elderly people. Functional neutroimaging modalities, including PET, SPECT and functional MRI show that MCI patients have special abnormalities in brain metabolism and perfusion, so they can offer great value in the predicting cognitive decline and early diagnosis of dementia. (authors)

  20. The Effect of Negative Affect on Cognition: Anxiety, Not Anger, Impairs Executive Function

    OpenAIRE

    Shields, Grant S.; Moons, Wesley G.; Tewell, Carl A.; Yonelinas, Andrew P.

    2016-01-01

    It is often assumed that negative affect impairs the executive functions that underlie our ability to control and focus our thoughts. However, support for this claim has been mixed. Recent work has suggested that different negative affective states like anxiety and anger may reflect physiologically separable states with distinct effects on cognition. However, the effects of these two affective states on executive function have never been assessed. As such, we induced anxiety or anger in parti...

  1. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2016-05-01

    Full Text Available Propolis has abundant polyphenolic constituents and is used widely as a health/functional food. Here, we investigated the effects of polyphenol-rich propolis extracts (PPE on intestinal barrier function in human intestinal epithelial Caco-2 cells, as well as in rats. In Caco-2 cells, PPE increased transepithelial electrical resistance and decreased lucifer yellow flux. PPE-treated cells showed increased expression of the tight junction (TJ loci occludin and zona occludens (ZO-1. Confocal microscopy showed organized expressions in proteins related to TJ assembly, i.e., occludin and ZO-1, in response to PPE. Furthermore, PPE led to the activation of AMPK, ERK1/2, p38, and Akt. Using selective inhibitors, we found that the positive effects of PPE on barrier function were abolished in cells in which AMPK and ERK1/2 signaling were inhibited. Moreover, rats fed a diet supplemented with PPE (0.3% in the diet exhibited increased colonic epithelium ZO-1 expression. Overall, these data suggest that PPE strengthens intestinal barrier function by activating AMPK and ERK signaling and provide novel insights into the potential application of propolis for human gut health.

  2. Subacute stress and chronic stress interact to decrease intestinal barrier function in rats.

    Science.gov (United States)

    Lauffer, Adriana; Vanuytsel, Tim; Vanormelingen, Christophe; Vanheel, Hanne; Salim Rasoel, Shadea; Tóth, Joran; Tack, Jan; Fornari, Fernando; Farré, Ricard

    2016-01-01

    Psychological stress increases intestinal permeability, potentially leading to low-grade inflammation and symptoms in functional gastrointestinal disorders. We assessed the effect of subacute, chronic and combined stress on intestinal barrier function and mast cell density. Male Wistar rats were allocated to four experimental groups (n = 8/group): 1/sham; 2/subacute stress (isolation and limited movement for 24 h); 3/chronic crowding stress for 14 days and 4/combined subacute and chronic stress. Jejunum and colon were collected to measure: transepithelial electrical resistance (TEER; a measure of epithelial barrier function); gene expression of tight junction molecules; mast cell density. Plasma corticosterone concentration was increased in all three stress conditions versus sham, with highest concentrations in the combined stress condition. TEER in the jejunum was decreased in all stress conditions, but was significantly lower in the combined stress condition than in the other groups. TEER in the jejunum correlated negatively with corticosterone concentration. Increased expression of claudin 1, 5 and 8, occludin and zonula occludens 1 mRNAs was detected after subacute stress in the jejunum. In contrast, colonic TEER was decreased only after combined stress, and the expression of tight junction molecules was unaltered. Increased mast cell density was observed in the chronic and combined stress condition in the colon only. In conclusion, our data show that chronic stress sensitizes the gastrointestinal tract to the effects of subacute stress on intestinal barrier function; different underlying cellular and molecular alterations are indicated in the small intestine versus the colon.

  3. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

    Science.gov (United States)

    Fasano, Alessio

    2011-01-01

    The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

  4. The role of cognitive impairment in psychosocial functioning in remitted depression.

    Science.gov (United States)

    Knight, Mattew J; Air, Tracy; Baune, Bernhard T

    2018-08-01

    Cognitive dysfunction is a prevalent and disabling symptom of Major Depressive Disorder (MDD), and is often retained in the remitted stage of illness. Emerging evidence suggests that cognitive impairment may be associated with dysfunction in a number of psychosocial domains (e.g., workplace productivity, social relationships). The current study explored the relationship between cognition and psychosocial functioning in remitted MDD and in healthy controls. Data were obtained from 182 participants of the Cognitive Function and Mood Study (CoFaM-S), a cross-sectional study of cognition, mood, and social cognition in mood disorders. Participants' (Remitted MDD n = 72, Healthy n = 110) cognition was assessed with a battery of cognitive tests including the Repeatable Battery for the Assessment of Neuropsychological Function (RBANS) and other standard measures of cognition (e.g., The Tower of London task). Psychosocial functioning was clinically evaluated with the Functioning Assessment Short Test (FAST). The results indicated that executive functioning was the strongest independent predictor of functioning in remitted MDD patients, whereas various cognitive domains predicted psychosocial functioning in healthy individuals. Psychosocial functioning was measured with a clinical interview, and was therefore reliant on clinicians' judgement of impairment, as opposed to more objective measures of functioning. These findings suggest that executive cognition plays an important role in functional recovery in remitted depression, and may be a crucial target in adjunctive treatment. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Functional implications of corticospinal tract impairment on gait after spinal cord injury

    DEFF Research Database (Denmark)

    Barthélemy, Dorothy; Knudsen, Hanne; Willerslev-Olsen, Maria

    2013-01-01

    elevation with clinical physiotherapy tests.Setting:Cross-sectional study, laboratory and clinical settings.Methods:A total of 24 individuals with SCI (American Spinal Injury Association (ASIA) Impairment Scale D) were recruited. Maximum toe elevation during the swing phase of treadmill gait was measured...... indicate that maximum toe elevation, which is directly correlated with CST impairment, is functionally relevant as it also correlates with timed clinical tests, LEMS and sensory scores.Spinal Cord advance online publication, 13 August 2013; doi:10.1038/sc.2013.84....

  6. Executive functioning impairment in women treated with chemotherapy for breast cancer: a systematic review.

    Science.gov (United States)

    Yao, Christie; Bernstein, Lori J; Rich, Jill B

    2017-11-01

    Women with breast cancer have reported adverse cognitive effects following chemotherapy. Evidence is mixed on whether executive functioning is particularly impaired in women treated with chemotherapy, in part due to the wide range of tasks used to measure executive processes. We performed a systematic review of the published literature to evaluate whether some subcomponents of executive functioning are more vulnerable to impairment than others among breast cancer survivors who had been treated with chemotherapy. Studies published as of April 2017 were identified using three electronic databases (MEDLINE, PsycINFO, and Web of Science) and a manual search of relevant reference lists. The methodological quality of included studies was assessed using a checklist of predefined criteria. Of 1280 identified articles, a total of 41 were included for review. Study findings were categorized into three primary subdomains of executive functioning: inhibition, shifting, and updating. Although there was heterogeneity in the neuropsychological measures used to assess executive functioning, tests could be grouped into the subcomponents they assessed. Inhibition appears relatively spared from the effects of chemotherapy, whereas impairments in shifting and updating are more commonly found following chemotherapy. Examination of subcomponents of executive functioning is recommended to better characterize the nature of executive dysfunction in women treated with chemotherapy. Future studies should include executive functioning tasks of varying complexity, use of multiple tasks to increase reliability, and alternative indices to capture performance, such as within-person variability.

  7. Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

    Science.gov (United States)

    Sturgeon, Craig; Fasano, Alessio

    2016-01-01

    Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

  8. Concerted regulation of retinal pigment epithelium basement membrane and barrier function by angiocrine factors.

    Science.gov (United States)

    Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique

    2017-05-19

    The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.

  9. Internal resistor of multi-functional tunnel barrier for selectivity and switching uniformity in resistive random access memory.

    Science.gov (United States)

    Lee, Sangheon; Woo, Jiyong; Lee, Daeseok; Cha, Euijun; Hwang, Hyunsang

    2014-01-01

    In this research, we analyzed the multi-functional role of a tunnel barrier that can be integrated in devices. This tunnel barrier, acting as an internal resistor, changes its resistance with applied bias. Therefore, the current flow in the devices can be controlled by a tunneling mechanism that modifies the tunnel barrier thickness for non-linearity and switching uniformity of devices. When a device is in a low-resistance state, the tunnel barrier controls the current behavior of the device because most of the bias is applied to the tunnel barrier owing to its higher resistance. Furthermore, the tunnel barrier induces uniform filament formation during set operation with the tunnel barrier controlling the current flow.

  10. Protective Effects of Edaravone in Adult Rats with Surgery and Lipopolysaccharide Administration-Induced Cognitive Function Impairment.

    Directory of Open Access Journals (Sweden)

    Peiqi Wang

    Full Text Available Postoperative cognitive dysfunction (POCD is a clinical syndrome characterized by cognitive declines in patients after surgery. Previous studies have suggested that surgery contributed to such impairment. It has been proven that neuroinflammation may exacerbate surgery-induced cognitive impairment in aged rats. The free radical scavenger edaravone has high blood brain barrier permeability, and was demonstrated to effectively remove free radicals from the brain and alleviate the development of POCD in patients undergoing carotid endarterectomy, suggesting its potential role in preventing POCD. For this reason, this study was designed to determine whether edaravone is protective against POCD through its inhibitory effects on inflammatory cytokines and oxidative stress. First, Sprague Dawley adult male rats were administered 3 mg/kg edaravone intraperitoneally after undergoing a unilateral nephrectomy combined with lipopolysaccharide injection. Second, behavioral parameters related to cognitive function were recorded by fear conditioning and Morris Water Maze tests. Last, superoxide dismutase activities and malondialdehyde levels were measured in the hippocampi and prefrontal cortex on postoperative days 3 and 7, and microglial (Iba1 activation, p-Akt and p-mTOR protein expression, and synaptic function (synapsin 1 were also examined 3 and 7 days after surgery. Rats that underwent surgery plus lipopolysaccharide administration showed significant impairments in spatial and working memory, accompanied by significant reductions in hippocampal-dependent and independent fear responses. All impairments were attenuated by treatment with edaravone. Moreover, an abnormal decrease in superoxide dismutase activation, abnormal increase in malondialdehyde levels, significant increase in microglial reactivity, downregulation of p-Akt and p-mTOR protein expression, and a statistically significant decrease in synapsin-1 were observed in the hippocampi and

  11. Protective Effects of Edaravone in Adult Rats with Surgery and Lipopolysaccharide Administration-Induced Cognitive Function Impairment.

    Science.gov (United States)

    Wang, Peiqi; Cao, Jiangbei; Liu, Na; Ma, Li; Zhou, Xueyue; Zhang, Hong; Wang, Yongan

    2016-01-01

    Postoperative cognitive dysfunction (POCD) is a clinical syndrome characterized by cognitive declines in patients after surgery. Previous studies have suggested that surgery contributed to such impairment. It has been proven that neuroinflammation may exacerbate surgery-induced cognitive impairment in aged rats. The free radical scavenger edaravone has high blood brain barrier permeability, and was demonstrated to effectively remove free radicals from the brain and alleviate the development of POCD in patients undergoing carotid endarterectomy, suggesting its potential role in preventing POCD. For this reason, this study was designed to determine whether edaravone is protective against POCD through its inhibitory effects on inflammatory cytokines and oxidative stress. First, Sprague Dawley adult male rats were administered 3 mg/kg edaravone intraperitoneally after undergoing a unilateral nephrectomy combined with lipopolysaccharide injection. Second, behavioral parameters related to cognitive function were recorded by fear conditioning and Morris Water Maze tests. Last, superoxide dismutase activities and malondialdehyde levels were measured in the hippocampi and prefrontal cortex on postoperative days 3 and 7, and microglial (Iba1) activation, p-Akt and p-mTOR protein expression, and synaptic function (synapsin 1) were also examined 3 and 7 days after surgery. Rats that underwent surgery plus lipopolysaccharide administration showed significant impairments in spatial and working memory, accompanied by significant reductions in hippocampal-dependent and independent fear responses. All impairments were attenuated by treatment with edaravone. Moreover, an abnormal decrease in superoxide dismutase activation, abnormal increase in malondialdehyde levels, significant increase in microglial reactivity, downregulation of p-Akt and p-mTOR protein expression, and a statistically significant decrease in synapsin-1 were observed in the hippocampi and prefrontal cortices of

  12. Home blood pressure predicts stroke incidence among older adults with impaired physical function: the Ohasama study.

    Science.gov (United States)

    Murakami, Keiko; Asayama, Kei; Satoh, Michihiro; Hosaka, Miki; Matsuda, Ayako; Inoue, Ryusuke; Tsubota-Utsugi, Megumi; Murakami, Takahisa; Nomura, Kyoko; Kikuya, Masahiro; Metoki, Hirohito; Imai, Yutaka; Ohkubo, Takayoshi

    2017-12-01

    Several observational studies have found modifying effects of functional status on the association between conventional office blood pressure (BP) and adverse outcomes. We aimed to examine whether the association between higher BP and stroke was attenuated or inverted among older adults with impaired function using self-measured home BP measurements. We followed 501 Japanese community-dwelling adults aged at least 60 years (mean age, 68.6 years) with no history of stroke. Multivariate-adjusted hazard ratios for 1-SD increase in home BP and office BP measurements were calculated by the Cox proportional hazards model. Functional status was assessed by self-reported physical function. During a median follow-up of 11.5 years, first strokes were observed in 47 participants. Higher home SBP, but not office SBP, was significantly associated with increased risk of stroke among both 349 participants with normal physical function and 152 participants with impaired physical function [hazard ratio (95% confidence interval) per 14.4-mmHg increase: 1.74 (1.12-2.69) and 1.77 (1.06-2.94), respectively], with no significant interaction for physical function (P = 0.56). Higher home DBP, but not office DBP, was also significantly associated with increased risk of stroke (P ≤ 0.029) irrespective of physical function (all P > 0.05 for interaction). Neither home BP nor office BP was significantly associated with all-cause mortality irrespective of physical function. Higher home BP was associated with increased risk of stroke even among those with impaired physical function. Measurements of home BP would be useful for stroke prevention, even after physical function decline.

  13. Association of functional variations in COMT and GCH1 genes with postherniotomy pain and related impairment

    DEFF Research Database (Denmark)

    Belfer, Inna; Dai, Feng; Kehlet, Henrik

    2015-01-01

    Persistent postoperative pain is a well-established clinical problem with potential severe personal and socioeconomic implications. The prevalence of persistent pain varies across surgery types. Severe persistent pain and related impairment occur in 5% to 10% of patients after groin hernia repair....... The substantial interindividual variability in pain-related phenotypes within each surgery type cannot be explained by environmental factors alone, suggesting that genetic variation may play a role. We investigated the contribution of COMT and GCH1 to persistent postherniotomy pain (PPP)-related functional...... moderate-to-severe pain-related activity impairment 6 months postoperatively as measured by Activity Assessment Scale (≥8.3). Patients with the G allele of COMT SNP rs6269 and C allele of COMT SNP rs4633 had less impairment (P = 0.03 and 0.01, respectively); in addition, the COMT haplotype GCG...

  14. Endothelium-Derived 5-Methoxytryptophan Protects Endothelial Barrier Function by Blocking p38 MAPK Activation.

    Directory of Open Access Journals (Sweden)

    Ling-Yun Chu

    Full Text Available The endothelial junction is tightly controlled to restrict the passage of blood cells and solutes. Disruption of endothelial barrier function by bacterial endotoxins, cytokines or growth factors results in inflammation and vascular damage leading to vascular diseases. We have identified 5-methoxytryptophan (5-MTP as an anti-inflammatory factor by metabolomic analysis of conditioned medium of human fibroblasts. Here we postulated that endothelial cells release 5-MTP to protect the barrier function. Conditioned medium of human umbilical vein endothelial cells (HUVECs prevented endothelial hyperpermeability and VE-cadherin downregulation induced by VEGF, LPS and cytokines. We analyzed the metabolomic profile of HUVEC conditioned medium and detected 5-MTP but not melatonin, serotonin or their catabolites, which was confirmed by enzyme-linked immunosorbent assay. Addition of synthetic pure 5-MTP preserved VE-cadherin and maintained barrier function despite challenge with pro-inflammatory mediators. Tryptophan hydroxylase-1, an enzyme required for 5-MTP biosynthesis, was downregulated in HUVECs by pro-inflammatory mediators and it was accompanied by reduction of 5-MTP. 5-MTP protected VE-cadherin and prevented endothelial hyperpermeability by blocking p38 MAPK activation. A chemical inhibitor of p38 MAPK, SB202190, exhibited a similar protective effect as 5-MTP. To determine whether 5-MTP prevents vascular hyperpermeability in vivo, we evaluated the effect of 5-MTP administration on LPS-induced murine microvascular permeability with Evans blue. 5-MTP significantly prevented Evans blue dye leakage. Our findings indicate that 5-MTP is a new class of endothelium-derived molecules which protects endothelial barrier function by blocking p38 MAPK.

  15. Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

    OpenAIRE

    Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

    2008-01-01

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

  16. Interactive effects of diabetes and impaired kidney function on cognitive performance in old age: a population-based study.

    Science.gov (United States)

    Yin, Zhaoxue; Yan, Zhongrui; Liang, Yajun; Jiang, Hui; Cai, Chuanzhu; Song, Aiqin; Feng, Lei; Qiu, Chengxuan

    2016-01-12

    The interactive effect between diabetes and impaired kidney function on cognitive impairment in older adults has not yet been reported. The aim of this study was to investigate the association of diabetes and impaired kidney function with cognitive impairment among Chinese older people living in a rural area. This cross-sectional study included 1,358 participants (age ≥60 years; 60.5% women) in the population-based Confucius Hometown Aging Project in Shandong, China. Data on demographics, lifestyle factors, health history, use of medications, global cognitive function, and kidney function were collected through structured interviews, clinical examinations, and blood tests. We defined diabetes as a fasting plasma glucose level ≥7.0 mmol/l or use of hypoglycemic agents, impaired kidney function as glomerular filtration rate estimated from cystatin C (eGFRcys) Cognitive impairment was defined using the education-based cut-off scores of Mini-Mental State Examination (MMSE). Data were analyzed using multiple general linear and logistic regression models. Cognitive impairment was defined in 197 (14.5%) persons. The multi-adjusted β coefficient of MMSE score associated with diabetes was -0.06 (95% confidence interval [CI], -0.16, 0.03); the corresponding figures associated with eGFRcys function showed an interactive effect on cognitive impairment ( interaction = 0.02). Compared with individuals having neither diabetes nor impaired kidney function, those with both conditions had a multi-adjusted odds ratio of 4.23 (95% CI, 2.10-8.49) for cognitive impairment. The relative excess risk due to interaction was 2.74. This study suggests that concurrent presence of diabetes and impaired kidney function is associated with a substantial likelihood for cognitive impairment in older adults.

  17. Investigation of impairment of liver function in local residents of Miaofeng Village, Wushan County, China

    Directory of Open Access Journals (Sweden)

    YANG Zhongxia

    2015-06-01

    Full Text Available ObjectiveTo assess the impairment of liver function and investigate possible causes in local residents in Miaofeng Village, Mali Town, Wushan County, Gansu Province, China, and to provide a basis for the etiological study of idiopathic liver damage. MethodsThe residents in Miaofeng Village were screened for liver function and an epidemiological study was conducted. Serological testing was performed for those with abnormal screening results. Trace elements in drinking water and soil such as arsenic, chromium, and selenium were also tested. ResultsOf all residents, 23.8% and 10.7% showed abnormal levels of alanine aminotransferase and aspartate aminotransferase, respectively. Positivity of HBsAg was detected in 11 cases, fatty liver was identified in 3 cases, and absence of selenium in soil was also confirmed. ConclusionA proportion of local residents in Miaofeng Village have impaired liver function and the absence of selenium in soil may be a contributing factor to this phenomenon.

  18. Functions and requirements for subsurface barriers used in support of single-shell tank waste retrieval

    International Nuclear Information System (INIS)

    Lowe, S.S.

    1993-01-01

    The mission of the Tank Waste Remediation System (TWRS) Program is to store, treat, and immobilize highly radioactive Hanford waste in an environmentally sound, safe, and cost-effective manner. The scope of the TWRS Program includes project and program activities for receiving, storing, maintaining, treating, and disposing onsite, or packaging for offsite disposal, all Hanford tank waste. Hanford tank waste includes the contents of 149 single-shell tanks (SSTs) and 28 double-shell tanks (DSTs), plus any new waste added to these facilities, and all encapsulated cesium and strontium stored onsite and returned from offsite users. A key element of the TWRS Program is retrieval of the waste in the SSTs. The waste stored in these underground tanks must be removed in order to minimize environmental, safety, and health risks associated with continuing waste storage. Subsurface barriers are being considered as a means to mitigate the effects of tank leaks including those occurring during SST waste retrieval. The functions to be performed by subsurface barriers based on their role in retrieving waste from the SSTs are described, and the requirements which constrain their application are identified. These functions and requirements together define the functional baseline for subsurface barriers

  19. In your eyes: does theory of mind predict impaired life functioning in bipolar disorder?

    Science.gov (United States)

    Purcell, Amanda L; Phillips, Mary; Gruber, June

    2013-12-01

    Deficits in emotion perception and social functioning are strongly implicated in bipolar disorder (BD). Examining theory of mind (ToM) may provide one potential mechanism to explain observed socio-emotional impairments in this disorder. The present study prospectively investigated the relationship between theory of mind performance and life functioning in individuals diagnosed with BD compared to unipolar depression and healthy control groups. Theory of mind (ToM) performance was examined in 26 individuals with remitted bipolar I disorder (BD), 29 individuals with remitted unipolar depression (UD), and 28 healthy controls (CTL) using a well-validated advanced theory of mind task. Accuracy and response latency scores were calculated from the task. Life functioning was measured during a 12 month follow-up session. No group differences for ToM accuracy emerged. However, the BD group exhibited significantly shorter response times than the UD and CTL groups. Importantly, quicker response times in the BD group predicted greater life functioning impairment at a 12-month follow-up, even after controlling for baseline symptoms. The stimuli were static representations of emotional states and do not allow for evaluating the appropriateness of context during emotional communication; due to sample size, neither specific comorbidities nor medication effects were analyzed for the BD and UD groups; preliminary status of theory of mind as a construct. Results suggest that quickened socio-emotional decision making may represent a risk factor for future functional impairment in BD. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Exercise reveals impairments in left ventricular systolic function in patients with metabolic syndrome.

    Science.gov (United States)

    Fournier, Sara B; Reger, Brian L; Donley, David A; Bonner, Daniel E; Warden, Bradford E; Gharib, Wissam; Failinger, Conard F; Olfert, Melissa D; Frisbee, Jefferson C; Olfert, I Mark; Chantler, Paul D

    2014-01-01

    Metabolic syndrome (MetS) is the manifestation of a cluster of cardiovascular risk factors and is associated with a threefold increase in the risk of cardiovascular morbidity and mortality, which is suggested to be mediated, in part, by resting left ventricular (LV) systolic dysfunction. However, to what extent resting LV systolic function is impaired in MetS is controversial, and there are no data indicating whether LV systolic function is impaired during exercise. Accordingly, the objective of this study was to examine comprehensively the LV and arterial responses to exercise in individuals with MetS without diabetes and/or overt cardiovascular disease in comparison to a healthy control population. Cardiovascular function was characterized using Doppler echocardiography and gas exchange in individuals with MetS (n = 27) versus healthy control subjects (n = 20) at rest and during peak exercise. At rest, individuals with MetS displayed normal LV systolic function but reduced LV diastolic function compared with healthy control subjects. During peak exercise, individuals with MetS had impaired contractility, pump performance and vasodilator reserve capacity versus control subjects. A blunted contractile reserve response resulted in diminished arterial-ventricular coupling reserve and limited aerobic capacity in individuals with MetS versus control subjects. These findings are of clinical importance, because they provide insight into the pathophysiological changes in MetS that may predispose this population of individuals to an increased risk of cardiovascular morbidity and mortality.

  1. Resting-State Functional Connectivity Predicts Cognitive Impairment Related to Alzheimer's Disease

    Directory of Open Access Journals (Sweden)

    Qi Lin

    2018-04-01

    Full Text Available Resting-state functional connectivity (rs-FC is a promising neuromarker for cognitive decline in aging population, based on its ability to reveal functional differences associated with cognitive impairment across individuals, and because rs-fMRI may be less taxing for participants than task-based fMRI or neuropsychological tests. Here, we employ an approach that uses rs-FC to predict the Alzheimer's Disease Assessment Scale (11 items; ADAS11 scores, which measure overall cognitive functioning, in novel individuals. We applied this technique, connectome-based predictive modeling, to a heterogeneous sample of 59 subjects from the Alzheimer's Disease Neuroimaging Initiative, including normal aging, mild cognitive impairment, and AD subjects. First, we built linear regression models to predict ADAS11 scores from rs-FC measured with Pearson's r correlation. The positive network model tested with leave-one-out cross validation (LOOCV significantly predicted individual differences in cognitive function from rs-FC. In a second analysis, we considered other functional connectivity features, accordance and discordance, which disentangle the correlation and anticorrelation components of activity timecourses between brain areas. Using partial least square regression and LOOCV, we again built models to successfully predict ADAS11 scores in novel individuals. Our study provides promising evidence that rs-FC can reveal cognitive impairment in an aging population, although more development is needed for clinical application.

  2. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  3. Performance-based functional impairment and readmission and death: a prospective study.

    Science.gov (United States)

    Aubert, Carole E; Folly, Antoine; Mancinetti, Marco; Hayoz, Daniel; Donzé, Jacques D

    2017-06-08

    Readmission and death are frequent after a hospitalisation and difficult to predict. While many predictors have been identified, few studies have focused on functional status. We assessed whether performance-based functional impairment at discharge is associated with readmission and death after an acute medical hospitalisation. We prospectively included patients aged ≥50 years admitted to the Department of General Internal Medicine of a large community hospital. Functional status was assessed shortly before discharge using the Timed Up and Go test performed twice in a standard way by trained physiotherapists and was defined as a test duration ≥15 s. Sensitivity analyses using a cut-off at >10 and >20 s were performed. The primary and secondary outcome measures were unplanned readmission and death, respectively, within 6 months after discharge. Within 6 months after discharge, 107/338 (31.7%) patients had an unplanned readmission and 31/338 (9.2%) died. Functional impairment was associated with higher risk of death (OR 2.44, 95% CI 1.15 to 5.18), but not with unplanned readmission (OR 1.34, 95% CI 0.84 to 2.15). No significant association was found between functional impairment and the total number of unplanned readmissions (adjusted OR 1.59, 95% CI 0.95 to 2.67). Functional impairment at discharge of an acute medical hospitalisation was associated with higher risk of death, but not of unplanned readmission within 6 months after discharge. Simple performance-based assessment may represent a better prognostic measure for mortality than for readmission. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. The influence of unilateral saccular impairment on functional balance performance and self-report dizziness.

    Science.gov (United States)

    McCaslin, Devin L; Jacobson, Gary P; Grantham, Sarah L; Piker, Erin G; Verghese, Susha

    2011-09-01

    Postural stability in humans is largely maintained by vestibular, visual, and somatosensory inputs to the central nervous system. Recent clinical advances in the assessment of otolith function (e.g., cervical and ocular vestibular evoked myogenic potentials [cVEMPs and oVEMPs], subjective visual vertical [SVV] during eccentric rotation) have enabled investigators to identify patients with unilateral otolith impairments. This research has suggested that patients with unilateral otolith impairments perform worse than normal healthy controls on measures of postural stability. It is not yet known if patients with unilateral impairments of the saccule and/or inferior vestibular nerve (i.e., unilaterally abnormal cVEMP) perform differently on measures of postural stability than patients with unilateral impairments of the horizontal SCC (semicircular canal) and/or superior vestibular nerve (i.e., unilateral caloric weakness). Further, it is not known what relationship exists, if any, between otolith system impairment and self-report dizziness handicap. The purpose of this investigation was to determine the extent to which saccular impairments (defined by a unilaterally absent cVEMP) and impairments of the horizontal semicircular canal (as measured by the results of caloric testing) affect vestibulospinal function as measured through the Sensory Organization Test (SOT) of the computerized dynamic posturography (CDP). A secondary objective of this investigation was to measure the effects, if any, that saccular impairment has on a modality-specific measure of health-related quality of life. A retrospective cohort study. Subjects were assigned to one of four groups based on results from balance function testing: Group 1 (abnormal cVEMP response only), Group 2 (abnormal caloric response only), Group 3 (abnormal cVEMP and abnormal caloric response), and Group 4 (normal control group). Subjects were 92 adult patients: 62 were seen for balance function testing due to complaints

  5. Fine Motor Function Skills in Patients with Parkinson Disease with and without Mild Cognitive Impairment.

    Science.gov (United States)

    Dahdal, Philippe; Meyer, Antonia; Chaturvedi, Menorca; Nowak, Karolina; Roesch, Anne D; Fuhr, Peter; Gschwandtner, Ute

    2016-01-01

    The objective of this study was to investigate the relation between impaired fine motor skills in Parkinson disease (PD) patients and their cognitive status, and to determine whether fine motor skills are more impaired in PD patients with mild cognitive impairment (MCI) than in non-MCI patients. Twenty PD MCI and 31 PD non-MCI patients (mean age 66.7 years, range 50-84, 36 males/15 females), all right-handed, took part in a motor performance test battery. Steadiness, precision, dexterity, velocity of arm-hand movements, and velocity of wrist-finger movements were measured and compared across groups and analyzed for confounders (age, sex, education, severity of motor symptoms, and disease duration). Statistical analysis included t tests corrected for multiple testing, and a linear regression with stepwise elimination procedure was used to select significant predictors for fine motor function. PD MCI patients performed significantly worse in precision (p motor function skills were confounded by age. Fine motor skills in PD MCI patients are impaired compared to PD non-MCI patients. Investigating the relation between the fine motor performance and MCI in PD might be a relevant subject for future research. © 2016 S. Karger AG, Basel.

  6. Suitability of polystyrene as a functional barrier layer in coloured food contact materials.

    Science.gov (United States)

    Genualdi, Susan; Addo Ntim, Susana; Begley, Timothy

    2015-01-01

    Functional barriers in food contact materials (FCMs) are used to prevent or reduce migration from inner layers in multilayer structures to food. The effectiveness of functional barrier layers was investigated in coloured polystyrene (PS) bowls due to their intended condition of use with hot liquids such as soups or stew. Migration experiments were performed over a 10-day period using USFDA-recommended food simulants (10% ethanol, 50% ethanol, corn oil and Miglyol) along with several other food oils. At the end of the 10 days, solvent dyes had migrated from the PS bowls at 12, 1 and 31,000 ng cm(-)(2) into coconut oil, palm kernel oil and Miglyol respectively, and in coconut oil and Miglyol the colour change was visible to the human eye. Scanning electron microscope (SEM) images revealed that the functional barrier was no longer intact for the bowls exposed to coconut oil, palm kernel oil, Miglyol, 10% ethanol, 50% ethanol and goat's milk. Additional tests showed that 1-dodecanol, a lauryl alcohol derived from palm kernel oil and coconut oil, was present in the PS bowls at an average concentration of 11 mg kg(-1). This compound is likely to have been used as a dispersing agent for the solvent dye and aided the migration of the solvent dye from the PS bowl into the food simulant. The solvent dye was not found in the 10% ethanol, 50% ethanol and goat's milk food simulants above their respective limits of detection, which is likely to be due to its insolubility in aqueous solutions. A disrupted barrier layer is of concern because if there are unregulated materials in the inner layers of the laminate, they may migrate to food, and therefore be considered unapproved food additives resulting in the food being deemed adulterated under the Federal Food Drug and Cosmetic Act.

  7. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Science.gov (United States)

    Bershtein, Shimon; Serohijos, Adrian W R; Bhattacharyya, Sanchari; Manhart, Michael; Choi, Jeong-Mo; Mu, Wanmeng; Zhou, Jingwen; Shakhnovich, Eugene I

    2015-10-01

    Horizontal gene transfer (HGT) plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR), with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90%) in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM), correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the intracellular

  8. Protein Homeostasis Imposes a Barrier on Functional Integration of Horizontally Transferred Genes in Bacteria.

    Directory of Open Access Journals (Sweden)

    Shimon Bershtein

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT plays a central role in bacterial evolution, yet the molecular and cellular constraints on functional integration of the foreign genes are poorly understood. Here we performed inter-species replacement of the chromosomal folA gene, encoding an essential metabolic enzyme dihydrofolate reductase (DHFR, with orthologs from 35 other mesophilic bacteria. The orthologous inter-species replacements caused a marked drop (in the range 10-90% in bacterial growth rate despite the fact that most orthologous DHFRs are as stable as E.coli DHFR at 37°C and are more catalytically active than E. coli DHFR. Although phylogenetic distance between E. coli and orthologous DHFRs as well as their individual molecular properties correlate poorly with growth rates, the product of the intracellular DHFR abundance and catalytic activity (kcat/KM, correlates strongly with growth rates, indicating that the drop in DHFR abundance constitutes the major fitness barrier to HGT. Serial propagation of the orthologous strains for ~600 generations dramatically improved growth rates by largely alleviating the fitness barriers. Whole genome sequencing and global proteome quantification revealed that the evolved strains with the largest fitness improvements have accumulated mutations that inactivated the ATP-dependent Lon protease, causing an increase in the intracellular DHFR abundance. In one case DHFR abundance increased further due to mutations accumulated in folA promoter, but only after the lon inactivating mutations were fixed in the population. Thus, by apparently distinguishing between self and non-self proteins, protein homeostasis imposes an immediate and global barrier to the functional integration of foreign genes by decreasing the intracellular abundance of their products. Once this barrier is alleviated, more fine-tuned evolution occurs to adjust the function/expression of the transferred proteins to the constraints imposed by the

  9. Relationship between cognitive impairment and nutritional assessment on functional status in Calabrian long-term-care.

    Science.gov (United States)

    Malara, Alba; Sgrò, Giovanni; Caruso, Chiara; Ceravolo, Francesco; Curinga, Giuseppe; Renda, Grazia Francesca; Spadea, Fausto; Garo, Michele; Rispoli, Vincenzo

    2014-01-01

    The interaction between dementia and nutritional state is very complex and not yet fully understood. The aim of the present study was to assess the interaction between cognitive impairment and nutritional state in a cohort of residential elderly in relationship with functional condition of patients and their load of assistance in long-term-care facilities of the National Association of Third Age Structures (ANASTE) Calabria. One hundred seventy-four subjects (122 female and 52 male) were admitted to the long-term-care ANASTE Calabria study. All patients underwent multidimensional geriatric assessment. Nutritional state was assessed with the Mini Nutritional Assessment (MNA), whereas cognitive performance was evaluated by the Mini-Mental State Examination (MMSE). The functional state was assessed by Barthel Index (BI) and Activity Daily Living (ADL). The following nutritional biochemical parameters were also evaluated: albumin, cholesterol, iron, and hemoglobin. All patients were reassessed 180 days later. A severe cognitive impairment in MMSE performance was displayed in 49.7% patients, while 39.8% showed a moderate deficit; 6.9% had a slight deficit; and 3.4% evidenced no cognitive impairment. In MNA, 30% of patients exhibited an impairment of nutritional state; 56% were at risk of malnutrition; and 14% showed no nutritional problems. Malnutrition was present in 42% of patients with severe cognitive impairment, but only 4% of malnourished patients showed moderate cognitive deficit. The statistical analysis displayed a significant correlation between MNA and MMSE (Pnutritional state (P<0.005) as well as with the functional state (P<0.05) and mortality (P<0.01). The present study clearly shows that malnutrition may play an important role in the progression of cognitive loss.

  10. Survivors of cardiac arrest with good neurological outcome show considerable impairments of memory functioning.

    Science.gov (United States)

    Sulzgruber, Patrick; Kliegel, Andreas; Wandaller, Cosima; Uray, Thomas; Losert, Heidrun; Laggner, Anton N; Sterz, Fritz; Kliegel, Matthias

    2015-03-01

    Deficits in cognitive function are a well-known dysfunction in survivors of cardiac arrest. However, data concerning memory function in this neurological vulnerable patient collective remain scarce and inconclusive. Therefore, we aimed to assess multiple aspects of retrospective and prospective memory performance in patients after cardiac arrest. We prospectively enrolled 33 survivors of cardiac arrest, with cerebral performance categories (CPC) 1 and 2 and a control-group (n=33) matched in sex, age and educational-level. To assess retrospective and prospective memory performance we administrated 4 weeks after cardiac arrest the "Rey Adult Learning Test" (RAVLT), the "Digit-Span-Backwards Test", the "Logic-Memory Test" and the "Red-Pencil Test". Results indicate an impairment in immediate and delayed free recall, but not in recognition. However, the overall impairment in immediate recall was qualified by analyzing RAVLT performance, showing that patients were only impaired in trials 4 and 5 of the learning sequence. Moreover, working and prospective memory as well as prose recall were worse in cardiac arrest survivors. Cranial computed tomography was available in 61% of all patients (n=20) but there was no specific neurological damage detectable that could be linked to this cognitive impairment. Episodic long-term memory functioning appears to be particularly impaired after cardiac arrest. In contrast, short-term memory storage, even tested via free-call, seems not to be affected. Based on cranial computed tomography we suggest that global brain ischemia rather than focal brain lesions appear to underlie these effects. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Platelet function in whole-blood donors is impaired: the effects of painkillers.

    Science.gov (United States)

    Curvers, Joyce; Dielis, Arne W J H; Heeremans, Judith; van Wersch, Jan W J

    2007-01-01

    Aspirin (ASA) or non-aspirin-like nonsteroidal anti-inflammatory drugs (NSAIDs) influence platelet (PLT) function by inhibiting cyclooxygenase enzymes. In this study, the aim was to address the use of ASA or NSAIDs before donation and the effect on PLT function. Donors were asked questions about recent use of ASA or NSAIDs. Furthermore, PLT function was evaluated by measurement of the closure time (CT) in a PLT function analyzer (PFA-100, Dade Behring) and by aggregometry (response to ADP or arachidonic acid [AA]). Of 100 questioned donors, 22 percent had used ASA (n = 4), NSAIDs (n = 6), or paracetamol (n = 12) before donation. Upon assessment of the PLT function in the PFA-100, 27 donors showed values of greater than 180 seconds, indicative of impaired PLT function. Of these, only 7 had used pain killers before donation. Furthermore, 15 of 22 users had normal CTs. Aggregation after stimulation with AA was absent in 33 PLT-rich samples. Again only 8 had reported use of ASA (3), NSAIDs (1), or paracetamol (4). Of the 22 users, 14 had normal AA aggregation responses. All donor samples showed ADP-induced aggregation, indicating PLT integrity. There was no difference between the group of donors who reported the intake of ASA or NSAIDs and the group of donors who did not with respect to the tested PLT function assays. It is concluded that there is a considerable group of donors that use PLT-influencing medication before donation. A relation between the reported use and impaired PLT function in blood donors could not be established, however. Impaired PLT function as tested may have other causes than intake of ASA or NSAIDs.

  12. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Impaired exercise performance and skeletal muscle mitochondrial function in rats with secondary carnitine deficiency

    Directory of Open Access Journals (Sweden)

    Jamal BOUITBIR

    2016-08-01

    Full Text Available Purpose: The effects of carnitine depletion upon exercise performance and skeletal muscle mitochondrial function remain largely unexplored. We therefore investigated the effect of N-trimethyl-hydrazine-3-propionate (THP, a carnitine analogue inhibiting carnitine biosynthesis and renal carnitine reabsorption, on physical performance and skeletal muscle mitochondrial function in rats.Methods: Male Sprague Dawley rats were treated daily with water (control rats; n=12 or with 20 mg/100 g body weight THP (n=12 via oral gavage for 3 weeks. Following treatment, half of the animals of each group performed an exercise test until exhaustion.Results: Distance covered and exercise performance were lower in THP-treated compared to control rats. In the oxidative soleus muscle, carnitine depletion caused atrophy (-24% and impaired function of complex II and IV of the mitochondrial electron transport chain. The free radical leak (ROS production relative to oxygen consumption was increased and the cellular glutathione pool decreased. Moreover, mRNA expression of markers of mitochondrial biogenesis and mitochondrial DNA were decreased in THP-treated compared to control rats. In comparison, in the glycolytic gastrocnemius muscle, carnitine depletion was associated with impaired function of complex IV and increased free radical leak, whilst muscle weight and cellular glutathione pool were maintained. Markers of mitochondrial proliferation and mitochondrial DNA were unaffected.Conclusions: Carnitine deficiency is associated with impaired exercise capacity in rats treated with THP. THP-induced carnitine deficiency is associated with impaired function of the electron transport chain in oxidative and glycolytic muscle as well as with atrophy and decreased mitochondrial DNA in oxidative muscle.

  14. Depression and pain impair daily functioning and quality of life in patients with major depressive disorder.

    Science.gov (United States)

    Lin, Ching-Hua; Yen, Yung-Chieh; Chen, Ming-Chao; Chen, Cheng-Chung

    2014-09-01

    Depression and pain frequently occur together. The objective of this study was to investigate the effects of depression and pain on the impairment of daily functioning and quality of life (QOL) of depressed patients. We enrolled 131 acutely ill inpatients with major depressive disorder. Depression, pain, and daily functioning were assessed using the 17-item Hamilton Depression Rating Scale, the Short-Form 36 (SF-36) Body Pain Index, and the Work and Social Adjustment Scale. Health-related QOL was assessed using three primary domains of the SF-36: social functioning, vitality, and general health perceptions. Pearson׳s correlation and structural equation modeling were used to examine relationships among the study variables. Five models were proposed. In all, 129 patients completed all the measures. Model 5, both depression and pain impaired daily functioning and QOL, was the most fitted structural equation model (χ(2)=9.2, df=8, p=0.33, GFI=0.98, AGFI=0.94, TLI=0.99, CFI=0.99, RMSEA=0.03). The correlation between pain and depression was weak (r=-0.27, z=-2.95, p=0.003). This was a cross-sectional study with a small sample size. Depression and pain exert a direct influence on the impairment of daily functioning and QOL of depressed patients; this impairment could be expected regardless of increased pain, depression, or both pain and depression. Pain had a somewhat separate entity from depression. Copyright © 2014. Published by Elsevier B.V.

  15. A functional approach to cerebral visual impairments in very preterm/very-low-birth-weight children.

    Science.gov (United States)

    Geldof, Christiaan J A; van Wassenaer-Leemhuis, Aleid G; Dik, Marjolein; Kok, Joke H; Oosterlaan, Jaap

    2015-08-01

    Cerebral visual impairment (CVI) is a major cause of visual impairment, with very preterm birth/very low birth weight (VP/VLBW) being a major risk factor. There is no generally accepted definition of CVI. This study aims to investigate the usefulness of an empirically-based functional definition of CVI. One-hundred-five VP/VLBW children and 67 controls participated. CVI was defined after comprehensive oculomotor, visual sensory and perceptive assessment, and validated against vision problems in daily life and in terms of intellectual, behavioral, emotional and social functioning, as well as use of therapeutic services. Twenty-four per cent of the VP/VLBW children met criteria for CVI, compared to 7% of controls (P = 0.006, OR: 3.86, 95% CI: 1.40-10.70). VP/VLBW children with CVI had lower performance IQ, but not verbal IQ, than those without CVI. Visual problems in daily life were confirmed in VP/VLBW children classified with CVI. Additionally, difficulties in behavioral and social functioning were most prominent among VP/VLBW children with CVI. In VP/VLBW children, CVI defined in terms of visual function deficits is accompanied by intellectual, behavioral, and social impairments, validating our operational definition of CVI. CVI might act as a marker for developmental problems in VP/VLBW children.

  16. Abnormal functional lateralization and activity of language brain areas in typical specific language impairment (developmental dysphasia)

    Science.gov (United States)

    De Guibert, Clément; Maumet, Camille; Jannin, Pierre; Ferré, Jean-Christophe; Tréguier, Catherine; Barillot, Christian; Le Rumeur, Elisabeth; Allaire, Catherine; Biraben, Arnaud

    2011-01-01

    Atypical functional lateralization and specialization for language have been proposed to account for developmental language disorders, yet results from functional neuroimaging studies are sparse and inconsistent. This functional magnetic resonance imaging study compared children with a specific subtype of specific language impairment affecting structural language (n=21), to a matched group of typically-developing children using a panel of four language tasks neither requiring reading nor metalinguistic skills, including two auditory lexico-semantic tasks (category fluency and responsive naming) and two visual phonological tasks based on picture naming. Data processing involved normalizing the data with respect to a matched pairs pediatric template, groups and between-groups analysis, and laterality indexes assessment within regions of interest using single and combined task analysis. Children with specific language impairment exhibited a significant lack of left lateralization in all core language regions (inferior frontal gyrus-opercularis, inferior frontal gyrus-triangularis, supramarginal gyrus, superior temporal gyrus), across single or combined task analysis, but no difference of lateralization for the rest of the brain. Between-group comparisons revealed a left hypoactivation of Wernicke’s area at the posterior superior temporal/supramarginal junction during the responsive naming task, and a right hyperactivation encompassing the anterior insula with adjacent inferior frontal gyrus and the head of the caudate nucleus during the first phonological task. This study thus provides evidence that this specific subtype of specific language impairment is associated with atypical lateralization and functioning of core language areas. PMID:21719430

  17. Impaired physical function, loss of muscle mass and assessment of biomechanical properties in critical ill patients

    DEFF Research Database (Denmark)

    Poulsen, Jesper Brøndum

    2012-01-01

    Intensive care unit (ICU) admission is associated with muscle weakness and ICU survivors report sustained limitation of physical capacity for years after discharge. Limited information is available on the underlying biomechanical properties responsible for this muscle function impairment. A plaus......Intensive care unit (ICU) admission is associated with muscle weakness and ICU survivors report sustained limitation of physical capacity for years after discharge. Limited information is available on the underlying biomechanical properties responsible for this muscle function impairment....... A plausible contributor to the accentuated catabolic drive in ICU patients is a synergistic response to inflammation and inactivity leading to loss of muscle mass. As these entities are predominantly present in the early phase of ICU stay, interventions employed during this time frame may exhibit the greatest...... potential to counteract loss of muscle mass. Despite the obvious clinical significance of muscle atrophy for the functional impairment observed in ICU survivors, no preventive therapies have been identified as yet. The overall aim of the present dissertation is to characterize aspects of physical function...

  18. Acute Effects of Viral Exposure on P-Glycoprotein Function in the Mouse Fetal Blood-Brain Barrier

    Directory of Open Access Journals (Sweden)

    Enrrico Bloise

    2017-02-01

    Full Text Available Background/Aims: Viral infection during pregnancy is known to affect the fetal brain. The toll-like receptor (TLR-3 is a pattern recognition receptor activated by viruses known to elicit adverse fetal neurological outcomes. The P-glycoprotein (P-gp efflux transporter protects the developing fetus by limiting the transfer of substrates across both the placenta and the fetal blood-brain barrier (BBB. As such, inhibition of P-gp at these blood-barrier sites may result in increased exposure of the developing fetus to environmental toxins and xenobiotics present in the maternal circulation. We hypothesized that viral exposure during pregnancy would impair P-gp function in the placenta and in the developing BBB. Here we investigated whether the TLR-3 ligand, polyinosinic:polycytidylic acid (PolyI:C, increased accumulation of one P-gp substrate in the fetus and in the developing fetal brain. Methods: Pregnant C57BL/6 mice (GD15.5 were injected (i.p. with PolyI:C (5 mg/kg or 10 mg/kg or vehicle (saline. [3H]digoxin (P-gp substrate was injected (i.v. 3 or 23h post-treatment and animals were euthanized 1h later. Maternal plasma, ‘fetal-units’ (fetal membranes, amniotic fluid and whole fetus, and fetal brains were collected. Results: PolyI:C exposure (4h significantly elevated maternal plasma IL-6 (P<0.001 and increased [3H]digoxin accumulation in the fetal brain (P<0.05. In contrast, 24h after PolyI:C exposure, no effect on IL-6 or fetal brain accumulation of P-gp substrate was observed. Conclusion: Viral infection modeled by PolyI:C causes acute increases in fetal brain accumulation of P-gp substrates and by doing so, may increase fetal brain exposure to xenobiotics and environmental toxins present in the maternal circulation.

  19. Impaired emotion processing in functional (psychogenic tremor: A functional magnetic resonance imaging study

    Directory of Open Access Journals (Sweden)

    Alberto J. Espay

    2018-01-01

    Conclusions: In response to emotional stimuli, functional tremor is associated with alterations in activation and functional connectivity in networks involved in emotion processing and theory of mind. These findings may be relevant to the pathophysiology of functional movement disorders.

  20. Improving Dispersion and Barrier Properties of Polyketone/Graphene Nanoplatelet Composites via Noncovalent Functionalization Using Aminopyrene.

    Science.gov (United States)

    Cho, Jaehyun; Jeon, Ikseong; Kim, Seong Yun; Lim, Soonho; Jho, Jae Young

    2017-08-23

    A series of polyketone (PK) nanocomposite films with varying content of noncovalently functionalized graphene nanoplatelet with 1-aminopyrene (GNP/APy) is prepared by solution blending with a solvent of hexafluoro-2-propanol. GNP/APy, prepared by a facile method, can effectively induce specific interaction such as hydrogen bonding between the amine functional group of GNP/APy and the carbonyl functional group of the PK matrix. With comparison of GNP and GNP/Py as reference materials, intensive investigation on filler-matrix interaction is achieved. In addition, the dispersion state of the functionalized GNP (f-GNPs; GNP/Py and GNP/APy) in the PK matrix is analyzed by three-dimensional nondestructive X-ray microcomputed tomography, and the increased dispersion state of those fillers results in significant improvement in the water vapor transmission rate (WVTR). The enhancement in WVTR of the PK/GNP/APy nanocomposite film at 1 wt % loading of filler leads to a barrier performance approximately 2 times larger compared to that of PK/GNP nanocomposite film and an approximately 92% reduction in WVTR compared to the case of pristine PK film. We expect that this facile method of graphene functionalization to enhance graphene dispersibility as well as interfacial interaction with the polymer matrix will be widely utilized to expand the potential of graphene materials to barrier film applications.

  1. Microbiome Composition and Function Drives Wound-Healing Impairment in the Female Genital Tract.

    Directory of Open Access Journals (Sweden)

    Alexander S Zevin

    2016-09-01

    Full Text Available The mechanism(s by which bacterial communities impact susceptibility to infectious diseases, such as HIV, and maintain female genital tract (FGT health are poorly understood. Evaluation of FGT bacteria has predominantly been limited to studies of species abundance, but not bacterial function. We therefore sought to examine the relationship of bacterial community composition and function with mucosal epithelial barrier health in the context of bacterial vaginosis (BV using metaproteomic, metagenomic, and in vitro approaches. We found highly diverse bacterial communities dominated by Gardnerella vaginalis associated with host epithelial barrier disruption and enhanced immune activation, and low diversity communities dominated by Lactobacillus species that associated with lower Nugent scores, reduced pH, and expression of host mucosal proteins important for maintaining epithelial integrity. Importantly, proteomic signatures of disrupted epithelial integrity associated with G. vaginalis-dominated communities in the absence of clinical BV diagnosis. Because traditional clinical assessments did not capture this, it likely represents a larger underrepresented phenomenon in populations with high prevalence of G. vaginalis. We finally demonstrated that soluble products derived from G. vaginalis inhibited wound healing, while those derived from L. iners did not, providing insight into functional mechanisms by which FGT bacterial communities affect epithelial barrier integrity.

  2. Brain barriers and functional interfaces with sequential appearance of ABC efflux transporters during human development

    DEFF Research Database (Denmark)

    Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.

    2017-01-01

    Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....

  3. Barriers and Facilitators to Implementing Functional Family Therapy in a Community Setting: Client and Practitioner Perspectives.

    Science.gov (United States)

    McPherson, Kerri E; Kerr, Susan; Casey, Beth; Marshall, John

    2017-10-01

    While Functional Family Therapy (FFT) is known to be effective in addressing adolescent behavioral problems, there has been little exploration of issues relevant to its transport from the tightly controlled setting of clinical trials into routine service delivery. This study sought the views of key stakeholders, clients, and practitioners, on barriers and facilitators to the successful implementation of FFT. Undertaken in a community setting in Scotland, interviews were carried out with 12 adolescents, 14 parents/caregivers, and 6 practitioners. Results focus on: Referral process and pre-intervention contact; Engagement of families; Structure and delivery; Organizational factors. Although barriers to engagement were identified, FFT was viewed as an acceptable, appropriate and feasible intervention with the potential to improve adolescent wellbeing in 'real-world' settings. © 2017 American Association for Marriage and Family Therapy.

  4. Curcumin-mediated regulation of intestinal barrier function: The mechanism underlying its beneficial effects.

    Science.gov (United States)

    Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha

    2018-01-02

    Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.

  5. Muscle enzyme release does not predict muscle function impairment after triathlon.

    Science.gov (United States)

    Margaritis, I; Tessier, F; Verdera, F; Bermon, S; Marconnet, P

    1999-06-01

    We sought to determine the effects of a long distance triathlon (4 km swim, 120 km bike-ride, and 30 km run) on the four-day kinetics of the biochemical markers of muscle damage, and whether they were quantitatively linked with muscle function impairment and soreness. Data were collected from 2 days before until 4 days after the completion of the race. Twelve triathletes performed the triathlon and five did not. Maximal voluntary contraction (MVC), muscle soreness (DOMS) and total serum CK, CK-MB, LDH, AST and ALT activities were assessed. Significant changes after triathlon completion were found for all muscle damage indirect markers over time (p triathlon. Long distance triathlon race caused muscle damage, but extent, as well as muscle recovery cannot be evaluated by the magnitude of changes in serum enzyme activities. Muscle enzyme release cannot be used to predict the magnitude of the muscle function impairment caused by muscle damage.

  6. The puzzle of processing speed, memory, and executive function impairments in schizophrenia: fitting the pieces together.

    Science.gov (United States)

    Knowles, Emma E M; Weiser, Mark; David, Anthony S; Glahn, David C; Davidson, Michael; Reichenberg, Abraham

    2015-12-01

    Substantial impairment in performance on the digit-symbol substitution task in patients with schizophrenia is well established, which has been widely interpreted as denoting a specific impairment in processing speed. However, other higher order cognitive functions might be more critical to performance on this task. To date, this idea has not been rigorously investigated in patients with schizophrenia. Neuropsychological measures of processing speed, memory, and executive functioning were completed by 125 patients with schizophrenia and 272 control subjects. We implemented a series of confirmatory factor and structural regression modeling to build an integrated model of processing speed, memory, and executive function with which to deconstruct the digit-symbol substitution task and characterize discrepancies between patients with schizophrenia and control subjects. The overall structure of the processing speed, memory, and executive function model was the same across groups (χ(2) = 208.86, p > .05), but the contribution of the specific cognitive domains to coding task performance differed significantly. When completing the task, control subjects relied on executive function and, indirectly, on working memory ability, whereas patients with schizophrenia used an alternative set of cognitive operations whereby they relied on the same processes required to complete verbal fluency tasks. Successful coding task performance relies predominantly on executive function, rather than processing speed or memory. Patients with schizophrenia perform poorly on this task because of an apparent lack of appropriate executive function input; they rely instead on an alternative cognitive pathway. Copyright © 2015 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  7. Structural and functional cerebral impairments in cirrhotic patients with a history of overt hepatic encephalopathy

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Hua-Jun [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Zhu, Xi-Qi [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Department of Radiology, The Second Hospital of Nanjing, Medical School of Southeast University, Nanjing 210002 (China); Shu, Hao [Department of Neurology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Yang, Ming; Zhang, Yi; Ding, Jie; Wang, Yu [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China); Teng, Gao-Jun, E-mail: gjteng@vip.sina.com [Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing 210009 (China)

    2012-10-15

    Objective: Diffuse brain atrophy has been observed in cirrhotic patients and recent reports have revealed the persistence of cognitive impairment after clinical resolution of overt hepatic encephalopathy. We sought to explore the continued influence of overt hepatic encephalopathy on neurological function by measuring brain resting-state inherent connectivity, based on an investigation of structural abnormalities. Methods: Neuropsychological tests and structural and functional magnetic resonance scanning were conducted in 20 healthy controls and 21 cirrhotic patients with a history of overt hepatic encephalopathy. The analysis of voxel-based morphometry and functional connectivity were performed to detect the alterations in brain structure and function, respectively. Results: Patients showed significantly worse performance in neuropsychological tests as compared with controls, despite apparently normal mental status. Analysis of voxel-based morphometry revealed a decrease in gray matter volume primarily in the midline regions, bilateral insular cortex and caudates, left parahippocampal gyrus, and right cerebellum posterior lobe, while the volume of the bilateral thalamus showed an increase. Of these regions, the posterior cingulate cortex with peak atrophy was selected as the origin for the analysis of functional connectivity. Typical patterns of a default mode network were identified in both groups. Decreased functional connectivity was found in the medial prefrontal gyrus, left inferior parietal lobule, and left middle temporal gyrus in the patients. Conclusions: Both functional and structural impairments were evident after apparent recovery from overt hepatic encephalopathy, demonstrating that brain dysfunction induced by hepatic encephalopathy persisted after clinical resolution and provided a basis for further evolution of the disease.

  8. Structural and functional cerebral impairments in cirrhotic patients with a history of overt hepatic encephalopathy

    International Nuclear Information System (INIS)

    Chen, Hua-Jun; Zhu, Xi-Qi; Shu, Hao; Yang, Ming; Zhang, Yi; Ding, Jie; Wang, Yu; Teng, Gao-Jun

    2012-01-01

    Objective: Diffuse brain atrophy has been observed in cirrhotic patients and recent reports have revealed the persistence of cognitive impairment after clinical resolution of overt hepatic encephalopathy. We sought to explore the continued influence of overt hepatic encephalopathy on neurological function by measuring brain resting-state inherent connectivity, based on an investigation of structural abnormalities. Methods: Neuropsychological tests and structural and functional magnetic resonance scanning were conducted in 20 healthy controls and 21 cirrhotic patients with a history of overt hepatic encephalopathy. The analysis of voxel-based morphometry and functional connectivity were performed to detect the alterations in brain structure and function, respectively. Results: Patients showed significantly worse performance in neuropsychological tests as compared with controls, despite apparently normal mental status. Analysis of voxel-based morphometry revealed a decrease in gray matter volume primarily in the midline regions, bilateral insular cortex and caudates, left parahippocampal gyrus, and right cerebellum posterior lobe, while the volume of the bilateral thalamus showed an increase. Of these regions, the posterior cingulate cortex with peak atrophy was selected as the origin for the analysis of functional connectivity. Typical patterns of a default mode network were identified in both groups. Decreased functional connectivity was found in the medial prefrontal gyrus, left inferior parietal lobule, and left middle temporal gyrus in the patients. Conclusions: Both functional and structural impairments were evident after apparent recovery from overt hepatic encephalopathy, demonstrating that brain dysfunction induced by hepatic encephalopathy persisted after clinical resolution and provided a basis for further evolution of the disease

  9. Left atrial function in heart failure with impaired and preserved ejection fraction.

    Science.gov (United States)

    Fang, Fang; Lee, Alex Pui-Wai; Yu, Cheuk-Man

    2014-09-01

    Left atrial structural and functional changes in heart failure are relatively ignored parts of cardiac assessment. This review illustrates the pathophysiological and functional changes in left atrium in heart failure as well as their prognostic value. Heart failure can be divided into those with systolic dysfunction and heart failure with preserved ejection fraction (HFPEF). Left atrial enlargement and dysfunction commonly occur in systolic heart failure, in particular, in idiopathic dilated cardiomyopathy. Atrial enlargement and dysfunction also carry important prognostic value in systolic heart failure, independently of known parameters such as left ventricular ejection fraction. In HFPEF, there is evidence of left atrial enlargement, impaired atrial compliance, and reduction of atrial pump function. This occurs not only at rest but also during exercise, indicating significant impairment of atrial contractile reserve. Furthermore, atrial dyssynchrony is common in HFPEF. These factors further contribute to the development of new onset or progression of atrial arrhythmias, in particular, atrial fibrillation. Left atrial function is an integral part of cardiac function and its structural and functional changes in heart failure are common. As changes of left atrial structure and function have different clinical implications in systolic heart failure and HFPEF, routine assessment is warranted.

  10. The Puzzle of Processing Speed, Memory and Executive Function Impairments in Schizophrenia: Fitting the Pieces Together

    Science.gov (United States)

    Knowles, Emma E. M.; Weiser, Mark; David, Anthony S.; Glahn, David; Davidson, Michael; Reichenberg, Abraham

    2015-01-01

    Background Substantial impairment in digit-symbol substitution task performance in schizophrenia is well established, which has been widely interpreted as denoting a specific impairment in processing-speed ability. However, other higher-order cognitive functions might be more critical to performance on this task. To date, this has not been rigorously investigated in schizophrenia. Methods One-hundred and twenty-five schizophrenia cases and 272 controls completed neuropsychological measures of processing speed, memory and executive functioning. We implemented a series of confirmatory factor and structural regression modeling in order to build an integrated model of processing speed, memory and executive function with which to deconstruct digit-symbol substitution task and characterize discrepancies between cases and controls. Results The overall structure of the processing speed, memory and executive function model was the same across groups (χ2 = 208.86, p>.05) but the contribution of the specific cognitive domains to coding task performance differed significantly. When completing the task controls relied on executive function and, indirectly, on working memory ability; while schizophrenia cases utilized an alternative set of cognitive operations whereby they relied on the same processes required to complete verbal fluency tasks. Conclusions Successful coding task performance is predominantly reliant on executive function, rather than processing-speed or memory abilities. Schizophrenia patients perform poorly on this task due to an apparent lack of appropriate executive function input, they rely instead on an alternative cognitive pathway. PMID:25863361

  11. Impaired pulmonary function after treatment for tuberculosis: the end of the disease?

    Science.gov (United States)

    Chushkin, Mikhail Ivanovich; Ots, Oleg Nikolayevich

    2017-01-01

    ABSTRACT Objective: To evaluate the prevalence of pulmonary function abnormalities and to investigate the factors affecting lung function in patients treated for pulmonary tuberculosis. Methods: A total of 214 consecutive patients (132 men and 82 women; 20-82 years of age), treated for pulmonary tuberculosis and followed at a local dispensary, underwent spirometry and plethysmography at least one year after treatment. Results: Pulmonary impairment was present in 102 (47.7%) of the 214 patients evaluated. The most common functional alteration was obstructive lung disease (seen in 34.6%). Of the 214 patients, 60 (28.0%) showed reduced pulmonary function (FEV1 below the lower limit of normal). Risk factors for reduced pulmonary function were having had culture-positive pulmonary tuberculosis in the past, being over 50 years of age, having recurrent tuberculosis, and having a lower level of education. Conclusions: Nearly half of all tuberculosis patients evolve to impaired pulmonary function. That underscores the need for pulmonary function testing after the end of treatment. PMID:28380187

  12. Neuropsychological, physical, and functional mobility measures associated with falls in cognitively impaired older adults.

    Science.gov (United States)

    Taylor, Morag E; Delbaere, Kim; Lord, Stephen R; Mikolaizak, A Stefanie; Brodaty, Henry; Close, Jacqueline C T

    2014-08-01

    Older people with cognitive impairment have an elevated fall risk, with 60% falling annually. There is a lack of evidence for fall prevention in this population, in part due to limited understanding of risk factors. This study examined fall risk in older people with cognitive impairment with an emphasis on identifying explanatory and modifiable risk factors. One hundred and seventy-seven community-dwelling older people with mild-moderate cognitive impairment (Mini-Mental State Examination 11-23/Addenbrooke's Cognitive Examination-Revised Falls were recorded prospectively for 12 months with the assistance of carers. Of the 174 participants available to follow-up, 111 (64%) fell at least once and 71 (41%) at least twice. Higher fall rates were associated with slower reaction time, impaired balance (sway on floor and foam, semitandem, near-tandem, tandem stance), and reduced functional mobility (co-ordinated stability, timed up-and-go, steps needed to turn 180°, sit-to-stand, gait velocity). Higher fall rates were also associated with increased medication use (central nervous system, total number) and poorer performances in cognitive (Addenbrooke's Cognitive Examination-Revised: visuospatial domain, cube drawing; Trail-Making Test) and psychological (Geriatric Depression Scale, Goldberg Anxiety Scale, Falls Efficacy Scale-International) tests. Multivariate analysis identified increased sway on foam, co-ordinated stability score, and depressive symptoms to be significantly and independently associated with falls while controlling for age, years of education, and Addenbrooke's Cognitive Examination-Revised score. This study identified several risk factors of falls in older people with cognitive impairment, a number of which are potentially modifiable. Future research involving targeted interventions addressing medication use, balance, mood, and functional performance may prove useful for fall prevention in this population. © The Author 2013. Published by Oxford

  13. Amyloid-independent functional neural correlates of episodic memory in amnestic mild cognitive impairment.

    Science.gov (United States)

    Seo, Eun Hyun; Choo, I L Han

    2016-06-01

    Although amnestic mild cognitive impairment (aMCI) could have various biological characteristics, little attention has been given to the nature of episodic memory decline in aMCI with pathophysiologies other than Alzheimer's disease (AD), i.e., aMCI with low beta-amyloid (Aβ) burden. This study aimed to identify the functional neural basis of episodic memory impairment in aMCI with Aβ burden negative (aMCI-Aβ-) and to compare these results with aMCI with Aβ burden positive (aMCI-Aβ+). Individuals with aMCI (n = 498) were selected from the Alzheimer's Disease Neuroimaging Initiative database. Based on the mean florbetapir standard uptake value ratio, participants were classified as aMCI-Aβ- or aMCI-Aβ+. Correlations between memory scores and regional cerebral glucose metabolism (rCMglc) were analyzed separately for the two subgroups using a multiple regression model. For aMCI-Aβ-, significant positive correlations between memory and rCMglc were found in the bilateral claustrum, right thalamus, left anterior cingulate cortex, left insula, and right posterior cingulate. For aMCI-Aβ+, significant positive correlations between memory and rCMglc were found in the temporoparietal areas. These correlation patterns remained unchanged when clinical severity was added as a covariate Our findings indicate that memory impairment in aMCI-Aβ- is related to multimodal integrative processing and the attentional control system, whereas memory impairment in aMCI-Aβ+ is related to the typical brain memory systems and AD signature. These results suggest that although the two subgroups are clinically in the same category as aMCI, the memory impairment process depends on completely different functional brain regions according to their Aβ burden level.

  14. Neurocognitive function in HIV-infected patients: comparison of two methods to define impairment.

    Directory of Open Access Journals (Sweden)

    Alejandro Arenas-Pinto

    Full Text Available To compare two definitions of neurocognitive impairment (NCI in a large clinical trial of effectively-treated HIV-infected adults at baseline.Hopkins Verbal Learning test-Revised (HVLT-R, Colour Trail (CTT and Grooved Pegboard (GPT tests were applied exploring five cognitive domains. Raw scores were transformed into Z-scores and NCI defined as summary NPZ-5 score one standard deviation below the mean of the normative dataset (i.e. <-1SD or Z-scores <-1SD in at least two individual domains (categorical scale. Principal component analysis (PCA was performed to explore the contribution of individual tests to the total variance.Mean NPZ-5 score was -0.72 (SD 0.98 and 178/548 (32% participants had NPZ-5 scores <-1SD. When impairment was defined as <-1SD in at least two individual tests, 283 (52% patients were impaired. Strong correlations between the two components of the HVLT-R test (learning/recall (r = 0.73, and the CTT and (attention/executive functioning (r = 0.66 were observed. PCA showed a clustering with three components accounting for 88% of the total variance. When patients who scored <-1SD only in two correlated tests were considered as not impaired, prevalence of NCI was 43%. When correlated test scores were averaged, 36% of participants had NPZ-3 scores <-1SD and 32% underperformed in at least two individual tests.Controlling for differential contribution of individual test-scores on the overall performance and the level of correlation between components of the test battery used appear to be important when testing cognitive function. These two factors are likely to affect both summary scores and categorical scales in defining cognitive impairment.EUDRACT: 2007-006448-23 and ISRCTN04857074.

  15. Arrested neuronal proliferation and impaired hippocampal function following fractionated brain irradiation in the adult rat

    DEFF Research Database (Denmark)

    Madsen, Torsten Meldgaard; Kristjansen, P.E.G.; Bolwig, Tom Gert

    2003-01-01

    irradiation blocked the formation of new neurons in the dentate gyrus of the hippocampus. At different time points after the termination of the irradiation procedure, the animals were tested in two tests of short-term memory that differ with respect to their dependence on hippocampal function. Eight and 21...... that blocked neurogenesis contributes to the reported deleterious side effects of this treatment, consisting of memory impairment, dysphoria and lethargy....

  16. Impaired osteoblast function in osteoporosis: comparison between calcium balance and dynamic histomorphometry.

    OpenAIRE

    Arlot, M; Edouard, C; Meunier, P J; Neer, R M; Reeve, J

    1984-01-01

    Osteoblast function was investigated in 27 patients with idiopathic osteoporosis. Transiliac bone biopsy specimens were taken after double labelling with tetracycline, and metabolic calcium balance was studied almost simultaneously. Many of the patients showed poor double labelling of their otherwise unremarkable trabecular osteoid, suggesting impaired formation of bone at many of these surfaces. This phenomenon was not accompanied by increased width of osteoid seams (as seen in osteomalacia)...

  17. Executive cognitive impairment detected by simple bedside testing ...

    African Journals Online (AJOL)

    Aims. Cognitive impairment in people with type 2 diabetes is a barrier to successful disease management. We sought to determine whether impaired executive function as detected by a battery of simple bedside cognitive tests of executive function was associated with inadequate glycaemic control. Methods. People with ...

  18. Environmental Exposure to Cadmium: Health Risk Assessment and its Associations with Hypertension and Impaired Kidney Function

    Science.gov (United States)

    Wu, Haiyun; Liao, Qilin; Chillrud, Steven N.; Yang, Qiang; Huang, Lei; Bi, Jun; Yan, Beizhan

    2016-07-01

    Cadmium (Cd) is a toxic metal. This study was aimed to estimate the potential health risks in a Cd-polluted district in China, and examine the relationship between urinary cadmium(UCd) and hypertension and impaired kidney function at low exposure levels (UCd: GM 1.3 μg/g creatinine). Blood pressure measurement, questionnaires, and collection of urinary samples were conducted from 217 residents. Environmental samples, food, and cigarette samples were collected and detected to estimate the risks posed by Cd and the contribution of inhalation, ingestion, and dermal contact pathways to these risks. A logistic regression model was used in examining associations between exposure and hypertension and impaired kidney function. Results show that this population is at high risk. For non-smokers, incremental lifetime cancer risk (ILCR) and hazard quotient (HQ) are 1.74E-04 and 2.96, and for smokers, they are 1.07E-03 and 52.5, respectively. Among all exposure pathways, smoking and foods cause the major increases in ILCR and HQ. UCd is significantly associated with hypertension (odds ratio (OR) = 1.468 95% confidence interval (CI): 1.104, 1.953; P = 0.008) and impaired kidney function (OR = 1.902, 95% CI: 1.054, 3.432; P = 0.033). The results demonstrate that Cd can potentially lead to adverse health effects.

  19. Intact short-term memory and impaired executive functions in obsessive compulsive disorder.

    Science.gov (United States)

    Demeter, Gyula; Racsmány, Mihály; Csigó, Katalin; Harsányi, András; Németh, Attila; Döme, László

    2013-01-30

    Previous neuropsychological studies produced inconsistent results with tasks tapping short-term verbal and visual-spatial memory and executive functions in obsessive compulsive disorder (OCD). The aim of this study was to investigate the presence of deficits in these cognitive domains. A further goal was to describe the distribution of patients in different impairment ranges for all functions, and clarify the relationship between symptom severity and cognitive impairments. Thirty patients with OCD (DSM-IV) and 30 healthy volunteers were compared using well-known neuropsychological tasks. We assessed short-term verbal memory with the Digit Span Forward and Digit Span Backward Tasks, short-term visual-spatial memory with the Corsi Block Tapping Task, while we measured the level of executive functions with the StroopTask and the Wisconsin Card Sorting Test (WCST). Compared with a matched healthy control group, the performance of OCD patients was in the impaired range only in the two executive tasks. We find a significant positive correlations between the Y-BOCS (Yale-Brown Obsessive Compulsive Scale) total scores and the number of perseverative responses (r(28) = 0.409, p short-term memory is intact in OCD. This is in line with neuropsychological model of OCD that the deficit of cognitive and behavioral inhibition are responsible for the main cognitive findings of this disorder, most prevalently the deficit in set shifting and prepotent response inhibition.

  20. Association between vestibular function and motor performance in hearing-impaired children.

    Science.gov (United States)

    Maes, Leen; De Kegel, Alexandra; Van Waelvelde, Hilde; Dhooge, Ingeborg

    2014-12-01

    The clinical balance performance of normal-hearing (NH) children was compared with the balance performance of hearing-impaired (HI) children with and without vestibular dysfunction to identify an association between vestibular function and motor performance. Prospective study. Tertiary referral center. Thirty-six children (mean age, 7 yr 5 mo; range, 3 yr 8 mo-12 yr 11 mo) divided into three groups: NH children with normal vestibular responses, HI children with normal vestibular responses, and HI children with abnormal vestibular function. A vestibular test protocol (rotatory and collic vestibular evoked myogenic potential testing) in combination with three clinical balance tests (balance beam walking, one-leg hopping, one-leg stance). Clinical balance performance. HI children with abnormal vestibular test results obtained the lowest quotients of motor performance, which were significantly lower compared with the NH group (p beam walking and one-leg stance; p = 0.003 for one-leg hopping). The balance performance of the HI group with normal vestibular responses was better in comparison with the vestibular impaired group but still significantly lower compared with the NH group (p = 0.020 for balance beam walking; p = 0.001 for one-leg stance; not significant for one-leg hopping). These results indicate an association between vestibular function and motor performance in HI children, with a more distinct motor deterioration if a vestibular impairment is superimposed to the auditory dysfunction.

  1. Cognitive impairment after traumatic brain injury: a functional magnetic resonance imaging study using the Stroop task

    Energy Technology Data Exchange (ETDEWEB)

    Soeda, Akio; Iwama, Toru [Gifu University School of Medicine, Department of Neurosurgery, Gifu City (Japan); Nakashima, Toshihiko; Okumura, Ayumi; Shinoda, Jun [Kizawa Memorial Hospital, Chubu Medical Center for Prolonged Traumatic Brain Dysfunction, Department of Neurosurgery, Minokamo (Japan); Kuwata, Kazuo [Gifu University School of Medicine, Department of Biochemistry and Biophysics, Gifu (Japan)

    2005-07-01

    The anterior cingulate cortex (ACC) plays a key role in cognition, motor function, and emotion processing. However, little is known about how traumatic brain injury (TBI) affects the ACC system. Our purpose was to compare, by functional magnetic resonance imaging (fMRI) studies, the patterns of cortical activation in patients with cognitive impairment after TBI and those of normal subjects. Cortical activation maps of 11 right-handed healthy control subjects and five TBI patients with cognitive impairment were recorded in response to a Stroop task during a block-designed fMRI experiment. Statistical parametric mapping (SPM99) was used for individual subjects and group analysis. In TBI patients and controls, cortical activation, found in similar regions of the frontal, occipital, and parietal lobes, resembled patterns of activation documented in previous neuroimaging studies of the Stroop task in healthy controls. However, the TBI patients showed a relative decrease in ACC activity compared with the controls. Cognitive impairment in TBI patients seems to be associated with alterations in functional cerebral activity, especially less activation of the ACC. These changes are probably the result of destruction of neural networks after diffuse axonal injury and may reflect cortical disinhibition attributable to disconnection or compensation for an inefficient cognitive process. (orig.)

  2. Association between antidepressant side effects and functional impairment in patients with major depressive disorders.

    Science.gov (United States)

    Kikuchi, Toshiaki; Suzuki, Takefumi; Uchida, Hiroyuki; Watanabe, Koichiro; Mimura, Masaru

    2013-11-30

    Patients with depression may not well be aware of antidepressant adverse events (AEs); however, no studies have assessed how these AEs affect their daily function. Therefore, to evaluate the relationship between the quality of AEs and functional impairment, we studied 482 outpatients with depressive disorders who were not receiving any antidepressant treatment prior to the baseline visit and started it thereafter in usual clinical settings. The Quick Inventory for Depressive Symptomatology Self-Report Japanese version and antidepressant AEs for subjective assessment (antiAS) were performed at baseline and 10 days after antidepressant initiation (i.e. second visit). Functional impairment was evaluated with the Sheehan Disability Scale (SDS) on the second visit. As a result, the SDS was positively associated with the number of AEs (β=0.089, p=0.022) in multiple linear regression analysis (adjusted R(2)=0.357, pfunctional impairment than those who did not. Additionally, the number of severe AEs (β=0.151, pfunction. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Cognitive impairment after traumatic brain injury: a functional magnetic resonance imaging study using the Stroop task

    International Nuclear Information System (INIS)

    Soeda, Akio; Iwama, Toru; Nakashima, Toshihiko; Okumura, Ayumi; Shinoda, Jun; Kuwata, Kazuo

    2005-01-01

    The anterior cingulate cortex (ACC) plays a key role in cognition, motor function, and emotion processing. However, little is known about how traumatic brain injury (TBI) affects the ACC system. Our purpose was to compare, by functional magnetic resonance imaging (fMRI) studies, the patterns of cortical activation in patients with cognitive impairment after TBI and those of normal subjects. Cortical activation maps of 11 right-handed healthy control subjects and five TBI patients with cognitive impairment were recorded in response to a Stroop task during a block-designed fMRI experiment. Statistical parametric mapping (SPM99) was used for individual subjects and group analysis. In TBI patients and controls, cortical activation, found in similar regions of the frontal, occipital, and parietal lobes, resembled patterns of activation documented in previous neuroimaging studies of the Stroop task in healthy controls. However, the TBI patients showed a relative decrease in ACC activity compared with the controls. Cognitive impairment in TBI patients seems to be associated with alterations in functional cerebral activity, especially less activation of the ACC. These changes are probably the result of destruction of neural networks after diffuse axonal injury and may reflect cortical disinhibition attributable to disconnection or compensation for an inefficient cognitive process. (orig.)

  4. Impaired thromboxane receptor dimerization reduces signaling efficiency: A potential mechanism for reduced platelet function in vivo.

    Science.gov (United States)

    Capra, Valérie; Mauri, Mario; Guzzi, Francesca; Busnelli, Marta; Accomazzo, Maria Rosa; Gaussem, Pascale; Nisar, Shaista P; Mundell, Stuart J; Parenti, Marco; Rovati, G Enrico

    2017-01-15

    Thromboxane A 2 is a potent mediator of inflammation and platelet aggregation exerting its effects through the activation of a G protein-coupled receptor (GPCR), termed TP. Although the existence of dimers/oligomers in Class A GPCRs is widely accepted, their functional significance still remains controversial. Recently, we have shown that TPα and TPβ homo-/hetero-dimers interact through an interface of residues in transmembrane domain 1 (TM1) whose disruption impairs dimer formation. Here, biochemical and pharmacological characterization of this dimer deficient mutant (DDM) in living cells indicates a significant impairment in its response to agonists. Interestingly, two single loss-of-function TPα variants, namely W29C and N42S recently identified in two heterozygous patients affected by bleeding disorders, match some of the residues mutated in our DDM. These two naturally occurring variants display a reduced potency to TP agonists and are characterized by impaired dimer formation in transfected HEK-293T cells. These findings provide proofs that lack of homo-dimer formation is a crucial process for reduced TPα function in vivo, and might represent one molecular mechanism through which platelet TPα receptor dysfunction affects the patient(s) carrying these mutations. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Systemic Inflammation and Lung Function Impairment in Morbidly Obese Subjects with the Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    Astrid van Huisstede

    2013-01-01

    Full Text Available Background. Obesity and asthma are associated. There is a relationship between lung function impairment and the metabolic syndrome. Whether this relationship also exists in the morbidly obese patients is still unknown. Hypothesis. Low-grade systemic inflammation associated with the metabolic syndrome causes inflammation in the lungs and, hence, lung function impairment. Methods. This is cross-sectional study of morbidly obese patients undergoing preoperative screening for bariatric surgery. Metabolic syndrome was assessed according to the revised NCEP-ATP III criteria. Results. A total of 452 patients were included. Patients with the metabolic syndrome (n=293 had significantly higher blood monocyte (mean 5.3 versus 4.9, P=0.044 and eosinophil percentages (median 1.0 versus 0.8, P=0.002, while the total leukocyte count did not differ between the groups. The FEV1/FVC ratio was significantly lower in patients with the metabolic syndrome (76.7% versus 78.2%, P=0.032. Blood eosinophils were associated with FEV1/FVC ratio (adj. B −0.113, P=0.018. Conclusion. Although the difference in FEV1/FVC ratio between the groups is relatively small, in this cross-sectional study, and its clinical relevance may be limited, these data indicate that the presence of the metabolic syndrome may influence lung function impairment, through the induction of relative eosinophilia.

  6. Biosensor Technology Reveals the Disruption of the Endothelial Barrier Function and the Subsequent Death of Blood Brain Barrier Endothelial Cells to Sodium Azide and Its Gaseous Products.

    Science.gov (United States)

    Kho, Dan T; Johnson, Rebecca H; O'Carroll, Simon J; Angel, Catherine E; Graham, E Scott

    2017-09-21

    Herein we demonstrate the sensitive nature of human blood-brain barrier (BBB) endothelial cells to sodium azide and its gaseous product. Sodium azide is known to be acutely cytotoxic at low millimolar concentrations, hence its use as a biological preservative (e.g., in antibodies). Loss of barrier integrity was noticed in experiments using Electric Cell-substrate Impedance Sensing (ECIS) biosensor technology, to measure endothelial barrier integrity continuously in real-time. Initially the effect of sodium azide was observed as an artefact where it was present in antibodies being employed in neutralisation experiments. This was confirmed where antibody clones that were azide-free did not mediate loss of barrier function. A delayed loss of barrier function in neighbouring wells implied the influence of a liberated gaseous product. ECIS technology demonstrated that the BBB endothelial cells had a lower level of direct sensitivity to sodium azide of ~3 µM. Evidence of gaseous toxicity was consistently observed at 30 µM and above, with disrupted barrier function and cell death in neighbouring wells. We highlight the ability of this cellular biosensor technology to reveal both the direct and gaseous toxicity mediated by sodium azide. The sensitivity and temporal dimension of ECIS technology was instrumental in these observations. These findings have substantial implications for the wide use of sodium azide in biological reagents, raising issues of their application in live-cell assays and with regard to the protection of the user. This research also has wider relevance highlighting the sensitivity of brain endothelial cells to a known mitochondrial disruptor. It is logical to hypothesise that BBB endothelial dysfunction due to mitochondrial dys-regulation could have an important but underappreciated role in a range of neurological diseases.

  7. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  8. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  9. Innovative probabilistic risk assessment applications: barrier impairments and fracture toughness. 2. Demolition Debris and Tornado Missile Hazard During Decommissioning

    International Nuclear Information System (INIS)

    Calhoun, David; Shepherd, Stephen

    2001-01-01

    impose on decommissioning projects. Unit 1 began operation in 1968. Because of the age of Unit 1's design and the low frequency of tornadoes in California, the original plant design did not provide any protection from tornado hazards. Tornado protection requirements were later imposed as a back-fit; however, the approved license change was based on a probabilistic risk assessment that defined Unit 1's tornado missile damage acceptance limit in terms of reactor core damage frequency. When several Unit 1 buildings have been demolished, construction will begin on an ISFSI for Unit 1's spent fuel. The ISFSI design incorporates tornado missile barrier features into the storage canister and transfer cask. These design provisions will alleviate any need to manage tornado missile hazards. Units 2 and 3 share a design basis for tornado missile protection that closely follows the U.S. Nuclear Regulatory Commission's Standard Review Plan (NUREG 0800), Revision 1. Critical components are identified that are required to be functional following design-basis tornadoes. Missile barriers protect most critical components; however, some critical components are allowed to be exposed to tornado missiles provided the aggregate annual probability of damage to all critical components is -7 per unit. According to the analysis that established this probability, it is directly proportional to the inventory of unrestrained objects within a missile pickup/transport area that includes the entire site. To determine the increased probability of damage due to demolition work, the quantity of loose debris was estimated for several discrete time intervals of the decommissioning process. This intermediate result showed that debris controls would be necessary to protect critical components in Units 2 and 3 during the demolition of Unit 1. Several different methods for controlling debris were evaluated for efficacy, feasibility, and cost-effectiveness. Unit 1 decommissioning work will increase the number of

  10. Sympathetic arousal, but not disturbed executive functioning, mediates the impairment of cognitive flexibility under stress.

    Science.gov (United States)

    Marko, Martin; Riečanský, Igor

    2018-05-01

    Cognitive flexibility emerges from an interplay of multiple cognitive systems, of which lexical-semantic and executive are thought to be the most important. Yet this has not been addressed by previous studies demonstrating that such forms of flexible thought deteriorate under stress. Motivated by these shortcomings, the present study evaluated several candidate mechanisms implied to mediate the impairing effects of stress on flexible thinking. Fifty-seven healthy adults were randomly assigned to psychosocial stress or control condition while assessed for performance on cognitive flexibility, working memory capacity, semantic fluency, and self-reported cognitive interference. Stress response was indicated by changes in skin conductance, hearth rate, and state anxiety. Our analyses showed that acute stress impaired cognitive flexibility via a concomitant increase in sympathetic arousal, while this mediator was positively associated with semantic fluency. Stress also decreased working memory capacity, which was partially mediated by elevated cognitive interference, but neither of these two measures were associated with cognitive flexibility or sympathetic arousal. Following these findings, we conclude that acute stress impairs cognitive flexibility via sympathetic arousal that modulates lexical-semantic and associative processes. In particular, the results indicate that stress-level of sympathetic activation may restrict the accessibility and integration of remote associates and bias the response competition towards prepotent and dominant ideas. Importantly, our results indicate that stress-induced impairments of cognitive flexibility and executive functions are mediated by distinct neurocognitive mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Fast-twitch glycolytic skeletal muscle is predisposed to age-induced impairments in mitochondrial function

    DEFF Research Database (Denmark)

    Jacobs, Robert A; Díaz, Víctor; Soldini, Lavinia

    2013-01-01

    The etiology of mammalian senescence is suggested to involve the progressive impairment of mitochondrial function; however, direct observations of age-induced alterations in actual respiratory chain function are lacking. Accordingly, we assessed mitochondrial function via high-resolution respirom......The etiology of mammalian senescence is suggested to involve the progressive impairment of mitochondrial function; however, direct observations of age-induced alterations in actual respiratory chain function are lacking. Accordingly, we assessed mitochondrial function via high......-resolution respirometry and mitochondrial protein expression in soleus, quadricep, and lateral gastrocnemius skeletal muscles, which represent type 1 slow-twitch oxidative muscle (soleus) and type 2 fast-twitch glycolytic muscle (quadricep and gastrocnemius), respectively, in young (10-12 weeks) and mature (74-76 weeks......) mice. Electron transport through mitochondrial complexes I and III increases with age in quadricep and gastrocnemius, which is not observed in soleus. Mitochondrial coupling efficiency during respiration through complex I also deteriorates with age in gastrocnemius and shows a tendency (p = .085...

  12. Proteasome function is not impaired in healthy aging of the lung.

    Science.gov (United States)

    Caniard, Anne; Ballweg, Korbinian; Lukas, Christina; Yildirim, Ali Ö; Eickelberg, Oliver; Meiners, Silke

    2015-10-01

    Aging is the progressive loss of cellular function which inevitably leads to death. Failure of proteostasis including the decrease in proteasome function is one hallmark of aging. In the lung, proteasome activity was shown to be impaired in age-related diseases such as chronic obstructive pulmonary disease. However, little is known on proteasome function during healthy aging. Here, we comprehensively analyzed healthy lung aging and proteasome function in wildtype, proteasome reporter and immunoproteasome knockout mice. Wildtype mice spontaneously developed senile lung emphysema while expression and activity of proteasome complexes and turnover of ubiquitinated substrates was not grossly altered in lungs of aged mice. Immunoproteasome subunits were specifically upregulated in the aged lung and the caspase-like proteasome activity concomitantly decreased. Aged knockout mice for the LMP2 or LMP7 immunoproteasome subunits showed no alteration in proteasome activities but exhibited typical lung aging phenotypes suggesting that immunoproteasome function is dispensable for physiological lung aging in mice. Our results indicate that healthy aging of the lung does not involve impairment of proteasome function. Apparently, the reserve capacity of the proteostasis systems in the lung is sufficient to avoid severe proteostasis imbalance during healthy aging.

  13. Exposure to lipopolysaccharide and/or unconjugated bilirubin impair the integrity and function of brain microvascular endothelial cells.

    Directory of Open Access Journals (Sweden)

    Filipa L Cardoso

    Full Text Available BACKGROUND: Sepsis and jaundice are common conditions in newborns that can lead to brain damage. Though lipopolysaccharide (LPS is known to alter the integrity of the blood-brain barrier (BBB, little is known on the effects of unconjugated bilirubin (UCB and even less on the joint effects of UCB and LPS on brain microvascular endothelial cells (BMEC. METHODOLOGY/PRINCIPAL FINDINGS: Monolayers of primary rat BMEC were treated with 1 µg/ml LPS and/or 50 µM UCB, in the presence of 100 µM human serum albumin, for 4 or 24 h. Co-cultures of BMEC with astroglial cells, a more complex BBB model, were used in selected experiments. LPS led to apoptosis and UCB induced both apoptotic and necrotic-like cell death. LPS and UCB led to inhibition of P-glycoprotein and activation of matrix metalloproteinases-2 and -9 in mono-cultures. Transmission electron microscopy evidenced apoptotic bodies, as well as damaged mitochondria and rough endoplasmic reticulum in BMEC by either insult. Shorter cell contacts and increased caveolae-like invaginations were noticeable in LPS-treated cells and loss of intercellular junctions was observed upon treatment with UCB. Both compounds triggered impairment of endothelial permeability and transendothelial electrical resistance both in mono- and co-cultures. The functional changes were confirmed by alterations in immunostaining for junctional proteins β-catenin, ZO-1 and claudin-5. Enlargement of intercellular spaces, and redistribution of junctional proteins were found in BMEC after exposure to LPS and UCB. CONCLUSIONS: LPS and/or UCB exert direct toxic effects on BMEC, with distinct temporal profiles and mechanisms of action. Therefore, the impairment of brain endothelial integrity upon exposure to these neurotoxins may favor their access to the brain, thus increasing the risk of injury and requiring adequate clinical management of sepsis and jaundice in the neonatal period.

  14. Executive functions in mono- and bilingual children with language impairment - issues for speech-language pathology.

    Science.gov (United States)

    Sandgren, Olof; Holmström, Ketty

    2015-01-01

    The clinical assessment of language impairment (LI) in bilingual children imposes challenges for speech-language pathology services. Assessment tools standardized for monolingual populations increase the risk of misinterpreting bilingualism as LI. This Perspective article summarizes recent studies on the assessment of bilingual LI and presents new results on including non-linguistic measures of executive functions in the diagnostic assessment. Executive functions shows clinical utility as less subjected to language use and exposure than linguistic measures. A possible bilingual advantage, and consequences for speech-language pathology practices and future research are discussed.

  15. A prospective study found impaired left ventricular function predicted job retirement after acute myocardial infarction

    DEFF Research Database (Denmark)

    Nielsen, Finn E; Sørensen, Henrik T; Skagen, Knud

    2004-01-01

    adjusting for confounding factors, reduced LVEF was an independent predictor of retirement. Based on a stratified analysis, being female (RR=3.90, 95% CI=1.18-12.62) or having heavy physical job demands (RR=3.83, 95% CI=1.02-14.30) had a more pronounced impact on retirement for patients with LVEF 35......%, compared with patients with better left ventricular function. CONCLUSION: We conclude that impaired left ventricular systolic function is a prognostic determinant of retirement from the job market after acute MI....

  16. Oral and fecal Campylobacter concisus strains perturb barrier function by apoptosis induction in HT-29/B6 intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Hans Linde Nielsen

    Full Text Available Campylobacter concisus infections of the gastrointestinal tract can be accompanied by diarrhea and inflammation, whereas colonization of the human oral cavity might have a commensal nature. We focus on the pathophysiology of C. concisus and the effects of different clinical oral and fecal C. concisus strains on human HT-29/B6 colon cells. Six oral and eight fecal strains of C. concisus were isolated. Mucus-producing HT-29/B6 epithelial monolayers were infected with the C. concisus strains. Transepithelial electrical resistance (R(t and tracer fluxes of different molecule size were measured in Ussing chambers. Tight junction (TJ protein expression was determined by Western blotting, and subcellular TJ distribution was analyzed by confocal laser-scanning microscopy. Apoptosis induction was examined by TUNEL-staining and Western blot of caspase-3 activation. All strains invaded confluent HT-29/B6 cells and impaired epithelial barrier function, characterized by a time- and dose-dependent decrease in R(t either after infection from the apical side but even more from the basolateral compartment. TJ protein expression changes were sparse, only in apoptotic areas of infected monolayers TJ proteins were redistributed. Solely the barrier-forming TJ protein claudin-5 showed a reduced expression level to 66±8% (P<0.05, by expression regulation from the gene. Concomitantly, Lactate dehydrogenase release was elevated to 3.1±0.3% versus 0.7±0.1% in control (P<0.001, suggesting cytotoxic effects. Furthermore, oral and fecal C. concisus strains elevated apoptotic events to 5-fold. C. concisus-infected monolayers revealed an increased permeability for 332 Da fluorescein (1.74±0.13 vs. 0.56±0.17 10(-6 cm/s in control, P<0.05 but showed no difference in permeability for 4 kDa FITC-dextran (FD-4. The same was true in camptothecin-exposed monolayers, where camptothecin was used for apoptosis induction.In conclusion, epithelial barrier dysfunction by oral and

  17. Functional and structural alterations of epithelial barrier properties of rat ileum following X-irradiation

    International Nuclear Information System (INIS)

    Dublineau, I.; Lebrun, F.; Grison, S.; Griffiths, N.M.

    2004-01-01

    Irradiation of the digestive system leads to alterations of the small intestine. We have characterized the disruption of the barrier integrity in rat ileum from 1 to 14 days following irradiation ranging from 6 to 12 Gy. The intestinal permeability to 14 C-mannitol and 3 H-dextran 70,000 was measured in vitro in Ussing chambers. In parallel to these functional studies, immunohistochemical analyses of junctional proteins (ZO-1 and β-catenin) of ileal epithelium were performed by confocal microscopy. Irradiation with 10 Gy induced a marked decrease in epithelial tissue resistance at three days and a fivefold increase in mannitol permeability, without modifications of dextran permeability. A disorganization of the localization for ZO-1 and β-catenin was also observed. At 7 days after irradiation, we observed a recovery of the organization of junctional proteins in parallel to a return of intestinal permeability to control value. In addition to these time-dependent effects, a gradual effect on epithelial integrity of the radiation doses was observed 3 days after irradiation. This study shows a disruption of the integrity of the intestinal barrier in rat ileum following abdominal X-irradiation, depending on the time postirradiation and on the delivered dose. The loss of barrier integrity was characterized by a disorganization of proteins of tight and adherent junctions, leading to increased intestinal permeability to mannitol. (author)

  18. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Potential barriers and facilitators for implementation of an integrated care pathway for hearing-impaired persons: an exploratory survey among patients and professionals

    Directory of Open Access Journals (Sweden)

    Verschuure Hans

    2007-04-01

    Full Text Available Abstract Background Because of the increasing costs and anticipated shortage of Ear Nose and Throat (ENT specialists in the care for hearing-impaired persons, an integrated care pathway that includes direct hearing aid provision was developed. While this direct pathway is still under investigation, in a survey we examined expectations and potential barriers and facilitators towards this direct pathway, of patients and professionals involved in the pathway. Methods Two study populations were assessed: members of the health professions involved in the care pathway for hearing-impaired persons (general practitioners (GPs, hearing aid dispensers, ENT-specialists and clinical audiologists and persons with hearing complaints. We developed a comprehensive semi-structured questionnaire for the professionals, regarding expectations, barriers, facilitators and conditions for implementation. We developed two questionnaires for persons with hearing complaints, both regarding evaluations and preferences, and administered them after they had experienced two key elements of the direct pathway: the triage and the hearing aid fitting. Results On average GPs and hearing aid dispensers had positive expectations towards the direct pathway, while ENT-specialists and clinical audiologists had negative expectations. Professionals stated both barriers and facilitators towards the direct pathway. Most professionals either supported implementation of the direct pathway, provided that a number of conditions were satisfied, or did not support implementation, unless roughly the same conditions were satisfied. Professionals generally agreed on which conditions need to be satisfied. Persons with hearing complaints evaluated the present referral pathway and the new direct pathway equally. Many, especially older, participants stated however that they would still visit the GP and ENT-specialist, even when this would not be necessary for reimbursement of the hearing aid, and

  20. Collaborative learning to unlock investments for functional ecological infrastructure: Bridging barriers in social-ecological systems in South Africa

    CSIR Research Space (South Africa)

    Angelstam, P

    2017-05-01

    Full Text Available . Based on expert knowledge at three scales, we analysed South Africa's opportunity to active adaptive management and to unlock investments that enhance functional ecological infrastructure. Barriers included lack of trust among actors, limited...

  1. Disorganized Symptoms and Executive Functioning Predict Impaired Social Functioning in Subjects at Risk for Psychosis

    OpenAIRE

    Eslami, Ali; Jahshan, Carol; Cadenhead, Kristin S.

    2011-01-01

    Predictors of social functioning deficits were assessed in 22 individuals “at risk” for psychosis. Disorganized symptoms and executive functioning predicted social functioning at follow-up. Early intervention efforts that focus on social and cognitive skills are indicated in this vulnerable population.

  2. Impairment in Proverb Interpretation as an Executive Function Deficit in Patients with Amnestic Mild Cognitive Impairment and Early Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Thomas Leyhe

    2011-01-01

    Full Text Available Background/Aims: Proverb interpretation is assumed to reflect executive functions. We hypothesized that proverb interpretation is impaired in patients with amnestic mild cognitive impairment (aMCI diagnosed as single-domain impairment by common neuropsychological testing. Methods: We compared performance in a proverb interpretation test in single-domain aMCI patients and patients with early Alzheimer’s disease (EAD. Results: The groups with aMCI and EAD performed significantly worse than healthy controls. Both patient groups gave concrete answers with a similar frequency. However, patients with EAD tended to give senseless answers more frequently. Conclusions: Our data suggest that in patients diagnosed as single-domain aMCI, deterioration of executive functions is detectable with subtle and appropriate neuropsychological testing. Implementation of these procedures may improve the early prediction of AD.

  3. Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

    Science.gov (United States)

    Ohno, Yusuke

    2017-01-01

    The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

  4. Testing the specificity of executive functioning impairments in adolescents with ADHD, ODD/CD and ASD.

    Science.gov (United States)

    Carter Leno, Virginia; Chandler, Susie; White, Pippa; Pickles, Andrew; Baird, Gillian; Hobson, Chris; Smith, Anna B; Charman, Tony; Rubia, Katya; Simonoff, Emily

    2017-12-09

    Current diagnostic systems conceptualise attention deficit hyperactivity disorder (ADHD), oppositional defiant/conduct disorder (ODD/CD) and autism spectrum disorder (ASD) as separate diagnoses. However, all three demonstrate executive functioning (EF) impairments. Whether these impairments are trans-diagnostic or disorder-specific remains relatively unexplored. Four groups of 10-16 year-olds [typically developing (TD; N = 43), individuals clinically diagnosed with ADHD (N = 21), ODD/CD (N = 26) and ASD (N = 41)] completed Go/NoGo and Switch tasks. Group differences were tested using analysis of co-variance (ANCOVA) including age, IQ, sex, conduct problems and ADHD symptoms as co-variates. Results indicated some disorder-specificity as only the ASD group demonstrated decreased probability of inhibition in the Go/NoGo task compared to all other groups. However, shared impairments were also found; all three diagnostic groups demonstrated increased reaction time variability (RTV) compared to the TD group, and both the ODD/CD and the ASD group demonstrated increased premature responses. When controlling for ADHD symptoms and conduct problems, group differences in RTV were no longer significant; however, the ASD group continued to demonstrate increased premature responses. No group differences were found in cognitive flexibility in the Switch task. A more varied response style was present across all clinical groups, although this appeared to be accounted for by sub-threshold ODD/CD and ADHD symptoms. Only the ASD group was impaired in response inhibition and premature responsiveness relative to TD adolescents. The findings suggest that some EF impairments typically associated with ADHD may also be found in individuals with ASD.

  5. When words lead to solutions: executive function deficits in preschool children with specific language impairment.

    Science.gov (United States)

    Roello, Mara; Ferretti, Maria Letizia; Colonnello, Valentina; Levi, Gabriel

    2015-02-01

    Several studies indicate that school-age children with specific language impairment (SLI) have difficulties with tasks that rely on executive functions. Whether executive function deficits in children with SLI emerge during preschool age remains unclear. Our aim was to fill this gap by investigating executive function performances in two age groups of preschoolers with and without SLI. Children with SLI (N=60; young: 53.6±5.3 months; old: 65.4±3.8 months) and age-matched control children (N=58) were tested for problem-representation ability, using the Flexible Item Selection Task (FIST), rule-use skills, using a Stroop-like Day-Night test (D/N), and planning skills, using the Tower of London test (TOL). Older children performed better than younger children did across tasks. Children with SLI had poorer performance, compared to typically developing children, on measures of problem representation, planning skills, and use of rules. Our results clearly indicate that executive function impairment is evident during the preschool period. Although old children with SLI performed better than young children with SLI, their performances were still poor, compared to those of control peers. These findings suggest that children with SLI have altered executive functioning at 53.6 months. Copyright © 2014. Published by Elsevier Ltd.

  6. Disrupted topological organization of resting-state functional brain network in subcortical vascular mild cognitive impairment.

    Science.gov (United States)

    Yi, Li-Ye; Liang, Xia; Liu, Da-Ming; Sun, Bo; Ying, Sun; Yang, Dong-Bo; Li, Qing-Bin; Jiang, Chuan-Lu; Han, Ying

    2015-10-01

    Neuroimaging studies have demonstrated both structural and functional abnormalities in widespread brain regions in patients with subcortical vascular mild cognitive impairment (svMCI). However, whether and how these changes alter functional brain network organization remains largely unknown. We recruited 21 patients with svMCI and 26 healthy control (HC) subjects who underwent resting-state functional magnetic resonance imaging scans. Graph theory-based network analyses were used to investigate alterations in the topological organization of functional brain networks. Compared with the HC individuals, the patients with svMCI showed disrupted global network topology with significantly increased path length and modularity. Modular structure was also impaired in the svMCI patients with a notable rearrangement of the executive control module, where the parietal regions were split out and grouped as a separate module. The svMCI patients also revealed deficits in the intra- and/or intermodule connectivity of several brain regions. Specifically, the within-module degree was decreased in the middle cingulate gyrus while it was increased in the left anterior insula, medial prefrontal cortex and cuneus. Additionally, increased intermodule connectivity was observed in the inferior and superior parietal gyrus, which was associated with worse cognitive performance in the svMCI patients. Together, our results indicate that svMCI patients exhibit dysregulation of the topological organization of functional brain networks, which has important implications for understanding the pathophysiological mechanism of svMCI. © 2015 John Wiley & Sons Ltd.

  7. Stereodynamic tetrahydrobiisoindole “NU-BIPHEP(O”s: functionalization, rotational barriers and non-covalent interactions

    Directory of Open Access Journals (Sweden)

    Golo Storch

    2016-07-01

    Full Text Available Stereodynamic ligands offer intriguing possibilities in enantioselective catalysis. “NU-BIPHEPs” are a class of stereodynamic diphosphine ligands which are easily accessible via rhodium-catalyzed double [2 + 2 + 2] cycloadditions. This study explores the preparation of differently functionalized “NU-BIPHEP(O” compounds, the characterization of non-covalent adduct formation and the quantification of enantiomerization barriers. In order to explore the possibilities of functionalization, we studied modifications of the ligand backbone, e.g., with 3,5-dichlorobenzoyl chloride. Diastereomeric adducts with Okamoto-type cellulose derivatives and on-column deracemization were realized on the basis of non-covalent interactions. Enantioselective dynamic HPLC (DHPLC allowed for the determination of rotational barriers of ΔG‡298K = 92.2 ± 0.3 kJ mol−1 and 99.5 ± 0.1 kJ mol−1 underlining the stereodynamic properties of “NU-BIPHEPs” and “NU-BIPHEP(Os”, respectively. These results make the preparation of tailor-made functionalized stereodynamic ligands possible and give an outline for possible applications in enantioselective catalysis.

  8. Association Between Parenting Stress and Functional Impairment Among Children Diagnosed with Neurodevelopmental Disorders.

    Science.gov (United States)

    Almogbel, Yasser S; Goyal, Rohit; Sansgiry, Sujit S

    2017-05-01

    The objective of this study was to examine the association between parenting stress and functional impairment among children with Neurodevelopmental Disorder (NDD). A sample of 150 parents of children diagnosed with NDD were recruited from schools that offer special education services. Parents completed a self-administered survey containing the parenting stress index-short form (PSI-SF) scale and the Columbia Impairment Scale. The multiple logistic regression conducted to compare those with clinically significant PSI-SF scores indicated that the risk of parents with clinically significant scores of parenting stress increased 5.5 times with functionally impaired children with NDD. Further the risk of stress increased 4.6 times when these parents reported having their own disorder/disease. The risk of stress was reduced by 57% for those who had higher than a college level education compared to those with a college level education or below. These findings might help health care providers to initiate early intervention strategies such as peer support and education that can prevent parenting stress and reduce the risk of potential incidence of depression.

  9. Proportional and functional analogical reasoning in normal and language-impaired children.

    Science.gov (United States)

    Nippold, M A; Erskine, B J; Freed, D B

    1988-11-01

    Teachers often use analogies in classroom settings to clarify new concepts for their students. However, analogies may inadvertently confuse the youngster who has difficulty identifying the one-to-one comparisons underlying them. Although analogical reasoning has been studied extensively in normal children, no information was available concerning this construct in children having a specific language impairment. Thus, it was unknown to what extent they might be deficient in analogical reasoning. Therefore, in the present study, 20 children ages 6-8 years (mean age = 7:6) having normal nonverbal intelligence but deficits in language comprehension were administered tasks of verbal and perceptual proportional analogical reasoning and a problem-solving task of functional analogical reasoning. Compared to a normal-language control group matched on the basis of chronological age and sex, the language-impaired group was deficient in all three tasks of analogical reasoning. However, when the factor of nonverbal intelligence was controlled statistically, the differences between the groups on each of the tasks were removed. Additional findings were that verbal proportional analogical reasoning was significantly correlated to perceptual proportional analogical reasoning and to functional analogical reasoning. Implications for assessment and intervention with young school-age language-impaired children are discussed.

  10. Olfactory evaluation in Mild Cognitive Impairment: correlation with neurocognitive performance and endothelial function.

    Science.gov (United States)

    Tonacci, Alessandro; Bruno, Rosa M; Ghiadoni, Lorenzo; Pratali, Lorenza; Berardi, Nicoletta; Tognoni, Gloria; Cintoli, Simona; Volpi, Leda; Bonuccelli, Ubaldo; Sicari, Rosa; Taddei, Stefano; Maffei, Lamberto; Picano, Eugenio

    2017-05-01

    Mild Cognitive Impairment (MCI) is an intermediate condition between normal aging and dementia, associated with an increased risk of progression into the latter within months or years. Olfactory impairment, a well-known biomarker for neurodegeneration, might be present in the condition early, possibly representing a signal for future pathological onset. Our study aimed at evaluating olfactory function in MCI and healthy controls in relation to neurocognitive performance and endothelial function. A total of 85 individuals with MCI and 41 healthy controls, matched for age and gender, were recruited. Olfactory function was assessed by Sniffin' Sticks Extended Test (Burghart, Medizintechnik, GmbH, Wedel, Germany). A comprehensive neurocognitive assessment was performed. Endothelial function was assessed by flow-mediated dilation (FMD) of the brachial artery by ultrasound. MCI individuals showed an impaired olfactory function compared to controls. The overall olfactory score is able to predict MCI with a good sensitivity and specificity (70.3 and 77.4% respectively). In MCI, olfactory identification score is correlated with a number of neurocognitive abilities, including overall cognitive status, dementia rating, immediate and delayed memory, visuospatial ability and verbal fluency. FMD was reduced in MCI (2.90 ± 2.15 vs. 3.66 ± 1.96%, P = 0.016) and was positively associated with olfactory identification score (ρ s =0.219, P = 0.025). The association remained significant after controlling for age, gender, and smoking. In conclusion, olfactory evaluation is able to discriminate between MCI and healthy individuals. Systemic vascular dysfunction might be involved, at least indirectly, in olfactory dysfunction in MCI. © 2017 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  11. Neuropsychological Impairment in Detoxified Alcohol-Dependent Subjects with Preserved Psychosocial Functioning

    Directory of Open Access Journals (Sweden)

    Catherine Martelli

    2017-09-01

    Full Text Available BackgroundChronic alcoholism and its related cognitive impairments are associated with increased social, relational, and professional deficits which have a variable overall impact on social integration. These impairments are known to have varying severities and have rarely been studied among healthy alcohol-dependent subjects with preserved psychosocial functioning. Thus, the objective of this study is to describe neuropsychological performance in this particular population.MethodTwenty-nine socially adjusted alcohol-dependent men, hospitalized for a first or second withdrawal and abstinent for 3 weeks minimum, were compared to 29 healthy non-alcoholic controls. All subjects underwent clinical and psychiatric examination, neuropsychological tests of memory (M, working memory (WM, and executive functions (EF. Comparisons were performed using Student’s t-tests or Mann–Whitney U tests.ResultsNo group differences were found on the Self-Reported Social Adjustment Scale (SAS-SR or in the Mini-Mental State Examination. Compared to controls, patients had greater episodic, spatial, and WM deficits as well as slightly altered executive functions. In contrast, their executive functions (spontaneous flexibility, criteria generation, rule maintenance, and inhibitory control were relatively preserved.ConclusionOur sample of socially and professionally integrated alcoholic patients shows fewer cognitive deficits than described in previous studies. Our results suggest that early on, alcohol-dependent subjects develop compensatory adaptation processes to preserve social function and adaptation. Minor cognitive impairments should be screened early in the disease to integrate cognitive interventions into the health-care plan to thus eventually prevent further socio-professional marginalization.

  12. Impaired financial capacity in late life depression is associated with cognitive performance on measures of executive functioning and attention.

    Science.gov (United States)

    Mackin, R Scott; Areán, Patricia A

    2009-09-01

    Few studies have evaluated the prevalence of impairments of financial capacity among individuals with psychiatric disorders. Late life depression (LLD) is a common psychiatric disorder associated with significant disability and cognitive impairment. The purpose of this investigation was to determine the prevalence and cognitive correlates of impairments of financial capacity among individuals with LLD. Participants included 65 LLD individuals and 32 comparison subjects. Assessments included measures of financial capacity, cognitive functioning, and depression symptom severity. Individuals with LLD exhibited a significantly higher rate of impaired financial capacity (22%) than the comparison group (6%). Results of a multiple regression analysis indicated that performance on measures of executive functioning and attention, but not depression severity, were most strongly associated with financial capacity performance in LLD. Our results suggest impairments of financial capacity in LLD are largely explained by cognitive functioning in these domains.

  13. Why do interracial interactions impair executive function? A resource depletion account.

    Science.gov (United States)

    Richeson, Jennifer A; Trawalter, Sophie

    2005-06-01

    Three studies investigated the veracity of a resource depletion account of the impairment of inhibitory task performance after interracial contact. White individuals engaged in either an interracial or same-race interaction, then completed an ostensibly unrelated Stroop color-naming test. In each study, the self-regulatory demands of the interaction were either increased (Study 1) or decreased (Studies 2 and 3). Results revealed that increasing the self-regulatory demands of an interracial interaction led to greater Stroop interference compared with control, whereas reducing self-regulatory demands led to less Stroop interference. Manipulating self-regulatory demands did not affect Stroop performance after same-race interactions. Taken together, the present studies point to resource depletion as the likely mechanism underlying the impairment of cognitive functioning after interracial dyadic interactions.

  14. War experiences, general functioning and barriers to care among former child soldiers in Northern Uganda: the WAYS study.

    Science.gov (United States)

    Amone-P'Olak, Kennedy; Jones, Peter; Meiser-Stedman, Richard; Abbott, Rosemary; Ayella-Ataro, Paul Stephen; Amone, Jackson; Ovuga, Emilio

    2014-12-01

    Exposure to war is associated with considerable risks for long-term mental health problems (MHP) and poor functioning. Yet little is known about functioning and mental health service (MHS) use among former child soldiers (FCS). We assessed whether different categories of war experiences predict functioning and perceived need for, sources of and barriers to MHS among FCS. Data were drawn from an on-going War-affected Youths (WAYS) cohort study of FCS in Uganda. Participants completed questionnaires about war experiences, functioning and perceived need for, sources of and barriers to MHS. Regression analyses and parametric tests were used to assess between-group differences. Deaths, material losses, threat to loved ones and sexual abuse significantly predicted poor functioning. FCS who received MHS function better than those who did not. Females reported more emotional and behavioural problems and needed MHS more than males. FCS who function poorly indicated more barriers to MHS than those who function well. Stigma, fear of family break-up and lack of health workers were identified as barriers to MHS. Various war experiences affect functioning differently. A significant need for MHS exists amidst barriers to MHS. Nevertheless, FCS are interested in receiving MHS and believe it would benefit them. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Multiconfiguration pair-density functional theory: barrier heights and main group and transition metal energetics.

    Science.gov (United States)

    Carlson, Rebecca K; Li Manni, Giovanni; Sonnenberger, Andrew L; Truhlar, Donald G; Gagliardi, Laura

    2015-01-13

    Kohn-Sham density functional theory, resting on the representation of the electronic density and kinetic energy by a single Slater determinant, has revolutionized chemistry, but for open-shell systems, the Kohn-Sham Slater determinant has the wrong symmetry properties as compared to an accurate wave function. We have recently proposed a theory, called multiconfiguration pair-density functional theory (MC-PDFT), in which the electronic kinetic energy and classical Coulomb energy are calculated from a multiconfiguration wave function with the correct symmetry properties, and the rest of the energy is calculated from a density functional, called the on-top density functional, that depends on the density and the on-top pair density calculated from this wave function. We also proposed a simple way to approximate the on-top density functional by translation of Kohn-Sham exchange-correlation functionals. The method is much less expensive than other post-SCF methods for calculating the dynamical correlation energy starting with a multiconfiguration self-consistent-field wave function as the reference wave function, and initial tests of the theory were quite encouraging. Here, we provide a broader test of the theory by applying it to bond energies of main-group molecules and transition metal complexes, barrier heights and reaction energies for diverse chemical reactions, proton affinities, and the water dimerization energy. Averaged over 56 data points, the mean unsigned error is 3.2 kcal/mol for MC-PDFT, as compared to 6.9 kcal/mol for Kohn-Sham theory with a comparable density functional. MC-PDFT is more accurate on average than complete active space second-order perturbation theory (CASPT2) for main-group small-molecule bond energies, alkyl bond dissociation energies, transition-metal-ligand bond energies, proton affinities, and the water dimerization energy.

  16. Article choice in children with High Functioning Autism (HFA) and in children with Specific Language Impairment (SLI).

    NARCIS (Netherlands)

    Schaeffer, J.; van Witteloostuijn, M.; de Haan, D.

    2014-01-01

    This study reports on the choice between a definite and an indefinite article by children with High Functioning Autism (HFA) and children with Specific Language Impairment (SLI). We carried out an elicited production task with 16 Dutch-speaking non-grammatically impaired children with HFA aged 6-13,

  17. Valsartan Improves β-Cell Function and Insulin Sensitivity in Subjects With Impaired Glucose Metabolism

    Science.gov (United States)

    van der Zijl, Nynke J.; Moors, Chantalle C.M.; Goossens, Gijs H.; Hermans, Marc M.H.; Blaak, Ellen E.; Diamant, Michaela

    2011-01-01

    OBJECTIVE Recently, the Nateglinide and Valsartan in Impaired Glucose Tolerance Outcomes Research Trial demonstrated that treatment with the angiotensin receptor blocker (ARB) valsartan for 5 years resulted in a relative reduction of 14% in the incidence of type 2 diabetes in subjects with impaired glucose metabolism (IGM). We investigated whether improvements in β-cell function and/or insulin sensitivity underlie these preventive effects of the ARB valsartan in the onset of type 2 diabetes. RESEARCH DESIGN AND METHODS In this randomized controlled, double-blind, two-center study, the effects of 26 weeks of valsartan (320 mg daily; n = 40) or placebo (n = 39) on β-cell function and insulin sensitivity were assessed in subjects with impaired fasting glucose and/or impaired glucose tolerance, using a combined hyperinsulinemic-euglycemic and hyperglycemic clamp with subsequent arginine stimulation and a 2-h 75-g oral glucose tolerance test (OGTT). Treatment effects were analyzed using ANCOVA, adjusting for center, glucometabolic status, and sex. RESULTS Valsartan increased first-phase (P = 0.028) and second-phase (P = 0.002) glucose-stimulated insulin secretion compared with placebo, whereas the enhanced arginine-stimulated insulin secretion was comparable between groups (P = 0.25). In addition, valsartan increased the OGTT-derived insulinogenic index (representing first-phase insulin secretion after an oral glucose load; P = 0.027). Clamp-derived insulin sensitivity was significantly increased with valsartan compared with placebo (P = 0.049). Valsartan treatment significantly decreased systolic and diastolic blood pressure compared with placebo (P valsartan treatment increased glucose-stimulated insulin release and insulin sensitivity in normotensive subjects with IGM. These findings may partly explain the beneficial effects of valsartan in the reduced incidence of type 2 diabetes. PMID:21330640

  18. Population pharmacokinetics of pomalidomide in patients with relapsed or refractory multiple myeloma with various degrees of impaired renal function.

    Science.gov (United States)

    Li, Yan; Wang, Xiaomin; O'Mara, Edward; Dimopoulos, Meletios A; Sonneveld, Pieter; Weisel, Katja C; Matous, Jeffrey; Siegel, David S; Shah, Jatin J; Kueenburg, Elisabeth; Sternas, Lars; Cavanaugh, Chloe; Zaki, Mohamed; Palmisano, Maria; Zhou, Simon

    2017-01-01

    Pomalidomide is an immunomodulatory drug for treatment of relapsed or refractory multiple myeloma (rrMM) in patients who often have comorbid renal conditions. To assess the impact of renal impairment on pomalidomide exposure, a population pharmacokinetics (PPK) model of pomalidomide in rrMM patients with various degrees of impaired renal function was developed. Intensive and sparse pomalidomide concentration data collected from two clinical studies in rrMM patients with normal renal function, moderately impaired renal function, severely impaired renal function not requiring dialysis, and with severely impaired renal function requiring dialysis were pooled over the dose range of 2 to 4 mg, to assess specifically the influence of the impaired renal function as a categorical variable and a continuous variable on pomalidomide clearance and plasma exposure. In addition, pomalidomide concentration data collected on dialysis days from both the withdrawal (arterial) side and from the returning (venous) side of the dialyzer, from rrMM patients with severely impaired renal function requiring dialysis, were used to assess the extent to which dialysis contributes to the removal of pomalidomide from blood circulation. PPK analyses demonstrated that moderate to severe renal impairment not requiring dialysis has no influence on pomalidomide clearance or plasma exposure, as compared to those patients with normal renal function, while pomalidomide exposure increased approximately 35% in patients with severe renal impairment requiring dialysis on nondialysis days. In addition, dialysis increased total body pomalidomide clearance from 5 L/h to 12 L/h, indicating that dialysis will significantly remove pomalidomide from the blood circulation. Thus, pomalidomide should be administered post-dialysis on the days of dialysis.

  19. Impaired vascular function after exposure to diesel exhaust generated at urban transient running conditions

    Directory of Open Access Journals (Sweden)

    Westerholm Roger

    2010-07-01

    Full Text Available Abstract Background Traffic emissions including diesel engine exhaust are associated with increased respiratory and cardiovascular morbidity and mortality. Controlled human exposure studies have demonstrated impaired vascular function after inhalation of exhaust generated by a diesel engine under idling conditions. Objectives To assess the vascular and fibrinolytic effects of exposure to diesel exhaust generated during urban-cycle running conditions that mimic ambient 'real-world' exposures. Methods In a randomised double-blind crossover study, eighteen healthy male volunteers were exposed to diesel exhaust (approximately 250 μg/m3 or filtered air for one hour during intermittent exercise. Diesel exhaust was generated during the urban part of the standardized European Transient Cycle. Six hours post-exposure, vascular vasomotor and fibrinolytic function was assessed during venous occlusion plethysmography with intra-arterial agonist infusions. Measurements and Main Results Forearm blood flow increased in a dose-dependent manner with both endothelial-dependent (acetylcholine and bradykinin and endothelial-independent (sodium nitroprusside and verapamil vasodilators. Diesel exhaust exposure attenuated the vasodilatation to acetylcholine (P Conclusion Exposure to diesel exhaust generated under transient running conditions, as a relevant model of urban air pollution, impairs vasomotor function and endogenous fibrinolysis in a similar way as exposure to diesel exhaust generated at idling. This indicates that adverse vascular effects of diesel exhaust inhalation occur over different running conditions with varying exhaust composition and concentrations as well as physicochemical particle properties. Importantly, exposure to diesel exhaust under ETC conditions was also associated with a novel finding of impaired of calcium channel-dependent vasomotor function. This implies that certain cardiovascular endpoints seem to be related to general diesel

  20. Theory of Mind deficits and social emotional functioning in preschoolers with Specific Language Impairment

    Directory of Open Access Journals (Sweden)

    Constance Vissers

    2016-11-01

    Full Text Available Children with Specific Language Impairment (SLI often experience emotional and social difficulties. In general, problems in social emotional functioning can be cognitively explained in terms of Theory of Mind (ToM. In this mini-review, an overview is provided of studies on social-emotional functioning and ToM in preschoolers (average age from 2.3 to 6.2 years with SLI. It is concluded that, similar to school-aged children with SLI, preschoolers with SLI have several social-emotional problems and that both cognitive and affective aspects of ToM are impaired in those children. Based hereon, three possible causal models for the interrelation between language, ToM and social emotional functioning are put forward. It is proposed that future research on the construct and measurement of early ToM, social emotional functioning and language development in preschoolers with SLI is needed to achieve early detection, tailored treatment, and ultimately insight into the pathogenesis of SLI.

  1. Impaired HDL function in obese adolescents: impact of lifestyle intervention and bariatric surgery.

    Science.gov (United States)

    Matsuo, Yae; Oberbach, Andreas; Till, Holger; Inge, Thomas H; Wabitsch, Martin; Moss, Anja; Jehmlich, Nico; Völker, Uwe; Müller, Ulrike; Siegfried, Wolfgang; Kanesawa, Norio; Kurabayashi, Masahiko; Schuler, Gerhard; Linke, Axel; Adams, Volker

    2013-12-01

    HDL regulates endothelial function via stimulation of nitric oxide production. It is documented that endothelial function is impaired in obese adolescents, and improved by lifestyle interventions (LI). HDL function in obese adolescents and the impact of LI or Roux-en-Y gastric bypass surgery (RYGB) was assessed. HDL was isolated from 14 adolescents with normal body mass index (HDLcontrol ), 10 obese (HDLobese ) before and after 6 month LI, and five severe obese adolescents before and one year after RYGB. HDL-mediated phosphorylation of endothelial nitric oxide synthase (eNOS)-Ser(1177) , eNOS-Thr(495) , and PKC-ßII was evaluated. In addition the HDL proteome was analyzed. HDLobese -mediated eNOS-Ser(1177) phosphorylation was reduced, whereas eNOS-Thr(495) phosphorylation increased significantly when compared to HDLcontrol . No impact of obesity was observed on PKC-ßII phosphorylation. LI and RYGB had no impact on HDL-mediated phosphorylation of eNOS and PKC-ßII. A principle component plot analysis of the HDL particle separated controls and severe obese, whereas the interventions did not trigger sufficient differences to the HDL proteome to permit distinction. These results demonstrated that HDL-function is impaired in obese adolescents, and that LI or RYGB did not correct this dysfunction. This might be an argument for developing earlier prevention strategies in obese adolescents to avoid HDL dysfunction. Copyright © 2013 The Obesity Society.

  2. Effects of Lactobacillus plantarum on gut barrier function in experimental obstructive jaundice

    Science.gov (United States)

    Zhou, Yu-Kun; Qin, Huan-Long; Zhang, Ming; Shen, Tong-Yi; Chen, Hong-Qi; Ma, Yan-Lei; Chu, Zhao-Xin; Zhang, Peng; Liu, Zhi-Hua

    2012-01-01

    AIM: To investigate the mechanisms of Lactobacillus plantarum (L. plantarum) action on gut barrier in preoperative and postoperative experimental obstructive jaundice in rats. METHODS: Forty rats were randomly divided into groups of sham-operation, bile duct ligation (BDL), BDL + L. plantarum, BDL + internal biliary drainage (IBD), and BDL + IBD + L. plantarum. Ten days after L. plantarum administration, blood and ileal samples were collected from the rats for morphological examination, and intestinal barrier function, liver function, intestinal oxidative stress and protein kinase C (PKC) activity measurement. The distribution and expression of the PKC and tight junction (TJ) proteins, such as occludin, zonula occludens-1, claudin-1, claudin-4, junction adhesion molecule-A and F-actin, were examined by confocal laser scanning microscopy, immunohistochemistry, Western blotting, real-time fluorescent quantitative polymerase chain reaction assay. RESULTS: L. plantarum administration substantially restored gut barrier, decreased enterocyte apoptosis, improved intestinal oxidative stress, promoted the activity and expression of protein kinase (BDL vs BDL + L. plantarum, 0.295 ± 0.007 vs 0.349 ± 0.003, P plantarum, 0.407 ± 0.046 vs 0.465 ± 0.135, P plantarum, 0.266 ± 0.118 vs 0.326 ± 0.009, P plantarum was more prominent after internal biliary drainage ( BDL + IBD vs BDL + IBD + L. plantarum, 0.415 ± 0.105 vs 0.494 ± 0.145, P plantarum can decrease intestinal epithelial cell apoptosis, reduce oxidative stress, and prevent TJ disruption in biliary obstruction by activating the PKC pathway. PMID:22912548

  3. A 37-year-old woman presenting with impaired visual function during antituberculosis drug therapy: a case report

    Directory of Open Access Journals (Sweden)

    Ayanniyi Abdulkabir A

    2011-07-01

    Full Text Available Abstract Introduction Combination antituberculosis drug therapy remains the mainstay of treating tuberculosis. Unfortunately, antituberculosis drugs produce side effects including (toxic impaired visual function, which may be irreversible. We report a case of antituberculosis-drug-induced impaired visual function that was reversed following early detection and attention. Case presentation A 37-year-old Yoruba woman, weighing 48 kg, presented to our facility with impaired visual functions and mild sensory polyneuropathy in about the fourth month of antituberculosis treatment. Her therapy comprised ethambutol 825 mg, isoniazid 225 mg, rifampicin 450 mg, and pyrazinamide 1200 mg. Her visual acuity was 6/60 in her right eye and 1/60 in her left eye. She had sluggish pupils, red-green dyschromatopsia, hyperemic optic discs and central visual field defects. Her intraocular pressure was 14 mmHg. Her liver and kidney functions were essentially normal. Screening for human immunodeficiency virus was not reactive. Her impaired visual function improved following prompt diagnosis and attention, including the discontinuation of medication. Conclusions The ethambutol and isoniazid in antituberculosis medication are notorious for causing impaired visual function. The diagnosis of ocular toxicity from antituberculosis drugs should never be delayed, and should be possible with the patient's history and simple but basic eye examinations and tests. Tight weight-based antituberculosis therapy, routine peri-therapy visual function monitoring towards early detection of impaired function, and prompt attention will reduce avoidable ocular morbidity.

  4. Activating mitochondrial function and haemoglobin expression with EH-201, an inducer of erythropoietin in neuronal cells, reverses memory impairment

    OpenAIRE

    Horng, Lin-Yea; Hsu, Pei-Lun; Chen, Li-Wen; Tseng, Wang-Zou; Hsu, Kai-Tin; Wu, Chia-Ling; Wu, Rong-Tsun

    2015-01-01

    Background and Purpose Memory impairment can be progressive in neurodegenerative diseases, and physiological ageing or brain injury, mitochondrial dysfunction and oxidative stress are critical components of these issues. An early clinical study has demonstrated cognitive improvement during erythropoietin treatment in patients with chronic renal failure. As erythropoietin cannot freely cross the blood?brain barrier, we tested EH-201 (2,3,5,4?-tetrahydroxystilbene-2-O-?-d-glucoside, also known ...

  5. Impaired fasting glycaemia vs impaired glucose tolerance: similar impairment of pancreatic alpha and beta cell function but differential roles of incretin hormones and insulin action

    DEFF Research Database (Denmark)

    Faerch, K; Vaag, A; Holst, Jens Juul

    2008-01-01

    .892) compared with NGT. Hepatic insulin sensitivity was normal in i-IFG and i-IGT individuals (p > or = 0.179). Individuals with i-IGT had peripheral insulin resistance (p = 0.003 vs NGT), and consequently the disposition index (DI; insulin secretion x insulin sensitivity) during IVGTT (DI(IVGTT))) was reduced......AIMS/HYPOTHESIS: The impact of strategies for prevention of type 2 diabetes in isolated impaired fasting glycaemia (i-IFG) vs isolated impaired glucose tolerance (i-IGT) may differ depending on the underlying pathophysiology. We examined insulin secretion during OGTTs and IVGTTs, hepatic...

  6. Thiolated silicone oils as adhesive skin protectants for improved barrier function.

    Science.gov (United States)

    Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A

    2016-06-01

    The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  7. A Lactobacillus mutant capable of accumulating long-chain polyphosphates that enhance intestinal barrier function.

    Science.gov (United States)

    Saiki, Asako; Ishida, Yasuaki; Segawa, Shuichi; Hirota, Ryuichi; Nakamura, Takeshi; Kuroda, Akio

    2016-05-01

    Inorganic polyphosphate (polyP) was previously identified as a probiotic-derived substance that enhances intestinal barrier function. PolyP-accumulating bacteria are expected to have beneficial effects on the human gastrointestinal tract. In this study, we selected Lactobacillus paracasei JCM 1163 as a strain with the potential to accumulate polyP, because among the probiotic bacteria stored in our laboratory, it had the largest amount of polyP. The chain length of polyP accumulated in L. paracasei JCM 1163 was approximately 700 phosphate (Pi) residues. L. paracasei JCM 1163 accumulated polyP when Pi was added to Pi-starved cells. We further improved the ability of L. paracasei JCM 1163 to accumulate polyP by nitrosoguanidine mutagenesis. The mutant accumulated polyP at a level of 1500 nmol/mg protein-approximately 190 times that of the wild-type strain. PolyP extracted from the L. paracasei JCM 1163 significantly suppressed the oxidant-induced intestinal permeability in mouse small intestine. In conclusion, we have succeeded in breeding the polyP-accumulating Lactobacillus mutant that is expected to enhance intestinal barrier function.

  8. Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

    Science.gov (United States)

    Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

    2012-01-01

    Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

  9. Protective Effects of Bifidobacterium on Intestinal Barrier Function in LPS-Induced Enterocyte Barrier Injury of Caco-2 Monolayers and in a Rat NEC Model.

    Directory of Open Access Journals (Sweden)

    Xiang Ling

    Full Text Available Zonulin protein is a newly discovered modulator which modulates the permeability of the intestinal epithelial barrier by disassembling intercellular tight junctions (TJ. Disruption of TJ is associated with neonatal necrotizing enterocolitis (NEC. It has been shown bifidobacterium could protect the intestinal barrier function and prophylactical administration of bifidobacterium has beneficial effects in NEC patients and animals. However, it is still unknown whether the zonulin is involved in the gut barrier dysfunction of NEC, and the protective mechanisms of bifidobacterium on intestinal barrier function are also not well understood. The present study aims to investigate the effects of bifidobacterium on intestinal barrier function, zonulin regulation, and TJ integrity both in LPS-induced enterocyte barrier injury of Caco-2 monolayers and in a rat NEC model. Our results showed bifidobacterium markedly attenuated the decrease in transepithelial electrical resistance and the increase in paracellular permeability in the Caco-2 monolayers treated with LPS (P < 0.01. Compared with the LPS group, bifidobacterium significantly decreased the production of IL-6 and TNF-α (P < 0.01 and suppressed zonulin release (P < 0.05. In addition, bifidobacterium pretreatment up-regulated occludin, claudin-3 and ZO-1 expression (P < 0.01 and also preserved these proteins localization at TJ compared with the LPS group. In the in vivo study, bifidobacterium decreased the incidence of NEC from 88 to 47% (P < 0.05 and reduced the severity in the NEC model. Increased levels of IL-6 and TNF-α in the ileum of NEC rats were normalized in bifidobacterium treated rats (P < 0.05. Moreover, administration of bifidobacterium attenuated the increase in intestinal permeability (P < 0.01, decreased the levels of serum zonulin (P < 0.05, normalized the expression and localization of TJ proteins in the ileum compared with animals with NEC. We concluded that bifidobacterium may

  10. How hormones influence composition and physiological function of the brain-blood barrier.

    Science.gov (United States)

    Hampl, R; Bičíková, M; Sosvorová, L

    2015-01-01

    Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

  11. Functional Two-Dimensional Coordination Polymeric Layer as a Charge Barrier in Li–S Batteries

    KAUST Repository

    Huang, Jing-Kai

    2018-01-04

    Ultrathin two-dimensional (2D) polymeric layers are capable of separating gases and molecules based on the reported size exclusion mechanism. What is equally important but missing today is an exploration of the 2D layers with charge functionality, which enables applications using the charge exclusion principle. This work demonstrates a simple and scalable method of synthesizing a free-standing 2D coordination polymer Zn2(benzimidazolate)2(OH)2 at the air–water interface. The hydroxyl (−OH) groups are stoichiometrically coordinated and implement electrostatic charges in the 2D structures, providing powerful functionality as a charge barrier. Electrochemical performance of the Li–S battery shows that the Zn2(benzimidazolate)2(OH)2 coordination polymer layers efficiently mitigate the polysulfide shuttling effects and largely enhance the battery capacity and cycle performance. The synthesis of the proposed coordination polymeric layers is simple, scalable, cost saving, and promising for practical use in batteries.

  12. The Weiss Functional Impairment Rating Scale-Parent Form for assessing ADHD: evaluating diagnostic accuracy and determining optimal thresholds using ROC analysis

    OpenAIRE

    Thompson, Trevor; Lloyd, Andrew; Joseph, Alain; Weiss, Margaret

    2017-01-01

    Purpose The Weiss Functional Impairment Rating Scale-Parent Form (WFIRS-P) is a 50-item scale that assesses functional impairment on six clinically relevant domains typically affected in attention-deficit/hyperactivity disorder (ADHD). As functional impairment is central to ADHD, the WFIRS-P offers potential as a tool for assessing functional impairment in ADHD. These analyses were designed to examine the overall performance of WFIRS-P in differentiating ADHD and non-ADHD cases using receiver...

  13. The link between impaired theory of mind and executive function in children with cerebral palsy.

    Science.gov (United States)

    Li, Xiaoming; Wang, Kai; Wu, Jianxian; Hong, Yongfeng; Zhao, Jingpu; Feng, Xiaojun; Xu, Mei; Wang, Min; Ndasauka, Yamikani; Zhang, Xiaochu

    2014-07-01

    The aim of the study was to explore the relationship between theory of mind (ToM) deficits and executive function (EF) impairments in children with cerebral palsy (CP), 42 CP with children and 42 typically developing (TD) children, acting as controls, were assessed on the tasks of ToM (false belief and faux pas) and EF (inhibition, updating and shifting). Results showed that CP children had deficits both in ToM and EF tasks. The correlation analyses showed that two EF components (inhibition and updating) were strongly related to false belief and faux pas in both two groups. We also found correlation between shifting and false belief and faux pas. However, this correlation was only found in TD children and not in children with CP. These findings suggest that children with CP lag behind TD children in both ToM and EF. Further, the results reveal, interestingly, that ToM deficits in CP children might be related to their inhibition and updating impairments, but not to shifting impairments. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Is semantic verbal fluency impairment explained by executive function deficits in schizophrenia?

    Directory of Open Access Journals (Sweden)

    Arthur A. Berberian

    2016-01-01

    Full Text Available Objective: To investigate if verbal fluency impairment in schizophrenia reflects executive function deficits or results from degraded semantic store or inefficient search and retrieval strategies. Method: Two groups were compared: 141 individuals with schizophrenia and 119 healthy age and education-matched controls. Both groups performed semantic and phonetic verbal fluency tasks. Performance was evaluated using three scores, based on 1 number of words generated; 2 number of clustered/related words; and 3 switching score. A fourth performance score based on the number of clusters was also measured. Results: SZ individuals produced fewer words than controls. After controlling for the total number of words produced, a difference was observed between the groups in the number of cluster-related words generated in the semantic task. In both groups, the number of words generated in the semantic task was higher than that generated in the phonemic task, although a significant group vs. fluency type interaction showed that subjects with schizophrenia had disproportionate semantic fluency impairment. Working memory was positively associated with increased production of words within clusters and inversely correlated with switching. Conclusion: Semantic fluency impairment may be attributed to an inability (resulting from reduced cognitive control to distinguish target signal from competing noise and to maintain cues for production of memory probes.

  15. Chronic caffeine treatment prevents sleep deprivation-induced impairment of cognitive function and synaptic plasticity.

    Science.gov (United States)

    Alhaider, Ibrahim A; Aleisa, Abdulaziz M; Tran, Trinh T; Alzoubi, Karem H; Alkadhi, Karim A

    2010-04-01

    This study was undertaken to provide a detailed account of the effect of chronic treatment with a small dose of caffeine on the deleterious effects of sleep loss on brain function in rats. We investigated the effects of chronic (4 weeks) caffeine treatment (0.3 g/L in drinking water) on memory impairment in acutely (24 h) sleep-deprived adult male Wistar rats. Sleep deprivation was induced using the modified multiple platform model. The effects of caffeine on sleep deprivation-induced hippocampus-dependent learning and memory deficits were studied by 3 approaches: learning and memory performance in the radial arm water maze task, electrophysiological recording of early long-term potentiation (E-LTP) in area CA1 of the hippocampus, and levels of memory- and synaptic plasticity-related signaling molecules after E-LTP induction. The results showed that chronic caffeine treatment prevented impairment of hippocampus-dependent learning, shortterm memory and E-LTP of area CA1 in the sleep-deprived rats. In correlation, chronic caffeine treatment prevented sleep deprivation-associated decrease in the levels of phosphorylated calcium/calmodulin-dependent protein kinase II (P-CaMKII) during expression of E-LTP. The results suggest that long-term use of a low dose of caffeine prevents impairment of short-term memory and E-LTP in acutely sleep-deprived rats.

  16. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  17. Cholinergic Hypofunction in Presbycusis-Related Tinnitus With Cognitive Function Impairment: Emerging Hypotheses.

    Science.gov (United States)

    Ruan, Qingwei; Yu, Zhuowei; Zhang, Weibin; Ruan, Jian; Liu, Chunhui; Zhang, Ruxin

    2018-01-01

    Presbycusis (age-related hearing loss) is a potential risk factor for tinnitus and cognitive deterioration, which result in poor life quality. Presbycusis-related tinnitus with cognitive impairment is a common phenotype in the elderly population. In these individuals, the central auditory system shows similar pathophysiological alterations as those observed in Alzheimer's disease (AD), including cholinergic hypofunction, epileptiform-like network synchronization, chronic inflammation, and reduced GABAergic inhibition and neural plasticity. Observations from experimental rodent models indicate that recovery of cholinergic function can improve memory and other cognitive functions via acetylcholine-mediated GABAergic inhibition enhancement, nicotinic acetylcholine receptor (nAChR)-mediated anti-inflammation, glial activation inhibition and neurovascular protection. The loss of cholinergic innervation of various brain structures may provide a common link between tinnitus seen in presbycusis-related tinnitus and age-related cognitive impairment. We hypothesize a key component of the condition is the withdrawal of cholinergic input to a subtype of GABAergic inhibitory interneuron, neuropeptide Y (NPY) neurogliaform cells. Cholinergic denervation might not only cause the degeneration of NPY neurogliaform cells, but may also result in decreased AChR activation in GABAergic inhibitory interneurons. This, in turn, would lead to reduced GABA release and inhibitory regulation of neural networks. Reduced nAChR-mediated anti-inflammation due to the loss of nicotinic innervation might lead to the transformation of glial cells and release of inflammatory mediators, lowering the buffering of extracellular potassium and glutamate metabolism. Further research will provide evidence for the recovery of cholinergic function with the use of cholinergic input enhancement alone or in combination with other rehabilitative interventions to reestablish inhibitory regulation mechanisms of

  18. Cholinergic Hypofunction in Presbycusis-Related Tinnitus With Cognitive Function Impairment: Emerging Hypotheses

    Directory of Open Access Journals (Sweden)

    Qingwei Ruan

    2018-04-01

    Full Text Available Presbycusis (age-related hearing loss is a potential risk factor for tinnitus and cognitive deterioration, which result in poor life quality. Presbycusis-related tinnitus with cognitive impairment is a common phenotype in the elderly population. In these individuals, the central auditory system shows similar pathophysiological alterations as those observed in Alzheimer’s disease (AD, including cholinergic hypofunction, epileptiform-like network synchronization, chronic inflammation, and reduced GABAergic inhibition and neural plasticity. Observations from experimental rodent models indicate that recovery of cholinergic function can improve memory and other cognitive functions via acetylcholine-mediated GABAergic inhibition enhancement, nicotinic acetylcholine receptor (nAChR-mediated anti-inflammation, glial activation inhibition and neurovascular protection. The loss of cholinergic innervation of various brain structures may provide a common link between tinnitus seen in presbycusis-related tinnitus and age-related cognitive impairment. We hypothesize a key component of the condition is the withdrawal of cholinergic input to a subtype of GABAergic inhibitory interneuron, neuropeptide Y (NPY neurogliaform cells. Cholinergic denervation might not only cause the degeneration of NPY neurogliaform cells, but may also result in decreased AChR activation in GABAergic inhibitory interneurons. This, in turn, would lead to reduced GABA release and inhibitory regulation of neural networks. Reduced nAChR-mediated anti-inflammation due to the loss of nicotinic innervation might lead to the transformation of glial cells and release of inflammatory mediators, lowering the buffering of extracellular potassium and glutamate metabolism. Further research will provide evidence for the recovery of cholinergic function with the use of cholinergic input enhancement alone or in combination with other rehabilitative interventions to reestablish inhibitory regulation

  19. The Effectiveness of a Multidisciplinary Group Rehabilitation Program on the Psychosocial Functioning of Elderly People Who Are Visually Impaired

    NARCIS (Netherlands)

    Alma, Manna A.; Groothoff, Johan W.; Melis-Dankers, Bart J. M.; Suurmeijer, Theodorus; van der Mei, Sijrike F.

    2013-01-01

    Introduction: The pilot study reported here determined the effectiveness of a multidisciplinary group rehabilitation program, Visually Impaired Elderly Persons Participating (VIPP), on psychosocial functioning. Methods: The single-group pretest-posttest pilot study included 29 persons with visual

  20. RELATIONSHIP BETWEEN ETHINYLESTRADIOL-MEDIATED CHANGES IN ENDOCRINE FUNCTION AND REPRODUCTION IMPAIRMENT IN JAPANESE MEDAKA (ORYZIAS LATIPES)

    Science.gov (United States)

    Many biochemical endpoints currently are used to describe endocrine function in fish; however, the sensitivity of these parameters as biomarkers of impaired reproduction or sexual development is not well understood. In the present study, adult Japanese medaka (Oryzias latipes) we...

  1. Subsyndromal depressive symptoms are associated with functional impairment in patients with bipolar disorder : Results of a large, multisite study

    NARCIS (Netherlands)

    Altshuler, Lori L.; Post, Robert M.; Black, David O.; Keck, Paul E.; Nolen, Willem A.; Frye, Mark A.; Suppes, Trisha; Grunze, Heinz; Kupka, Ralph W.; Leverich, Gabriele S.; McElroy, Susan L.; Walden, Joerg; Mintz, Jim

    2006-01-01

    Objective: Studies of patients with unipolar depression have demonstrated a relationship between subthreshold depressive symptoms and impairment in role functioning. Research examining this relationship in persons with bipolar disorder is rare. This study sought to evaluate the association between

  2. MR velocity mapping measurement of renal artery blood flow in patients with impaired kidney function

    DEFF Research Database (Denmark)

    Cortsen, M; Petersen, L.J.; Stahlberg, F

    1996-01-01

    Renal blood flow (RBF) was measured in 9 patients with chronic impaired kidney function using MR velocity mapping and compared to PAH clearance and 99mTc-DTPA scintigraphy. An image plane suitable for flow measurement perpendicular to the renal arteries was chosen from 2-dimensional MR angiography....... MR velocity mapping was performed in both renal arteries using an ECG-triggered gradient echo pulse sequence previously validated in normal volunteers. Effective renal plasma flow was calculated from the clearance rate of PAH during constant infusion and the split of renal function was evaluated...... by 99mTc-DTPA scintigraphy. A reduction of RBF was found, and there was a significant correlation between PAH clearance multiplied by 1/(1-hematocrit) and RBF determined by MR velocity mapping. Furthermore, a significant correlation between the distribution of renal function and the percent distribution...

  3. The Effects of Fire on the Function of the 200-BP-1 Engineered Surface Barrier

    Energy Technology Data Exchange (ETDEWEB)

    Ward, Anderson L.; Link, Steven O.; Hasan, Nazmul; Draper, Kathryn E.

    2009-09-01

    A critical unknown in use of barrier technology for long-term waste isolation is performance after a major disturbance especially when institutional controls are intact, but there are no resources to implement corrective actions. The objective of this study was to quantify the effects of wild fire on alterations the function of an engineered barrier. A controlled burn September 26, 2008 was used to remove all the vegetation from the north side of the barrier. Flame heights exceeded 9 m and temperatures ranged from 250 oC at 1.5 cm below the surface to over 700 oC at 1 m above the surface. Post-fire analysis of soil properties show significant decreases in wettability, hydraulic conductivity, air entry pressure, organic matter, and porosity relative to pre-fire conditions whereas dry bulk density increased. Decreases in hydraulic conductivity and wettabilty immediately after the fire are implicated in a surface runoff event that occurred in January 2009, the first in 13 years. There was a significant increase in macro-nutrients, pH, and electrical conductivity. After one year, hydrophobicity has returned to pre-burn levels with only 16% of samples still showing signs of decreased wettability. Over the same period, hydraulic conductivity and air entry pressure returned to pre-burn levels at one third of the locations but remained identical to values recorded immediately after the fire at the other two thirds. Soil nutrients, pH, and electrical conductivity remain elevated after 1 year. Species composition on the burned surface changed markedly from prior years and relative to the unburned surface and two analog sites. An increase in the proportion of annuals and biennials is characteristic of burned surfaces that have become dominated by ruderal species. Greenhouse seedling emergence tests conducted to assess the seed bank of pre- and post-burn soils and of two analog sites at the McGee Ranch show no difference in the number of species emerging from soils collected

  4. The relationship between lung function impairment and quantitative computed tomography in chronic obstructive pulmonary disease

    Energy Technology Data Exchange (ETDEWEB)

    Mets, O.M. [Radiology, University Medical Center Utrecht (Netherlands); University Medical Center Utrecht, Department of Radiology, Utrecht (Netherlands); Murphy, K. [Image Sciences Institute, University Medical Center Utrecht (Netherlands); Zanen, P.; Lammers, J.W. [Pulmonology, University Medical Center Utrecht (Netherlands); Gietema, H.A.; Jong, P.A. de [Radiology, University Medical Center Utrecht (Netherlands); Ginneken, B. van [Image Sciences Institute, University Medical Center Utrecht (Netherlands); Radboud University Nijmegen Medical Centre, Diagnostic Image Analysis Group, Radiology, Nijmegen (Netherlands); Prokop, M. [Radiology, University Medical Center Utrecht (Netherlands); Radiology, Radboud University Nijmegen Medical Centre (Netherlands)

    2012-01-15

    To determine the relationship between lung function impairment and quantitative computed tomography (CT) measurements of air trapping and emphysema in a population of current and former heavy smokers with and without airflow limitation. In 248 subjects (50 normal smokers; 50 mild obstruction; 50 moderate obstruction; 50 severe obstruction; 48 very severe obstruction) CT emphysema and CT air trapping were quantified on paired inspiratory and end-expiratory CT examinations using several available quantification methods. CT measurements were related to lung function (FEV{sub 1}, FEV{sub 1}/FVC, RV/TLC, Kco) by univariate and multivariate linear regression analysis. Quantitative CT measurements of emphysema and air trapping were strongly correlated to airflow limitation (univariate r-squared up to 0.72, p < 0.001). In multivariate analysis, the combination of CT emphysema and CT air trapping explained 68-83% of the variability in airflow limitation in subjects covering the total range of airflow limitation (p < 0.001). The combination of quantitative CT air trapping and emphysema measurements is strongly associated with lung function impairment in current and former heavy smokers with a wide range of airflow limitation. (orig.)

  5. Dietary sodium loading impairs microvascular function independent of blood pressure in humans: role of oxidative stress

    Science.gov (United States)

    Greaney, Jody L; DuPont, Jennifer J; Lennon-Edwards, Shannon L; Sanders, Paul W; Edwards, David G; Farquhar, William B

    2012-01-01

    Animal studies have reported dietary salt-induced reductions in vascular function independent of increases in blood pressure (BP). The purpose of this study was to determine if short-term dietary sodium loading impairs cutaneous microvascular function in normotensive adults with salt resistance. Following a control run-in diet, 12 normotensive adults (31 ± 2 years) were randomized to a 7 day low-sodium (LS; 20 mmol day−1) and 7 day high-sodium (HS; 350 mmol day−1) diet (controlled feeding study). Salt resistance, defined as a ≤5 mmHg change in 24 h mean BP determined while on the LS and HS diets, was confirmed in all subjects undergoing study (LS: 84 ± 1 mmHg vs. HS: 85 ± 2 mmHg; P > 0.05). On the last day of each diet, subjects were instrumented with two microdialysis fibres for the local delivery of Ringer solution and 20 mm ascorbic acid (AA). Laser Doppler flowmetry was used to measure red blood cell flux during local heating-induced vasodilatation (42°C). After the established plateau, 10 mm l-NAME was perfused to quantify NO-dependent vasodilatation. All data were expressed as a percentage of maximal cutaneous vascular conductance (CVC) at each site (28 mm sodium nitroprusside; 43°C). Sodium excretion increased during the HS diet (P sodium loading impairs cutaneous microvascular function independent of BP in normotensive adults and suggest a role for oxidative stress. PMID:22907057

  6. The relationship between lung function impairment and quantitative computed tomography in chronic obstructive pulmonary disease

    International Nuclear Information System (INIS)

    Mets, O.M.; Murphy, K.; Zanen, P.; Lammers, J.W.; Gietema, H.A.; Jong, P.A. de; Ginneken, B. van; Prokop, M.

    2012-01-01

    To determine the relationship between lung function impairment and quantitative computed tomography (CT) measurements of air trapping and emphysema in a population of current and former heavy smokers with and without airflow limitation. In 248 subjects (50 normal smokers; 50 mild obstruction; 50 moderate obstruction; 50 severe obstruction; 48 very severe obstruction) CT emphysema and CT air trapping were quantified on paired inspiratory and end-expiratory CT examinations using several available quantification methods. CT measurements were related to lung function (FEV 1 , FEV 1 /FVC, RV/TLC, Kco) by univariate and multivariate linear regression analysis. Quantitative CT measurements of emphysema and air trapping were strongly correlated to airflow limitation (univariate r-squared up to 0.72, p < 0.001). In multivariate analysis, the combination of CT emphysema and CT air trapping explained 68-83% of the variability in airflow limitation in subjects covering the total range of airflow limitation (p < 0.001). The combination of quantitative CT air trapping and emphysema measurements is strongly associated with lung function impairment in current and former heavy smokers with a wide range of airflow limitation. (orig.)

  7. Impaired coupling of local and global functional feedbacks underlies abnormal synchronization and negative symptoms of schizophrenia.

    Science.gov (United States)

    Noh, Kyungchul; Shin, Kyung Soon; Shin, Dongkwan; Hwang, Jae Yeon; Kim, June Sic; Jang, Joon Hwan; Chung, Chun Kee; Kwon, Jun Soo; Cho, Kwang-Hyun

    2013-04-10

    Abnormal synchronization of brain oscillations is found to be associated with various core symptoms of schizophrenia. However, the underlying mechanism of this association remains yet to be elucidated. In this study, we found that coupled local and global feedback (CLGF) circuits in the cortical functional network are related to the abnormal synchronization and also correlated to the negative symptom of schizophrenia. Analysis of the magnetoencephalography data obtained from patients with chronic schizophrenia during rest revealed an increase in beta band synchronization and a reduction in gamma band power compared to healthy controls. Using a feedback identification method based on non-causal impulse responses, we constructed functional feedback networks and found that CLGF circuits were significantly reduced in schizophrenia. From computational analysis on the basis of the Wilson-Cowan model, we unraveled that the CLGF circuits are critically involved in the abnormal synchronization and the dynamical switching between beta and gamma bands power in schizophrenia. Moreover, we found that the abundance of CLGF circuits was negatively correlated with the development of negative symptoms of schizophrenia, suggesting that the negative symptom is closely related to the impairment of this circuit. Our study implicates that patients with schizophrenia might have the impaired coupling of inter- and intra-regional functional feedbacks and that the CLGF circuit might serve as a critical bridge between abnormal synchronization and the negative symptoms of schizophrenia.

  8. Varicocele is associated with hypogonadism and impaired erectile function: a prospective comparative study.

    Science.gov (United States)

    Ji, B; Jin, X-B

    2017-08-01

    We conducted this prospective comparative study to examine the hypothesis that varicocele was associate