Chromatin immunoprecipitation improvements for the processing of small frozen pieces of adipose tissue.

Directory of Open Access Journals (Sweden)

Daniel Castellano-Castillo

Full Text Available Chromatin immunoprecipitation (ChIP has gained importance to identify links between the genome and the proteome. Adipose tissue has emerged as an active tissue, which secretes a wide range of molecules that have been related to metabolic and obesity-related disorders, such as diabetes, cardiovascular failure, metabolic syndrome, or cancer. In turn, epigenetics has raised the importance in discerning the possible relationship between metabolic disorders, lifestyle and environment. However, ChIP application in human adipose tissue is limited by several factors, such as sample size, frozen sample availability, high lipid content and cellular composition of the tissue. Here, we optimize the standard protocol of ChIP for small pieces of frozen human adipose tissue. In addition, we test ChIP for the histone mark H3K4m3, which is related to active promoters, and validate the performance of the ChIP by analyzing gene promoters for factors usually studied in adipose tissue using qPCR. Our improvements result in a higher performance in chromatin shearing and DNA recovery of adipocytes from the tissue, which may be useful for ChIP-qPCR or ChIP-seq analysis.

Using Chromatin Immunoprecipitation in Toxicology: A Step-by-Step Guide to Increasing Efficiency, Reducing Variability, and Expanding Applications.

Science.gov (United States)

McCullough, Shaun D; On, Doan M; Bowers, Emma C

2017-05-02

Histone modifications work in concert with DNA methylation to regulate cellular structure, function, and response to environmental stimuli. More than 130 unique histone modifications have been described to date, and chromatin immunoprecipitation (ChIP) allows for the exploration of their associations with the regulatory regions of target genes and other DNA/chromatin-associated proteins across the genome. Many variations of ChIP have been developed in the 30 years since its earliest version came into use, which makes it challenging for users to integrate the procedure into their research programs. Furthermore, the differences in ChIP protocols can confound efforts to increase reproducibility across studies. The streamlined ChIP procedure presented here can be readily applied to samples from a wide range of in vitro studies (cell lines and primary cells) and clinical samples (peripheral leukocytes) in toxicology. We also provide detailed guidance on the optimization of critical protocol parameters, such as chromatin fixation, fragmentation, and immunoprecipitation, to increase efficiency and improve reproducibility. Expanding toxicoepigenetic studies to more readily include histone modifications will facilitate a more comprehensive understanding of the role of the epigenome in environmental exposure effects and the integration of epigenetic data in mechanistic toxicology, adverse outcome pathways, and risk assessment. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.

Directory of Open Access Journals (Sweden)

Nina Winter

Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.

Nanoliter Centrifugal Liquid Dispenser Coupled with Superhydrophobic Microwell Array Chips for High-Throughput Cell Assays

Directory of Open Access Journals (Sweden)

Yuyi Wang

2018-06-01

Full Text Available Microfluidic systems have been regarded as a potential platform for high-throughput screening technology in drug discovery due to their low sample consumption, high integration, and easy operation. The handling of small-volume liquid is an essential operation in microfluidic systems, especially in investigating large-scale combination conditions. Here, we develop a nanoliter centrifugal liquid dispenser (NanoCLD coupled with superhydrophobic microwell array chips for high-throughput cell-based assays in the nanoliter scale. The NanoCLD consists of a plastic stock block with an array of drilled through holes, a reagent microwell array chip (reagent chip, and an alignment bottom assembled together in a fixture. A simple centrifugation at 800 rpm can dispense ~160 nL reagents into microwells in 5 min. The dispensed reagents are then delivered to cells by sandwiching the reagent chip upside down with another microwell array chip (cell chip on which cells are cultured. A gradient of doxorubicin is then dispensed to the cell chip using the NanoCLD for validating the feasibility of performing drug tests on our microchip platform. This novel nanoliter-volume liquid dispensing method is simple, easy to operate, and especially suitable for repeatedly dispensing many different reagents simultaneously to microwells.

Highly expressed loci are vulnerable to misleading ChIP localization of multiple unrelated proteins

NARCIS (Netherlands)

Teytelman, L.; Thurtle, D.M.; Rine, J.; van Oudenaarden, A.

2013-01-01

Chromatin immunoprecipitation (ChIP) is the gold-standard technique for localizing nuclear proteins in the genome. We used ChIP, in combination with deep sequencing (Seq), to study the genome-wide distribution of the Silent information regulator (Sir) complex in Saccharomyces cerevisiae. We analyzed

Development and evaluation of a real-time fluorogenic loop-mediated isothermal amplification assay integrated on a microfluidic disc chip (on-chip LAMP) for rapid and simultaneous detection of ten pathogenic bacteria in aquatic animals.

Science.gov (United States)

Zhou, Qian-Jin; Wang, Lei; Chen, Jiong; Wang, Rui-Na; Shi, Yu-Hong; Li, Chang-Hong; Zhang, De-Min; Yan, Xiao-Jun; Zhang, Yan-Jun

2014-09-01

Rapid, low-cost, and user-friendly strategies are urgently needed for early disease diagnosis and timely treatment, particularly for on-site screening of pathogens in aquaculture. In this study, we successfully developed a real-time fluorogenic loop-mediated isothermal amplification assay integrated on a microfluidic disc chip (on-chip LAMP), which was capable of simultaneously detecting 10 pathogenic bacteria in aquatic animals, i.e., Nocardia seriolae, Pseudomonas putida, Streptococcus iniae, Vibrio alginolyticus, Vibrio anguillarum, Vibrio fluvialis, Vibrio harveyi, Vibrio parahaemolyticus, Vibrio rotiferianus, and Vibrio vulnificus. The assay provided a nearly-automated approach, with only a single pipetting step per chip for sample dispensing. This technique could achieve limits of detection (LOD) ranging from 0.40 to 6.42pg per 1.414μL reaction in less than 30 min. The robust reproducibility was demonstrated by a little variation among duplications for each bacterium with the coefficient of variation (CV) for time to positive (Tp) value less than 0.10. The clinical sensitivity and specificity of this on-chip LAMP assay in detecting field samples were 96.2% and 93.8% by comparison with conventional microbiological methods. Compared with other well-known techniques, on-chip LAMP assay provides low sample and reagent consumption, ease-of-use, accelerated analysis, multiple bacteria and on-site detection, and high reproducibility, indicating that such a technique would be applicable for on-site detection and routine monitoring of multiple pathogens in aquaculture. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of the analytical and clinical performances of Abbott RealTime High Risk HPV, Hybrid Capture 2, and DNA Chip assays in gynecology patients.

Science.gov (United States)

Park, Seungman; Kang, Youjin; Kim, Dong Geun; Kim, Eui-Chong; Park, Sung Sup; Seong, Moon-Woo

2013-08-01

The detection of high-risk (HR) HPV in cervical cancer screening is important for early diagnosis of cervical cancer or pre-cancerous lesions. We evaluated the analytical and clinical performances of 3 HR HPV assays in Gynecology patients. A total of 991 specimens were included in this study: 787 specimens for use with a Hybrid Capture 2 (HC2) and 204 specimens for a HPV DNA microarray (DNA Chip). All specimens were tested using an Abbott RealTime High Risk HPV assay (Real-time HR), PGMY PCR, and sequence analysis. Clinical sensitivities for severe abnormal cytology (severe than high-grade squamous intraepithelial lesion) were 81.8% for Real-time HR, 77.3% for HC2, and 66.7% for DNA Chip, and clinical sensitivities for severe abnormal histology (cervical intraepithelial neoplasia grade 2+) were 91.7% for HC2, 87.5% for Real-time HR, and 73.3% for DNA Chip. As compared to results of the sequence analysis, HC2, Real-time HR, and DNA Chip showed concordance rates of 94.3% (115/122), 90.0% (117/130), and 61.5% (16/26), respectively. The HC2 assay and Real-time HR assay showed comparable results to each other in both clinical and analytical performances, while the DNA Chip assay showed poor clinical and analytical performances. The Real-time HR assay can be a good alternative option for HR HPV testing with advantages of allowing full automation and simultaneous genotyping of HR types 16 and 18. Copyright © 2013 Elsevier Inc. All rights reserved.

Paper-Based Digital Microfluidic Chip for Multiple Electrochemical Assay Operated by a Wireless Portable Control System

DEFF Research Database (Denmark)

Ruecha, Nipapan; Lee, Jumi; Chae, Heedo

2017-01-01

for multiple analysis assays are fabricated by affordable printing techniques. For enhanced sensitivity of the sensor, the working electrode is modified through the electrochemical method, namely by reducing graphene with voltammetry and coating gold nanoparticles by amperometry. Detachable sensor and absorber...... designed portable power supply and wireless control system, the active paper-based chip platform can be utilized as an advanced point-of-care device for multiple assays in digital microfluidics....

Nanobody®-based chromatin immunoprecipitation/micro-array analysis for genome-wide identification of transcription factor DNA binding sites

Science.gov (United States)

Nguyen-Duc, Trong; Peeters, Eveline; Muyldermans, Serge; Charlier, Daniel; Hassanzadeh-Ghassabeh, Gholamreza

2013-01-01

Nanobodies® are single-domain antibody fragments derived from camelid heavy-chain antibodies. Because of their small size, straightforward production in Escherichia coli, easy tailoring, high affinity, specificity, stability and solubility, nanobodies® have been exploited in various biotechnological applications. A major challenge in the post-genomics and post-proteomics era is the identification of regulatory networks involving nucleic acid–protein and protein–protein interactions. Here, we apply a nanobody® in chromatin immunoprecipitation followed by DNA microarray hybridization (ChIP-chip) for genome-wide identification of DNA–protein interactions. The Lrp-like regulator Ss-LrpB, arguably one of the best-studied specific transcription factors of the hyperthermophilic archaeon Sulfolobus solfataricus, was chosen for this proof-of-principle nanobody®-assisted ChIP. Three distinct Ss-LrpB-specific nanobodies®, each interacting with a different epitope, were generated for ChIP. Genome-wide ChIP-chip with one of these nanobodies® identified the well-established Ss-LrpB binding sites and revealed several unknown target sequences. Furthermore, these ChIP-chip profiles revealed auxiliary operator sites in the open reading frame of Ss-lrpB. Our work introduces nanobodies® as a novel class of affinity reagents for ChIP. Taking into account the unique characteristics of nanobodies®, in particular, their short generation time, nanobody®-based ChIP is expected to further streamline ChIP-chip and ChIP-Seq experiments, especially in organisms with no (or limited) possibility of genetic manipulation. PMID:23275538

Testing for myositis specific autoantibodies: Comparison between line blot and immunoprecipitation assays in 57 myositis sera.

Science.gov (United States)

Cavazzana, Ilaria; Fredi, Micaela; Ceribelli, Angela; Mordenti, Cristina; Ferrari, Fabio; Carabellese, Nice; Tincani, Angela; Satoh, Minoru; Franceschini, Franco

2016-06-01

To analyze the performance of a line blot assay for the identification of autoantibodies in sera of patients affected by myositis, compared with immunoprecipitation (IP) as gold standard. 66 sera of patients with myositis (23 polymyositis, 8 anti-synthetase syndromes, 29 dermatomyositis and 6 overlap syndromes) were tested by commercial LB (Euroimmun, Lubeck, Germany); 57 sera were analyzed also by IP of K562 cell extract radiolabeled with (35)S-methionine. Inter-rater agreement was calculated with Cohen's k coefficient. Myositis-specific antibodies (MSA) were detected in 36/57 sera (63%) by IP and in 39/66 sera (59%) by LB. The most frequent MSA found by LB were anti-Jo1 and anti-Mi2 found in 15% (10/66) of sera, followed by anti-NXP2 and anti-SRP detected in 106% (7/66) of sera. Anti-TIF1gamma and anti-MDA5 were found in 6 (9%) and 5 sera (7.6%), respectively. A good agreement between methods was found only for anti-TIF1γ, anti-MDA5 and anti-NXP-2 antibodies, while a moderate agreement was estimated for anti-Mi2 and anti-EJ. By contrast, a high discordance rate for the detection of anti-Jo1 antibodies was evident (k: 0.3). Multiple positivity for MSA were found in 11/66 (17%) by LB and 0/57 by IP (p: 0001). Comparing the clinical features of these 11 sera, we found total discrepancies between assays in 3 sera (27.3%), a relative discrepancy due to the occurrence of one discordant autoantibody (not confirmed by IP) in 5 cases (45.5%) and a total discrepancy between LB and IP results, but with a relative concordance with clinical features were found in other 3 sera (27.3%). The semiquantitative results do not support the interpretation of the data. The use of LB assay allowed the detection of new MSA, such as anti-MDA5, anti-MJ and anti-TIF1gamma antibodies, previously not found with routine methods. However, the high prevalence of multiple positivities and the high discondant rate of anti-Jo1 antibodies could create some misinterpretation of the results from the

Efficiency of a solid-phase chemiluminescence immunoassay for detection of antinuclear and cytoplasmic autoantibodies compared with gold standard immunoprecipitation.

Science.gov (United States)

Gelpí, Carmen; Pérez, Elena; Roldan, Cristina

2014-09-01

The aim of this study was to compare the degree of agreement of a novel Zenit RA chemiluminescent immunoassay (CLIA) from A. Menarini Diagnostics (Florence, Italy) and the gold standard immunoprecipitation assay to screen for the presence of specific anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his)tRNA-Synthetase) and anti-Scl-70(Topo I) antibodies. We studied 114 sera, 98 from patients with well-defined autoimmune connective tissue diseases and 16 from blood donor volunteers. All samples were fully characterized using the new chemiluminescent immunoassay and immunoprecipitation. In addition, all the samples were analyzed by indirect immunofluorescence (IIF) and anti-Scl-70(Topo I) antibodies were analyzed by immunoblot (IB) assay. Discrepant samples were analyzed using a commercial dot blot technique (Recomline from Mikrogen). The simple Kappa coefficient was used to measure the level of agreement between the results of Zenit RA CLIA and the gold standard. The Kappa agreement between Zenit RA CLIA and gold standard immunoprecipitation, as well as IB and IIFassays for the presence of anti-Scl-70(Topo I)(0.948) was excellent. The concordance between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-U1snRNP (0.883), anti-Ro/SS-A (0.878), anti-Jo-1((his)tRNA-Synthetase) (0.791) and anti-Sm (0.786) was good, and excellent when the cut-off was raised to 14 U/ml (arbitrary units/ml). Between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-La/SS-B, the Kappa agreement had a value of 0.689, but this improved to 0.775 when the cut-off was raised to14 U/ml. Precision was good based on the evaluation of replicate samples. Inter-assay coefficient variation was lower than 3.4 % (CV in %) in all the kits and <1.2 % (CV in  %) for intra-assay measurements. Our findings show that Zenit RA CLIA was specific and sensitive to detect anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his

ChIP on SNP-chip for genome-wide analysis of human histone H4 hyperacetylation

Directory of Open Access Journals (Sweden)

Porter Christopher J

2007-09-01

Full Text Available Abstract Background SNP microarrays are designed to genotype Single Nucleotide Polymorphisms (SNPs. These microarrays report hybridization of DNA fragments and therefore can be used for the purpose of detecting genomic fragments. Results Here, we demonstrate that a SNP microarray can be effectively used in this way to perform chromatin immunoprecipitation (ChIP on chip as an alternative to tiling microarrays. We illustrate this novel application by mapping whole genome histone H4 hyperacetylation in human myoblasts and myotubes. We detect clusters of hyperacetylated histone H4, often spanning across up to 300 kilobases of genomic sequence. Using complementary genome-wide analyses of gene expression by DNA microarray we demonstrate that these clusters of hyperacetylated histone H4 tend to be associated with expressed genes. Conclusion The use of a SNP array for a ChIP-on-chip application (ChIP on SNP-chip will be of great value to laboratories whose interest is the determination of general rules regarding the relationship of specific chromatin modifications to transcriptional status throughout the genome and to examine the asymmetric modification of chromatin at heterozygous loci.

Evaluation of the Sepsis Flow Chip assay for the diagnosis of blood infections.

Science.gov (United States)

Galiana, Antonio; Coy, Javier; Gimeno, Adelina; Guzman, Noemi Marco; Rosales, Francisco; Merino, Esperanza; Royo, Gloria; Rodríguez, Juan Carlos

2017-01-01

Blood infections are serious complex conditions that generally require rapid diagnosis and treatment. The big challenge is to reduce the time necessary to make a diagnosis with current clinical microbiological methods so as to improve the treatment given to patients. In this study, we assess for the first time the Sepsis Flow Chip assay, which is a novel diagnostic assay for simultaneous rapid-detection of the vast majority of bloodstream pathogens, including Gram-positive and Gram-negative bacteria and fungi, in the same assay, and for the detection of most common antibiotic resistance genes. The SFC assay is based on multiplex PCR and low density DNA arrays. Positive blood cultures from 202 consecutive bacteremia patients were analyzed by SFC assay and the results were compared with the results obtained by the gold standard methodology used in clinical microbiology diagnostic laboratories (EUCAST guidelines). SFC assay overall sensitivity and specificity for bacterial identification were 93.3% and 100% respectively and sensitivity and specificity for the identification of antibiotic genetic resistance determinants were 93.6% and 100% respectively. This is the first evaluation of SFC assay in clinical samples. This new method appears to be very promising by combining the high number of distinct pathogens and genetic resistance determinants identified in a single assay. Further investigations should be done to evaluate the usefulness of this assay in combination with clinical multidisciplinary groups (stewardship), in order for the results to be applied appropriately to the management of patients`infectious processes.

Dramatic repositioning of c-Myb to different promoters during the cell cycle observed by combining cell sorting with chromatin immunoprecipitation.

Directory of Open Access Journals (Sweden)

Anita M Quintana

2011-02-01

Full Text Available The c-Myb transcription factor is a critical regulator of proliferation and stem cell differentiation, and mutated alleles of c-Myb are oncogenic, but little is known about changes in c-Myb activity during the cell cycle. To map the association of c-Myb with specific target genes during the cell cycle, we developed a novel Fix-Sort-ChIP approach, in which asynchronously growing cells were fixed with formaldehyde, stained with Hoechst 33342 and separated into different cell cycle fractions by flow sorting, then processed for chromatin immunoprecipitation (ChIP assays. We found that c-Myb actively repositions, binding to some genes only in specific cell cycle phases. In addition, the specificity of c-Myb is dramatically different in small subpopulations of cells, for example cells in the G2/M phase of the cell cycle, than in the bulk population. The repositioning of c-Myb during the cell cycle is not due to changes in its expression and also occurs with ectopically expressed, epitope-tagged versions of c-Myb. The repositioning occurs in established cell lines, in primary human CD34+ hematopoietic progenitors and in primary human acute myeloid leukemia cells. The combination of fixation, sorting and ChIP analysis sheds new light on the dynamic nature of gene regulation during the cell cycle and provides a new type of tool for the analysis of gene regulation in small subsets of cells, such as cells in a specific phase of the cell cycle.

Rapid and simple half-quantitative measurement alpha-fetoprotein by poly(dimethylsiloxane) microfluidic chip immunochromatographic assay

Science.gov (United States)

Tong, Chao; Jin, Qinghui; Zhao, Jianlong

2008-03-01

In this article, a kind of microfluidic method based on MEMS technology combined with gold immunochromatographic assay (GICA) is developed and discussed. Compared to the traditional GICA, this method supplies us convenient, multi-channel, in-parallel, low cost and similar efficiency approach in the fields of alpha-fetopro-tei (AFP)detection. Firstly, we improved the adhesion between the model material SU-8 and Silicon wafer, optimized approaches of the fabrication of the SU-8 model systematically, and fabricate the PDMS micro fluid chip with good reproduction successfully. Secondly, Surface modification and antibody immobilization methods with the GICA on the PDMS micro fluid analysis chip are studied, we choose the PDMS material and transfer GICA to the PDMS micro fluid chip successfully after researching the antibody immobilization efficiency of different materials utilized in fabrication of the micro fluid chip. In order to improve the reaction efficiency of the immobilized antibody, we studied the characteristics of micro fluid without the gas drive, and the fluid velocity control in our design; we also design structure of grove to strengthen the ability of immobilizing the antibody. The stimulation of the structure shows that it achieves great improvement and experiments prove the design is feasible.

Evaluation of the Sepsis Flow Chip assay for the diagnosis of blood infections.

Directory of Open Access Journals (Sweden)

Antonio Galiana

Full Text Available Blood infections are serious complex conditions that generally require rapid diagnosis and treatment. The big challenge is to reduce the time necessary to make a diagnosis with current clinical microbiological methods so as to improve the treatment given to patients.In this study, we assess for the first time the Sepsis Flow Chip assay, which is a novel diagnostic assay for simultaneous rapid-detection of the vast majority of bloodstream pathogens, including Gram-positive and Gram-negative bacteria and fungi, in the same assay, and for the detection of most common antibiotic resistance genes. The SFC assay is based on multiplex PCR and low density DNA arrays.Positive blood cultures from 202 consecutive bacteremia patients were analyzed by SFC assay and the results were compared with the results obtained by the gold standard methodology used in clinical microbiology diagnostic laboratories (EUCAST guidelines. SFC assay overall sensitivity and specificity for bacterial identification were 93.3% and 100% respectively and sensitivity and specificity for the identification of antibiotic genetic resistance determinants were 93.6% and 100% respectively.This is the first evaluation of SFC assay in clinical samples. This new method appears to be very promising by combining the high number of distinct pathogens and genetic resistance determinants identified in a single assay. Further investigations should be done to evaluate the usefulness of this assay in combination with clinical multidisciplinary groups (stewardship, in order for the results to be applied appropriately to the management of patients`infectious processes.

Immunoprecipitation of Tri-methylated Capped RNA.

Science.gov (United States)

Hayes, Karen E; Barr, Jamie A; Xie, Mingyi; Steitz, Joan A; Martinez, Ivan

2018-02-05

Cellular quiescence (also known as G 0 arrest) is characterized by reduced DNA replication, increased autophagy, and increased expression of cyclin-dependent kinase p27 Kip1 . Quiescence is essential for wound healing, organ regeneration, and preventing neoplasia. Previous findings indicate that microRNAs (miRNAs) play an important role in regulating cellular quiescence. Our recent publication demonstrated the existence of an alternative miRNA biogenesis pathway in primary human foreskin fibroblast (HFF) cells during quiescence. Indeed, we have identified a group of pri-miRNAs (whose mature miRNAs were found induced during quiescence) modified with a 2,2,7-trimethylguanosine (TMG)-cap by the trimethylguanosine synthase 1 (TGS1) protein and transported to the cytoplasm by the Exportin-1 (XPO1) protein. We used an antibody against (TMG)-caps (which does not cross-react with the (m 7 G)-caps that most pri-miRNAs or mRNAs contain [Luhrmann et al ., 1982]) to perform RNA immunoprecipitations from total RNA extracts of proliferating or quiescent HFFs. The novelty of this assay is the specific isolation of pri-miRNAs as well as other non-coding RNAs containing a TMG-cap modification.

Rapid and simultaneous detection of human hepatitis B virus and hepatitis C virus antibodies based on a protein chip assay using nano-gold immunological amplification and silver staining method

Directory of Open Access Journals (Sweden)

Wan Zhixiang

2005-07-01

Full Text Available Abstract Background Viral hepatitis due to hepatitis B virus and hepatitis C virus are major public health problems all over the world. Traditional detection methods including polymerase chain reaction (PCR-based assays and enzyme-linked immunosorbent assays (ELISA are expensive and time-consuming. In our assay, a protein chip assay using Nano-gold Immunological Amplification and Silver Staining (NIASS method was applied to detect HBV and HCV antibodies rapidly and simultaneously. Methods Chemically modified glass slides were used as solid supports (named chip, on which several antigens, including HBsAg, HBeAg, HBcAg and HCVAg (a mixture of NS3, NS5 and core antigens were immobilized respectively. Colloidal nano-gold labelled staphylococcal protein A (SPA was used as an indicator and immunogold silver staining enhancement technique was applied to amplify the detection signals, producing black image on array spots, which were visible with naked eyes. To determine the detection limit of the protein chip assay, a set of model arrays in which human IgG was spotted were structured and the model arrays were incubated with different concentrations of anti-IgG. A total of 305 serum samples previously characterized with commercial ELISA were divided into 4 groups and tested in this assay. Results We prepared mono-dispersed, spherical nano-gold particles with an average diameter of 15 ± 2 nm. Colloidal nano-gold-SPA particles observed by TEM were well-distributed, maintaining uniform and stable. The optimum silver enhancement time ranged from 8 to 12 minutes. In our assay, the protein chips could detect serum antibodies against HBsAg, HBeAg, HBcAg and HCVAg with the absence of the cross reaction. In the model arrays, the anti-IgG as low as 3 ng/ml could be detected. The data for comparing the protein chip assay with ELISA indicated that no distinct difference (P > 0.05 existed between the results determined by our assay and ELISA respectively. Conclusion

The development and validation of EpiComet-Chip, a modified high-throughput comet assay for the assessment of DNA methylation status.

Science.gov (United States)

Townsend, Todd A; Parrish, Marcus C; Engelward, Bevin P; Manjanatha, Mugimane G

2017-08-01

DNA damage and alterations in global DNA methylation status are associated with multiple human diseases and are frequently correlated with clinically relevant information. Therefore, assessing DNA damage and epigenetic modifications, including DNA methylation, is critical for predicting human exposure risk of pharmacological and biological agents. We previously developed a higher-throughput platform for the single cell gel electrophoresis (comet) assay, CometChip, to assess DNA damage and genotoxic potential. Here, we utilized the methylation-dependent endonuclease, McrBC, to develop a modified alkaline comet assay, "EpiComet," which allows single platform evaluation of genotoxicity and global DNA methylation [5-methylcytosine (5-mC)] status of single-cell populations under user-defined conditions. Further, we leveraged the CometChip platform to create an EpiComet-Chip system capable of performing quantification across simultaneous exposure protocols to enable unprecedented speed and simplicity. This system detected global methylation alterations in response to exposures which included chemotherapeutic and environmental agents. Using EpiComet-Chip on 63 matched samples, we correctly identified single-sample hypermethylation (≥1.5-fold) at 87% (20/23), hypomethylation (≥1.25-fold) at 100% (9/9), with a 4% (2/54) false-negative rate (FNR), and 10% (4/40) false-positive rate (FPR). Using a more stringent threshold to define hypermethylation (≥1.75-fold) allowed us to correctly identify 94% of hypermethylation (17/18), but increased our FPR to 16% (7/45). The successful application of this novel technology will aid hazard identification and risk characterization of FDA-regulated products, while providing utility for investigating epigenetic modes of action of agents in target organs, as the assay is amenable to cultured cells or nucleated cells from any tissue. Environ. Mol. Mutagen. 58:508-521, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Fluorimetric urease inhibition assay on a multilayer microfluidic chip with immunoaffinity immobilized enzyme reactors.

Science.gov (United States)

Zhang, Qin; Tang, Xiuwen; Hou, Fenghua; Yang, Jianping; Xie, Zhiyong; Cheng, Zhiyi

2013-10-01

We fabricated a three-layer polydimethylsiloxane (PDMS)-based microfluidic chip for realizing urease inhibition assay with sensitive fluorescence detection. Procedures such as sample prehandling, enzyme reaction, reagent mixing, fluorescence derivatization, and detection can be readily carried out. Urease reactors were prepared by adsorption of rabbit immunoglobulin G (IgG) and immunoreaction with urease-conjugated goat anti-rabbit IgG. Acetohydroxamic acid (AHA) as a competitive inhibitor of urease was tested on the chip. Microfluidically generated gradient concentrations of AHA with substrate (urea) were loaded into urease reactors. After incubation, the produced ammonia was transported out of reactors and then reacted with o-phthalaldehyde (OPA) to generate fluorescent products. Urease inhibition was indicated by a decrease in fluorescence signal detected by microplate reader. The IC50 value of AHA was determined and showed good agreement with that obtained in microplate. The presented device combines several steps of the analytical process with advantages of low reagent consumption, reduced analysis time, and ease of manipulation. This microfluidic approach can be extended to the screening of inhibitory compounds in drug discovery. Copyright © 2013 Elsevier Inc. All rights reserved.

Integrated bioassays in microfluidic devices: botulinum toxin assays.

Science.gov (United States)

Mangru, Shakuntala; Bentz, Bryan L; Davis, Timothy J; Desai, Nitin; Stabile, Paul J; Schmidt, James J; Millard, Charles B; Bavari, Sina; Kodukula, Krishna

2005-12-01

A microfluidic assay was developed for screening botulinum neurotoxin serotype A (BoNT-A) by using a fluorescent resonance energy transfer (FRET) assay. Molded silicone microdevices with integral valves, pumps, and reagent reservoirs were designed and fabricated. Electrical and pneumatic control hardware were constructed, and software was written to automate the assay protocol and data acquisition. Detection was accomplished by fluorescence microscopy. The system was validated with a peptide inhibitor, running 2 parallel assays, as a feasibility demonstration. The small footprint of each bioreactor cell (0.5 cm2) and scalable fluidic architecture enabled many parallel assays on a single chip. The chip is programmable to run a dilution series in each lane, generating concentration-response data for multiple inhibitors. The assay results showed good agreement with the corresponding experiments done at a macroscale level. Although the system has been developed for BoNT-A screening, a wide variety of assays can be performed on the microfluidic chip with little or no modification.

Highly Sensitive and Selective Sensor Chips with Graphene-Oxide Linking Layer

DEFF Research Database (Denmark)

Stebunov, Yury V.; Aftenieva, Olga A.; Arsenin, Aleksey V.

2015-01-01

sensor chip for SPR biosensors based on graphene-oxide linking layers. The biosensing assay model was based on a graphene oxide film containing streptavidin. The proposed sensor chip has three times higher sensitivity than the carboxymethylated dextran surface of a commercial sensor chip. Moreover...

Highly sensitive bacterial susceptibility test against penicillin using parylene-matrix chip.

Science.gov (United States)

Park, Jong-Min; Kim, Jo-Il; Song, Hyun-Woo; Noh, Joo-Yoon; Kang, Min-Jung; Pyun, Jae-Chul

2015-09-15

This work presented a highly sensitive bacterial antibiotic susceptibility test through β-lactamase assay using Parylene-matrix chip. β-lactamases (EC 3.5.2.6) are an important family of enzymes that confer resistance to β-lactam antibiotics by catalyzing the hydrolysis of these antibiotics. Here we present a highly sensitive assay to quantitate β-lactamase-mediated hydrolysis of penicillin into penicilloic acid. Typically, MALDI-TOF mass spectrometry has been used to quantitate low molecular weight analytes and to discriminate them from noise peaks of matrix fragments that occur at low m/z ratios (m/ztest was carried out using Parylene-matrix chip and MALDI-TOF mass spectrometry. The Parylene-matrix chip was successfully used to quantitate penicillin (m/z: [PEN+H](+)=335.1 and [PEN+Na](+)=357.8) and penicilloic acid (m/z: [PA+H](+)=353.1) in a β-lactamase assay with minimal interference of low molecular weight noise peaks. The β-lactamase assay was carried out with an antibiotic-resistant E. coli strain and an antibiotic-susceptible E. coli strain, revealing that the minimum number of E. coli cells required to screen for antibiotic resistance was 1000 cells for the MALDI-TOF mass spectrometry/Parylene-matrix chip assay. Copyright © 2015 Elsevier B.V. All rights reserved.

A versatile electrowetting-based digital microfluidic platform for quantitative homogeneous and heterogeneous bio-assays

Science.gov (United States)

Vergauwe, Nicolas; Witters, Daan; Ceyssens, Frederik; Vermeir, Steven; Verbruggen, Bert; Puers, Robert; Lammertyn, Jeroen

2011-05-01

Electrowetting-on-dielectric (EWOD) lab-on-a-chip systems have already proven their potential within a broad range of bio-assays. Nevertheless, research on the analytical performance of those systems is limited, yet crucial for a further breakthrough in the diagnostic field. Therefore, this paper presents the intrinsic possibilities of an EWOD lab-on-a-chip as a versatile platform for homogeneous and heterogeneous bio-assays with high analytical performance. Both droplet dispensing and splitting cause variations in droplet size, thereby directly influencing the assay's performance. The extent to which they influence the performance is assessed by a theoretical sensitivity analysis, which allows the definition of a basic framework for the reduction of droplet size variability. Taking advantage of the optimized droplet manipulations, both homogeneous and heterogeneous bio-assays are implemented in the EWOD lab-on-a-chip to demonstrate the analytical capabilities and versatility of the device. A fully on-chip enzymatic assay is realized with high analytical performance. It demonstrates the promising capabilities of an EWOD lab-on-a-chip in food-related and medical applications, such as nutritional and blood analyses. Further, a magnetic bio-assay for IgE detection using superparamagnetic nanoparticles is presented whereby the nanoparticles are used as solid carriers during the bio-assay. Crucial elements are the precise manipulation of the superparamagnetic nanoparticles with respect to dispensing and separation. Although the principle of using nano-carriers is demonstrated for protein detection, it can be easily extended to a broader range of bio-related applications like DNA sensing. In heterogeneous bio-assays the chip surface is actively involved during the execution of the bio-assay. Through immobilization of specific biological compounds like DNA, proteins and cells a reactive chip surface is realized, which enhances the bio-assay performance. To demonstrate

Critical stages of a biodetection platform development from sensor chip fabrication to surface chemistry and assay development

Science.gov (United States)

Uludag, Yildiz

2014-06-01

Once viewed solely as a tool to analyse biomolecular interactions, biosensors are gaining widespread interest for diagnostics, biological defense, environmental and quality assurance in agriculture/food industries. Advanced micro fabrication techniques have facilitated integration of microfluidics with sensing functionalities on the same chip making system automation more convenient1. Biosensor devices relying on lab-on-a-chip technologies and nanotechnology has attracted much of attention in recent years for biological defense research and development. However, compared with the numerous publications and patents available, the commercialization of biosensors technology has significantly lagged behind the research output. This paper reviews the reasons behind the slow commercialisation of biosensors with an insight to the critical stages of a biosensor development from the sensor chip fabrication to surface chemistry applications and nanotechnology applications in sensing with case studies. In addition, the paper includes the description of a new biodetection platform based on Real-time Electrochemical ProfilingTM (REPTM) that comprises novel electrode arrays and nanoparticle based sensing. The performance of the REPTM platform has been tested for the detection of Planktothrix agardhii, one of the toxic bloom-forming cyanobacteria, usually found in shallow fresh water sources that can be used for human consumption. The optimised REPTM assay allowed the detection of P. agardhii DNA down to 6 pM. This study, showed the potential of REPTM as a new biodetection platform for toxic bacteria and hence further studies will involve the development of a portable multi-analyte biosensor based on REPTM technology for on-site testing.

A missing factor in chip-based patch clamp assay: gigaseal

International Nuclear Information System (INIS)

Ong, W-L; Yobas, L; Ong, W-Y

2006-01-01

The 'gold' standard in the study of ionic currents across biological membranes is the Patch Clamp method. However, this is a slow, labor and skill intensive process. High throughput patch clamp devices are mainly chip-based. A major challenge in these miniaturized devices is the low rate of 'Gigaseal' formation which is critical in the study of Single Channel effect. In a conventional patch clamp, a pipette moves and patches a fixed cell (cell-adhered patch) which is grown on the bottom of a Petri dish. In the chip-based case, the cells are in suspension and move towards the fixed patch clamp sites (cell-suspended patch). In this study, using the proven conventional patch clamp setup, we investigated the effect of the differences in the cell configurations between the convention patch clamp and cell-based patch clamp. It is shown that adhered cells (as used in the conventional setup) have a much higher rate of gigaseal formation as compared to the cells in suspension (as used in chip-based devices). We postulate that the arrangement of the cytoskeleton within the cell plays a major part in the formation of the gigaseal

A new scintillation proximity assay-based approach for the detection of KRAS mutations

Energy Technology Data Exchange (ETDEWEB)

Lee, So-Young; Lim, Jae-Cheong; Cho, Eun-Ha; Jung, Sung-Hee [Korea Atomic Energy Research Institute (KAERI), Daejeon (Korea, Republic of). Radioisotope Research Div.

2016-04-01

KRAS is very commonly mutated resulting in a constitutively activated protein, which is independent of epidermal growth factor receptor (EGFR) ligand binding and resistant to anti-EGFR therapy. Although KRAS is frequently studied, there is still no uniform standard for detecting of KRAS mutations. In this report, a new scintillation proximity assay-based approach is described that determines the relative affinities of wild-type and mutated KRAS to the anti-KRAS antibody. We performed in vitro experiments using normal human colonic cells (CCD18Co), KRAS wild type (Caco-2) and KRAS mutant (HCT 116) cell lines to determine the relative affinities of wild type or mutated KRAS toward an anti-KRAS monoclonal antibody. The process consists of two primary steps: immunoprecipitation from cell lysate to enrich the KRAS protein and the scintillation proximity assay of the immunoprecipitant to determine the relative affinity against the antibody. A fixed concentration of cell lysates was purified by the immunoprecipitation method. The expressions of the KRAS protein in all cell lines was quantitatively confirmed by western blot analysis. For the scintillation proximity assay, the KRAS standard protein was radiolabeled with {sup 125}I by a simple mixing process in the iodogen tube immediately at room temperature immediately before use. The obtained CPM (count per minute) values of were used to calculate the KRAS concentration using purified KRAS as the standard. The calculated relative affinities of 7 μg of Caco-2 and HCT 116 immunoprecipitants for the anti-KRAS antibody were 77 and 0%, respectively. The newly developed scintillation proximity assay-based strategy determines the relative affinities of wild-type or mutated KRAS towards the anti-KRAS monoclonal antibody. This determination can help distinguish mutated KRAS from the wild type protein. The new SPA based approach for detecting KRAS mutations is applicable to many other cancer-related mutations.

A new scintillation proximity assay-based approach for the detection of KRAS mutations

International Nuclear Information System (INIS)

Lee, So-Young; Lim, Jae-Cheong; Cho, Eun-Ha; Jung, Sung-Hee

2016-01-01

KRAS is very commonly mutated resulting in a constitutively activated protein, which is independent of epidermal growth factor receptor (EGFR) ligand binding and resistant to anti-EGFR therapy. Although KRAS is frequently studied, there is still no uniform standard for detecting of KRAS mutations. In this report, a new scintillation proximity assay-based approach is described that determines the relative affinities of wild-type and mutated KRAS to the anti-KRAS antibody. We performed in vitro experiments using normal human colonic cells (CCD18Co), KRAS wild type (Caco-2) and KRAS mutant (HCT 116) cell lines to determine the relative affinities of wild type or mutated KRAS toward an anti-KRAS monoclonal antibody. The process consists of two primary steps: immunoprecipitation from cell lysate to enrich the KRAS protein and the scintillation proximity assay of the immunoprecipitant to determine the relative affinity against the antibody. A fixed concentration of cell lysates was purified by the immunoprecipitation method. The expressions of the KRAS protein in all cell lines was quantitatively confirmed by western blot analysis. For the scintillation proximity assay, the KRAS standard protein was radiolabeled with 125 I by a simple mixing process in the iodogen tube immediately at room temperature immediately before use. The obtained CPM (count per minute) values of were used to calculate the KRAS concentration using purified KRAS as the standard. The calculated relative affinities of 7 μg of Caco-2 and HCT 116 immunoprecipitants for the anti-KRAS antibody were 77 and 0%, respectively. The newly developed scintillation proximity assay-based strategy determines the relative affinities of wild-type or mutated KRAS towards the anti-KRAS monoclonal antibody. This determination can help distinguish mutated KRAS from the wild type protein. The new SPA based approach for detecting KRAS mutations is applicable to many other cancer-related mutations.

Organ-Tumor-on-a-Chip for Chemosensitivity Assay: A Critical Review

OpenAIRE

Navid Kashaninejad; Mohammad Reza Nikmaneshi; Hajar Moghadas; Amir Kiyoumarsi Oskouei; Milad Rismanian; Maryam Barisam; Mohammad Said Saidi; Bahar Firoozabadi

2016-01-01

With a mortality rate over 580,000 per year, cancer is still one of the leading causes of death worldwide. However, the emerging field of microfluidics can potentially shed light on this puzzling disease. Unique characteristics of microfluidic chips (also known as micro-total analysis system) make them excellent candidates for biological applications. The ex vivo approach of tumor-on-a-chip is becoming an indispensable part of personalized medicine and can replace in vivo animal testing as we...

Rapid and Quantitative Detection of Vibrio parahemolyticus by the Mixed-Dye-Based Loop-Mediated Isothermal Amplification Assay on a Self-Priming Compartmentalization Microfluidic Chip.

Science.gov (United States)

Pang, Bo; Ding, Xiong; Wang, Guoping; Zhao, Chao; Xu, Yanan; Fu, Kaiyue; Sun, Jingjing; Song, Xiuling; Wu, Wenshuai; Liu, Yushen; Song, Qi; Hu, Jiumei; Li, Juan; Mu, Ying

2017-12-27

Vibrio parahemolyticus (VP) mostly isolated from aquatic products is one of the major causes of bacterial food-poisoning events worldwide, which could be reduced using a promising on-site detection method. Herein, a rapid and quantitative method for VP detection was developed by applying a mixed-dye-loaded loop-mediated isothermal amplification (LAMP) assay on a self-priming compartmentalization (SPC) microfluidic chip, termed on-chip mixed-dye-based LAMP (CMD-LAMP). In comparison to conventional approaches, CMD-LAMP was advantageous on the limit of detection, which reached down to 1 × 10 3 CFU/mL in food-contaminated samples without the pre-enrichment of bacteria. Additionally, as a result of the use of a mixed dye and SPC chip, the quantitative result could be easily acquired, avoiding the requirement of sophisticated instruments and tedious operation. Also, CMD-LAMP was rapid and cost-effective. Conclusively, CMD-LAMP has great potential in realizing the on-site quantitative analysis of VP for food safety.

Detection and classification of ebola on microfluidic chips

Science.gov (United States)

Lin, Xue; Jin, Xiangyu; Fan, Yunqian; Huang, Qin; Kou, Yue; Zu, Guo; Huang, Shiguang; Liu, Xiaosheng; Huang, Guoliang

2016-10-01

Point-of-care testing (POCT) for an infectious diseases is the prerequisite to control of the disease and limitation of its spread. A microfluidic chip for detection and classification of four strains of Ebola virus was developed and evaluated. This assay was based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) and specific primers for Ebola Zaire virus, Ebola Sudan virus, Ebola Tai Forest virus and Ebola Bundibugyo virus were designed. The sensitivity of the microfluidic chip was under 103 copies per milliliter, as determined by ten repeated tests. This assay is unique in its ability to enable diagnosis of the Ebola infections and simultaneous typing of Ebola virus on a single chip. It offers short reaction time, ease of use and high specificity. These features should enable POCT in remote area during outbreaks of Ebola virus.

Barcoded microchips for biomolecular assays.

Science.gov (United States)

Zhang, Yi; Sun, Jiashu; Zou, Yu; Chen, Wenwen; Zhang, Wei; Xi, Jianzhong Jeff; Jiang, Xingyu

2015-01-20

Multiplexed assay of analytes is of great importance for clinical diagnostics and other analytical applications. Barcode-based bioassays with the ability to encode and decode may realize this goal in a straightforward and consistent manner. We present here a microfluidic barcoded chip containing several sets of microchannels with different widths, imitating the commonly used barcode. A single barcoded microchip can carry out tens of individual protein/nucleic acid assays (encode) and immediately yield all assay results by a portable barcode reader or a smartphone (decode). The applicability of a barcoded microchip is demonstrated by human immunodeficiency virus (HIV) immunoassays for simultaneous detection of three targets (anti-gp41 antibody, anti-gp120 antibody, and anti-gp36 antibody) from six human serum samples. We can also determine seven pathogen-specific oligonucleotides by a single chip containing both positive and negative controls.

A dual-docking microfluidic cell migration assay (D2-Chip) for testing neutrophil chemotaxis and the memory effect.

Science.gov (United States)

Yang, Ke; Wu, Jiandong; Xu, Guoqing; Xie, Dongxue; Peretz-Soroka, Hagit; Santos, Susy; Alexander, Murray; Zhu, Ling; Zhang, Michael; Liu, Yong; Lin, Francis

2017-04-18

Chemotaxis is a classic mechanism for guiding cell migration and an important topic in both fundamental cell biology and health sciences. Neutrophils are a widely used model to study eukaryotic cell migration and neutrophil chemotaxis itself can lead to protective or harmful immune actions to the body. While much has been learnt from past research about how neutrophils effectively navigate through a chemoattractant gradient, many interesting questions remain unclear. For example, while it is tempting to model neutrophil chemotaxis using the well-established biased random walk theory, the experimental proof was challenged by the cell's highly persistent migrating nature. A special experimental design is required to test the key predictions from the random walk model. Another question that has interested the cell migration community for decades concerns the existence of chemotactic memory and its underlying mechanism. Although chemotactic memory has been suggested in various studies, a clear quantitative experimental demonstration will improve our understanding of the migratory memory effect. Motivated by these questions, we developed a microfluidic cell migration assay (so-called dual-docking chip or D 2 -Chip) that can test both the biased random walk model and the memory effect for neutrophil chemotaxis on a single chip enabled by multi-region gradient generation and dual-region cell alignment. Our results provide experimental support for the biased random walk model and chemotactic memory for neutrophil chemotaxis. Quantitative data analyses provide new insights into neutrophil chemotaxis and memory by making connections to entropic disorder, cell morphology and oscillating migratory response.

A hidden Ising model for ChIP-chip data analysis

KAUST Repository

Mo, Q.

2010-01-28

Motivation: Chromatin immunoprecipitation (ChIP) coupled with tiling microarray (chip) experiments have been used in a wide range of biological studies such as identification of transcription factor binding sites and investigation of DNA methylation and histone modification. Hidden Markov models are widely used to model the spatial dependency of ChIP-chip data. However, parameter estimation for these models is typically either heuristic or suboptimal, leading to inconsistencies in their applications. To overcome this limitation and to develop an efficient software, we propose a hidden ferromagnetic Ising model for ChIP-chip data analysis. Results: We have developed a simple, but powerful Bayesian hierarchical model for ChIP-chip data via a hidden Ising model. Metropolis within Gibbs sampling algorithm is used to simulate from the posterior distribution of the model parameters. The proposed model naturally incorporates the spatial dependency of the data, and can be used to analyze data with various genomic resolutions and sample sizes. We illustrate the method using three publicly available datasets and various simulated datasets, and compare it with three closely related methods, namely TileMap HMM, tileHMM and BAC. We find that our method performs as well as TileMap HMM and BAC for the high-resolution data from Affymetrix platform, but significantly outperforms the other three methods for the low-resolution data from Agilent platform. Compared with the BAC method which also involves MCMC simulations, our method is computationally much more efficient. Availability: A software called iChip is freely available at http://www.bioconductor.org/. Contact: moq@mskcc.org. © The Author 2010. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org.

Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens

International Nuclear Information System (INIS)

Weng, X.; Jiang, H.; Li, D.

2012-01-01

We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)

Bayesian Modeling of ChIP-chip Data Through a High-Order Ising Model

KAUST Repository

Mo, Qianxing

2010-01-29

ChIP-chip experiments are procedures that combine chromatin immunoprecipitation (ChIP) and DNA microarray (chip) technology to study a variety of biological problems, including protein-DNA interaction, histone modification, and DNA methylation. The most important feature of ChIP-chip data is that the intensity measurements of probes are spatially correlated because the DNA fragments are hybridized to neighboring probes in the experiments. We propose a simple, but powerful Bayesian hierarchical approach to ChIP-chip data through an Ising model with high-order interactions. The proposed method naturally takes into account the intrinsic spatial structure of the data and can be used to analyze data from multiple platforms with different genomic resolutions. The model parameters are estimated using the Gibbs sampler. The proposed method is illustrated using two publicly available data sets from Affymetrix and Agilent platforms, and compared with three alternative Bayesian methods, namely, Bayesian hierarchical model, hierarchical gamma mixture model, and Tilemap hidden Markov model. The numerical results indicate that the proposed method performs as well as the other three methods for the data from Affymetrix tiling arrays, but significantly outperforms the other three methods for the data from Agilent promoter arrays. In addition, we find that the proposed method has better operating characteristics in terms of sensitivities and false discovery rates under various scenarios. © 2010, The International Biometric Society.

Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

Science.gov (United States)

Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

2009-11-01

Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

Identification of lactoferricin B intracellular targets using an Escherichia coli proteome chip.

Science.gov (United States)

Tu, Yu-Hsuan; Ho, Yu-Hsuan; Chuang, Ying-Chih; Chen, Po-Chung; Chen, Chien-Sheng

2011-01-01

Lactoferricin B (LfcinB) is a well-known antimicrobial peptide. Several studies have indicated that it can inhibit bacteria by affecting intracellular activities, but the intracellular targets of this antimicrobial peptide have not been identified. Therefore, we used E. coli proteome chips to identify the intracellular target proteins of LfcinB in a high-throughput manner. We probed LfcinB with E. coli proteome chips and further conducted normalization and Gene Ontology (GO) analyses. The results of the GO analyses showed that the identified proteins were associated with metabolic processes. Moreover, we validated the interactions between LfcinB and chip assay-identified proteins with fluorescence polarization (FP) assays. Sixteen proteins were identified, and an E. coli interaction database (EcID) analysis revealed that the majority of the proteins that interact with these 16 proteins affected the tricarboxylic acid (TCA) cycle. Knockout assays were conducted to further validate the FP assay results. These results showed that phosphoenolpyruvate carboxylase was a target of LfcinB, indicating that one of its mechanisms of action may be associated with pyruvate metabolism. Thus, we used pyruvate assays to conduct an in vivo validation of the relationship between LfcinB and pyruvate level in E. coli. These results showed that E. coli exposed to LfcinB had abnormal pyruvate amounts, indicating that LfcinB caused an accumulation of pyruvate. In conclusion, this study successfully revealed the intracellular targets of LfcinB using an E. coli proteome chip approach.

Identification of lactoferricin B intracellular targets using an Escherichia coli proteome chip.

Directory of Open Access Journals (Sweden)

Yu-Hsuan Tu

Full Text Available Lactoferricin B (LfcinB is a well-known antimicrobial peptide. Several studies have indicated that it can inhibit bacteria by affecting intracellular activities, but the intracellular targets of this antimicrobial peptide have not been identified. Therefore, we used E. coli proteome chips to identify the intracellular target proteins of LfcinB in a high-throughput manner. We probed LfcinB with E. coli proteome chips and further conducted normalization and Gene Ontology (GO analyses. The results of the GO analyses showed that the identified proteins were associated with metabolic processes. Moreover, we validated the interactions between LfcinB and chip assay-identified proteins with fluorescence polarization (FP assays. Sixteen proteins were identified, and an E. coli interaction database (EcID analysis revealed that the majority of the proteins that interact with these 16 proteins affected the tricarboxylic acid (TCA cycle. Knockout assays were conducted to further validate the FP assay results. These results showed that phosphoenolpyruvate carboxylase was a target of LfcinB, indicating that one of its mechanisms of action may be associated with pyruvate metabolism. Thus, we used pyruvate assays to conduct an in vivo validation of the relationship between LfcinB and pyruvate level in E. coli. These results showed that E. coli exposed to LfcinB had abnormal pyruvate amounts, indicating that LfcinB caused an accumulation of pyruvate. In conclusion, this study successfully revealed the intracellular targets of LfcinB using an E. coli proteome chip approach.

A Cardiac Cell Outgrowth Assay for Evaluating Drug Compounds Using a Cardiac Spheroid-on-a-Chip Device

Directory of Open Access Journals (Sweden)

Jonas Christoffersson

2018-05-01

Full Text Available Three-dimensional (3D models with cells arranged in clusters or spheroids have emerged as valuable tools to improve physiological relevance in drug screening. One of the challenges with cells cultured in 3D, especially for high-throughput applications, is to quickly and non-invasively assess the cellular state in vitro. In this article, we show that the number of cells growing out from human induced pluripotent stem cell (hiPSC-derived cardiac spheroids can be quantified to serve as an indicator of a drug’s effect on spheroids captured in a microfluidic device. Combining this spheroid-on-a-chip with confocal high content imaging reveals easily accessible, quantitative outgrowth data. We found that effects on outgrowing cell numbers correlate to the concentrations of relevant pharmacological compounds and could thus serve as a practical readout to monitor drug effects. Here, we demonstrate the potential of this semi-high-throughput “cardiac cell outgrowth assay” with six compounds at three concentrations applied to spheroids for 48 h. The image-based readout complements end-point assays or may be used as a non-invasive assay for quality control during long-term culture.

A Method to Study the Epigenetic Chromatin States of Rare Hematopoietic Stem and Progenitor Cells; MiniChIP–Chip

Directory of Open Access Journals (Sweden)

Weishaupt Holger

2010-01-01

Full Text Available Abstract Dynamic chromatin structure is a fundamental property of gene transcriptional regulation, and has emerged as a critical modulator of physiological processes during cellular differentiation and development. Analysis of chromatin structure using molecular biology and biochemical assays in rare somatic stem and progenitor cells is key for understanding these processes but poses a great challenge because of their reliance on millions of cells. Through the development of a miniaturized genome-scale chromatin immunoprecipitation method (miniChIP–chip, we have documented the genome-wide chromatin states of low abundant populations that comprise hematopoietic stem cells and immediate progeny residing in murine bone marrow. In this report, we describe the miniChIP methodology that can be used for increasing an understanding of the epigenetic mechanisms underlying hematopoietic stem and progenitor cell function. Application of this method will reveal the contribution of dynamic chromatin structure in regulating the function of other somatic stem cell populations, and how this process becomes perturbed in pathological conditions. Additional file 1 Click here for file

Hybridization of Environmental Microbial Community Nucleic Acids by GeoChip.

Science.gov (United States)

Van Nostrand, Joy D; Yin, Huaqin; Wu, Liyou; Yuan, Tong; Zhou, Jizhong

2016-01-01

Functional gene arrays, like the GeoChip, allow for the study of tens of thousands of genes in a single assay. The GeoChip array (5.0) contains probes for genes involved in geochemical cycling (N, C, S, and P), metal homeostasis, stress response, organic contaminant degradation, antibiotic resistance, secondary metabolism, and virulence factors as well as genes specific for fungi, protists, and viruses. Here, we briefly describe GeoChip design strategies (gene selection and probe design) and discuss minimum quantity and quality requirements for nucleic acids. We then provide detailed protocols for amplification, labeling, and hybridization of samples to the GeoChip.

A comparison of the whole genome approach of MeDIP-seq to the targeted approach of the Infinium HumanMethylation450 BeadChip(® for methylome profiling.

Directory of Open Access Journals (Sweden)

Christine Clark

Full Text Available DNA methylation is one of the most studied epigenetic marks in the human genome, with the result that the desire to map the human methylome has driven the development of several methods to map DNA methylation on a genomic scale. Our study presents the first comparison of two of these techniques - the targeted approach of the Infinium HumanMethylation450 BeadChip® with the immunoprecipitation and sequencing-based method, MeDIP-seq. Both methods were initially validated with respect to bisulfite sequencing as the gold standard and then assessed in terms of coverage, resolution and accuracy. The regions of the methylome that can be assayed by both methods and those that can only be assayed by one method were determined and the discovery of differentially methylated regions (DMRs by both techniques was examined. Our results show that the Infinium HumanMethylation450 BeadChip® and MeDIP-seq show a good positive correlation (Spearman correlation of 0.68 on a genome-wide scale and can both be used successfully to determine differentially methylated loci in RefSeq genes, CpG islands, shores and shelves. MeDIP-seq however, allows a wider interrogation of methylated regions of the human genome, including thousands of non-RefSeq genes and repetitive elements, all of which may be of importance in disease. In our study MeDIP-seq allowed the detection of 15,709 differentially methylated regions, nearly twice as many as the array-based method (8070, which may result in a more comprehensive study of the methylome.

Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.

Science.gov (United States)

Rebollo, Rita; Mager, Dixie L

2016-01-01

Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.

Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

Energy Technology Data Exchange (ETDEWEB)

Liu, Zhenbao [Central South University, School of Pharmaceutical Sciences (China); Zhou, Bo, E-mail: zhoubo1771@163.com [The Affiliated Zhongda Hospital of Southeast University, Department of Gerontology (China); Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang, E-mail: lengxigyky@163.com [Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College (China)

2013-09-15

A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 {mu}m in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL{sup -1} to 10 ng mL{sup -1}. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

Science.gov (United States)

Liu, Zhenbao; Zhou, Bo; Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang

2013-09-01

A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 μm in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL-1 to 10 ng mL-1. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

International Nuclear Information System (INIS)

Liu, Zhenbao; Zhou, Bo; Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang

2013-01-01

A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 μm in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL −1 to 10 ng mL −1 . This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples

A multiplexed chip-based assay system for investigating the functional development of human skeletal myotubes in vitro.

Science.gov (United States)

Smith, A S T; Long, C J; Pirozzi, K; Najjar, S; McAleer, C; Vandenburgh, H H; Hickman, J J

2014-09-20

This report details the development of a non-invasive in vitro assay system for investigating the functional maturation and performance of human skeletal myotubes. Data is presented demonstrating the survival and differentiation of human myotubes on microscale silicon cantilevers in a defined, serum-free system. These cultures can be stimulated electrically and the resulting contraction quantified using modified atomic force microscopy technology. This system provides a higher degree of sensitivity for investigating contractile waveforms than video-based analysis, and represents the first system capable of measuring the contractile activity of individual human muscle myotubes in a reliable, high-throughput and non-invasive manner. The development of such a technique is critical for the advancement of body-on-a-chip platforms toward application in pre-clinical drug development screens. Copyright © 2014 Elsevier B.V. All rights reserved.

Reagent-loaded plastic microfluidic chips for detecting homocysteine

International Nuclear Information System (INIS)

Suk, Ji Won; Jang, Jae-Young; Cho, Jun-Hyeong

2008-01-01

This report describes the preliminary study on plastic microfluidic chips with pre-loaded reagents for detecting homocysteine (Hcy). All reagents needed in an Hcy immunoassay were included in a microfluidic chip to remove tedious assay steps. A simple and cost-effective bonding method was developed to realize reagent-loaded microfluidic chips. This technique uses an intermediate layer between two plastic substrates by selectively patterning polydimethylsiloxane (PDMS) on the embossed surface of microchannels and fixing the substrates under pressure. Using this bonding method, the competitive immunoassay for SAH, a converted form of Hcy, was performed without any damage to reagents in chips, and the results showed that the fluorescent signal from antibody antigen binding decreased as the SAH concentration increased. Based on the SAH immunoassay, whole immunoassay steps for Hcy detection were carried out in plastic microfluidic chips with all necessary reagents. These experiments demonstrated the feasibility of the Hcy immunoassay in microfluidic devices

Normalization and experimental design for ChIP-chip data

Directory of Open Access Journals (Sweden)

Alekseyenko Artyom A

2007-06-01

Full Text Available Abstract Background Chromatin immunoprecipitation on tiling arrays (ChIP-chip has been widely used to investigate the DNA binding sites for a variety of proteins on a genome-wide scale. However, several issues in the processing and analysis of ChIP-chip data have not been resolved fully, including the effect of background (mock control subtraction and normalization within and across arrays. Results The binding profiles of Drosophila male-specific lethal (MSL complex on a tiling array provide a unique opportunity for investigating these topics, as it is known to bind on the X chromosome but not on the autosomes. These large bound and control regions on the same array allow clear evaluation of analytical methods. We introduce a novel normalization scheme specifically designed for ChIP-chip data from dual-channel arrays and demonstrate that this step is critical for correcting systematic dye-bias that may exist in the data. Subtraction of the mock (non-specific antibody or no antibody control data is generally needed to eliminate the bias, but appropriate normalization obviates the need for mock experiments and increases the correlation among replicates. The idea underlying the normalization can be used subsequently to estimate the background noise level in each array for normalization across arrays. We demonstrate the effectiveness of the methods with the MSL complex binding data and other publicly available data. Conclusion Proper normalization is essential for ChIP-chip experiments. The proposed normalization technique can correct systematic errors and compensate for the lack of mock control data, thus reducing the experimental cost and producing more accurate results.

Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation.

Science.gov (United States)

Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro

2011-01-30

During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own

Functional coupling between adenosine A1 receptors and G-proteins in rat and postmortem human brain membranes determined with conventional guanosine-5'-O-(3-[35S]thio)triphosphate ([35S]GTPγS) binding or [35S]GTPγS/immunoprecipitation assay.

Science.gov (United States)

Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A

2018-06-01

Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.

Preferential microRNA targeting revealed by in vivo competitive binding and differential Argonaute immunoprecipitation.

Science.gov (United States)

Werfel, Stanislas; Leierseder, Simon; Ruprecht, Benjamin; Kuster, Bernhard; Engelhardt, Stefan

2017-09-29

MicroRNAs (miRNAs) have been described to simultaneously inhibit hundreds of targets, albeit to a modest extent. It was recently proposed that there could exist more specific, exceptionally strong binding to a subgroup of targets. However, it is unknown, whether this is the case and how such targets can be identified. Using Argonaute2-ribonucleoprotein immunoprecipitation and in vivo competitive binding assays, we demonstrate for miRNAs-21, -199-3p and let-7 exceptional regulation of a subset of targets, which are characterized by preferential miRNA binding. We confirm this finding by analysis of independent quantitative proteome and transcriptome datasets obtained after miRNA silencing. Our data suggest that mammalian miRNA activity is guided by preferential binding of a small set of 3'-untranslated regions, thereby shaping a steep gradient of regulation between potential targets. Our approach can be applied for transcriptome-wide identification of such targets independently of the presence of seed complementary sequences or other predictors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Chromatin Immunoprecipitation (ChIP) using Drosophila tissue

OpenAIRE

Tran, Vuong; Gan, Qiang; Chen, Xin

2012-01-01

Epigenetics remains a rapidly developing field that studies how the chromatin state contributes to differential gene expression in distinct cell types at different developmental stages. Epigenetic regulation contributes to a broad spectrum of biological processes, including cellular differentiation during embryonic development and homeostasis in adulthood. A critical strategy in epigenetic studies is to examine how various histone modifications and chromatin factors regulate gene expression. ...

Lab-on-a-Chip Pathogen Sensors for Food Safety

Directory of Open Access Journals (Sweden)

Bumsang Kim

2012-08-01

Full Text Available There have been a number of cases of foodborne illness among humans that are caused by pathogens such as Escherichia coli O157:H7, Salmonella typhimurium, etc. The current practices to detect such pathogenic agents are cell culturing, immunoassays, or polymerase chain reactions (PCRs. These methods are essentially laboratory-based methods that are not at all real-time and thus unavailable for early-monitoring of such pathogens. They are also very difficult to implement in the field. Lab-on-a-chip biosensors, however, have a strong potential to be used in the field since they can be miniaturized and automated; they are also potentially fast and very sensitive. These lab-on-a-chip biosensors can detect pathogens in farms, packaging/processing facilities, delivery/distribution systems, and at the consumer level. There are still several issues to be resolved before applying these lab-on-a-chip sensors to field applications, including the pre-treatment of a sample, proper storage of reagents, full integration into a battery-powered system, and demonstration of very high sensitivity, which are addressed in this review article. Several different types of lab-on-a-chip biosensors, including immunoassay- and PCR-based, have been developed and tested for detecting foodborne pathogens. Their assay performance, including detection limit and assay time, are also summarized. Finally, the use of optical fibers or optical waveguide is discussed as a means to improve the portability and sensitivity of lab-on-a-chip pathogen sensors.

A multiple biomarker assay for quality assessment of botanical drugs using a versatile microfluidic chip.

Science.gov (United States)

Li, Zhen-Hao; Ai, Ni; Yu, Lawrence X; Qian, Zhong-Zhi; Cheng, Yi-Yu

2017-09-25

Quality control is critical for ensuring the safety and effectiveness of drugs. Current quality control method for botanical drugs is mainly based on chemical testing. However, chemical testing alone may not be sufficient as it may not capture all constituents of botanical drugs. Therefore, it is necessary to establish a bioassay correlating with the drug's known mechanism of action to ensure its potency and activity. Herein we developed a multiple biomarker assay to assess the quality of botanicals using microfluidics, where enzyme inhibition was employed to indicate the drug's activity and thereby evaluate biological consistency. This approach was exemplified on QiShenYiQi Pills using thrombin and angiotensin converting enzyme as "quality biomarkers". Our results demonstrated that there existed variations in potency across different batches of the intermediates and preparations. Compared with chromatographic fingerprinting, the bioassay provided better discrimination ability for some abnormal samples. Moreover, the chip could function as "affinity chromatography" to identify bioactive phytochemicals bound to the enzymes. This work proposed a multiple-biomarker strategy for quality assessment of botanical drugs, while demonstrating for the first time the feasibility of microfluidics in this field.

On-chip mitochondrial assay microfluidic devices and protein nanopore/nanotube hybrid transistor

Science.gov (United States)

Lim, Taesun

Tremendous efforts to understand the cause, mechanism of development and the way to treat various diseases as well as an early diagnosis have been made so far and people are still working hardly on these researches. Even now, countless people are suffering from diseases such as Alzhemer's disease, Parkinson's disease, diabetes and cancer without knowing clues to cure their diseases completely. Generally speaking, we still have a long way to go through to comprehensively figure out these our long-lasting homeworks. One of possible solutions is to merge current advanced technology and science together to find a powerful synergetic effect for a specific purpose that can be tailored depending on user's need. Here this research tried to put nanotechnology and biological science together to find a way to resolve current challenges by developing a new generation of the analytical sensing device. Mitochondrial functions and biological roles in regulating life and death control will be discussed indicating mitochondrion is a crucial organism to monitor to obtain important information regarding degenerative diseases and aging process. On-chip mitochondrial functional assay microsensor that could facilitate the mitochondrial evaluation will be extensively demonstrated and discussed in both technical and biological perspectives. The novel fusion technological approach will be demonstrated by combining artificial cell membrane with carbon nanotube electronics to interrogate interactions between biomolecules and electronic circuitries. In addition, molecular dynamics at the cell membrane could be investigated closely which can help understand the cell-cell communication and the regulation of ion transport.

Nanodisc-based Co-immunoprecipitation for Mass Spectrometric Identification of Membrane-interacting Proteins

DEFF Research Database (Denmark)

Borch-Jensen, Jonas; Roepstorff, Peter; Møller-Jensen, Jakob

2011-01-01

enterotoxigenic Escherischia coli, GM1-nanodiscs were employed for co-immunoprecipitation. The B subunit of heat labile enterotoxin was identified as a specific interaction partner by mass spectrometry, thus demonstrating that nanodisc technology is useful for highly specific detection and identification...

Studying RNA-protein interactions in vivo by RNA immunoprecipitation

DEFF Research Database (Denmark)

Selth, Luke A; Close, Pierre; Svejstrup, Jesper Q

2011-01-01

and have significant effects on gene expression. RNA immunoprecipitation (RIP) is a powerful technique used to detect direct and indirect interactions between individual proteins and specific RNA molecules in vivo. Here, we describe RIP methods for both yeast and mammalian cells.......The crucial roles played by RNA-binding proteins in all aspects of RNA metabolism, particularly in the regulation of transcription, have become increasingly evident. Moreover, other factors that do not directly interact with RNA molecules can nevertheless function proximally to RNA polymerases...

DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

Science.gov (United States)

Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

2018-04-23

Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https

Immunoassays in clinical chemistry (principles of immunoradiometric assays)

International Nuclear Information System (INIS)

Chapman, R.S.

1998-01-01

The use of antibodies as reagents in clinical chemistry for the quantitation of a wide range of analytes has now become widely established. Initially antibodies were employed in precipitation techniques, usually for the analysis of serum proteins, in solution or in the form of antibody containing gels, e.g. immunoprecipitation, immunodiffusion, and immunoelectrophoresis. Further developments have led to the highly sensitive techniques of radioimmunoassay and recently immunometric assay for the measurement of drugs, tumour markers and hormones. In general, those techniques without the addition of a label e.g. immunoprecipitation, immunodiffusion and immunoturbidimetry are the older techniques used for the measurement of serum proteins. These techniques are relatively insensitive, measuring at the g/L. level, and in the case of immunodiffusion are generally slow. Automation coupled with the development of chemistries to enhance precipitation has, however, reduced measurement times to minutes in modern laboratories. Nevertheless these methods have detection limits of the order of 1 g/L

Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation

Directory of Open Access Journals (Sweden)

Nakano Toshitsugu

2011-01-01

Full Text Available Abstract Background During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Results Using immunoprecipitated (IPed DNA fragments recovered by chromatin immunoprecipitation (ChIP with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. Conclusions The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes

Organs-on-a-chip: Current applications and consideration points for in vitro ADME-Tox studies.

Science.gov (United States)

Ishida, Seiichi

2018-02-01

Assay systems using in vitro cultured cells are increasingly applied for evaluation of the efficacy, safety, and toxicity of drug candidates. In vitro cell-based assays have two main applications in the drug discovery process: searching for a compound that is effective against the target disease (seed investigation) and confirmation of safety during use of the identified compounds (safety assessment). Currently available in vitro cell-based assays have been designed to evaluate the efficacy and toxicity in single organs, but the in vivo pharmacokinetics and pharmacodynamics of the administered drug candidates have not been considered. Thus, an evaluation system that interconnects cell culture units, one of which has appropriate drug metabolism activities and the other assesses the efficacy and toxicity of compounds, is needed. Accordingly, the in vitro ADME-Tox culture system known as organs-on-a-chip has been proposed. In this review, after introducing the organs-on-a-chip system, the evaluation of enterohepatic circulation and the gut-liver axis relationship will be presented as an example of the application of the organs-on-a-chip system for ADME studies based on inter-organ network. Additionally, the functions required for the organs-on-a-chip system and the necessity of standardization of cells mounted on the chip system will be discussed. Copyright © 2018 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

Automated, Miniaturized and Integrated Quality Control-on-Chip (QC-on-a-Chip for Advanced Cell Therapy Applications

Directory of Open Access Journals (Sweden)

David eWartmann

2015-09-01

Full Text Available The combination of microfabrication-based technologies with cell biology has laid the foundation for the development of advanced in vitro diagnostic systems capable of evaluating cell cultures under defined, reproducible and standardizable measurement conditions. In the present review we describe recent lab-on-a-chip developments for cell analysis and how these methodologies could improve standard quality control in the field of manufacturing cell-based vaccines for clinical purposes. We highlight in particular the regulatory requirements for advanced cell therapy applications using as an example dendritic cell-based cancer vaccines to describe the tangible advantages of microfluidic devices that overcome most of the challenges associated with automation, miniaturization and integration of cell-based assays. As its main advantage lab-on-a-chip technology allows for precise regulation of culturing conditions, while simultaneously monitoring cell relevant parameters using embedded sensory systems. State-of-the-art lab-on-a-chip platforms for in vitro assessment of cell cultures and their potential future applications for cell therapies and cancer immunotherapy are discussed in the present review.

Lab-on-a-chip-based PCR-RFLP assay for the confirmed detection of short-length feline DNA in food.

Science.gov (United States)

Ali, Md Eaqub; Al Amin, Md; Hamid, Sharifah Bee Abd; Hossain, M A Motalib; Mustafa, Shuhaimi

2015-01-01

Wider availability but lack of legal market trades has given feline meat a high potential for use as an adulterant in common meat and meat products. However, mixing of feline meat or its derivatives in food is a sensitive issue, since it is a taboo in most countries and prohibited in certain religions such as Islam and Judaism. Cat meat also has potential for contamination with of severe acute respiratory syndrome, anthrax and hepatitis, and its consumption might lead to an allergic reaction. We developed a very short-amplicon-length (69 bp) PCR assay, authenticated the amplified PCR products by AluI-restriction digestion followed by its separation and detection on a lab-on-a-chip-based automated electrophoretic system, and proved its superiority over the existing long-amplicon-based assays. Although it has been assumed that longer DNA targets are susceptible to breakdown under compromised states, scientific evidence for this hypothesis has been rarely documented. Strong evidence showed that shorter targets are more stable than the longer ones. We confirmed feline-specificity by cross-challenging the primers against 10 different species of terrestrial, aquatic and plant origins in the presence of a 141-bp site of an 18S rRNA gene as a universal eukaryotic control. RFLP analysis separated 43- and 26-bp fragments of AluI-digest in both the gel-image and electropherograms, confirming the original products. The tested detection limit was 0.01% (w/w) feline meat in binary and ternary admixed as well as meatball matrices. Shorter target, better stability and higher sensitivity mean such an assay would be valid for feline identification even in degraded specimens.

An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein

International Nuclear Information System (INIS)

Janaki Ramaiah, M.; Parnaik, Veena K.

2006-01-01

Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif

A protein chip membrane-capture assay for botulinum neurotoxin activity

International Nuclear Information System (INIS)

Marconi, Severine; Ferracci, Geraldine; Berthomieu, Maelys; Kozaki, Shunji; Miquelis, Raymond; Boucraut, Jose; Seagar, Michael

2008-01-01

Botulinum neurotoxins A and B (BoNT/A and B) are neuromuscular blocking agents which inhibit neurotransmission by cleaving the intra-cellular presynaptic SNARE proteins SNAP-25 and VAMP2, localized respectively in plasma membrane and synaptic vesicles. These neurotoxins are both dangerous pathogens and powerful therapeutic agents with numerous clinical and cosmetic applications. Consequently there is a need for in vitro assays of their biological activity to screen for potential inhibitors and to replace the widely used in vivo mouse assay. Surface plasmon resonance (SPR) was used to measure membrane vesicle capture by antibodies against SNAP-25 and VAMP2. Substrate cleavage by BoNTs modified capture providing a method to assay toxin activity. Firstly using synaptic vesicles as a substrate, a comparison of the EC 50 s for BoNT/B obtained by SPR, ELISA or flow cytometry indicated similar sensitivity although SPR assays were more rapid. Sonication of brain or neuronal cultures generated plasma membrane fragments with accessible intra-cellular epitopes adapted to measurement of BoNT/A activity. SPR responses were proportional to antigen concentration permitting detection of as little as 4 pM SNAP-25 in crude lysates. BoNT/A activity was assayed using monoclonal antibodies that specifically recognize a SNAP-25 epitope generated by the proteolytic action of the toxin. Incubation of intact primary cultured neurons with BoNT/A yielded an EC 50 of 0.5 pM. The SPR biosensor method was sensitive enough to monitor BoNT/A and B activity in cells cultured in a 96-well format providing an alternative to experimental animals for toxicological assays

Experimental Design and Methods for Development of Diagnostic Assays for Schistosomiasis Using Monoclonal Antibodies.

Science.gov (United States)

1983-08-25

solium, Echinococcus granulosus , Entamoeba histolytica, or Wucher erTra-bancr--ofti. The S. mansoni glycoproteins that were immunoprecipitated by sera...Sera from patients or experimental animals infected with Schistosoma, Fasciola hepatica, Trichinella spiralis, Taenia solium, Echinococcus ... granulosus , or Paragonimus westermani cross-react in diag-nostic assays with antigens derived from schistosomes, whether as whole organisms (1-4), crude

Rotational microfluidic motor for on-chip microcentrifugation

Science.gov (United States)

Shilton, Richie J.; Glass, Nick R.; Chan, Peggy; Yeo, Leslie Y.; Friend, James R.

2011-06-01

We report on the design of a surface acoustic wave (SAW) driven fluid-coupled micromotor which runs at high rotational velocities. A pair of opposing SAWs generated on a lithium niobate substrate are each obliquely passed into either side of a fluid drop to drive rotation of the fluid, and the thin circular disk set on the drop. Using water for the drop, a 5 mm diameter disk was driven with rotation speeds and start-up torques up to 2250 rpm and 60 nN m, respectively. Most importantly for lab-on-a-chip applications, radial accelerations of 172 m/s2 was obtained, presenting possibilities for microcentrifugation, flow sequencing, assays, and cell culturing in truly microscale lab-on-a-chip devices.

Low-Cost Chemical-Responsive Adhesive Sensing Chips.

Science.gov (United States)

Tan, Weirui; Zhang, Liyuan; Shen, Wei

2017-12-06

Chemical-responsive adhesive sensing chip is a new low-cost analytical platform that uses adhesive tape loaded with indicator reagents to detect or quantify the target analytes by directly sticking the tape to the samples of interest. The chemical-responsive adhesive sensing chips can be used with paper to analyze aqueous samples; they can also be used to detect and quantify solid, particulate, and powder analytes. The colorimetric indicators become immediately visible as the contact between the functionalized adhesives and target samples is made. The chemical-responsive adhesive sensing chip expands the capability of paper-based analytical devices to analyze solid, particulate, or powder materials via one-step operation. It is also a simpler alternative way, to the covalent chemical modification of paper, to eliminate indicator leaching from the dipstick-style paper sensors. Chemical-responsive adhesive chips can display analytical results in the form of colorimetric dot patterns, symbols, and texts, enabling clear understanding of assay results by even nonprofessional users. In this work, we demonstrate the analyses of heavy metal salts in silica powder matrix, heavy metal ions in water, and bovine serum albumin in an aqueous solution. The detection is one-step, specific, sensitive, and easy-to-operate.

Accounting for immunoprecipitation efficiencies in the statistical analysis of ChIP-seq data

NARCIS (Netherlands)

Bao, Yanchun; Vinciotti, Veronica; Wit, Ernst; 't Hoen, Peter A C

2013-01-01

Background: ImmunoPrecipitation (IP) efficiencies may vary largely between different antibodies and between repeated experiments with the same antibody. These differences have a large impact on the quality of ChIP-seq data: a more efficient experiment will necessarily lead to a higher signal to

Quantized correlation coefficient for measuring reproducibility of ChIP-chip data

Directory of Open Access Journals (Sweden)

Kuroda Mitzi I

2010-07-01

Full Text Available Abstract Background Chromatin immunoprecipitation followed by microarray hybridization (ChIP-chip is used to study protein-DNA interactions and histone modifications on a genome-scale. To ensure data quality, these experiments are usually performed in replicates, and a correlation coefficient between replicates is used often to assess reproducibility. However, the correlation coefficient can be misleading because it is affected not only by the reproducibility of the signal but also by the amount of binding signal present in the data. Results We develop the Quantized correlation coefficient (QCC that is much less dependent on the amount of signal. This involves discretization of data into set of quantiles (quantization, a merging procedure to group the background probes, and recalculation of the Pearson correlation coefficient. This procedure reduces the influence of the background noise on the statistic, which then properly focuses more on the reproducibility of the signal. The performance of this procedure is tested in both simulated and real ChIP-chip data. For replicates with different levels of enrichment over background and coverage, we find that QCC reflects reproducibility more accurately and is more robust than the standard Pearson or Spearman correlation coefficients. The quantization and the merging procedure can also suggest a proper quantile threshold for separating signal from background for further analysis. Conclusions To measure reproducibility of ChIP-chip data correctly, a correlation coefficient that is robust to the amount of signal present should be used. QCC is one such measure. The QCC statistic can also be applied in a variety of other contexts for measuring reproducibility, including analysis of array CGH data for DNA copy number and gene expression data.

Quantized correlation coefficient for measuring reproducibility of ChIP-chip data.

Science.gov (United States)

Peng, Shouyong; Kuroda, Mitzi I; Park, Peter J

2010-07-27

Chromatin immunoprecipitation followed by microarray hybridization (ChIP-chip) is used to study protein-DNA interactions and histone modifications on a genome-scale. To ensure data quality, these experiments are usually performed in replicates, and a correlation coefficient between replicates is used often to assess reproducibility. However, the correlation coefficient can be misleading because it is affected not only by the reproducibility of the signal but also by the amount of binding signal present in the data. We develop the Quantized correlation coefficient (QCC) that is much less dependent on the amount of signal. This involves discretization of data into set of quantiles (quantization), a merging procedure to group the background probes, and recalculation of the Pearson correlation coefficient. This procedure reduces the influence of the background noise on the statistic, which then properly focuses more on the reproducibility of the signal. The performance of this procedure is tested in both simulated and real ChIP-chip data. For replicates with different levels of enrichment over background and coverage, we find that QCC reflects reproducibility more accurately and is more robust than the standard Pearson or Spearman correlation coefficients. The quantization and the merging procedure can also suggest a proper quantile threshold for separating signal from background for further analysis. To measure reproducibility of ChIP-chip data correctly, a correlation coefficient that is robust to the amount of signal present should be used. QCC is one such measure. The QCC statistic can also be applied in a variety of other contexts for measuring reproducibility, including analysis of array CGH data for DNA copy number and gene expression data.

On-chip Magnetic Separation and Cell Encapsulation in Droplets

Science.gov (United States)

Chen, A.; Byvank, T.; Bharde, A.; Miller, B. L.; Chalmers, J. J.; Sooryakumar, R.; Chang, W.-J.; Bashir, R.

2012-02-01

The demand for high-throughput single cell assays is gaining importance because of the heterogeneity of many cell suspensions, even after significant initial sorting. These suspensions may display cell-to-cell variability at the gene expression level that could impact single cell functional genomics, cancer, stem-cell research and drug screening. The on-chip monitoring of individual cells in an isolated environment could prevent cross-contamination, provide high recovery yield and ability to study biological traits at a single cell level These advantages of on-chip biological experiments contrast to conventional methods, which require bulk samples that provide only averaged information on cell metabolism. We report on a device that integrates microfluidic technology with a magnetic tweezers array to combine the functionality of separation and encapsulation of objects such as immunomagnetically labeled cells or magnetic beads into pico-liter droplets on the same chip. The ability to control the separation throughput that is independent of the hydrodynamic droplet generation rate allows the encapsulation efficiency to be optimized. The device can potentially be integrated with on-chip labeling and/or bio-detection to become a powerful single-cell analysis device.

Silicon Chip-to-Chip Mode-Division Multiplexing

DEFF Research Database (Denmark)

Baumann, Jan Markus; Porto da Silva, Edson; Ding, Yunhong

2018-01-01

A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes.......A chip-to-chip mode-division multiplexing connection is demonstrated using a pair of multiplexers/demultiplexers fabricated on the silicon-on-insulator platform. Successful mode multiplexing and demultiplexing is experimentally demonstrated, using the LP01, LP11a and LP11b modes....

Genome-Wide Methylated DNA Immunoprecipitation Analysis of Patients with Polycystic Ovary Syndrome

OpenAIRE

Shen, Hao-ran; Qiu, Li-hua; Zhang, Zhi-qing; Qin, Yuan-yuan; Cao, Cong; Di, Wen

2013-01-01

Polycystic ovary syndrome (PCOS) is a complex, heterogeneous disorder of uncertain etiology. Recent studies suggested that insulin resistance (IR) plays an important role in the development of PCOS. In the current study, we aimed to investigate the molecular mechanism of IR in PCOS. We employed genome-wide methylated DNA immunoprecipitation (MeDIP) analysis to characterize genes that are differentially methylated in PCOS patients vs. healthy controls. Besides, we also identified the different...

Flip chip assembly of thinned chips for hybrid pixel detector applications

International Nuclear Information System (INIS)

Fritzsch, T; Zoschke, K; Rothermund, M; Oppermann, H; Woehrmann, M; Ehrmann, O; Lang, K D; Huegging, F

2014-01-01

There is a steady trend to ultra-thin microelectronic devices. Especially for future particle detector systems a reduced readout chip thickness is required to limit the loss of tracking precision due to scattering. The reduction of silicon thickness is performed at wafer level in a two-step thinning process. To minimize the risk of wafer breakage the thinned wafer needs to be handled by a carrier during the whole process chain of wafer bumping. Another key process is the flip chip assembly of thinned readout chips onto thin sensor tiles. Besides the prevention of silicon breakage the minimization of chip warpage is one additional task for a high yield and reliable flip chip process. A new technology using glass carrier wafer will be described in detail. The main advantage of this technology is the combination of a carrier support during wafer processing and the chip support during flip chip assembly. For that a glass wafer is glue-bonded onto the backside of the thinned readout chip wafer. After the bump deposition process the glass-readout chip stack is diced in one step. Finally the glass carrier chip is released by laser illumination after flip chip assembly of the readout chip onto sensor tile. The results of the flip chip assembly process development for the ATLAS IBL upgrade are described more in detail. The new ATLAS FEI4B chip with a size of 20 × 19 mm 2 is flip chip bonded with a thickness of only 150 μm, but the capability of this technology has been demonstrated on hybrid modules with a reduced readout chip thickness of down to 50 μm which is a major step for ultra-thin electronic systems

Dental Stem Cell Migration on Pulp Ceiling Cavities Filled with MTA, Dentin Chips, or Bio-Oss

Directory of Open Access Journals (Sweden)

Stefania Lymperi

2015-01-01

Full Text Available MTA, Bio-Oss, and dentin chips have been successfully used in endodontics. The aim of this study was to assess the adhesion and migration of dental stem cells on human pulp ceiling cavities filled with these endodontic materials in an experimental model, which mimics the clinical conditions of regenerative endodontics. Cavities were formed, by a homemade mold, on untouched third molars, filled with endodontic materials, and observed with electron microscopy. Cells were seeded on cavities’ surface and their morphology and number were analysed. The phenomenon of tropism was assessed in a migration assay. All three materials demonstrated appropriate microstructures for cell attachment. Cells grew on all reagents, but they showed a differential morphology. Moreover, variations were observed when comparing cells numbers on cavity’s filling versus the surrounding dentine disc. The highest number of cells was recorded on dentin chips whereas the opposite was true for Bio-Oss. This was confirmed in the migration assay where a statistically significant lower number of cells migrated towards Bio-Oss as compared to MTA and dentin chips. This study highlights that MTA and dentin chips have a greater potential compared to Bio-Oss regarding the attraction of dental stem cells and are good candidates for bioengineered pulp regeneration.

Lab-on-a-Chip-Based PCR-RFLP Assay for the Detection of Malayan Box Turtle (Cuora amboinensis) in the Food Chain and Traditional Chinese Medicines

Science.gov (United States)

Asing; Ali, Md. Eaqub; Abd Hamid, Sharifah Bee; Hossain, M. A. Motalib; Mustafa, Shuhaimi; Kader, Md. Abdul; Zaidul, I. S. M.

2016-01-01

The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition. PMID:27716792

Lab-on-a-Chip-Based PCR-RFLP Assay for the Detection of Malayan Box Turtle (Cuora amboinensis) in the Food Chain and Traditional Chinese Medicines.

Science.gov (United States)

Asing; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Hossain, M A Motalib; Mustafa, Shuhaimi; Kader, Md Abdul; Zaidul, I S M

2016-01-01

The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition.

A review of digital microfluidics as portable platforms for lab-on a-chip applications.

Science.gov (United States)

Samiei, Ehsan; Tabrizian, Maryam; Hoorfar, Mina

2016-07-07

Following the development of microfluidic systems, there has been a high tendency towards developing lab-on-a-chip devices for biochemical applications. A great deal of effort has been devoted to improve and advance these devices with the goal of performing complete sets of biochemical assays on the device and possibly developing portable platforms for point of care applications. Among the different microfluidic systems used for such a purpose, digital microfluidics (DMF) shows high flexibility and capability of performing multiplex and parallel biochemical operations, and hence, has been considered as a suitable candidate for lab-on-a-chip applications. In this review, we discuss the most recent advances in the DMF platforms, and evaluate the feasibility of developing multifunctional packages for performing complete sets of processes of biochemical assays, particularly for point-of-care applications. The progress in the development of DMF systems is reviewed from eight different aspects, including device fabrication, basic fluidic operations, automation, manipulation of biological samples, advanced operations, detection, biological applications, and finally, packaging and portability of the DMF devices. Success in developing the lab-on-a-chip DMF devices will be concluded based on the advances achieved in each of these aspects.

Use of laminar flow patterning for miniaturised biochemical assays

DEFF Research Database (Denmark)

Regenberg, Birgitte; Krühne, Ulrich; Beyer, M.

2004-01-01

Laminar flow in microfluidic chambers was used to construct low (one dimensional) density arrays suitable for miniaturized biochemical assays. By varying the ratio of flows of two guiding streams flanking a sample stream, precise focusing and positioning of the latter was achieved, and reactive s...... species carried in the sample stream were deposited on functionalized chip surfaces as discrete 50 mm wide lanes. Using different model systems we have confirmed the method's suitability for qualitative screening and quantification tasks in receptor-ligand assays, recording biotin...

Bio-Inspired Microsystem for Robust Genetic Assay Recognition

Directory of Open Access Journals (Sweden)

Jaw-Chyng Lue

2008-01-01

Full Text Available A compact integrated system-on-chip (SoC architecture solution for robust, real-time, and on-site genetic analysis has been proposed. This microsystem solution is noise-tolerable and suitable for analyzing the weak fluorescence patterns from a PCR prepared dual-labeled DNA microchip assay. In the architecture, a preceding VLSI differential logarithm microchip is designed for effectively computing the logarithm of the normalized input fluorescence signals. A posterior VLSI artificial neural network (ANN processor chip is used for analyzing the processed signals from the differential logarithm stage. A single-channel logarithmic circuit was fabricated and characterized. A prototype ANN chip with unsupervised winner-take-all (WTA function was designed, fabricated, and tested. An ANN learning algorithm using a novel sigmoid-logarithmic transfer function based on the supervised backpropagation (BP algorithm is proposed for robustly recognizing low-intensity patterns. Our results show that the trained new ANN can recognize low-fluorescence patterns better than an ANN using the conventional sigmoid function.

A volumetric meter chip for point-of-care quantitative detection of bovine catalase for food safety control.

Science.gov (United States)

Cui, Xingye; Hu, Jie; Choi, Jane Ru; Huang, Yalin; Wang, Xuemin; Lu, Tian Jian; Xu, Feng

2016-09-07

A volumetric meter chip was developed for quantitative point-of-care (POC) analysis of bovine catalase, a bioindicator of bovine mastitis, in milk samples. The meter chip displays multiplexed quantitative results by presenting the distance of ink bar advancement that is detectable by the naked eye. The meter chip comprises a poly(methyl methacrylate) (PMMA) layer, a double-sided adhesive (DSA) layer and a glass slide layer fabricated by the laser-etching method, which is typically simple, rapid (∼3 min per chip), and cost effective (∼$0.2 per chip). Specially designed "U shape" reaction cells are covered by an adhesive tape that serves as an on-off switch, enabling the simple operation of the assay. As a proof of concept, we employed the developed meter chip for the quantification of bovine catalase in raw milk samples to detect catalase concentrations as low as 20 μg/mL. The meter chip has great potential to detect various target analytes for a wide range of POC applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Haploinsufficiency of the E3 ubiquitin ligase C-terminus of heat shock cognate 70 interacting protein (CHIP produces specific behavioral impairments.

Directory of Open Access Journals (Sweden)

Bethann McLaughlin

Full Text Available The multifunctional E3 ubiquitin ligase CHIP is an essential interacting partner of HSP70, which together promote the proteasomal degradation of client proteins. Acute CHIP overexpression provides neuroprotection against neurotoxic mitochondrial stress, glucocorticoids, and accumulation of toxic amyloid fragments, as well as genetic mutations in other E3 ligases, which have been shown to result in familial Parkinson's disease. These studies have created a great deal of interest in understanding CHIP activity, expression and modulation. While CHIP knockout mice have the potential to provide essential insights into the molecular control of cell fate and survival, the animals have been difficult to characterize in vivo due to severe phenotypic and behavioral dysfunction, which have thus far been poorly characterized. Therefore, in the present study we conducted a battery of neurobehavioral and physiological assays of adult CHIP heterozygotic (HET mutant mice to provide a better understanding of the functional consequence of CHIP deficiency. We found that CHIP HET mice had normal body and brain weight, body temperature, muscle tone and breathing patterns, but do have a significant elevation in baseline heart rate. Meanwhile basic behavioral screens of sensory, motor, emotional and cognitive functions were normative. We observed no alterations in performance in the elevated plus maze, light-dark preference and tail suspension assays, or two simple cognitive tasks: novel object recognition and spontaneous alternation in a Y maze. Significant deficits were found, however, when CHIP HET mice performed wire hang, inverted screen, wire maneuver, and open field tasks. Taken together, our data indicate a clear subset of behaviors that are altered at baseline in CHIP deficient animals, which will further guide whole animal studies of the effects of CHIP dysregulation on cardiac function, brain circuitry and function, and responsiveness to environmental and

A label-free, fluorescence based assay for microarray

Science.gov (United States)

Niu, Sanjun

DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same

CCAAT/Enhancer Binding Protein β Regulates Expression of Indian Hedgehog during Chondrocytes Differentiation

Science.gov (United States)

Ushijima, Takahiro; Okazaki, Ken; Tsushima, Hidetoshi; Ishihara, Kohei; Doi, Toshio; Iwamoto, Yukihide

2014-01-01

Background CCAAT/enhancer binding protein β (C/EBPβ) is a transcription factor that promotes hypertrophic differentiation of chondrocytes. Indian hedgehog (Ihh) also stimulates the hypertrophic transition of chondrocytes. Furthermore, runt-related transcription factor-2 (RUNX2) was reported to regulate chondrocyte maturation during skeletal development and to directly regulate transcriptional activity of Ihh. In this study, we investigated whether the interaction of C/EBPβ and RUNX2 regulates the expression of Ihh during chondrocyte differentiation. Methodology/Results Immunohistochemistry of embryonic growth plate revealed that both C/EBPβ and Ihh were strongly expressed in pre-hypertrophic and hypertrophic chondrocytes. Overexpression of C/EBPβ by adenovirus vector in ATDC5 cells caused marked stimulation of Ihh and Runx2. Conversely, knockdown of C/EBPβ by lentivirus expressing shRNA significantly repressed Ihh and Runx2 in ATDC5 cells. A reporter assay revealed that C/EBPβ stimulated transcriptional activity of Ihh. Deletion and mutation analysis showed that the C/EBPβ responsive element was located between −214 and −210 bp in the Ihh promoter. An electrophoretic mobility shift assay (EMSA) and a chromatin immunoprecipitation (ChIP) assay also revealed the direct binding of C/EBPβ to this region. Moreover, reporter assays demonstrated that RUNX2 failed to stimulate the transcriptional activity of the Ihh promoter harboring a mutation at the C/EBPβ binding site. EMSA and ChIP assays showed that RUNX2 interacted to this element with C/EBPβ. Immunoprecipitation revealed that RUNX2 and C/EBPβ formed heterodimer complex with each other in the nuclei of chondrocytes. These data suggested that the C/EBPβ binding element is also important for RUNX2 to regulate the expression of Ihh. Ex vivo organ culture of mouse limbs transfected with C/EBPβ showed that the expression of Ihh and RUNX2 was increased upon ectopic C/EBPβ expression. Conclusions C

CCAAT/enhancer binding protein β regulates expression of Indian hedgehog during chondrocytes differentiation.

Directory of Open Access Journals (Sweden)

Takahiro Ushijima

Full Text Available CCAAT/enhancer binding protein β (C/EBPβ is a transcription factor that promotes hypertrophic differentiation of chondrocytes. Indian hedgehog (Ihh also stimulates the hypertrophic transition of chondrocytes. Furthermore, runt-related transcription factor-2 (RUNX2 was reported to regulate chondrocyte maturation during skeletal development and to directly regulate transcriptional activity of Ihh. In this study, we investigated whether the interaction of C/EBPβ and RUNX2 regulates the expression of Ihh during chondrocyte differentiation.Immunohistochemistry of embryonic growth plate revealed that both C/EBPβ and Ihh were strongly expressed in pre-hypertrophic and hypertrophic chondrocytes. Overexpression of C/EBPβ by adenovirus vector in ATDC5 cells caused marked stimulation of Ihh and Runx2. Conversely, knockdown of C/EBPβ by lentivirus expressing shRNA significantly repressed Ihh and Runx2 in ATDC5 cells. A reporter assay revealed that C/EBPβ stimulated transcriptional activity of Ihh. Deletion and mutation analysis showed that the C/EBPβ responsive element was located between -214 and -210 bp in the Ihh promoter. An electrophoretic mobility shift assay (EMSA and a chromatin immunoprecipitation (ChIP assay also revealed the direct binding of C/EBPβ to this region. Moreover, reporter assays demonstrated that RUNX2 failed to stimulate the transcriptional activity of the Ihh promoter harboring a mutation at the C/EBPβ binding site. EMSA and ChIP assays showed that RUNX2 interacted to this element with C/EBPβ. Immunoprecipitation revealed that RUNX2 and C/EBPβ formed heterodimer complex with each other in the nuclei of chondrocytes. These data suggested that the C/EBPβ binding element is also important for RUNX2 to regulate the expression of Ihh. Ex vivo organ culture of mouse limbs transfected with C/EBPβ showed that the expression of Ihh and RUNX2 was increased upon ectopic C/EBPβ expression.C/EBPβ and RUNX2 cooperatively stimulate

An optimized protocol for isolating primary epithelial cell chromatin for ChIP.

Directory of Open Access Journals (Sweden)

James A Browne

Full Text Available A critical part of generating robust chromatin immunoprecipitation (ChIP data is the optimization of chromatin purification and size selection. This is particularly important when ChIP is combined with next-generation sequencing (ChIP-seq to identify targets of DNA-binding proteins, genome-wide. Current protocols refined by the ENCODE consortium generally use a two-step cell lysis procedure that is applicable to a wide variety of cell types. However, the isolation and size selection of chromatin from primary human epithelial cells may often be particularly challenging. These cells tend to form sheets of formaldehyde cross-linked material in which cells are resistant to membrane lysis, nuclei are not released and subsequent sonication produces extensive high molecular weight contamination. Here we describe an optimized protocol to prepare high quality ChIP-grade chromatin from primary human bronchial epithelial cells. The ENCODE protocol was used as a starting point to which we added the following key steps to separate the sheets of formaldehyde-fixed cells prior to lysis. (1 Incubation of the formaldehyde-fixed adherent cells in Trypsin-EDTA (0.25% room temperature for no longer than 5 min. (2 Equilibration of the fixed cells in detergent-free lysis buffers prior to each lysis step. (3 The addition of 0.5% Triton X-100 to the complete cell membrane lysis buffer. (4 Passing the cell suspension (in complete cell membrane lysis buffer through a 25-gauge needle followed by continuous agitation on ice for 35 min. Each step of the modified protocol was documented by light microscopy using the Methyl Green-Pyronin dual dye, which stains cytoplasm red (Pyronin and the nuclei grey-blue (Methyl green. This modified method is reproducibly effective at producing high quality sheared chromatin for ChIP and is equally applicable to other epithelial cell types.

Investigating Potential Toxicity of Leachate from Wood Chip Piles Generated by Roadside Biomass Operations

Directory of Open Access Journals (Sweden)

John Rex

2016-02-01

Full Text Available Roadside processing of wood biomass leaves chip piles of varying size depending upon whether they were created for temporary storage, spillage, or equipment maintenance. Wood chips left in these piles can generate leachate that contaminates streams when processing sites are connected to waterways. Leachate toxicity and chemistry were assessed for pure aspen (Populus tremuloides Michx., lodgepole pine (Pinus contorta Dougl., hybrid white spruce (Picea engelmannii x glauca Parry, and black spruce (Picea mariana (Mill. Britton as well as from two wood chipping sites using mixes of lodgepole pine and hybrid or black spruce. Leachate was generated using rainfall simulation, a static 28-day laboratory assay, and a field-based exposure. Leachate generated by these exposures was analyzed for organic matter content, phenols, ammonia, pH, and toxicity. Findings indicate that all wood chip types produced a toxic leachate despite differences in their chemistry. The consistent toxicity response highlights the need for runoff management that will disconnect processing sites from aquatic environments.

Flip chip assembly of thinned chips for hybrid pixel detector applications

CERN Document Server

Fritzsch, T; Woehrmann, M; Rothermund, M; Huegging, F; Ehrmann, O; Oppermann, H; Lang, K.D

2014-01-01

There is a steady trend to ultra-thin microelectronic devices. Especially for future particle detector systems a reduced readout chip thickness is required to limit the loss of tracking precision due to scattering. The reduction of silicon thickness is performed at wafer level in a two-step thinning process. To minimize the risk of wafer breakage the thinned wafer needs to be handled by a carrier during the whole process chain of wafer bumping. Another key process is the flip chip assembly of thinned readout chips onto thin sensor tiles. Besides the prevention of silicon breakage the minimization of chip warpage is one additional task for a high yield and reliable flip chip process. A new technology using glass carrier wafer will be described in detail. The main advantage of this technology is the combination of a carrier support during wafer processing and the chip support during flip chip assembly. For that a glass wafer is glue-bonded onto the backside of the thinned readout chip wafer. After the bump depo...

A volumetric meter chip for point-of-care quantitative detection of bovine catalase for food safety control

International Nuclear Information System (INIS)

Cui, Xingye; Hu, Jie; Choi, Jane Ru; Huang, Yalin; Wang, Xuemin; Lu, Tian Jian; Xu, Feng

2016-01-01

A volumetric meter chip was developed for quantitative point-of-care (POC) analysis of bovine catalase, a bioindicator of bovine mastitis, in milk samples. The meter chip displays multiplexed quantitative results by presenting the distance of ink bar advancement that is detectable by the naked eye. The meter chip comprises a poly(methyl methacrylate) (PMMA) layer, a double-sided adhesive (DSA) layer and a glass slide layer fabricated by the laser-etching method, which is typically simple, rapid (∼3 min per chip), and cost effective (∼$0.2 per chip). Specially designed “U shape” reaction cells are covered by an adhesive tape that serves as an on-off switch, enabling the simple operation of the assay. As a proof of concept, we employed the developed meter chip for the quantification of bovine catalase in raw milk samples to detect catalase concentrations as low as 20 μg/mL. The meter chip has great potential to detect various target analytes for a wide range of POC applications. - Highlights: • The meter chip is a standalone point-of-care diagnostic tool with visible readouts of quantification results. • A fast and low cost fabrication protocol (~3 min and ~$0.2 per chip) of meter chip was proposed. • The chip may hold the potential for rapid scaning of bovine mastitis in cattle farms for food safety control.

A volumetric meter chip for point-of-care quantitative detection of bovine catalase for food safety control

Energy Technology Data Exchange (ETDEWEB)

Cui, Xingye; Hu, Jie; Choi, Jane Ru; Huang, Yalin; Wang, Xuemin [The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology, Xi' an Jiaotong University, Xi' an, 710049 (China); Bioinspired Engineering and Biomechanics Center (BEBC), Xi' an Jiaotong University, Xi' an, 710049 (China); Lu, Tian Jian, E-mail: tjlu@mail.xjtu.edu.cn [Bioinspired Engineering and Biomechanics Center (BEBC), Xi' an Jiaotong University, Xi' an, 710049 (China); Xu, Feng, E-mail: fengxu@mail.xjtu.edu.cn [The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology, Xi' an Jiaotong University, Xi' an, 710049 (China); Bioinspired Engineering and Biomechanics Center (BEBC), Xi' an Jiaotong University, Xi' an, 710049 (China)

2016-09-07

A volumetric meter chip was developed for quantitative point-of-care (POC) analysis of bovine catalase, a bioindicator of bovine mastitis, in milk samples. The meter chip displays multiplexed quantitative results by presenting the distance of ink bar advancement that is detectable by the naked eye. The meter chip comprises a poly(methyl methacrylate) (PMMA) layer, a double-sided adhesive (DSA) layer and a glass slide layer fabricated by the laser-etching method, which is typically simple, rapid (∼3 min per chip), and cost effective (∼$0.2 per chip). Specially designed “U shape” reaction cells are covered by an adhesive tape that serves as an on-off switch, enabling the simple operation of the assay. As a proof of concept, we employed the developed meter chip for the quantification of bovine catalase in raw milk samples to detect catalase concentrations as low as 20 μg/mL. The meter chip has great potential to detect various target analytes for a wide range of POC applications. - Highlights: • The meter chip is a standalone point-of-care diagnostic tool with visible readouts of quantification results. • A fast and low cost fabrication protocol (~3 min and ~$0.2 per chip) of meter chip was proposed. • The chip may hold the potential for rapid scaning of bovine mastitis in cattle farms for food safety control.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

PEA3activates CXCL12transcription in MCF-7breast cancer cells%PEA3 activates CXCL12 transcription in MCF-7 breast cancer cells

Institute of Scientific and Technical Information of China (English)

CHEN Li; CHEN Bo-bin; LI Jun-jie; JIN Wei; SHAO Zhi-min

2011-01-01

Objective To explore the activity of PEA3 ( polyomavirus enhancer activator 3 ) on CXCL12 (Chemokine CXC motif ligand 12) transcription and to reveal the role of PEA3 involved in CXCL12-mediated metastasis and angiogenesis in breast cancer. Methods Methods such as cell transfection, ChIP assay (chromatin immunoprecipitation ), and siRNA (small interfering RNA) were applied to demonstrate and confirm the interaction between PEA3 and CXCL12. Results Over-expression of PEA3 could increase the CXCL12 mRNA level and the CXCL12 promoter activity in human MCF-7 breast cancer cells. ChIP assay demonstrated that PEA3 could bind to the CXCL12 promoter in the cells transfected with PEA3 expression vector. PEA3 siRNA decreased CXCL12 promoter activity and the binding of PEA3 to the CXCL12 promoter in MCF-7 cells. Conclusions PEA3 could activate CXCL12 promoter transcription. It may be a potential mechanism of tumor angiogenesis and metastasis regarding of PEA3 and CXCL12.

Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene

International Nuclear Information System (INIS)

Kaneoka, Hidenori; Miyake, Katsuhide; Iijima, Shinji

2009-01-01

The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIP assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.

Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene

Energy Technology Data Exchange (ETDEWEB)

Kaneoka, Hidenori [Department of Biotechnology, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Miyake, Katsuhide, E-mail: miyake@nubio.nagoya-u.ac.jp [Department of Biotechnology, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Iijima, Shinji [Department of Biotechnology, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan)

2009-10-02

The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIP assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.

On-chip concentration of bacteria using a 3D dielectrophoretic chip and subsequent laser-based DNA extraction in the same chip

International Nuclear Information System (INIS)

Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun

2010-01-01

We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.

Development of a high-throughput Candida albicans biofilm chip.

Directory of Open Access Journals (Sweden)

Anand Srinivasan

2011-04-01

Full Text Available We have developed a high-density microarray platform consisting of nano-biofilms of Candida albicans. A robotic microarrayer was used to print yeast cells of C. albicans encapsulated in a collagen matrix at a volume as low as 50 nL onto surface-modified microscope slides. Upon incubation, the cells grow into fully formed "nano-biofilms". The morphological and architectural complexity of these biofilms were evaluated by scanning electron and confocal scanning laser microscopy. The extent of biofilm formation was determined using a microarray scanner from changes in fluorescence intensities due to FUN 1 metabolic processing. This staining technique was also adapted for antifungal susceptibility testing, which demonstrated that, similar to regular biofilms, cells within the on-chip biofilms displayed elevated levels of resistance against antifungal agents (fluconazole and amphotericin B. Thus, results from structural analyses and antifungal susceptibility testing indicated that despite miniaturization, these biofilms display the typical phenotypic properties associated with the biofilm mode of growth. In its final format, the C. albicans biofilm chip (CaBChip is composed of 768 equivalent and spatially distinct nano-biofilms on a single slide; multiple chips can be printed and processed simultaneously. Compared to current methods for the formation of microbial biofilms, namely the 96-well microtiter plate model, this fungal biofilm chip has advantages in terms of miniaturization and automation, which combine to cut reagent use and analysis time, minimize labor intensive steps, and dramatically reduce assay costs. Such a chip should accelerate the antifungal drug discovery process by enabling rapid, convenient and inexpensive screening of hundreds-to-thousands of compounds simultaneously.

Chips 2020

CERN Document Server

2016-01-01

The release of this second volume of CHIPS 2020 coincides with the 50th anniversary of Moore’s Law, a critical year marked by the end of the nanometer roadmap and by a significantly reduced annual rise in chip performance. At the same time, we are witnessing a data explosion in the Internet, which is consuming 40% more electrical power every year, leading to fears of a major blackout of the Internet by 2020. The messages of the first CHIPS 2020, published in 2012, concerned the realization of quantum steps for improving the energy efficiency of all chip functions. With this second volume, we review these messages and amplify upon the most promising directions: ultra-low-voltage electronics, nanoscale monolithic 3D integration, relevant-data, brain- and human-vision-inspired processing, and energy harvesting for chip autonomy. The team of authors, enlarged by more world leaders in low-power, monolithic 3D, video, and Silicon brains, presents new vistas in nanoelectronics, promising  Moore-like exponential g...

On-chip real-time single-copy polymerase chain reaction in picoliter droplets

Energy Technology Data Exchange (ETDEWEB)

Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

2007-04-20

The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

Luminescent Immunoprecipitation System (LIPS) for Detection of Autoantibodies Against ATP4A and ATP4B Subunits of Gastric Proton Pump H+,K+-ATPase in Atrophic Body Gastritis Patients

Science.gov (United States)

Lahner, Edith; Brigatti, Cristina; Marzinotto, Ilaria; Carabotti, Marilia; Scalese, Giulia; Davidson, Howard W; Wenzlau, Janet M; Bosi, Emanuele; Piemonti, Lorenzo; Annibale, Bruno; Lampasona, Vito

2017-01-01

Objectives: Circulating autoantibodies targeting the H+/K+-ATPase proton pump of gastric parietal cells are considered markers of autoimmune gastritis, whose diagnostic accuracy in atrophic body gastritis, the pathological lesion of autoimmune gastritis, remains unknown. This study aimed to assess autoantibodies against ATP4A and ATP4B subunits of parietal cells H+, K+-ATPase in atrophic body gastritis patients and controls. Methods: One-hundred and four cases with atrophic body gastritis and 205 controls were assessed for serological autoantibodies specific for ATP4A or ATP4B subunits using luminescent immunoprecipitation system (LIPS). Recombinant luciferase-reporter-fused-antigens were expressed by in vitro transcription-translation (ATP4A) or after transfection in Expi293F cells (ATP4B), incubated with test sera, and immune complexes recovered using protein-A-sepharose. LIPS assays were compared with a commercial enzyme immunoassay (EIA) for parietal cell autoantibodies. Results: ATP4A and ATP4B autoantibody titers were higher in cases compared to controls (Pgastritis. Both assays had the highest sensitivity, at the cost of diagnostic accuracy (89 and 90% specificity), outperforming traditional EIA. Once validated, these LIPS assays should be valuable screening tools for detecting biomarkers of damaged atrophic oxyntic mucosa. PMID:28102858

Price of forest chips decreasing

International Nuclear Information System (INIS)

Hakkila, P.

2001-01-01

Use of forest chips was studied in 1999 in the national Puuenergia (Wood Energy) research program. Wood combusting heating plants were questioned about are the main reasons restricting the increment of the use of forest chips. Heating plants, which did not use forest chips at all or which used less than 250 m 3 (625 bulk- m 3 ) in 1999 were excluded. The main restrictions for additional use of forest chips were: too high price of forest chips; lack of suppliers and/or uncertainty of deliveries; technical problems of reception and processing of forest chips; insufficiency of boiler output especially in winter; and unsatisfactory quality of chips. The price of forest chips becomes relatively high because wood biomass used for production of forest chips has to be collected from wide area. Heavy equipment has to be used even though small fragments of wood are processed, which increases the price of chips. It is essential for forest chips that the costs can be pressed down because competition with fossil fuels, peat and industrial wood residues is hard. Low market price leads to the situation in which forest owner gets no price of the raw material, the entrepreneurs operate at the limit of profitability and renovation of machinery is difficult, and forest chips suppliers have to sell the chips at prime costs. Price of forest chips has decreased significantly during the past decade. Nominal price of forest chips is now lower than two decades ago. The real price of chips has decreased even more than the nominal price, 35% during the past decade and 20% during the last five years. Chips, made of small diameter wood, are expensive because the price includes the felling costs and harvesting is carried out at thinning lots. Price is especially high if chips are made of delimbed small diameter wood due to increased the work and reduced amount of chips. The price of logging residue chips is most profitable because cutting does not cause additional costs. Recovery of chips is

Lab-on-a-Chip Device for Rapid Measurement of Vitamin D Levels.

Science.gov (United States)

Peter, Harald; Bistolas, Nikitas; Schumacher, Soeren; Laurisch, Cecilia; Guest, Paul C; Höller, Ulrich; Bier, Frank F

2018-01-01

Lab-on-a-chip assays allow rapid analysis of one or more molecular analytes on an automated user-friendly platform. Here we describe a fully automated assay and readout for measurement of vitamin D levels in less than 15 min using the Fraunhofer in vitro diagnostics platform. Vitamin D (25-hydroxyvitamin D 3 [25(OH)D 3 ]) dilution series in buffer were successfully tested down to 2 ng/mL. This could be applied in the future as an inexpensive point-of-care analysis for patients suffering from a variety of conditions marked by vitamin D deficiencies.

STUDY OF CHIP IGNITION AND CHIP MORPHOLOGY AFTER MILLING OF MAGNESIUM ALLOYS

Directory of Open Access Journals (Sweden)

Ireneusz Zagórski

2016-12-01

Full Text Available The paper analyses the impact of specified technological parameters of milling (vc, fz, ap on time to ignition. Stages leading to chip ignition were analysed. Metallographic images of magnesium chip were presented. No significant difference was observed in time to ignition in different chip fractions. Moreover, the surface of chips was free of products of ignition and signs of strong oxidation.

Feasibility assessment of Micro electrode chip assay (MEA as a method of detecting neurotoxicity in vitro

Directory of Open Access Journals (Sweden)

Enrico eDefranchi

2011-04-01

Full Text Available Detection and characterization of chemically-induced toxic effects in the nervous system represent a challenge for the hazard assessment of chemicals. In vivo, neurotoxicological assessments exploit the fact that the activity of neurons in the central and peripheral nervous system has functional consequences. And so far, no in vitro method for evaluating the neurotoxic hazard has yet been validated and accepted for regulatory purpose.The microelectrode array (MEA assay consists of a culture chamber into which an integrated array of microelectrodes is capable of measuring extracellular electrophysiology (spikes and bursts from electro-active tissues. A wide variety of electrically excitable biological tissues may be placed onto the chips including primary cultures of nervous system tissue. Recordings from this type of in vitro cultured system are non invasive, give label free evaluations and provide a higher throughput than conventional electrophysiological techniques. In this paper, twenty substances were tested in a blinded study for their toxicity and dose-response curves were obtained from foetal rat cortical neuronal networks coupled to MEAs. The experimental procedure consisted of evaluating the firing activity (spiking rate and modification/reduction in response to chemical administration. Native/reference activity, 30 minutes of activity recording per dilution, plus the recovery points (after 24 hours were recorded. The preliminary data, using a set of chemicals with different mode-of-actions (13 known to be neurotoxic, 2 non-neuroactive and not toxic and 5 non-neuroactive but toxic show good predictivity (sensitivity: 0.77; specificity: 0.86; accuracy: 0.85. Thus, the MEA with a neuronal network has the potency to become an effective tool to evaluate the neurotoxicity of substances in vitro.

The Advances, Challenges and Future Possibilities of Millimeter-Wave Chip-to-Chip Interconnections for Multi-Chip Systems

Directory of Open Access Journals (Sweden)

Amlan Ganguly

2018-02-01

Full Text Available With aggressive scaling of device geometries, density of manufacturing faults is expected to increase. Therefore, yield of complex Multi-Processor Systems-on-Chips (MP-SoCs will decrease due to higher probability of manufacturing defects especially, in dies with large area. Therefore, disintegration of large SoCs into smaller chips called chiplets will improve yield and cost of complex platform-based systems. This will also provide functional flexibility, modular scalability as well as the capability to integrate heterogeneous architectures and technologies in a single unit. However, with scaling of the number of chiplets in such a system, the shared resources in the system such as the interconnection fabric and memory modules will become performance bottlenecks. Additionally, the integration of heterogeneous chiplets operating at different frequencies and voltages can be challenging. State-of-the-art inter-chip communication requires power-hungry high-speed I/O circuits and data transfer over long wired traces on substrates. This increases energy consumption and latency while decreasing data bandwidth for chip-to-chip communication. In this paper, we explore the advances and the challenges of interconnecting a multi-chip system with millimeter-wave (mm-wave wireless interconnects from a variety of perspectives spanning multiple aspects of the wireless interconnection design. Our discussion on the recent advances include aspects such as interconnection topology, physical layer, Medium Access Control (MAC and routing protocols. We also present some potential paradigm-shifting applications as well as complementary technologies of wireless inter-chip communications.

Extraction, amplification and detection of DNA in microfluidic chip-based assays

KAUST Repository

Wu, Jinbo; Kodzius, Rimantas; Cao, Wenbin; Wen, Weijia

2013-01-01

comparison between conventional and microfluidic schemes. In order to accomplish these essential assays without human intervention between individual steps, the micro-components for fluid manipulation become critical. We therefore summarize and discuss

Organ/body-on-a-chip based on microfluidic technology for drug discovery.

Science.gov (United States)

Kimura, Hiroshi; Sakai, Yasuyuki; Fujii, Teruo

2018-02-01

Although animal experiments are indispensable for preclinical screening in the drug discovery process, various issues such as ethical considerations and species differences remain. To solve these issues, cell-based assays using human-derived cells have been actively pursued. However, it remains difficult to accurately predict drug efficacy, toxicity, and organs interactions, because cultivated cells often do not retain their original organ functions and morphologies in conventional in vitro cell culture systems. In the μTAS research field, which is a part of biochemical engineering, the technologies of organ-on-a-chip, based on microfluidic devices built using microfabrication, have been widely studied recently as a novel in vitro organ model. Since it is possible to physically and chemically mimic the in vitro environment by using microfluidic device technology, maintenance of cellular function and morphology, and replication of organ interactions can be realized using organ-on-a-chip devices. So far, functions of various organs and tissues, such as the lung, liver, kidney, and gut have been reproduced as in vitro models. Furthermore, a body-on-a-chip, integrating multi organ functions on a microfluidic device, has also been proposed for prediction of organ interactions. We herein provide a background of microfluidic systems, organ-on-a-chip, Body-on-a-chip technologies, and their challenges in the future. Copyright © 2017 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

A nanofluidic bioarray chip for fast and high-throughput detection of antibodies in biological fluids

Science.gov (United States)

Lee, Jonathan; Gulzar, Naveed; Scott, Jamie K.; Li, Paul C. H.

2012-10-01

Immunoassays have become a standard in secretome analysis in clinical and research analysis. In this field there is a need for a high throughput method that uses low sample volumes. Microfluidics and nanofluidics have been developed for this purpose. Our lab has developed a nanofluidic bioarray (NBA) chip with the goal being a high throughput system that assays low sample volumes against multiple probes. A combination of horizontal and vertical channels are produced to create an array antigens on the surface of the NBA chip in one dimension that is probed by flowing in the other dimension antibodies from biological fluids. We have tested the NBA chip by immobilizing streptavidin and then biotinylated peptide to detect the presence of a mouse monoclonal antibody (MAb) that is specific for the peptide. Bound antibody is detected by an AlexaFluor 647 labeled goat (anti-mouse IgG) polyclonal antibody. Using the NBA chip, we have successfully detected peptide binding by small-volume (0.5 μl) samples containing 50 attomoles (100 pM) MAb.

Red cell autoantibodies characterized by competitive inhibition of iodine 125 Rh alloantibody binding and by immunoprecipitation of membrane proteins

International Nuclear Information System (INIS)

Pierce, S.W.; Victoria, E.J.; Masouredis, S.P.

1990-01-01

The relationship between determinants recognized by warm-type immunoglobulin G red cell autoantibodies and the Rh antigens was characterized by autoantibody competitive inhibition of iodine 125 Rh alloantibody binding and autoantibody immunoprecipitation of iodine 125 red blood cell membrane proteins. The majority of blood donor autoantibody recognized epitopes that are closely related to Rh antigens as determined by competitive inhibition studies. Eighteen of 20 (90%) autoantibodies inhibited anti-Rh(c) binding, 15 inhibited anti-Rh(E), 5 inhibited anti-Rh(D), and only 2 failed to inhibit any of the three Rh alloantibodies tested. Autoantibodies that inhibited anti-Rh(D) also inhibited anti-Rh(c) and anti-Rh(E) and all those that inhibited anti-Rh(E) also inhibited anti-Rh(c). Autoantibodies that inhibited all three Rh alloantibodies immunoprecipitated 30 kd membrane polypeptides, as did two of the three autoantibodies that inhibited only anti-Rh(c) and anti-Rh(E). One autoantibody in this group and two autoantibodies that inhibited only anti-Rh(c), as well as an autoantibody that did not inhibit any of the Rh alloantibodies, immunoprecipitated only a single membrane polypeptide identified as band 3. The majority of normal donor red blood cell autoantibodies inhibited the binding of Rh alloantibodies, which indicates that they either bound to the Rh polypeptides or to epitopes on band 3 that were closely associated with the Rh complex

Chip-to-Chip Half Duplex Spiking Data Communication over Power Supply Rails

Science.gov (United States)

Hashida, Takushi; Nagata, Makoto

Chip-to-chip serial data communication is superposed on power supply over common Vdd/Vss connections through chip, package, and board traces. A power line transceiver demonstrates half duplex spiking communication at more than 100Mbps. A pair of transceivers consumes 1.35mA from 3.3V, at 130Mbps. On-chip power line LC low pass filter attenuates pseudo-differential communication spikes by 30dB, purifying power supply current for internal circuits. Bi-directional spiking communication was successfully examined in a 90-nm CMOS prototype setup of on-chip waveform capturing. A micro controller forwards clock pulses to and receives data streams from a comparator based waveform capturer formed on a different chip, through a single pair of power and ground traces. The bit error rate is small enough not to degrade waveform acquisition capability, maintaining the spurious free dynamic range of higher than 50dB.

Combining ChIP-chip and expression profiling to model the MoCRZ1 mediated circuit for Ca/calcineurin signaling in the rice blast fungus.

Directory of Open Access Journals (Sweden)

Soonok Kim

2010-05-01

Full Text Available Significant progress has been made in defining the central signaling networks in many organisms, but collectively we know little about the downstream targets of these networks and the genes they regulate. To reconstruct the regulatory circuit of calcineurin signal transduction via MoCRZ1, a Magnaporthe oryzae C2H2 transcription factor activated by calcineurin dephosphorylation, we used a combined approach of chromatin immunoprecipitation - chip (ChIP-chip, coupled with microarray expression studies. One hundred forty genes were identified as being both a direct target of MoCRZ1 and having expression concurrently differentially regulated in a calcium/calcineurin/MoCRZ1 dependent manner. Highly represented were genes involved in calcium signaling, small molecule transport, ion homeostasis, cell wall synthesis/maintenance, and fungal virulence. Of particular note, genes involved in vesicle mediated secretion necessary for establishing host associations, were also found. MoCRZ1 itself was a target, suggesting a previously unreported autoregulation control point. The data also implicated a previously unreported feedback regulation mechanism of calcineurin activity. We propose that calcium/calcineurin regulated signal transduction circuits controlling development and pathogenicity manifest through multiple layers of regulation. We present results from the ChIP-chip and expression analysis along with a refined model of calcium/calcineurin signaling in this important plant pathogen.

IFSA: a microfluidic chip-platform for frit-based immunoassay protocols

Science.gov (United States)

Hlawatsch, Nadine; Bangert, Michael; Miethe, Peter; Becker, Holger; Gärtner, Claudia

2013-03-01

Point-of-care diagnostics (POC) is one of the key application fields for lab-on-a-chip devices. While in recent years much of the work has concentrated on integrating complex molecular diagnostic assays onto a microfluidic device, there is a need to also put comparatively simple immunoassay-type protocols on a microfluidic platform. In this paper, we present the development of a microfluidic cartridge using an immunofiltration approach. In this method, the sandwich immunoassay takes place in a porous frit on which the antibodies have immobilized. The device is designed to be able to handle three samples in parallel and up to four analytical targets per sample. In order to meet the critical cost targets for the diagnostic market, the microfluidic chip has been designed and manufactured using high-volume manufacturing technologies in mind. Validation experiments show comparable sensitivities in comparison with conventional immunofiltration kits.

A proposed holistic approach to on-chip, off-chip, test, and package interconnections

Science.gov (United States)

Bartelink, Dirk J.

1998-11-01

The term interconnection has traditionally implied a `robust' connection from a transistor or a group of transistors in an IC to the outside world, usually a PC board. Optimum system utilization is done from outside the IC. As an alternative, this paper addresses `unimpeded' transistor-to-transistor interconnection aimed at reaching the high circuit densities and computational capabilities of neighboring IC's. In this view, interconnections are not made to some human-centric place outside the IC world requiring robustness—except for system input and output connections. This unimpeded interconnect style is currently available only through intra-chip signal traces in `system-on-a-chip' implementations, as exemplified by embedded DRAMs. Because the traditional off-chip penalty in performance and wiring density is so large, a merging of complex process technologies is the only option today. It is suggested that, for system integration to move forward, the traditional robustness requirement inherited from conventional packaging interconnect and IC manufacturing test must be discarded. Traditional system assembly from vendor parts requires robustness under shipping, inspection and assembly. The trend toward systems on a chip signifies willingness by semiconductor companies to design and fabricate whole systems in house, so that `in-house' chip-to-chip assembly is not beyond reach. In this scenario, bare chips never leave the controlled environment of the IC fabricator while the two major contributors to off-chip signal penalty, ESD protection and the need to source a 50-ohm test head, are avoided. With in-house assembly, ESD protection can be eliminated with the precautions already familiar in plasma etching. Test interconnection impacts the fundamentals of IC manufacturing, particularly with clock speeds approaching 1GHz, and cannot be an afterthought. It should be an integral part of the chip-to-chip interconnection bandwidth optimization, because—as we must

A scalable single-chip multi-processor architecture with on-chip RTOS kernel

NARCIS (Netherlands)

Theelen, B.D.; Verschueren, A.C.; Reyes Suarez, V.V.; Stevens, M.P.J.; Nunez, A.

2003-01-01

Now that system-on-chip technology is emerging, single-chip multi-processors are becoming feasible. A key problem of designing such systems is the complexity of their on-chip interconnects and memory architecture. It is furthermore unclear at what level software should be integrated. An example of a

A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

DEFF Research Database (Denmark)

Sun, Yi; Phuoc Long, Truong; Wolff, Anders

2016-01-01

Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

A New Serum Biomarker for Lung Cancer - Transthyretin

Directory of Open Access Journals (Sweden)

Liyun LIU

2009-04-01

Full Text Available Background and objective Lung cancer is the leading cause of cancer death worldwide and very few specific biomarkers could be used in clinical diagnosis at present. The aim of this study is to find novel potential serum biomarkers for lung cancer using Surface Enhanced Laser Desorption/Ionization (SELDI technique. Methods Serumsample of 227 cases including 146 lung cancer, 13 pneumonia, 28 tuberculous pleurisy and 40 normal individuals were analyzed by CM10 chips. The candidate biomarkers were identified by ESI/MS-MS and database searching, and further confirmed by immunoprecipitation. The same sets of serum sample from all groups were re-measured by ELISA assay. Results Three protein peaks with the molecular weight 13.78 kDa, 13.90 kDa and 14.07 kDa were found significantlydecreased in lung cancer serum compared to the other groups and were all automatically selected as specific biomarkers by Biomarker Wizard software. The candidate biomarkers obtained from 1-D SDS gel bands by matching the molecular weight with peaks on CM10 chips were identified by Mass spectrometry as the native transthyretin (nativeTTR, cysTTR and glutTTR, and the identity was further validated by immunoprecipitation using commercial TTR antibodies. Downregulated of TTR was found in both ELISA and SELDI analysis. Conclusion TTRs acted as the potentially useful biomarkers for lung cancer by SELDI technique.

Chip compacting press; Jido kirikuzu asshukuki

Energy Technology Data Exchange (ETDEWEB)

Oura, K. [Yuken Kogyo Co. Ltd., Kanagawa (Japan)

1998-08-15

The chips exhausted from various machine tools are massy, occupy much space and make working environment worse by staying added cutting oil to lower part. The chips are exhausted as a result of machining and have not constant quality. Even if used material is same the chips have various shapes and properties by kinds and machining methods of used machine tools, and are troublesome materials from a standpoint of their treatment. Pressing and solidification of the chips have frequently been tried. A chip compacting press introduced in this paper, a relatively cheap chip compacting press aimed for relatively small scale chip treatment, and has such characteristics and effects as follows. Chips are pressed and solidified by each raw material, so fractional management can be easily conducted. As casting metal chips and curled chips of iron and aluminum can be pressed to about 1/3 to 1/5 and about 1/40, respectively, space saving can be conducted. Chip compacting pressing upgrades its transporting efficiency to make possible to reduce its transporting cost. As chip solidification controls its oxidation and most cutting oil are removed, chips are easy to recycle. 2 figs., 1 tab.

On-chip nanofluidic integration of acoustic sensors towards high Q in liquid

Science.gov (United States)

Liang, Ji; Liu, Zifeng; Zhang, Hongxiang; Liu, Bohua; Zhang, Menglun; Zhang, Hao; Pang, Wei

2017-11-01

This paper reports an on-chip acoustic sensor comprising a piston-mode film bulk acoustic resonator and a monolithically integrated nanochannel. The resonator with the channel exhibits a resonance frequency (f) of 2.5 GHz and a quality (Q) factor of 436 in deionized water. The f × Q product is as high as 1.1 × 1012, which is the highest among all the acoustic wave sensors in the liquid phase. The sensor consumes 2 pl liquid volume and thus greatly saves the precious assays in biomedical testing. The Q factor is investigated, and real-time viscosity tests of glucose solution are demonstrated. The highly miniaturized and integrated sensor is capable to be arrayed with readout-circuitry, which opens an avenue for portable applications and lab-on-chip systems.

Hybrid macro-micro fluidics system for a chip-based biosensor

Science.gov (United States)

Tamanaha, C. R.; Whitman, L. J.; Colton, R. J.

2002-03-01

We describe the engineering of a hybrid fluidics platform for a chip-based biosensor system that combines high-performance microfluidics components with powerful, yet compact, millimeter-scale pump and valve actuators. The microfluidics system includes channels, valveless diffuser-based pumps, and pinch-valves that are cast into a poly(dimethylsiloxane) (PDMS) membrane and packaged along with the sensor chip into a palm-sized plastic cartridge. The microfluidics are driven by pump and valve actuators contained in an external unit (with a volume ~30 cm3) that interfaces kinematically with the PDMS microelements on the cartridge. The pump actuator is a simple-lever, flexure-hinge displacement amplifier that increases the motion of a piezoelectric stack. The valve actuators are an array of cantilevers operated by shape memory alloy wires. All components can be fabricated without the need for complex lithography or micromachining, and can be used with fluids containing micron-sized particulates. Prototypes have been modeled and tested to ensure the delivery of microliter volumes of fluid and the even dispersion of reagents over the chip sensing elements. With this hybrid approach to the fluidics system, the biochemical assay benefits from the many advantages of microfluidics yet we avoid the complexity and unknown reliability of immature microactuator technologies.

Sequential chromatin immunoprecipitation to detect SUMOylated MeCP2 in neurons

Directory of Open Access Journals (Sweden)

Tao Wu

2016-03-01

Full Text Available The small ubiquitin-like modifier (SUMO is a short peptide that can be covalently linked to proteins altering their function. SUMOylation is an essential post-translational modification (PTM. Because of its dynamic nature, low abundance levels, and technical limitations, the occupation of endogenous SUMOylated transcription factors at genomic loci is challenging to detect. The chromatin regulator Methyl CpG binding protein 2 (MeCP2 is subjected to PTMs including SUMO. Mutations in MeCP2 lead to Rett syndrome, a severe neurodevelopmental disorder. Here, we present an efficient method to perform sequential chromatin immunoprecipitation (Seq-ChIP for detecting SUMOylated MeCP2 in neurons. This Seq-ChIP technique is a useful tool to determine the occupancy of SUMOylated transcription and chromatin factors at specific genomic regions.

Promoter of CaZF, a chickpea gene that positively regulates growth and stress tolerance, is activated by an AP2-family transcription factor CAP2.

Directory of Open Access Journals (Sweden)

Deepti Jain

Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.

On-chip electrochromic micro display for a disposable bio-sensor chip

Science.gov (United States)

Zhu, Yanjun; Tsukamoto, Takashiro; Tanaka, Shuji

2017-12-01

This paper reports an on-chip electrochromic micro display made of polyaniline (PANi) which can be easily made on a CMOS chip. Micro-patterned PANi thin films were selectively deposited on pre-patterned microelectrodes by using electrodeposition. The optimum conditions for deposition and electrochromism were investigated. An 8-pixel on-chip micro display was made on a Si chip. The color of each PANi film could be independently but simultaneously controlled, which means any 1-byte digital data could be displayed on the display. The PANi display had a response time as fast as about 100 ms, which means the transfer data rate was as fast as 80 bits per second.

ChIP-on-chip analysis identifies IL-22 as direct target gene of ectopically expressed FOXP3 transcription factor in human T cells

Directory of Open Access Journals (Sweden)

Jeron Andreas

2012-12-01

Full Text Available Abstract Background The transcription factor (TF forkhead box P3 (FOXP3 is constitutively expressed at high levels in naturally occurring CD4+CD25+ regulatory T cells (nTregs. It is not only the most accepted marker for that cell population but is also considered lineage determinative. Chromatin immunoprecipitation (ChIP of TFs in combination with genomic tiling microarray analysis (ChIP-on-chip has been shown to be an appropriate tool for identifying FOXP3 transcription factor binding sites (TFBSs on a genome-wide scale. In combination with microarray expression analysis, the ChIP-on-chip technique allows identification of direct FOXP3 target genes. Results ChIP-on-chip analysis of the human FOXP3 expressed in resting and PMA/ionomycin–stimulated Jurkat T cells revealed several thousand putative FOXP3 binding sites and demonstrated the importance of intronic regions for FOXP3 binding. The analysis of expression data showed that the stimulation-dependent down-regulation of IL-22 was correlated with direct FOXP3 binding in the IL-22 promoter region. This association was confirmed by real-time PCR analysis of ChIP-DNA. The corresponding ChIP-region also contained a matching FOXP3 consensus sequence. Conclusions Knowledge of the general distribution patterns of FOXP3 TFBSs in the human genome under resting and activated conditions will contribute to a better understanding of this TF and its influence on direct target genes, as well as its importance for the phenotype and function of Tregs. Moreover, FOXP3-dependent repression of Th17-related IL-22 may be relevant to an understanding of the phenomenon of Treg/Th17 cell plasticity.

A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins

Science.gov (United States)

Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R.

2011-09-01

Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells.

A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins.

Science.gov (United States)

Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R

2011-09-01

Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells. © 2011 American Institute of Physics

Interfacing Lab-on-a-Chip Embryo Technology with High-Definition Imaging Cytometry.

Science.gov (United States)

Zhu, Feng; Hall, Christopher J; Crosier, Philip S; Wlodkowic, Donald

2015-08-01

To spearhead deployment of zebrafish embryo biotests in large-scale drug discovery studies, automated platforms are needed to integrate embryo in-test positioning and immobilization (suitable for high-content imaging) with fluidic modules for continuous drug and medium delivery under microperfusion to developing embryos. In this work, we present an innovative design of a high-throughput three-dimensional (3D) microfluidic chip-based device for automated immobilization and culture and time-lapse imaging of developing zebrafish embryos under continuous microperfusion. The 3D Lab-on-a-Chip array was fabricated in poly(methyl methacrylate) (PMMA) transparent thermoplastic using infrared laser micromachining, while the off-chip interfaces were fabricated using additive manufacturing processes (fused deposition modelling and stereolithography). The system's design facilitated rapid loading and immobilization of a large number of embryos in predefined clusters of traps during continuous microperfusion of drugs/toxins. It was conceptually designed to seamlessly interface with both upright and inverted fluorescent imaging systems and also to directly interface with conventional microtiter plate readers that accept 96-well plates. Compared with the conventional Petri dish assays, the chip-based bioassay was much more convenient and efficient as only small amounts of drug solutions were required for the whole perfusion system running continuously over 72 h. Embryos were spatially separated in the traps that assisted tracing single embryos, preventing interembryo contamination and improving imaging accessibility.

Measurement of O-GlcNAcylated endothelial nitric oxide synthase by using 2',5'-ADP-Sepharose pull-down assay.

Science.gov (United States)

Long, Yang; Yan, Jianghong; Luo, Suxin; Liu, Zhenguo; Xia, Yong

2017-11-15

Endothelial nitric oxide synthase (eNOS) plays central roles in cardiovascular regulation and disease. eNOS function is critically affected by O-linked N-acetylglucosamine (O-GlcNAc) modification. The present method for measuring O-GlcNAcylated eNOS relies on immunoprecipitation. Such method exhibits low detection efficiency and is also costly. We here report a simplified assay by employing the high binding affinity of eNOS with the 2',5'-ADP-Sepharose resins. Together with the O-GlcNAc antibody, this assay readily allows the detection of O-GlcNAcylated eNOS in both cultured endothelial cells and rat vascular tissues. By using this assay, we demonstrate that eNOS O-GlcNAcylation is markedly elevated in the vessels of diabetic rats. Thus, a 2',5'-ADP-Sepharose-based pull-down assay is developed to measure O-GlcNAcylated eNOS. This assay is simple and efficient in detecting O-GlcNAcylated eNOS in cultured cells and animal tissues under both normal and disease conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

Universal lab-on-a-chip platform for complex, perfused 3D cell cultures

Science.gov (United States)

Sonntag, F.; Schmieder, F.; Ströbel, J.; Grünzner, S.; Busek, M.; Günther, K.; Steege, T.; Polk, C.; Klotzbach, U.

2016-03-01

The miniaturization, rapid prototyping and automation of lab-on-a-chip technology play nowadays a very important role. Lab-on-a-chip technology is successfully implemented not only for environmental analysis and medical diagnostics, but also as replacement of animals used for the testing of substances in the pharmaceutical and cosmetics industries. For that purpose the Fraunhofer IWS and partners developed a lab-on-a-chip platform for perfused cell-based assays in the last years, which includes different micropumps, valves, channels, reservoirs and customized cell culture modules. This technology is already implemented for the characterization of different human cell cultures and organoids, like skin, liver, endothelium, hair follicle and nephron. The advanced universal lab-on-a-chip platform for complex, perfused 3D cell cultures is divided into a multilayer basic chip with integrated micropump and application-specific 3D printed cell culture modules. Moreover a technology for surface modification of the printed cell culture modules by laser micro structuring and a complex and flexibly programmable controlling device based on an embedded Linux system was developed. A universal lab-on-a-chip platform with an optional oxygenator and a cell culture module for cubic scaffolds as well as first cell culture experiments within the cell culture device will be presented. The module is designed for direct interaction with robotic dispenser systems. This offers the opportunity to combine direct organ printing of cells and scaffolds with the microfluidic cell culture module. The characterization of the developed system was done by means of Micro-Particle Image Velocimetry (μPIV) and an optical oxygen measuring system.

Dopamine-functionalized InP/ZnS quantum dots as fluorescence probes for the detection of adenosine in microfluidic chip.

Science.gov (United States)

Ankireddy, Seshadri Reddy; Kim, Jongsung

2015-01-01

Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescence probes for the detection of adenosine in microfluidic chips. The photoluminescence (PL) intensity of the QDs-DA is quenched by Zn(2+) because of the strong coordination interactions. In the presence of adenosine, Zn(2+) cations preferentially bind to adenosine, and the PL intensity of the QDs-DA is recovered. A polydimethylsiloxane-based microfluidic chip was fabricated, and adenosine detection was confirmed using QDs-DA probes.

Stationary and protable instruments for assay of HEU [highly enriched uranium] solids holdup

International Nuclear Information System (INIS)

Russo, P.A.; Sprinkle, J.K. Jr.; Stephens, M.M.; Brumfield, T.L.; Gunn, C.S.; Watson, D.R.

1987-01-01

Two NaI(Tl)-based instruments, one stationary and one portable, designed for automated assay of highly enriched uranium (HEU) solids holdup, are being evaluated at the scrap recovery facility of the Oak Ridge Y-12 Plant. The stationary instrument, a continuous monitor of HEU within the filters of the chip burner exhaust system, measures the HEU deposits that accumulate erratically and rapidly during chip burner operation. The portable system was built to assay HEU in over 100 m of elevated piping used to transfer UO 3 , UO 2 , and UF 4 powder to, from, and between the fluid bed conversion furnances and the powder storage hoods. Both instruments use two detector heads. Both provide immediate automatic readout of accumulated HEU mass. The 186-keV 235 U gamma ray is the assay signature, and the 60-keV gamma ray from an 241 Am source attached to each detector is used to normalize the 186-keV rate. The measurement geometries were selected for compatibility with simple calibration models. The assay calibrations were calculated from these models and were verified and normalized with measurements of HEU standards built to match geometries of uniform accumulations on the surfaces of the process equipment. This instrumentation effort demonstrates that simple calibration models can often be applied to unique measurement geometries, minimizing the otherwise unreasonable requirements for calibration standards and allowing extension of the measurements to other process locations

Rapid detection of EBOLA VP40 in microchip immunofiltration assay

Science.gov (United States)

Miethe, Peter; Gary, Dominik; Hlawatsch, Nadine; Gad, Anne-Marie

2015-05-01

In the spring of 2014, the Ebola virus (EBOV) strain Zaire caused a dramatic outbreak in several regions of West Africa. The RT-PCR and antigen capture diagnostic proved to be effective for detecting EBOV in blood and serum. In this paper, we present data of a rapid antigen capture test for the detection of VP40. The test was performed in a microfluidic chip for immunofiltration analysis. The chip integrates all necessary assay components. The analytical sensitivity of the rapid test was 8 ng/ml for recombinant VP40. In serum and whole blood samples spiked with virus culture material, the detection limit was 2.2 x 102 PFU/ml. The performance data of the rapid test (15 min) are comparable to that of the VP40 laboratory ELISA.

"Hook"-calibration of GeneChip-microarrays: Chip characteristics and expression measures

Directory of Open Access Journals (Sweden)

Krohn Knut

2008-08-01

Full Text Available Abstract Background Microarray experiments rely on several critical steps that may introduce biases and uncertainty in downstream analyses. These steps include mRNA sample extraction, amplification and labelling, hybridization, and scanning causing chip-specific systematic variations on the raw intensity level. Also the chosen array-type and the up-to-dateness of the genomic information probed on the chip affect the quality of the expression measures. In the accompanying publication we presented theory and algorithm of the so-called hook method which aims at correcting expression data for systematic biases using a series of new chip characteristics. Results In this publication we summarize the essential chip characteristics provided by this method, analyze special benchmark experiments to estimate transcript related expression measures and illustrate the potency of the method to detect and to quantify the quality of a particular hybridization. It is shown that our single-chip approach provides expression measures responding linearly on changes of the transcript concentration over three orders of magnitude. In addition, the method calculates a detection call judging the relation between the signal and the detection limit of the particular measurement. The performance of the method in the context of different chip generations and probe set assignments is illustrated. The hook method characterizes the RNA-quality in terms of the 3'/5'-amplification bias and the sample-specific calling rate. We show that the proper judgement of these effects requires the disentanglement of non-specific and specific hybridization which, otherwise, can lead to misinterpretations of expression changes. The consequences of modifying probe/target interactions by either changing the labelling protocol or by substituting RNA by DNA targets are demonstrated. Conclusion The single-chip based hook-method provides accurate expression estimates and chip-summary characteristics

Pixel detector readout chip

CERN Multimedia

1991-01-01

Close-up of a pixel detector readout chip. The photograph shows an aera of 1 mm x 2 mm containing 12 separate readout channels. The entire chip contains 1000 readout channels (around 80 000 transistors) covering a sensitive area of 8 mm x 5 mm. The chip has been mounted on a silicon detector to detect high energy particles.

Preservation of forest wood chips

Energy Technology Data Exchange (ETDEWEB)

Kofman, P.D.; Thomsen, I.M.; Ohlsson, C.; Leer, E.; Ravn Schmidt, E.; Soerensen, M.; Knudsen, P.

1999-01-01

As part of the Danish Energy Research Programme on biomass utilisation for energy production (EFP), this project concerns problems connected to the handling and storing of wood chips. In this project, the possibility of preserving wood chips of the Norway Spruce (Picea Abies) is addressed, and the potential improvements by anaerobic storage are tested. Preservation of wood chips aims at reducing dry matter losses from extensive heating during storage and to reduce production of fungal spores. Fungal spores pose a health hazards to workers handling the chips. Further the producers of wood chips are interested in such a method since it would enable them to give a guarantee for the delivery of homogeneous wood chips also during the winter period. Three different types of wood chips were stored airtight and further one of these was stored in accordance with normal practise and use as reference. The results showed that airtight storage had a beneficial impact on the quality of the chips: no redistribution of moisture, low dry matter losses, unfavourable conditions for microbial activity of most fungi, and the promotion of yeasts instead of fungi with airborne spores. Likewise the firing tests showed that no combustion problems, and no increased risk to the environment or to the health of staff is caused by anaerobic storage of wood chips. In all, the tests of the anaerobic storage method of forest wood chips were a success and a large-scale test of the method will be carried out in 1999. (au)

Direct current insulator based dielectrophoresis (DC-iDEP) microfluidic chip for blood plasma separation

OpenAIRE

Mohammadi, Mahdi

2015-01-01

Lab-on-a-Chip (LOC) integrated microfluidics has been a powerful tool for new developments in analytical chemistry. These microfluidic systems enable the miniaturization, integration and automation of complex biochemical assays through the reduction of reagent use and enabling portability.Cell and particle separation in microfluidic systems has recently gained significant attention in many sample preparations for clinical procedures. Direct-current insulator-based dielectrophoresis (DC-iDEP) ...

The impact of CHIP premium increases on insurance outcomes among CHIP eligible children.

Science.gov (United States)

Nikolova, Silviya; Stearns, Sally

2014-03-03

Within the United States, public insurance premiums are used both to discourage private health policy holders from dropping coverage and to reduce state budget costs. Prior research suggests that the odds of having private coverage and being uninsured increase with increases in public insurance premiums. The aim of this paper is to test effects of Children's Health Insurance Program (CHIP) premium increases on public insurance, private insurance, and uninsurance rates. The fact that families just below and above a state-specific income cut-off are likely very similar in terms of observable and unobservable characteristics except the premium contribution provides a natural experiment for estimating the effect of premium increases. Using 2003 Medical Expenditure Panel Survey (MEPS) merged with CHIP premiums, we compare health insurance outcomes for CHIP eligible children as of January 2003 in states with a two-tier premium structure using a cross-sectional regression discontinuity methodology. We use difference-in-differences analysis to compare longitudinal insurance outcomes by December 2003. Higher CHIP premiums are associated with higher likelihood of private insurance. Disenrollment from CHIP in response to premium increases over time does not increase the uninsurance rate. When faced with higher CHIP premiums, private health insurance may be a preferable alternative for CHIP eligible families with higher incomes. Therefore, competition in the insurance exchanges being formed under the Affordable Care Act could enhance choice.

High-throughput screening platform for engineered nanoparticle-mediated genotoxicity using CometChip technology.

Science.gov (United States)

Watson, Christa; Ge, Jing; Cohen, Joel; Pyrgiotakis, Georgios; Engelward, Bevin P; Demokritou, Philip

2014-03-25

The likelihood of intentional and unintentional engineered nanoparticle (ENP) exposure has dramatically increased due to the use of nanoenabled products. Indeed, ENPs have been incorporated in many useful products and have enhanced our way of life. However, there are many unanswered questions about the consequences of nanoparticle exposures, in particular, with regard to their potential to damage the genome and thus potentially promote cancer. In this study, we present a high-throughput screening assay based upon the recently developed CometChip technology, which enables evaluation of single-stranded DNA breaks, abasic sites, and alkali-sensitive sites in cells exposed to ENPs. The strategic microfabricated, 96-well design and automated processing improves efficiency, reduces processing time, and suppresses user bias in comparison to the standard comet assay. We evaluated the versatility of this assay by screening five industrially relevant ENP exposures (SiO2, ZnO, Fe2O3, Ag, and CeO2) on both suspension human lymphoblastoid (TK6) and adherent Chinese hamster ovary (H9T3) cell lines. MTT and CyQuant NF assays were employed to assess cellular viability and proliferation after ENP exposure. Exposure to ENPs at a dose range of 5, 10, and 20 μg/mL induced dose-dependent increases in DNA damage and cytotoxicity. Genotoxicity profiles of ZnO>Ag>Fe2O3>CeO2>SiO2 in TK6 cells at 4 h and Ag>Fe2O3>ZnO>CeO2>SiO2 in H9T3 cells at 24 h were observed. The presented CometChip platform enabled efficient and reliable measurement of ENP-mediated DNA damage, therefore demonstrating the efficacy of this powerful tool in nanogenotoxicity studies.

Advanced flip chip packaging

CERN Document Server

Lai, Yi-Shao; Wong, CP

2013-01-01

Advanced Flip Chip Packaging presents past, present and future advances and trends in areas such as substrate technology, material development, and assembly processes. Flip chip packaging is now in widespread use in computing, communications, consumer and automotive electronics, and the demand for flip chip technology is continuing to grow in order to meet the need for products that offer better performance, are smaller, and are environmentally sustainable. This book also: Offers broad-ranging chapters with a focus on IC-package-system integration Provides viewpoints from leading industry executives and experts Details state-of-the-art achievements in process technologies and scientific research Presents a clear development history and touches on trends in the industry while also discussing up-to-date technology information Advanced Flip Chip Packaging is an ideal book for engineers, researchers, and graduate students interested in the field of flip chip packaging.

UW VLSI chip tester

Science.gov (United States)

McKenzie, Neil

1989-12-01

We present a design for a low-cost, functional VLSI chip tester. It is based on the Apple MacIntosh II personal computer. It tests chips that have up to 128 pins. All pin drivers of the tester are bidirectional; each pin is programmed independently as an input or an output. The tester can test both static and dynamic chips. Rudimentary speed testing is provided. Chips are tested by executing C programs written by the user. A software library is provided for program development. Tests run under both the Mac Operating System and A/UX. The design is implemented using Xilinx Logic Cell Arrays. Price/performance tradeoffs are discussed.

Chemiluminescence generation and detection in a capillary-driven microfluidic chip

Science.gov (United States)

Ramon, Charlotte; Temiz, Yuksel; Delamarche, Emmanuel

2017-02-01

The use of microfluidic technology represents a strong opportunity for providing sensitive, low-cost and rapid diagnosis at the point-of-care and such a technology might therefore support better, faster and more efficient diagnosis and treatment of patients at home and in healthcare settings both in developed and developing countries. In this work, we consider luminescence-based assays as an alternative to well-established fluorescence-based systems because luminescence does not require a light source or expensive optical components and is therefore a promising detection method for point-of-care applications. Here, we show a proof-of-concept of chemiluminescence (CL) generation and detection in a capillary-driven microfluidic chip for potential immunoassay applications. We employed a commercial acridan-based reaction, which is catalyzed by horseradish peroxidase (HRP). We investigated CL generation under flow conditions using a simplified immunoassay model where HRP is used instead of the complete sandwich immunocomplex. First, CL signals were generated in a capillary microfluidic chip by immobilizing HRP on a polydimethylsiloxane (PDMS) sealing layer using stencil deposition and flowing CL substrate through the hydrophilic channels. CL signals were detected using a compact (only 5×5×2.5 cm3) and custom-designed scanner, which was assembled for less than $30 and comprised a 128×1 photodiode array, a mini stepper motor, an Arduino microcontroller, and a 3D-printed housing. In addition, microfluidic chips having specific 30-μm-deep structures were fabricated and used to immobilize ensembles of 4.50 μm beads functionalized with HRP so as to generate high CL signals from capillary-driven chips.

Materials for microfluidic chip fabrication.

Science.gov (United States)

Ren, Kangning; Zhou, Jianhua; Wu, Hongkai

2013-11-19

Through manipulating fluids using microfabricated channel and chamber structures, microfluidics is a powerful tool to realize high sensitive, high speed, high throughput, and low cost analysis. In addition, the method can establish a well-controlled microenivroment for manipulating fluids and particles. It also has rapid growing implementations in both sophisticated chemical/biological analysis and low-cost point-of-care assays. Some unique phenomena emerge at the micrometer scale. For example, reactions are completed in a shorter amount of time as the travel distances of mass and heat are relatively small; the flows are usually laminar; and the capillary effect becomes dominant owing to large surface-to-volume ratios. In the meantime, the surface properties of the device material are greatly amplified, which can lead to either unique functions or problems that we would not encounter at the macroscale. Also, each material inherently corresponds with specific microfabrication strategies and certain native properties of the device. Therefore, the material for making the device plays a dominating role in microfluidic technologies. In this Account, we address the evolution of materials used for fabricating microfluidic chips, and discuss the application-oriented pros and cons of different materials. This Account generally follows the order of the materials introduced to microfluidics. Glass and silicon, the first generation microfluidic device materials, are perfect for capillary electrophoresis and solvent-involved applications but expensive for microfabriaction. Elastomers enable low-cost rapid prototyping and high density integration of valves on chip, allowing complicated and parallel fluid manipulation and in-channel cell culture. Plastics, as competitive alternatives to elastomers, are also rapid and inexpensive to microfabricate. Their broad variety provides flexible choices for different needs. For example, some thermosets support in-situ fabrication of

Cache-aware network-on-chip for chip multiprocessors

Science.gov (United States)

Tatas, Konstantinos; Kyriacou, Costas; Dekoulis, George; Demetriou, Demetris; Avraam, Costas; Christou, Anastasia

2009-05-01

This paper presents the hardware prototype of a Network-on-Chip (NoC) for a chip multiprocessor that provides support for cache coherence, cache prefetching and cache-aware thread scheduling. A NoC with support to these cache related mechanisms can assist in improving systems performance by reducing the cache miss ratio. The presented multi-core system employs the Data-Driven Multithreading (DDM) model of execution. In DDM thread scheduling is done according to data availability, thus the system is aware of the threads to be executed in the near future. This characteristic of the DDM model allows for cache aware thread scheduling and cache prefetching. The NoC prototype is a crossbar switch with output buffering that can support a cache-aware 4-node chip multiprocessor. The prototype is built on the Xilinx ML506 board equipped with a Xilinx Virtex-5 FPGA.

Experiment list: SRX122496 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available || chip antibody=Rel || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip ant...ibody catalog number 1=sc-71 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc

Smart vision chips: An overview

Science.gov (United States)

Koch, Christof

1994-01-01

This viewgraph presentation presents four working analog VLSI vision chips: (1) time-derivative retina, (2) zero-crossing chip, (3) resistive fuse, and (4) figure-ground chip; work in progress on computing motion and neuromorphic systems; and conceptual and practical lessons learned.

Experiment list: SRX122465 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 6 || chip antibody=Relb || treatment=LPS || time=120 min || chip antibody manufacturer 1=Bethyl || chip anti...body catalog number 1=A302-183A || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2

Experiment list: SRX122555 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available chip antibody=Stat1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip anti...body catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-7

The multicenter study of a new assay for simultaneous detection of multiple anti-aminoacyl-tRNA synthetases in myositis and interstitial pneumonia.

Directory of Open Access Journals (Sweden)

Ran Nakashima

Full Text Available OBJECTIVE: Autoantibodies to aminoacyl-tRNA synthetases (ARSs are useful in the diagnosis of idiopathic inflammatory myopathy (IIM with interstitial pneumonia (IP. We developed an enzyme-linked immunosorbent assay (ELISA system using a mixture of recombinant ARS antigens and tested its utility in a multicenter study. METHODS: We prepared six recombinant ARSs: GST-Jo-1, His-PL-12, His-EJ and GST-KS expressed in Escherichia coli, and His-PL-7 and His-OJ expressed in Hi-5 cells. After confirming their antigenic activity, with the exception of His-OJ, we developed our ELISA system in which the five recombinant ARSs (without His-OJ were mixed. Efficiency was confirmed using the sera from 526 Japanese patients with connective tissue disease (CTD (IIM n = 250, systemic lupus erythematosus n = 91, systemic sclerosis n = 70, rheumatoid arthritis n = 75, Sjögren's syndrome n = 27 and other diseases n = 13, 168 with idiopathic interstitial pneumonia (IIP and 30 healthy controls collected from eight institutes. IIPs were classified into two groups; idiopathic pulmonary fibrosis (IPF (n = 38 and non-IPF (n = 130. RESULTS were compared with those of RNA immunoprecipitation. RESULTS: Sensitivity and specificity of the ELISA were 97.1% and 99.8%, respectively when compared with the RNA immunoprecipitation assay. Anti-ARS antibodies were detected in 30.8% of IIM, 2.5% of non-myositis CTD, and 10.7% of IIP (5.3% of IPF and 12.3% of non-IPF. Anti-ARS-positive non-IPF patients were younger and more frequently treated with glucocorticoids and/or immunosuppressants than anti-ARS-negative patients. CONCLUSION: A newly established ELISA detected anti-ARS antibodies as efficiently as RNA immunoprecipitation. This system will enable easier and wider use in the detection of anti-ARS antibodies in patients with IIM and IIP.

On-chip digital power supply control for system-on-chip applications

NARCIS (Netherlands)

Meijer, M.; Pineda de Gyvez, J.; Otten, R.H.J.M.

2005-01-01

The authors presented an on-chip, fully-digital, power-supply control system. The scheme consists of two independent control loops that regulate power supply variations due to semiconductor process spread, temperature, and chip's workload. Smart power-switches working as linear voltage regulators

LncRNA SNHG6 is Associated with Poor Prognosis of Gastric Cancer and Promotes Cell Proliferation and EMT through Epigenetically Silencing p27 and Sponging miR-101-3p

Directory of Open Access Journals (Sweden)

Kai Yan

2017-06-01

Full Text Available Background/Amis: Long non-coding RNAs (lncRNAs, a novel class of transcripts, have been shown to play critical roles in diverse cellular biological processes, including tumorigenesis. Small nucleolar RNA host gene 6 (SNHG6 regulates various biological processes in cancer cells. However, the biological role of SNHG6 in gastric cancer still remains to be explored. The aim of this study is to investigate the characteristic of the SNHG6 in gastric cancer. Methods: Quantitative real-time polymerase chain reaction (qRT-PCR was used to measure the expression of SNHG6 in gastric cancer tissues and cell lines. MTT assays, colony formation assays were used to determine the impact of SNHG6 on tumorigenesis . Flow cytometric analysis of cell cycle and apoptosis was performed to measure the effect of SNHG6 on cell cycle and apoptosis rate. Transwell assay was performed to measure the effect of SNHG6 on cell migration. Western blotting and immunofuorescence were utilized to examine the effect of SNHG6 on epithelial-mesenchymal transition (EMT of GC cells. Chromatin immunoprecipitation (ChIP, RNA immunoprecipitation (RIP, RNA-pulldown and luciferase reporter assays were employed to dissect molecular mechanisms. Results: In this study, we revealed that SNHG6 was overexpressed in gastric cancer tissues and cell lines. High expression levels of SNHG6 wereassociated with invasion depth, lymph node metastasis, distant metastasis and tumor/node/metastasis (TNM stage, and predicted poor prognosis. Loss-of-function assays revealed that silenced SNHG6 obviously inhibited gastric cancer cell growth, weakened cell migration capacity and suppressed the EMT processes of gastric cancer cells. Additionally, ChIP, RIP, RNA-pulldown and luciferase reporter assays evidenced that SNHG6 could epigenetically silenced p27 and could competitively sponging miR-101-3p thereby regulating zinc finger E-box-binding homeobox 1 (ZEB1. Conclusion: In summary, our findings demonstrated that

Lab-on-chip system combining a microfluidic-ELISA with an array of amorphous silicon photosensors for the detection of celiac disease epitopes

Directory of Open Access Journals (Sweden)

Francesca Costantini

2015-12-01

Full Text Available This work presents a lab-on-chip system, which combines a glass-polydimethilsiloxane microfluidic network and an array of amorphous silicon photosensors for the diagnosis and follow-up of Celiac disease. The microfluidic chip implements an on-chip enzyme-linked immunosorbent assay (ELISA, relying on a sandwich immunoassay between antibodies against gliadin peptides (GPs and a secondary antibody marked with horseradish peroxidase (Ig-HRP. This enzyme catalyzes a chemiluminescent reaction, whose light intensity is detected by the amorphous silicon photosensors and transduced into an electrical signal that can be processed to recognize the presence of antibodies against GPs in the serum of people affected by Celiac syndrome.The correct operation of the developed lab-on-chip has been demonstrated using rabbit serum in the microfluidic ELISA. In particular, optimizing the dilution factors of both sera and Ig-HRP samples in the flowing solutions, the specific and non-specific antibodies against GPs can be successfully distinguished, showing the suitability of the presented device to effectively screen celiac disease epitopes. Keywords: Lab-on-chip, Celiac disease, Microfluidics, On-chip detection, ELISA, Amorphous silicon photosensors

Supply chains of forest chip production in Finland

Energy Technology Data Exchange (ETDEWEB)

Kaerhae, Kalle (Metsaeteho Oy, Helsinki (Finland)), e-mail: kalle.karha@metsateho.fi

2010-07-15

The Metsaeteho study investigated how logging residue chips, stump wood chips, and chips from small sized thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2008. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2008 by these suppliers was 6.5 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected in March-May 2009. The majority of the logging residue chips and chips from small-sized thinning wood were produced using the roadside chipping supply chain in Finland in 2008. The chipping at plant supply chain was also significant in the production of logging residue chips. 70% of all stump wood chips consumed were comminuted at the plant and 29% at terminals. The role of the terminal chipping supply chain was also significant in the production of chips from logging residues and small-sized wood chips. When producing chips from large-sized (rotten) roundwood, nearly a half of chips were comminuted at plants and more than 40% at terminals

Supply systems of forest chip production in Finland

Energy Technology Data Exchange (ETDEWEB)

Kaerhae, K. (Metsaeteho Oy, Helsinki (Finland)), e-mail: kalle.karha@metsateho.fi

2010-07-01

The Metsaeteho study investigated how logging residue chips, stump wood chips, and chips from small-diameter thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2009. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2009 by these suppliers was 8,4 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected from March-May, 2010. The majority of the logging residue chips and chips from small-diameter thinning wood were produced using the roadside chipping supply system in Finland in 2009. The chipping at plant supply system was also significant in the production of logging residue chips. Nearly 70 % of all stump wood chips consumed were comminuted at the plant and 28 % at terminals. The role of the terminal chipping supply system was also significant in the production of chips from logging residues and small-diameter wood chips. When producing chips from large-sized (rotten) roundwood, similarly roughly 70 % of chips were comminuted at plants and 23 % at terminals. (orig.)

Supply chains of forest chip production in Finland

Energy Technology Data Exchange (ETDEWEB)

Kaerhae, K. (Metsaeteho Oy, Helsinki (Finland)), Email: kalle.karha@metsateho.fi

2009-07-01

The Metsaeteho study investigated how logging residue chips. stump wood chips, and chips from small-sized thinning wood and large-sized (rotten) roundwood used by heating and power plants were produced in Finland in 2008. Almost all the major forest chip suppliers in Finland were involved in the study. The total volume of forest chips supplied in 2008 by these suppliers was 6,5 TWh. The study was implemented by conducting an e-mail questionnaire survey and telephone interviews. Research data was collected in March-May 2009. The majority of the logging residue chips and chips from small-sized thinning wood were produced using the roadside chipping supply chain in Finland in 2008. The chipping at plant supply chain was also significant in the production of logging residue chips. 70% of all stump wood chips consumed were comminuted at the plant and 29% at terminals. The role of the terminal chipping supply chain was also significant in the production of chips from logging residues and small-sized wood chips. When producing chips from large-sized (rotten) roundwood, nearly a half of chips were comminuted at plants and more than 40 % at terminals. (orig.)

ImmunoCAP assays: Pros and cons in allergology.

Science.gov (United States)

van Hage, Marianne; Hamsten, Carl; Valenta, Rudolf

2017-10-01

Allergen-specific IgE measurements and the clinical history are the cornerstones of allergy diagnosis. During the past decades, both characterization and standardization of allergen extracts and assay technology have improved. Here we discuss the uses, advantages, misinterpretations, and limitations of ImmunoCAP IgE assays (Thermo Fisher Scientific/Phadia, Uppsala, Sweden) in the field of allergology. They can be performed as singleplex (ImmunoCAP) and, for the last decade, as multiplex (Immuno Solid-phase Allergen Chip [ISAC]). The major benefit of ImmunoCAP is the obtained quantified allergen-specific IgE antibody level and the lack of interference from allergen-specific IgG antibodies. However, ImmunoCAP allergen extracts are limited to the composition of the extract. The introduction of allergen molecules has had a major effect on analytic specificity and allergy diagnosis. They are used in both singleplex ImmunoCAP and multiplex ImmunoCAP ISAC assays. The major advantage of ISAC is the comprehensive IgE pattern obtained with a minute amount of serum. The shortcomings are its semiquantitative measurements, lower linear range, and cost per assay. With respect to assay performance, ImmunoCAP allergen extracts are good screening tools, but allergen molecules dissect the IgE response on a molecular level and put allergy research on the map of precision medicine. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

On-chip determination of C-reactive protein using magnetic particles in continuous flow.

Science.gov (United States)

Phurimsak, Chayakom; Tarn, Mark D; Peyman, Sally A; Greenman, John; Pamme, Nicole

2014-11-04

We demonstrate the application of a multilaminar flow platform, in which functionalized magnetic particles are deflected through alternating laminar flow streams of reagents and washing solutions via an external magnet, for the rapid detection of the inflammatory biomarker, C-reactive protein (CRP). The two-step sandwich immunoassay was accomplished in less than 60 s, a vast improvement on the 80-300 min time frame required for enzyme-linked immunosorbent assays (ELISA) and the 50 min necessary for off-chip magnetic particle-based assays. The combination of continuous flow and a stationary magnet enables a degree of autonomy in the system, while a detection limit of 0.87 μg mL(-1) makes it suitable for the determination of CRP concentrations in clinical diagnostics. Its applicability was further proven by assaying real human serum samples and comparing those results to values obtained using standard ELISA tests.

Single chip camera active pixel sensor

Science.gov (United States)

Shaw, Timothy (Inventor); Pain, Bedabrata (Inventor); Olson, Brita (Inventor); Nixon, Robert H. (Inventor); Fossum, Eric R. (Inventor); Panicacci, Roger A. (Inventor); Mansoorian, Barmak (Inventor)

2003-01-01

A totally digital single chip camera includes communications to operate most of its structure in serial communication mode. The digital single chip camera include a D/A converter for converting an input digital word into an analog reference signal. The chip includes all of the necessary circuitry for operating the chip using a single pin.

Ultra-thin chip technology and applications

CERN Document Server

2010-01-01

Ultra-thin chips are the "smart skin" of a conventional silicon chip. This book shows how very thin and flexible chips can be fabricated and used in many new applications in microelectronics, microsystems, biomedical and other fields. It provides a comprehensive reference to the fabrication technology, post processing, characterization and the applications of ultra-thin chips.

An economic evaluation of a chlorhexidine chip for treating chronic periodontitis: the CHIP (chlorhexidine in periodontitis) study.

Science.gov (United States)

Henke, C J; Villa, K F; Aichelmann-Reidy, M E; Armitage, G C; Eber, R M; Genco, R J; Killoy, W J; Miller, D P; Page, R C; Polson, A M; Ryder, M I; Silva, S J; Somerman, M J; Van Dyke, T E; Wolff, L F; Evans, C J; Finkelman, R D

2001-11-01

The authors previously suggested that an adjunctive, controlled-release chlorhexidine, or CHX, chip may reduce periodontal surgical needs at little additional cost. This article presents an economic analysis of the CHX chip in general dental practice. In a one-year prospective clinical trial, 484 chronic periodontitis patients in 52 general practices across the United States were treated with either scaling and root planing, or SRP, plus any therapy prescribed by treating, unblinded dentists; or SRP plus other therapy as above but including the CHX chip. Economic data were collected from bills, case report forms and 12-month treatment recommendations from blinded periodontist evaluators. Total dental charges were higher for SRP + CHX chip patients vs. SRP patients when CHX chip costs were included (P = .027) but lower when CHX chip costs were excluded (P = .012). About one-half of the CHX chip acquisition cost was offset by savings in other charges. SRP + CHX chip patients were about 50 percent less likely to undergo surgical procedures than were SRP patients (P = .021). At the end of the trial, periodontist evaluators recommended similar additional procedures for both groups: SRP, about 46 percent; maintenance, about 37 percent; surgery, 56 percent for SRP alone and 63 percent for SRP + CHX chip. Adjunctive CHX chip use for general-practice patients with periodontitis increased costs but reduced surgeries over one year. At study's end, periodontists recommended similar additional surgical treatment for both groups. In general practice, routine use of the CHX chip suggests that costs will be partially offset by reduced surgery over at least one year.

Photonic network-on-chip design

CERN Document Server

Bergman, Keren; Biberman, Aleksandr; Chan, Johnnie; Hendry, Gilbert

2013-01-01

This book provides a comprehensive synthesis of the theory and practice of photonic devices for networks-on-chip. It outlines the issues in designing photonic network-on-chip architectures for future many-core high performance chip multiprocessors. The discussion is built from the bottom up: starting with the design and implementation of key photonic devices and building blocks, reviewing networking and network-on-chip theory and existing research, and finishing with describing various architectures, their characteristics, and the impact they will have on a computing system. After acquainting

Solid state silicon based condenser microphone for hearing aid, has transducer chip and IC chip between intermediate chip and openings on both sides of intermediate chip, to allow sound towards diaphragm

DEFF Research Database (Denmark)

2000-01-01

towards diaphragm. Surface of the chip (2) has electrical conductors (14) to connect chip with IC chip (3). USE - For use in miniature electroacoustic devices such as hearing aid. ADVANTAGE - Since sound inlet is covered by filter, dust, moisture and other impurities do not obstruct interior and sound...... inlet of microphone. External electrical connection can be made economically reliable and the thermal stress is avoided with the small size solid state silicon based condenser microphone....

Development of a paper-based vertical flow SERS assay for citrulline detection using aptamer-conjugated gold nanoparticles

Science.gov (United States)

Locke, Andrea; Deutz, Nicolaas; Coté, Gerard

2018-02-01

Research toward development of point-of-care (POC) technologies is emerging as a means for diagnosis and monitoring of patients outside the hospital. These POC devices typically utilize assays capable of detecting low level biomarkers indicative of specific diseases. L-citrulline, an α-amino acid produced in the intestinal mucosa cells, is one such biomarker typically found circulating within the plasma at physiological concentrations of 40 μM. Researchers have found that intestinal enterocyte malfunction causes its level to be significantly lowered, establishing it as a potential diagnostic biomarker for gut function. Our research group has proposed the development of a surface enhanced Raman spectroscopy (SERS) based assay, using vertical flow paper fluidics, for citrulline detection. The assay consists of a fluorescently active, Raman reporter labeled aptamer conjugated on gold nanoparticles. The aptamer changes its confirmation on binding to its target, which in turn changes the distance between the Raman active molecule and the nanoparticle surface. These particles were embedded within a portable chip consisting of cellulose-based paper. After the chips were loaded with different concentrations of free L-citrulline in phosphate buffer, time was given for the assay to interact with the sample. A handheld Raman spectrometer (638 nm; Ocean Optics) was used to measure the SERS intensity. Results showed decrease in intensity with increasing concentration of L-citrulline (0-50μM).

Experiment list: SRX214086 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available entiated || cell line=KH2 || chip antibody 1=none || chip antibody manufacturer 1=none || chip antibody 2=none || chip antibody manuf...acturer 2=none http://dbarchive.biosciencedbc.jp/kyushu-

Optical lattice on an atom chip

DEFF Research Database (Denmark)

Gallego, D.; Hofferberth, S.; Schumm, Thorsten

2009-01-01

Optical dipole traps and atom chips are two very powerful tools for the quantum manipulation of neutral atoms. We demonstrate that both methods can be combined by creating an optical lattice potential on an atom chip. A red-detuned laser beam is retroreflected using the atom chip surface as a high......-quality mirror, generating a vertical array of purely optical oblate traps. We transfer thermal atoms from the chip into the lattice and observe cooling into the two-dimensional regime. Using a chip-generated Bose-Einstein condensate, we demonstrate coherent Bloch oscillations in the lattice....

Experiment list: SRX214071 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Undifferentiated || treatment=Overexpress Sox2-V5 tagged || cell line=KH2 || chip antibody 1=none || chip antibody manufacture...r 1=none || chip antibody 2=V5 || chip antibody manufacturer 2=

Experiment list: SRX214075 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available age=Undifferentiated || treatment=Overexpress Sox17EK-V5 tagged || cell line=KH2 || chip antibody 1=none || chip antibody manufacture...r 1=none || chip antibody 2=V5 || chip antibody manufacture

Experiment list: SRX214074 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ge=Undifferentiated || treatment=Overexpress Sox17EK-V5 tagged || cell line=KH2 || chip antibody 1=none || chip antibody manufacture...r 1=none || chip antibody 2=V5 || chip antibody manufacture

Experiment list: SRX214072 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available e=Undifferentiated || treatment=Overexpress Sox2KE-V5 tagged || cell line=KH2 || chip antibody 1=none || chip antibody manufacture...r 1=none || chip antibody 2=V5 || chip antibody manufacture

Experiment list: SRX214067 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available fferentiated || cell line=F9 || chip antibody 1=Pou5f1/Oct4 || chip antibody manufacture...r 1=Santa Cruz || chip antibody 2=none || chip antibody manufacturer 2=none http://dbarchive.bioscien

iTAR: a web server for identifying target genes of transcription factors using ChIP-seq or ChIP-chip data.

Science.gov (United States)

Yang, Chia-Chun; Andrews, Erik H; Chen, Min-Hsuan; Wang, Wan-Yu; Chen, Jeremy J W; Gerstein, Mark; Liu, Chun-Chi; Cheng, Chao

2016-08-12

Chromatin immunoprecipitation followed by massively parallel DNA sequencing (ChIP-seq) or microarray hybridization (ChIP-chip) has been widely used to determine the genomic occupation of transcription factors (TFs). We have previously developed a probabilistic method, called TIP (Target Identification from Profiles), to identify TF target genes using ChIP-seq/ChIP-chip data. To achieve high specificity, TIP applies a conservative method to estimate significance of target genes, with the trade-off being a relatively low sensitivity of target gene identification compared to other methods. Additionally, TIP's output does not render binding-peak locations or intensity, information highly useful for visualization and general experimental biological use, while the variability of ChIP-seq/ChIP-chip file formats has made input into TIP more difficult than desired. To improve upon these facets, here we present are fined TIP with key extensions. First, it implements a Gaussian mixture model for p-value estimation, increasing target gene identification sensitivity and more accurately capturing the shape of TF binding profile distributions. Second, it enables the incorporation of TF binding-peak data by identifying their locations in significant target gene promoter regions and quantifies their strengths. Finally, for full ease of implementation we have incorporated it into a web server ( http://syslab3.nchu.edu.tw/iTAR/ ) that enables flexibility of input file format, can be used across multiple species and genome assembly versions, and is freely available for public use. The web server additionally performs GO enrichment analysis for the identified target genes to reveal the potential function of the corresponding TF. The iTAR web server provides a user-friendly interface and supports target gene identification in seven species, ranging from yeast to human. To facilitate investigating the quality of ChIP-seq/ChIP-chip data, the web server generates the chart of the

Wax-bonding 3D microfluidic chips

KAUST Repository

Gong, Xiuqing; Yi, Xin; Xiao, Kang; Li, Shunbo; Kodzius, Rimantas; Qin, Jianhua; Wen, Weijia

2013-01-01

We report a simple, low-cost and detachable microfluidic chip incorporating easily accessible paper, glass slides or other polymer films as the chip materials along with adhesive wax as the recycling bonding material. We use a laser to cut through the paper or film to form patterns and then sandwich the paper and film between glass sheets or polymer membranes . The hot-melt adhesive wax can realize bridge bonding between various materials, for example, paper, polymethylmethacrylate (PMMA) film, glass sheets, or metal plate. The bonding process is reversible and the wax is reusable through a melting and cooling process. With this process, a three-dimensional (3D) microfluidic chip is achievable by vacuating and venting the chip in a hot-water bath. To study the biocompatibility and applicability of the wax-based microfluidic chip, we tested the PCR compatibility with the chip materials first. Then we applied the wax-paper based microfluidic chip to HeLa cell electroporation (EP ). Subsequently, a prototype of a 5-layer 3D chip was fabricated by multilayer wax bonding. To check the sealing ability and the durability of the chip, green fluorescence protein (GFP) recombinant Escherichia coli (E. coli) bacteria were cultured, with which the chemotaxis of E. coli was studied in order to determine the influence of antibiotic ciprofloxacin concentration on the E. coli migration.

Wax-bonding 3D microfluidic chips

KAUST Repository

Gong, Xiuqing

2013-10-10

We report a simple, low-cost and detachable microfluidic chip incorporating easily accessible paper, glass slides or other polymer films as the chip materials along with adhesive wax as the recycling bonding material. We use a laser to cut through the paper or film to form patterns and then sandwich the paper and film between glass sheets or polymer membranes . The hot-melt adhesive wax can realize bridge bonding between various materials, for example, paper, polymethylmethacrylate (PMMA) film, glass sheets, or metal plate. The bonding process is reversible and the wax is reusable through a melting and cooling process. With this process, a three-dimensional (3D) microfluidic chip is achievable by vacuating and venting the chip in a hot-water bath. To study the biocompatibility and applicability of the wax-based microfluidic chip, we tested the PCR compatibility with the chip materials first. Then we applied the wax-paper based microfluidic chip to HeLa cell electroporation (EP ). Subsequently, a prototype of a 5-layer 3D chip was fabricated by multilayer wax bonding. To check the sealing ability and the durability of the chip, green fluorescence protein (GFP) recombinant Escherichia coli (E. coli) bacteria were cultured, with which the chemotaxis of E. coli was studied in order to determine the influence of antibiotic ciprofloxacin concentration on the E. coli migration.

Experiment list: SRX122523 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Irf2 || treatment=LPS || time=60 min || chip antibody manufacturer 1=Abcam || chip antibody catalog ...number 1=ab65048 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-498 http://

Experiment list: SRX122414 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Junb || treatment=LPS || time=30 min || chip antibody manufacturer 1=Abcam || chip antibody catalog ...number 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http://d

Experiment list: SRX214077 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available erentiated || treatment=Overexpress Sox17_V5 tagged || cell line=KH2 || chip antibody 1=Sox17 || chip antibody manufacture...r 1=R&D || chip antibody 2=V5 || chip antibody manufacturer 2=Invit

Experiment list: SRX122485 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Atf3 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip antibody ...catalog number 1=sc-188 || chip antibody manufacturer 2=Abcam || chip antibody catalog number 2=ab70005-100

Experiment list: SRX122521 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Irf2 || treatment=LPS || time=30 min || chip antibody manufacturer 1=Abcam || chip antibody catalog ...number 1=ab65048 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-498 http://

Experiment list: SRX122417 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Junb || treatment=LPS || time=60 min || chip antibody manufacturer 1=Abcam || chip antibody catalog ...number 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http://d

Experiment list: SRX122520 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Irf2 || treatment=LPS || time=30 min || chip antibody manufacturer 1=Abcam || chip antibody catalog ...number 1=ab65048 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-498 http://

Experiment list: SRX122413 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Junb || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody catalo...g number 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http:/

Experiment list: SRX122412 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Junb || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody catalo...g number 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http:/

Experiment list: SRX122406 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Irf1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Abcam || chip antibody catalog... number 1=ab52520 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-640 http:/

Experiment list: SRX122415 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Junb || treatment=LPS || time=30 min || chip antibody manufacturer 1=Abcam || chip antibody catalog ...number 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http://d

Experiment list: SRX122416 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Junb || treatment=LPS || time=60 min || chip antibody manufacturer 1=Abcam || chip antibody catalog ...number 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http://d

Experiment list: SRX122565 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat2 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Abcam || chip antibody catalog... number 1=ab53149 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-839 http:/

Experiment list: SRX122510 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Egr1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Abcam || chip antibody catalog... number 1=ab54966-100 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-110 ht

Experiment list: SRX122519 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Irf2 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody catalo...g number 1=ab65048 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-498 http:

Experiment list: SRX122472 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Runx1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Abcam || chip antibody catalo...g number 1=ab61753 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-8564 http

Experiment list: SRX122473 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Runx1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody ca...talog number 1=ab61753 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-8564

Experiment list: SRX122497 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Rel || treatment=LPS || time=30 min || chip antibody manufacturer 1=Santa Cruz || chip antibody cat...alog number 1=sc-71 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-70 http:

Experiment list: SRX122410 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Junb || treatment=LPS || time=0 min || chip antibody manufacturer 1=Abcam || chip antibody catalog n...umber 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http://db

Experiment list: SRX186172 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 1=YY1 || chip antibody manufacturer 1=Abcam || chip antibody 2=YY1 || chip antibody manufacturer 2=Santa Cru...ip-Seq; Mus musculus; ChIP-Seq source_name=Rag1 -/- pro-B cells || chip antibody

Experiment list: SRX122493 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Atf4 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody catal...og number 1=ab28830-100 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-200

Experiment list: SRX122571 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat2 || treatment=LPS || time=30 min || chip antibody manufacturer 1=Abcam || chip antibody catal...og number 1=ab53149 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-839 http

Experiment list: SRX122411 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Junb || treatment=LPS || time=0 min || chip antibody manufacturer 1=Abcam || chip antibody catalog n...umber 1=ab28838 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-46 http://db

Experiment list: SRX122498 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Rel || treatment=LPS || time=60 min || chip antibody manufacturer 1=Santa Cruz || chip antibody cat...alog number 1=sc-71 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-70 http:

Experiment list: SRX122516 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Irf2 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody catalo...g number 1=ab65048 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-498 http:

Experiment list: SRX122495 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Rel || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody catal...og number 1=sc-71 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-70 http://

Ultrasmall volume molecular isothermal amplification in microfluidic chip with advanced surface processing

International Nuclear Information System (INIS)

Huang Guoliang; Yang Xiaoyong; Ma Li; Yang Xu

2011-01-01

In this paper, we developed a metal micro-fluidic chip with advanced surface processing for ultra-small volume molecular isothermal amplification. This method takes advantages of the nucleic acid amplification with good stability and consistency, high sensitivity about 31 genomic DNA copies and bacteria specific gene identification. Based on the advanced surface processing, the bioreaction assays of nucleic acid amplification was dropped about 392nl in volume. A high numerical aperture confocal optical detection system was advanced to sensitively monitor the DNA amplification with low noise and high power collecting fluorescence near to the optical diffraction limit. A speedy nucleic acid isothermal amplification was performed in the ultra-small volume microfluidic chip, where the time at the inflexions of second derivative to DNA exponential amplified curves was brought forward and the sensitivity was improved about 65 folds to that of in current 25μl Ep-tube amplified reaction, which indicates a promising clinic molecular diagnostics in the droplet amplification.

Experiment list: SRX122563 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat1 || treatment=LPS || time=60 min || chip antibody manufacturer 1=Santa Cruz || chip antibody ...catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A h

Experiment list: SRX122564 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat1 || treatment=LPS || time=60 min || chip antibody manufacturer 1=Santa Cruz || chip antibody ...catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A h

Experiment list: SRX122488 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Atf3 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip antibody c...atalog number 1=sc-188 || chip antibody manufacturer 2=Abcam || chip antibody catalog number 2=ab70005-100 h

Experiment list: SRX122491 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Atf3 || treatment=LPS || time=60 min || chip antibody manufacturer 1=Santa Cruz || chip antibody cat...alog number 1=sc-188 || chip antibody manufacturer 2=Abcam || chip antibody catalog number 2=ab70005-100 htt

Experiment list: SRX122548 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Stat1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody... catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A

Experiment list: SRX122468 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Rela || treatment=LPS || time=0 min || chip antibody manufacturer 1=Bethyl || chip antibody catalo...g number 1=A301-824A || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-372 htt

Experiment list: SRX122561 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat1 || treatment=LPS || time=30 min || chip antibody manufacturer 1=Santa Cruz || chip antibody ...catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A h

Experiment list: SRX122409 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Irf1 || treatment=LPS || time=60 min || chip antibody manufacturer 1=Abcam || chip antibody cata...log number 1=ab52520 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-640 htt

Experiment list: SRX122487 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Atf3 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip antibody c...atalog number 1=sc-188 || chip antibody manufacturer 2=Abcam || chip antibody catalog number 2=ab70005-100 h

Experiment list: SRX122552 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Stat1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip antibo...dy catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753

Experiment list: SRX122408 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available p antibody=Irf1 || treatment=LPS || time=30 min || chip antibody manufacturer 1=Abcam || chip antibody catal...og number 1=ab52520 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-640 http

Experiment list: SRX122513 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available p antibody=Egr1 || treatment=LPS || time=60 min || chip antibody manufacturer 1=Abcam || chip antibody catal...og number 1=ab54966-100 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-110

Experiment list: SRX122567 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available p antibody=Stat2 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody cat...alog number 1=ab53149 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-839 ht

Experiment list: SRX122490 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Atf3 || treatment=LPS || time=30 min || chip antibody manufacturer 1=Santa Cruz || chip antibody cat...alog number 1=sc-188 || chip antibody manufacturer 2=Abcam || chip antibody catalog number 2=ab70005-100 htt

Experiment list: SRX122558 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available hip antibody=Stat1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip antib...ody catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-75

Experiment list: SRX122494 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available hip antibody=Atf4 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody ca...talog number 1=ab28830-100 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-2

Experiment list: SRX122557 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available hip antibody=Stat1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip antib...ody catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-75

Experiment list: SRX122492 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Atf3 || treatment=LPS || time=60 min || chip antibody manufacturer 1=Santa Cruz || chip antibody cat...alog number 1=sc-188 || chip antibody manufacturer 2=Abcam || chip antibody catalog number 2=ab70005-100 htt

Experiment list: SRX122549 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Stat1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody... catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A

Experiment list: SRX122484 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ntibody=Atf3 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody cata...log number 1=sc-188 || chip antibody manufacturer 2=Abcam || chip antibody catalog number 2=ab70005-100 http

Experiment list: SRX122514 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available tibody=Irf2 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Abcam || chip antibody catalog nu...mber 1=ab65048 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-498 http://db

Experiment list: SRX122570 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available p antibody=Stat2 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody cat...alog number 1=ab53149 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-839 ht

Experiment list: SRX122569 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Stat2 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody ca...talog number 1=ab53149 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-839 h

Experiment list: SRX122511 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Egr1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Abcam || chip antibody cat...alog number 1=ab54966-100 || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-11

Experiment list: SRX122471 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Rela || treatment=LPS || time=60 min || chip antibody manufacturer 1=Bethyl || chip antibody cat...alog number 1=A301-824A || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-372

Experiment list: SRX122554 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ip antibody=Stat1 || treatment=LPS || time=120 min || chip antibody manufacturer 1=Santa Cruz || chip antibo...dy catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753

Experiment list: SRX122551 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody ca...talog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A htt

Experiment list: SRX122546 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available p antibody=Stat1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody ...catalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A h

Experiment list: SRX122547 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody c...atalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A ht

Experiment list: SRX214084 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available turer 1=Santa Cruz || chip antibody 2=V5 || chip antibody manufacture...ge=Undifferentiated || treatment=Overexpress Sox17-V5 tagged || cell line=KH2 || chip antibody 1=Pou5f1/Oct4 || chip antibody manufac

Experiment list: SRX122544 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody c...atalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A ht

Experiment list: SRX214082 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available facturer 1=Santa Cruz || chip antibody 2=V5 || chip antibody manufacture...age=Undifferentiated || treatment=Overexpress Sox17EK-V5 tagged || cell line=KH2 || chip antibody 1=Pou5f1/Oct4 || chip antibody manu

Experiment list: SRX122466 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available p antibody=Relb || treatment=LPS || time=30 min || chip antibody manufacturer 1=Bethyl || chip antibody cata...log number 1=A302-183A || chip antibody manufacturer 2=Santa Cruz || chip antibody catalog number 2=sc-226 h

Experiment list: SRX122545 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available antibody=Stat1 || treatment=LPS || time=0 min || chip antibody manufacturer 1=Santa Cruz || chip antibody c...atalog number 1=sc-346 || chip antibody manufacturer 2=Bethyl || chip antibody catalog number 2=A302-753A ht

Experiment list: SRX214080 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available cturer 1=Santa Cruz || chip antibody 2=V5 || chip antibody manufacture...ge=Undifferentiated || treatment=Overexpress Sox2KE-V5 tagged || cell line=KH2 || chip antibody 1=Pou5f1/Oct4 || chip antibody manufa

Experiment list: SRX214081 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available cturer 1=Santa Cruz || chip antibody 2=V5 || chip antibody manufacture...ge=Undifferentiated || treatment=Overexpress Sox2KE-V5 tagged || cell line=KH2 || chip antibody 1=Pou5f1/Oct4 || chip antibody manufa

Long non-coding RNA TUG1 is involved in cell growth and chemoresistance of small cell lung cancer by regulating LIMK2b via EZH2.

Science.gov (United States)

Niu, Yuchun; Ma, Feng; Huang, Weimei; Fang, Shun; Li, Man; Wei, Ting; Guo, Linlang

2017-01-09

Taurine upregulated gene1 (TUG1) as a 7.1-kb lncRNA, has been shown to play an oncogenic role in various cancers. However, the biological functions of lncRNA TUG1 in small cell lung cancer (SCLC) remain unknown. The aim of this study is to explore the roles of TUG1 in cell growth and chemoresistance of SCLC and its possible molecular mechanism. The expression of TUG1 in thirty-three cases of SCLC tissues and SCLC cell line were examined by quantitative RT-PCR (qRT-PCR). The functional roles of TUG1 in SCLC were demonstrated by CCK8 assay, colony formation assay, wound healing assay and transwell assay, flow cytometry analysis and in vivo study through siRNA or shRNA mediated knockdown. Western blot assays were used to evaluate gene and protein expression in cell lines. Chromatin immunoprecipitation (ChIP) and RNA binding protein immunoprecipitation (RIP) were performed to confirm the molecular mechanism of TUG1 involved in cell growth and chemoresistance of small cell lung cancer. We found that TUG1 was overexpressed in SCLC tissues, and its expression was correlated with the clinical stage and the shorter survival time of SCLC patients. Moreover, downregulation of TUG1 expression could impair cell proliferation and increased cell sensitivity to anticancer drugs both in vitro and in vivo. We also discovered that TUG1 knockdown significantly promoted cell apoptosis and cell cycle arrest, and inhibited cell migration and invasion in vitro . We further demonstrated that TUG1 can regulate the expression of LIMK2b (a splice variant of LIM-kinase 2) via binding with enhancer of zeste homolog 2 (EZH2), and then promoted cell growth and chemoresistance of SCLC. Together, these results suggested that TUG1 mediates cell growth and chemoresistance of SCLC by regulating LIMK2b via EZH2.

Experiment list: SRX214068 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available inoic acid || cell line=F9 || chip antibody 1=Pou5f1/Oct4 || chip antibody manufacturer 1=Santa Cruz || chip... antibody 2=none || chip antibody manufacturer 2=none http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/eachDat

ALICE chip processor

CERN Multimedia

Maximilien Brice

2003-01-01

This tiny chip provides data processing for the time projection chamber on ALICE. Known as the ALICE TPC Read Out (ALTRO), this device was designed to minimize the size and power consumption of the TPC front end electronics. This single chip contains 16 low-power analogue-to-digital converters with six million transistors of digital processing and 8 kbits of data storage.

Pelly Crossing wood chip boiler

Energy Technology Data Exchange (ETDEWEB)

1985-03-11

The Pelly wood chip project has demonstrated that wood chips are a successful fuel for space and domestic water heating in a northern climate. Pelly Crossing was chosen as a demonstration site for the following reasons: its extreme temperatures, an abundant local supply of resource material, the high cost of fuel oil heating and a lack of local employment. The major obstacle to the smooth operation of the boiler system was the poor quality of the chip supply. The production of poor quality chips has been caused by inadequate operation and maintenance of the chipper. Dull knives and faulty anvil adjustments produced chips and splinters far in excess of the one centimetre size specified for the system's design. Unanticipated complications have caused costs of the system to be higher than expected by approximately $15,000. The actual cost of the project was approximately $165,000. The first year of the system's operation was expected to accrue $11,600 in heating cost savings. This estimate was impossible to confirm given the system's irregular operation and incremental costs. Consistent operation of the system for a period of at least one year plus the installation of monitoring devices will allow the cost effectiveness to be calculated. The wood chip system's impact on the environment was estimated to be minimal. Wood chip burning was considered cleaner and safer than cordwood burning. 9 refs., 6 figs., 6 tabs.

Permeabilization assay for antimicrobial peptides based on pore-spanning lipid membranes on nanoporous alumina.

Science.gov (United States)

Neubacher, Henrik; Mey, Ingo; Carnarius, Christian; Lazzara, Thomas D; Steinem, Claudia

2014-04-29

Screening tools to study antimicrobial peptides (AMPs) with the aim to optimize therapeutic delivery vectors require automated and parallelized sampling based on chip technology. Here, we present the development of a chip-based assay that allows for the investigation of the action of AMPs on planar lipid membranes in a time-resolved manner by fluorescence readout. Anodic aluminum oxide (AAO) composed of cylindrical pores with a diameter of 70 nm and a thickness of up to 10 μm was used as a support to generate pore-spanning lipid bilayers from giant unilamellar vesicle spreading, which resulted in large continuous membrane patches sealing the pores. Because AAO is optically transparent, fluid single lipid bilayers and the underlying pore cavities can be readily observed by three-dimensional confocal laser scanning microscopy (CLSM). To assay the membrane permeabilizing activity of the AMPs, the translocation of the water-soluble dyes into the AAO cavities and the fluorescence of the sulforhodamine 101 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanol-l-amine triethylammonium salt (Texas Red DHPE)-labeled lipid membrane were observed by CLSM in a time-resolved manner as a function of the AMP concentration. The effect of two different AMPs, magainin-2 and melittin, was investigated, showing that the concentrations required for membrane permeabilization and the kinetics of the dye entrance differ significantly. Our results are discussed in light of the proposed permeabilization models of the two AMPs. The presented data demonstrate the potential of this setup for the development of an on-chip screening platform for AMPs.

Down-regulation of cellular FLICE-inhibitory protein (Long Form contributes to apoptosis induced by Hsp90 inhibition in human lung cancer cells

Directory of Open Access Journals (Sweden)

Wang Qilin

2012-12-01

Full Text Available Abstract Background Cellular FLICE-Inhibitory Protein (long form, c-FLIPL is a critical negative regulator of death receptor-mediated apoptosis. Overexpression of c-FLIPL has been reported in many cancer cell lines and is associated with chemoresistance. In contrast, down-regulation of c-FLIP may drive cancer cells into cellular apoptosis. This study aims to demonstrate that inhibition of the heat shock protein 90 (Hsp90 either by inhibitors geldanamycin/17-N-Allylamino-17-demethoxygeldanamycin (GA/17-AAG or siRNA technique in human lung cancer cells induces c-FLIPL degradation and cellular apoptosis through C-terminus of Hsp70-interacting protein (CHIP-mediated mechanisms. Methods Calu-1 and H157 cell lines (including H157-c-FLIPL overexpressing c-FLIPL and control cell H157-lacZ were treated with 17-AAG and the cell lysates were prepared to detect the given proteins by Western Blot and the cell survival was assayed by SRB assay. CHIP and Hsp90 α/β proteins were knocked down by siRNA technique. CHIP and c-FLIPL plasmids were transfected into cells and immunoprecipitation experiments were performed to testify the interactions between c-FLIPL, CHIP and Hsp90. Results c-FLIPL down-regulation induced by 17-AAG can be reversed with the proteasome inhibitor MG132, which suggested that c-FLIPL degradation is mediated by a ubiquitin-proteasome system. Inhibition of Hsp90α/β reduced c-FLIPL level, whereas knocking down CHIP expression with siRNA technique inhibited c-FLIPL degradation. Furthermore, c-FLIPL and CHIP were co-precipitated in the IP complexes. In addition, overexpression of c-FLIPL can rescue cancer cells from apoptosis. When 17-AAG was combined with an anti-cancer agent celecoxib(CCB, c-FLIPL level declined further and there was a higher degree of caspase activation. Conclusion We have elucidated c-FLIPL degradation contributes to apoptosis induced by Hsp90 inhibition, suggesting c-FLIP and Hsp90 may be the promising combined targets

Validation of commercially available sphingosine kinase 2 antibodies for use in immunoblotting, immunoprecipitation and immunofluorescence [version 2; referees: 2 approved

Directory of Open Access Journals (Sweden)

Heidi A. Neubauer

2017-03-01

Full Text Available Sphingosine kinase 2 (SK2 is a ubiquitously expressed lipid kinase that has important, albeit complex and poorly understood, roles in regulating cell survival and cell death. In addition to being able to promote cell cycle arrest and apoptosis under certain conditions, it has recently been shown that SK2 can promote neoplastic transformation and tumorigenesis in vivo. Therefore, well validated and reliable tools are required to study and better understand the true functions of SK2. Here, we compare two commercially available SK2 antibodies: a rabbit polyclonal antibody from Proteintech that recognizes amino acids 266-618 of human SK2a, and a rabbit polyclonal antibody from ECM Biosciences that recognizes amino acids 36-52 of human SK2a. We examine the performance of these antibodies for use in immunoblotting, immunoprecipitation and immunofluorescence staining of endogenous SK2, using human HEK293 and HeLa cell lines, as well as mouse embryonic fibroblasts (MEFs. Furthermore, we assess the specificity of these antibodies to the target protein through the use of siRNA-mediated SK2 knockdown and SK2 knockout (Sphk2-/- MEFs. Our results demonstrate that the Proteintech anti-SK2 antibody reproducibly displayed superior sensitivity and selectivity towards SK2 in immunoblot analyses, while the ECM Biosciences anti-SK2 antibody was reproducibly superior for SK2 immunoprecipitation and detection by immunofluorescence staining. Notably, both antibodies produced non-specific bands and staining in the MEFs, which was not observed with the human cell lines. Therefore, we conclude that the Proteintech SK2 antibody is a valuable reagent for use in immunoblot analyses, and the ECM Biosciences SK2 antibody is a useful tool for SK2 immunoprecipitation and immunofluorescence staining, at least in the human cell lines employed in this study.

'Fluorescent Cell Chip' for immunotoxicity testing: Development of the c-fos expression reporter cell lines

International Nuclear Information System (INIS)

Trzaska, Dominika; Zembek, Patrycja; Olszewski, Maciej; Adamczewska, Violetta; Ulleras, Erik; Dastych, JarosIaw

2005-01-01

The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals

A Single-Chip CMOS Pulse Oximeter with On-Chip Lock-In Detection

Directory of Open Access Journals (Sweden)

Diwei He

2015-07-01

Full Text Available Pulse oximetry is a noninvasive and continuous method for monitoring the blood oxygen saturation level. This paper presents the design and testing of a single-chip pulse oximeter fabricated in a 0.35 µm CMOS process. The chip includes photodiode, transimpedance amplifier, analogue band-pass filters, analogue-to-digital converters, digital signal processor and LED timing control. The experimentally measured AC and DC characteristics of individual circuits including the DC output voltage of the transimpedance amplifier, transimpedance gain of the transimpedance amplifier, and the central frequency and bandwidth of the analogue band-pass filters, show a good match (within 1% with the circuit simulations. With modulated light source and integrated lock-in detection the sensor effectively suppresses the interference from ambient light and 1/f noise. In a breath hold and release experiment the single chip sensor demonstrates consistent and comparable performance to commercial pulse oximetry devices with a mean of 1.2% difference. The single-chip sensor enables a compact and robust design solution that offers a route towards wearable devices for health monitoring.

A Single-Chip CMOS Pulse Oximeter with On-Chip Lock-In Detection.

Science.gov (United States)

He, Diwei; Morgan, Stephen P; Trachanis, Dimitrios; van Hese, Jan; Drogoudis, Dimitris; Fummi, Franco; Stefanni, Francesco; Guarnieri, Valerio; Hayes-Gill, Barrie R

2015-07-14

Pulse oximetry is a noninvasive and continuous method for monitoring the blood oxygen saturation level. This paper presents the design and testing of a single-chip pulse oximeter fabricated in a 0.35 µm CMOS process. The chip includes photodiode, transimpedance amplifier, analogue band-pass filters, analogue-to-digital converters, digital signal processor and LED timing control. The experimentally measured AC and DC characteristics of individual circuits including the DC output voltage of the transimpedance amplifier, transimpedance gain of the transimpedance amplifier, and the central frequency and bandwidth of the analogue band-pass filters, show a good match (within 1%) with the circuit simulations. With modulated light source and integrated lock-in detection the sensor effectively suppresses the interference from ambient light and 1/f noise. In a breath hold and release experiment the single chip sensor demonstrates consistent and comparable performance to commercial pulse oximetry devices with a mean of 1.2% difference. The single-chip sensor enables a compact and robust design solution that offers a route towards wearable devices for health monitoring.

Lab-on a-Chip

Science.gov (United States)

1999-01-01

Labs on chips are manufactured in many shapes and sizes and can be used for numerous applications, from medical tests to water quality monitoring to detecting the signatures of life on other planets. The eight holes on this chip are actually ports that can be filled with fluids or chemicals. Tiny valves control the chemical processes by mixing fluids that move in the tiny channels that look like lines, connecting the ports. Scientists at NASA's Marshall Space Flight Center (MSFC) in Huntsville, Alabama designed this chip to grow biological crystals on the International Space Station (ISS). Through this research, they discovered that this technology is ideally suited for solving the challenges of the Vision for Space Exploration. For example, thousands of chips the size of dimes could be loaded on a Martian rover looking for biosignatures of past or present life. Other types of chips could be placed in handheld devices used to monitor microbes in water or to quickly conduct medical tests on astronauts. The portable, handheld Lab-on-a Chip Application Development Portable Test System (LOCAD-PTS) made its debut flight aboard Discovery during the STS-116 mission launched December 9, 2006. The system allowed crew members to monitor their environment for problematic contaminants such as yeast, mold, and even E.coli, and salmonella. Once LOCAD-PTS reached the ISS, the Marshall team continued to manage the experiment, monitoring the study from a console in the Payload Operations Center at MSFC. The results of these studies will help NASA researchers refine the technology for future Moon and Mars missions. (NASA/MSFC/D.Stoffer)

Elucidation of Chromatin Remodeling Machinery Involved in Regulation of Estrogen Receptor Alpha Expression in Human Breast Cancer Cells

National Research Council Canada - National Science Library

Sharma, Dipali

2005-01-01

.... Using chromatin immunoprecipitation (ChIP), we examined the chromatin status and repressor complex associated with silenced ER and changes in the key regulatory factors during reactivation by inhibitors of DNMT...

Estradiol-Induced Transcriptional Regulation of Long Non-Coding RNA, HOTAIR.

Science.gov (United States)

Bhan, Arunoday; Mandal, Subhrangsu S

2016-01-01

HOTAIR (HOX antisense intergenic RNA) is a 2.2 kb long non-coding RNA (lncRNA), transcribed from the antisense strand of homeobox C (HOXC) gene locus in chromosome 12. HOTAIR acts as a scaffolding lncRNA. It interacts and guides various chromatin-modifying complexes such as PRC2 (polycomb-repressive complex 2) and LSD1 (lysine-specific demethylase 1) to the target gene promoters leading to their gene silencing. Various studies have demonstrated that HOTAIR overexpression is associated with breast cancer. Recent studies from our laboratory demonstrate that HOTAIR is required for viability of breast cancer cells and is transcriptionally regulated by estradiol (E2) in vitro and in vivo. This chapter describes protocols for analysis of the HOTAIR promoter, cloning, transfection and dual luciferase assays, knockdown of protein synthesis by antisense oligonucleotides, and chromatin immunoprecipitation (ChIP) assay. These protocols are useful for studying the estrogen-mediated transcriptional regulation of lncRNA HOTAIR, as well as other protein coding genes and non-coding RNAs.

Detection of Metallothionein in Javanese Medaka (Oryzias javanicus, Using a scFv-Immobilized Protein Chip

Directory of Open Access Journals (Sweden)

Euiyeon Lee

2018-04-01

Full Text Available Environmental pollution by various industrial chemicals and biological agents poses serious risks to human health. Especially, marine contamination by potentially toxic elements (PTEs has become a global concern in recent years. Many efforts have been undertaken to monitor the PTE contamination of the aquatic environment. However, there are few approaches available to assess the PTE exposure of aquatic organisms. In this research, we developed a strategy to evaluate the heavy metal exposure of marine organisms, by measuring the expression levels of metallothionein protein derived from Oryzias javanicus (OjaMT. OjaMT is a biomarker of heavy metal exposure because the expression level increases upon heavy metal exposure. The developed assay is based on a real-time, label-free surface plasmon resonance (SPR measurement. Anti-OjaMT antibody and anti-OjaMT single-chain fragment of variable region (scFv were used as detection probes. Two types of SPR sensor chips were fabricated, by immobilizing antibody or Cys3-tagged scFv (scFv-Cys3 in a controlled orientation and were tested for in situ label-free OjaMT detection. Compared to the antibody-presenting sensor chips, the scFv-presenting sensor chips showed improved performance, displaying enhanced sensitivity and enabling semi-quantitative detection. The portable SPR system combined with scFv-immobilized sensor chips is expected to provide an excellent point-of-care testing system that can monitor target biomarkers in real time.

Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

Energy Technology Data Exchange (ETDEWEB)

Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

2006-05-25

Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

Detection of Plasmodium Aldolase Using a Smartphone and Microfluidic Enzyme Linked Immunosorbent Assay

Directory of Open Access Journals (Sweden)

Nikhil S. Gopal

2017-01-01

Full Text Available Background. Malaria control efforts are limited in rural areas. A low-cost system to monitor response without the use of electricity is needed. Plasmodium aldolase is a malaria biomarker measured using enzyme linked immunosorbent assay (ELISA techniques. A three-part system using ELISA was developed consisting of a microfluidic chip, hand crank centrifuge, and a smartphone. Methods. A circular microfluidic chip was fabricated using clear acrylic and a CO2 laser. A series of passive valves released reagents at precise times based upon centrifugal force. Color change was measured via smartphone camera using an application programmed in Java. The microchip was compared to a standard 96-well sandwich ELISA. Results. Results from standard ELISA were compared to microchip at varying concentrations (1–10 ng/mL. Over 15 different microfluidic patterns were tested, and a final prototype of the chip was created. The prototype microchip was compared to standard sandwich ELISA (n=20 using samples of recombinant aldolase. Color readings of standard ELISA and microfluidic microchip showed similar results. Conclusion. A low-cost microfluidic system could detect and follow therapeutic outcomes in rural areas and identify resistant strains.

Optimal selection of TLD chips

International Nuclear Information System (INIS)

Phung, P.; Nicoll, J.J.; Edmonds, P.; Paris, M.; Thompson, C.

1996-01-01

Large sets of TLD chips are often used to measure beam dose characteristics in radiotherapy. A sorting method is presented to allow optimal selection of chips from a chosen set. This method considers the variation

An integrated lab-on-chip for rapid identification and simultaneous differentiation of tropical pathogens.

Directory of Open Access Journals (Sweden)

Jeslin J L Tan

Full Text Available Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens.

Experiment list: SRX110782 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available e3 (ab6002, abcam), Pol II (CTD4H8, Millipore) || chip antibody 1 manufacturer=ab...cam || chip antibody 2=Pol II (CTD4H8, Millipore) || chip antibody 2 manufacturer=Millipore http://dbarchive

Avaliação da aceitação de "chips" de mandioca Acceptance evaluation of cassava chips

Directory of Open Access Journals (Sweden)

Regina Kitagawa Grizotto

2003-12-01

Full Text Available Pré-tratamentos como o cozimento, a fermentação natural e a secagem parcial foram aplicados em raízes de mandioca, visando a obtenção de "chips" comestíveis. A avaliação sensorial foi feita com base na aceitação e aparência dos "chips" das variedades IAC Mantiqueira e IAC 576.70. Trinta consumidores potenciais do produto foram selecionados em função da disponibilidade e interesse em participar dos testes. Foi utilizada escala hedônica de 7 pontos, onde os provadores avaliaram as amostras delineadas em blocos casualizados. Os resultados obtidos mostraram que os "chips" controle e pré-cozidos foram aceitos sensorialmente, apresentado médias de 5,1 (gostei ligeiramente para IAC Mantiqueira e 6,0 (gostei moderadamente para IAC 576.70. Os "chips" pré-fermentados de ambas variedades foram rejeitados. Os termos de agrado mais comentados pelos provadores foram "sabor de mandioca", "crocância" e "textura". Os termos de desagrado mais citados incluem "textura dura", "falta sabor de mandioca" e "gosto de óleo". Os provadores consideraram adequada a aparência dos "chips" de ambas variedades, sendo ligeiramente preferida a aparência dos "chips" da IAC 576.70, com exceção dos "chips" cozidos por 8 minutos e os fermentados, rejeitados pelos consumidores. A cor amarela da polpa pode ter influenciado a aceitação da variedade IAC 576.70. A composição centesimal e o teor de fibras na mandioca in natura e, o teor de lipídeos em "chips" de mandioca, também foram apresentados.Pre-treatments such as cooking, natural fermentation and partial drying were applied to cassava roots, aimed at obtaining edible cassava chips. The sensory evaluation was based on the acceptance and appearance of the chips, using the varieties IAC Mantiqueira and IAC 576.70. Thirty potential consumers of the product were selected based on their availability and interest. A 7-point hedonic scale was used, all the judges evaluating all the samples using a randomised

Large-scale analysis of antisense transcription in wheat using the Affymetrix GeneChip Wheat Genome Array

Directory of Open Access Journals (Sweden)

Settles Matthew L

2009-05-01

Full Text Available Abstract Background Natural antisense transcripts (NATs are transcripts of the opposite DNA strand to the sense-strand either at the same locus (cis-encoded or a different locus (trans-encoded. They can affect gene expression at multiple stages including transcription, RNA processing and transport, and translation. NATs give rise to sense-antisense transcript pairs and the number of these identified has escalated greatly with the availability of DNA sequencing resources and public databases. Traditionally, NATs were identified by the alignment of full-length cDNAs or expressed sequence tags to genome sequences, but an alternative method for large-scale detection of sense-antisense transcript pairs involves the use of microarrays. In this study we developed a novel protocol to assay sense- and antisense-strand transcription on the 55 K Affymetrix GeneChip Wheat Genome Array, which is a 3' in vitro transcription (3'IVT expression array. We selected five different tissue types for assay to enable maximum discovery, and used the 'Chinese Spring' wheat genotype because most of the wheat GeneChip probe sequences were based on its genomic sequence. This study is the first report of using a 3'IVT expression array to discover the expression of natural sense-antisense transcript pairs, and may be considered as proof-of-concept. Results By using alternative target preparation schemes, both the sense- and antisense-strand derived transcripts were labeled and hybridized to the Wheat GeneChip. Quality assurance verified that successful hybridization did occur in the antisense-strand assay. A stringent threshold for positive hybridization was applied, which resulted in the identification of 110 sense-antisense transcript pairs, as well as 80 potentially antisense-specific transcripts. Strand-specific RT-PCR validated the microarray observations, and showed that antisense transcription is likely to be tissue specific. For the annotated sense

Fully Automated On-Chip Imaging Flow Cytometry System with Disposable Contamination-Free Plastic Re-Cultivation Chip

Directory of Open Access Journals (Sweden)

Tomoyuki Kaneko

2011-06-01

Full Text Available We have developed a novel imaging cytometry system using a poly(methyl methacrylate (PMMA based microfluidic chip. The system was contamination-free, because sample suspensions contacted only with a flammable PMMA chip and no other component of the system. The transparency and low-fluorescence of PMMA was suitable for microscopic imaging of cells flowing through microchannels on the chip. Sample particles flowing through microchannels on the chip were discriminated by an image-recognition unit with a high-speed camera in real time at the rate of 200 event/s, e.g., microparticles 2.5 μm and 3.0 μm in diameter were differentiated with an error rate of less than 2%. Desired cells were separated automatically from other cells by electrophoretic or dielectrophoretic force one by one with a separation efficiency of 90%. Cells in suspension with fluorescent dye were separated using the same kind of microfluidic chip. Sample of 5 μL with 1 × 106 particle/mL was processed within 40 min. Separated cells could be cultured on the microfluidic chip without contamination. The whole operation of sample handling was automated using 3D micropipetting system. These results showed that the novel imaging flow cytometry system is practically applicable for biological research and clinical diagnostics.

DNA chip-assisted diagnosis of a previously unknown etiology of intermediate uveitis- Toxoplasma gondii

Directory of Open Access Journals (Sweden)

Basu Soumyava

2010-01-01

Full Text Available We report the use of DNA chip technology in the identification of Toxoplasma gondii as the etiological agent in two patients with recurrent intermediate uveitis (IU. Both patients had recurrent episodes of vitritis (with no focal retinochoroidal lesion over varying time intervals and were diagnosed to have IU. The tuberculin test was negative in both. Blood counts, erythrocyte sedimentation rate, and serum angiotensin convertase enzyme levels were normal. In both cases, the vitreous fluid tested positive for the T. gondii DNA sequence by using a uveitis DNA chip (XCyton Pvt. Ltd., Bangalore, India. It contained complimentary sequences to "signature genes" of T. gondii, Mycobacterium tuberculosis, M. chelonae, and M. fortuitum. The enzyme-linked immunosorbent assay (ELISA detected elevated serum antitoxoplasma IgG levels in both. They responded to the antitoxoplasma therapy with oral co-trimoxazole (and additional intravitreal clindamycin in patient 1, with no recurrence during follow-ups of 6 and 8 months, respectively.

Myeloid cell leukemia-1 (Mc1-1 is a candidate target gene of hypoxia-inducible factor-1 (HIF-1 in the testis

Directory of Open Access Journals (Sweden)

Palladino Michael A

2012-12-01

Full Text Available Abstract Background Spermatic cord torsion can lead to testis ischemia (I and subsequent ischemia-reperfusion (I/R causing germ cell-specific apoptosis. Previously, we demonstrated that the hypoxia-inducible factor-1 (HIF-1 transcription factor, a key regulator of physiological responses to hypoxia, is abundant in Leydig cells in normoxic and ischemic testes. We hypothesize that testicular HIF-1 activates the expression of antiapoptotic target genes to protect Leydig cells from apoptosis. In silico analysis of testis genes containing a consensus hypoxia response element (HRE, 5’-RCGTG-3’ identified myeloid cell leukemia-1 (Mcl-1 as a potential HIF-1 target gene. The purpose of this study was to determine whether HIF-1 shows DNA-binding activity in normoxic and ischemic testes and whether Mcl-1 is a target gene of testicular HIF-1. Methods The testicular HIF-1 DNA-binding capacity was analyzed in vitro using a quantitative enzyme-linked immunosorbent assay (ELISA and electrophoretic mobility shift assays (EMSA. MCL-1 protein expression was evaluated by immunoblot analysis and immunohistochemistry. The binding of testicular HIF-1 to the Mcl-1 gene was examined via chromatin immunoprecipitation (ChIP analysis. Results The ELISA and EMSA assays demonstrated that testicular HIF-1 from normoxic and ischemic testes binds DNA equally strongly, suggesting physiological roles for HIF-1 in the normoxic testis, unlike most tissues in which HIF-1 is degraded under normoxic conditions and is only activated by hypoxia. MCL-1 protein was determined to be abundant in both normoxic and ischemic testes and expressed in Leydig cells. In a pattern identical to that of HIF-1 expression, the steady-state levels of MCL-1 were not significantly affected by I or I/R and MCL-1 co-localized with HIF-1α in Leydig cells. Chromatin immunoprecipitation (ChIP analysis using a HIF-1 antibody revealed sequences enriched for the Mcl-1 promoter. Conclusions The results

Chip-to-chip SnO2 nanowire network sensors for room temperature H2 detection

Science.gov (United States)

Köck, A.; Brunet, E.; Mutinati, G. C.; Maier, T.; Steinhauer, S.

2012-06-01

The employment of nanowires is a very powerful strategy to improve gas sensor performance. We demonstrate a gas sensor device, which is based on silicon chip-to-chip synthesis of ultralong tin oxide (SnO2) nanowires. The sensor device employs an interconnected SnO2 nanowire network configuration, which exhibits a huge surface-to-volume ratio and provides full access of the target gas to the nanowires. The chip-to-chip SnO2 nanowire device is able to detect a H2 concentration of only 20 ppm in synthetic air with ~ 60% relative humidity at room temperature. At an operating temperature of 300°C a concentration of 50 ppm H2 results in a sensitivity of 5%. At this elevated temperature the sensor shows a linear response in a concentration range between 10 ppm and 100 ppm H2. The SnO2-nanowire fabrication procedure based on spray pyrolysis and subsequent annealing is performed at atmospheric pressure, requires no vacuum and allows upscale of the substrate to a wafer size. 3D-integration with CMOS chips is proposed as viable way for practical realization of smart nanowire based gas sensor devices for the consumer market.

Isotope coded protein labeling coupled immunoprecipitation (ICPL-IP): a novel approach for quantitative protein complex analysis from native tissue.

Science.gov (United States)

Vogt, Andreas; Fuerholzner, Bettina; Kinkl, Norbert; Boldt, Karsten; Ueffing, Marius

2013-05-01

High confidence definition of protein interactions is an important objective toward the understanding of biological systems. Isotope labeling in combination with affinity-based isolation of protein complexes has increased in accuracy and reproducibility, yet, larger organisms--including humans--are hardly accessible to metabolic labeling and thus, a major limitation has been its restriction to small animals, cell lines, and yeast. As composition as well as the stoichiometry of protein complexes can significantly differ in primary tissues, there is a great demand for methods capable to combine the selectivity of affinity-based isolation as well as the accuracy and reproducibility of isotope-based labeling with its application toward analysis of protein interactions from intact tissue. Toward this goal, we combined isotope coded protein labeling (ICPL)(1) with immunoprecipitation (IP) and quantitative mass spectrometry (MS). ICPL-IP allows sensitive and accurate analysis of protein interactions from primary tissue. We applied ICPL-IP to immuno-isolate protein complexes from bovine retinal tissue. Protein complexes of immunoprecipitated β-tubulin, a highly abundant protein with known interactors as well as the lowly expressed small GTPase RhoA were analyzed. The results of both analyses demonstrate sensitive and selective identification of known as well as new protein interactions by our method.

Isotope Coded Protein Labeling Coupled Immunoprecipitation (ICPL-IP): A Novel Approach for Quantitative Protein Complex Analysis From Native Tissue*

Science.gov (United States)

Vogt, Andreas; Fuerholzner, Bettina; Kinkl, Norbert; Boldt, Karsten; Ueffing, Marius

2013-01-01

High confidence definition of protein interactions is an important objective toward the understanding of biological systems. Isotope labeling in combination with affinity-based isolation of protein complexes has increased in accuracy and reproducibility, yet, larger organisms—including humans—are hardly accessible to metabolic labeling and thus, a major limitation has been its restriction to small animals, cell lines, and yeast. As composition as well as the stoichiometry of protein complexes can significantly differ in primary tissues, there is a great demand for methods capable to combine the selectivity of affinity-based isolation as well as the accuracy and reproducibility of isotope-based labeling with its application toward analysis of protein interactions from intact tissue. Toward this goal, we combined isotope coded protein labeling (ICPL)1 with immunoprecipitation (IP) and quantitative mass spectrometry (MS). ICPL-IP allows sensitive and accurate analysis of protein interactions from primary tissue. We applied ICPL-IP to immuno-isolate protein complexes from bovine retinal tissue. Protein complexes of immunoprecipitated β-tubulin, a highly abundant protein with known interactors as well as the lowly expressed small GTPase RhoA were analyzed. The results of both analyses demonstrate sensitive and selective identification of known as well as new protein interactions by our method. PMID:23268931

Simulating the Effect of Modulated Tool-Path Chip Breaking On Surface Texture and Chip Length

Energy Technology Data Exchange (ETDEWEB)

Smith, K.S.; McFarland, J.T.; Tursky, D. A.; Assaid, T. S.; Barkman, W. E.; Babelay, Jr., E. F.

2010-04-30

One method for creating broken chips in turning processes involves oscillating the cutting tool in the feed direction utilizing the CNC machine axes. The University of North Carolina at Charlotte and the Y-12 National Security Complex have developed and are refining a method to reliably control surface finish and chip length based on a particular machine's dynamic performance. Using computer simulations it is possible to combine the motion of the machine axes with the geometry of the cutting tool to predict the surface characteristics and map the surface texture for a wide range of oscillation parameters. These data allow the selection of oscillation parameters to simultaneously ensure broken chips and acceptable surface characteristics. This paper describes the machine dynamic testing and characterization activities as well as the computational method used for evaluating and predicting chip length and surface texture.

Next-Generation Sequencing of Genomic DNA Fragments Bound to a Transcription Factor in Vitro Reveals Its Regulatory Potential

Directory of Open Access Journals (Sweden)

Yukio Kurihara

2014-12-01

Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.

Fishing on chips: up-and-coming technological advances in analysis of zebrafish and Xenopus embryos.

Science.gov (United States)

Zhu, Feng; Skommer, Joanna; Huang, Yushi; Akagi, Jin; Adams, Dany; Levin, Michael; Hall, Chris J; Crosier, Philip S; Wlodkowic, Donald

2014-11-01

Biotests performed on small vertebrate model organisms provide significant investigative advantages as compared with bioassays that employ cell lines, isolated primary cells, or tissue samples. The main advantage offered by whole-organism approaches is that the effects under study occur in the context of intact physiological milieu, with all its intercellular and multisystem interactions. The gap between the high-throughput cell-based in vitro assays and low-throughput, disproportionally expensive and ethically controversial mammal in vivo tests can be closed by small model organisms such as zebrafish or Xenopus. The optical transparency of their tissues, the ease of genetic manipulation and straightforward husbandry, explain the growing popularity of these model organisms. Nevertheless, despite the potential for miniaturization, automation and subsequent increase in throughput of experimental setups, the manipulation, dispensing and analysis of living fish and frog embryos remain labor-intensive. Recently, a new generation of miniaturized chip-based devices have been developed for zebrafish and Xenopus embryo on-chip culture and experimentation. In this work, we review the critical developments in the field of Lab-on-a-Chip devices designed to alleviate the limits of traditional platforms for studies on zebrafish and clawed frog embryo and larvae. © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

Power-aware transceiver design for half-duplex bidirectional chip-to-chip optical interconnects

International Nuclear Information System (INIS)

Sangirov Jamshid; Ukaegbu Ikechi Augustine; Lee Tae-Woo; Park Hyo-Hoon; Sangirov Gulomjon

2013-01-01

A power-aware transceiver for half-duplex bidirectional chip-to-chip optical interconnects has been designed and fabricated in a 0.13 μm complementary metal–oxide–semiconductor (CMOS) technology. The transceiver can detect the presence and absence of received signals and saves 55% power in Rx enabled mode and 45% in Tx enabled mode. The chip occupies an area of 1.034 mm 2 and achieves a 3-dB bandwidth of 6 GHz and 7 GHz in Tx and Rx modes, respectively. The disabled outputs for the Tx and Rx modes are isolated with 180 dB and 139 dB, respectively, from the enabled outputs. Clear eye diagrams are obtained at 4.25 Gbps for both the Tx and Rx modes. (semiconductor integrated circuits)

A Single-Chip CMOS Pulse Oximeter with On-Chip Lock-In Detection

OpenAIRE

Diwei He; Stephen P. Morgan; Dimitrios Trachanis; Jan van Hese; Dimitris Drogoudis; Franco Fummi; Francesco Stefanni; Valerio Guarnieri; Barrie R. Hayes-Gill

2015-01-01

Pulse oximetry is a noninvasive and continuous method for monitoring the blood oxygen saturation level. This paper presents the design and testing of a single-chip pulse oximeter fabricated in a 0.35 ?m CMOS process. The chip includes photodiode, transimpedance amplifier, analogue band-pass filters, analogue-to-digital converters, digital signal processor and LED timing control. The experimentally measured AC and DC characteristics of individual circuits including the DC output voltage of the...

Experiment list: SRX485203 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346544: Rhino ChIP from control germline knock-down ovaries, replicate 2; Drosophila melanogaster; ChIP-Seq ...source_name=Rhino ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult ||... Sex=female || tissue=ovary || germline knock-down=control || chip antibody=custo

Experiment list: SRX485202 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346543: Rhino ChIP from control germline knock-down ovaries, replicate 1; Drosophila melanogaster; ChIP-Seq ...source_name=Rhino ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult ||... Sex=female || tissue=ovary || germline knock-down=control || chip antibody=custo

Experiment list: SRX485210 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 6551: Deadlock ChIP from deadlock germline knock-down ovaries; Drosophila melanogaster; ChIP-Seq source_name...=Deadlock ChIP from deadlock germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=fe...male || tissue=ovary || germline knock-down=deadlock || chip antibody=custom-made

Experiment list: SRX485211 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346552: Cutoff ChIP from control germline knock-down ovaries; Drosophila melanogaster; ChIP-Seq source_name=...Cutoff ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=female... || tissue=ovary || germline knock-down=control || chip antibody=custom-made rabb

On-chip antenna: Practical design and characterization considerations

KAUST Repository

Shamim, Atif; Salama, Khaled N.; Sedky, S.; Soliman, E. A.

2012-01-01

This paper highlights the challenges of an emergent field, namely, on-chip antenna design. Consistent with the RF System-on-Chip (SoC) concept, co-design strategy for circuits and on-chip antennas is described. A number of design and layout issues, arising from the highly integrated nature of this kind of systems, are discussed. The characterization difficulties related to on-chip antennas radiation properties are also highlighted. Finally, a novel on-wafer test fixture is proposed to measure the gain and radiation pattern of the on-chip antennas in the anechoic chamber.

On-chip antenna: Practical design and characterization considerations

KAUST Repository

Shamim, Atif

2012-07-28

This paper highlights the challenges of an emergent field, namely, on-chip antenna design. Consistent with the RF System-on-Chip (SoC) concept, co-design strategy for circuits and on-chip antennas is described. A number of design and layout issues, arising from the highly integrated nature of this kind of systems, are discussed. The characterization difficulties related to on-chip antennas radiation properties are also highlighted. Finally, a novel on-wafer test fixture is proposed to measure the gain and radiation pattern of the on-chip antennas in the anechoic chamber.

Influence of passivation process on chip performance

NARCIS (Netherlands)

Lu, J.; Kovalgin, Alexeij Y.; Schmitz, Jurriaan

2009-01-01

In this work, we have studied the performance of CMOS chips before and after a low temperature post-processing step. In order to prevent damage to the IC chips by the post-processing steps, a first passivation layers is needed on top of the IC chips. Two different passivation layer deposition

Experiment list: SRX485205 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 46546: Rhino ChIP from deadlock germline knock-down ovaries; Drosophila melanogaster; ChIP-Seq source_name=R...hino ChIP from deadlock germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=female ...|| tissue=ovary || germline knock-down=deadlock || chip antibody=custom-made rabb

Experiment list: SRX485212 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346553: Cutoff ChIP from cutoff germline knock-down ovaries; Drosophila melanogaster; ChIP-Seq source_name=C...utoff ChIP from cutoff germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=female |...| tissue=ovary || germline knock-down=cutoff || chip antibody=custom-made rabbit

Experiment list: SRX485206 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346547: Rhino ChIP from cutoff germline knock-down ovaries; Drosophila melanogaster; ChIP-Seq source_name=Rh...ino ChIP from cutoff germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=female || ...tissue=ovary || germline knock-down=cutoff || chip antibody=custom-made rabbit po

Experiment list: SRX485209 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346550: Deadlock ChIP from control germline knock-down ovaries; Drosophila melanogaster; ChIP-Seq source_nam...e=Deadlock ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=fe...male || tissue=ovary || germline knock-down=control || chip antibody=custom-made

The use of forest chips in Finland

International Nuclear Information System (INIS)

Hakkila, P.

2001-01-01

International commitments require the industrial world to restrict their greenhouse gas emissions. In Finland, where the annual timber cut per capita is more than ten times the average cut in the other EU countries, the primary means to reduce CO 2 emissions is to replace fossil fuels with forest biomass. The annual consumption of wood-based energy corresponds to 6 million tonnes of oil equivalent (toe) or almost 20% of the total primary energy consumption. The goal is to rise the annual production of wood-based energy to 7.8 million toe by 2010. Substantial part of the targeted increase could be obtained by forest chips produced of unmerchantable small-diameter trees and logging residues. The goal for 2010 is to use 5 million solid m 3 of forest chips, which equals to 0.9 million toe. The use of forest chips is increasing. About 474 000 solid m 3 of forest chips were used as fuel in 1999. At the moment, the growth is rapid especially in cogeneration plants producing both heat and electricity. The growth is based primarily on chips obtained from logging residues. The price of forest chips decreased considerably during the 1990s but the price range remained wide. Chips made of logging residues are cheaper than those made of small trees. The average price of forest chips at the plant, VAT excluded, is about 53 FIM per MWh. In Sweden, the average price is more than 40% higher

Self-driven filter-based blood plasma separator microfluidic chip for point-of-care testing

International Nuclear Information System (INIS)

Madadi, Hojjat; Casals-Terré, Jasmina; Mohammadi, Mahdi

2015-01-01

There is currently a growing need for lab-on-a-chip devices for use in clinical analysis and diagnostics, especially in the area of patient care. The first step in most blood assays is plasma extraction from whole blood. This paper presents a novel, self-driven blood plasma separation microfluidic chip, which can extract more than 0.1 μl plasma from a single droplet of undiluted fresh human blood (∼5 μl). This volume of blood plasma is extracted from whole blood with high purity (more than 98%) in a reasonable time frame (3 to 5 min), and without the need for any external force. This would be the first step towards the realization of a single-use, self-blood test that does not require any external force or power source to deliver and analyze a fresh whole-blood sample, in contrast to the existing time-consuming conventional blood analysis. The prototypes are manufactured in polydimethylsiloxane that has been modified with a strong nonionic surfactant (Silwet L-77) to achieve hydrophilic behavior. The main advantage of this microfluidic chip design is the clogging delay in the filtration area, which results in an increased amount of extracted plasma (0.1 μl). Moreover, the plasma can be collected in one or more 10 μm-deep channels to facilitate the detection and readout of multiple blood assays. This high volume of extracted plasma is achieved thanks to a novel design that combines maximum pumping efficiency without disturbing the red blood cells’ trajectory through the use of different hydrodynamic principles, such as a constriction effect and a symmetrical filtration mode. To demonstrate the microfluidic chip’s functionality, we designed and fabricated a novel hybrid microdevice that exhibits the benefits of both microfluidics and lateral flow immunochromatographic tests. The performance of the presented hybrid microdevice is validated using rapid detection of thyroid stimulating hormone within a single droplet of whole blood. (paper)

Experiment list: SRX485220 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 53 GSM1346561: RNA Polymerase II ChIP from rhino germline knock-down ovaries; Drosophila melanogaster; ChIP-...Seq source_name=RNA Polymerase II ChIP from rhino germline knock-down ovaries || developmental stage=4-6 day...s old adult || Sex=female || tissue=ovary || germline knock-down=rhino || chip an

Experiment list: SRX485204 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346545: Rhino ChIP from rhino germline knock-down ovaries; Drosophila melanogaster; ChIP-Seq source_name=Rhi...no ChIP from rhino germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=female || ti...ssue=ovary || germline knock-down=rhino || chip antibody=custom-made rabbit polyc

Experiment list: SRX485208 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 346549: Rhino ChIP from piwi germline knock-down ovaries, replicate 2; Drosophila melanogaster; ChIP-Seq sou...rce_name=Rhino ChIP from piwi germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=f...emale || tissue=ovary || germline knock-down=piwi || chip antibody=custom-made ra

SignalSpider: Probabilistic pattern discovery on multiple normalized ChIP-Seq signal profiles

KAUST Repository

Wong, Kachun; Li, Yue; Peng, Chengbin; Zhang, Zhaolei

2014-01-01

Motivation: Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-Seq) measures the genome-wide occupancy of transcription factors in vivo. Different combinations of DNA-binding protein occupancies may result in a gene

Cytotoxicity of cadmium-containing quantum dots based on a study using a microfluidic chip

International Nuclear Information System (INIS)

Zheng Xiannuo; Weng Lixing; Tian Jing; Wang Lianhui; Wu Lei; Jin Qinghui; Zhao Jianlong

2012-01-01

There is a lack of reliable nanotoxicity assays available for monitoring and quantifying multiple cellular events in cultured cells. In this study, we used a microfluidic chip to systematically investigate the cytotoxicity of three kinds of well-characterized cadmium-containing quantum dots (QDs) with the same core but different shell structures, including CdTe core QDs, CdTe/CdS core–shell QDs, and CdTe/CdS/ZnS core–shell–shell QDs, in HEK293 cells. Using the microfluidic chip combined with fluorescence microscopy, multiple QD-induced cellular events including cell morphology, viability, proliferation, and QD uptake were simultaneously analysed. The three kinds of QDs showed significantly different cytotoxicities. The CdTe QDs, which are highly toxic to HEK293 cells, resulted in remarkable cellular and nuclear morphological changes, a dose-dependent decrease in cell viability, and strong inhibition of cell proliferation; the CdTe/CdS QDs were moderately toxic but did not significantly affect the proliferation of HEK293 cells; while the CdTe/CdS/ZnS QDs had no detectable influence on cytotoxicity with respect to cell morphology, viability, and proliferation. Our data indicated that QD cytotoxicity was closely related to their surface structures and specific physicochemical properties. This study also demonstrated that the microfluidic chip could serve as a powerful tool to systematically evaluate the cytotoxicity of nanoparticles in multiple cellular events. (paper)

Cytotoxicity of cadmium-containing quantum dots based on a study using a microfluidic chip

Science.gov (United States)

Zheng, Xiannuo; Tian, Jing; Weng, Lixing; Wu, Lei; Jin, Qinghui; Zhao, Jianlong; Wang, Lianhui

2012-02-01

There is a lack of reliable nanotoxicity assays available for monitoring and quantifying multiple cellular events in cultured cells. In this study, we used a microfluidic chip to systematically investigate the cytotoxicity of three kinds of well-characterized cadmium-containing quantum dots (QDs) with the same core but different shell structures, including CdTe core QDs, CdTe/CdS core-shell QDs, and CdTe/CdS/ZnS core-shell-shell QDs, in HEK293 cells. Using the microfluidic chip combined with fluorescence microscopy, multiple QD-induced cellular events including cell morphology, viability, proliferation, and QD uptake were simultaneously analysed. The three kinds of QDs showed significantly different cytotoxicities. The CdTe QDs, which are highly toxic to HEK293 cells, resulted in remarkable cellular and nuclear morphological changes, a dose-dependent decrease in cell viability, and strong inhibition of cell proliferation; the CdTe/CdS QDs were moderately toxic but did not significantly affect the proliferation of HEK293 cells; while the CdTe/CdS/ZnS QDs had no detectable influence on cytotoxicity with respect to cell morphology, viability, and proliferation. Our data indicated that QD cytotoxicity was closely related to their surface structures and specific physicochemical properties. This study also demonstrated that the microfluidic chip could serve as a powerful tool to systematically evaluate the cytotoxicity of nanoparticles in multiple cellular events.

METAL CHIP HEATING PROCESS INVESTIGATION (Part I

Directory of Open Access Journals (Sweden)

O. M. Dyakonov

2007-01-01

Full Text Available The main calculation methods for heat- and mass transfer in porous heterogeneous medium have been considered. The paper gives an evaluation of the possibility to apply them for calculation of metal chip heating process. It has been shown that a description of transfer processes in a chip has its own specific character that is attributed to difference between thermal and physical properties of chip material and lubricant-coolant components on chip surfaces. It has been determined that the known expressions for effective heat transfer coefficients can be used as basic ones while approaching mutually penetrating continuums. A mathematical description of heat- and mass transfer in chip medium can be considered as a basis of mathematical modeling, numerical solution and parameter optimization of the mentioned processes.

Real-time single-molecule co-immunoprecipitation analyses reveal cancer-specific Ras signalling dynamics

Science.gov (United States)

Lee, Hong-Won; Kyung, Taeyoon; Yoo, Janghyun; Kim, Tackhoon; Chung, Chaeuk; Ryu, Ji Young; Lee, Hanki; Park, Kihyun; Lee, Sangkyu; Jones, Walton D.; Lim, Dae-Sik; Hyeon, Changbong; Do Heo, Won; Yoon, Tae-Young

2013-01-01

Co-immunoprecipitation (co-IP) has become a standard technique, but its protein-band output provides only static, qualitative information about protein–protein interactions. Here we demonstrate a real-time single-molecule co-IP technique that generates real-time videos of individual protein–protein interactions as they occur in unpurified cell extracts. By analysing single Ras–Raf interactions with a 50-ms time resolution, we have observed transient intermediates of the protein–protein interaction and determined all the essential kinetic rates. Using this technique, we have quantified the active fraction of native Ras proteins in xenograft tumours, normal tissue and cancer cell lines. We demonstrate that the oncogenic Ras mutations selectively increase the active-Ras fraction by one order of magnitude, without affecting total Ras levels or single-molecule signalling kinetics. Our approach allows us to probe the previously hidden, dynamic aspects of weak protein–protein interactions. It also suggests a path forward towards precision molecular diagnostics at the protein–protein interaction level. PMID:23422673

A contact-lens-shaped IC chip technology

International Nuclear Information System (INIS)

Liu, Ching-Yu; Yang, Frank; Teng, Chih-Chiao; Fan, Long-Sheng

2014-01-01

We report on novel contact-lens-shaped silicon integrated circuit chip technology for applications such as forming a conforming retinal prosthesis. This is achieved by means of patterning thin films of high residual stress on top of a shaped thin silicon substrate. Several strategies are employed to achieve curvatures of various amounts. Firstly, high residual stress on a thin film makes a thin chip deform into a designed three-dimensional shape. Also, a series of patterned stress films and ‘petal-shaped’ chips were fabricated and analyzed. Large curvatures can also be formed and maintained by the packaging process of bonding the chips to constraining elements such as thin-film polymer ring structures. As a demonstration, a complementary metal oxide semiconductor transistor (CMOS) image-sensing retina chip is made into a contact-lens shape conforming to a human eyeball 12.5 mm in radius. This non-planar and flexible chip technology provides a desirable device surface interface to soft tissues or non-planar bio surfaces and opens up many other possibilities for biomedical applications. (paper)

Wood chip delivery and research project at Mikkeli region

International Nuclear Information System (INIS)

Saksa, T.; Auvinen, P.

1995-01-01

In 1994, a large-scale energywood production chain was started as a co-operation project by the Mikkeli city forest office and local forestry societies. Over 60 000 m 3 (about 46 000 MWh of energy) of forest processed chips were delivered to Pursiala heat and power plant in Mikkeli. About 60 % of these chips was whole tree chips from improvement cuttings of young forest stands and the rest was logging waste chips from regeneration cutting areas. The average total delivery costs of forest processed chips after reduction of energywood and other subsidies were approximately 51 FIM/m 3 (68 FIM/MWh) for the whole tree chips and 40 FIM/m 3 (53 FIM/MWh) for logging waste chips. The delivery costs of wood chips could compete with those of fuel peat only in the most favourable cases. The resources of forest processed chips were studied on the basis of forestry plans. According to the study, there is enough raw material for permanent, large-scale delivery of forest processed chips (up to 250 000 m 3 /a) in the forests located at a distance of under 40 road kilometers from the Pursiala heat and power plant. The following project stages will involve further development of the wood chip delivery chain logistics, as well as improvement of logging and chipping equipment and methods in energywood and logging waste production. Also the effects of wood energy production on the economy and environment of the whole Mikkeli region will be studied. (author)

Experiment list: SRX485222 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 4me2 ChIP from control germline knock-down ovaries, replicate 2; Drosophila melanogaster; ChIP-Seq source_na...me=H3K4me2 ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=fe...male || tissue=ovary || germline knock-down=control || chip antibody=Anti-dimethy

Experiment list: SRX485221 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available K4me2 ChIP from control germline knock-down ovaries, replicate 1; Drosophila melanogaster; ChIP-Seq source_n...ame=H3K4me2 ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=f...emale || tissue=ovary || germline knock-down=control || chip antibody=Anti-dimeth

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

Science.gov (United States)

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Rework of flip chip bonded radiation pixel detectors

International Nuclear Information System (INIS)

Vaehaenen, S.; Heikkinen, H.; Pohjonen, H.; Salonen, J.; Savolainen-Pulli, S.

2008-01-01

In this paper, some practical aspects of reworking flip chip hybridized pixel detectors are discussed. As flip chip technology has been advancing in terms of placement accuracy and reliability, large-area hybrid pixel detectors have been developed. The area requirements are usually fulfilled by placing several readout chips (ROCs) on single sensor chip. However, as the number of ROCs increases, the probability of failure in the hybridization process and the ROC operation also increases. Because high accuracy flip chip bonding takes time, a significant part of the price of a pixel detector comes from the flip chip assembly process itself. As large-area detector substrates are expensive, and many flip chip placements are required, the price of an assembled detector can become very high. In a typical case, there is just one bad ROC (out of several) on a faulty detector to be replaced. Considering the high price of pixel detectors and the fact that reworking faulty ROCs does not take much longer than the original placement, it is worthwhile to investigate the feasibility of a rework process

Rework of flip chip bonded radiation pixel detectors

Energy Technology Data Exchange (ETDEWEB)

Vaehaenen, S. [VTT MEMS and Micropackaging, Espoo 02150 (Finland)], E-mail: sami.vahanen@vtt.fi; Heikkinen, H.; Pohjonen, H.; Salonen, J.; Savolainen-Pulli, S. [VTT MEMS and Micropackaging, Espoo 02150 (Finland)

2008-06-11

In this paper, some practical aspects of reworking flip chip hybridized pixel detectors are discussed. As flip chip technology has been advancing in terms of placement accuracy and reliability, large-area hybrid pixel detectors have been developed. The area requirements are usually fulfilled by placing several readout chips (ROCs) on single sensor chip. However, as the number of ROCs increases, the probability of failure in the hybridization process and the ROC operation also increases. Because high accuracy flip chip bonding takes time, a significant part of the price of a pixel detector comes from the flip chip assembly process itself. As large-area detector substrates are expensive, and many flip chip placements are required, the price of an assembled detector can become very high. In a typical case, there is just one bad ROC (out of several) on a faulty detector to be replaced. Considering the high price of pixel detectors and the fact that reworking faulty ROCs does not take much longer than the original placement, it is worthwhile to investigate the feasibility of a rework process.

Multimedia-Based Chip Design Education.

Science.gov (United States)

Catalkaya, Tamer; Golze, Ulrich

This paper focuses on multimedia computer-based training programs on chip design. Their development must be fast and economical, in order to be affordable by technical university institutions. The self-produced teaching program Illusion, which demonstrates a monitor controller as an example of a small but complete chip design, was implemented to…

Design and characterization of a 52K SNP chip for goats.

Directory of Open Access Journals (Sweden)

Gwenola Tosser-Klopp

Full Text Available The success of Genome Wide Association Studies in the discovery of sequence variation linked to complex traits in humans has increased interest in high throughput SNP genotyping assays in livestock species. Primary goals are QTL detection and genomic selection. The purpose here was design of a 50-60,000 SNP chip for goats. The success of a moderate density SNP assay depends on reliable bioinformatic SNP detection procedures, the technological success rate of the SNP design, even spacing of SNPs on the genome and selection of Minor Allele Frequencies (MAF suitable to use in diverse breeds. Through the federation of three SNP discovery projects consolidated as the International Goat Genome Consortium, we have identified approximately twelve million high quality SNP variants in the goat genome stored in a database together with their biological and technical characteristics. These SNPs were identified within and between six breeds (meat, milk and mixed: Alpine, Boer, Creole, Katjang, Saanen and Savanna, comprising a total of 97 animals. Whole genome and Reduced Representation Library sequences were aligned on >10 kb scaffolds of the de novo goat genome assembly. The 60,000 selected SNPs, evenly spaced on the goat genome, were submitted for oligo manufacturing (Illumina, Inc and published in dbSNP along with flanking sequences and map position on goat assemblies (i.e. scaffolds and pseudo-chromosomes, sheep genome V2 and cattle UMD3.1 assembly. Ten breeds were then used to validate the SNP content and 52,295 loci could be successfully genotyped and used to generate a final cluster file. The combined strategy of using mainly whole genome Next Generation Sequencing and mapping on a contig genome assembly, complemented with Illumina design tools proved to be efficient in producing this GoatSNP50 chip. Advances in use of molecular markers are expected to accelerate goat genomic studies in coming years.

Experiment list: SRX485218 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available K9me3 ChIP from piwi germline knock-down ovaries, replicate 2; Drosophila melanogaster; ChIP-Seq source_name...=H3K9me3 ChIP from piwi germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=female ...|| tissue=ovary || germline knock-down=piwi || chip antibody=Histone H3K9me3 anti

Experiment list: SRX485213 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available K9me3 ChIP from control germline knock-down ovaries, replicate 1; Drosophila melanogaster; ChIP-Seq source_n...ame=H3K9me3 ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=f...emale || tissue=ovary || germline knock-down=control || chip antibody=Histone H3K

Experiment list: SRX485214 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available K9me3 ChIP from control germline knock-down ovaries, replicate 2; Drosophila melanogaster; ChIP-Seq source_n...ame=H3K9me3 ChIP from control germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=f...emale || tissue=ovary || germline knock-down=control || chip antibody=Histone H3K

75 FR 16149 - Medicaid and CHIP Programs; Meeting of the CHIP Working Group-April 26, 2010

Science.gov (United States)

2010-03-31

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Medicare & Medicaid Services [CMS-2312-N] DEPARTMENT OF LABOR Employee Benefits Security Administration Medicaid and CHIP Programs; Meeting of the CHIP Working Group-- April 26, 2010 AGENCIES: Centers for Medicare & Medicaid Services (CMS), Department of...

Subtractive Inhibition Assay for the Detection of E. coli O157:H7 Using Surface Plasmon Resonance

Directory of Open Access Journals (Sweden)

Chengyan Si

2011-03-01

Full Text Available A surface plasmon resonance (SPR immunosensor was developed for the detection of E. coli O157:H7 by means of a new subtractive inhibition assay. In the subtractive inhibition assay, E. coli O157:H7 cells and goat polyclonal antibodies for E. coli O157:H7 were incubated for a short of time, and then the E. coli O157:H7 cells which bound antibodies were removed by a stepwise centrifugation process. The remaining free unbound antibodies were detected through interaction with rabbit anti-goat IgG polyclonal antibodies immobilized on the sensor chip using a BIAcore 3000 biosensor. The results showed that the signal was inversely correlated with the concentration of E. coli O157:H7 cells in a range from 3.0 × 104 to 3.0 × 108 cfu/mL with a detection limit of 3.0 × 104 cfu/mL. Compared with direct SPR by immobilizing antibodies on the chip surface to capture the bacterial cells and ELISA for E. coli O157:H7 (detection limit: both 3.0 × 105 cfu/mL in this paper, the detection limit of subtractive inhibition assay method was reduced by one order of magnitude. The method simplifies bacterial cell detection to protein-protein interaction, which has the potential for providing a practical alternative for the monitoring of E. coli O157:H7 and other pathogens.

From bioseparation to artificial micro-organs: microfluidic chip based particle manipulation techniques

Science.gov (United States)

Stelzle, Martin

2010-02-01

Microfluidic device technology provides unique physical phenomena which are not available in the macroscopic world. These may be exploited towards a diverse array of applications in biotechnology and biomedicine ranging from bioseparation of particulate samples to the assembly of cells into structures that resemble the smallest functional unit of an organ. In this paper a general overview of chip-based particle manipulation and separation is given. In the state of the art electric, magnetic, optical and gravitational field effects are utilized. Also, mechanical obstacles often in combination with force fields and laminar flow are employed to achieve separation of particles or molecules. In addition, three applications based on dielectrophoretic forces for particle manipulation in microfluidic systems are discussed in more detail. Firstly, a virus assay is demonstrated. There, antibody-loaded microbeads are used to bind virus particles from a sample and subsequently are accumulated to form a pico-liter sized aggregate located at a predefined position in the chip thus enabling highly sensitive fluorescence detection. Secondly, subcellular fractionation of mitochondria from cell homogenate yields pure samples as was demonstrated by Western Blot and 2D PAGE analysis. Robust long-term operation with complex cell homogenate samples while avoiding electrode fouling is achieved by a set of dedicated technical means. Finally, a chip intended for the dielectrophoretic assembly of hepatocytes and endothelial cells into a structure resembling a liver sinusoid is presented. Such "artificial micro organs" are envisioned as substance screening test systems providing significantly higher predictability with respect to the in vivo response towards a substance under test.

Modelling, Synthesis, and Configuration of Networks-on-Chips

DEFF Research Database (Denmark)

Stuart, Matthias Bo

This thesis presents three contributions in two different areas of network-on-chip and system-on-chip research: Application modelling and identifying and solving different optimization problems related to two specific network-on-chip architectures. The contribution related to application modelling...... is an analytical method for deriving the worst-case traffic pattern caused by an application and the cache-coherence protocol in a cache-coherent shared-memory system. The contributions related to network-on-chip optimization problems consist of two parts: The development and evaluation of six heuristics...... for solving the network synthesis problem in the MANGO network-on-chip, and the identification and formalization of the ReNoC configuration problem together with three heuristics for solving it....

Research of Dielectric Breakdown Micro fluidic Sampling Chip

International Nuclear Information System (INIS)

Jiang, F.; Lei, Y.; Yu, J.

2013-01-01

Micro fluidic chip is mainly driven electrically by external electrode and array electrode, but there are certain disadvantages in both of ways, which affect the promotion and application of micro fluidic technology. This paper discusses a scheme that uses the conductive solution in a microchannel made by PDMS, replacing electrodes and the way of dielectric breakdown to achieve microfluidic chip driver. It could reduce the driving voltage and simplify the chip production process. To prove the feasibility of this method, we produced a micro fluidic chip used in PDMS material with the lithography technology and experimented it. The results showed that using the dielectric breakdown to achieve microfluidic chip driver is feasible, and it has certain application prospect.

Multiplexed detection of DNA sequences using a competitive displacement assay in a microfluidic SERRS-based device.

Science.gov (United States)

Yazdi, Soroush H; Giles, Kristen L; White, Ian M

2013-11-05

We demonstrate sensitive and multiplexed detection of DNA sequences through a surface enhanced resonance Raman spectroscopy (SERRS)-based competitive displacement assay in an integrated microsystem. The use of the competitive displacement scheme, in which the target DNA sequence displaces a Raman-labeled reporter sequence that has lower affinity for the immobilized probe, enables detection of unlabeled target DNA sequences with a simple single-step procedure. In our implementation, the displacement reaction occurs in a microporous packed column of silica beads prefunctionalized with probe-reporter pairs. The use of a functionalized packed-bead column in a microfluidic channel provides two major advantages: (i) immobilization surface chemistry can be performed as a batch process instead of on a chip-by-chip basis, and (ii) the microporous network eliminates the diffusion limitations of a typical biological assay, which increases the sensitivity. Packed silica beads are also leveraged to improve the SERRS detection of the Raman-labeled reporter. Following displacement, the reporter adsorbs onto aggregated silver nanoparticles in a microfluidic mixer; the nanoparticle-reporter conjugates are then trapped and concentrated in the silica bead matrix, which leads to a significant increase in plasmonic nanoparticles and adsorbed Raman reporters within the detection volume as compared to an open microfluidic channel. The experimental results reported here demonstrate detection down to 100 pM of the target DNA sequence, and the experiments are shown to be specific, repeatable, and quantitative. Furthermore, we illustrate the advantage of using SERRS by demonstrating multiplexed detection. The sensitivity of the assay, combined with the advantages of multiplexed detection and single-step operation with unlabeled target sequences makes this method attractive for practical applications. Importantly, while we illustrate DNA sequence detection, the SERRS-based competitive

Experiment list: SRX485216 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 3K9me3 ChIP from rhino germline knock-down ovaries, replicate 2; Drosophila melanogaster; ChIP-Seq source_na...me=H3K9me3 ChIP from rhino germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=fema...le || tissue=ovary || germline knock-down=rhino || chip antibody=Histone H3K9me3

Experiment list: SRX485215 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available K9me3 ChIP from rhino germline knock-down ovaries, replicate 1; Drosophila melanogaster; ChIP-Seq source_nam...e=H3K9me3 ChIP from rhino germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=femal...e || tissue=ovary || germline knock-down=rhino || chip antibody=Histone H3K9me3 a

Experiment list: SRX485217 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 3K9me3 ChIP from piwi germline knock-down ovaries, replicate 1; Drosophila melanogaster; ChIP-Seq source_nam...e=H3K9me3 ChIP from piwi germline knock-down ovaries || developmental stage=4-6 days old adult || Sex=female... || tissue=ovary || germline knock-down=piwi || chip antibody=Histone H3K9me3 ant

ReseqChip: Automated integration of multiple local context probe data from the MitoChip array in mitochondrial DNA sequence assembly

Directory of Open Access Journals (Sweden)

Spang Rainer

2009-12-01

Full Text Available Abstract Background The Affymetrix MitoChip v2.0 is an oligonucleotide tiling array for the resequencing of the human mitochondrial (mt genome. For each of 16,569 nucleotide positions of the mt genome it holds two sets of four 25-mer probes each that match the heavy and the light strand of a reference mt genome and vary only at their central position to interrogate all four possible alleles. In addition, the MitoChip v2.0 carries alternative local context probes to account for known mtDNA variants. These probes have been neglected in most studies due to the lack of software for their automated analysis. Results We provide ReseqChip, a free software that automates the process of resequencing mtDNA using multiple local context probes on the MitoChip v2.0. ReseqChip significantly improves base call rate and sequence accuracy. ReseqChip is available at http://code.open-bio.org/svnweb/index.cgi/bioperl/browse/bioperl-live/trunk/Bio/Microarray/Tools/. Conclusions ReseqChip allows for the automated consolidation of base calls from alternative local mt genome context probes. It thereby improves the accuracy of resequencing, while reducing the number of non-called bases.

Thermal-Aware Scheduling for Future Chip Multiprocessors

Directory of Open Access Journals (Sweden)

Pedro Trancoso

2007-04-01

Full Text Available The increased complexity and operating frequency in current single chip microprocessors is resulting in a decrease in the performance improvements. Consequently, major manufacturers offer chip multiprocessor (CMP architectures in order to keep up with the expected performance gains. This architecture is successfully being introduced in many markets including that of the embedded systems. Nevertheless, the integration of several cores onto the same chip may lead to increased heat dissipation and consequently additional costs for cooling, higher power consumption, decrease of the reliability, and thermal-induced performance loss, among others. In this paper, we analyze the evolution of the thermal issues for the future chip multiprocessor architectures and show that as the number of on-chip cores increases, the thermal-induced problems will worsen. In addition, we present several scenarios that result in excessive thermal stress to the CMP chip or significant performance loss. In order to minimize or even eliminate these problems, we propose thermal-aware scheduler (TAS algorithms. When assigning processes to cores, TAS takes their temperature and cooling ability into account in order to avoid thermal stress and at the same time improve the performance. Experimental results have shown that a TAS algorithm that considers also the temperatures of neighboring cores is able to significantly reduce the temperature-induced performance loss while at the same time, decrease the chip's temperature across many different operation and configuration scenarios.

75 FR 30046 - Medicaid and CHIP Programs; Meeting of the CHIP Working Group-June 14, 2010

Science.gov (United States)

2010-05-28

..., Employee Benefits Security Administration, DOL at (202) 693-8335. News media representatives must contact... eligible for benefits under titles XIX or XXI of the Social Security Act (the Act) to enable them to enroll...] DEPARTMENT OF LABOR Employee Benefits Security Administration Medicaid and CHIP Programs; Meeting of the CHIP...

Instrument for measuring moisture in wood chips

Energy Technology Data Exchange (ETDEWEB)

Werme, L

1980-06-01

A method to determine the moisture content in wood chips, in batch and on-line, has been investigated. The method can be used for frozen and non frozen chips. Samples of wood chips are thawn and dryed with microwaves. During the drying the sample is weighed continously and the rate of drying is measured. The sample is dried t 10 percent moisture content. The result is extrapolated to the drying rate zero. The acccuracy at the method is 1.6 to 1.7 percent for both frozen and non frozen chips. The accuracy of the method is considered acceptable, but sofisticated sampling equipment is necessary. This makes the method too complex to make the instrument marketable.

On-chip power delivery and management

CERN Document Server

Vaisband, Inna P; Popovich, Mikhail; Mezhiba, Andrey V; Köse, Selçuk; Friedman, Eby G

2016-01-01

This book describes methods for distributing power in high speed, high complexity integrated circuits with power levels exceeding many tens of watts and power supplies below a volt. It provides a broad and cohesive treatment of power delivery and management systems and related design problems, including both circuit network models and design techniques for on-chip decoupling capacitors, providing insight and intuition into the behavior and design of on-chip power distribution systems. Organized into subareas to provide a more intuitive flow to the reader, this fourth edition adds more than a hundred pages of new content, including inductance models for interdigitated structures, design strategies for multi-layer power grids, advanced methods for efficient power grid design and analysis, and methodologies for simultaneously placing on-chip multiple power supplies and decoupling capacitors. The emphasis of this additional material is on managing the complexity of on-chip power distribution networks.

Characterizing Rat PNS Electrophysiological Response to Electrical Stimulation Using in vitro Chip-Based Human Investigational Platform (iCHIP)

Energy Technology Data Exchange (ETDEWEB)

Khani, Joshua [Georgetown Univ., Washington, DC (United States); Prescod, Lindsay [Georgetown Univ., Washington, DC (United States); Enright, Heather [Georgetown Univ., Washington, DC (United States); Felix, Sarah [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Osburn, Joanne [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wheeler, Elizabeth [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kulp, Kris [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2015-08-18

Ex vivo systems and organ-on-a-chip technology offer an unprecedented approach to modeling the inner workings of the human body. The ultimate goal of LLNL’s in vitro Chip-based Human Investigational Platform (iCHIP) is to integrate multiple organ tissue cultures using microfluidic channels, multi-electrode arrays (MEA), and other biosensors in order to effectively simulate and study the responses and interactions of the major organs to chemical and physical stimulation. In this study, we focused on the peripheral nervous system (PNS) component of the iCHIP system. Specifically we sought to expound on prior research investigating the electrophysiological response of rat dorsal root ganglion cells (rDRGs) to chemical exposures, such as capsaicin. Our aim was to establish a protocol for electrical stimulation using the iCHIP device that would reliably elicit a characteristic response in rDRGs. By varying the parameters for both the stimulation properties – amplitude, phase width, phase shape, and stimulation/ return configuration – and the culture conditions – day in vitro and neural cell types - we were able to make several key observations and uncover a potential convention with a minimal number of devices tested. Future work will seek to establish a standard protocol for human DRGs in the iCHIP which will afford a portable, rapid method for determining the effects of toxins and novel therapeutics on the PNS.

Dopamine-functionalized InP/ZnS quantum dots as fluorescence probes for the detection of adenosine in microfluidic chip

OpenAIRE

An, Seong Soo; Ankireddy,Seshadri Reddy; Kim,Jongsung

2015-01-01

Seshadri Reddy Ankireddy, Jongsung Kim Department of Chemical and Biological Engineering, Gachon University, Seongnam, Gyeonggi-Do, South Korea Abstract: Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescen...

RNA Binding Proteins Posttranscriptionally Regulate Genes Involved In Oncogenesis

Science.gov (United States)

2010-06-01

HuR using RNA immunoprecipitations applied to m icroarray chip s ( RIP-Chip) in estrogen positiv e (ER+) and estrogen negative (ER-) breast ca ncer...CALM2 mRNAs, were identified and validated by quantitative RT-PCR and biotin pull- down analysis. Conclusion: This is the first report of a side-by...labeled amplified cDNA) were quantitated using a Nanodrop™ (Thermo Fisher Scientific, Waltham, MA) spectrophotometer. RNA quality and integrity were

Modified precision-husky progrind H-3045 for chipping biomass

Science.gov (United States)

Dana Mitchell; Fernando Seixas; John. Klepac

2008-01-01

A specific size of whole tree chip was needed to co-mill wood chips with coal. The specifications are stringent because chips must be mixed with coal, as opposed to a co-firing process. In co-firing, two raw products are conveyed separately to a boiler. In co-milling, such as at Alabama Power's Plant Gadsden, the chip and coal mix must pass through a series of...

Titer on chip: new analytical tool for influenza vaccine potency determination.

Directory of Open Access Journals (Sweden)

Laura R Kuck

Full Text Available Titer on Chip (Flu-ToC is a new technique for quantification of influenza hemagglutinin (HA concentration. In order to evaluate the potential of this new technique, a comparison of Flu-ToC to more conventional methods was conducted using recombinant HA produced in a baculovirus expression system as a test case. Samples from current vaccine strains were collected from four different steps in the manufacturing process. A total of 19 samples were analysed by Flu-ToC (blinded, single radial immunodiffusion (SRID, an enzyme-linked immunosorbent assay (ELISA, and the purity adjusted bicinchoninic acid assay (paBCA. The results indicated reasonable linear correlation between Flu-ToC and SRID, ELISA, and paBCA, with regression slopes of log-log plots being 0.91, 1.03, and 0.91, respectively. The average ratio for HA content measured by Flu-ToC relative to SRID, ELISA, and paBCA was 83%, 147%, and 81%, respectively; indicating nearly equivalent potency determination for Flu-ToC relative to SRID and paBCA. These results, combined with demonstrated multiplexed analysis of all components within a quadrivalent formulation and robust response to HA strains over a wide time period, support the conclusion that Flu-ToC can be used as a reliable and time-saving alternative potency assay for influenza vaccines.

Perspective: Fabrication of integrated organ-on-a-chip via bioprinting.

Science.gov (United States)

Yang, Qingzhen; Lian, Qin; Xu, Feng

2017-05-01

Organ-on-a-chip has emerged as a powerful platform with widespread applications in biomedical engineering, such as pathology studies and drug screening. However, the fabrication of organ-on-a-chip is still a challenging task due to its complexity. For an integrated organ-on-a-chip, it may contain four key elements, i.e., a microfluidic chip, live cells/microtissues that are cultured in this chip, components for stimulus loading to mature the microtissues, and sensors for results readout. Recently, bioprinting has been used for fabricating organ-on-a-chip as it enables the printing of multiple materials, including biocompatible materials and even live cells in a programmable manner with a high spatial resolution. Besides, all four elements for organ-on-a-chip could be printed in a single continuous procedure on one printer; in other words, the fabrication process is assembly free. In this paper, we discuss the recent advances of organ-on-a-chip fabrication by bioprinting. Light is shed on the printing strategies, materials, and biocompatibility. In addition, some specific bioprinted organs-on-chips are analyzed in detail. Because the bioprinted organ-on-a-chip is still in its early stage, significant efforts are still needed. Thus, the challenges presented together with possible solutions and future trends are also discussed.

Experiment list: SRX319558 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available | cell type=mouse embryonic stem cells || genotype/variation=expressing control BirA || chip beads=Dynabeads... MyOne Streptavidin T1 || chip beads vendor=Invitrogen http://dbarchive.bioscienc

Experiment list: SRX319557 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available se embryonic stem cells || genotype/variation=expressing Flag-bio tagged Nanog || chip beads=Dynabeads MyOne... Streptavidin T1 || chip beads vendor=Invitrogen http://dbarchive.biosciencedbc.j

Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.

Directory of Open Access Journals (Sweden)

Nobuko Matsushita

Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.

Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

Science.gov (United States)

Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

2017-07-01

Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

A simple clockless Network-on-Chip for a commercial audio DSP chip

DEFF Research Database (Denmark)

Stensgaard, Mikkel Bystrup; Bjerregaard, Tobias; Sparsø, Jens

2006-01-01

We design a very small, packet-switched, clockless Network-on-Chip (NoC) as a replacement for the existing crossbar-based communication infrastructure in a commercial audio DSP chip. Both solutions are laid out in a 0.18 um process, and compared in terms of area, power consumption and routing...... to the existing crossbar, it allows all blocks to communicate. The total wire length is decreased by 22% which eases the layout process and makes the design less prone to routing congestion. Not least, the communicating blocks are decoupled by means of the NoC, providing a Globally-Asynchronous, Locally...

Experiment list: SRX319556 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ype=mouse embryonic stem cells || genotype/variation=expressing Flag-bio tagged Dax1 || chip beads=Dynabeads... MyOne Streptavidin T1 || chip beads vendor=Invitrogen http://dbarchive.bioscienc

Experiment list: SRX319553 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available se embryonic stem cells || genotype/variation=expressing Flag-bio tagged Tip60 || chip beads=Dynabeads MyOne... Streptavidin T1 || chip beads vendor=Invitrogen http://dbarchive.biosciencedbc.j

Experiment list: SRX319555 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ype=mouse embryonic stem cells || genotype/variation=expressing Flag-bio tagged Dax1 || chip beads=Dynabeads... MyOne Streptavidin T1 || chip beads vendor=Invitrogen http://dbarchive.bioscienc

Experiment list: SRX319551 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available use embryonic stem cells || genotype/variation=expressing Flag-bio tagged Dmap1 || chip beads=Dynabeads MyOn...e Streptavidin T1 || chip beads vendor=Invitrogen http://dbarchive.biosciencedbc.

Space division multiplexing chip-to-chip quantum key distribution

DEFF Research Database (Denmark)

Bacco, Davide; Ding, Yunhong; Dalgaard, Kjeld

2017-01-01

nodes of the quantum keys to their respective destinations. In this paper we present an experimental demonstration of a photonic integrated silicon chip quantum key distribution protocols based on space division multiplexing (SDM), through multicore fiber technology. Parallel and independent quantum...

Wood harvesting as chunkwood chips and multi-stage chipping; Puun korjuu palahakkeena ja monivaiheinen lastuaminen

Energy Technology Data Exchange (ETDEWEB)

Kaipainen, H; Seppaenen, V

1997-12-31

The task for the year 1995 was to define the preliminary results of the previous years, to measure the productivity of a harvester, designed for production of chunkwood, and the properties of the chunks. The costs of the PALAPUU method from the felling site to pulpwood chips were to be examined on this basis. Because the prototype of the harvester was not yet available for field tests, the costs were partially calculated on the basis of previous measurements, completed by productivity data obtained from the time-consumption measurements of a multi-tree harvester, applied with minor alteration for this purpose. According to the calculations the PALAPUU method cannot compete with partial-tree or shortwood methods. The profitability of the method could be improved by adding the transportation density and the productivity of the harvester. It is also possible to procure timber to the mill as partial-trees and to chunk it while feeding it into the drum. Chipping tests were made using the steel-frame-chipper owned by VTT Construction Technology. The blade construction of the chipper was changed so, that it was possible to adjust the cutting thickness of the chips to 4 mm, while in the previous mill-tests it had been 6 mm. The chips were used for cooking tests in the Department of Chemistry of the University of Jyvaeskylae. The results showed that the thinner chips were cooked further under the same cooking conditions. By using the chunkwood method it is possible to harvest 10-70 more biomass for the mills, than it is possible in the pulpwood harvesting

Wood harvesting as chunkwood chips and multi-stage chipping; Puun korjuu palahakkeena ja monivaiheinen lastuaminen

Energy Technology Data Exchange (ETDEWEB)

Kaipainen, H.; Seppaenen, V.

1996-12-31

The task for the year 1995 was to define the preliminary results of the previous years, to measure the productivity of a harvester, designed for production of chunkwood, and the properties of the chunks. The costs of the PALAPUU method from the felling site to pulpwood chips were to be examined on this basis. Because the prototype of the harvester was not yet available for field tests, the costs were partially calculated on the basis of previous measurements, completed by productivity data obtained from the time-consumption measurements of a multi-tree harvester, applied with minor alteration for this purpose. According to the calculations the PALAPUU method cannot compete with partial-tree or shortwood methods. The profitability of the method could be improved by adding the transportation density and the productivity of the harvester. It is also possible to procure timber to the mill as partial-trees and to chunk it while feeding it into the drum. Chipping tests were made using the steel-frame-chipper owned by VTT Construction Technology. The blade construction of the chipper was changed so, that it was possible to adjust the cutting thickness of the chips to 4 mm, while in the previous mill-tests it had been 6 mm. The chips were used for cooking tests in the Department of Chemistry of the University of Jyvaeskylae. The results showed that the thinner chips were cooked further under the same cooking conditions. By using the chunkwood method it is possible to harvest 10-70 more biomass for the mills, than it is possible in the pulpwood harvesting

Comparison of a Ring On-Chip Network and a Code-Division Multiple-Access On-Chip Network

Directory of Open Access Journals (Sweden)

Xin Wang

2007-01-01

Full Text Available Two network-on-chip (NoC designs are examined and compared in this paper. One design applies a bidirectional ring connection scheme, while the other design applies a code-division multiple-access (CDMA connection scheme. Both of the designs apply globally asynchronous locally synchronous (GALS scheme in order to deal with the issue of transferring data in a multiple-clock-domain environment of an on-chip system. The two NoC designs are compared with each other by their network structures, data transfer principles, network node structures, and their asynchronous designs. Both the synchronous and the asynchronous designs of the two on-chip networks are realized using a hardware-description language (HDL in order to make the entire designs suit the commonly used synchronous design tools and flow. The performance estimation and comparison of the two NoC designs which are based on the HDL realizations are addressed. By comparing the two NoC designs, the advantages and disadvantages of applying direct connection and CDMA connection schemes in an on-chip communication network are discussed.

Experiment list: SRX319550 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available e embryonic stem cells || genotype/variation=expressing Flag-bio tagged Myc || chip beads=Dynabeads MyOne Streptavidin T1 || chip bea...ds vendor=Invitrogen http://dbarchive.biosciencedbc.jp/k

A fast template matching method for LED chip Localization

Directory of Open Access Journals (Sweden)

Zhong Fuqiang

2015-01-01

Full Text Available Efficiency determines the profits of the semiconductor producers. So the producers spare no effort to enhance the efficiency of every procedure. The purpose of the paper is to present a method to shorten the time to locate the LED chips on wafer. The method consists of 3 steps. Firstly, image segmentation and blob analyzation are used to predict the positions of potential chips. Then predict the orientations of potential chips based on their dominant orientations. Finally, according to the positions and orientations predicted above, locate the chips precisely based on gradient orientation features. Experiments show that the algorithm is faster than the traditional method we choose to locate the LED chips. Besides, even the orientations of the chips on wafer are of big deviation to the orientation of the template, the efficiency of this method won't be affected.

Experiment list: SRX180159 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available sd || cell type=hemogenic endothelium || chip antibody=CEBPb || chip antibody vendor=santa cruz biotechnol...ogy http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/eachData/bw/SRX180159.bw http://

Experiment list: SRX112178 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available line=OS25 ES cells || chip antibody=8WG16 (MMS-126R, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads...=Magnetic beads http://dbarchive.biosciencedbc.jp/kyushu-u/mm

Tunable on chip optofluidic laser

DEFF Research Database (Denmark)

Bakal, Avraham; Vannahme, Christoph; Kristensen, Anders

2016-01-01

On chip tunable laser is demonstrated by realizing a microfluidic droplet array. The periodicity is controlled by the pressure applied to two separate inlets, allowing to tune the lasing frequency over a broad spectral range.......On chip tunable laser is demonstrated by realizing a microfluidic droplet array. The periodicity is controlled by the pressure applied to two separate inlets, allowing to tune the lasing frequency over a broad spectral range....

Experiment list: SRX185907 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Homo sapiens; ChIP-Seq source_name=MCF-7 breast adenocarcinoma cells, control, FOXM1 ChIP || cell_line=MCF-...7 || cell_type=ER-positive breast adenocarcinoma cells || treatment=DMSO || chip_

Experiment list: SRX319552 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available embryonic stem cells || genotype/variation=expressing Flag-bio tagged E2F4 || chip beads=Dynabeads MyOne Streptavidin T1 || chip bea...ds vendor=Invitrogen http://dbarchive.biosciencedbc.jp/k

Experiment list: SRX112184 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available line=OS25 ES cells || chip antibody=CTD4H8 (MMS-128P, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads...=Sepharose beads http://dbarchive.biosciencedbc.jp/kyushu-u/m

Experiment list: SRX367328 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available nology) || sirna transfection=siCTL http://dbarchive.bio...=HEK293T cell || cell line=Human Embryonic Kidney 293 cells || chip antibody=CDK9 || chip antibody details=2316S (Cell Signaling Tech

Experiment list: SRX543048 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available nology http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/ea...CID.adh murine thymic lymphoma || development stage=DN3 || chip antibody=rabbit anti-Miz-1 || chip antibody vendor=Santa Cruz Biotech

Design of Networks-on-Chip for Real-Time Multi-Processor Systems-on-Chip

DEFF Research Database (Denmark)

Sparsø, Jens

2012-01-01

This paper addresses the design of networks-on-chips for use in multi-processor systems-on-chips - the hardware platforms used in embedded systems. These platforms typically have to guarantee real-time properties, and as the network is a shared resource, it has to provide service guarantees...... (bandwidth and/or latency) to different communication flows. The paper reviews some past work in this field and the lessons learned, and the paper discusses ongoing research conducted as part of the project "Time-predictable Multi-Core Architecture for Embedded Systems" (T-CREST), supported by the European...

CMOS Image Sensors: Electronic Camera On A Chip

Science.gov (United States)

Fossum, E. R.

1995-01-01

Recent advancements in CMOS image sensor technology are reviewed, including both passive pixel sensors and active pixel sensors. On- chip analog to digital converters and on-chip timing and control circuits permit realization of an electronic camera-on-a-chip. Highly miniaturized imaging systems based on CMOS image sensor technology are emerging as a competitor to charge-coupled devices for low cost uses.

Experiment list: SRX185915 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available mo sapiens; ChIP-Seq source_name=MCF-7 breast adenocarcinoma cells, control, FOXM1 ChIP || cell_line=MCF-7 |...| cell_type=ER-positive breast adenocarcinoma cells || treatment=DMSO || chip_tar

Experiment list: SRX185909 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available omo sapiens; ChIP-Seq source_name=MCF-7 breast adenocarcinoma cells, control, FOXM1 ChIP || cell_line=MCF-7 ...|| cell_type=ER-positive breast adenocarcinoma cells || treatment=DMSO || chip_ta

Experiment list: SRX185917 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available omo sapiens; ChIP-Seq source_name=MCF-7 breast adenocarcinoma cells, control, FOXM1 ChIP || cell_line=MCF-7 ...|| cell_type=ER-positive breast adenocarcinoma cells || treatment=DMSO || chip_ta

Experiment list: SRX112179 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available =OS25 ES cells || chip antibody=H5 (MMS-129R, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads=Magnetic bea...ds http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/eachDa

Experiment list: SRX367330 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available nology) || sirna transfection=siBrd4 http://dbarchive.bi...=HEK293T cell || cell line=Human Embryonic Kidney 293 cells || chip antibody=CDK9 || chip antibody details=2316S (Cell Signaling Tech

Wood chips procurement and research project at the Mikkeli region

International Nuclear Information System (INIS)

Saksa, T.; Auvinen, P.

1996-01-01

In 1993-94, a large-scale energywood production chain started as a co-operation project by the Mikkeli city forest office and local forestry societies. In 1995 over 115 000 m 3 (about 85 000 MWh of energy) of wood chips were delivered to Pursiala heat and power plant in Mikkeli. About 75 % of these chips was forest processed chips. About 70 % of the forest processed chips was whole tree chips from improvement cuttings of young forest stands and the rest was logging waste chips from regeneration cutting areas. The average total delivery costs of forest processed chips after reduction of energywood and other subsidies were approximately 45 FIM/m 3 (60 FIM/MWh) for the whole tree chips and 38 FIM/m 3 (50 FIM/MWh) for logging waste chips. The delivery costs of forest processed chips could meet the target of Bioenergy Research Programme (45 FIM/MWh) only in the most favourable cases. In an average the delivery costs were about 9 FIM/MWh more than the price obtained when sold to the heat and power plant. However the wood chip production created 27 new jobs and the increase of income to the local economy was about 2.2 milj. FIM /year. The local communities got new tax revenue about 3 FIM/MWh. The gain for the forestry was approximated to be 5 - 6 FIM/MWh. The resources of forest processed chips were studied on the basis of stand measurements. According to the study the most remarkable energywood resources were in young thinning stands on Oxalis-Myrtillus and Myrtillus forest site types. On Oxalis-Myrtillus type almost every and on Myrtillus type every second stand included energywood more than 40 m 3 /ha

A primary battery-on-a-chip using monolayer graphene

Science.gov (United States)

Iost, Rodrigo M.; Crespilho, Frank N.; Kern, Klaus; Balasubramanian, Kannan

2016-07-01

We present here a bottom-up approach for realizing on-chip on-demand batteries starting out with chemical vapor deposition-grown graphene. Single graphene monolayers contacted by electrode lines on a silicon chip serve as electrodes. The anode and cathode are realized by electrodeposition of zinc and copper respectively onto graphene, leading to the realization of a miniature graphene-based Daniell cell on a chip. The electrolyte is housed partly in a gel and partly in liquid form in an on-chip enclosure molded using a 3d printer or made out of poly(dimethylsiloxane). The realized batteries provide a stable voltage (∼1.1 V) for many hours and exhibit capacities as high as 15 μAh, providing enough power to operate a pocket calculator. The realized batteries show promise for deployment as on-chip power sources for autonomous systems in lab-on-a-chip or biomedical applications.

Variation Tolerant On-Chip Interconnects

CERN Document Server

Nigussie, Ethiopia Enideg

2012-01-01

This book presents design techniques, analysis and implementation of high performance and power efficient, variation tolerant on-chip interconnects.  Given the design paradigm shift to multi-core, interconnect-centric designs and the increase in sources of variability and their impact in sub-100nm technologies, this book will be an invaluable reference for anyone concerned with the design of next generation, high-performance electronics systems. Provides comprehensive, circuit-level explanation of high-performance, energy-efficient, variation-tolerant on-chip interconnect; Describes design techniques to mitigate problems caused by variation; Includes techniques for design and implementation of self-timed on-chip interconnect, delay variation insensitive communication protocols, high speed signaling techniques and circuits, bit-width independent completion detection and process, voltage and temperature variation tolerance.                          

Microfluidic Organ-on-a-Chip Models of Human IntestineSummary

Directory of Open Access Journals (Sweden)

Amir Bein

Full Text Available Microfluidic organ-on-a-chip models of human intestine have been developed and used to study intestinal physiology and pathophysiology. In this article, we review this field and describe how microfluidic Intestine Chips offer new capabilities not possible with conventional culture systems or organoid cultures, including the ability to analyze contributions of individual cellular, chemical, and physical control parameters one-at-a-time; to coculture human intestinal cells with commensal microbiome for extended times; and to create human-relevant disease models. We also discuss potential future applications of human Intestine Chips, including how they might be used for drug development and personalized medicine. Keywords: Organs-on-Chips, Gut-on-a-Chip, Intestine-on-a-Chip, Microfluidic

Experiment list: SRX112176 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available e=OS25 ES cells || chip antibody=CTD4H8 (MMS-128P, Covance) || chip antibody manufacturer=Covance || chromatin=Fixed || beads...=Magnetic beads http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/e

Two-Phase Microfluidic Systems for High Throughput Quantification of Agglutination Assays

KAUST Repository

Castro, David

2018-04-01

Lab-on-Chip, the miniaturization of the chemical and analytical lab, is an endeavor that seems to come out of science fiction yet is slowly becoming a reality. It is a multidisciplinary field that combines different areas of science and engineering. Within these areas, microfluidics is a specialized field that deals with the behavior, control and manipulation of small volumes of fluids. Agglutination assays are rapid, single-step, low-cost immunoassays that use microspheres to detect a wide variety molecules and pathogens by using a specific antigen-antibody interaction. Agglutination assays are particularly suitable for the miniaturization and automation that two-phase microfluidics can offer, a combination that can help tackle the ever pressing need of high-throughput screening for blood banks, epidemiology, food banks diagnosis of infectious diseases. In this thesis, we present a two-phase microfluidic system capable of incubating and quantifying agglutination assays. The microfluidic channel is a simple fabrication solution, using laboratory tubing. These assays are incubated by highly efficient passive mixing with a sample-to-answer time of 2.5 min, a 5-10 fold improvement over traditional agglutination assays. It has a user-friendly interface that that does not require droplet generators, in which a pipette is used to continuously insert assays on-demand, with no down-time in between experiments at 360 assays/h. System parameters are explored, using the streptavidin-biotin interaction as a model assay, with a minimum detection limit of 50 ng/mL using optical image analysis. We compare optical image analysis and light scattering as quantification methods, and demonstrate the first light scattering quantification of agglutination assays in a two-phase ow format. The application can be potentially applied to other biomarkers, which we demonstrate using C-reactive protein (CRP) assays. Using our system, we can take a commercially available CRP qualitative slide

Chipping operations and efficiency in different operational environments

Energy Technology Data Exchange (ETDEWEB)

Roeser, D.; Mola-Yudego, B.; Prinz, R.; Emer, B.; Sikanen, L., e-mail: dominik.roser@metla.fi

2012-11-01

This research analyses the productivity of energy wood chipping operations at several sites in Austria and Finland. The aim of the work is to examine the differences in productivity and the effects of the operational environment for the chipping of bioenergy at the roadside. Furthermore, the study quantifies the effects of different variables such as forest energy assortments, tree species, sieve size and machines on the overall productivity of chipping. The results revealed that there are significant differences in the chipping productivity in Austria and Finland which are largely based on the use of different sieve sizes. Furthermore, the different operational environments in both countries, as well as the characteristics of the raw material also seem to have an effect on productivity. In order to improve the chipping productivity, particularly in Central European conditions, all relevant stakeholders need to work jointly to find solutions that will allow a greater variation of chip size. Furthermore, in the future more consideration has to be given to the close interlinkage between the chipper, crane and grapple. As a result, investments costs can be optimized and operational costs and stress on the machines reduced. (orig.)

Developing an Integrated Design Strategy for Chip Layout Optimization

NARCIS (Netherlands)

Wits, Wessel Willems; Jauregui Becker, Juan Manuel; van Vliet, Frank Edward; te Riele, G.J.

2011-01-01

This paper presents an integrated design strategy for chip layout optimization. The strategy couples both electric and thermal aspects during the conceptual design phase to improve chip performances; thermal management being one of the major topics. The layout of the chip circuitry is optimized

Transcriptional regulatory networks downstream of TAL1/SCL in T-cell acute lymphoblastic leukemia

OpenAIRE

Palomero, Teresa; Odom, Duncan T.; O'Neil, Jennifer; Ferrando, Adolfo A.; Margolin, Adam; Neuberg, Donna S.; Winter, Stuart S.; Larson, Richard S.; Li, Wei; Liu, X. Shirley; Young, Richard A.; Look, A. Thomas

2006-01-01

Aberrant expression of 1 or more transcription factor oncogenes is a critical component of the molecular pathogenesis of human T-cell acute lymphoblastic leukemia (T-ALL); however, oncogenic transcriptional programs downstream of T-ALL oncogenes are mostly unknown. TAL1/SCL is a basic helix-loop-helix (bHLH) transcription factor oncogene aberrantly expressed in 60% of human T-ALLs. We used chromatin immunoprecipitation (ChIP) on chip to identify 71 direct transcriptional targets of TAL1/SCL. ...

Opto-electronic DNA chip-based integrated card for clinical diagnostics.

Science.gov (United States)

Marchand, Gilles; Broyer, Patrick; Lanet, Véronique; Delattre, Cyril; Foucault, Frédéric; Menou, Lionel; Calvas, Bernard; Roller, Denis; Ginot, Frédéric; Campagnolo, Raymond; Mallard, Frédéric

2008-02-01

Clinical diagnostics is one of the most promising applications for microfluidic lab-on-a-chip or lab-on-card systems. DNA chips, which provide multiparametric data, are privileged tools for genomic analysis. However, automation of molecular biology protocol and use of these DNA chips in fully integrated systems remains a great challenge. Simplicity of chip and/or card/instrument interfaces is amongst the most critical issues to be addressed. Indeed, current detection systems for DNA chip reading are often complex, expensive, bulky and even limited in terms of sensitivity or accuracy. Furthermore, for liquid handling in the lab-on-cards, many devices use complex and bulky systems, either to directly manipulate fluids, or to ensure pneumatic or mechanical control of integrated valves. All these drawbacks prevent or limit the use of DNA-chip-based integrated systems, for point-of-care testing or as a routine diagnostics tool. We present here a DNA-chip-based protocol integration on a plastic card for clinical diagnostics applications including: (1) an opto-electronic DNA-chip, (2) fluid handling using electrically activated embedded pyrotechnic microvalves with closing/opening functions. We demonstrate both fluidic and electric packaging of the optoelectronic DNA chip without major alteration of its electronical and biological functionalities, and fluid control using novel electrically activable pyrotechnic microvalves. Finally, we suggest a complete design of a card dedicated to automation of a complex biological protocol with a fully electrical fluid handling and DNA chip reading.

Integrated lasers for polymer Lab-on-a-Chip systems

DEFF Research Database (Denmark)

Mappes, Timo; Vannahme, Christoph; Grosmann, Tobias

2012-01-01

We develop optical Lab-on-a-Chips on different platforms for marker-based and label-free biophotonic sensor applications. Our chips are based on polymers and fabricated by mass production technologies to integrate microfluidic channels, optical waveguides and miniaturized lasers.......We develop optical Lab-on-a-Chips on different platforms for marker-based and label-free biophotonic sensor applications. Our chips are based on polymers and fabricated by mass production technologies to integrate microfluidic channels, optical waveguides and miniaturized lasers....

Biostability of an implantable glucose sensor chip

Science.gov (United States)

Fröhlich, M.; Birkholz, M.; Ehwald, K. E.; Kulse, P.; Fursenko, O.; Katzer, J.

2012-12-01

Surface materials of an implantable microelectronic chip intended for medical applications were evaluated with respect to their long-term stability in bio-environments. The sensor chip shall apply in a glucose monitor by operating as a microviscosimeter according to the principle of affinity viscosimetry. A monolithic integration of a microelectromechanical system (MEMS) into the sensor chip was successfully performed in a combined 0.25 μm CMOS/BiCMOS technology. In order to study material durability and biostability of the surfaces, sensor chips were exposed to various in vitro and in vivo tests. Corrosional damage of SiON, SiO2 and TiN surfaces was investigated by optical microscopy, ellipsometry and AFM. The results served for optimizing the Back-end-of-Line (BEoL) stack, from which the MEMS was prepared. Corrosion of metal lines could significantly be reduced by improving the topmost passivation layer. The experiments revealed no visible damage of the actuator or other functionally important MEMS elements. Sensor chips were also exposed to human body fluid for three month by implantation into the abdomen of a volunteer. Only small effects were observed for layer thickness and Ra roughness after explantation. In particular, TiN as used for the actuator beam showed no degradation by biocorrosion. The highest degradation rate of about 50 nm per month was revealed for the SiON passivation layer. These results suggest that the sensor chip may safely operate in subcutaneous tissue for a period of several months.

Biostability of an implantable glucose sensor chip

International Nuclear Information System (INIS)

Fröhlich, M; Ehwald, K E; Kulse, P; Fursenko, O; Katzer, J; Birkholz, M

2012-01-01

Surface materials of an implantable microelectronic chip intended for medical applications were evaluated with respect to their long-term stability in bio-environments. The sensor chip shall apply in a glucose monitor by operating as a microviscosimeter according to the principle of affinity viscosimetry. A monolithic integration of a microelectromechanical system (MEMS) into the sensor chip was successfully performed in a combined 0.25 μm CMOS/BiCMOS technology. In order to study material durability and biostability of the surfaces, sensor chips were exposed to various in vitro and in vivo tests. Corrosional damage of SiON, SiO 2 and TiN surfaces was investigated by optical microscopy, ellipsometry and AFM. The results served for optimizing the Back-end-of-Line (BEoL) stack, from which the MEMS was prepared. Corrosion of metal lines could significantly be reduced by improving the topmost passivation layer. The experiments revealed no visible damage of the actuator or other functionally important MEMS elements. Sensor chips were also exposed to human body fluid for three month by implantation into the abdomen of a volunteer. Only small effects were observed for layer thickness and R a roughness after explantation. In particular, TiN as used for the actuator beam showed no degradation by biocorrosion. The highest degradation rate of about 50 nm per month was revealed for the SiON passivation layer. These results suggest that the sensor chip may safely operate in subcutaneous tissue for a period of several months.

Experiment list: SRX262781 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available _name=NIH3T3_SRF_15 || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=SRF || chip antibody vendor=Santa Cruz Biotec...hnology http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/e

Experiment list: SRX262786 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available H3T3_MRTFA_15 || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=MRTF-A || chip antibody vendor=Santa Cruz Biotechno...logy http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/each

Experiment list: SRX262791 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available IH3T3_MRTFB_LAT || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=MRTF-B || chip antibody vendor=Santa Cruz Biotech...nology http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/ea

Experiment list: SRX262782 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available echnology http://dbarchive.biosciencedbc.jp/kyushu-u/mm9...ce_name=NIH3T3_SRF_15 || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=SRF || chip antibody vendor=Santa Cruz Biot

Experiment list: SRX262788 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available IH3T3_MRTFA_UO || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=MRTF-A || chip antibody vendor=Santa Cruz Biotechn...ology http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/eac

Experiment list: SRX262787 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available IH3T3_MRTFA_LAT || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=MRTF-A || chip antibody vendor=Santa Cruz Biotech...nology http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/ea

Experiment list: SRX262780 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available chnology http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/...e_name=NIH3T3_SRF_03 || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=SRF || chip antibody vendor=Santa Cruz Biote

Selection of aptamers specific for glycated hemoglobin and total hemoglobin using on-chip SELEX.

Science.gov (United States)

Lin, Hsin-I; Wu, Ching-Chu; Yang, Ching-Hsuan; Chang, Ko-Wei; Lee, Gwo-Bin; Shiesh, Shu-Chu

2015-01-21

Blood glycated hemoglobin (HbA1c) levels reflecting average glucose concentrations over the past three months are fundamental for the diagnosis, monitoring, and risk assessment of diabetes. It has been hypothesized that aptamers, which are single-stranded DNAs or RNAs that demonstrate high affinity to a large variety of molecules ranging from small drugs, metabolites, or proteins, could be used for the measurement of HbA1c. Aptamers are selected through an in vitro process called systematic evolution of ligands by exponential enrichment (SELEX), and they can be chemically synthesized with high reproducibility at relatively low costs. This study therefore aimed to select HbA1c- and hemoglobin (Hb)-specific single-stranded DNA aptamers using an on-chip SELEX protocol. A microfluidic SELEX chip was developed to continuously and automatically carry out multiple rounds of SELEX to screen specific aptamers for HbA1c and Hb. HbA1c and Hb were first coated onto magnetic beads. Following several rounds of selection and enrichment with a randomized 40-mer DNA library, specific oligonucleotides were selected. The binding specificity and affinity were assessed by competitive and binding assays. Using the developed microfluidic system, the incubation and partitioning times were greatly decreased, and the entire process was shortened dramatically. Both HbA1c- and Hb-specific aptamers selected by the microfluidic system showed high specificity and affinity (dissociation constant, Kd = 7.6 ± 3.0 nM and 7.3 ± 2.2 nM for HbA1c and Hb, respectively). With further refinements in the assay, these aptamers may replace the conventional antibodies for in vitro diagnostics applications in the near future.

3D Printing of Organs-On-Chips.

Science.gov (United States)

Yi, Hee-Gyeong; Lee, Hyungseok; Cho, Dong-Woo

2017-01-25

Organ-on-a-chip engineering aims to create artificial living organs that mimic the complex and physiological responses of real organs, in order to test drugs by precisely manipulating the cells and their microenvironments. To achieve this, the artificial organs should to be microfabricated with an extracellular matrix (ECM) and various types of cells, and should recapitulate morphogenesis, cell differentiation, and functions according to the native organ. A promising strategy is 3D printing, which precisely controls the spatial distribution and layer-by-layer assembly of cells, ECMs, and other biomaterials. Owing to this unique advantage, integration of 3D printing into organ-on-a-chip engineering can facilitate the creation of micro-organs with heterogeneity, a desired 3D cellular arrangement, tissue-specific functions, or even cyclic movement within a microfluidic device. Moreover, fully 3D-printed organs-on-chips more easily incorporate other mechanical and electrical components with the chips, and can be commercialized via automated massive production. Herein, we discuss the recent advances and the potential of 3D cell-printing technology in engineering organs-on-chips, and provides the future perspectives of this technology to establish the highly reliable and useful drug-screening platforms.

Chip-based microtrap arrays for cold polar molecules

Science.gov (United States)

Hou, Shunyong; Wei, Bin; Deng, Lianzhong; Yin, Jianping

2017-12-01

Compared to the atomic chip, which has been a powerful platform to perform an astonishing range of applications from rapid Bose-Einstein condensate (BEC) production to the atomic clock, the molecular chip is only in its infant stages. Recently a one-dimensional electric lattice was demonstrated to trap polar molecules on a chip. This excellent work opens up the way to building a molecular chip laboratory. Here we propose a two-dimensional (2D) electric lattice on a chip with concise and robust structure, which is formed by arrays of squared gold wires. Arrays of microtraps that originate in the microsize electrodes offer a steep gradient and thus allow for confining both light and heavy polar molecules. Theoretical analysis and numerical calculations are performed using two types of sample molecules, N D3 and SrF, to justify the possibility of our proposal. The height of the minima of the potential wells is about 10 μm above the surface of the chip and can be easily adjusted in a wide range by changing the voltages applied on the electrodes. These microtraps offer intriguing perspectives for investigating cold molecules in periodic potentials, such as quantum computing science, low-dimensional physics, and some other possible applications amenable to magnetic or optical lattice. The 2D adjustable electric lattice is expected to act as a building block for a future gas-phase molecular chip laboratory.

An Energy-Efficient Reconfigurable Circuit Switched Network-on-Chip

NARCIS (Netherlands)

Wolkotte, P.T.; Smit, Gerardus Johannes Maria; Rauwerda, G.K.; Smit, L.T.

Network-on-Chip (NoC) is an energy-efficient on-chip communication architecture for multi-tile System-on-Chip (SoC) architectures. The SoC architecture, including its run-time software, can replace inflexible ASICs for future ambient systems. These ambient systems have to be flexible as well as

Energy Model of Networks-on-Chip and a Bus

NARCIS (Netherlands)

Wolkotte, P.T.; Smit, Gerardus Johannes Maria; Kavaldjiev, N.K.; Becker, Jens E.; Becker, Jürgen; Nurmi, J.; Takala, J.; Hamalainen, T.D.

2005-01-01

A Network-on-Chip (NoC) is an energy-efficient onchip communication architecture for Multi-Processor Systemon-Chip (MPSoC) architectures. In earlier papers we proposed two Network-on-Chip architectures based on packet-switching and circuit-switching. In this paper we derive an energy model for both

Fisetin inhibits epidermal growth factor-induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression.

Science.gov (United States)

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa

2017-01-01

Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.

Experiment list: SRX262797 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 3T3_SAP1_03 || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=SAP-1a || chip antibody vendor=Santa Cruz Biotechnolo...gy http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/eachDa

Experiment list: SRX262799 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available H3T3_SAP1_LAT || cell line=NIH3T3 fibroblasts || genotype=normal || chip antibody=SAP-1a || chip antibody vendor=Santa Cruz Biotechno...logy http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/each

Experiment list: SRX352046 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available SM1232564: CSB M CHIP; Homo sapiens; ChIP-Seq source_name=fibroblast_menadione_CSB-ChIP || cell type=fibroblast || treated with=menad...ione || chip antibody=Mouse monoclonal anti-CSB N Terminus (1B1) http://dbarchive.b

Microneedle Array Interface to CE on Chip

NARCIS (Netherlands)

Lüttge, Regina; Gardeniers, Johannes G.E.; Vrouwe, E.X.; van den Berg, Albert; Northrup, M.A.; Jensen, K.F; Harrison, D.J.

2003-01-01

This paper presents a microneedle array sampler interfaced to a capillary electrophoresis (CE) glass chip with integrated conductivity detection electrodes. A solution of alkali ions was electrokinetically loaded through the microneedles onto the chip and separation was demonstrated compared to a

Experiment list: SRX144526 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available stein-Barr Virus transformed 11803840,92.5,91.6,38 GSM922971: NRF2 ChIP vehicle treated rep2; Homo sapiens; ...ChIP-Seq source_name=NRF2 ChIP vehicle treated || biomaterial_provider=Coriell; h

Experiment list: SRX151245 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 0: CTCF ChIPSeq; Homo sapiens; ChIP-Seq source_name=BCBL1 pleural effusion lymphoma, CTCF ChIP || cell line=...BCBL1 || cell type=KSHV-infected pleural effusion lymphoma cells || chip antibody=rabbit anti-CTCF || antibo

Synthesis of on-chip control circuits for mVLSI biochips

DEFF Research Database (Denmark)

Potluri, Seetal; Schneider, Alexander Rüdiger; Hørslev-Petersen, Martin

2017-01-01

them to laboratory environments. To address this issue, researchers have proposed methods to reduce the number of offchip pressure sources, through integration of on-chip pneumatic control logic circuits fabricated using three-layer monolithic membrane valve technology. Traditionally, mVLSI biochip......-chip control circuit design and (iii) the integration of on-chip control in the placement and routing design tasks. In this paper we present a design methodology for logic synthesis and physical synthesis of mVLSI biochips that use on-chip control. We show how the proposed methodology can be successfully...... applied to generate biochip layouts with integrated on-chip pneumatic control....

Experiment list: SRX150568 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available is=Adenocarcinoma 59265240,72.4,16.4,4779 GSM935489: Harvard ChipSeq HeLa-S3 RPC155 std source_name=HeLa-S3 ...|| biomaterial_provider=ATCC || lab=Harvard || lab description=Struhl - Harvard University || datatype=ChipS

Experiment list: SRX150661 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available is=Adenocarcinoma 59396606,71.7,11.1,1200 GSM935582: Harvard ChipSeq HeLa-S3 BRF1 std source_name=HeLa-S3 ||... biomaterial_provider=ATCC || lab=Harvard || lab description=Struhl - Harvard University || datatype=ChipSeq

Experiment list: SRX150495 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available is=Adenocarcinoma 62508352,67.6,8.4,1556 GSM935416: Harvard ChipSeq HeLa-S3 ZZZ3 std source_name=HeLa-S3 || ...biomaterial_provider=ATCC || lab=Harvard || lab description=Struhl - Harvard University || datatype=ChipSeq

Experiment list: SRX150565 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available =Adenocarcinoma 54953593,74.3,12.2,1703 GSM935486: Harvard ChipSeq HeLa-S3 BDP1 std source_name=HeLa-S3 || b...iomaterial_provider=ATCC || lab=Harvard || lab description=Struhl - Harvard University || datatype=ChipSeq |

Performance evaluation of chip seals in Idaho.

Science.gov (United States)

2010-08-01

The intent of this research project is to identify a wide variety of parameters that influence the performance of pavements treated via chip seals within the State of Idaho. Chip sealing is currently one of the most popular methods of maintenance for...

Experiment list: SRX507380 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available + (wildtype) || age of animals=1-5 day old || tissue=Ovaries || chip antibody=anti-HP1 || chip antibody vend...1770: WT anti-HP1- replicate#2; Drosophila melanogaster; ChIP-Seq source_name=WT_WT_anti-HP1 || strain=piwi/

Experiment list: SRX176054 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available nosis=Carcinoma 13338805,91.2,4.9,792 GSM984386: LNCAP AR vehicle; Homo sapiens; ChIP-Seq source_name=prosta...te cancer cells || cell line=LNCaP || chip antibody=AR || chip antibody manufacturer=Abcam || treatment=EtOH vehicle

Experiment list: SRX144525 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available neage=mesoderm|Description=parental cell type to lymphoblastoid cell lines 14487710,85.8,82.8,188 GSM922970: NRF2 ChIP vehicle... treated rep1; Homo sapiens; ChIP-Seq source_name=NRF2 ChIP vehicle treated || biomaterial

Experiment list: SRX144524 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available neage=mesoderm|Description=parental cell type to lymphoblastoid cell lines 4766716,6.2,89.4,0 GSM922969: NRF2 ChIP vehicle... treated pilot; Homo sapiens; ChIP-Seq source_name=NRF2 ChIP vehicle treated || biomaterial_pr

Experiment list: SRX151246 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 11: SMC1 ChIPSeq; Homo sapiens; ChIP-Seq source_name=BCBL1 pleural effusion lymphoma, SMC1 ChIP || cell line...=BCBL1 || cell type=KSHV-infected pleural effusion lymphoma cells || chip antibody=rabbit anti-SMC1 || antib

New generation of single-chip microcomputers focused on cost performance

Energy Technology Data Exchange (ETDEWEB)

Akao, Y.; Iwashita, H. (Hitachi, Ltd., Tokyo (Japan))

1993-06-01

A single-chip microcomputer which incorporates a CPU (central processing unit), memory, and peripheral functions in one chip has been increasingly applied to various fields as the heart of electronic equipment in terms of its economy, compactness, lightness, and suitability for mass production. In response to a wide variety of needs, a lineup must have substantial breadth with regard to performance, on-chip memory capacity, on-chip peripheral functions, operating voltage, and packaging. In particular, low-voltage high-speed operation, high integration, expanded address space, and improved software productivity, which are required for mobile communication terminals, are the common needs for single-chip microcomputers. In accordance with these needs, Hitachi has been actively developing new products. The present paper introduces Hitachi's lineup of single-chip microcomputers. 10 figs., 1 tab.

Experiment list: SRX150586 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available -Barr Virus 33195472,90.4,25.9,15633 GSM935507: Harvard ChipSeq GM12878 NF-YB IgG-mus source_name=GM12878 ||...?PgId=165&q=GM12878 || lab=Harvard || lab description=Struhl - Harvard University || datatype=ChipSeq || dat

Experiment list: SRX150496 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ein-Barr Virus 63040797,85.0,19.7,1435 GSM935417: Harvard ChipSeq GM12878 SPT20 std source_name=GM12878 || b...gId=165&q=GM12878 || lab=Harvard || lab description=Struhl - Harvard University || datatype=ChipSeq || datat

Experiment list: SRX150585 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available -Barr Virus 32926476,94.0,12.0,2668 GSM935506: Harvard ChipSeq GM12878 NF-YA IgG-mus source_name=GM12878 || ...PgId=165&q=GM12878 || lab=Harvard || lab description=Struhl - Harvard University || datatype=ChipSeq || data

A Chip for an Implantable Neural Stimulator

DEFF Research Database (Denmark)

Gudnason, Gunnar; Bruun, Erik; Haugland, Morten

2000-01-01

This paper describes a chip for a multichannel neural stimulator for functional electrical stimulation (FES). The purpose of FES is to restore muscular control in disabled patients. The chip performs all the signal processing required in an implanted neural stimulator. The power and digital data...

Experiment list: SRX153146 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available -Seq source_name=Human breast adenocarcinoma cell-line MCF7 || cell-line=MCF7 || passage=5 || chip antibody=...n=Pleura|Tissue Diagnosis=Adenocarcinoma 60170246,98.4,5.7,16756 GSM946850: MCF7 H3K27ac; Homo sapiens; ChIP

Experiment list: SRX176063 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available =Carcinoma 11279321,95.5,3.6,13985 GSM984395: LNCAP ACH3 vehicle; Homo sapiens; ChIP-Seq source_name=prostat...e cancer cells || cell line=LNCaP || chip antibody=AcH3 || chip antibody manufacturer=Millipore || treatment=EtOH vehicle

Experiment list: SRX176057 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available nosis=Carcinoma 21582823,90.1,7.3,1074 GSM984389: 22RV1 AR vehicle; Homo sapiens; ChIP-Seq source_name=prost...ate cancer cells || cell line=22RV1 || chip antibody=AR || chip antibody manufacturer=Abcam || treatment=EtOH vehicle

Experiment list: SRX144527 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available neage=mesoderm|Description=parental cell type to lymphoblastoid cell lines 8704444,92.1,92.5,9 GSM922972: NRF2 ChIP vehicle... treated rep3; Homo sapiens; ChIP-Seq source_name=NRF2 ChIP vehicle treated || biomaterial_pr

Experiment list: SRX160914 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available M970829: IgG for KSHV LANA; Homo sapiens; ChIP-Seq source_name=BCBL1 pleural effusion lymphoma, IgG ChIP || ...cell line=BCBL1 || cell type=KSHV-infected pleural effusion lymphoma cells || chip antibody=Rabbit IgG [Sant

Experiment list: SRX160915 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available M970828: IgG for CTCF SMC1; Homo sapiens; ChIP-Seq source_name=BCBL1 pleural effusion lymphoma, IgG ChIP || ...cell line=BCBL1 || cell type=KSHV-infected pleural effusion lymphoma cells || chip antibody=Mouse IgG [Santa

Ion Chromatography-on-a-chip for Water Quality Analysis

Science.gov (United States)

Kidd, R. D.; Noell, A.; Kazarians, G.; Aubrey, A. D.; Scianmarello, N.; Tai, Y.-C.

2015-01-01

We report progress towards developing a Micro-Electro-Mechanical Systems (MEMS)- based ion chromatograph (IC) for crewed spacecraft water analysis. This IC-chip is an offshoot of a NASA-funded effort to produce a high performance liquid chromatograph (HPLC)-chip. This HPLC-chip system would require a desalting (i.e. ion chromatography) step. The complete HPLC instrument consists of the Jet Propulsion Labortory's (JPL's) quadrupole ion trap mass spectrometer integrated with a state-of-the-art MEMS liquid chromatograph (LC) system developed by the California Institute of Technology's (Caltech's) Micromachining Laboratory. The IC version of the chip consist of an electrolysis-based injector, a separation column, two electrolysis pumps for gradient generation, mixer, and a built-in conductivity detector. The HPLC version of the chip also includes a nanospray tip. The low instrument mass, coupled with its high analytical capabilities, makes the LC chip ideally suitable for wide range of applications such as trace contaminant, inorganic analytical science and, when coupled to a mass spectrometer, a macromolecular detection system for either crewed space exploration vehicles or robotic planetary missions.

3D Printing of Organs-On-Chips

Science.gov (United States)

Yi, Hee-Gyeong; Lee, Hyungseok; Cho, Dong-Woo

2017-01-01

Organ-on-a-chip engineering aims to create artificial living organs that mimic the complex and physiological responses of real organs, in order to test drugs by precisely manipulating the cells and their microenvironments. To achieve this, the artificial organs should to be microfabricated with an extracellular matrix (ECM) and various types of cells, and should recapitulate morphogenesis, cell differentiation, and functions according to the native organ. A promising strategy is 3D printing, which precisely controls the spatial distribution and layer-by-layer assembly of cells, ECMs, and other biomaterials. Owing to this unique advantage, integration of 3D printing into organ-on-a-chip engineering can facilitate the creation of micro-organs with heterogeneity, a desired 3D cellular arrangement, tissue-specific functions, or even cyclic movement within a microfluidic device. Moreover, fully 3D-printed organs-on-chips more easily incorporate other mechanical and electrical components with the chips, and can be commercialized via automated massive production. Herein, we discuss the recent advances and the potential of 3D cell-printing technology in engineering organs-on-chips, and provides the future perspectives of this technology to establish the highly reliable and useful drug-screening platforms. PMID:28952489

Emission of organic substances from chip-boards

Energy Technology Data Exchange (ETDEWEB)

Deppe, H.J.

1982-01-01

A relatively small number of investigations on emissions of organic substances from chip-board is available up to now. The emissions known to date are caused by glues or other additives rather than by the wood itself. As concerns aminoplast glues (urea-formaldehyde or melamine-formaldehyde resins) the most important point of public interest has been the off-gassing of formaldehyde from chip-board. Chip-board with phenol-formaldehyde glues has been known in some cases to give off phenol. The formation of diamino diphenyl methane from isocyanate glues is still a matter of discussion. A further source for possible emissions are wood and fire protectives which are added during the manufacturing process. Finally, coating of chip-board may lead to emissions of organic substances. The lack of adequate detection methods has so far delayed the treatment of questions in relation to emissions from chip-board. Even now, there are numerous problems in this field especially when investigating isocyanate glues. Problems in relation to the origin of emissions due to the kind of glue used and the manufacturing process are discussed, and proposals are made how to solve some of these problems. The question of the health risk is dealt with from the view-point of the civil engineer and in an general economic context.

3D Printing of Organs-On-Chips

Directory of Open Access Journals (Sweden)

Hee-Gyeong Yi

2017-01-01

Full Text Available Organ-on-a-chip engineering aims to create artificial living organs that mimic the complex and physiological responses of real organs, in order to test drugs by precisely manipulating the cells and their microenvironments. To achieve this, the artificial organs should to be microfabricated with an extracellular matrix (ECM and various types of cells, and should recapitulate morphogenesis, cell differentiation, and functions according to the native organ. A promising strategy is 3D printing, which precisely controls the spatial distribution and layer-by-layer assembly of cells, ECMs, and other biomaterials. Owing to this unique advantage, integration of 3D printing into organ-on-a-chip engineering can facilitate the creation of micro-organs with heterogeneity, a desired 3D cellular arrangement, tissue-specific functions, or even cyclic movement within a microfluidic device. Moreover, fully 3D-printed organs-on-chips more easily incorporate other mechanical and electrical components with the chips, and can be commercialized via automated massive production. Herein, we discuss the recent advances and the potential of 3D cell-printing technology in engineering organs-on-chips, and provides the future perspectives of this technology to establish the highly reliable and useful drug-screening platforms.

Chip-Level Electromigration Reliability for Cu Interconnects

International Nuclear Information System (INIS)

Gall, M.; Oh, C.; Grinshpon, A.; Zolotov, V.; Panda, R.; Demircan, E.; Mueller, J.; Justison, P.; Ramakrishna, K.; Thrasher, S.; Hernandez, R.; Herrick, M.; Fox, R.; Boeck, B.; Kawasaki, H.; Haznedar, H.; Ku, P.

2004-01-01

Even after the successful introduction of Cu-based metallization, the electromigration (EM) failure risk has remained one of the most important reliability concerns for most advanced process technologies. Ever increasing operating current densities and the introduction of low-k materials in the backend process scheme are some of the issues that threaten reliable, long-term operation at elevated temperatures. The traditional method of verifying EM reliability only through current density limit checks is proving to be inadequate in general, or quite expensive at the best. A Statistical EM Budgeting (SEB) methodology has been proposed to assess more realistic chip-level EM reliability from the complex statistical distribution of currents in a chip. To be valuable, this approach requires accurate estimation of currents for all interconnect segments in a chip. However, no efficient technique to manage the complexity of such a task for very large chip designs is known. We present an efficient method to estimate currents exhaustively for all interconnects in a chip. The proposed method uses pre-characterization of cells and macros, and steps to identify and filter out symmetrically bi-directional interconnects. We illustrate the strength of the proposed approach using a high-performance microprocessor design for embedded applications as a case study

An automatic chip structure optical inspection system for electronic components

Science.gov (United States)

Song, Zhichao; Xue, Bindang; Liang, Jiyuan; Wang, Ke; Chen, Junzhang; Liu, Yunhe

2018-01-01

An automatic chip structure inspection system based on machine vision is presented to ensure the reliability of electronic components. It consists of four major modules, including a metallographic microscope, a Gigabit Ethernet high-resolution camera, a control system and a high performance computer. An auto-focusing technique is presented to solve the problem that the chip surface is not on the same focusing surface under the high magnification of the microscope. A panoramic high-resolution image stitching algorithm is adopted to deal with the contradiction between resolution and field of view, caused by different sizes of electronic components. In addition, we establish a database to storage and callback appropriate parameters to ensure the consistency of chip images of electronic components with the same model. We use image change detection technology to realize the detection of chip images of electronic components. The system can achieve high-resolution imaging for chips of electronic components with various sizes, and clearly imaging for the surface of chip with different horizontal and standardized imaging for ones with the same model, and can recognize chip defects.

Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome.

Science.gov (United States)

Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette

2012-10-01

Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

Experiment list: SRX153147 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available -Seq source_name=Human breast adenocarcinoma cell-line MCF7 || cell-line=MCF7 || passage=5 || chip antibody=...on=Pleura|Tissue Diagnosis=Adenocarcinoma 64054379,98.7,5.2,764 GSM946851: MCF7 H3K27me3; Homo sapiens; ChIP

Experiment list: SRX153148 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available -Seq source_name=Human breast adenocarcinoma cell-line MCF7 || cell-line=MCF7 || passage=5 || chip antibody=...n=Pleura|Tissue Diagnosis=Adenocarcinoma 57306360,95.7,15.1,2666 GSM946852: MCF7 H3K9me3; Homo sapiens; ChIP

On-chip integrated lasers for biophotonic applications

DEFF Research Database (Denmark)

Mappes, Timo; Wienhold, Tobias; Bog, Uwe

Meeting the need of biomedical users, we develop disposable Lab-on-a-Chip systems based on commercially available polymers. We are combining passive microfluidics with active optical elements on-chip by integrating multiple solid-state and liquid-core lasers. While covering a wide range of laser ...

‘Chip-olate’ and dry-film resists for efficient fabrication, singulation and sealing of microfluidic chips

Science.gov (United States)

Temiz, Yuksel; Delamarche, Emmanuel

2014-09-01

This paper describes a technique for high-throughput fabrication and efficient singulation of chips having closed microfluidic structures and takes advantage of dry-film resists (DFRs) for efficient sealing of capillary systems. The technique is illustrated using 4-inch Si/SiO2 wafers. Wafers carrying open microfluidic structures are partially diced to about half of their thickness. Treatments such as surface cleaning are done at wafer-level, then the structures are sealed using low-temperature (45 °C) lamination of a DFR that is pre-patterned using a craft cutter, and ready-to-use chips are finally separated manually like a chocolate bar by applying a small force (≤ 4 N). We further show that some DFRs have low auto-fluorescence at wavelengths typically used for common fluorescent dyes and that mechanical properties of some DFRs allow for the lamination of 200 μm wide microfluidic structures with negligible sagging (~1 μm). The hydrophilicity (advancing contact angle of ~60°) of the DFR supports autonomous capillary-driven flow without the need for additional surface treatment of the microfluidic chips. Flow rates from 1 to 5 µL min-1 are generated using different geometries of channels and capillary pumps. In addition, the ‘chip-olate’ technique is compatible with the patterning of capture antibodies on DFR for use in immunoassays. We believe this technique to be applicable to the fabrication of a wide range of microfluidic and lab-on-a-chip devices and to offer a viable alternative to many labor-intensive processes that are currently based on wafer bonding techniques or on the molding of poly(dimethylsiloxane) (PDMS) layers.

Aflatoxin-producing Aspergillus spp. and aflatoxin levels in stored cassava chips as affected by processing practices

DEFF Research Database (Denmark)

Essono, G.; Ayodele, M.; Akoa, A.

2009-01-01

. The levels of aflatoxin ranged between 5.2 and 14.5 ppb. The distribution of aflatoxin in positive samples depended on 8 parameters including pH, moisture content, storage duration, types of chips, level of contamination by aflatoxin-producing fungi, processing practices and storage facilities. From analysis......), followed by A. nomius (58 isolates in 15 samples), whereas A. parasiticus was rarest. A direct competitive Enzyme-linked immunosorbent assay (ELISA)-based method was implemented to quantify the content in aflatoxins. Eighteen of the samples contained some aflatoxins at detectable levels whereas 54 did not...... of variance results, only pH (p levels were...

Error Control for Network-on-Chip Links

CERN Document Server

Fu, Bo

2012-01-01

As technology scales into nanoscale regime, it is impossible to guarantee the perfect hardware design. Moreover, if the requirement of 100% correctness in hardware can be relaxed, the cost of manufacturing, verification, and testing will be significantly reduced. Many approaches have been proposed to address the reliability problem of on-chip communications. This book focuses on the use of error control codes (ECCs) to improve on-chip interconnect reliability. Coverage includes detailed description of key issues in NOC error control faced by circuit and system designers, as well as practical error control techniques to minimize the impact of these errors on system performance. Provides a detailed background on the state of error control methods for on-chip interconnects; Describes the use of more complex concatenated codes such as Hamming Product Codes with Type-II HARQ, while emphasizing integration techniques for on-chip interconnect links; Examines energy-efficient techniques for integrating multiple error...

On-chip cellomics assay enabling algebraic and geometric understanding of epigenetic information in cellular networks of living systems. 1. Temporal aspects of epigenetic information in bacteria.

Science.gov (United States)

Yasuda, Kenji

2012-01-01

A series of studies aimed at developing methods and systems of analyzing epigenetic information in cells and in cell networks, as well as that of genetic information, was examined to expand our understanding of how living systems are determined. Because cells are minimum units reflecting epigenetic information, which is considered to map the history of a parallel-processing recurrent network of biochemical reactions, their behaviors cannot be explained by considering only conventional DNA information-processing events. The role of epigenetic information on cells, which complements their genetic information, was inferred by comparing predictions from genetic information with cell behaviour observed under conditions chosen to reveal adaptation processes, population effects and community effects. A system of analyzing epigenetic information was developed starting from the twin complementary viewpoints of cell regulation as an "algebraic" system (emphasis on temporal aspects) and as a "geometric" system (emphasis on spatial aspects). Exploiting the combination of latest microfabrication technology and measurement technologies, which we call on-chip cellomics assay, we can control and re-construct the environments and interaction of cells from "algebraic" and "geometric" viewpoints. In this review, temporal viewpoint of epigenetic information, a part of the series of single-cell-based "algebraic" and "geometric" studies of celluler systems in our research groups, are summerized and reported. The knowlege acquired from this study may lead to the use of cells that fully control practical applications like cell-based drug screening and the regeneration of organs.

Chip cleaning and regeneration for electrochemical sensor arrays

Energy Technology Data Exchange (ETDEWEB)

Bhalla, Vijayender [Biochemistry Department ' G.Moruzzi' , University of Bologna, Via Irnerio 48, 40126 Bologna (Italy); Carrara, Sandro, E-mail: sandro.carrara@epfl.c [Biochemistry Department ' G.Moruzzi' , University of Bologna, Via Irnerio 48, 40126 Bologna (Italy); Stagni, Claudio [Department DEIS, University of Bologna, viale Risorgimento 2, 40136 Bologna (Italy); Samori, Bruno [Biochemistry Department ' G.Moruzzi' , University of Bologna, Via Irnerio 48, 40126 Bologna (Italy)

2010-04-02

Sensing systems based on electrochemical detection have generated great interest because electronic readout may replace conventional optical readout in microarray. Moreover, they offer the possibility to avoid labelling for target molecules. A typical electrochemical array consists of many sensing sites. An ideal micro-fabricated sensor-chip should have the same measured values for all the equivalent sensing sites (or spots). To achieve high reliability in electrochemical measurements, high quality in functionalization of the electrodes surface is essential. Molecular probes are often immobilized by using alkanethiols onto gold electrodes. Applying effective cleaning methods on the chip is a fundamental requirement for the formation of densely-packed and stable self-assembly monolayers. However, the available well-known techniques for chip cleaning may not be so reliable. Furthermore, it could be necessary to recycle the chip for reuse. Also in this case, an effective recycling technique is required to re-obtain well cleaned sensing surfaces on the chip. This paper presents experimental results on the efficacy and efficiency of the available techniques for initial cleaning and further recycling of micro-fabricated chips. Piranha, plasma, reductive and oxidative cleaning methods were applied and the obtained results were critically compared. Some interesting results were attained by using commonly considered cleaning methodologies. This study outlines oxidative electrochemical cleaning and recycling as the more efficient cleaning procedure for electrochemical based sensor arrays.

FISH & CHIPS: Four Electrode Conductivity / Salinity Sensor on a Silicon Multi-sensor chip for Fisheries Research

DEFF Research Database (Denmark)

Hyldgård, Anders; Olafsdottir, Iris; Olesen, M.

2005-01-01

The design and fabrication of a single chip silicon salinity, temperature, pressure and light multisensor is presented. The behavior 2- and 4-electrode conductivity microsensors are described and methods for precise determination of water conductivity are given......The design and fabrication of a single chip silicon salinity, temperature, pressure and light multisensor is presented. The behavior 2- and 4-electrode conductivity microsensors are described and methods for precise determination of water conductivity are given...

Teaching Quality Control with Chocolate Chip Cookies

Science.gov (United States)

Baker, Ardith

2014-01-01

Chocolate chip cookies are used to illustrate the importance and effectiveness of control charts in Statistical Process Control. By counting the number of chocolate chips, creating the spreadsheet, calculating the control limits and graphing the control charts, the student becomes actively engaged in the learning process. In addition, examining…

Exploration within the Network-on-Chip Paradigm

NARCIS (Netherlands)

Wolkotte, P.T.

2009-01-01

A general purpose processor used to consist of a single processing core, which performed and controlled all tasks on the chip. Its functionality and maximum clock frequency grew steadily over the years. Due to the continuous increase of the number of transistors available on-chip and the operational

Experiment list: SRX119679 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 8,18360 GSM874985: ES.H3K27me3; Homo sapiens; ChIP-Seq source_name=H1 human Embryonic stem cells || cell line=H1 || treatment=diagnos...tic sample (pre-treatment) || chip antibody=H3K27me3 || chip antibody manufacturer=

Experiment list: SRX119684 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 2,13603 GSM874990: ES.H3K79me2; Homo sapiens; ChIP-Seq source_name=H1 human Embryonic stem cell || cell line=H1 || treatment=diagnost...ic sample (pre-treatment) || chip antibody=H3K79me2 || chip antibody manufacturer=A

Self-powered integrated systems-on-chip (energy chip)

KAUST Repository

Hussain, Muhammad Mustafa

2010-04-23

In today\\'s world, consumer driven technology wants more portable electronic gadgets to be developed, and the next big thing in line is self-powered handheld devices. Therefore to reduce the power consumption as well as to supply sufficient power to run those devices, several critical technical challenges need to be overcome: a. Nanofabrication of macro/micro systems which incorporates the direct benefit of light weight (thus portability), low power consumption, faster response, higher sensitivity and batch production (low cost). b. Integration of advanced nano-materials to meet the performance/cost benefit trend. Nano-materials may offer new functionalities that were previously underutilized in the macro/micro dimension. c. Energy efficiency to reduce power consumption and to supply enough power to meet that low power demand. We present a pragmatic perspective on a self-powered integrated System on Chip (SoC). We envision the integrated device will have two objectives: low power consumption/dissipation and on-chip power generation for implementation into handheld or remote technologies for defense, space, harsh environments and medical applications. This paper provides insight on materials choices, intelligent circuit design, and CMOS compatible integration.

Self-powered integrated systems-on-chip (energy chip)

Science.gov (United States)

Hussain, M. M.; Fahad, H.; Rojas, J.; Hasan, M.; Talukdar, A.; Oommen, J.; Mink, J.

2010-04-01

In today's world, consumer driven technology wants more portable electronic gadgets to be developed, and the next big thing in line is self-powered handheld devices. Therefore to reduce the power consumption as well as to supply sufficient power to run those devices, several critical technical challenges need to be overcome: a. Nanofabrication of macro/micro systems which incorporates the direct benefit of light weight (thus portability), low power consumption, faster response, higher sensitivity and batch production (low cost). b. Integration of advanced nano-materials to meet the performance/cost benefit trend. Nano-materials may offer new functionalities that were previously underutilized in the macro/micro dimension. c. Energy efficiency to reduce power consumption and to supply enough power to meet that low power demand. We present a pragmatic perspective on a self-powered integrated System on Chip (SoC). We envision the integrated device will have two objectives: low power consumption/dissipation and on-chip power generation for implementation into handheld or remote technologies for defense, space, harsh environments and medical applications. This paper provides insight on materials choices, intelligent circuit design, and CMOS compatible integration.

A Neuron- and a Synapse Chip for Artificial Neural Networks

DEFF Research Database (Denmark)

Lansner, John; Lehmann, Torsten

1992-01-01

A cascadable, analog, CMOS chip set has been developed for hardware implementations of artificial neural networks (ANN's):I) a neuron chip containing an array of neurons with hyperbolic tangent activation functions and adjustable gains, and II) a synapse chip (or a matrix-vector multiplier) where...

A polymer chip-integrable piezoelectric micropump with low backpressure dependence

DEFF Research Database (Denmark)

Conde, A. J.; Bianchetti, A.; Veiras, F. E.

2015-01-01

We describe a piezoelectric micropump constructed in polymers with conventional machining methods. The micropump is self-contained and can be built as an independent device or as an on-chip module within laminated microfluidic chips. We demonstrate on-chip integrability by the fabrication and tes...

Ultrasensitive microfluidic solid-phase ELISA using an actuatable microwell-patterned PDMS chip.

Science.gov (United States)

Wang, Tanyu; Zhang, Mohan; Dreher, Dakota D; Zeng, Yong

2013-11-07

Quantitative detection of low abundance proteins is of significant interest for biological and clinical applications. Here we report an integrated microfluidic solid-phase ELISA platform for rapid and ultrasensitive detection of proteins with a wide dynamic range. Compared to the existing microfluidic devices that perform affinity capture and enzyme-based optical detection in a constant channel volume, the key novelty of our design is two-fold. First, our system integrates a microwell-patterned assay chamber that can be pneumatically actuated to significantly reduce the volume of chemifluorescent reaction, markedly improving the sensitivity and speed of ELISA. Second, monolithic integration of on-chip pumps and the actuatable assay chamber allow programmable fluid delivery and effective mixing for rapid and sensitive immunoassays. Ultrasensitive microfluidic ELISA was demonstrated for insulin-like growth factor 1 receptor (IGF-1R) across at least five orders of magnitude with an extremely low detection limit of 21.8 aM. The microwell-based solid-phase ELISA strategy provides an expandable platform for developing the next-generation microfluidic immunoassay systems that integrate and automate digital and analog measurements to further improve the sensitivity, dynamic ranges, and reproducibility of proteomic analysis.

Development of Indirect Competitive Immuno-Assay Method Using SPR Detection for Rapid and Highly Sensitive Measurement of Salivary Cortisol Levels

International Nuclear Information System (INIS)

Tahara, Yusuke; Huang, Zhe; Kiritoshi, Tetsuro; Onodera, Takeshi; Toko, Kiyoshi

2014-01-01

The monitoring of salivary cortisol as a key biomarker of an individual’s stress response has been increasingly focused on. This paper describes the development of a novel cortisol immuno-assay method based on an indirect competitive method using a commercially available surface plasmon resonance instrument. The surface of an Au chip was modified with PEG6-COOH aromatic dialkanethiol self-assembled monolayers and hydrocortisone 3-(O-carboxymethyl) oxime (hydrocortisone 3-CMO) as a cortisol analog. A detection limit of 38 ppt range with a measurement range of 10 ppt–100 ppb was accomplished without the incubation of a mixing solution consisting of standard cortisol and an anti-cortisol antibody, and the time for quantification of cortisol concentration was 8 min from the sample injection. We experimentally compared our immuno-assay with a commercialized salivary cortisol enzyme-linked immunosorbent assay (ELISA) kit using human saliva samples. It was found that the results obtained by the cortisol immuno-assay had a good correlation with those obtained by ELISA assay (R = 0.96). Our findings indicate the potential utility of the cortisol immuno-assay for measurements of human salivary cortisol levels.

Development of Indirect Competitive Immuno-Assay Method Using SPR Detection for Rapid and Highly Sensitive Measurement of Salivary Cortisol Levels

Energy Technology Data Exchange (ETDEWEB)

Tahara, Yusuke; Huang, Zhe; Kiritoshi, Tetsuro [Graduate School of Information Science and Electrical Engineering, Kyushu University, Fukuoka (Japan); Onodera, Takeshi [Research and Development Center for Taste and Odor Sensing, Kyushu University, Fukuoka (Japan); Toko, Kiyoshi, E-mail: toko@ed.kyushu-u.ac.jp [Graduate School of Information Science and Electrical Engineering, Kyushu University, Fukuoka (Japan); Research and Development Center for Taste and Odor Sensing, Kyushu University, Fukuoka (Japan)

2014-05-30

The monitoring of salivary cortisol as a key biomarker of an individual’s stress response has been increasingly focused on. This paper describes the development of a novel cortisol immuno-assay method based on an indirect competitive method using a commercially available surface plasmon resonance instrument. The surface of an Au chip was modified with PEG6-COOH aromatic dialkanethiol self-assembled monolayers and hydrocortisone 3-(O-carboxymethyl) oxime (hydrocortisone 3-CMO) as a cortisol analog. A detection limit of 38 ppt range with a measurement range of 10 ppt–100 ppb was accomplished without the incubation of a mixing solution consisting of standard cortisol and an anti-cortisol antibody, and the time for quantification of cortisol concentration was 8 min from the sample injection. We experimentally compared our immuno-assay with a commercialized salivary cortisol enzyme-linked immunosorbent assay (ELISA) kit using human saliva samples. It was found that the results obtained by the cortisol immuno-assay had a good correlation with those obtained by ELISA assay (R = 0.96). Our findings indicate the potential utility of the cortisol immuno-assay for measurements of human salivary cortisol levels.

Determining wood chip size: image analysis and clustering methods

Directory of Open Access Journals (Sweden)

Paolo Febbi

2013-09-01

Full Text Available One of the standard methods for the determination of the size distribution of wood chips is the oscillating screen method (EN 15149- 1:2010. Recent literature demonstrated how image analysis could return highly accurate measure of the dimensions defined for each individual particle, and could promote a new method depending on the geometrical shape to determine the chip size in a more accurate way. A sample of wood chips (8 litres was sieved through horizontally oscillating sieves, using five different screen hole diameters (3.15, 8, 16, 45, 63 mm; the wood chips were sorted in decreasing size classes and the mass of all fractions was used to determine the size distribution of the particles. Since the chip shape and size influence the sieving results, Wang’s theory, which concerns the geometric forms, was considered. A cluster analysis on the shape descriptors (Fourier descriptors and size descriptors (area, perimeter, Feret diameters, eccentricity was applied to observe the chips distribution. The UPGMA algorithm was applied on Euclidean distance. The obtained dendrogram shows a group separation according with the original three sieving fractions. A comparison has been made between the traditional sieve and clustering results. This preliminary result shows how the image analysis-based method has a high potential for the characterization of wood chip size distribution and could be further investigated. Moreover, this method could be implemented in an online detection machine for chips size characterization. An improvement of the results is expected by using supervised multivariate methods that utilize known class memberships. The main objective of the future activities will be to shift the analysis from a 2-dimensional method to a 3- dimensional acquisition process.

Least cost supply strategies for wood chips

DEFF Research Database (Denmark)

Möller, Bernd

The abstract presents a study based on a geographical information system, which produce  cost-supply curves by location for forest woods chips in Denmark.......The abstract presents a study based on a geographical information system, which produce  cost-supply curves by location for forest woods chips in Denmark....

Experiment list: SRX507384 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available + (wildtype) || age of animals=1-5 day old || tissue=Ovaries || chip antibody=Anti-H3K4me2 || chip antibody ... Anti-H3K4me2- replicate#2; Drosophila melanogaster; ChIP-Seq source_name=WT_WT_Anti-H3K4me2 || strain=piwi/

Experiment list: SRX507382 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available + (wildtype) || age of animals=1-5 day old || tissue=Ovaries || chip antibody=Anti-H3K9me3 || chip antibody ... Anti-H3K9me3- replicate#2; Drosophila melanogaster; ChIP-Seq source_name=WT_WT_Anti-H3K9me3 || strain=piwi/

Experiment list: SRX037432 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available s from PBMC, normal || gender=male || cell type=aTconv cells || chip antibody=H3K4me1 || chip antibody vendo...=peripheral blood mononuclear cells 14792460,17.0,2.9,5804 GSM648494: aTconv-H3K4me1 source_name=aTconv cell

All-electronic droplet generation on-chip with real-time feedback control for EWOD digital microfluidics.

Science.gov (United States)

Gong, Jian; Kim, Chang-Jin C J

2008-06-01

Electrowetting-on-dielectric (EWOD) actuation enables digital (or droplet) microfluidics where small packets of liquids are manipulated on a two-dimensional surface. Due to its mechanical simplicity and low energy consumption, EWOD holds particular promise for portable systems. To improve volume precision of the droplets, which is desired for quantitative applications such as biochemical assays, existing practices would require near-perfect device fabrication and operation conditions unless the droplets are generated under feedback control by an extra pump setup off of the chip. In this paper, we develop an all-electronic (i.e., no ancillary pumping) real-time feedback control of on-chip droplet generation. A fast voltage modulation, capacitance sensing, and discrete-time PID feedback controller are integrated on the operating electronic board. A significant improvement is obtained in the droplet volume uniformity, compared with an open loop control as well as the previous feedback control employing an external pump. Furthermore, this new capability empowers users to prescribe the droplet volume even below the previously considered minimum, allowing, for example, 1 : x (x < 1) mixing, in comparison to the previously considered n : m mixing (i.e., n and m unit droplets).

ALL-ELECTRONIC DROPLET GENERATION ON-CHIP WITH REAL-TIME FEEDBACK CONTROL FOR EWOD DIGITIAL MICROFLUIDICS

Science.gov (United States)

Gong, Jian; Kim, Chang-Jin “CJ”

2009-01-01

Electrowetting-on-dielectric (EWOD) actuation enables digital (or droplet) microfluidics where small packets of liquids are manipulated on a two-dimensional surface. Due to its mechanical simplicity and low energy consumption, EWOD holds particular promise for portable systems. To improve volume precision of the droplets, which is desired for quantitative applications such as biochemical assays, existing practices would require near-perfect device fabricaion and operation conditions unless the droplets are generated under feedback control by an extra pump setup off of the chip. In this paper, we develop an all-electronic (i.e., no ancillary pumping) real-time feedback control of on-chip droplet generation. A fast voltage modulation, capacitance sensing, and discrete-time PID feedback controller are integrated on the operating electronic board. A significant improvement is obtained in the droplet volume uniformity, compared with an open loop control as well as the previous feedback control employing an external pump. Furthermore, this new capability empowers users to prescribe the droplet volume even below the previously considered minimum, allowing, for example, 1:x (x < 1) mixing, in comparison to the previously considered n:m mixing (i.e., n and m unit droplets). PMID:18497909

Diffusion driven optofluidic dye lasers encapsulated into polymer chips

DEFF Research Database (Denmark)

Wienhold, Tobias; Breithaupt, Felix; Vannahme, Christoph

2012-01-01

Lab-on-a-chip systems made of polymers are promising for the integration of active optical elements, enabling e.g. on-chip excitation of fluorescent markers or spectroscopy. In this work we present diffusion operation of tunable optofluidic dye lasers in a polymer foil. We demonstrate that these ......Lab-on-a-chip systems made of polymers are promising for the integration of active optical elements, enabling e.g. on-chip excitation of fluorescent markers or spectroscopy. In this work we present diffusion operation of tunable optofluidic dye lasers in a polymer foil. We demonstrate...... that these first order distributed feedback lasers can be operated for more than 90 min at a pulse repetition rate of 2 Hz without fluidic pumping. Ultra-high output pulse energies of more than 10 μJ and laser thresholds of 2 μJ are achieved for resonator lengths of 3 mm. By introducing comparatively large on......-chip dye solution reservoirs, the required exchange of dye molecules is accomplished solely by diffusion. Polymer chips the size of a microscope cover slip (18 × 18 mm2) were fabricated in batches on a wafer using a commercially available polymer (TOPAS® Cyclic Olefin Copolymer). Thermal imprinting...

Lab-on-a-Chip Magneto-Immunoassays: How to Ensure Contact between Superparamagnetic Beads and the Sensor Surface

Directory of Open Access Journals (Sweden)

Andreas Hütten

2013-09-01

Full Text Available Lab-on-a-chip immuno assays utilizing superparamagnetic beads as labels suffer from the fact that the majority of beads pass the sensing area without contacting the sensor surface. Different solutions, employing magnetic forces, ultrasonic standing waves, or hydrodynamic effects have been found over the past decades. The first category uses magnetic forces, created by on-chip conducting lines to attract beads towards the sensor surface. Modifications of the magnetic landscape allow for additional transport and separation of different bead species. The hydrodynamic approach uses changes in the channel geometry to enhance the capture volume. In acoustofluidics, ultrasonic standing waves force µm-sized particles onto a surface through radiation forces. As these approaches have their disadvantages, a new sensor concept that circumvents these problems is suggested. This concept is based on the granular giant magnetoresistance (GMR effect that can be found in gels containing magnetic nanoparticles. The proposed design could be realized in the shape of paper-based test strips printed with gel-based GMR sensors.

Prototype detection unit for the CHIPS experiment

Science.gov (United States)

Pfützner, Maciej M.

2017-09-01

CHIPS (CHerenkov detectors In mine PitS) is an R&D project aiming to develop novel cost-effective neutrino detectors, focused on measuring the CP-violating neutrino mixing phase (δ CP). A single detector module, containing an enclosed volume of purified water, would be submerged in an existing lake, located in a neutrino beam. A staged approach is proposed with first detectors deployed in a flooded mine pit in Northern Minnesota, 7 mrad off-axis from the existing NuMI beam. A small proof-of-principle model (CHIPS-M) has already been tested and the first stage of a fully functional 10 kt module (CHIPS-10) is planned for 2018. One of the instruments submerged on board of CHIPS-M in autumn 2015 was a prototype detection unit, constructed at Nikhef. The unit contains hardware borrowed from the KM3NeT experiment, including 16 3 inch photomultiplier tubes and readout electronics. In addition to testing the mechanical design and data acquisition, the detector was used to record a large sample of cosmic ray muon events. The collected data is valuable for characterising the cosmic muon background and validating a Monte Carlo simulation used to optimise future designs. This paper introduces the CHIPS project, describes the design of the prototype unit, and presents the results of a preliminary data analysis.

CHIP promotes thyroid cancer proliferation via activation of the MAPK and AKT pathways

Energy Technology Data Exchange (ETDEWEB)

Zhang, Li [Department of Pharmacy, Urumchi General Hospital of Lanzhou Military Region, Urumchi, Xinjiang 830000 (China); Liu, Lianyong [Medical College of Soochow University, Suzhou, Jiangsu 215123 (China); Department of Endocrinology, Shanghai Punan Hospital, Shanghai 200125 (China); He, Xiaohua; Shen, Yunling; Liu, Xuerong; Wei, Jing; Yu, Fang [Department of Endocrinology, Urumchi General Hospital of Lanzhou Military Region, Urumchi, Xinjiang 830000 (China); Tian, Jianqing, E-mail: jianqing0991@163.com [Department of Endocrinology, Urumchi General Hospital of Lanzhou Military Region, Urumchi, Xinjiang 830000 (China)

2016-08-26

The carboxyl terminus of Hsp70-interacting protein (CHIP) is a U box-type ubiquitin ligase that plays crucial roles in various biological processes, including tumor progression. To date, the functional mechanism of CHIP in thyroid cancer remains unknown. Here, we obtained evidence of upregulation of CHIP in thyroid cancer tissues and cell lines. CHIP overexpression markedly enhanced thyroid cancer cell viability and colony formation in vitro and accelerated tumor growth in vivo. Conversely, CHIP knockdown impaired cell proliferation and tumor growth. Notably, CHIP promoted cell growth through activation of MAPK and AKT pathways, subsequently decreasing p27 and increasing cyclin D1 and p-FOXO3a expression. Our findings collectively indicate that CHIP functions as an oncogene in thyroid cancer, and is therefore a potential therapeutic target for this disease. - Highlights: • CHIP is significantly upregulated in thyroid cancer cells. • Overexpression of CHIP facilitates proliferation and tumorigenesis of thyroid cancer cells. • Silencing of CHIP inhibits the proliferation and tumorigenesis of thyroid cancer cells. • CHIP promotes thyroid cancer cell proliferation via activating the MAPK and AKT pathways.

Fabrication and characterization of SPR chips with the modified bovine serum albumin

Science.gov (United States)

Chen, Xing; Zhang, Lu-lu; Cui, Da-fu

2016-03-01

A facile surface plasmon resonance (SPR) chip is developed for small molecule determination and analysis. The SPR chip was prepared based on a self assembling principle, in which the modified bovine serum albumin (BSA) was directly self-assembled onto the bare gold surface. The surface morphology of the chip with the modified BSA was investigated by atomic force microscopy (AFM) and its optical properties were characterized. The surface binding capacity of the bare facile SPR chip with a uniform morphology is 8 times of that of the bare control SPR chip. Based on the experiments of immune reaction between cortisol antibody and cortisol derivative, the sensitivity of the facile SPR chip with the modified BSA is much higher than that of the control SPR chip with the un-modified BSA. The facile SPR chip has been successfully used to detect small molecules. The lowest detection limit is 5 ng/mL with a linear range of 5—100 ng/mL for cortisol analysis. The novel facile SPR chip can also be applied to detect other small molecules.

‘Chip-olate’ and dry-film resists for efficient fabrication, singulation and sealing of microfluidic chips

International Nuclear Information System (INIS)

Temiz, Yuksel; Delamarche, Emmanuel

2014-01-01

This paper describes a technique for high-throughput fabrication and efficient singulation of chips having closed microfluidic structures and takes advantage of dry-film resists (DFRs) for efficient sealing of capillary systems. The technique is illustrated using 4-inch Si/SiO 2 wafers. Wafers carrying open microfluidic structures are partially diced to about half of their thickness. Treatments such as surface cleaning are done at wafer-level, then the structures are sealed using low-temperature (45 °C) lamination of a DFR that is pre-patterned using a craft cutter, and ready-to-use chips are finally separated manually like a chocolate bar by applying a small force (≤ 4 N). We further show that some DFRs have low auto-fluorescence at wavelengths typically used for common fluorescent dyes and that mechanical properties of some DFRs allow for the lamination of 200 μm wide microfluidic structures with negligible sagging (∼1 μm). The hydrophilicity (advancing contact angle of ∼60°) of the DFR supports autonomous capillary-driven flow without the need for additional surface treatment of the microfluidic chips. Flow rates from 1 to 5 µL min -1 are generated using different geometries of channels and capillary pumps. In addition, the ‘chip-olate’ technique is compatible with the patterning of capture antibodies on DFR for use in immunoassays. We believe this technique to be applicable to the fabrication of a wide range of microfluidic and lab-on-a-chip devices and to offer a viable alternative to many labor-intensive processes that are currently based on wafer bonding techniques or on the molding of poly(dimethylsiloxane) (PDMS) layers. (technical note)

Experiment list: SRX176067 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available sis=Carcinoma 6619400,91.7,7.2,13648 GSM984399: LNCAP H3K4ME3 vehicle; Homo sapiens; ChIP-Seq source_name=pr...ostate cancer cells || cell line=LNCaP || chip antibody=H3K4Me3 || chip antibody manufacturer=Millipore || treatment=EtOH vehicle

Experiment list: SRX485219 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available 56 GSM1346560: RNA Polymerase II ChIP from control germline knock-down ovaries; Drosophila melanogaster; ChI...P-Seq source_name=RNA Polymerase II ChIP from control germline knock-down ovaries || developmental stage=4-6... days old adult || Sex=female || tissue=ovary || germline knock-down=control || c

Experiment list: SRX107410 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Adenocarcinoma 37378122,96.3,56.7,376 GSM838388: h3k36me3 si23 ChIP-Seq; Homo sapiens; ChIP-Seq source_name=Hela cells knock...down Med23 || chip antibody=H3K36me3 || treatment=knockdown Med23 || cell line=HeLa || chip

Chips in banknotes for a banknote electronic signature

Science.gov (United States)

Perron, Maurice; Grimal, Jean-Michel; Beauchet, Frederic; Dell'Ova, Francis

2004-06-01

A lot of information can be found in the media about the possibility of using micro-chips in banknotes. This mostly comes from chip manufacturers whose technology is becoming mature for this application. A lot of patents have been applied therefore but what must be noticed is that all these patents concern the processes to insert chips in banknotes and not a lot is said about the product itself and for what use. The Banque de France is a Central Bank involved in all tasks concerning banknotes from design, production, issue, recirculation and sorting, action against counterfeiting and finally destruction. These activities concern, of course, the banknotes in circulation in France (formerly the French francs notes, presently the Euro notes as Banque de France is part of the Eurosystem) and in other countries in the world. The Banque de France approach in looking to the future of chips in banknotes is at first a product approach. Banknotes are means of payment for which security of authentication is fundamental. They could carry chips to provide more security in the transactions but without altering their nature: the anonyminity and immediacy of the transactions.

Simple photolithographic rapid prototyping of microfluidic chips

DEFF Research Database (Denmark)

Kunstmann-Olsen, Casper; Hoyland, James; Rubahn, Horst-Günter

2012-01-01

Vi præsenterer en simpel metode til at producere støbeforme til støbning af PDMS mikrofluide chips vha. fotolitografi, med 35mm fotonegativer som masker. Vi demonstrer metodens muligheder og begrænsninger. Vi har optimeret processen til at fremstille planare lab-on-a-chip strukturer med meget høj...

Energy Harvesting Chip and the Chip Based Power Supply Development for a Wireless Sensor Network.

Science.gov (United States)

Lee, Dasheng

2008-12-02

In this study, an energy harvesting chip was developed to scavenge energy from artificial light to charge a wireless sensor node. The chip core is a miniature transformer with a nano-ferrofluid magnetic core. The chip embedded transformer can convert harvested energy from its solar cell to variable voltage output for driving multiple loads. This chip system yields a simple, small, and more importantly, a battery-less power supply solution. The sensor node is equipped with multiple sensors that can be enabled by the energy harvesting power supply to collect information about the human body comfort degree. Compared with lab instruments, the nodes with temperature, humidity and photosensors driven by harvested energy had variation coefficient measurement precision of less than 6% deviation under low environmental light of 240 lux. The thermal comfort was affected by the air speed. A flow sensor equipped on the sensor node was used to detect airflow speed. Due to its high power consumption, this sensor node provided 15% less accuracy than the instruments, but it still can meet the requirement of analysis for predicted mean votes (PMV) measurement. The energy harvesting wireless sensor network (WSN) was deployed in a 24-hour convenience store to detect thermal comfort degree from the air conditioning control. During one year operation, the sensor network powered by the energy harvesting chip retained normal functions to collect the PMV index of the store. According to the one month statistics of communication status, the packet loss rate (PLR) is 2.3%, which is as good as the presented results of those WSNs powered by battery. Referring to the electric power records, almost 54% energy can be saved by the feedback control of an energy harvesting sensor network. These results illustrate that, scavenging energy not only creates a reliable power source for electronic devices, such as wireless sensor nodes, but can also be an energy source by building an energy efficient

Energy Harvesting Chip and the Chip Based Power Supply Development for a Wireless Sensor Network

Science.gov (United States)

Lee, Dasheng

2008-01-01

In this study, an energy harvesting chip was developed to scavenge energy from artificial light to charge a wireless sensor node. The chip core is a miniature transformer with a nano-ferrofluid magnetic core. The chip embedded transformer can convert harvested energy from its solar cell to variable voltage output for driving multiple loads. This chip system yields a simple, small, and more importantly, a battery-less power supply solution. The sensor node is equipped with multiple sensors that can be enabled by the energy harvesting power supply to collect information about the human body comfort degree. Compared with lab instruments, the nodes with temperature, humidity and photosensors driven by harvested energy had variation coefficient measurement precision of less than 6% deviation under low environmental light of 240 lux. The thermal comfort was affected by the air speed. A flow sensor equipped on the sensor node was used to detect airflow speed. Due to its high power consumption, this sensor node provided 15% less accuracy than the instruments, but it still can meet the requirement of analysis for predicted mean votes (PMV) measurement. The energy harvesting wireless sensor network (WSN) was deployed in a 24-hour convenience store to detect thermal comfort degree from the air conditioning control. During one year operation, the sensor network powered by the energy harvesting chip retained normal functions to collect the PMV index of the store. According to the one month statistics of communication status, the packet loss rate (PLR) is 2.3%, which is as good as the presented results of those WSNs powered by battery. Referring to the electric power records, almost 54% energy can be saved by the feedback control of an energy harvesting sensor network. These results illustrate that, scavenging energy not only creates a reliable power source for electronic devices, such as wireless sensor nodes, but can also be an energy source by building an energy efficient

Energy Harvesting Chip and the Chip Based Power Supply Development for a Wireless Sensor Network

Directory of Open Access Journals (Sweden)

Dasheng Lee

2008-12-01

Full Text Available In this study, an energy harvesting chip was developed to scavenge energy from artificial light to charge a wireless sensor node. The chip core is a miniature transformer with a nano-ferrofluid magnetic core. The chip embedded transformer can convert harvested energy from its solar cell to variable voltage output for driving multiple loads. This chip system yields a simple, small, and more importantly, a battery-less power supply solution. The sensor node is equipped with multiple sensors that can be enabled by the energy harvesting power supply to collect information about the human body comfort degree. Compared with lab instruments, the nodes with temperature, humidity and photosensors driven by harvested energy had variation coefficient measurement precision of less than 6% deviation under low environmental light of 240 lux. The thermal comfort was affected by the air speed. A flow sensor equipped on the sensor node was used to detect airflow speed. Due to its high power consumption, this sensor node provided 15% less accuracy than the instruments, but it still can meet the requirement of analysis for predicted mean votes (PMV measurement. The energy harvesting wireless sensor network (WSN was deployed in a 24-hour convenience store to detect thermal comfort degree from the air conditioning control. During one year operation, the sensor network powered by the energy harvesting chip retained normal functions to collect the PMV index of the store. According to the one month statistics of communication status, the packet loss rate (PLR is 2.3%, which is as good as the presented results of those WSNs powered by battery. Referring to the electric power records, almost 54% energy can be saved by the feedback control of an energy harvesting sensor network. These results illustrate that, scavenging energy not only creates a reliable power source for electronic devices, such as wireless sensor nodes, but can also be an energy source by building an

Microfluidic organ-on-chip technology for blood-brain barrier research.

Science.gov (United States)

van der Helm, Marinke W; van der Meer, Andries D; Eijkel, Jan C T; van den Berg, Albert; Segerink, Loes I

2016-01-01

Organs-on-chips are a new class of microengineered laboratory models that combine several of the advantages of current in vivo and in vitro models. In this review, we summarize the advances that have been made in the development of organ-on-chip models of the blood-brain barrier (BBBs-on-chips) and the challenges that are still ahead. The BBB is formed by specialized endothelial cells and separates blood from brain tissue. It protects the brain from harmful compounds from the blood and provides homeostasis for optimal neuronal function [corrected]. Studying BBB function and dysfunction is important for drug development and biomedical research. Microfluidic BBBs-on-chips enable real-time study of (human) cells in an engineered physiological microenvironment, for example incorporating small geometries and fluid flow as well as sensors. Examples of BBBs-on-chips in literature already show the potential of more realistic microenvironments and the study of organ-level functions. A key challenge in the field of BBB-on-chip development is the current lack of standardized quantification of parameters such as barrier permeability and shear stress. This limits the potential for direct comparison of the performance of different BBB-on-chip models to each other and existing models. We give recommendations for further standardization in model characterization and conclude that the rapidly emerging field of BBB-on-chip models holds great promise for further studies in BBB biology and drug development.

The GenoChip: a new tool for genetic anthropology.

Science.gov (United States)

Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G; Greenspan, Bennett; Spencer Wells, R

2013-01-01

The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project's new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic

The GenoChip: A New Tool for Genetic Anthropology

Science.gov (United States)

Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G.; Greenspan, Bennett; Spencer Wells, R.

2013-01-01

The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project’s new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic

Genome-wide ChIP-seq mapping and analysis of butyrate-induced H3K9 and H3K27 acetylation and epigenomic landscape alteration in bovine cells

Science.gov (United States)

Utilizing next-generation sequencing technology, combined with ChIP (Chromatin Immunoprecipitation) technology, we analyzed histone modification (acetylation) induced by butyrate and the large-scale mapping of the epigenomic landscape of normal histone H3 and acetylated histone H3K9 and H3K27. To d...

Development of a biochip-based assay integrated in a global strategy for identification of fusion transcripts in acute myeloid leukemia: a work flow for acute myeloid leukemia diagnosis.

Science.gov (United States)

Giusiano, S; Formisano-Tréziny, C; Benziane, A; Maroc, N; Picard, C; Hermitte, F; Taranger-Charpin, C; Gabert, J

2010-08-01

Three major types of rearrangements are involved in acute myeloid leukemias (AML): t(8;21)(q22;q22), inv(16)(p13q22), and 11q23/MLL abnormalities. Their precise identification becomes essential for diagnosis, prognosis, and therapeutic choices. Resulting fusion transcripts (FT) are also powerful markers for monitoring the efficacy of treatment, the minimal residual disease (MRD) and could become therapeutic targets. Today, the challenge is to propose an individual follow-up for each patient even for those with a rare fusion event. In this study, we propose a biochip-based assay integrated in a global strategy for identification of rare FT in AML, after fluorescence in situ hybridization detection, as described by the World Health Organization classification. Using cell lines, we developed and validated a biochip-based assay called the AMLFusionChip that identifies every FT of AML1-ETO, CBFbeta-MYH11 as well as MLL-AF9, MLL-ENL, MLL-AF6, and MLL-AF10. The original design of our AMLFusionChip.v01 enables the identification of these FT wherever the breakpoint on the partner gene may be. In case of biochip negative result, our 3'RACE amplification strategy enables to clone and then sequence the new translocation partner. This AMLFusionChip strategy fits into the concept of personalized medicine for the largest number of patients.

Microfluidic organ-on-chip technology for blood-brain barrier research

NARCIS (Netherlands)

van der Helm, Marieke Willemijn; van der Meer, Andries Dirk; Eijkel, Jan C.T.; van den Berg, Albert; Segerink, Loes Irene

2016-01-01

Organs-on-chips are a new class of microengineered laboratory models that combine several of the advantages of current in vivo and in vitro models. In this review, we summarize the advances that have been made in the development of organ-on-chip models of the blood-brain barrier (BBBs-on-chips) and

Experiment list: SRX150629 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available sue Diagnosis=Fibrocystic Disease 27949151,89.1,5.9,589 GSM935550: Harvard ChipSeq MCF10A-Er-Src EtOH 0.01pc...t 12hr Input std source_name=MCF10A-Er-Src || biomaterial_provider=Struhl laboratory || lab=Harvard || lab description=Struhl - Harva...rd University || datatype=ChipSeq || datatype descriptio

Experiment list: SRX150494 [Chip-atlas[Archive