Rogge, George A; Shen, Li-Ling; Kuhar, Michael J
2010-07-16
Both over expression of cyclic AMP response element binding protein (CREB) in the nucleus accumbens (NAc), and intra-accumbal injection of cocaine- and amphetamine-regulated transcript (CART) peptides, have been shown to decrease cocaine reward. Also, over expression of CREB in the rat NAc increased CART mRNA and peptide levels, but it is not known if this was due to a direct action of P-CREB on the CART gene promoter. The goal of this study was to test if CREB and P-CREB bound directly to the CRE site in the CART promoter, using chromatin immunoprecipitation (ChIP) assays. ChIP assay with anti-CREB antibodies showed an enrichment of the CART promoter fragment containing the CRE region over IgG precipitated material, a non-specific control. Forskolin, which was known to increase CART mRNA levels in GH3 cells, was utilized to show that the drug increased levels of P-CREB protein and P-CREB binding to the CART promoter CRE-containing region. A region of the c-Fos promoter containing a CRE cis-regulatory element was previously shown to bind P-CREB, and it was used here as a positive control. These data suggest that the effects of CREB over expression on blunting cocaine reward could be, at least in part, attributed to the increased expression of the CART gene by direct interaction of P-CREB with the CART promoter CRE site, rather than by some indirect action. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Komar, Dorota N; Mouriz, Alfonso; Jarillo, José A; Piñeiro, Manuel
2016-01-14
Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.
Chandrangsu, Matt; Burbelo, Peter D.; Iadarola, Michael J.; Smith, Paul D.; Morgan, Nicole Y.
2012-06-01
There is considerable interest in the development of rapid, point-of-care antibody detection for the diagnosis of infectious and auto-immune diseases. In this paper, we present work on the development of a self-contained microfluidic format for the Luciferase Immunoprecipitation Systems (LIPS) assay. Whereas the majority of immunoassays for antigen-specific antibodies employ either bacteria- or yeast-expressed proteins and require the use of secondary antibodies, the LIPS technique uses a fusion protein comprised of a Renilla luciferase reporter and the antigen of interest produced via mammalian cell culture, ensuring the addition of mammalian post-translational modifications. Patient serum is mixed with the fusion protein and passed over immobilized Protein A/G; after washing, the only remaining luciferase-tagged antigens are those retained by specific antibodies. These can be quantitatively measured using chemiluminescence upon the introduction of coelenterazine. The assay has been successfully employed for a wide variety of diseases in a microwell format. We report on a recent demonstration of rapid HSV-2 diagnosis with the LIPS assay in a microfluidic format, using one microliter of serum and obtaining results in under ten minutes. We will also discuss recent progress on two fronts, both aimed at the deployment of this technology in the field: first, simplifying assay operation through the automation of flow control using power-free means; and second, efforts to increase signal levels, primarily through strategies to increase antibody binding capacity, in order to move towards portable battery powered electronics.
Burlibașa, Liliana; Suciu, Ilinca
2015-12-01
Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.
International Nuclear Information System (INIS)
Railo, Antti; Pajunen, Antti; Itaeranta, Petri; Naillat, Florence; Vuoristo, Jussi; Kilpelaeinen, Pekka; Vainio, Seppo
2009-01-01
Wnt proteins are important regulators of embryonic development, and dysregulated Wnt signalling is involved in the oncogenesis of several human cancers. Our knowledge of the downstream target genes is limited, however. We used a chromatin immunoprecipitation-based assay to isolate and characterize the actual gene segments through which Wnt-activatable transcription factors, TCFs, regulate transcription and an Affymetrix microarray analysis to study the global transcriptional response to the Wnt3a ligand. The anti-β-catenin immunoprecipitation of DNA-protein complexes from mouse NIH3T3 fibroblasts expressing a fusion protein of β-catenin and TCF7 resulted in the identification of 92 genes as putative TCF targets. GeneChip assays of gene expression performed on NIH3T3 cells and the rat pheochromocytoma cell line PC12 revealed 355 genes in NIH3T3 and 129 genes in the PC12 cells with marked changes in expression after Wnt3a stimulus. Only 2 Wnt-regulated genes were shared by both cell lines. Surprisingly, Disabled-2 was the only gene identified by the chromatin immunoprecipitation approach that displayed a marked change in expression in the GeneChip assay. Taken together, our approaches give an insight into the complex context-dependent nature of Wnt pathway transcriptional responses and identify Disabled-2 as a potential new direct target for Wnt signalling.
Werfel, Stanislas; Leierseder, Simon; Ruprecht, Benjamin; Kuster, Bernhard; Engelhardt, Stefan
2017-09-29
MicroRNAs (miRNAs) have been described to simultaneously inhibit hundreds of targets, albeit to a modest extent. It was recently proposed that there could exist more specific, exceptionally strong binding to a subgroup of targets. However, it is unknown, whether this is the case and how such targets can be identified. Using Argonaute2-ribonucleoprotein immunoprecipitation and in vivo competitive binding assays, we demonstrate for miRNAs-21, -199-3p and let-7 exceptional regulation of a subset of targets, which are characterized by preferential miRNA binding. We confirm this finding by analysis of independent quantitative proteome and transcriptome datasets obtained after miRNA silencing. Our data suggest that mammalian miRNA activity is guided by preferential binding of a small set of 3'-untranslated regions, thereby shaping a steep gradient of regulation between potential targets. Our approach can be applied for transcriptome-wide identification of such targets independently of the presence of seed complementary sequences or other predictors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Komar, Dorota N.; Mouriz, Alfonso; Jarillo, José A.; Piñeiro, Manuel
2016-01-01
Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a proced...
Cavazzana, Ilaria; Fredi, Micaela; Ceribelli, Angela; Mordenti, Cristina; Ferrari, Fabio; Carabellese, Nice; Tincani, Angela; Satoh, Minoru; Franceschini, Franco
2016-06-01
To analyze the performance of a line blot assay for the identification of autoantibodies in sera of patients affected by myositis, compared with immunoprecipitation (IP) as gold standard. 66 sera of patients with myositis (23 polymyositis, 8 anti-synthetase syndromes, 29 dermatomyositis and 6 overlap syndromes) were tested by commercial LB (Euroimmun, Lubeck, Germany); 57 sera were analyzed also by IP of K562 cell extract radiolabeled with (35)S-methionine. Inter-rater agreement was calculated with Cohen's k coefficient. Myositis-specific antibodies (MSA) were detected in 36/57 sera (63%) by IP and in 39/66 sera (59%) by LB. The most frequent MSA found by LB were anti-Jo1 and anti-Mi2 found in 15% (10/66) of sera, followed by anti-NXP2 and anti-SRP detected in 106% (7/66) of sera. Anti-TIF1gamma and anti-MDA5 were found in 6 (9%) and 5 sera (7.6%), respectively. A good agreement between methods was found only for anti-TIF1γ, anti-MDA5 and anti-NXP-2 antibodies, while a moderate agreement was estimated for anti-Mi2 and anti-EJ. By contrast, a high discordance rate for the detection of anti-Jo1 antibodies was evident (k: 0.3). Multiple positivity for MSA were found in 11/66 (17%) by LB and 0/57 by IP (p: 0001). Comparing the clinical features of these 11 sera, we found total discrepancies between assays in 3 sera (27.3%), a relative discrepancy due to the occurrence of one discordant autoantibody (not confirmed by IP) in 5 cases (45.5%) and a total discrepancy between LB and IP results, but with a relative concordance with clinical features were found in other 3 sera (27.3%). The semiquantitative results do not support the interpretation of the data. The use of LB assay allowed the detection of new MSA, such as anti-MDA5, anti-MJ and anti-TIF1gamma antibodies, previously not found with routine methods. However, the high prevalence of multiple positivities and the high discondant rate of anti-Jo1 antibodies could create some misinterpretation of the results from the
Gelpí, Carmen; Pérez, Elena; Roldan, Cristina
2014-09-01
The aim of this study was to compare the degree of agreement of a novel Zenit RA chemiluminescent immunoassay (CLIA) from A. Menarini Diagnostics (Florence, Italy) and the gold standard immunoprecipitation assay to screen for the presence of specific anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his)tRNA-Synthetase) and anti-Scl-70(Topo I) antibodies. We studied 114 sera, 98 from patients with well-defined autoimmune connective tissue diseases and 16 from blood donor volunteers. All samples were fully characterized using the new chemiluminescent immunoassay and immunoprecipitation. In addition, all the samples were analyzed by indirect immunofluorescence (IIF) and anti-Scl-70(Topo I) antibodies were analyzed by immunoblot (IB) assay. Discrepant samples were analyzed using a commercial dot blot technique (Recomline from Mikrogen). The simple Kappa coefficient was used to measure the level of agreement between the results of Zenit RA CLIA and the gold standard. The Kappa agreement between Zenit RA CLIA and gold standard immunoprecipitation, as well as IB and IIFassays for the presence of anti-Scl-70(Topo I)(0.948) was excellent. The concordance between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-U1snRNP (0.883), anti-Ro/SS-A (0.878), anti-Jo-1((his)tRNA-Synthetase) (0.791) and anti-Sm (0.786) was good, and excellent when the cut-off was raised to 14 U/ml (arbitrary units/ml). Between Zenit RA CLIA and gold standard immunoprecipitation for the presence of anti-La/SS-B, the Kappa agreement had a value of 0.689, but this improved to 0.775 when the cut-off was raised to14 U/ml. Precision was good based on the evaluation of replicate samples. Inter-assay coefficient variation was lower than 3.4 % (CV in %) in all the kits and <1.2 % (CV in %) for intra-assay measurements. Our findings show that Zenit RA CLIA was specific and sensitive to detect anti-U1snRNP, anti-Sm, anti-Ro/SS-A, anti-La/SS-B, anti-Jo-1((his
Immunoprecipitation of Tri-methylated Capped RNA.
Hayes, Karen E; Barr, Jamie A; Xie, Mingyi; Steitz, Joan A; Martinez, Ivan
2018-02-05
Cellular quiescence (also known as G 0 arrest) is characterized by reduced DNA replication, increased autophagy, and increased expression of cyclin-dependent kinase p27 Kip1 . Quiescence is essential for wound healing, organ regeneration, and preventing neoplasia. Previous findings indicate that microRNAs (miRNAs) play an important role in regulating cellular quiescence. Our recent publication demonstrated the existence of an alternative miRNA biogenesis pathway in primary human foreskin fibroblast (HFF) cells during quiescence. Indeed, we have identified a group of pri-miRNAs (whose mature miRNAs were found induced during quiescence) modified with a 2,2,7-trimethylguanosine (TMG)-cap by the trimethylguanosine synthase 1 (TGS1) protein and transported to the cytoplasm by the Exportin-1 (XPO1) protein. We used an antibody against (TMG)-caps (which does not cross-react with the (m 7 G)-caps that most pri-miRNAs or mRNAs contain [Luhrmann et al ., 1982]) to perform RNA immunoprecipitations from total RNA extracts of proliferating or quiescent HFFs. The novelty of this assay is the specific isolation of pri-miRNAs as well as other non-coding RNAs containing a TMG-cap modification.
Lee, Hong-Won; Kyung, Taeyoon; Yoo, Janghyun; Kim, Tackhoon; Chung, Chaeuk; Ryu, Ji Young; Lee, Hanki; Park, Kihyun; Lee, Sangkyu; Jones, Walton D.; Lim, Dae-Sik; Hyeon, Changbong; Do Heo, Won; Yoon, Tae-Young
2013-01-01
Co-immunoprecipitation (co-IP) has become a standard technique, but its protein-band output provides only static, qualitative information about protein–protein interactions. Here we demonstrate a real-time single-molecule co-IP technique that generates real-time videos of individual protein–protein interactions as they occur in unpurified cell extracts. By analysing single Ras–Raf interactions with a 50-ms time resolution, we have observed transient intermediates of the protein–protein interaction and determined all the essential kinetic rates. Using this technique, we have quantified the active fraction of native Ras proteins in xenograft tumours, normal tissue and cancer cell lines. We demonstrate that the oncogenic Ras mutations selectively increase the active-Ras fraction by one order of magnitude, without affecting total Ras levels or single-molecule signalling kinetics. Our approach allows us to probe the previously hidden, dynamic aspects of weak protein–protein interactions. It also suggests a path forward towards precision molecular diagnostics at the protein–protein interaction level. PMID:23422673
Abu Samra, Dina Bashir Kamil; Al Kilani, Alia; Hamdan, Samir; Sakashita, Kosuke; Gadhoum, Samah Z.; Merzaban, Jasmeen
2015-01-01
Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Abu Samra, Dina Bashir Kamil
2015-06-29
Selectins (E-, P-, and L-selectins) interact with glycoprotein ligands to mediate the essential tethering/rolling step in cell transport and delivery that captures migrating cells from the circulating flow. In this work, we developed a real time immunoprecipitation assay on a surface plasmon resonance chip that captures native glycoforms of two well known E-selectin ligands (CD44/hematopoietic cell E-/L-selectin ligand and P-selectin glycoprotein ligand-1) from hematopoietic cell extracts. Here we present a comprehensive characterization of their binding to E-selectin. We show that both ligands bind recombinant monomeric E-selectin transiently with fast on- and fast off-rates, whereas they bind dimeric E-selectin with remarkably slow onand off-rates. This binding requires the sialyl Lewis x sugar moiety to be placed on both O- and N-glycans, and its association, but not dissociation, is sensitive to the salt concentration. Our results suggest a mechanism through which monomeric selectins mediate initial fast on and fast off kinetics to help capture cells out of the circulating shear flow; subsequently, tight binding by dimeric/oligomeric selectins is enabled to significantly slow rolling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis
Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan
2009-01-01
DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301
Protein-carbohydrate complex reveals circulating metastatic cells in a microfluidic assay
Simone, Giuseppina
2013-02-11
Advances in carbohydrate sequencing technologies reveal the tremendous complexity of the glycome and the role that glycomics might have to bring insight into the biological functions. Carbohydrate-protein interactions, in particular, are known to be crucial to most mammalian physiological processes as mediators of cell adhesion and metastasis, signal transducers, and organizers of protein interactions. An assay is developed here to mimic the multivalency of biological complexes that selectively and sensitively detect carbohydrate-protein interactions. The binding of β-galactosides and galectin-3 - a protein that is correlated to the progress of tumor and metastasis - is examined. The efficiency of the assay is related to the expression of the receptor while anchoring to the interaction\\'s strength. Comparative binding experiments reveal molecular binding preferences. This study establishes that the assay is robust to isolate metastatic cells from colon affected patients and paves the way to personalized medicine. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Protein-carbohydrate complex reveals circulating metastatic cells in a microfluidic assay
Simone, Giuseppina; Malara, Natalia Maria; Trunzo, Valentina; Perozziello, Gerardo; Neužil, Pavel; Francardi, Marco; Roveda, Laura; Renne, Maria; Prati, Ubaldo; Mollace, Vincenzo; Manz, Andreas; Di Fabrizio, Enzo M.
2013-01-01
Advances in carbohydrate sequencing technologies reveal the tremendous complexity of the glycome and the role that glycomics might have to bring insight into the biological functions. Carbohydrate-protein interactions, in particular, are known to be crucial to most mammalian physiological processes as mediators of cell adhesion and metastasis, signal transducers, and organizers of protein interactions. An assay is developed here to mimic the multivalency of biological complexes that selectively and sensitively detect carbohydrate-protein interactions. The binding of β-galactosides and galectin-3 - a protein that is correlated to the progress of tumor and metastasis - is examined. The efficiency of the assay is related to the expression of the receptor while anchoring to the interaction's strength. Comparative binding experiments reveal molecular binding preferences. This study establishes that the assay is robust to isolate metastatic cells from colon affected patients and paves the way to personalized medicine. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A new scintillation proximity assay-based approach for the detection of KRAS mutations
Energy Technology Data Exchange (ETDEWEB)
Lee, So-Young; Lim, Jae-Cheong; Cho, Eun-Ha; Jung, Sung-Hee [Korea Atomic Energy Research Institute (KAERI), Daejeon (Korea, Republic of). Radioisotope Research Div.
2016-04-01
KRAS is very commonly mutated resulting in a constitutively activated protein, which is independent of epidermal growth factor receptor (EGFR) ligand binding and resistant to anti-EGFR therapy. Although KRAS is frequently studied, there is still no uniform standard for detecting of KRAS mutations. In this report, a new scintillation proximity assay-based approach is described that determines the relative affinities of wild-type and mutated KRAS to the anti-KRAS antibody. We performed in vitro experiments using normal human colonic cells (CCD18Co), KRAS wild type (Caco-2) and KRAS mutant (HCT 116) cell lines to determine the relative affinities of wild type or mutated KRAS toward an anti-KRAS monoclonal antibody. The process consists of two primary steps: immunoprecipitation from cell lysate to enrich the KRAS protein and the scintillation proximity assay of the immunoprecipitant to determine the relative affinity against the antibody. A fixed concentration of cell lysates was purified by the immunoprecipitation method. The expressions of the KRAS protein in all cell lines was quantitatively confirmed by western blot analysis. For the scintillation proximity assay, the KRAS standard protein was radiolabeled with {sup 125}I by a simple mixing process in the iodogen tube immediately at room temperature immediately before use. The obtained CPM (count per minute) values of were used to calculate the KRAS concentration using purified KRAS as the standard. The calculated relative affinities of 7 μg of Caco-2 and HCT 116 immunoprecipitants for the anti-KRAS antibody were 77 and 0%, respectively. The newly developed scintillation proximity assay-based strategy determines the relative affinities of wild-type or mutated KRAS towards the anti-KRAS monoclonal antibody. This determination can help distinguish mutated KRAS from the wild type protein. The new SPA based approach for detecting KRAS mutations is applicable to many other cancer-related mutations.
A new scintillation proximity assay-based approach for the detection of KRAS mutations
International Nuclear Information System (INIS)
Lee, So-Young; Lim, Jae-Cheong; Cho, Eun-Ha; Jung, Sung-Hee
2016-01-01
KRAS is very commonly mutated resulting in a constitutively activated protein, which is independent of epidermal growth factor receptor (EGFR) ligand binding and resistant to anti-EGFR therapy. Although KRAS is frequently studied, there is still no uniform standard for detecting of KRAS mutations. In this report, a new scintillation proximity assay-based approach is described that determines the relative affinities of wild-type and mutated KRAS to the anti-KRAS antibody. We performed in vitro experiments using normal human colonic cells (CCD18Co), KRAS wild type (Caco-2) and KRAS mutant (HCT 116) cell lines to determine the relative affinities of wild type or mutated KRAS toward an anti-KRAS monoclonal antibody. The process consists of two primary steps: immunoprecipitation from cell lysate to enrich the KRAS protein and the scintillation proximity assay of the immunoprecipitant to determine the relative affinity against the antibody. A fixed concentration of cell lysates was purified by the immunoprecipitation method. The expressions of the KRAS protein in all cell lines was quantitatively confirmed by western blot analysis. For the scintillation proximity assay, the KRAS standard protein was radiolabeled with 125 I by a simple mixing process in the iodogen tube immediately at room temperature immediately before use. The obtained CPM (count per minute) values of were used to calculate the KRAS concentration using purified KRAS as the standard. The calculated relative affinities of 7 μg of Caco-2 and HCT 116 immunoprecipitants for the anti-KRAS antibody were 77 and 0%, respectively. The newly developed scintillation proximity assay-based strategy determines the relative affinities of wild-type or mutated KRAS towards the anti-KRAS monoclonal antibody. This determination can help distinguish mutated KRAS from the wild type protein. The new SPA based approach for detecting KRAS mutations is applicable to many other cancer-related mutations.
Nohara, Kazunari; Chen, Zheng; Yoo, Seung-Hee
2017-07-06
Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a challenge for ChIP due to technical difficulty in isolation of high-quality nuclei with minimal contamination of myofibrils. Previous protocols have attempted to purify nuclei before cross-linking, which incurs the risk of altered DNA-protein interaction during the prolonged nuclei preparation process. In the current protocol, we first cross-linked the skeletal muscle tissue collected from mice, and the tissues were minced and sonicated. Since we found that ultracentrifugation was not able to separate nuclei from myofibrils using cross-linked muscle tissue, we devised a sequential filtration procedure to obtain high-quality nuclei devoid of significant myofibril contamination. We subsequently prepared chromatin by using an ultrasonicator, and ChIP assays with anti-BMAL1 antibody revealed robust circadian binding pattern of BMAL1 to target gene promoters. This filtration protocol constitutes an easily applicable method to isolate high-quality nuclei from cross-linked skeletal muscle tissue, allowing consistent sample processing for circadian and other time-sensitive studies. In combination with next-generation sequencing (NGS), our method can be deployed for various mechanistic and genomic studies focusing on skeletal muscle function.
Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.
Rebollo, Rita; Mager, Dixie L
2016-01-01
Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.
Optimal use of tandem biotin and V5 tags in ChIP assays
K.E. Kolodziej (Katarzyna); F. Pourfarzad, F. (Farzin); E. de Boer (Ernie); S. Krpic (Sanja); F.G. Grosveld (Frank); J. Strouboulis (John)
2009-01-01
textabstractBackground: Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the
Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A
2018-06-01
Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.
Fujisawa, Masaki; Nakano, Toshitsugu; Ito, Yasuhiro
2011-01-30
During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Using immunoprecipitated (IPed) DNA fragments recovered by chromatin immunoprecipitation (ChIP) with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites) in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes during ripening. Moreover, the binding of RIN to its own
DEFF Research Database (Denmark)
Borch-Jensen, Jonas; Roepstorff, Peter; Møller-Jensen, Jakob
2011-01-01
enterotoxigenic Escherischia coli, GM1-nanodiscs were employed for co-immunoprecipitation. The B subunit of heat labile enterotoxin was identified as a specific interaction partner by mass spectrometry, thus demonstrating that nanodisc technology is useful for highly specific detection and identification...
Studying RNA-protein interactions in vivo by RNA immunoprecipitation
DEFF Research Database (Denmark)
Selth, Luke A; Close, Pierre; Svejstrup, Jesper Q
2011-01-01
and have significant effects on gene expression. RNA immunoprecipitation (RIP) is a powerful technique used to detect direct and indirect interactions between individual proteins and specific RNA molecules in vivo. Here, we describe RIP methods for both yeast and mammalian cells.......The crucial roles played by RNA-binding proteins in all aspects of RNA metabolism, particularly in the regulation of transcription, have become increasingly evident. Moreover, other factors that do not directly interact with RNA molecules can nevertheless function proximally to RNA polymerases...
Immunoassays in clinical chemistry (principles of immunoradiometric assays)
International Nuclear Information System (INIS)
Chapman, R.S.
1998-01-01
The use of antibodies as reagents in clinical chemistry for the quantitation of a wide range of analytes has now become widely established. Initially antibodies were employed in precipitation techniques, usually for the analysis of serum proteins, in solution or in the form of antibody containing gels, e.g. immunoprecipitation, immunodiffusion, and immunoelectrophoresis. Further developments have led to the highly sensitive techniques of radioimmunoassay and recently immunometric assay for the measurement of drugs, tumour markers and hormones. In general, those techniques without the addition of a label e.g. immunoprecipitation, immunodiffusion and immunoturbidimetry are the older techniques used for the measurement of serum proteins. These techniques are relatively insensitive, measuring at the g/L. level, and in the case of immunodiffusion are generally slow. Automation coupled with the development of chemistries to enhance precipitation has, however, reduced measurement times to minutes in modern laboratories. Nevertheless these methods have detection limits of the order of 1 g/L
Directory of Open Access Journals (Sweden)
Nakano Toshitsugu
2011-01-01
Full Text Available Abstract Background During ripening, climacteric fruits increase their ethylene level and subsequently undergo various physiological changes, such as softening, pigmentation and development of aroma and flavor. These changes occur simultaneously and are caused by the highly synchronized expression of numerous genes at the onset of ripening. In tomatoes, the MADS-box transcription factor RIN has been regarded as a key regulator responsible for the onset of ripening by acting upstream of both ethylene- and non-ethylene-mediated controls. However, except for LeACS2, direct targets of RIN have not been clarified, and little is known about the transcriptional cascade for ripening. Results Using immunoprecipitated (IPed DNA fragments recovered by chromatin immunoprecipitation (ChIP with anti-RIN antibody from ripening tomato fruit, we analyzed potential binding sites for RIN (CArG-box sites in the promoters of representative ripening-induced genes by quantitative PCR. Results revealed nearly a 5- to 20-fold enrichment of CArG boxes in the promoters of LeACS2, LeACS4, PG, TBG4, LeEXP1, and LeMAN4 and of RIN itself, indicating direct interaction of RIN with their promoters in vivo. Moreover, sequence analysis and genome mapping of 51 cloned IPed DNAs revealed potential RIN binding sites. Quantitative PCR revealed that four of the potential binding sites were enriched 4- to 17-fold in the IPed DNA pools compared with the controls, indicating direct interaction of RIN with these sites in vivo. Near one of the four CArG boxes we found a gene encoding a protein similar to thioredoxin y1. An increase in the transcript level of this gene was observed with ripening in normal fruit but not in the rin mutant, suggesting that RIN possibly induces its expression. Conclusions The presented results suggest that RIN controls fruit softening and ethylene production by the direct transcriptional regulation of cell-wall-modifying genes and ethylene biosynthesis genes
1983-08-25
solium, Echinococcus granulosus , Entamoeba histolytica, or Wucher erTra-bancr--ofti. The S. mansoni glycoproteins that were immunoprecipitated by sera...Sera from patients or experimental animals infected with Schistosoma, Fasciola hepatica, Trichinella spiralis, Taenia solium, Echinococcus ... granulosus , or Paragonimus westermani cross-react in diag-nostic assays with antigens derived from schistosomes, whether as whole organisms (1-4), crude
Protocol: methodology for chromatin immunoprecipitation (ChIP in Chlamydomonas reinhardtii
Directory of Open Access Journals (Sweden)
Strenkert Daniela
2011-11-01
Full Text Available Abstract We report on a detailed chromatin immunoprecipitation (ChIP protocol for the unicellular green alga Chlamydomonas reinhardtii. The protocol is suitable for the analysis of nucleosome occupancy, histone modifications and transcription factor binding sites at the level of mononucleosomes for targeted and genome-wide studies. We describe the optimization of conditions for crosslinking, chromatin fragmentation and antibody titer determination and provide recommendations and an example for the normalization of ChIP results as determined by real-time PCR.
Accounting for immunoprecipitation efficiencies in the statistical analysis of ChIP-seq data
Bao, Yanchun; Vinciotti, Veronica; Wit, Ernst; 't Hoen, Peter A C
2013-01-01
Background: ImmunoPrecipitation (IP) efficiencies may vary largely between different antibodies and between repeated experiments with the same antibody. These differences have a large impact on the quality of ChIP-seq data: a more efficient experiment will necessarily lead to a higher signal to
A novel assay reveals hygrotactic behavior in Drosophila.
Directory of Open Access Journals (Sweden)
Feiteng Ji
Full Text Available Humidity is one of the most important factors that determines the geographical distribution and survival of terrestrial animals. The ability to detect variation in humidity is conserved across many species. Here, we established a novel behavioral assay that revealed the thirsty Drosophila exhibits strong hygrotactic behavior, and it can locate water by detecting humidity gradient. In addition, exposure to high levels of moisture was sufficient to elicit proboscis extension reflex behavior in thirsty flies. Furthermore, we found that the third antennal segment was necessary for hygrotactic behavior in thirsty flies, while arista was required for the avoidance of moist air in hydrated flies. These results indicated that two types of hygroreceptor cells exist in Drosophila: one located in the third antennal segment that mediates hygrotactic behavior in thirst status, and the other located in arista which is responsible for the aversive behavior toward moist air in hydration status. Using a neural silencing screen, we demonstrated that synaptic output from the mushroom body α/β surface and posterior neurons was required for both hygrotactic behavior and moisture-aversive behavior.
Genome-Wide Methylated DNA Immunoprecipitation Analysis of Patients with Polycystic Ovary Syndrome
Shen, Hao-ran; Qiu, Li-hua; Zhang, Zhi-qing; Qin, Yuan-yuan; Cao, Cong; Di, Wen
2013-01-01
Polycystic ovary syndrome (PCOS) is a complex, heterogeneous disorder of uncertain etiology. Recent studies suggested that insulin resistance (IR) plays an important role in the development of PCOS. In the current study, we aimed to investigate the molecular mechanism of IR in PCOS. We employed genome-wide methylated DNA immunoprecipitation (MeDIP) analysis to characterize genes that are differentially methylated in PCOS patients vs. healthy controls. Besides, we also identified the different...
Lahner, Edith; Brigatti, Cristina; Marzinotto, Ilaria; Carabotti, Marilia; Scalese, Giulia; Davidson, Howard W; Wenzlau, Janet M; Bosi, Emanuele; Piemonti, Lorenzo; Annibale, Bruno; Lampasona, Vito
2017-01-01
Objectives: Circulating autoantibodies targeting the H+/K+-ATPase proton pump of gastric parietal cells are considered markers of autoimmune gastritis, whose diagnostic accuracy in atrophic body gastritis, the pathological lesion of autoimmune gastritis, remains unknown. This study aimed to assess autoantibodies against ATP4A and ATP4B subunits of parietal cells H+, K+-ATPase in atrophic body gastritis patients and controls. Methods: One-hundred and four cases with atrophic body gastritis and 205 controls were assessed for serological autoantibodies specific for ATP4A or ATP4B subunits using luminescent immunoprecipitation system (LIPS). Recombinant luciferase-reporter-fused-antigens were expressed by in vitro transcription-translation (ATP4A) or after transfection in Expi293F cells (ATP4B), incubated with test sera, and immune complexes recovered using protein-A-sepharose. LIPS assays were compared with a commercial enzyme immunoassay (EIA) for parietal cell autoantibodies. Results: ATP4A and ATP4B autoantibody titers were higher in cases compared to controls (Pgastritis. Both assays had the highest sensitivity, at the cost of diagnostic accuracy (89 and 90% specificity), outperforming traditional EIA. Once validated, these LIPS assays should be valuable screening tools for detecting biomarkers of damaged atrophic oxyntic mucosa. PMID:28102858
International Nuclear Information System (INIS)
Pierce, S.W.; Victoria, E.J.; Masouredis, S.P.
1990-01-01
The relationship between determinants recognized by warm-type immunoglobulin G red cell autoantibodies and the Rh antigens was characterized by autoantibody competitive inhibition of iodine 125 Rh alloantibody binding and autoantibody immunoprecipitation of iodine 125 red blood cell membrane proteins. The majority of blood donor autoantibody recognized epitopes that are closely related to Rh antigens as determined by competitive inhibition studies. Eighteen of 20 (90%) autoantibodies inhibited anti-Rh(c) binding, 15 inhibited anti-Rh(E), 5 inhibited anti-Rh(D), and only 2 failed to inhibit any of the three Rh alloantibodies tested. Autoantibodies that inhibited anti-Rh(D) also inhibited anti-Rh(c) and anti-Rh(E) and all those that inhibited anti-Rh(E) also inhibited anti-Rh(c). Autoantibodies that inhibited all three Rh alloantibodies immunoprecipitated 30 kd membrane polypeptides, as did two of the three autoantibodies that inhibited only anti-Rh(c) and anti-Rh(E). One autoantibody in this group and two autoantibodies that inhibited only anti-Rh(c), as well as an autoantibody that did not inhibit any of the Rh alloantibodies, immunoprecipitated only a single membrane polypeptide identified as band 3. The majority of normal donor red blood cell autoantibodies inhibited the binding of Rh alloantibodies, which indicates that they either bound to the Rh polypeptides or to epitopes on band 3 that were closely associated with the Rh complex
Directory of Open Access Journals (Sweden)
Cui Guan
Full Text Available The honey bee has a well-organized system of division of labour among workers. Workers typically progress through a series of discrete behavioural castes as they age, and this has become an important case study for exploring how dynamic changes in gene expression can influence behaviour. Here we applied both digital gene expression analysis and methyl DNA immunoprecipitation analysis to nurse, forager and reverted nurse bees (nurses that have returned to the nursing state after a period spent foraging from the same colony in order to compare the outcomes of these different forms of genomic analysis. A total of 874 and 710 significantly differentially expressed genes were identified in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 229 genes exhibited reversed directions of gene expression differences between the forager/nurse and reverted nurse/forager comparisons. Using methyl-DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq we identified 366 and 442 significantly differentially methylated genes in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 165 genes were identified as differentially methylated in both comparisons. However, very few genes were identified as both differentially expressed and differentially methylated in our comparisons of nurses and foragers. These findings confirm that changes in both gene expression and DNA methylation are involved in the nurse and forager behavioural castes, but the different analytical methods reveal quite distinct sets of candidate genes.
Sequential chromatin immunoprecipitation to detect SUMOylated MeCP2 in neurons
Directory of Open Access Journals (Sweden)
Tao Wu
2016-03-01
Full Text Available The small ubiquitin-like modifier (SUMO is a short peptide that can be covalently linked to proteins altering their function. SUMOylation is an essential post-translational modification (PTM. Because of its dynamic nature, low abundance levels, and technical limitations, the occupation of endogenous SUMOylated transcription factors at genomic loci is challenging to detect. The chromatin regulator Methyl CpG binding protein 2 (MeCP2 is subjected to PTMs including SUMO. Mutations in MeCP2 lead to Rett syndrome, a severe neurodevelopmental disorder. Here, we present an efficient method to perform sequential chromatin immunoprecipitation (Seq-ChIP for detecting SUMOylated MeCP2 in neurons. This Seq-ChIP technique is a useful tool to determine the occupancy of SUMOylated transcription and chromatin factors at specific genomic regions.
Long, Yang; Yan, Jianghong; Luo, Suxin; Liu, Zhenguo; Xia, Yong
2017-11-15
Endothelial nitric oxide synthase (eNOS) plays central roles in cardiovascular regulation and disease. eNOS function is critically affected by O-linked N-acetylglucosamine (O-GlcNAc) modification. The present method for measuring O-GlcNAcylated eNOS relies on immunoprecipitation. Such method exhibits low detection efficiency and is also costly. We here report a simplified assay by employing the high binding affinity of eNOS with the 2',5'-ADP-Sepharose resins. Together with the O-GlcNAc antibody, this assay readily allows the detection of O-GlcNAcylated eNOS in both cultured endothelial cells and rat vascular tissues. By using this assay, we demonstrate that eNOS O-GlcNAcylation is markedly elevated in the vessels of diabetic rats. Thus, a 2',5'-ADP-Sepharose-based pull-down assay is developed to measure O-GlcNAcylated eNOS. This assay is simple and efficient in detecting O-GlcNAcylated eNOS in cultured cells and animal tissues under both normal and disease conditions. Copyright © 2017 Elsevier Inc. All rights reserved.
Lee, Young Kwang; Low-Nam, Shalini T; Chung, Jean K; Hansen, Scott D; Lam, Hiu Yue Monatrice; Alvarez, Steven; Groves, Jay T
2017-04-28
The guanine nucleotide exchange factor (GEF) Son of Sevenless (SOS) plays a critical role in signal transduction by activating Ras. Here we introduce a single-molecule assay in which individual SOS molecules are captured from raw cell lysate using Ras-functionalized supported membrane microarrays. This enables characterization of the full-length SOS protein, which has not previously been studied in reconstitution due to difficulties in purification. Our measurements on the full-length protein reveal a distinct role of the C-terminal proline-rich (PR) domain to obstruct the engagement of allosteric Ras independently of the well-known N-terminal domain autoinhibition. This inhibitory role of the PR domain limits Grb2-independent recruitment of SOS to the membrane through binding of Ras·GTP in the SOS allosteric binding site. More generally, this assay strategy enables characterization of the functional behaviour of GEFs with single-molecule precision but without the need for purification.
He, Hua; Wang, Xiaojuan; Cheng, Tiantian; Xia, Yongqing; Lao, Jun; Ge, Baosheng; Ren, Hao; Khan, Naseer Ullah; Huang, Fang
2016-04-18
Revealing chemokine receptor CXCR4 expression, distribution, and internalization levels in different cancers helps to evaluate cancer progression or prognosis and to set personalized treatment strategy. We here describe a sensitive and high-throughput immunoassay for determining CXCR4 expression and distribution in cancer cells. The assay is accessible to a wide range of users in an ordinary lab only by dip-coating poly(styrene-co-N-isopropylacrylamide) spheres on the glass substrate. The self- assembled spheres form three-dimensional photonic colloidal crystals which enhance the fluorescence of CF647 and Alexa Fluor 647 by a factor of up to 1000. CXCR4 in cells is detected by using the sandwich immunoassay, where the primary antibody recognizes CXCR4 and the secondary antibody is labeled with CF647. With the newly established assay, we quantified the total expression of CXCR4, its distribution on the cell membrane and cytoplasm, and revealed their internalization level upon SDF-1α activation in various cancer cells, even for those with extremely low expression level. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Asciolla, James J; Miele, Matthew M; Hendrickson, Ronald C; Resh, Marilyn D
2017-08-18
Wnt proteins are a family of secreted signaling proteins that play key roles in regulating cell proliferation in both embryonic and adult tissues. Production of active Wnt depends on attachment of palmitoleate, a monounsaturated fatty acid, to a conserved serine by the acyltransferase Porcupine (PORCN). Studies of PORCN activity relied on cell-based fatty acylation and signaling assays as no direct enzyme assay had yet been developed. Here, we present the first in vitro assay that accurately recapitulates PORCN-mediated fatty acylation of a Wnt substrate. The critical feature is the use of a double disulfide-bonded Wnt peptide that mimics the two-dimensional structure surrounding the Wnt acylation site. PORCN-mediated Wnt acylation was abolished when the Wnt peptide was treated with DTT, and did not occur with a linear (non-disulfide-bonded) peptide, or when the double disulfide-bonded Wnt peptide contained Ala substituted for the Ser acylation site. We exploited this in vitro Wnt acylation assay to provide direct evidence that the small molecule LGK974, which is in clinical trials for managing Wnt-driven tumors, is a bona fide PORCN inhibitor whose IC 50 for inhibition of Wnt fatty acylation in vitro closely matches that for inhibition of Wnt signaling. Side-by-side comparison of PORCN and Hedgehog acyltransferase (HHAT), two enzymes that attach 16-carbon fatty acids to secreted proteins, revealed that neither enzyme will accept the other's fatty acyl-CoA or peptide substrates. These findings illustrate the unique enzyme-substrate selectivity exhibited by members of the membrane-bound O -acyl transferase family. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Rosebrock, J A; Parker, C L; Kute, T E
1981-01-01
This investigation was to study the biosynthesis of 3H-labeled alpha-fetoprotein (AFP) by cultured mouse hepatoma (HEPA-2) cells. Both the function and regulation of this oncodevelopmental gene are unknown. However, evidence indicates that mechanisms controlling the expression of AFP involve aspects of both normal embryonic development and neoplastic transformation. the secretion of AFP was analyzed during different phases of the growth cycle to provide information on AFP production using standard culture conditions. The highest rate of secretion occurred during the stationary phase, followed by the late logarithmic and early logarithmic phases of growth, respectively. The production of AFP was then determined following the addition of glucocorticoids and estrogens in an attempt to understand hormonal factors that may be involved. Studies utilizing estradiol-17 beta indicated that the secretion of AFP did not appear to be sensitive to this steroid even though sucrose density gradient analysis of HEPA-2 cytosol, for estrogenic receptors, revealed competitive binding moieties on the 8S and 4S regions of the gradient. In contrast, the secretion of the total complement of proteins, including AFP, was significantly stimulated by the glucocorticoids, dexamethasone and corticosterone. Analysis of HEPA-2 cytosol for glucocorticoid receptors revealed binding components in the 7S and 3-4S regions of the gradient. The 3H-dexamethasone binding appeared to be stereospecific since nonlabeled dexamethasone, but not nonlabeled estradiol-17 beta, effectively displaced the bound radioactivity. The glucocorticoid-binding component in HEPA-2 therefore displayed characteristics reported for glucocorticoid receptors in normal liver and other hepatomas.
Chat-Uthai, Nunthawut; Vejvisithsakul, Pichpisith; Udommethaporn, Sutthirat; Meesiri, Puttarakun; Danthanawanit, Chetiya; Wongchai, Yannawan; Teerapakpinyo, Chinachote; Shuangshoti, Shanop; Poungvarin, Naravat
2018-01-01
The protein kinase BRAF is one of the key players in regulating cellular responses to extracellular signals. Somatic mutations of the BRAF gene, causing constitutive activation of BRAF, have been found in various types of human cancers such as malignant melanoma, and colorectal cancer. BRAF V600E and V600K, most commonly observed mutations in these cancers, may predict response to targeted therapies. Many techniques suffer from a lack of diagnostic sensitivity in mutation analysis in clinical samples with a low cancer cell percentage or poor-quality fragmented DNA. Here we present allele-specific real-time PCR assay for amplifying 35- to 45-base target sequences in BRAF gene. Forward primer designed for BRAF V600E detection is capable of recognizing both types of BRAF V600E mutation, i.e. V600E1 (c.1799T>A) and V600E2 (c.1799_1800delTGinsAA), as well as complex tandem mutation caused by nucleotide changes in codons 600 and 601. We utilized this assay to analyze Thai formalin-fixed paraffin-embedded tissues. Forty-eight percent of 178 Thai colorectal cancer tissues has KRAS mutation detected by highly sensitive commercial assays. Although these DNA samples contain low overall yield of amplifiable DNA, our newly-developed assay successfully revealed BRAF V600 mutations in 6 of 93 formalin-fixed paraffin-embedded colorectal cancer tissues which KRAS mutation was not detected. Ultra-short PCR assay with forward mutation-specific primers is potentially useful to detect BRAF V600 mutations in highly fragmented DNA specimens from cancer patients.
Directory of Open Access Journals (Sweden)
Ran Nakashima
Full Text Available OBJECTIVE: Autoantibodies to aminoacyl-tRNA synthetases (ARSs are useful in the diagnosis of idiopathic inflammatory myopathy (IIM with interstitial pneumonia (IP. We developed an enzyme-linked immunosorbent assay (ELISA system using a mixture of recombinant ARS antigens and tested its utility in a multicenter study. METHODS: We prepared six recombinant ARSs: GST-Jo-1, His-PL-12, His-EJ and GST-KS expressed in Escherichia coli, and His-PL-7 and His-OJ expressed in Hi-5 cells. After confirming their antigenic activity, with the exception of His-OJ, we developed our ELISA system in which the five recombinant ARSs (without His-OJ were mixed. Efficiency was confirmed using the sera from 526 Japanese patients with connective tissue disease (CTD (IIM n = 250, systemic lupus erythematosus n = 91, systemic sclerosis n = 70, rheumatoid arthritis n = 75, Sjögren's syndrome n = 27 and other diseases n = 13, 168 with idiopathic interstitial pneumonia (IIP and 30 healthy controls collected from eight institutes. IIPs were classified into two groups; idiopathic pulmonary fibrosis (IPF (n = 38 and non-IPF (n = 130. RESULTS were compared with those of RNA immunoprecipitation. RESULTS: Sensitivity and specificity of the ELISA were 97.1% and 99.8%, respectively when compared with the RNA immunoprecipitation assay. Anti-ARS antibodies were detected in 30.8% of IIM, 2.5% of non-myositis CTD, and 10.7% of IIP (5.3% of IPF and 12.3% of non-IPF. Anti-ARS-positive non-IPF patients were younger and more frequently treated with glucocorticoids and/or immunosuppressants than anti-ARS-negative patients. CONCLUSION: A newly established ELISA detected anti-ARS antibodies as efficiently as RNA immunoprecipitation. This system will enable easier and wider use in the detection of anti-ARS antibodies in patients with IIM and IIP.
RAS - Screens & Assays - Drug Discovery
The RAS Drug Discovery group aims to develop assays that will reveal aspects of RAS biology upon which cancer cells depend. Successful assay formats are made available for high-throughput screening programs to yield potentially effective drug compounds.
Nguyen-Duc, Trong; Peeters, Eveline; Muyldermans, Serge; Charlier, Daniel; Hassanzadeh-Ghassabeh, Gholamreza
2013-01-01
Nanobodies® are single-domain antibody fragments derived from camelid heavy-chain antibodies. Because of their small size, straightforward production in Escherichia coli, easy tailoring, high affinity, specificity, stability and solubility, nanobodies® have been exploited in various biotechnological applications. A major challenge in the post-genomics and post-proteomics era is the identification of regulatory networks involving nucleic acid–protein and protein–protein interactions. Here, we apply a nanobody® in chromatin immunoprecipitation followed by DNA microarray hybridization (ChIP-chip) for genome-wide identification of DNA–protein interactions. The Lrp-like regulator Ss-LrpB, arguably one of the best-studied specific transcription factors of the hyperthermophilic archaeon Sulfolobus solfataricus, was chosen for this proof-of-principle nanobody®-assisted ChIP. Three distinct Ss-LrpB-specific nanobodies®, each interacting with a different epitope, were generated for ChIP. Genome-wide ChIP-chip with one of these nanobodies® identified the well-established Ss-LrpB binding sites and revealed several unknown target sequences. Furthermore, these ChIP-chip profiles revealed auxiliary operator sites in the open reading frame of Ss-lrpB. Our work introduces nanobodies® as a novel class of affinity reagents for ChIP. Taking into account the unique characteristics of nanobodies®, in particular, their short generation time, nanobody®-based ChIP is expected to further streamline ChIP-chip and ChIP-Seq experiments, especially in organisms with no (or limited) possibility of genetic manipulation. PMID:23275538
Directory of Open Access Journals (Sweden)
Heidi A. Neubauer
2017-03-01
Full Text Available Sphingosine kinase 2 (SK2 is a ubiquitously expressed lipid kinase that has important, albeit complex and poorly understood, roles in regulating cell survival and cell death. In addition to being able to promote cell cycle arrest and apoptosis under certain conditions, it has recently been shown that SK2 can promote neoplastic transformation and tumorigenesis in vivo. Therefore, well validated and reliable tools are required to study and better understand the true functions of SK2. Here, we compare two commercially available SK2 antibodies: a rabbit polyclonal antibody from Proteintech that recognizes amino acids 266-618 of human SK2a, and a rabbit polyclonal antibody from ECM Biosciences that recognizes amino acids 36-52 of human SK2a. We examine the performance of these antibodies for use in immunoblotting, immunoprecipitation and immunofluorescence staining of endogenous SK2, using human HEK293 and HeLa cell lines, as well as mouse embryonic fibroblasts (MEFs. Furthermore, we assess the specificity of these antibodies to the target protein through the use of siRNA-mediated SK2 knockdown and SK2 knockout (Sphk2-/- MEFs. Our results demonstrate that the Proteintech anti-SK2 antibody reproducibly displayed superior sensitivity and selectivity towards SK2 in immunoblot analyses, while the ECM Biosciences anti-SK2 antibody was reproducibly superior for SK2 immunoprecipitation and detection by immunofluorescence staining. Notably, both antibodies produced non-specific bands and staining in the MEFs, which was not observed with the human cell lines. Therefore, we conclude that the Proteintech SK2 antibody is a valuable reagent for use in immunoblot analyses, and the ECM Biosciences SK2 antibody is a useful tool for SK2 immunoprecipitation and immunofluorescence staining, at least in the human cell lines employed in this study.
Directory of Open Access Journals (Sweden)
Yukio Kurihara
2014-12-01
Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.
McCullough, Shaun D; On, Doan M; Bowers, Emma C
2017-05-02
Histone modifications work in concert with DNA methylation to regulate cellular structure, function, and response to environmental stimuli. More than 130 unique histone modifications have been described to date, and chromatin immunoprecipitation (ChIP) allows for the exploration of their associations with the regulatory regions of target genes and other DNA/chromatin-associated proteins across the genome. Many variations of ChIP have been developed in the 30 years since its earliest version came into use, which makes it challenging for users to integrate the procedure into their research programs. Furthermore, the differences in ChIP protocols can confound efforts to increase reproducibility across studies. The streamlined ChIP procedure presented here can be readily applied to samples from a wide range of in vitro studies (cell lines and primary cells) and clinical samples (peripheral leukocytes) in toxicology. We also provide detailed guidance on the optimization of critical protocol parameters, such as chromatin fixation, fragmentation, and immunoprecipitation, to increase efficiency and improve reproducibility. Expanding toxicoepigenetic studies to more readily include histone modifications will facilitate a more comprehensive understanding of the role of the epigenome in environmental exposure effects and the integration of epigenetic data in mechanistic toxicology, adverse outcome pathways, and risk assessment. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Vogt, Andreas; Fuerholzner, Bettina; Kinkl, Norbert; Boldt, Karsten; Ueffing, Marius
2013-05-01
High confidence definition of protein interactions is an important objective toward the understanding of biological systems. Isotope labeling in combination with affinity-based isolation of protein complexes has increased in accuracy and reproducibility, yet, larger organisms--including humans--are hardly accessible to metabolic labeling and thus, a major limitation has been its restriction to small animals, cell lines, and yeast. As composition as well as the stoichiometry of protein complexes can significantly differ in primary tissues, there is a great demand for methods capable to combine the selectivity of affinity-based isolation as well as the accuracy and reproducibility of isotope-based labeling with its application toward analysis of protein interactions from intact tissue. Toward this goal, we combined isotope coded protein labeling (ICPL)(1) with immunoprecipitation (IP) and quantitative mass spectrometry (MS). ICPL-IP allows sensitive and accurate analysis of protein interactions from primary tissue. We applied ICPL-IP to immuno-isolate protein complexes from bovine retinal tissue. Protein complexes of immunoprecipitated β-tubulin, a highly abundant protein with known interactors as well as the lowly expressed small GTPase RhoA were analyzed. The results of both analyses demonstrate sensitive and selective identification of known as well as new protein interactions by our method.
Vogt, Andreas; Fuerholzner, Bettina; Kinkl, Norbert; Boldt, Karsten; Ueffing, Marius
2013-01-01
High confidence definition of protein interactions is an important objective toward the understanding of biological systems. Isotope labeling in combination with affinity-based isolation of protein complexes has increased in accuracy and reproducibility, yet, larger organisms—including humans—are hardly accessible to metabolic labeling and thus, a major limitation has been its restriction to small animals, cell lines, and yeast. As composition as well as the stoichiometry of protein complexes can significantly differ in primary tissues, there is a great demand for methods capable to combine the selectivity of affinity-based isolation as well as the accuracy and reproducibility of isotope-based labeling with its application toward analysis of protein interactions from intact tissue. Toward this goal, we combined isotope coded protein labeling (ICPL)1 with immunoprecipitation (IP) and quantitative mass spectrometry (MS). ICPL-IP allows sensitive and accurate analysis of protein interactions from primary tissue. We applied ICPL-IP to immuno-isolate protein complexes from bovine retinal tissue. Protein complexes of immunoprecipitated β-tubulin, a highly abundant protein with known interactors as well as the lowly expressed small GTPase RhoA were analyzed. The results of both analyses demonstrate sensitive and selective identification of known as well as new protein interactions by our method. PMID:23268931
Directory of Open Access Journals (Sweden)
Anita M Quintana
2011-02-01
Full Text Available The c-Myb transcription factor is a critical regulator of proliferation and stem cell differentiation, and mutated alleles of c-Myb are oncogenic, but little is known about changes in c-Myb activity during the cell cycle. To map the association of c-Myb with specific target genes during the cell cycle, we developed a novel Fix-Sort-ChIP approach, in which asynchronously growing cells were fixed with formaldehyde, stained with Hoechst 33342 and separated into different cell cycle fractions by flow sorting, then processed for chromatin immunoprecipitation (ChIP assays. We found that c-Myb actively repositions, binding to some genes only in specific cell cycle phases. In addition, the specificity of c-Myb is dramatically different in small subpopulations of cells, for example cells in the G2/M phase of the cell cycle, than in the bulk population. The repositioning of c-Myb during the cell cycle is not due to changes in its expression and also occurs with ectopically expressed, epitope-tagged versions of c-Myb. The repositioning occurs in established cell lines, in primary human CD34+ hematopoietic progenitors and in primary human acute myeloid leukemia cells. The combination of fixation, sorting and ChIP analysis sheds new light on the dynamic nature of gene regulation during the cell cycle and provides a new type of tool for the analysis of gene regulation in small subsets of cells, such as cells in a specific phase of the cell cycle.
Kaufmann, K.; Muiño, J.M.; Østerås, M.; Farinelli, L.; Krajewski, P.; Angenent, G.C.
2010-01-01
Chromatin immunoprecipitation (ChIP) is a powerful technique to study interactions between transcription factors (TFs) and DNA in vivo. For genome-wide de novo discovery of TF-binding sites, the DNA that is obtained in ChIP experiments needs to be processed for sequence identification. The sequences
Zhu, Xiao-Hong; Lu, Ming; Lee, Byeong-Yeul; Ugurbil, Kamil; Chen, Wei
2015-01-01
NAD is an essential metabolite that exists in NAD+ or NADH form in all living cells. Despite its critical roles in regulating mitochondrial energy production through the NAD+/NADH redox state and modulating cellular signaling processes through the activity of the NAD+-dependent enzymes, the method for quantifying intracellular NAD contents and redox state is limited to a few in vitro or ex vivo assays, which are not suitable for studying a living brain or organ. Here, we present a magnetic resonance (MR) -based in vivo NAD assay that uses the high-field MR scanner and is capable of noninvasively assessing NAD+ and NADH contents and the NAD+/NADH redox state in intact human brain. The results of this study provide the first insight, to our knowledge, into the cellular NAD concentrations and redox state in the brains of healthy volunteers. Furthermore, an age-dependent increase of intracellular NADH and age-dependent reductions in NAD+, total NAD contents, and NAD+/NADH redox potential of the healthy human brain were revealed in this study. The overall findings not only provide direct evidence of declined mitochondrial functions and altered NAD homeostasis that accompany the normal aging process but also, elucidate the merits and potentials of this new NAD assay for noninvasively studying the intracellular NAD metabolism and redox state in normal and diseased human brain or other organs in situ. PMID:25730862
A Soluble Fluorescent Binding Assay Reveals PIP2 Antagonism of TREK-1 Channels
Directory of Open Access Journals (Sweden)
Cerrone Cabanos
2017-08-01
Full Text Available Lipid regulation of ion channels by low-abundance signaling lipids phosphatidylinositol 4,5-bisphosphate (PIP2 and phosphatidic acid (PA has emerged as a central cellular mechanism for controlling ion channels and the excitability of nerves. A lack of robust assays suitable for facile detection of a lipid bound to a channel has hampered the probing of the lipid binding sites and measuring the pharmacology of putative lipid agonists for ion channels. Here, we show a fluorescent PIP2 competition assay for detergent-purified potassium channels, including TWIK-1-related K+-channel (TREK-1. Anionic lipids PA and phosphatidylglycerol (PG bind dose dependently (9.1 and 96 μM, respectively and agonize the channel. Our assay shows PIP2 binds with high affinity (0.87 μM but surprisingly can directly antagonize TREK-1 in liposomes. We propose a model for TREK-1 lipid regulation where PIP2 can compete with PA and PG agonism based on the affinity of the lipid for a site within the channel.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.
Ushijima, Takahiro; Okazaki, Ken; Tsushima, Hidetoshi; Ishihara, Kohei; Doi, Toshio; Iwamoto, Yukihide
2014-01-01
Background CCAAT/enhancer binding protein β (C/EBPβ) is a transcription factor that promotes hypertrophic differentiation of chondrocytes. Indian hedgehog (Ihh) also stimulates the hypertrophic transition of chondrocytes. Furthermore, runt-related transcription factor-2 (RUNX2) was reported to regulate chondrocyte maturation during skeletal development and to directly regulate transcriptional activity of Ihh. In this study, we investigated whether the interaction of C/EBPβ and RUNX2 regulates the expression of Ihh during chondrocyte differentiation. Methodology/Results Immunohistochemistry of embryonic growth plate revealed that both C/EBPβ and Ihh were strongly expressed in pre-hypertrophic and hypertrophic chondrocytes. Overexpression of C/EBPβ by adenovirus vector in ATDC5 cells caused marked stimulation of Ihh and Runx2. Conversely, knockdown of C/EBPβ by lentivirus expressing shRNA significantly repressed Ihh and Runx2 in ATDC5 cells. A reporter assay revealed that C/EBPβ stimulated transcriptional activity of Ihh. Deletion and mutation analysis showed that the C/EBPβ responsive element was located between −214 and −210 bp in the Ihh promoter. An electrophoretic mobility shift assay (EMSA) and a chromatin immunoprecipitation (ChIP) assay also revealed the direct binding of C/EBPβ to this region. Moreover, reporter assays demonstrated that RUNX2 failed to stimulate the transcriptional activity of the Ihh promoter harboring a mutation at the C/EBPβ binding site. EMSA and ChIP assays showed that RUNX2 interacted to this element with C/EBPβ. Immunoprecipitation revealed that RUNX2 and C/EBPβ formed heterodimer complex with each other in the nuclei of chondrocytes. These data suggested that the C/EBPβ binding element is also important for RUNX2 to regulate the expression of Ihh. Ex vivo organ culture of mouse limbs transfected with C/EBPβ showed that the expression of Ihh and RUNX2 was increased upon ectopic C/EBPβ expression. Conclusions C
Directory of Open Access Journals (Sweden)
Takahiro Ushijima
Full Text Available CCAAT/enhancer binding protein β (C/EBPβ is a transcription factor that promotes hypertrophic differentiation of chondrocytes. Indian hedgehog (Ihh also stimulates the hypertrophic transition of chondrocytes. Furthermore, runt-related transcription factor-2 (RUNX2 was reported to regulate chondrocyte maturation during skeletal development and to directly regulate transcriptional activity of Ihh. In this study, we investigated whether the interaction of C/EBPβ and RUNX2 regulates the expression of Ihh during chondrocyte differentiation.Immunohistochemistry of embryonic growth plate revealed that both C/EBPβ and Ihh were strongly expressed in pre-hypertrophic and hypertrophic chondrocytes. Overexpression of C/EBPβ by adenovirus vector in ATDC5 cells caused marked stimulation of Ihh and Runx2. Conversely, knockdown of C/EBPβ by lentivirus expressing shRNA significantly repressed Ihh and Runx2 in ATDC5 cells. A reporter assay revealed that C/EBPβ stimulated transcriptional activity of Ihh. Deletion and mutation analysis showed that the C/EBPβ responsive element was located between -214 and -210 bp in the Ihh promoter. An electrophoretic mobility shift assay (EMSA and a chromatin immunoprecipitation (ChIP assay also revealed the direct binding of C/EBPβ to this region. Moreover, reporter assays demonstrated that RUNX2 failed to stimulate the transcriptional activity of the Ihh promoter harboring a mutation at the C/EBPβ binding site. EMSA and ChIP assays showed that RUNX2 interacted to this element with C/EBPβ. Immunoprecipitation revealed that RUNX2 and C/EBPβ formed heterodimer complex with each other in the nuclei of chondrocytes. These data suggested that the C/EBPβ binding element is also important for RUNX2 to regulate the expression of Ihh. Ex vivo organ culture of mouse limbs transfected with C/EBPβ showed that the expression of Ihh and RUNX2 was increased upon ectopic C/EBPβ expression.C/EBPβ and RUNX2 cooperatively stimulate
Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.
Directory of Open Access Journals (Sweden)
Nina Winter
Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.
DEFF Research Database (Denmark)
Boelt, Sanne Grundvad; Houen, Gunnar; Højrup, Peter
2015-01-01
Here we present an agarose gel shift assay that, in contrast to other electrophoresis approaches, is loaded in the center of the gel. This allows proteins to migrate in either direction according to their isoelectric points. Therefore, the presented assay enables a direct visualization, separation...... structure. It is also demonstrated that the agarose gel shift assay is useful in the study of other protein interactions and can be used as an alternative method to native polyacrylamide gel electrophoresis....... measure of interactions. Therefore, no interaction studies between calreticulin and substrates in solution have been investigated previously. The results presented here indicate that calreticulin has a preference for substrates with a quaternary structure and primarily β-sheets in their secondary...
Assay of free urinary cortisol with inverted phase liquid chromatography and radiocompetition
International Nuclear Information System (INIS)
Franck, C.; Patricot, M.C.; Mathian, B.; Revol, A.
1984-01-01
The authors present an assay method for free urinary cortisol using inverted phase liquid chromatography for purification and radiocompetition for the assay. The usual values for adult men and women were established. The results of 150 routine assays were compared with those of 17 OHCS revealing the value of this assay [fr
Directory of Open Access Journals (Sweden)
Daniel Castellano-Castillo
Full Text Available Chromatin immunoprecipitation (ChIP has gained importance to identify links between the genome and the proteome. Adipose tissue has emerged as an active tissue, which secretes a wide range of molecules that have been related to metabolic and obesity-related disorders, such as diabetes, cardiovascular failure, metabolic syndrome, or cancer. In turn, epigenetics has raised the importance in discerning the possible relationship between metabolic disorders, lifestyle and environment. However, ChIP application in human adipose tissue is limited by several factors, such as sample size, frozen sample availability, high lipid content and cellular composition of the tissue. Here, we optimize the standard protocol of ChIP for small pieces of frozen human adipose tissue. In addition, we test ChIP for the histone mark H3K4m3, which is related to active promoters, and validate the performance of the ChIP by analyzing gene promoters for factors usually studied in adipose tissue using qPCR. Our improvements result in a higher performance in chromatin shearing and DNA recovery of adipocytes from the tissue, which may be useful for ChIP-qPCR or ChIP-seq analysis.
Energy Technology Data Exchange (ETDEWEB)
Ruan, Jiapeng [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Mouveaux, Thomas [Université Lille Nord de France, (France); Light, Samuel H.; Minasov, George; Anderson, Wayne F. [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); Tomavo, Stanislas [Université Lille Nord de France, (France); Ngô, Huân M., E-mail: h-ngo@northwestern.edu [Northwestern University, 320 E. Superior Street, Morton 7-601, Chicago, IL 60611 (United States); BrainMicro LLC, 21 Pendleton Street, New Haven, CT 06511 (United States)
2015-03-01
The second crystal structure of a parasite protein preferentially enriched in the brain cyst of T. gondii has been solved at 2.75 Å resolution. Bradyzoite enolase 1 is reported to have differential functions as a glycolytic enzyme and a transcriptional regulator in bradyzoites. In addition to catalyzing a central step in glycolysis, enolase assumes a remarkably diverse set of secondary functions in different organisms, including transcription regulation as documented for the oncogene c-Myc promoter-binding protein 1. The apicomplexan parasite Toxoplasma gondii differentially expresses two nuclear-localized, plant-like enolases: enolase 1 (TgENO1) in the latent bradyzoite cyst stage and enolase 2 (TgENO2) in the rapidly replicative tachyzoite stage. A 2.75 Å resolution crystal structure of bradyzoite enolase 1, the second structure to be reported of a bradyzoite-specific protein in Toxoplasma, captures an open conformational state and reveals that distinctive plant-like insertions are located on surface loops. The enolase 1 structure reveals that a unique residue, Glu164, in catalytic loop 2 may account for the lower activity of this cyst-stage isozyme. Recombinant TgENO1 specifically binds to a TTTTCT DNA motif present in the cyst matrix antigen 1 (TgMAG1) gene promoter as demonstrated by gel retardation. Furthermore, direct physical interactions of both nuclear TgENO1 and TgENO2 with the TgMAG1 gene promoter are demonstrated in vivo using chromatin immunoprecipitation (ChIP) assays. Structural and biochemical studies reveal that T. gondii enolase functions are multifaceted, including the coordination of gene regulation in parasitic stage development. Enolase 1 provides a potential lead in the design of drugs against Toxoplasma brain cysts.
Directory of Open Access Journals (Sweden)
Stéphane Uroz
Full Text Available In temperate ecosystems, acidic forest soils are among the most nutrient-poor terrestrial environments. In this context, the long-term differentiation of the forest soils into horizons may impact the assembly and the functions of the soil microbial communities. To gain a more comprehensive understanding of the ecology and functional potentials of these microbial communities, a suite of analyses including comparative metagenomics was applied on independent soil samples from a spruce plantation (Breuil-Chenue, France. The objectives were to assess whether the decreasing nutrient bioavailability and pH variations that naturally occurs between the organic and mineral horizons affects the soil microbial functional biodiversity. The 14 Gbp of pyrosequencing and Illumina sequences generated in this study revealed complex microbial communities dominated by bacteria. Detailed analyses showed that the organic soil horizon was significantly enriched in sequences related to Bacteria, Chordata, Arthropoda and Ascomycota. On the contrary the mineral horizon was significantly enriched in sequences related to Archaea. Our analyses also highlighted that the microbial communities inhabiting the two soil horizons differed significantly in their functional potentials according to functional assays and MG-RAST analyses, suggesting a functional specialisation of these microbial communities. Consistent with this specialisation, our shotgun metagenomic approach revealed a significant increase in the relative abundance of sequences related glycoside hydrolases in the organic horizon compared to the mineral horizon that was significantly enriched in glycoside transferases. This functional stratification according to the soil horizon was also confirmed by a significant correlation between the functional assays performed in this study and the functional metagenomic analyses. Together, our results suggest that the soil stratification and particularly the soil resource
Directory of Open Access Journals (Sweden)
Rodrigo Juliano Oliveira
2014-01-01
Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.
Directory of Open Access Journals (Sweden)
Vidal Mônica Scarpelli Martinelli
2003-01-01
Full Text Available Chromoblastomycosis (CBM is a chronic subcutaneous infection caused by several dematiaceous fungi. The most commonly etiological agent found in Brazil is Fonsecaea pedrosoi, which appears as thick walled, brownish colored cells with transverse and longitudinal division in the lesions, called "muriform cells". This disease is found worldwide but countries like Madagascar and Brazil have highest incidence. Diagnosis is made by clinical, direct and histopathologic examination and culture of specimens. Serological tests have been used to identify specific antibodies against Fonsecaea pedrosoi antigens, as well as immunotechniques have been used for CBM serological identification and diagnosis. In the present study double immunodiffusion (DID, counterimmunoelectrophoresis (CIE and immunoenzymatic test (ELISA have been used to evaluate humoral immune response in patients with CBM caused by F. pedrosoi. Metabolic antigen was used for immunoprecipitation tests (DID and CIE while somatic antigen for ELISA. Our results demonstrated 53% sensitivity and 96% specificity for DID, while CIE presented 68% sensitivity and 90.5% specificity. ELISA demonstrated 78% sensibility and 83% specificity. Serological tests can be a useful tool to study different aspects of CBM, such as helping differential diagnosis, when culture of the pathogenic agent is impossible.
Nanoparticle-assay marker interaction: effects on nanotoxicity assessment
International Nuclear Information System (INIS)
Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei; Loo, Say Chye Joachim
2015-01-01
Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein–particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges
Nanoparticle-assay marker interaction: effects on nanotoxicity assessment
Energy Technology Data Exchange (ETDEWEB)
Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)
2015-01-15
Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein–particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges.
Nanoparticle-assay marker interaction: effects on nanotoxicity assessment
Zhao, Xinxin; Xiong, Sijing; Huang, Liwen Charlotte; Ng, Kee Woei; Loo, Say Chye Joachim
2015-01-01
Protein-based cytotoxicity assays such as lactate dehydrogenase (LDH) and tumor necrosis factor-alpha (TNF-α) are commonly used in cytotoxic evaluation of nanoparticles (NPs) despite numerous reports on possible interactions with protein markers in these assays that can confound the results obtained. In this study, conventional cytotoxicity assays where assay markers may (LDH and TNF- α) or may not (PicoGreen and WST-8) come into contact with NPs were used to evaluate the cytotoxicity of NPs. The findings revealed selective interactions between negatively charged protein assay markers (LDH and TNF- α) and positively charged ZnO NPs under abiotic conditions. The adsorption and interaction with these protein assay markers were strongly influenced by surface charge, concentration, and specific surface area of the NPs, thereby resulting in less than accurate cytotoxic measurements, as observed from actual cell viability measurements. An improved protocol for LDH assay was, therefore, proposed and validated by eliminating any effects associated with protein-particle interactions. In view of this, additional measures and precautions should be taken when evaluating cytotoxicity of NPs with standard protein-based assays, particularly when they are of opposite charges.
Ma, Y; Gregorio, G; Gäken, J; Muratori, L; Bianchi, F B; Mieli-Vergani, G; Vergani, D
1997-06-01
Liver kidney microsomal type 1 antibody (LKM1) is the diagnostic marker of autoimmune hepatitis (AIH) type 2 and is also found in patients with hepatitis C virus (HCV) infection. Cytochrome P4502D6 (CYP2D6) is the documented target antigen of LKM1 in AIH, but not in HCV infection. To compare the reactivity in the two conditions, we established a radioligand assay using eukaryotically expressed CYP2D6 as target. A 1.2-kb human CYP2D6 cDNA was isolated from a human liver cDNA library and subcloned into an in vitro transcription vector pSP64 Poly(A). Recombinant CYP2D6 was then produced by in vitro transcription/translation, metabolically labelled with 35S methionine and used in the immunoprecipitation assay. Antibodies that bound radiolabelled CYP2D6 were immunoprecipitated and their levels assessed as cpm. Sera from 50 LKM1-positive patients (26 with AIH; 24 with HCV infection), 128 LKM1-negative patients and 57 normal controls were tested. Reactivity to 35S labelled CYP2D6 was observed in all LKM1-positive sera from patients with AIH and HCV infection, but in none of the controls. The cpm in both conditions were significantly higher than in normal controls (pLKM1 (r 0.87, p<0.001 and r=0.64, p<0.001 for AIH and HCV infection, respectively). Reactivity to 35S labelled CYP2D6 was inhibited by addition of an excess of eukaryotically expressed CYP2D6. CYP2D6 is a major target antigen of both AIH and HCV infection. The novel radioligand assay is highly sensitive and specific.
International Nuclear Information System (INIS)
Nixon, E.
1989-01-01
14 C labeled 4'-phosphopantetheine (PAN) is detectable as 2 bands after SDS-PAGE of mitochondrial proteins. The bands comigrate with subunit 6 of cytochrome oxidase (COX) and a small ATPase subunit in tube gel slices of immunoprecipitates. However, other work demonstrated these bands to be due to modification of a novel protein, related to acyl carrier protein (ACP) of spinach and E. coli, that exists in two forms. To resolve this discrepancy, 1-dimensional (1D) slab and 2-dimensional (2D) SDS-PAGE was used for increased resolution over tube gels. Total mitochondrial protein gels from PAN labeled cells were western blotted, probed for COX, and autoradiographed. In 1D there is exact migration of PAN with COX6. In 2D PAN overlaps a protein distinct from and not antigenically related to COX subunits. These data suggest it is the ACP-like protein that in PAN-modified. Its possible association with COX during assembly will be discussed
Quantitative immunoassays for diagnosis and carrier detection in cystic fibrosis
International Nuclear Information System (INIS)
Bullock, S.; Hayward, C.; Manson, J.; Brock, D.J.H.; Raeburn, J.A.
1982-01-01
Quantitative immunoprecipitation and immunoradiometric assays have been developed for a protein present in the serum of cystic fibrosis homozygotes, and to a lesser extent in the serum of heterozygotes. When tested on a panel of sera from 14 cystic fibrosis patients, 29 heterozygotes and 23 controls, the immunoprecipitation assay allowed correct assignments to be made on 94% of occasions with one batch of antiserum and 95% with another. With the same panel of sera, the immunoradiometric assay allowed 94% correct assignments. It is suggested that such accuracy is the maximum that can be expected in the present state of knowledge of cystic fibrosis. (author)
Polireddy, Kishore; Khan, Mohiuddin Md Taimur; Chavan, Hemantkumar; Young, Susan; Ma, Xiaochao; Waller, Anna; Garcia, Matthew; Perez, Dominique; Chavez, Stephanie; Strouse, Jacob J; Haynes, Mark K; Bologa, Cristian G; Oprea, Tudor I; Tegos, George P; Sklar, Larry A; Krishnamurthy, Partha
2012-01-01
ABCB6 is a member of the adenosine triphosphate (ATP)-binding cassette family of transporter proteins that is increasingly recognized as a relevant physiological and therapeutic target. Evaluation of modulators of ABCB6 activity would pave the way toward a more complete understanding of the significance of this transport process in tumor cell growth, proliferation and therapy-related drug resistance. In addition, this effort would improve our understanding of the function of ABCB6 in normal physiology with respect to heme biosynthesis, and cellular adaptation to metabolic demand and stress responses. To search for modulators of ABCB6, we developed a novel cell-based approach that, in combination with flow cytometric high-throughput screening (HTS), can be used to identify functional modulators of ABCB6. Accumulation of protoporphyrin, a fluorescent molecule, in wild-type ABCB6 expressing K562 cells, forms the basis of the HTS assay. Screening the Prestwick Chemical Library employing the HTS assay identified four compounds, benzethonium chloride, verteporfin, tomatine hydrochloride and piperlongumine, that reduced ABCB6 mediated cellular porphyrin levels. Validation of the identified compounds employing the hemin-agarose affinity chromatography and mitochondrial transport assays demonstrated that three out of the four compounds were capable of inhibiting ABCB6 mediated hemin transport into isolated mitochondria. However, only verteporfin and tomatine hydrochloride inhibited ABCB6's ability to compete with hemin as an ABCB6 substrate. This assay is therefore sensitive, robust, and suitable for automation in a high-throughput environment as demonstrated by our identification of selective functional modulators of ABCB6. Application of this assay to other libraries of synthetic compounds and natural products is expected to identify novel modulators of ABCB6 activity.
Riakhovskiĭ, A A; Tillib, S V
2007-09-01
Using the method of immunoprecipitation of the in vivo crosslinked and sheared by sonication chromatin, mapping of potential trithorax-associated regulatory elements within the extended (9 kb) promoter region of the fork head gene (fkh) in the Drosophila melanogaster salivary gland cells was performed. Relative homogeneity of the salivary gland cells, along with the parallel use of the antibodies to different domains of the same trithorax protein (TRX), and the introduction of cross-hybridization steps for additional specific enrichment of initial DNA libraries, provided improvement of the method effectiveness and identification of one major and two less expressed potential TRX-binding sites.
Directory of Open Access Journals (Sweden)
Herrmann Harald
2008-09-01
Full Text Available Abstract Background Colocalization of Stk33 with vimentin by double immunofluorescence in certain cells indicated that vimentin might be a target for phosphorylation by the novel kinase Stk33. We therefore tested in vitro the ability of Stk33 to phosphorylate recombinant full length vimentin and amino-terminal truncated versions thereof. In order to prove that Stk33 and vimentin are also in vivo associated proteins co-immunoprecipitation experiments were carried out. For testing the enzymatic activity of immunoprecipitated Stk33 we incubated precipitated Stk33 with recombinant vimentin proteins. To investigate whether Stk33 binds directly to vimentin, an in vitro co-sedimentation assay was performed. Results The results of the kinase assays demonstrate that Stk33 is able to specifically phosphorylate the non-α-helical amino-terminal domain of vimentin in vitro. Furthermore, co-immunoprecipitation experiments employing cultured cell extracts indicate that Stk33 and vimentin are associated in vivo. Immunoprecipitated Stk33 has enzymatic activity as shown by successful phosphorylation of recombinant vimentin proteins. The results of the co-sedimentation assay suggest that vimentin binds directly to Stk33 and that no additional protein mediates the association. Conclusion We hypothesize that Stk33 is involved in the in vivo dynamics of the intermediate filament cytoskeleton by phosphorylating vimentin.
The lncRNA TUG1 modulates proliferation in trophoblast cells via epigenetic suppression of RND3.
Xu, Yetao; Ge, Zhiping; Zhang, Erbao; Zuo, Qing; Huang, Shiyun; Yang, Nana; Wu, Dan; Zhang, Yuanyuan; Chen, Yanzi; Xu, Haoqin; Huang, Huan; Jiang, Zhiyan; Sun, Lizhou
2017-10-12
Due to limited treatment options, pre-eclampsia (PE) is associated with fetal perinatal and maternal morbidity and mortality. During the causes of PE, failure of uterine spiral artery remodeling which might be related to functioning abnormally of trophoblast cells, result in the occurrence and progression of PE. Recently, abnormal expression of long non-coding RNAs (lncRNAs), as imperative regulators involved in human diseases progression (included PE), which has been indicated by increasing evidence. In this research, we found that TUG1, a lncRNA, was markedly reduced in placental samples from patients with PE. Loss-function assays indicated that knockdown TUG1 significantly affected cell proliferation, apoptosis, migration and network formation in vitro. RNA-seq revealed that TUG1 could affect abundant genes, and then explore the function and regulatory mechanism of TUG1 in trophoblast cells. Furthermore, RNA immunoprecipitation and chromatin immunoprecipitation assays validated that TUG1 can epigenetically inhibit the level of RND3 through binding to EZH2, thus promoting PE development. Therefore, via illuminating the TUG1 mechanisms underlying PE development and progression, our findings might furnish a prospective therapeutic strategy for PE intervention.
Directory of Open Access Journals (Sweden)
Kishore Polireddy
Full Text Available ABCB6 is a member of the adenosine triphosphate (ATP-binding cassette family of transporter proteins that is increasingly recognized as a relevant physiological and therapeutic target. Evaluation of modulators of ABCB6 activity would pave the way toward a more complete understanding of the significance of this transport process in tumor cell growth, proliferation and therapy-related drug resistance. In addition, this effort would improve our understanding of the function of ABCB6 in normal physiology with respect to heme biosynthesis, and cellular adaptation to metabolic demand and stress responses. To search for modulators of ABCB6, we developed a novel cell-based approach that, in combination with flow cytometric high-throughput screening (HTS, can be used to identify functional modulators of ABCB6. Accumulation of protoporphyrin, a fluorescent molecule, in wild-type ABCB6 expressing K562 cells, forms the basis of the HTS assay. Screening the Prestwick Chemical Library employing the HTS assay identified four compounds, benzethonium chloride, verteporfin, tomatine hydrochloride and piperlongumine, that reduced ABCB6 mediated cellular porphyrin levels. Validation of the identified compounds employing the hemin-agarose affinity chromatography and mitochondrial transport assays demonstrated that three out of the four compounds were capable of inhibiting ABCB6 mediated hemin transport into isolated mitochondria. However, only verteporfin and tomatine hydrochloride inhibited ABCB6's ability to compete with hemin as an ABCB6 substrate. This assay is therefore sensitive, robust, and suitable for automation in a high-throughput environment as demonstrated by our identification of selective functional modulators of ABCB6. Application of this assay to other libraries of synthetic compounds and natural products is expected to identify novel modulators of ABCB6 activity.
Directory of Open Access Journals (Sweden)
Kaoru Miyazaki
Full Text Available Endometrial stem/progenitor cells contribute to the cyclical regeneration of human endometrium throughout a woman's reproductive life. Although the candidate cell populations have been extensively studied, no consensus exists regarding which endometrial population represents the stem/progenitor cell fraction in terms of in vivo stem cell activity. We have previously reported that human endometrial side population cells (ESP, but not endometrial main population cells (EMP, exhibit stem cell-like properties, including in vivo reconstitution of endometrium-like tissues when xenotransplanted into immunodeficient mice. The reconstitution efficiency, however, was low presumably because ESP cells alone could not provide a sufficient microenvironment (niche to support their stem cell activity. The objective of this study was to establish a novel in vivo endometrial stem cell assay employing cell tracking and tissue reconstitution systems and to examine the stem cell properties of ESP through use of this assay.ESP and EMP cells isolated from whole endometrial cells were infected with lentivirus to express tandem Tomato (TdTom, a red fluorescent protein. They were mixed with unlabeled whole endometrial cells and then transplanted under the kidney capsule of ovariectomized immunodeficient mice. These mice were treated with estradiol and progesterone for eight weeks and nephrectomized. All of the grafts reconstituted endometrium-like tissues under the kidney capsules. Immunofluorescence revealed that TdTom-positive cells were significantly more abundant in the glandular, stromal, and endothelial cells of the reconstituted endometrium in mice transplanted with TdTom-labeled ESP cells than those with TdTom-labeled EMP cells.We have established a novel in vivo endometrial stem cell assay in which multi-potential differentiation can be identified through cell tracking during in vivo endometrial tissue reconstitution. Using this assay, we demonstrated that ESP
MicroRNA transfection and AGO-bound CLIP-seq data sets reveal distinct determinants of miRNA action
DEFF Research Database (Denmark)
Wen, Jiayu; Parker, Brian J; Jacobsen, Anders
2011-01-01
the predictive effect of target flanking features. We observe distinct target determinants between expression-based and CLIP-based data. Target flanking features such as flanking region conservation are an important AGO-binding determinant-we hypothesize that CLIP experiments have a preference for strongly bound......Microarray expression analyses following miRNA transfection/inhibition and, more recently, Argonaute cross-linked immunoprecipitation (CLIP)-seq assays have been used to detect miRNA target sites. CLIP and expression approaches measure differing stages of miRNA functioning-initial binding of the mi...... miRNP-target interactions involving adjacent RNA-binding proteins that increase the strength of cross-linking. In contrast, seed-related features are major determinants in expression-based studies, but less so for CLIP-seq studies, and increased miRNA concentrations typical of transfection studies...
Breitkopf, Susanne B; Yuan, Min; Pihan, German A; Asara, John M
2012-10-02
Hypothesis directed proteomics offers higher throughput over global analyses. We show that immunoprecipitation (IP)-tandem mass spectrometry (LC-MS/MS) in H929 multiple myeloma (MM) cancer cells led to the discovery of a rare and unexpected BCR-ABL fusion, informing a therapeutic intervention using imatinib (Gleevec). BCR-ABL is the driving mutation in chronic myeloid leukemia (CML) and is uncommon to other cancers. Three different IP-MS experiments central to cell signaling pathways were sufficient to discover a BCR-ABL fusion in H929 cells: phosphotyrosine (pY) peptide IP, p85 regulatory subunit of phosphoinositide-3-kinase (PI3K) IP, and the GRB2 adaptor IP. The pY peptides inform tyrosine kinase activity, p85 IP informs the activating adaptors and receptor tyrosine kinases (RTKs) involved in AKT activation and GRB2 IP identifies RTKs and adaptors leading to ERK activation. Integration of the bait-prey data from the three separate experiments identified the BCR-ABL protein complex, which was confirmed by biochemistry, cytogenetic methods, and DNA sequencing revealed the e14a2 fusion transcript. The tyrosine phosphatase SHP2 and the GAB2 adaptor protein, important for MAPK signaling, were common to all three IP-MS experiments. The comparative treatment of tyrosine kinase inhibitor (TKI) drugs revealed only imatinib, the standard of care in CML, was inhibitory to BCR-ABL leading to down-regulation of pERK and pS6K and inhibiting cell proliferation. These data suggest a model for directed proteomics from patient tumor samples for selecting the appropriate TKI drug(s) based on IP and LC-MS/MS. The data also suggest that MM patients, in addition to CML patients, may benefit from BCR-ABL diagnostic screening.
International Nuclear Information System (INIS)
Sung, Uhna; Jennings, Jennifer L.; Link, Andrew J.; Blakely, Randy D.
2005-01-01
The norepinephrine transporter (NET) terminates noradrenergic signals by clearing released NE at synapses. NET regulation by receptors and intracellular signaling pathways is supported by a growing list of associated proteins including syntaxin1A, protein phosphatase 2A (PP2A) catalytic subunit (PP2A-C), PICK1, and Hic-5. In the present study, we sought evidence for additional partnerships by mass spectrometry-based analysis of proteins co-immunoprecipitated with human NET (hNET) stably expressed in a mouse noradrenergic neuroblastoma cell line. Our initial proteomic analyses reveal multiple peptides derived from hNET, peptides arising from the mouse PP2A anchoring subunit (PP2A-Ar) and peptides derived from 14-3-3 proteins. We verified physical association of NET with PP2A-Ar via co-immunoprecipitation studies using mouse vas deferens extracts and with 14-3-3 via a fusion pull-down approach, implicating specifically the hNET NH 2 -terminus for interactions. The transporter complexes described likely support mechanisms regulating transporter activity, localization, and trafficking
Development of a nematode offspring counting assay for rapid and simple soil toxicity assessment.
Kim, Shin Woong; Moon, Jongmin; Jeong, Seung-Woo; An, Youn-Joo
2018-05-01
Since the introduction of standardized nematode toxicity assays by the American Society for Testing and Materials (ASTM) and International Organization for Standardization (ISO), many studies have reported their use. Given that the currently used standardized nematode toxicity assays have certain limitations, in this study, we examined the use of a novel nematode offspring counting assay for evaluating soil ecotoxicity based on a previous soil-agar isolation method used to recover live adult nematodes. In this new assay, adult Caenorhabditis elegans were exposed to soil using a standardized toxicity assay procedure, and the resulting offspring in test soils attracted by a microbial food source in agar plates were counted. This method differs from previously used assays in terms of its endpoint, namely, the number of nematode offspring. The applicability of the bioassay was demonstrated using metal-spiked soils, which revealed metal concentration-dependent responses, and with 36 field soil samples characterized by different physicochemical properties and containing various metals. Principal component analysis revealed that texture fraction (clay, sand, and silt) and electrical conductivity values were the main factors influencing the nematode offspring counting assay, and these findings warrant further investigation. The nematode offspring counting assay is a rapid and simple process that can provide multi-directional toxicity assessment when used in conjunction with other standard methods. Copyright © 2018 Elsevier Ltd. All rights reserved.
Zhao, Ziyan; Henowitz, Liza; Zweifach, Adam
2018-05-01
We previously developed a flow cytometry assay that monitored lytic granule exocytosis in cytotoxic T lymphocytes stimulated by contacting beads coated with activating anti-CD3 antibodies. That assay was multiplexed in that responses of cells that did or did not receive the activating stimulus were distinguished via changes in light scatter accompanying binding of cells to beads, allowing us to discriminate compounds that activate responses on their own from compounds that enhance responses in cells that received the activating stimulus, all within a single sample. Here we add a second dimension of multiplexing by developing means to assess in a single sample the effects of treating cells with test compounds for different times. Bar-coding cells before adding them to test wells lets us determine compound treatment time while also monitoring activation status and response amplitude at the point of interrogation. This multiplexed assay is suitable for screening 96-well plates. We used it to screen compounds from the National Cancer Institute, identifying several compounds that enhance anti-LAMP1 responses. Multiple-treatment-time (MTT) screening enabled by bar-coding and read via high-throughput flow cytometry may be a generally useful method for facilitating the discovery of compounds of interest.
Sugiura, Aya; Iwahara, Kunihiro; Suga, Yasuyuki; Uchiyama, Sachinori; Maekawa, Masato
2012-02-01
We compared the ECLusys HBsAgII (ECL HBsAg) assay to the Lumipulse Forte (LPf HBsAg) and HISCL (HIS HBsAg) assays. Measurement of dilution panels for which the WHO HBsAg international reference panel was the parent specimen revealed that the ECL and HIS assays enabled detection to a theoretical level of 0.04 IU/mL, whereas the LPf assay enabled detection to a level of 0.08 IU/mL. In a specificity test using high RF positive specimens (n = 33), pregnancy specimens (n = 35), cytomegalovirus antibody positive specimens (n = 36), and high M protein positive specimens (n = 21) that were confirmed negative for HBsAg by the LPf assay, negative results were obtained for all specimens on the HIS assay, but the ECL assay yielded a positive result for one of the high RF positive specimens. This individual was suggested on further testing to be an HBV carrier who was strongly positive for HBc antibody. In HBsAg mutants detection test, the detection rate was 92.3% with the ECL assay and 69.2% with the HIS assay. In a correlation test using routinely collected clinical specimens (n = 155), including positive stock specimens, aside from the one case where the LPf assay gave a negative result but both the ECL and HIS assays gave positive results, all of the results were consistent for all specimens. The above results confirmed that the ECL assay is both highly sensitive and specific, and also enables a high rate of HBsAg mutant detection.
Directory of Open Access Journals (Sweden)
Hong Hao
Full Text Available A stringent control of homeostasis is critical for functional maintenance and survival of neurons. In the mammalian retina, the basic motif leucine zipper transcription factor NRL determines rod versus cone photoreceptor cell fate and activates the expression of many rod-specific genes. Here, we report an integrated analysis of NRL-centered gene regulatory network by coupling chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-Seq data from Illumina and ABI platforms with global expression profiling and in vivo knockdown studies. We identified approximately 300 direct NRL target genes. Of these, 22 NRL targets are associated with human retinal dystrophies, whereas 95 mapped to regions of as yet uncloned retinal disease loci. In silico analysis of NRL ChIP-Seq peak sequences revealed an enrichment of distinct sets of transcription factor binding sites. Specifically, we discovered that genes involved in photoreceptor function include binding sites for both NRL and homeodomain protein CRX. Evaluation of 26 ChIP-Seq regions validated their enhancer functions in reporter assays. In vivo knockdown of 16 NRL target genes resulted in death or abnormal morphology of rod photoreceptors, suggesting their importance in maintaining retinal function. We also identified histone demethylase Kdm5b as a novel secondary node in NRL transcriptional hierarchy. Exon array analysis of flow-sorted photoreceptors in which Kdm5b was knocked down by shRNA indicated its role in regulating rod-expressed genes. Our studies identify candidate genes for retinal dystrophies, define cis-regulatory module(s for photoreceptor-expressed genes and provide a framework for decoding transcriptional regulatory networks that dictate rod homeostasis.
A novel microculture kinetic assay (MiCK assay) for malignant cell growth and chemosensitivity.
Kravtsov, V D
1994-01-01
The THERMOmax microplate reader was adapted for monitoring the growth kinetics of human leukaemic OCI/AML-2 and mouse tumour J-774.1 cell lines in continuous culture. Fluid evaporation from wells, CO2 escape and contamination were prevented by hermetic sealing of the microcultures in wells of a 96-well microplate, thus enabling the cells to grow exponentially for 72 h under the conditions of the incubated microplate reader. For both OCI/AML-2 cells, which grow in suspension, and adherent J-774.1 cells, a linear correlation was demonstrated between the number of unstained cells seeded in a given microplate well and the optical density (OD) of that well. Therefore, the OD/time curve of the culture could be deemed to be its growth curve. By the use of the linear fit equation, the actual number of the cells in the wells was computable at any time point of the assay. In the chemosensitivity test, an inhibitory effect of ARA-C on the growth of the cells could be estimated by viewing of the growth curves plotted on the screen. The maximum kinetic rates (Vmax) of the curves in the control and the ARA-C-treated wells were compared, yielding a growth inhibition index (GII). Comparison of results of the kinetic chemosensitivity assay with those of a [3H]thymidine incorporation assay revealed that the novel assay is suitable for precise quantitation of the cell chemosensitivity, is more informative and has the added technical advantage of performance without recourse to radioactive or chemically hazardous substances.
Directory of Open Access Journals (Sweden)
Tommy Baumann
2013-10-01
Full Text Available We have shown previously that the raft-associated proteins flotillin-1 and -2 are rapidly recruited to the uropods of chemoattractant-stimulated human neutrophils and T-cells and are involved in cell polarization. Other proteins such as the adhesion receptor PSGL-1, the actin-membrane linker proteins ezrin/radixin/moesin (ERM and the signaling enzyme phosphatidylinositol-4-phosphate 5-kinase type Iγ90 (PIPKIγ90 also accumulate in the T-cell uropod. Using the in situ proximity ligation assay (PLA we now have investigated putative close associations of these proteins in human freshly isolated T-cells before and after chemokine addition. The PLA allows in situ subcellular localization of close proximity of endogenous proteins at single-molecule resolution in fixed cells. It allows detection also of weaker and transient complexes that would not be revealed with co-immunoprecipitation approaches. We previously provided evidence for heterodimer formation of tagged flotillin-1 and -2 in T-cells before and after chemokine addition using fluorescence resonance energy transfer (FRET. We now confirm these findings using PLA for the endogenous flotillins in fixed human T-cells. Moreover, in agreement with the literature, our PLA findings confirm a close association of endogenous PSGL-1 and ERM proteins both in resting and chemokine-activated human T-cells. In addition, we provide novel evidence using the PLA for close associations of endogenous activated ERM proteins with PIPKIγ90 and of endogenous flotillins with PSGL-1 in human T-cells, before and after chemokine addition. Our findings suggest that preformed clusters of these proteins coalesce in the uropod upon cell stimulation.
Sajayan, Arya; Seghal Kiran, G; Priyadharshini, S; Poulose, Navya; Selvin, Joseph
2017-09-01
A bioflocculant-producing bacterial strain, designated MSI021, was isolated from the marine sponge Dendrilla nigra and demonstrated 94% flocculation activity in a kaolin clay suspension. MSI021 was identified as Bacillus cereus based on phylogenetic affiliation and biochemical characteristics. The purified extra-cellular bioflocculant was chemically elucidated as a polysaccharide molecule. The polysaccharide bioflocculant was stable under both acidic and alkaline conditions (pH 2.0-10.0) and temperatures up to 100 °C. The purified bioflocculant efficiently nucleated the formation of silver nanoparticles which showed broad spectrum antibacterial activity. The ability of the bioflocculant to remediate heavy metal toxicity was evaluated by measuring the inhibition of bioluminescence expression in Vibrio harveyi. Enrichment of heavy metals such as zinc, mercury and copper at concentrations of 1, 2 and 3 mM in culture media showed significant reduction of bioluminescence in Vibrio, whereas media enriched with heavy metals and bioflocculant showed dose dependent improvement in the expression of bioluminescence. The assay results demonstrated that the polysaccharide bioflocculant effectively mitigates heavy metal toxicity, thereby improving the expression of bioluminescence in Vibrio. This bioluminescence reporter assay can be developed into a high-throughput format to monitor and evaluate of heavy metal toxicity. The findings of this study revealed that a novel polysaccharide bioflocculant produced by a marine B. cereus demonstrated strong flocculating performance and was effective in nucleating the formation antibacterial silver nanoparticles and removing heavy metals. These results suggest that the MSI021 polysaccharide bioflocculant can be used to develop greener waste water treatment systems. Copyright © 2017 Elsevier Ltd. All rights reserved.
Burgess, Janette K.; Lopez, Jose A.; Gaudry, Leonie E.; Chong, Beng H.
2000-01-01
The drug-dependent antibody of a patient with rifampicin-induced thrombocytopenia was characterized using the antigen-capture enzyme-linked immunosorbent assay (MAIPA assay), flow cytometry, and immunoprecipitation. The antibody was found to bind glycoprotein (GP) Ib-IX but not GPIIb-IIIa because
Roy, Prasenjit; Mukherjee, Anita; Giri, Sarbani
2016-02-01
Ground water is the principal source of drinking water in Assam. Ground water contamination of arsenic in drinking water is a great concern for human health and considered as a human carcinogen. The present cytogenetic biomonitoring study was undertaken to investigate the genotoxic effects associated with people of southern Assam consuming arsenic contaminated water and chewing tobacco. Employing the buccal cytome assay, exfoliated cells were analyzed in 138 individuals of age range 22-42 years and divided into four groups. Group I (n=54) are participants residing in localities where ground water contains arsenic concentration below the permissible limit (comet assay, percent of tail DNA gradually increases among the groups and has statistical significance. Spearman correlation revealed strong positive correlation between the arsenic exposed peoples and the binucleated cells (r=0.4763; Pcomet assay. Copyright © 2015 Elsevier Inc. All rights reserved.
Kim, Soung Min; Jeong, Dasul; Kim, Min Keun; Lee, Sang Shin; Lee, Suk Keun
2017-08-08
Oral squamous cell carcinoma (OSCC) is one of the most dangerous cancers in the body, producing serious complications with individual behaviors. Many different pathogenetic factors are involved in the carcinogenesis of OSCC. Cancer cells derived from oral keratinocytes can produce different carcinogenic signaling pathways through differences in protein expression, but their protein expression profiles cannot be easily explored with ordinary detection methods. The present study compared the protein expression profiles between two different types of OSCCs, which were analyzed through immunoprecipitation high-performance liquid chromatography (IP-HPLC). Two types of squamous cell carcinoma (SCC) occurred in a mandibular (SCC-1) and maxillary gingiva (SCC-2), but their clinical features and progression were quite different from each other. SCC-1 showed a large gingival ulceration with severe halitosis and extensive bony destruction, while SCC-2 showed a relatively small papillary gingival swelling but rapidly grew to form a large submucosal mass, followed by early cervical lymph node metastasis. In the histological observation, SCC-1 was relatively well differentiated with a severe inflammatory reaction, while SCC-2 showed severely infiltrative growth of each cancer islets accompanied with a mild inflammatory reaction. IP-HPLC analysis revealed contrary protein expression profiles analyzed by 72 different oncogenic proteins. SCC-1 showed more cellular apoptosis and invasive growth than SCC-2 through increased expression of caspases, MMPs, p53 signaling, FAS signaling, TGF-β1 signaling, and angiogenesis factors, while SCC-2 showed more cellular growth and survival than SCC-1 through the increased expression of proliferating factors, RAS signaling, eIF5A signaling, WNT signaling, and survivin. The increased trends of cellular apoptosis and invasiveness in the protein expression profiles of SCC-1 were implicative of its extensive gingival ulceration and bony destruction
A novel high-throughput assay for islet respiration reveals uncoupling of rodent and human islets.
Directory of Open Access Journals (Sweden)
Jakob D Wikstrom
Full Text Available The pancreatic beta cell is unique in its response to nutrient by increased fuel oxidation. Recent studies have demonstrated that oxygen consumption rate (OCR may be a valuable predictor of islet quality and long term nutrient responsiveness. To date, high-throughput and user-friendly assays for islet respiration are lacking. The aim of this study was to develop such an assay and to examine bioenergetic efficiency of rodent and human islets.The XF24 respirometer platform was adapted to islets by the development of a 24-well plate specifically designed to confine islets. The islet plate generated data with low inter-well variability and enabled stable measurement of oxygen consumption for hours. The F1F0 ATP synthase blocker oligomycin was used to assess uncoupling while rotenone together with myxothiazol/antimycin was used to measure the level of non-mitochondrial respiration. The use of oligomycin in islets was validated by reversing its effect in the presence of the uncoupler FCCP. Respiratory leak averaged to 59% and 49% of basal OCR in islets from C57Bl6/J and FVB/N mice, respectively. In comparison, respiratory leak of INS-1 cells and C2C12 myotubes was measured to 38% and 23% respectively. Islets from a cohort of human donors showed a respiratory leak of 38%, significantly lower than mouse islets.The assay for islet respiration presented here provides a novel tool that can be used to study islet mitochondrial function in a relatively high-throughput manner. The data obtained in this study shows that rodent islets are less bioenergetically efficient than human islets as well as INS1 cells.
Selective activation of SHP2 activity by cisplatin revealed by a novel chemical probe-based assay
International Nuclear Information System (INIS)
Kuo, Chun-Chen; Chu, Chi-Yuan; Lin, Jing-Jer; Lo, Lee-Chiang
2010-01-01
Src homology-2 (SH2) domain-containing phosphatase 2 (SHP2) is known to participate in several different signaling pathways to mediate cell growth, survival, migration, and differentiation. However, due to the lack of proper analytical tools, it is unclear whether the phosphatase activity of SHP2 is activated in most studies. We have previously developed an activity-based probe LCL2 that formed covalent linkage with catalytically active protein tyrosine phosphatases (PTPs). Here, by combining LCL2 with a SHP2 specific antibody, we established an assay system that enables the direct monitoring of SHP2 activity upon cisplatin treatment of cancer cells. The protocol is advantageous over conventional colorimetric or in-gel PTP assays as it is specific and does not require the use of radioisotope reagents. Using this assay, we found SHP2 activity was selectively activated by cisplatin. Moreover, the activation of SHP2 appeared to be specific for cisplatin as other DNA damage agents failed to activate the activity. Although the role of SHP2 activation by cisplatin treatments is still unclear to us, our results provide the first direct evidence for the activation of SHP2 during cisplatin treatments. More importantly, the concept of using activity-based probe in conjunction with target-specific antibodies could be extended to other enzyme classes.
DEFF Research Database (Denmark)
Caviglia, Claudia; Zor, Kinga; Canepa, Silvia
2015-01-01
We investigated the combined effect of the initial cell density (12 500, 35 000, 75 000, and 100 000 cells cm−2) and concentration of the anti-cancer drug doxorubicin on HeLa cells by performing timedependent cytotoxicity assays using real-time electrochemical impedance spectroscopy. A correlation...... between the rate of cell death and the initial cell seeding density was found at 2.5 μM doxorubicin concentration, whereas this was not observed at 5 or 100 μM. By sensing the changes in the cell–substrate interaction using impedance spectroscopy under static conditions, the onset of cytotoxicity...... was observed 5 h earlier than when using a standard colorimetric end-point assay (MTS) which measures changes in the mitochondrial metabolism. Furthermore, with the MTS assay no cytotoxicity was observed after 15 h of incubation with 2.5 μM doxorubicin, whereas the impedance showed at this time point cell...
Widespread nanoparticle-assay interference: implications for nanotoxicity testing.
Ong, Kimberly J; MacCormack, Tyson J; Clark, Rhett J; Ede, James D; Ortega, Van A; Felix, Lindsey C; Dang, Michael K M; Ma, Guibin; Fenniri, Hicham; Veinot, Jonathan G C; Goss, Greg G
2014-01-01
The evaluation of engineered nanomaterial safety has been hindered by conflicting reports demonstrating differential degrees of toxicity with the same nanoparticles. The unique properties of these materials increase the likelihood that they will interfere with analytical techniques, which may contribute to this phenomenon. We tested the potential for: 1) nanoparticle intrinsic fluorescence/absorbance, 2) interactions between nanoparticles and assay components, and 3) the effects of adding both nanoparticles and analytes to an assay, to interfere with the accurate assessment of toxicity. Silicon, cadmium selenide, titanium dioxide, and helical rosette nanotubes each affected at least one of the six assays tested, resulting in either substantial over- or under-estimations of toxicity. Simulation of realistic assay conditions revealed that interference could not be predicted solely by interactions between nanoparticles and assay components. Moreover, the nature and degree of interference cannot be predicted solely based on our current understanding of nanomaterial behaviour. A literature survey indicated that ca. 95% of papers from 2010 using biochemical techniques to assess nanotoxicity did not account for potential interference of nanoparticles, and this number had not substantially improved in 2012. We provide guidance on avoiding and/or controlling for such interference to improve the accuracy of nanotoxicity assessments.
Widespread nanoparticle-assay interference: implications for nanotoxicity testing.
Directory of Open Access Journals (Sweden)
Kimberly J Ong
Full Text Available The evaluation of engineered nanomaterial safety has been hindered by conflicting reports demonstrating differential degrees of toxicity with the same nanoparticles. The unique properties of these materials increase the likelihood that they will interfere with analytical techniques, which may contribute to this phenomenon. We tested the potential for: 1 nanoparticle intrinsic fluorescence/absorbance, 2 interactions between nanoparticles and assay components, and 3 the effects of adding both nanoparticles and analytes to an assay, to interfere with the accurate assessment of toxicity. Silicon, cadmium selenide, titanium dioxide, and helical rosette nanotubes each affected at least one of the six assays tested, resulting in either substantial over- or under-estimations of toxicity. Simulation of realistic assay conditions revealed that interference could not be predicted solely by interactions between nanoparticles and assay components. Moreover, the nature and degree of interference cannot be predicted solely based on our current understanding of nanomaterial behaviour. A literature survey indicated that ca. 95% of papers from 2010 using biochemical techniques to assess nanotoxicity did not account for potential interference of nanoparticles, and this number had not substantially improved in 2012. We provide guidance on avoiding and/or controlling for such interference to improve the accuracy of nanotoxicity assessments.
Directory of Open Access Journals (Sweden)
Yitao Wang
2017-03-01
Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.
Directory of Open Access Journals (Sweden)
Hongkai Ji
Full Text Available The functions of key oncogenic transcription factors independent of context have not been fully delineated despite our richer understanding of the genetic alterations in human cancers. The MYC oncogene, which produces the Myc transcription factor, is frequently altered in human cancer and is a major regulatory hub for many cancers. In this regard, we sought to unravel the primordial signature of Myc function by using high-throughput genomic approaches to identify the cell-type independent core Myc target gene signature. Using a model of human B lymphoma cells bearing inducible MYC, we identified a stringent set of direct Myc target genes via chromatin immunoprecipitation (ChIP, global nuclear run-on assay, and changes in mRNA levels. We also identified direct Myc targets in human embryonic stem cells (ESCs. We further document that a Myc core signature (MCS set of target genes is shared in mouse and human ESCs as well as in four other human cancer cell types. Remarkably, the expression of the MCS correlates with MYC expression in a cell-type independent manner across 8,129 microarray samples, which include 312 cell and tissue types. Furthermore, the expression of the MCS is elevated in vivo in Eμ-Myc transgenic murine lymphoma cells as compared with premalignant or normal B lymphocytes. Expression of the MCS in human B cell lymphomas, acute leukemia, lung cancers or Ewing sarcomas has the highest correlation with MYC expression. Annotation of this gene signature reveals Myc's primordial function in RNA processing, ribosome biogenesis and biomass accumulation as its key roles in cancer and stem cells.
Directory of Open Access Journals (Sweden)
Minh T Than
2013-06-01
Full Text Available Identifying the physiological functions of microRNAs (miRNAs is often challenging because miRNAs commonly impact gene expression under specific physiological conditions through complex miRNA::mRNA interaction networks and in coordination with other means of gene regulation, such as transcriptional regulation and protein degradation. Such complexity creates difficulties in dissecting miRNA functions through traditional genetic methods using individual miRNA mutations. To investigate the physiological functions of miRNAs in neurons, we combined a genetic "enhancer" approach complemented by biochemical analysis of neuronal miRNA-induced silencing complexes (miRISCs in C. elegans. Total miRNA function can be compromised by mutating one of the two GW182 proteins (AIN-1, an important component of miRISC. We found that combining an ain-1 mutation with a mutation in unc-3, a neuronal transcription factor, resulted in an inappropriate entrance into the stress-induced, alternative larval stage known as dauer, indicating a role of miRNAs in preventing aberrant dauer formation. Analysis of this genetic interaction suggests that neuronal miRNAs perform such a role partly by regulating endogenous cyclic guanosine monophosphate (cGMP signaling, potentially influencing two other dauer-regulating pathways. Through tissue-specific immunoprecipitations of miRISC, we identified miRNAs and their likely target mRNAs within neuronal tissue. We verified the biological relevance of several of these miRNAs and found that many miRNAs likely regulate dauer formation through multiple dauer-related targets. Further analysis of target mRNAs suggests potential miRNA involvement in various neuronal processes, but the importance of these miRNA::mRNA interactions remains unclear. Finally, we found that neuronal genes may be more highly regulated by miRNAs than intestinal genes. Overall, our study identifies miRNAs and their targets, and a physiological function of these miRNAs in
The identification of host proteins that interact with virus proteins is a major challenge for the field of virology. Phloem-limited viruses pose extraordinary challenges for in vivo protein interaction experiments because these viruses are localized in very few and highly specialized host cells. ...
Whole-genome resequencing reveals candidate mutations for pig prolificacy.
Li, Wen-Ting; Zhang, Meng-Meng; Li, Qi-Gang; Tang, Hui; Zhang, Li-Fan; Wang, Ke-Jun; Zhu, Mu-Zhen; Lu, Yun-Feng; Bao, Hai-Gang; Zhang, Yuan-Ming; Li, Qiu-Yan; Wu, Ke-Liang; Wu, Chang-Xin
2017-12-20
Changes in pig fertility have occurred as a result of domestication, but are not understood at the level of genetic variation. To identify variations potentially responsible for prolificacy, we sequenced the genomes of the highly prolific Taihu pig breed and four control breeds. Genes involved in embryogenesis and morphogenesis were targeted in the Taihu pig, consistent with the morphological differences observed between the Taihu pig and others during pregnancy. Additionally, excessive functional non-coding mutations have been specifically fixed or nearly fixed in the Taihu pig. We focused attention on an oestrogen response element (ERE) within the first intron of the bone morphogenetic protein receptor type-1B gene ( BMPR1B ) that overlaps with a known quantitative trait locus (QTL) for pig fecundity. Using 242 pigs from 30 different breeds, we confirmed that the genotype of the ERE was nearly fixed in the Taihu pig. ERE function was assessed by luciferase assays, examination of histological sections, chromatin immunoprecipitation, quantitative polymerase chain reactions, and western blots. The results suggest that the ERE may control pig prolificacy via the cis-regulation of BMPR1B expression. This study provides new insight into changes in reproductive performance and highlights the role of non-coding mutations in generating phenotypic diversity between breeds. © 2017 The Author(s).
Chen, Jun; Liang, Xiu; Chen, Pei-fu
2011-04-01
Inducing animal viruses to adapt to chicken embryos or chicken embryo fibroblasts (CEF) is a common method to develop attenuated live vaccines with full security. Canine distemper virus (CDV) also does this, but the mechanisms and particular receptors remain unclear. Virus overlay protein blot assays were carried out on CEF membrane proteins, which were extracted respectively with a Mem-PER™ kit, a radioimmunoprecipitation assay buffer or a modified co-immunoprecipitation method, and revealed a common 57 kDa positive band that differed from the 42-kDa positive band in Vero cells and also from those receptors reported in lymphocytes and 293 cells, indicating a receptor diversity of CDV and the possibility of the 57-kDa protein acting as a receptor that is involved in adaptive infection of CDV Kunming strain to CEF.
Mendez, N.; Herrera, V.; Zhang, L.; Hedjran, F.; Feuer, R.; Blair, S.; Trogler, W.; Reid, T.
2014-01-01
Oncolytic viruses (OVs) constitute a promising class of cancer therapeutics which exploit validated genetic pathways known to be deregulated in many cancers. To overcome an immune response and to enhance its potential use to treat primary and metastatic tumors, a method for liposomal encapsulation of adenovirus has been developed. The encapsulation of adenovirus in non-toxic anionic lecithin-cholesterol-PEG liposomes ranging from 140–180nm in diameter have been prepared by self-assembly around the viral capsid. The encapsulated viruses retain their ability to infect cancer cells. Furthermore, an immunoprecipitation (IP) technique has shown to be a fast and effective method to extract non-encapsulated viruses and homogenize the liposomes remaining in solution. 78% of adenovirus plaque forming units were encapsulated and retained infectivity after IP processing. Additionally, encapsulated viruses have shown enhanced transfection efficiency up to 4× higher compared to non-encapsulated Ads. Extracting non-encapsulated viruses from solution may prevent an adverse in vivo immune response and may enhance treatment for multiple administrations. PMID:25154663
Mendez, Natalie; Herrera, Vanessa; Zhang, Lingzhi; Hedjran, Farah; Feuer, Ralph; Blair, Sarah L; Trogler, William C; Reid, Tony R; Kummel, Andrew C
2014-11-01
Oncolytic viruses (OVs) constitute a promising class of cancer therapeutics which exploit validated genetic pathways known to be deregulated in many cancers. To overcome an immune response and to enhance its potential use to treat primary and metastatic tumors, a method for liposomal encapsulation of adenovirus has been developed. The encapsulation of adenovirus in non-toxic anionic lecithin-cholesterol-PEG liposomes ranging from 140 to 180 nm in diameter have been prepared by self-assembly around the viral capsid. The encapsulated viruses retain their ability to infect cancer cells. Furthermore, an immunoprecipitation (IP) technique has shown to be a fast and effective method to extract non-encapsulated viruses and homogenize the liposomes remaining in solution. 78% of adenovirus plaque forming units were encapsulated and retained infectivity after IP processing. Additionally, encapsulated viruses have shown enhanced transfection efficiency up to 4 × higher compared to non-encapsulated Ads. Extracting non-encapsulated viruses from solution may prevent an adverse in vivo immune response and may enhance treatment for multiple administrations. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Anli Zhang
2015-06-01
Full Text Available Background Increased surveillance of avian-origin influenza A (H7N9 virus infection is critical to assess the risk of new outbreaks in China. A high-throughput assay with a good safety profile, sensitivity, and specificity is urgently needed. Methods We used a hemagglutination-inhibition (HI assay based on an H7N9-enveloped pseudovirus to assess serum neutralization antibodies level in 40 H7N9 positive sera and 40 H7N9 negative sera and compared the efficacy of the assay with traditional HI test and micro-neutralization (MN test. Results Spearman’s rank correlation coefficient analysis showed pseudovirus HI (PHI titers correlated well with both HI titers and MN titers. Receiver operating characteristic (ROC curves test revealed using a PHI cut-off titer of 10, the sensitivity and specificity reached 1.0. Conclusions PHI can be used in H7N9-related serological studies. This assay is high-throughput, very sensitive and specific, and cost effective.
Assaying Cellular Viability Using the Neutral Red Uptake Assay.
Ates, Gamze; Vanhaecke, Tamara; Rogiers, Vera; Rodrigues, Robim M
2017-01-01
The neutral red uptake assay is a cell viability assay that allows in vitro quantification of xenobiotic-induced cytotoxicity. The assay relies on the ability of living cells to incorporate and bind neutral red, a weak cationic dye, in lysosomes. As such, cytotoxicity is expressed as a concentration-dependent reduction of the uptake of neutral red after exposure to the xenobiotic under investigation. The neutral red uptake assay is mainly used for hazard assessment in in vitro toxicology applications. This method has also been introduced in regulatory recommendations as part of 3T3-NRU-phototoxicity-assay, which was regulatory accepted in all EU member states in 2000 and in the OECD member states in 2004 as a test guideline (TG 432). The present protocol describes the neutral red uptake assay using the human hepatoma cell line HepG2, which is often employed as an alternative in vitro model for human hepatocytes. As an example, the cytotoxicity of acetaminophen and acetyl salicylic acid is assessed.
DEFF Research Database (Denmark)
Kristensen, B.K.; Askerlund, P.; Bykova, N.V.
2004-01-01
.2 mM CuSO4 for 10 min at room temperature). The oxidised proteins in both samples were tagged with dinitrophenylhydrazine (DNP), which forms a covalent bond with carbonyl groups. The DNP-tagged proteins were immunoprecipitated using anti-DNP antibodies and digested with trypsin. The mixture...... of peptides was analysed by nano-HPLC coupled online to an ESI-Quad-TOF mass spectrometer. The peptides were separated by stepwise ion exchange chromatography followed by reverse phase chromatography (2D-LC), and analysed by MS/MS. Proteins were identified by un-interpreted fragment ion database searches...... blots showed that neither the isolation of mitochondria, nor their subfractionation introduced carbonyl groups. We therefore conclude that a number of proteins are oxidised in the matrix of rice leaf mitochondria in vivo and further identify a group of proteins that are particularly susceptible to mild...
van der Ploeg, René; Goudelis, Spyridon Theodoros; den Blaauwen, Tanneke
2015-01-01
The increase in antibiotic resistant bacteria demands the development of new antibiotics against preferably new targets. The common approach is to test compounds for their ability to kill bacteria or to design molecules that inhibit essential protein activities in vitro. In the first case, the mode of action of the drug is unknown and in the second case, it is not known whether the compound will pass the impermeable barrier of the bacterial envelope. We developed an assay that detects the target of a compound, as well as its ability to pass the membrane(s) simultaneously. The Escherichia coli cytoskeletal protein MreB recruits protein complexes (elongasomes) that are essential for cell envelope growth. An in cell Förster Resonance Energy Transfer (FRET) assay was developed to detect the interaction between MreB molecules and between MreB and the elongasome proteins RodZ, RodA and PBP2. Inhibition of the polymerization of MreB by S-(3,4-dichlorobenzyl) isothiourea (A22) or of the activity of PBP2 by mecilinam resulted in loss or reduction of all measured interactions. This suggests that the interactions between the elongasome proteins are governed by a combination of weak affinities and substrate availability. This validated in cell FRET assay can be used to screen for cell envelope growth inhibitors. PMID:26263980
Directory of Open Access Journals (Sweden)
René van der Ploeg
2015-07-01
Full Text Available The increase in antibiotic resistant bacteria demands the development of new antibiotics against preferably new targets. The common approach is to test compounds for their ability to kill bacteria or to design molecules that inhibit essential protein activities in vitro. In the first case, the mode of action of the drug is unknown and in the second case, it is not known whether the compound will pass the impermeable barrier of the bacterial envelope. We developed an assay that detects the target of a compound, as well as its ability to pass the membrane(s simultaneously. The Escherichia coli cytoskeletal protein MreB recruits protein complexes (elongasomes that are essential for cell envelope growth. An in cell Förster Resonance Energy Transfer (FRET assay was developed to detect the interaction between MreB molecules and between MreB and the elongasome proteins RodZ, RodA and PBP2. Inhibition of the polymerization of MreB by S-(3,4-dichlorobenzyl isothiourea (A22 or of the activity of PBP2 by mecilinam resulted in loss or reduction of all measured interactions. This suggests that the interactions between the elongasome proteins are governed by a combination of weak affinities and substrate availability. This validated in cell FRET assay can be used to screen for cell envelope growth inhibitors.
Random assay in radioimmunoassay: Feasibility and application compared with batch assay
Energy Technology Data Exchange (ETDEWEB)
Lee, Jung Min; Lee, Hwan Hee; Park, Sohyun; Kim, Tae Sung; Kim, Seok Ki [Dept. of Nuclear MedicineNational Cancer Center, Goyang (Korea, Republic of)
2016-12-15
The batch assay has been conventionally used for radioimmunoassay (RIA) because of its technical robustness and practical convenience. However, it has limitations in terms of the relative lag of report time due to the necessity of multiple assays in a small number of samples compared with the random assay technique. In this study, we aimed to verify whether the random assay technique can be applied in RIA and is feasible in daily practice. The coefficients of variation (CVs) of eight standard curves within a single kit were calculated in a CA-125 immunoradiometric assay (IRMA) for the reference of the practically ideal CV of the CA-125 kit. Ten standard curves of 10 kits from 2 prospectively collected lots (pLot) and 85 standard curves of 85 kits from 3 retrospectively collected lots (Lot) were obtained. Additionally, the raw measurement data of both 170 control references and 1123 patients' sera were collected retrospectively between December 2015 and January 2016. A standard curve of the first kit of each lot was used as a master standard curve for a random assay. The CVs of inter-kits were analyzed in each lot, respectively. All raw measurements were normalized by decay and radioactivity. The CA-125 values from control samples and patients' sera were compared using the original batch assay and random assay. In standard curve analysis, the CVs of inter-kits in pLots and Lots were comparable to those within a single kit. The CVs from the random assay with normalization were similar to those from the batch assay in the control samples (CVs % of low/high concentration; Lot1 2.71/1.91, Lot2 2.35/1.83, Lot3 2.83/2.08 vs. Lot1 2.05/1.21, Lot2 1.66/1.48, Lot3 2.41/2.14). The ICCs between the batch assay and random assay using patients' sera were satisfactory (Lot1 1.00, Lot2 0.999, Lot3 1.00). The random assay technique could be successfully applied to the conventional CA-125 IRMA kits. The random assay showed strong agreement with the batch assay. The
Chang, Ti Ling; Ito, Kosei; Ko, Tun Kiat; Liu, Qiang; Salto-Tellez, Manuel; Yeoh, Khay Guan; Fukamachi, Hiroshi; Ito, Yoshiaki
2010-01-01
The transcription factor RUNX3 is a gastric tumor suppressor. Tumorigenic Runx3(-/-) gastric epithelial cells attach weakly to each other, compared with nontumorigenic Runx3(+/+) cells. We aimed to identify RUNX3 target genes that promote cell-cell contact to improve our understanding of RUNX3's role in suppressing gastric carcinogenesis. We compared gene expression profiles of Runx3(+/+) and Runx3(-/-) cells and observed down-regulation of genes associated with cell-cell adhesion in Runx3(-/-) cells. Reporter, mobility shift, and chromatin immunoprecipitation assays were used to examine the regulation of these genes by RUNX3. Tumorigenesis assays and immunohistological analyses of human gastric tumors were performed to confirm the role of the candidate genes in gastric tumor development. Mobility shift and chromatin immunoprecipitation assays revealed that the promoter activity of the gene that encodes the tight junction protein claudin-1 was up-regulated via the binding of RUNX3 to the RUNX consensus sites. The tumorigenicity of gastric epithelial cells from Runx3(-/-) mice was significantly reduced by restoration of claudin-1 expression, whereas knockdown of claudin-1 increased the tumorigenicity of human gastric cancer cells. Concomitant expression of RUNX3 and claudin-1 was observed in human normal gastric epithelium and cancers. The tight junction protein claudin-1 has gastric tumor suppressive activity and is a direct transcriptional target of RUNX3. Claudin-1 is down-regulated during the epithelial-mesenchymal transition; RUNX3 might therefore act as a tumor suppressor to antagonize the epithelial-mesenchymal transition. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.
Matrix effects of TRU [transuranic] assays using the SWEPP PAN assay system
International Nuclear Information System (INIS)
Smith, J.R.
1990-08-01
The Drum Assay System (DAS) at the Stored Waste Experimental Pilot Plant (SWEPP) is a second-generation active-passive neutron assay system. It has been used to assay over 5000 208-liter drums of transuranic waste from the Rocky Flats Plant (RFP). Data from these assays have been examined and compared with the assays performed at Rocky Flats, mainly utilize counting of 239 Pu gamma rays. For the most part the passive assays are in very good agreement with the Rocky Flats assays. The active assays are strongly correlated with the results of the other two methods, but require matrix-dependent correction factors beyond those provided by the system itself. A set of matrix-dependent correction factors has been developed from the study of the assay results. 3 refs., 4 figs., 3 tabs
Comparison of Batch Assay and Random Assay Using Automatic Dispenser in Radioimmunoassay
Energy Technology Data Exchange (ETDEWEB)
Moon, Seung Hwan; Jang, Su Jin; Kang, Ji Yeon; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul [Seoul Metropolitan Government Seoul National University Boramae Medical Center, Seoul (Korea, Republic of); Lee, Ho Young; Shin, Sun Young; Min, Gyeong Sun; Lee, Hyun Joo [Seoul National University college of Medicine, Seoul (Korea, Republic of)
2009-08-15
Radioimmunoassay (RIA) was usually performed by the batch assay. To improve the efficiency of RIA without increase of the cost and time, random assay could be a choice. We investigated the possibility of the random assay using automatic dispenser by assessing the agreement between batch assay and random assay. The experiments were performed with four items; Triiodothyronine (T3), free thyroxine (fT4), Prostate specific antigen (PSA), Carcinoembryonic antigen (CEA). In each item, the sera of twenty patients, the standard, and the control samples were used. The measurements were done 4 times with 3 hour time intervals by random assay and batch assay. The coefficient of variation (CV) of the standard samples and patients' data in T3, fT4, PSA, and CEA were assessed. ICC (Intraclass correlation coefficient) and coefficient of correlation were measured to assessing the agreement between two methods. The CVs (%) of T3, fT4, PSA, and CEA measured by batch assay were 3.2+-1.7%, 3.9+-2.1%, 7.1+-6.2%, 11.2+-7.2%. The CVs by random assay were 2.1+-1.7%, 4.8+-3.1%, 3.6+-4.8%, and 7.4+-6.2%. The ICC between the batch assay and random assay were 0.9968 (T3), 0.9973 (fT4), 0.9996 (PSA), and 0.9901 (CEA). The coefficient of correlation between the batch assay and random assay were 0.9924(T3), 0.9974 (fT4), 0.9994 (PSA), and 0.9989 (CEA) (p<0.05). The results of random assay showed strong agreement with the batch assay in a day. These results suggest that random assay using automatic dispenser could be used in radioimmunoassay
Comparison of Batch Assay and Random Assay Using Automatic Dispenser in Radioimmunoassay
International Nuclear Information System (INIS)
Moon, Seung Hwan; Jang, Su Jin; Kang, Ji Yeon; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul; Lee, Ho Young; Shin, Sun Young; Min, Gyeong Sun; Lee, Hyun Joo
2009-01-01
Radioimmunoassay (RIA) was usually performed by the batch assay. To improve the efficiency of RIA without increase of the cost and time, random assay could be a choice. We investigated the possibility of the random assay using automatic dispenser by assessing the agreement between batch assay and random assay. The experiments were performed with four items; Triiodothyronine (T3), free thyroxine (fT4), Prostate specific antigen (PSA), Carcinoembryonic antigen (CEA). In each item, the sera of twenty patients, the standard, and the control samples were used. The measurements were done 4 times with 3 hour time intervals by random assay and batch assay. The coefficient of variation (CV) of the standard samples and patients' data in T3, fT4, PSA, and CEA were assessed. ICC (Intraclass correlation coefficient) and coefficient of correlation were measured to assessing the agreement between two methods. The CVs (%) of T3, fT4, PSA, and CEA measured by batch assay were 3.2±1.7%, 3.9±2.1%, 7.1±6.2%, 11.2±7.2%. The CVs by random assay were 2.1±1.7%, 4.8±3.1%, 3.6±4.8%, and 7.4±6.2%. The ICC between the batch assay and random assay were 0.9968 (T3), 0.9973 (fT4), 0.9996 (PSA), and 0.9901 (CEA). The coefficient of correlation between the batch assay and random assay were 0.9924(T3), 0.9974 (fT4), 0.9994 (PSA), and 0.9989 (CEA) (p<0.05). The results of random assay showed strong agreement with the batch assay in a day. These results suggest that random assay using automatic dispenser could be used in radioimmunoassay
Huang, Bill X.; Kim, Hee-Yong
2013-01-01
Akt is a critical protein for cell survival and known to interact with various proteins. However, Akt binding partners that modulate or regulate Akt activation have not been fully elucidated. Identification of Akt-interacting proteins has been customarily achieved by co-immunoprecipitation combined with western blot and/or MS analysis. An intrinsic problem of the method is loss of interacting proteins during procedures to remove non-specific proteins. Moreover, antibody contamination often interferes with the detection of less abundant proteins. Here, we developed a novel two-step chemical crosslinking strategy to overcome these problems which resulted in a dramatic improvement in identifying Akt interacting partners. Akt antibody was first immobilized on protein A/G beads using disuccinimidyl suberate and allowed to bind to cellular Akt along with its interacting proteins. Subsequently, dithiobis[succinimidylpropionate], a cleavable crosslinker, was introduced to produce stable complexes between Akt and binding partners prior to the SDS-PAGE and nanoLC-MS/MS analysis. This approach enabled identification of ten Akt partners from cell lysates containing as low as 1.5 mg proteins, including two new potential Akt interacting partners. None of these but one protein was detectable without crosslinking procedures. The present method provides a sensitive and effective tool to probe Akt-interacting proteins. This strategy should also prove useful for other protein interactions, particularly those involving less abundant or weakly associating partners. PMID:23613850
International Nuclear Information System (INIS)
Miller, R.J.; Chang, K.-J.
1981-01-01
A radioreceptor assay is described for assaying opioid drugs in biological fluids. The method enables the assay of total opioid activity, being specific for opioids as a class but lacking specificity within the class. A radio-iodinated opioid and the liquid test sample are incubated with an opiate receptor material. The percentage inhibition of the binding of the radio-iodinated compound to the opiate receptor is calculated and the opioid activity of the test liquid determined from a standard curve. Examples of preparing radio-iodinated opioids and assaying opioid activity are given. A test kit for the assay is described. Compared to other methods, this assay is cheap, easy and rapid. (U.K.)
Galgoczy, Roland; Pastor, Isabel; Colom, Adai; Giménez, Alicia; Mas, Francesc; Alcaraz, Jordi
2014-08-01
The design of 3D culture studies remains challenging due to the limited understanding of extracellular matrix (ECM)-dependent hindered diffusion and the lack of simple diffusivity assays. To address these limitations, we set up a cost-effective diffusivity assay based on a Transwell plate and the spectrophotometer of a Microplate Reader, which are readily accessible to cell biology groups. The spectrophotometer-based assay was used to assess the apparent diffusivity D of FITC-dextrans with molecular weight (4-70kDa) spanning the physiological range of signaling factors in a panel of acellular ECM gels including Matrigel, fibrin and type I collagen. Despite their technical differences, D data exhibited ∼15% relative difference with respect to FRAP measurements. Our results revealed that diffusion hindrance of small particles is controlled by the enhanced viscosity of the ECM gel in conformance with the Stokes-Einstein equation rather than by geometrical factors. Moreover, we provided a strong rationale that the enhanced ECM viscosity is largely contributed to by unassembled ECM macromolecules. We also reported that gels with the lowest D exhibited diffusion hindrance closest to the large physiologic hindrance of brain tissue, which has a typical pore size much smaller than ECM gels. Conversely, sparse gels (≤1mg/ml), which are extensively used in 3D cultures, failed to reproduce the hindered diffusion of tissues, thereby supporting that dense (but not sparse) ECM gels are suitable tissue surrogates in terms of macromolecular transport. Finally, the consequences of reduced diffusivity in terms of optimizing the design of 3D culture experiments were addressed in detail. Copyright © 2014 Elsevier B.V. All rights reserved.
Evaluation of the reliability of maize reference assays for GMO quantification.
Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel
2010-03-01
A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb
Liu, Yanyan; Fu, Jianjie; Pan, Wenxiao; Xue, Qiao; Liu, Xian; Zhang, Aiqian
2018-01-01
The studies on the human toxicity of nanoparticles (NPs) are far behind the rapid development of engineered functionalized NPs. Fullerene has been widely used as drug carrier skeleton due to its reported low risk. However, different from other kinds of NPs, fullerene-based NPs (C 60 NPs) have been found to have an anticoagulation effect, although the potential target is still unknown. In the study, both experimental and computational methods were adopted to gain mechanistic insight into the modulation of thrombin activity by nine kinds of C 60 NPs with diverse surface chemistry properties. In vitro enzyme activity assays showed that all tested surface-modified C 60 NPs exhibited thrombin inhibition ability. Kinetic studies coupled with competitive testing using 3 known inhibitors indicated that six of the C 60 NPs, of greater hydrophobicity and hydrogen bond (HB) donor acidity or acceptor basicity, acted as competitive inhibitors of thrombin by directly interacting with the active site of thrombin. A simple quantitative nanostructure-activity relationship model relating the surface substituent properties to the inhibition potential was then established for the six competitive inhibitors. Molecular docking analysis revealed that the intermolecular HB interactions were important for the specific binding of C 60 NPs to the active site canyon, while the additional stability provided by the surface groups through van der Waals interaction also play a key role in the thrombin binding affinity of the NPs. Our results suggest that thrombin is a possible target of the surface-functionalized C 60 NPs relevant to their anticoagulation effect. Copyright © 2017. Published by Elsevier B.V.
A fluorescence-based rapid screening assay for cytotoxic compounds
International Nuclear Information System (INIS)
Montoya, Jessica; Varela-Ramirez, Armando; Estrada, Abril; Martinez, Luis E.; Garza, Kristine; Aguilera, Renato J.
2004-01-01
A simple fluorescence-based assay was developed for the rapid screening of potential cytotoxic compounds generated by combinatorial chemistry. The assay is based on detection of nuclear green fluorescent protein (GFP) staining of a human cervical cancer cell line (HeLa) carrying an integrated histone H2B-GFP fusion gene. Addition of a cytotoxic compound to the HeLa-GFP cells results in the eventual degradation of DNA and loss of the GFP nuclear fluorescence. Using this assay, we screened 11 distinct quinone derivatives and found that several of these compounds were cytotoxic. These compounds are structurally related to plumbagin an apoptosis-inducing naphthoquinone isolated from Black Walnut. In order to determine the mechanism by which cell death was induced, we performed additional experiments with the most cytotoxic quinones. These compounds were found to induce morphological changes (blebbing and nuclear condensation) consistent with induction of apoptosis. Additional tests revealed that the cytotoxic compounds induce both necrotic and apoptotic modes of death
Liu, Huan; Zhou, Guizhi; Fu, Xin; Cui, Haiyan; Pu, Guangrui; Xiao, Yao; Sun, Wei; Dong, Xinhua; Zhang, Libin; Cao, Sijia; Li, Guiqin; Wu, Xiaowei; Yang, Xu
2017-11-24
Lung cancer is one of the leading causes of cancer-related mortality, and responds badly to existing treatment. Thus, it is of urgent need to identify novel diagnostic markers and therapeutic targets. Increasing evidences have indicated that long non-coding RNAs (lncRNAs) play an important role in initiation and progression of lung cancer. However, the role of lncRNA Taurine upregulated 1 (TUG1) in lung adenocarcinoma (LAD) progression is not well known. In this study, we determined the diagnostic value of TUG1 in LAD patients, and further uncovered the underlying functional mechanism. Our results showed that TUG1 was significantly upregulated in LAD cells and serum samples. Receiver operator characteristic (ROC) analysis suggested a relatively higher area under the curve (AUC) of TUG1 (0.756) contrast to cyfra21-1 (0.619). In addition, high TUG1 level was associated with enhanced tumor size, degree of differentiation, lymph node metastases, distant metastasis and TNM stage. Cell functional assays showed that knockdown of TUG1 suppressed LAD cell viability and promoted cell apoptosis. We then sought to reveal the underlying regulatory mechanism, and the pro-apoptotic protein BAX was then identified as the downstream target of TUG1. Gain and loss functional assays showed that inhibition of BAX reversed the induced apoptosis by TUG1 knockdown. Finally, RNA immunoprecipitation and Chromatin immunoprecipitation revealed that TUG1 suppressed BAX expression through physically interacting with EZH2. In conclusion, lncRNA TUG1 is a promising diagnostic marker for LAD patients and suppression of TUG1 levels could be a future direction to promote the prognosis of LAD patients.
Directory of Open Access Journals (Sweden)
Kai Yan
2017-06-01
Full Text Available Background/Amis: Long non-coding RNAs (lncRNAs, a novel class of transcripts, have been shown to play critical roles in diverse cellular biological processes, including tumorigenesis. Small nucleolar RNA host gene 6 (SNHG6 regulates various biological processes in cancer cells. However, the biological role of SNHG6 in gastric cancer still remains to be explored. The aim of this study is to investigate the characteristic of the SNHG6 in gastric cancer. Methods: Quantitative real-time polymerase chain reaction (qRT-PCR was used to measure the expression of SNHG6 in gastric cancer tissues and cell lines. MTT assays, colony formation assays were used to determine the impact of SNHG6 on tumorigenesis . Flow cytometric analysis of cell cycle and apoptosis was performed to measure the effect of SNHG6 on cell cycle and apoptosis rate. Transwell assay was performed to measure the effect of SNHG6 on cell migration. Western blotting and immunofuorescence were utilized to examine the effect of SNHG6 on epithelial-mesenchymal transition (EMT of GC cells. Chromatin immunoprecipitation (ChIP, RNA immunoprecipitation (RIP, RNA-pulldown and luciferase reporter assays were employed to dissect molecular mechanisms. Results: In this study, we revealed that SNHG6 was overexpressed in gastric cancer tissues and cell lines. High expression levels of SNHG6 wereassociated with invasion depth, lymph node metastasis, distant metastasis and tumor/node/metastasis (TNM stage, and predicted poor prognosis. Loss-of-function assays revealed that silenced SNHG6 obviously inhibited gastric cancer cell growth, weakened cell migration capacity and suppressed the EMT processes of gastric cancer cells. Additionally, ChIP, RIP, RNA-pulldown and luciferase reporter assays evidenced that SNHG6 could epigenetically silenced p27 and could competitively sponging miR-101-3p thereby regulating zinc finger E-box-binding homeobox 1 (ZEB1. Conclusion: In summary, our findings demonstrated that
Selection of non-destructive assay methods: Neutron counting or calorimetric assay?
International Nuclear Information System (INIS)
Cremers, T.L.; Wachter, J.R.
1994-01-01
The transition of DOE facilities from production to D ampersand D has lead to more measurements of product, waste, scrap, and other less attractive materials. Some of these materials are difficult to analyze by either neutron counting or calorimetric assay. To determine the most efficacious analysis method, variety of materials, impure salts and hydrofluorination residues have been assayed by both calorimetric assay and neutron counting. New data will be presented together with a review of published data. The precision and accuracy of these measurements are compared to chemistry values and are reported. The contribution of the gamma ray isotopic determination measurement to the overall error of the calorimetric assay or neutron assay is examined and discussed. Other factors affecting selection of the most appropriate non-destructive assay method are listed and considered
Directory of Open Access Journals (Sweden)
Arase Sachiko
2012-03-01
Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.
Directory of Open Access Journals (Sweden)
Samuel Rout
2016-12-01
Full Text Available Protozoan parasites of the genus Giardia are highly prevalent globally, and infect a wide range of vertebrate hosts including humans, with proliferation and pathology restricted to the small intestine. This narrow ecological specialization entailed extensive structural and functional adaptations during host-parasite co-evolution. An example is the streamlined mitosomal proteome with iron-sulphur protein maturation as the only biochemical pathway clearly associated with this organelle. Here, we applied techniques in microscopy and protein biochemistry to investigate the mitosomal membrane proteome in association to mitosome homeostasis. Live cell imaging revealed a highly immobilized array of 30-40 physically distinct mitosome organelles in trophozoites. We provide direct evidence for the single giardial dynamin-related protein as a contributor to mitosomal morphogenesis and homeostasis. To overcome inherent limitations that have hitherto severely hampered the characterization of these unique organelles we applied a novel interaction-based proteome discovery strategy using forward and reverse protein co-immunoprecipitation. This allowed generation of organelle proteome data strictly in a protein-protein interaction context. We built an initial Tom40-centered outer membrane interactome by co-immunoprecipitation experiments, identifying small GTPases, factors with dual mitosome and endoplasmic reticulum (ER distribution, as well as novel matrix proteins. Through iterative expansion of this protein-protein interaction network, we were able to i significantly extend this interaction-based mitosomal proteome to include other membrane-associated proteins with possible roles in mitosome morphogenesis and connection to other subcellular compartments, and ii identify novel matrix proteins which may shed light on mitosome-associated metabolic functions other than Fe-S cluster biogenesis. Functional analysis also revealed conceptual conservation of protein
Directory of Open Access Journals (Sweden)
Dorota Borecka
2002-12-01
Full Text Available A fluorimetric assay of aldehyde dehydrogenase isozymes, based on naphthaldehyde oxidation, is compared with Western Blotting analysis on several clinical samples obtained from surgery. The comparison reveals qualitatively good correlation of ALDH1A1 isozyme detection with two methods and somewhat worse on ALDH3A1 assay.
Ariel, Federico; Diet, Anouck; Verdenaud, Marion; Gruber, Véronique; Frugier, Florian; Chan, Raquel; Crespi, Martin
2010-07-01
The adaptation of root architecture to environmental constraints is a major agricultural trait, notably in legumes, the third main crop worldwide. This root developmental plasticity depends on the formation of lateral roots (LRs) emerging from primary roots. In the model legume Medicago truncatula, the HD-Zip I transcription factor HB1 is expressed in primary and lateral root meristems and induced by salt stress. Constitutive expression of HB1 in M. truncatula roots alters their architecture, whereas hb1 TILLING mutants showed increased lateral root emergence. Electrophoretic mobility shift assay, promoter mutagenesis, and chromatin immunoprecipitation-PCR assays revealed that HB1 directly recognizes a CAATAATTG cis-element present in the promoter of a LOB-like (for Lateral Organ Boundaries) gene, LBD1, transcriptionally regulated by auxin. Expression of these genes in response to abscisic acid and auxin and their behavior in hb1 mutants revealed an HB1-mediated repression of LBD1 acting during LR emergence. M. truncatula HB1 regulates an adaptive developmental response to minimize the root surface exposed to adverse environmental stresses.
Directory of Open Access Journals (Sweden)
Carina Ladeira
2015-06-01
The results concerning of positive findings by micronuclei and non significant ones by comet assay, are corroborated by Deng et al. (2005 study performed in workers occupationally exposed to methotrexate, also a cytostatic drug. According to Cavallo et al. (2009, the comet assay seems to be more suitable for the prompt evaluation of the genotoxic effects, for instance, of polycyclic aromatic hydrocarbons mixtures containing volatile substances, whereas the micronucleus test seems more appropriate to evaluate the effects of exposure to antineoplastic agents. However, there are studies that observed an increase in both the comet assay and the micronucleus test in nurses handling antineoplastic drugs, although statistical significance was only seen in the comet assay, quite the opposite of our results (Maluf & Erdtmann, 2000; Laffon et al. 2005.
Directory of Open Access Journals (Sweden)
Sebastian Weiterer
Full Text Available Chromatin immunoprecipitation in combination with a genome-wide analysis via high-throughput sequencing is the state of the art method to gain genome-wide representation of histone modification or transcription factor binding profiles. However, chromatin immunoprecipitation analysis in the context of human experimental samples is limited, especially in the case of blood cells. The typically extremely low yields of precipitated DNA are usually not compatible with library amplification for next generation sequencing. We developed a highly reproducible protocol to present a guideline from the first step of isolating monocytes from a blood sample to analyse the distribution of histone modifications in a genome-wide manner.The protocol describes the whole work flow from isolating monocytes from human blood samples followed by a high-sensitivity and small-scale chromatin immunoprecipitation assay with guidance for generating libraries compatible with next generation sequencing from small amounts of immunoprecipitated DNA.
Directory of Open Access Journals (Sweden)
Dabisch-Ruthe Mareike
2012-07-01
in 16 TS samples (32% by RespiFinder-19. Fewer infections were found in summer (RespiFinder-19: 20%; RVP: 6%. All positive results were verified using monoplex PCR. Conclusions Multiplex PCR tests have a broad spectrum of pathogens to test at a time. Analysis of multiple inoculated samples revealed a different focus of the detected virus types by the three assays. Analysis of clinical samples showed a high concordance of detected viruses by the RespiFinder-19 compared to monoplex tests.
Directory of Open Access Journals (Sweden)
Hannah L Albritton
Full Text Available Chlamydia trachomatis (CT is the leading sexually transmitted bacterial infection. The continued global burden of CT infection strongly predicates the need for a vaccine to supplement current chlamydial control programs. The correlates of protection against CT are currently unknown, but they must be carefully defined to guide vaccine design. The localized nature of chlamydial infection in columnar epithelial cells of the genital tract necessitates investigation of immunity at the site of infection. The purpose of this study was to develop a sensitive whole bacterial enzyme-linked immunosorbent assay (ELISA to quantify and compare CT-specific IgG and IgA in sera and genital secretions from CT-infected women. To achieve this, elementary bodies (EBs from two of the most common genital serovars (D and E were attached to poly-L-lysine-coated microtiter plates with glutaraldehyde. EB attachment and integrity were verified by the presence of outer membrane antigens and the absence of bacterial cytoplasmic antigens. EB-specific IgG and IgA standards were developed by pooling sera with high titers of CT-specific antibodies from infected women. Serum, endocervical and vaginal secretions, and endocervical cytobrush specimens from CT-infected women were used to quantify CT-specific IgG and IgA which were then normalized to total IgG and IgA, respectively. Analyses of paired serum and genital samples revealed significantly higher proportions of EB-specific antibodies in genital secretions compared to sera. Cervical and vaginal secretions and cytobrush specimens had similar proportions of EB-specific antibodies, suggesting any one of these genital sampling techniques could be used to quantify CT-specific antibodies when appropriate normalization methodologies are implemented. Overall, these results illustrate the need to investigate genital tract CT antibody responses, and our assay provides a useful quantitative tool to assess natural immunity in defined
LENUS (Irish Health Repository)
Murphy, Derek M
2009-01-01
BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the
Microbead agglutination based assays
Kodzius, Rimantas
2013-01-21
We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microbeads in the presence of a specific analyte thus enabling the macroscopic observation. Such tests are most often used to explore antibody-antigen reactions. Agglutination has been used for protein assays using a biotin/streptavidin system as well as a hybridization based assay. The agglutination systems are prone to selftermination of the linking analyte, prone to active site saturation and loss of agglomeration at high analyte concentrations. We investigated the molecular target/ligand interaction, explaining the common agglutination problems related to analyte self-termination, linkage of the analyte to the same bead instead of different microbeads. We classified the agglutination process into three kinds of assays: a two- component assay, a three-component assay and a stepped three- component assay. Although we compared these three kinds of assays for recognizing DNA and protein molecules, the assay can be used for virtually any molecule, including ions and metabolites. In total, the optimized assay permits detecting analytes with high sensitivity in a short time, 5 min, at room temperature. Such a system is appropriate for POC testing.
Saez, Angela; Rodrigues, Americo; Santiago, Julia; Rubio, Silvia; Rodriguez, Pedro L.
2008-01-01
Abscisic acid (ABA) has an important role for plant growth, development, and stress adaptation. HYPERSENSITIVE TO ABA1 (HAB1) is a protein phosphatase type 2C that plays a key role as a negative regulator of ABA signaling; however, the molecular details of HAB1 action in this process are not known. A two-hybrid screen revealed that SWI3B, an Arabidopsis thaliana homolog of the yeast SWI3 subunit of SWI/SNF chromatin-remodeling complexes, is a prevalent interacting partner of HAB1. The interaction mapped to the N-terminal half of SWI3B and required an intact protein phosphatase catalytic domain. Bimolecular fluorescence complementation and coimmunoprecipitation assays confirmed the interaction of HAB1 and SWI3B in the nucleus of plant cells. swi3b mutants showed a reduced sensitivity to ABA-mediated inhibition of seed germination and growth and reduced expression of the ABA-responsive genes RAB18 and RD29B. Chromatin immunoprecipitation experiments showed that the presence of HAB1 in the vicinity of RD29B and RAB18 promoters was abolished by ABA, which suggests a direct involvement of HAB1 in the regulation of ABA-induced transcription. Additionally, our results uncover SWI3B as a novel positive regulator of ABA signaling and suggest that HAB1 modulates ABA response through the regulation of a putative SWI/SNF chromatin-remodeling complex. PMID:19033529
Assaying the reporter gene chloramphenicol acetyltransferase
International Nuclear Information System (INIS)
Crabb, D.W.; Minth, C.D.; Dixon, J.E.
1989-01-01
These experiments document the presence of enzymatic activities in extracts of commonly used cell lines which interfere with the determination of CAT activity. We suspect that the deacetylase activity is the most important, as the extract of the H4IIE C3 cells was capable of completely deacetylating the mono- and diacetylchloramphenicol formed during a 2-hr incubation of CAT with chloramphenicol and acetyl-CoA. The results of the inhibitor experiments are consistent with the presence of proteases which degrade CAT, or a serine carboxylesterase. The interference was also reduced by about half by EDTA; a metalloenzyme (either a protease or esterase) may therefore be involved. This interference appears to be a common phenomenon. We have surveyed 23 different cell types for the presence of the interfering activity and found it in 15. The interference was particularly prominent in several neuroendocrine and hepatoma cells. We took advantage of the effect of EDTA and the heat stability of CAT to eliminate the interference. Addition of 5 mM EDTA and a 10-min incubation of the sonicated cell suspension at 60 degrees prior to centrifugation abolished the interference in all cell lines tested. It is important to note that in order to reveal any CAT activity in some of the extracts (e.g., PC-12 or Hep3B), it was necessary to run the CAT assay for 2 hr. The control assays were therefore run almost to completion, and were well beyond the linear range of the assay. Therefore, the small differences which we observed between the heat-treated and control samples in some instances (e.g., rice, corn, or HeLa cells) will be dramatically amplified when the CAT assay is performed under conditions in which only a small percentage of the substrate is converted to product
Keltanen, T; Mariottini, C; Walta, A M; Rahikainen, A L; Ojanperä, I
2017-06-01
Buprenorphine and methadone are commonly used medications for opioid maintenance treatment (OMT), using sublingual and oral administration, respectively. Although beneficial for OMT, these drugs can also be abused by intravenous administration. In intravenous abuse cases, the adjuvants lactose and sucrose are excreted in urine without hydrolysis to monosaccharides, since there are no disaccharidases in the blood. We validated enzymatic methods for the analysis of lactose and sucrose in urine. The analytical performance of both assays was considered appropriate for detecting intravenous drug abuse. The principle was proven by analyzing 93 postmortem (PM) urine samples for lactose, following comprehensive toxicological drug screening. In addition, 32 clinical urine samples from potential drug abusers were analyzed to assess the effect of PM changes on the assay. The mean level of lactose was low in clinical samples and relatively low in PM samples in which no drugs were found. Markedly elevated levels were seen in many of the buprenorphine positive samples, suggesting intravenous administration. Enzymatic methods could provide a simple and cost effective way to assess the intravenous administration of OMT drugs or drugs of abuse. Very high levels of glucose in urine may interfere with the assays. Furthermore, other causes for elevated urine disaccharides, such as hypolactasia and increased intestinal permeability, need to be considered in the interpretation of the results. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Joshua, CJ; Simmons, BA; Singer, SW
2016-01-01
© 2016 The Royal Society of Chemistry. This study describes the application of a ferricyanide-based assay as a simple and inexpensive assay for rapid analysis of aqueous lignin samples. The assay measures the formation of Prussian blue from the redox reaction between a mixture of potassium ferricyanide and ferric chloride, and phenolic hydroxyl groups of lignin or lignin-derived phenolic moieties. This study revealed that soluble lignin moieties exhibited stronger ferricyanide reactivity than...
A novel data mining method to identify assay-specific signatures in functional genomic studies
Directory of Open Access Journals (Sweden)
Guidarelli Jack W
2006-08-01
Full Text Available Abstract Background: The highly dimensional data produced by functional genomic (FG studies makes it difficult to visualize relationships between gene products and experimental conditions (i.e., assays. Although dimensionality reduction methods such as principal component analysis (PCA have been very useful, their application to identify assay-specific signatures has been limited by the lack of appropriate methodologies. This article proposes a new and powerful PCA-based method for the identification of assay-specific gene signatures in FG studies. Results: The proposed method (PM is unique for several reasons. First, it is the only one, to our knowledge, that uses gene contribution, a product of the loading and expression level, to obtain assay signatures. The PM develops and exploits two types of assay-specific contribution plots, which are new to the application of PCA in the FG area. The first type plots the assay-specific gene contribution against the given order of the genes and reveals variations in distribution between assay-specific gene signatures as well as outliers within assay groups indicating the degree of importance of the most dominant genes. The second type plots the contribution of each gene in ascending or descending order against a constantly increasing index. This type of plots reveals assay-specific gene signatures defined by the inflection points in the curve. In addition, sharp regions within the signature define the genes that contribute the most to the signature. We proposed and used the curvature as an appropriate metric to characterize these sharp regions, thus identifying the subset of genes contributing the most to the signature. Finally, the PM uses the full dataset to determine the final gene signature, thus eliminating the chance of gene exclusion by poor screening in earlier steps. The strengths of the PM are demonstrated using a simulation study, and two studies of real DNA microarray data – a study of
A Mass Spectrometry-Based Predictive Strategy Reveals ADAP1 is Phosphorylated at Tyrosine 364
Energy Technology Data Exchange (ETDEWEB)
Littrell, BobbiJo R [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2018-04-16
The goal of this work was to identify phosphorylation sites within the amino acid sequence of human ADAP1. Using traditional mass spectrometry-based techniques we were unable to produce interpretable spectra demonstrating modification by phosphorylation. This prompted us to employ a strategy in which phosphorylated peptides were first predicted using peptide mapping followed by targeted MS/MS acquisition. ADAP1 was immunoprecipitated from extracts of HEK293 cells stably-transfected with ADAP1 cDNA. Immunoprecipitated ADAP1 was digested with proteolytic enzymes and analyzed by LC-MS in MS1 mode by high-resolution quadrupole time-of-flight mass spectrometry (QTOF-MS). Peptide molecular features were extracted using an untargeted data mining algorithm. Extracted peptide neutral masses were matched against the ADAP1 amino acid sequence with phosphorylation included as a predicted modification. Peptides with predicted phosphorylation sites were analyzed by targeted LC-MS2. Acquired MS2 spectra were then analyzed using database search engines to confirm phosphorylation. Spectra of phosphorylated peptides were validated by manual interpretation. Further confirmation was performed by manipulating phospho-peptide abundance using calf intestinal phosphatase (CIP) and the phorbol ester, phorbol 12-myristate 13-acetate (PMA). Of five predicted phosphopeptides, one, comprised of the sequence AVDRPMLPQEYAVEAHFK, was confirmed to be phosphorylated on a Tyrosine at position 364. Pre-treatment of cells with PMA prior to immunoprecipitation increased the ratio of phosphorylated to unphosphorylated peptide as determined by area counts of extracted ion chromatograms (EIC). Addition of CIP to immunoprecipitation reactions eliminated the phosphorylated form. A novel phosphorylation site was identified at Tyrosine 364. Phosphorylation at this site is increased by treatment with PMA. PMA promotes membrane translocation and activation of protein kinase C (PKC), indicating that Tyrosine 364
Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.
2010-01-01
Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966
Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B
2010-04-01
Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.
Haridas, Parvathi; Penington, Catherine J; McGovern, Jacqui A; McElwain, D L Sean; Simpson, Matthew J
2017-06-21
Malignant spreading involves the migration of cancer cells amongst other native cell types. For example, in vivo melanoma invasion involves individual melanoma cells migrating through native skin, which is composed of several distinct subpopulations of cells. Here, we aim to quantify how interactions between melanoma and fibroblast cells affect the collective spreading of a heterogeneous population of these cells in vitro. We perform a suite of circular barrier assays that includes: (i) monoculture assays with fibroblast cells; (ii) monoculture assays with SK-MEL-28 melanoma cells; and (iii) a series of co-culture assays initiated with three different ratios of SK-MEL-28 melanoma cells and fibroblast cells. Using immunostaining, detailed cell density histograms are constructed to illustrate how the two subpopulations of cells are spatially arranged within the spreading heterogeneous population. Calibrating the solution of a continuum partial differential equation to the experimental results from the monoculture assays allows us to estimate the cell diffusivity and the cell proliferation rate for the melanoma and the fibroblast cells, separately. Using the parameter estimates from the monoculture assays, we then make a prediction of the spatial spreading in the co-culture assays. Results show that the parameter estimates obtained from the monoculture assays lead to a reasonably accurate prediction of the spatial arrangement of the two subpopulations in the co-culture assays. Overall, the spatial pattern of spreading of the melanoma cells and the fibroblast cells is very similar in monoculture and co-culture conditions. Therefore, we find no clear evidence of any interactions other than cell-to-cell contact and crowding effects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Souberbielle, Jean-Claude; Fayol, Véronique; Sault, Corinne; Lawson-Body, Ethel; Kahan, André; Cormier, Catherine
2005-02-01
The recent development of nonradioactive automated assays for serum parathyroid hormone (PTH) and 25-hydroxyvitamin D (25OHD) has made measurement of these two hormones possible in many laboratories. In this study, we compared two new assays for PTH and 25OHD adapted on an automated analyzer, the LIAISON, with two manual immunoassays used worldwide. We studied 228 osteoporotic patients, 927 healthy individuals, 38 patients with primary hyperparathyroidism, and 167 hemodialyzed patients. Serum PTH was measured with the Allegro and the LIAISON assays, and 25OHD was measured with DiaSorin RIA and the LIAISON assay. Regression analysis was used to calculate decision thresholds for the LIAISON assays that were equivalent to those of the Allegro PTH and DiaSorin 25OHD assays. The 25OHD concentrations obtained with the LIAISON assay and the RIA in osteoporotic patients were well correlated (r = 0.83; P 50 nmol/L as eligible for the reference population for the LIAISON PTH assay. In this group, the 3rd-97th percentile interval for LIAISON PTH was 3-51 ng/L. Considering upper reference limits of 46 and 51 ng/L for the Allegro and LIAISON assays, respectively, the frequency of above-normal PTH concentrations in patients with primary hyperparathyroidism was similar in both assays. Regression analysis between serum PTH measured by the Allegro and LIAISON assays in 167 hemodialyzed patients and the corresponding Bland-Altman analysis of these data suggest that the LIAISON PTH assay tends to read higher than the Allegro assay at low concentrations but lower at high concentrations (>300 ng/L). Because clinical decision limits for both PTH and 25OHD should be assay specific, we propose equivalences between these assays and two manual assays used worldwide. These assay-specific decision limits should help potential users of the LIAISON PTH and 25OHD assays.
Repression of the albumin gene in Novikoff hepatoma cells
International Nuclear Information System (INIS)
Capetanaki, Y.G.; Flytzanis, C.N.; Alonso, A.
1982-01-01
Novikoff hepatoma cells have lost their capacity to synthesize albumin. As a first approach to study the mechanisms underlying this event, in vitro translation in a reticulocyte system was performed using total polyadenylated mRNA from rat liver and Novikoff hepatoma cells. Immunoprecipitation of the in vitro translation products with albumin-specific antibody revealed a total lack of albumin synthesis in Novikoff hepatoma, suggesting the absence of functional albumin mRNA in these cells. Titration experiments using as probe albumin cDNA cloned in pBR322 plasmid demonstrated the absence of albumin-specific sequences in both polysomal and nuclear polyadenylated and total RNA from Novikoff cells. This albumin recombinant plasmid was obtained by screening a rat liver cDNA library with albumin [/sup 32/P]cDNA reverse transcribed from immuno-precipitated mRNA. The presence of an albumin-specific gene insert was documented with translation assays as well as by restriction mapping. Repression of the albumin gene at the transcriptional level was further demonstrated by RNA blotting experiments using the cloned albumin cDNA probe. Genomic DNA blots using the cloned albumin cDNA as probe did not reveal any large-scale deletions, insertions, or rearrangements in the albumin gene, suggesting that the processes involved in the suppression of albumin mRNA synthesis do not involve extensive genomic rearrangements
International Nuclear Information System (INIS)
Garaj-Vrhovac, V.; Kopjar, N.
2003-01-01
Genotoxic risks of occupational exposure in a radar facility were evaluated by using alkaline comet assay, micronucleus assay and chromatid breakage assay on peripheral blood leukocytes in exposed subjects and corresponding controls. Results show that occupational exposure to microwave radiation correlates with an increase of genome damage in somatic cells. The levels of DNA damage in exposed subjects determined by using alkaline comet assay were increased compared to control and showed interindividual variations. Incidence of micronuclei was also significantly increased compared to baseline control values. After short exposure of cultured lymphocytes to bleomycin, cells of occupationally exposed subjects responded with high numbers of chromatid breaks. Although the level of chromosome damage generated by bleomycin varied greatly between individuals, in exposed subjects a significantly elevated number of chromatid breaks was observed. Our results support data reported in literature indicating that microwave radiation represents a potential DNA-damaging hazard. Alkaline comet assay is confirmed as a sensitive and highly reproducible technique for detection of primary DNA damage inflicted in somatic cells. Micronucleus assay was confirmed as reliable bio-markers of effect and chromatid breakage assay as sensitive bio-marker of individual cancer susceptibility. The results obtained also confirm the necessity to improve measures and to perform accurate health surveillance of individuals occupationally exposed to microwave radiation
Analysis of JC virus DNA replication using a quantitative and high-throughput assay
Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.
2015-01-01
Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. PMID:25155200
Development and evaluation of a nested-PCR assay for Senecavirus A diagnosis.
Feronato, Cesar; Leme, Raquel A; Diniz, Jaqueline A; Agnol, Alais Maria Dall; Alfieri, Alice F; Alfieri, Amauri A
2018-02-01
Senecavirus A (SVA) has been associated with vesicular disease in weaned and adult pigs and with high mortality of newborn piglets. This study aimed to establish a nested-PCR assay for the routine diagnosis of SVA infection. Tissue samples (n = 177) were collected from 37 piglets of 18 pig farms located in four different Brazilian states. For the nested-PCR, a primer set was defined to amplify an internal VP1 fragment of 316 bp of SVA genome. Of the 37 piglets, 15 (40.5%) and 23 (62.2%) were positive for the SVA in the RT-PCR and nested-PCR assays, respectively. The SVA RNA was detected in 61/177 (34.5%) samples with the RT-PCR, while the nested-PCR assay showed 84/177 (47.5%) samples with the virus (p PCR and nested-PCR assays, respectively. Nucleotide sequencing analysis revealed similarities of 98.7-100% among SVA Brazilian strains and of 86.6-98% with SVA strains from other countries. The nested-PCR assay in this study was suitable to recover the SVA RNA in biological specimens, piglets, and/or herds that were considered as negative in the RT-PCR assay, and is proposed for the routine investigation of the SVA infection in piglets, especially when other techniques are not available or when a great number of samples has to be examined.
International Nuclear Information System (INIS)
Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong
2007-01-01
To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression
Czech Academy of Sciences Publication Activity Database
Tichý, Vlastimil; Šebest, Peter; Orság, Petr; Havran, Luděk; Pivoňková, Hana; Fojta, Miroslav
2017-01-01
Roč. 29, č. 2 (2017), s. 319-323 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 Keywords : catalytic hydrogen evolution * probe * mechanism * suggest Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 2.851, year: 2016
Assay strategies and methods for phospholipases
International Nuclear Information System (INIS)
Reynolds, L.J.; Washburn, W.N.; Deems, R.A.; Dennis, E.A.
1991-01-01
Of the general considerations discussed, the two issues which are most important in choosing an assay are (1) what sensitivity is required to assay a particular enzyme and (2) whether the assay must be continuous. One can narrow the options further by considering substrate availability, enzyme specificity, assay convenience, or the presence of incompatible side reactions. In addition, the specific preference of a particular phospholipase for polar head group, micellar versus vesicular substrates, and anionic versus nonionic detergents may further restrict the options. Of the many assays described in this chapter, several have limited applicability or serious drawbacks and are not commonly employed. The most commonly used phospholipase assays are the radioactive TLC assay and the pH-stat assay. The TLC assay is probably the most accurate, sensitive assay available. These aspects often outweigh the disadvantages of being discontinuous, tedious, and expensive. The radioactive E. coli assay has become popular recently as an alternative to the TLC assay for the purification of the mammalian nonpancreatic phospholipases. The assay is less time consuming and less expensive than the TLC assay, but it is not appropriate when careful kinetics are required. Where less sensitivity is needed, or when a continuous assay is necessary, the pH-stat assay is often employed. With purified enzymes, when free thiol groups are not present, a spectrophotometric thiol assay can be used. This assay is ∼ as sensitive as the pH-stat assay but is more convenient and more reproducible, although the substrate is not available commercially. Despite the many assay choices available, the search continues for a convenient, generally applicable assay that is both sensitive and continuous
Antibodies to poliovirus detected by immunoradiometric assay with a monoclonal antibody
International Nuclear Information System (INIS)
Spitz, M.; Fossati, C.A.; Schild, G.C.; Spitz, L.; Brasher, M.
1982-01-01
An immunoradiometric assay (IRMA) for the assay of antibodies to poliovirus antigens is described. Dilutions of the test sera or whole (finger prick) blood samples were incubated with the poliovirus antigen bound to a solid phase and the specific antibody was detected by the addition of a mouse anti-human IgG monoclonal antibody (McAb), which was itself revealed by iodinated sheep IgG antimouse F(ab). The authors have shown that this technique is suitable for the estimation of IgG anti-poliovirus antibodies induced in children following polio vaccine. The present study shows that SPRIA provides a simple and inexpensive method for serological studies with poliovirus particularly for use in large-scale surveys. (Auth.)
Antibodies to poliovirus detected by immunoradiometric assay with a monoclonal antibody
Energy Technology Data Exchange (ETDEWEB)
Spitz, M.; Fossati, C.A.; Schild, G.C.; Spitz, L.; Brasher, M. (National Inst. for Biological Standards and Control, London (UK))
1982-10-01
An immunoradiometric assay (IRMA) for the assay of antibodies to poliovirus antigens is described. Dilutions of the test sera or whole (finger prick) blood samples were incubated with the poliovirus antigen bound to a solid phase and the specific antibody was detected by the addition of a mouse anti-human IgG monoclonal antibody (McAb), which was itself revealed by iodinated sheep IgG antimouse F(ab). The authors have shown that this technique is suitable for the estimation of IgG anti-poliovirus antibodies induced in children following polio vaccine. The present study shows that SPRIA provides a simple and inexpensive method for serological studies with poliovirus particularly for use in large-scale surveys.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
International Nuclear Information System (INIS)
Reese, M.G.; Johnson, L.R.; Ransom, D.K.
1980-01-01
In a solid phase assay for quantitative determination of biological and other analytes, a sample such as serum is contacted with a receptor for the analyte being assayed, the receptor being supported on a solid support. No tracer for the analyte is added to the sample before contacting with the receptor; instead the tracer is contacted with the receptor after unbound analyte has been removed from the receptor. The assay can be otherwise performed in a conventional manner but can give greater sensitivity. (author)
Farsi, Davood; Pishbin, Elham; Abbasi, Saeed; Hafezimoghadam, Peyman; Fathi, Marzieh; Zare, Mohammad Amin
2013-04-01
The troponin I serum level is widely used in acute coronary syndrome patients for their classification. The qualitative assay is faster and more available than the quantitative assay. The objective was to determine the operating characteristics of a qualitative troponin I assay compared with a quantitative method. This is a prospective observational study and patients suspected to have acute coronary syndrome were enrolled. A rapid troponin I test and a quantitative assay were carried out for each patient on arrival and 6 h after admission. A total of 262 patients were enrolled. The degree of agreement between the second rapid qualitative and quantitative troponin I was excellent (κ=0.946; 95% confidence interval, 0.903-0.989). The sensitivity, specificity, negative predictive value, and positive predictive value of the rapid qualitative troponin I test were 92.6, 100, 96.8, and 100%, respectively. In conclusion, this study reveals an excellent agreement between quantitative and qualitative bedside assays 6 h after admission in a sample of Iranian patients in the emergency department.
Ozeki, Itaru; Nakajima, Tomoaki; Suii, Hirokazu; Tatsumi, Ryoji; Yamaguchi, Masakatsu; Kimura, Mutsuumi; Arakawa, Tomohiro; Kuwata, Yasuaki; Ohmura, Takumi; Hige, Shuhei; Karino, Yoshiyasu; Toyota, Joji
2018-02-01
We investigated the utility of high-sensitivity hepatitis B surface antigen (HBsAg) assays compared with conventional HBsAg assays. Using serum samples from 114 hepatitis B virus (HBV) carriers in whom HBsAg seroclearance was confirmed by conventional HBsAg assays (cut-off value, 0.05 IU/mL), the amount of HBsAg was re-examined by high-sensitivity HBsAg assays (cut-off value, 0.005 IU/mL). Cases negative for HBsAg in both assays were defined as consistent cases, and cases positive for HBsAg in the high-sensitivity HBsAg assay only were defined as discrepant cases. There were 55 (48.2%) discrepant cases, and the range of HBsAg titers determined by high-sensitivity HBsAg assays was 0.005-0.056 IU/mL. Multivariate analysis showed that the presence of nucleos(t)ide analog therapy, liver cirrhosis, and negative anti-HBs contributed to the discrepancies between the two assays. Cumulative anti-HBs positivity rates among discrepant cases were 12.7%, 17.2%, 38.8%, and 43.9% at baseline, 1 year, 3 years, and 5 years, respectively, whereas the corresponding rates among consistent cases were 50.8%, 56.0%, 61.7%, and 68.0%, respectively. Hepatitis B virus DNA negativity rates were 56.4% and 81.4% at baseline, 51.3% and 83.3% at 1 year, and 36.8% and 95.7% at 3 years, among discrepant and consistent cases, respectively. Hepatitis B surface antigen reversion was observed only in discrepant cases. Re-examination by high-sensitivity HBsAg assays revealed that HBsAg was positive in approximately 50% of cases. Cumulative anti-HBs seroconversion rates and HBV-DNA seroclearance rates were lower in these cases, suggesting a population at risk for HBsAg reversion. © 2017 The Japan Society of Hepatology.
Energy Technology Data Exchange (ETDEWEB)
Singer, Timothy M. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Lambert, Iain B. [Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ont., K1S 5B6 (Canada); Williams, Andrew [Biostatistics and Epidemiology Division, Safe Environments Programme, 6604B, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Douglas, George R. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada); Yauk, Carole L. [Mutagenesis Section, Environmental and Occupational Toxicology Division, Safe Environments Programme, 0803A, Health Canada, Ottawa, Ont., K1A 0K9 (Canada)]. E-mail: carole_yauk@hc-sc.gc.ca
2006-06-25
Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development.
International Nuclear Information System (INIS)
Singer, Timothy M.; Lambert, Iain B.; Williams, Andrew; Douglas, George R.; Yauk, Carole L.
2006-01-01
Several rodent assays are capable of monitoring germline mutation. These include traditional assays, such as the dominant lethal (DL) assay, the morphological specific locus (SL) test and the heritable translocation (HT) assay, and two assays that have been developed more recently-the expanded simple tandem repeat (ESTR) and transgenic rodent (TGR) mutation assays. In this paper, we have compiled the limited amount of experimental data that are currently available to make conclusions regarding the comparative ability of the more recently developed assays to detect germline mutations induced by chemical and radiological agents. The data suggest that ESTR and TGR assays are generally comparable with SL in detecting germline mutagenicity induced by alkylating agents and radiation, though TGR offered less sensitivity than ESTR in some cases. The DL and HT assays detect clastogenic events and are most susceptible to mutations arising in post-spermatogonial cells, and they may not provide the best comparisons with TGR and ESTR instability. The measurement of induced ESTR instability represents a relatively sensitive method of identifying agents causing germline mutation in rodents, and may also be useful for bio-monitoring exposed individuals in the human population. Any future use of the TGR and ESTR germline mutation assays in a regulatory testing context will entail more robust and extensive characterization of assay performance. This will require substantially more data, including experiments measuring multiple endpoints, a greatly expanded database of chemical agents and a focus on characterizing stage-specific activity of mutagens in these assays, preferably by sampling epididymal sperm exposed at defined pre-meiotic, meiotic and post-meiotic stages of development
Wischhusen, Jennifer; Padilla, Frederic
2017-07-01
Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Evaluation of total PSA assay on vitros ECi and correlation with Kryptor-PSA assay.
Cassinat, B; Wacquet, M; Toubert, M E; Rain, J D; Schlageter, M H
2001-01-01
An increasing number of multiparametric immuno-analysers for PSA assays are available. As different immuno-assays may vary in their analytical quality and their accuracy for the follow-up of patients, expertise is necessary for each new assay. The PSA assay on the Vitros-ECi analyser has been evaluated and compared with the PSA assay from the Kryptor analyser. Variation coefficients were 0.91 to 1.98% for within-run assays, and 4.2% to 5.4% for interassay (PSA levels = 0.8 microgram/L to 33.6 micrograms/L). Dilution tests showed 93 to 136% recovery until 70 micrograms/L PSA. Functional sensitivity was estimated at 0.03 microgram/L. Equimolarity of the test was confirmed. Correlation of PSA levels measured with Vitros-ECi and Kryptor analysers displayed a correlation coefficient r2 of 0.9716. The half-lives and doubling times of PSA were similar using both methods. Vitros-ECi PSA assay meets the major criteria for the management of prostate cancer patients.
International Nuclear Information System (INIS)
Eisentraut, A.M.
1977-01-01
An improved radioimmunoassay is described for measuring total triiodothyronine or total thyroxine levels in a sample of serum containing free endogenous thyroid hormone and endogenous thyroid hormone bound to thyroid hormone binding protein. The thyroid hormone is released from the protein by adding hydrochloric acid to the serum. The pH of the separated thyroid hormone and thyroid hormone binding protein is raised in the absence of a blocking agent without interference from the endogenous protein. 125 I-labelled thyroid hormone and thyroid hormone antibodies are added to the mixture, allowing the labelled and unlabelled thyroid hormone and the thyroid hormone antibody to bind competitively. This results in free thyroid hormone being separated from antibody bound thyroid hormone and thus the unknown quantity of thyroid hormone may be determined. A thyroid hormone test assay kit is described for this radioimmunoassay. It provides a 'single tube' assay which does not require blocking agents for endogenous protein interference nor an external solid phase sorption step for the separation of bound and free hormone after the competitive binding step; it also requires a minimum number of manipulative steps. Examples of the assay are given to illustrate the reproducibility, linearity and specificity of the assay. (UK)
Energy Technology Data Exchange (ETDEWEB)
Li, Liangpeng; Zhang, Qian; Peng, Jiahe; Jiang, Chanjui; Zhang, Yan; Shen, Lili; Dong, Jinyu; Wang, Yongchao; Jiang, Yu, E-mail: yujiang0207@163.com
2015-11-27
Farnesoid X receptor (FXR) is a member of the nuclear receptor superfamily, which plays important roles in bile acids/lipid homeostasis and inflammation. Monocyte chemoattractant protein-1 (MCP-1) contributes to macrophage infiltration into body tissues during inflammation. Here we investigated whether FXR can regulate MCP-1 expression in murine macrophage. FXR activation down regulate MCP-1 mRNA and protein levels in ANA-1 and Raw264.7 cells. Luciferase reporter assay, Gel shift and Chromatin immunoprecipitation assays have revealed that the activated FXR bind to the FXR element located in −738 bp ∼ −723 bp in MCP-1 promoter. These results suggested that FXR may serve as a novel target for regulating MCP-1 levels for the inflammation related diseases therapies. - Highlights: • FXR is expressed in murine macrophage cell line. • FXR down regulates MCP-1 expression. • FXR binds to the DR4 in MCP-1 promoter.
GATA-1 directly regulates Nanog in mouse embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Li, Wen-Zhong; Ai, Zhi-Ying [College of Life Sciences, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China); Wang, Zhi-Wei [School of Life Sciences and Medical Center, University of Science and Technology of China, Hefei, Anhui 230027 (China); Chen, Lin-Lin [College of Life Sciences, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China); Guo, Ze-Kun, E-mail: gzknwaf@126.com [College of Veterinary Medicine, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China); Zhang, Yong, E-mail: zylabnwaf@126.com [College of Veterinary Medicine, Northwest A& F University, Yangling 712100 (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A& F University, Yangling 712100 (China)
2015-09-25
Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.
Analysis of JC virus DNA replication using a quantitative and high-throughput assay
International Nuclear Information System (INIS)
Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.
2014-01-01
Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication
Analysis of JC virus DNA replication using a quantitative and high-throughput assay
Energy Technology Data Exchange (ETDEWEB)
Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert [Department of Developmental, Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States); Gagnon, David [Institut de Recherches Cliniques de Montreal (IRCM), 110 Pine Avenue West, Montreal, Quebec, Canada H2W 1R7 (Canada); Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Quebec (Canada); Gjoerup, Ole [Molecular Oncology Research Institute, Tufts Medical Center, Boston, MA 02111 (United States); Archambault, Jacques [Institut de Recherches Cliniques de Montreal (IRCM), 110 Pine Avenue West, Montreal, Quebec, Canada H2W 1R7 (Canada); Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Quebec (Canada); Bullock, Peter A., E-mail: Peter.Bullock@tufts.edu [Department of Developmental, Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States)
2014-11-15
Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication.
A novel SERRS sandwich-hybridization assay to detect specific DNA target.
Directory of Open Access Journals (Sweden)
Cécile Feuillie
Full Text Available In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR. In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics.
The Comet Assay: Tails of the (Unexpected. Use of the comet assay in pharmaceutical development.
Directory of Open Access Journals (Sweden)
Bas-jan Van Der Leede
2015-08-01
Full Text Available In genotoxicity testing of pharmaceuticals the rodent alkaline comet assay is being increasingly used as a second in vivo assay in addition to the in vivo micronucleus assay to mitigate in vitro positive results as recommended by regulatory guidance. In this presentation we want to give insight into the circumstances in vivo comet assay is deployed in a Genetic Toxicology Department of a pharmaceutical company. As the in vivo comet assay is a salvage assay, it means that some events have occurred in an in vitro assay and that the compound (or metabolite responsible for this signal is potentially deselected for further development. More than often the decision to perform an in vivo comet assay is at a very early stage in development and the first time that the compound will be tested in vivo at high/toxic dose levels. As almost no toxicokinetic data and tissue distribution data are available a careful design with maximizes the chances for successful mitigation is necessary. Decisions on acute or repeated dosing need to be made and arrangements for combining the in vivo comet assay with the in vivo micronucleus assay are to be considered. Often synthesis methods need to be scaled up fast to provide the required amount of compound and information on suitable formulations needs to be in place. As exposure data is crucial for interpretation of results, analytical methods need to be brought in place rapidly. An experienced multi skilled and communicative team needs to be available to deploy successfully this kind of assays at an early stage of development. We will present a few scenarios on study conduct and demonstrate how this assay can make a difference for the further development of a new drug.
Directory of Open Access Journals (Sweden)
Chao-Bin Yeh
Full Text Available The mortality and morbidity rates from cancer metastasis have not declined in Taiwan, especially because of hepatocellular carcinoma (HCC. Resveratrol has been shown to have benefits such as cardioprotection, providing antioxidative, anti-inflammatory, anti-cancer properties in previous studies. Therefore, HCC cells were subjected to treatment with resveratrol and then analyzed to determine the effects of resveratrol on the migration and invasion.Modified Boyden chamber assays revealed that resveratrol treatment significantly inhibited cell migration and invasion capacities of Huh7 cell lines that have low cytotoxicity in vitro, even at a high concentration of 100 µM. The results of casein zymography and western blotting revealed that the activities and protein levels of the urokinase-type plasminogen activator (u-PA were inhibited by resveratrol. Western blot analysis also showed that resveratrol inhibits phosphorylation of JNK1/2. Tests of the mRNA level, real-time PCR, and promoter assays evaluated the inhibitory effects of resveratrol on u-PA expression in HCC cells. The chromatin immunoprecipitation (ChIP assay showed that reactive in transcription protein of nuclear factor SP-1 was inhibited by resveratrol.Resveratrol inhibits u-PA expression and the metastasis of HCC cells and is a powerful chemopreventive agent. The inhibitory effects were associated with the downregulation of the transcription factors of SP-1 signaling pathways.
Hou, Zhouhua; Xu, Xuwen; Zhou, Ledu; Fu, Xiaoyu; Tao, Shuhui; Zhou, Jiebin; Tan, Deming; Liu, Shuiping
2017-07-01
Increasing evidence supports the significance of long non-coding RNA in cancer development. Several recent studies suggest the oncogenic activity of long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) in hepatocellular carcinoma. In this study, we explored the molecular mechanisms by which MALAT1 modulates hepatocellular carcinoma biological behaviors. We found that microRNA-204 was significantly downregulated in sh-MALAT1 HepG2 cell and 15 hepatocellular carcinoma tissues by quantitative real-time polymerase chain reaction analysis. Through bioinformatic screening, luciferase reporter assay, RNA-binding protein immunoprecipitation, and RNA pull-down assay, we identified microRNA-204 as a potential interacting partner for MALAT1. Functionally, wound-healing and transwell assays revealed that microRNA-204 significantly inhibited the migration and invasion of hepatocellular carcinoma cells. Notably, sirtuin 1 was recognized as a direct downstream target of microRNA-204 in HepG2 cells. Moreover, si-SIRT1 significantly inhibited cell invasion and migration process. These data elucidated, by sponging and competitive binding to microRNA-204, MALAT1 releases the suppression on sirtuin 1, which in turn promotes hepatocellular carcinoma migration and invasion. This study reveals a novel mechanism by which MALAT1 stimulates hepatocellular carcinoma progression and justifies targeting metastasis-associated lung adenocarcinoma transcript 1 as a potential therapy for hepatocellular carcinoma.
MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.
Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier
2016-10-25
MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.
Radioreceptor assays: plasma membrane receptors and assays for polypeptide and glycoprotein hormones
International Nuclear Information System (INIS)
Schulster, D.
1977-01-01
Receptors for peptide, protein and glycoprotein hormones, and the catecholamines are located on the plasma membranes of their target cells. Preparations of the receptors may be used as specific, high-affinity binding agents for these hormones in assay methodology akin to that for radioimmunoassay. A particular advantage of the radioreceptor assay is that it has a specificity directed towards the biologically active region of the hormone, rather than to some immunologically active region that may have little (or no) involvement in the expression of hormonal activity. Methods for hormone receptor preparation vary greatly, and range from the use of intact cells (as the source of hormone receptor) to the use of purified or solubilized membrane receptors. Receptors isolated from plasma membranes have proved to be of variable stability, and may be damaged during preparation and/or storage. Moreover, since they are present in relatively low concentration in the cell, their preparation in sufficient quantity for use in a radioreceptor assay may present technical problems. In general, there is good correlation between radioreceptor assays and in-vitro bioassays; differences between results from radioreceptor assays and radioimmunoassays are similar to those noted between in-vitro bioassays and radioimmunoassays. The sensitivity of the method is such that normal plasma concentrations of various hormones have been assayed by this technique. (author)
Directory of Open Access Journals (Sweden)
Mukerji Joya
2012-06-01
Full Text Available Abstract Background HIV-1 Nef protein contributes to pathogenesis via multiple functions that include enhancement of viral replication and infectivity, alteration of intracellular trafficking, and modulation of cellular signaling pathways. Nef stimulates formation of tunneling nanotubes and virological synapses, and is transferred to bystander cells via these intercellular contacts and secreted microvesicles. Nef associates with and activates Pak2, a kinase that regulates T-cell signaling and actin cytoskeleton dynamics, but how Nef promotes nanotube formation is unknown. Results To identify Nef binding partners involved in Pak2-association dependent Nef functions, we employed tandem mass spectrometry analysis of Nef immunocomplexes from Jurkat cells expressing wild-type Nef or Nef mutants defective for the ability to associate with Pak2 (F85L, F89H, H191F and A72P, A75P in NL4-3. We report that wild-type, but not mutant Nef, was associated with 5 components of the exocyst complex (EXOC1, EXOC2, EXOC3, EXOC4, and EXOC6, an octameric complex that tethers vesicles at the plasma membrane, regulates polarized exocytosis, and recruits membranes and proteins required for nanotube formation. Additionally, Pak2 kinase was associated exclusively with wild-type Nef. Association of EXOC1, EXOC2, EXOC3, and EXOC4 with wild-type, but not mutant Nef, was verified by co-immunoprecipitation assays in Jurkat cells. Furthermore, shRNA-mediated depletion of EXOC2 in Jurkat cells abrogated Nef-mediated enhancement of nanotube formation. Using bioinformatic tools, we visualized protein interaction networks that reveal functional linkages between Nef, the exocyst complex, and the cellular endocytic and exocytic trafficking machinery. Conclusions Exocyst complex proteins are likely a key effector of Nef-mediated enhancement of nanotube formation, and possibly microvesicle secretion. Linkages revealed between Nef and the exocyst complex suggest a new paradigm of
International Nuclear Information System (INIS)
Mizushima, Yutaka; Takeichi, Noritoshi; Minami, Akio; Kasai, Masaharu; Itaya, Toshiyuki
1981-01-01
KMT-17, a fibrosarcoma induced by 3-methylcholanthrene in a WKA rat, is a sensitive tumor to various kinds of immunological assays and is a suitable model tumor for the study of the immune status in tumor bearing hosts. The antitumor immune response of KMT-17 bearing rats was studied by a radioisotopic footpad assay (FPA) in comparison with other in vivo and in vitro assays. Delayed hypersensitivity to tumor antigens measured by the FPA was observed from the 8th day after transplantation of KMT-17 cells, reached a peak on the 12 - 15th day, and then declined in the late stage on the 17th day. The kinetics of the FPA correlated well with those of an in vivo Winn assay and of an in vitro lymphocyte cytotoxicity assay ( 51 Cr-release assay). The appearance of an antitumor antibody detected by a complement dependent cytotoxicity test also correlated well with the kinetics of the FPA. A growth inhibition assay (GIA) for non-specific cell-mediated immunity also showed similar kinetics to that of the FPA. The delayed hypersensitivity footpad reaction to tumor cell extracts measured by this FPA was tumor-specific. These results suggest that the FPA is a simple and reliable in vivo assay for evaluating antitumor immunity in tumor bearing hosts. (author)
Directory of Open Access Journals (Sweden)
Angela Filomena
2017-10-01
Full Text Available Infection with Helicobacter pylori (H. pylori occurs in 50% of the world population, and is associated with the development of ulcer and gastric cancer. Serological diagnostic tests indicate an H. pylori infection by detecting antibodies directed against H. pylori proteins. In addition to line blots, multiplex assay platforms provide smart solutions for the simultaneous analysis of antibody responses towards several H. pylori proteins. We used seven H. pylori proteins (FliD, gGT, GroEL, HpaA, CagA, VacA, and HP0231 and an H. pylori lysate for the development of a multiplex serological assay on a novel microfluidic platform. The reaction limited binding regime in the microfluidic channels allows for a short incubation time of 35 min. The developed assay showed very high sensitivity (99% and specificity (100%. Besides sensitivity and specificity, the technical validation (intra-assay CV = 3.7 ± 1.2% and inter-assay CV = 5.5 ± 1.2% demonstrates that our assay is also a robust tool for the analysis of the H. pylori-specific antibody response. The integration of the virulence factors CagA and VacA allow for the assessment of the risk for gastric cancer development. The short assay time and the performance of the platform shows the potential for implementation of such assays in a clinical setting.
Zhao, Liang; Sun, Hongwei; Kong, Hongru; Chen, Zongjing; Chen, Bicheng; Zhou, Mengtao
2017-01-01
Pancreatic carcinoma (PC) is the one of the most common and malignant cancers worldwide. LncRNA taurine upregulated gene 1 (TUG1) was initially identified as a transcript upregulated by taurine, and the abnormal expression of TUG1 has been reported in many cancers. However, the biological role and molecular mechanism of TUG1 in PC still needs further investigation. Quantitative real-time PCR (qRT-PCR) was performed to measure the expression of TUG1 in PC cell lines and tissues. MTT and colony formation assays were used to measure the effect of TUG1 on cell proliferation. A wound healing assay, transwell assay and western blot assay were employed to determine the effect of TUG1 on cell migration and the epithelial mesenchymal transition (EMT) phenotype. RNA-binding protein immunoprecipitation (RIP) and a biotin-avidin pulldown system were performed to confirm the interaction between miR-328 and TUG1. A gene expression array analysis using clinical samples and RT-qPCR suggested that enhancer of zeste homolog 2 (EZH2) was a target of miR-382 in PC. In this study, we reported that TUG1 was overexpressed in PC tissues and cell lines, and high expression of TUG1 predicted poor prognosis. Further experiments revealed that overexpressed TUG1 promoted cell proliferation, migration and contributed to EMT formation, whereas silenced TUG1 led to opposing results. Additionally, luciferase reporter assays, an RIP assay and an RNA-pulldown assay demonstrated that TUG1 could competitively sponge miR-382 and thereby regulate EZH2. Collectively, these findings revealed that TUG1 functions as an oncogenic lncRNA that promotes tumor progression, at least partially, by functioning as an endogenous 'sponge' and competing for miR-382 binding to the miRNA target EZH2. © 2017 The Author(s). Published by S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Liang Zhao
2017-08-01
Full Text Available Background/Aims: Pancreatic carcinoma (PC is the one of the most common and malignant cancers worldwide. LncRNA taurine upregulated gene 1 (TUG1 was initially identified as a transcript upregulated by taurine, and the abnormal expression of TUG1 has been reported in many cancers. However, the biological role and molecular mechanism of TUG1 in PC still needs further investigation. Methods: Quantitative real-time PCR (qRT-PCR was performed to measure the expression of TUG1 in PC cell lines and tissues. MTT and colony formation assays were used to measure the effect of TUG1 on cell proliferation. A wound healing assay, transwell assay and western blot assay were employed to determine the effect of TUG1 on cell migration and the epithelial mesenchymal transition (EMT phenotype. RNA-binding protein immunoprecipitation (RIP and a biotin-avidin pulldown system were performed to confirm the interaction between miR-328 and TUG1. A gene expression array analysis using clinical samples and RT-qPCR suggested that enhancer of zeste homolog 2 (EZH2 was a target of miR-382 in PC. Results: In this study, we reported that TUG1 was overexpressed in PC tissues and cell lines, and high expression of TUG1 predicted poor prognosis. Further experiments revealed that overexpressed TUG1 promoted cell proliferation, migration and contributed to EMT formation, whereas silenced TUG1 led to opposing results. Additionally, luciferase reporter assays, an RIP assay and an RNA-pulldown assay demonstrated that TUG1 could competitively sponge miR-382 and thereby regulate EZH2. Conclusion: Collectively, these findings revealed that TUG1 functions as an oncogenic lncRNA that promotes tumor progression, at least partially, by functioning as an endogenous ‘sponge’ and competing for miR-382 binding to the miRNA target EZH2.
Bagdonas, Dovydas
2017-01-01
Aim: to analyse the possible relationship between liquor IgG oligoclonal bands assay and other laboratory assays in neurological patients. Objectives: to determine the frequency of oligoclonal bands in neurological patients; to compare the results between serum and liquor laboratory assays in dependence of oligoclonal bands assay results; to evaluate the relationships between oligoclonal bands assay and serological-immunological assays for infectious diseases, gender, age and neurological ...
Determination of the molar extinction coefficient for the ferric reducing/antioxidant power assay.
Hayes, William A; Mills, Daniel S; Neville, Rachel F; Kiddie, Jenna; Collins, Lisa M
2011-09-15
The FRAP reagent contains 2,4,6-tris(2-pyridyl)-s-triazine, which forms a blue-violet complex ion in the presence of ferrous ions. Although the FRAP (ferric reducing/antioxidant power) assay is popular and has been in use for many years, the correct molar extinction coefficient of this complex ion under FRAP assay conditions has never been published, casting doubt on the validity of previous calibrations. A previously reported value of 19,800 is an underestimate. We determined that the molar extinction coefficient was 21,140. The value of the molar extinction coefficient was also shown to depend on the type of assay and was found to be 22,230 under iron assay conditions, in good agreement with published data. Redox titration indicated that the ferrous sulfate heptahydrate calibrator recommended by Benzie and Strain, the FRAP assay inventors, is prone to efflorescence and, therefore, is unreliable. Ferrous ammonium sulfate hexahydrate in dilute sulfuric acid was a more stable alternative. Few authors publish their calibration data, and this makes comparative analyses impossible. A critical examination of the limited number of examples of calibration data in the published literature reveals only that Benzie and Strain obtained a satisfactory calibration using their method. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Endogenous Locus Reporter Assays.
Liu, Yaping; Hermes, Jeffrey; Li, Jing; Tudor, Matthew
2018-01-01
Reporter gene assays are widely used in high-throughput screening (HTS) to identify compounds that modulate gene expression. Traditionally a reporter gene assay is built by cloning an endogenous promoter sequence or synthetic response elements in the regulatory region of a reporter gene to monitor transcriptional activity of a specific biological process (exogenous reporter assay). In contrast, an endogenous locus reporter has a reporter gene inserted in the endogenous gene locus that allows the reporter gene to be expressed under the control of the same regulatory elements as the endogenous gene, thus more accurately reflecting the changes seen in the regulation of the actual gene. In this chapter, we introduce some of the considerations behind building a reporter gene assay for high-throughput compound screening and describe the methods we have utilized to establish 1536-well format endogenous locus reporter and exogenous reporter assays for the screening of compounds that modulate Myc pathway activity.
Baxter, C G; Denning, D W; Jones, A M; Todd, A; Moore, C B; Richardson, M D
2013-04-01
Detection of Aspergillus IgG antibodies is important in the diagnosis of chronic pulmonary aspergillosis and allergic bronchopulmonary aspergillosis. Immunoprecipitation techniques to detect these antibodies appear to lack sensitivity and accurate quantitation compared with enzyme immunoassays (EIA). This study assessed the performance of two commercial EIAs compared with counterimmunoelectrophoresis (CIE). This was a prospective cohort study of 175 adult patients with chronic or allergic pulmonary aspergillosis. Aspergillus IgG antibodies were detected using CIE, Phadia ImmunoCap Aspergillus IgG and Bio-Rad Platelia Aspergillus IgG. Inter-assay reproducibility was determined for each method and 25 patients had two serum samples analysed within a 6-month interval. When compared with CIE, both ImmunoCap and Platelia Aspergillus IgG had good sensitivity (97 and 93%, respectively) for detection of Aspergillus IgG antibodies. The level of agreement between the two EIAs for positive results was good, but the concentration of antibodies was not correlated between the tests or with CIE titre. ImmunoCap IgG inter-assay coefficient of variation was 5%, whereas Platelia IgG was 33%. Median ImmunoCap IgG values for CPA and allergic aspergillosis were 95 and 32 mg/L, respectively, whereas Platelia IgG values were >80 and 6 AU/mL. The direction of CIE titre change over 6 months was mirrored by ImmunoCap IgG levels in 92% of patients, and by Platelia IgG in 72% of patients. Both ImmunoCap and Platelia Aspergillus IgG EIAs are sensitive measures of Aspergillus IgG antibodies compared with CIE. However, ImmunoCap appears to have better reproducibility and may be more suitable for monitoring patient disease. © 2012 The Authors Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.
DEFF Research Database (Denmark)
Glubb, Dylan M; Maranian, Mel J; Michailidou, Kyriaki
2015-01-01
evidence of association of a further 173 variants (iCHAV2) containing three subsets with a range of effects (the strongest was rs113317823 [pcond = 1.61 × 10(-5)]) and five variants composing iCHAV3 (lead rs11949391; ER(+): OR = 0.90, 95% CI = 0.87-0.93, pcond = 1.4 × 10(-4)). Twenty-six percent......CHAV2a], and rs17432750 [iCHAV3]) increased MAP3K1 transcriptional activity. Chromatin immunoprecipitation analysis revealed diminished GATA3 binding to the minor (cancer-protective) allele of rs17432750, indicating a mechanism for its action. We propose that the cancer risk alleles act to increase MAP3...
Moreno-Ramos, Oscar A; Olivares, Ana María; Haider, Neena B; de Autismo, Liga Colombiana; Lattig, María Claudia
2015-01-01
Autism spectrum disorders (ASDs) are a range of complex neurodevelopmental conditions principally characterized by dysfunctions linked to mental development. Previous studies have shown that there are more than 1000 genes likely involved in ASD, expressed mainly in brain and highly interconnected among them. We applied whole exome sequencing in Colombian-South American trios. Two missense novel SNVs were found in the same child: ALDH1A3 (RefSeq NM_000693: c.1514T>C (p.I505T)) and FOXN1 (RefSeq NM_003593: c.146C>T (p.S49L)). Gene expression studies reveal that Aldh1a3 and Foxn1 are expressed in ~E13.5 mouse embryonic brain, as well as in adult piriform cortex (PC; ~P30). Conserved Retinoic Acid Response Elements (RAREs) upstream of human ALDH1A3 and FOXN1 and in mouse Aldh1a3 and Foxn1 genes were revealed using bioinformatic approximation. Chromatin immunoprecipitation (ChIP) assay using Retinoid Acid Receptor B (Rarb) as the immunoprecipitation target suggests RA regulation of Aldh1a3 and Foxn1 in mice. Our results frame a possible link of RA regulation in brain to ASD etiology, and a feasible non-additive effect of two apparently unrelated variants in ALDH1A3 and FOXN1 recognizing that every result given by next generation sequencing should be cautiously analyzed, as it might be an incidental finding.
Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.
Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel
2012-01-01
γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.
Evaluation of irradiation in foods using DNA comet assay
International Nuclear Information System (INIS)
Khawar, Affaf; Bhatti, Ijaz Ahmad; Khan, Q.M.; Ali, T.; Khan, A.I.; Asi, M.R.
2011-01-01
Comet assay is a rapid, inexpensive and sensitive biological technique to detect DNA damage in food stuffs by irradiation. In this study the Comet assay is applied on foods of plant and animal origins. Samples were irradiated by using 60 Co gamma-radiation source. The applied doses were 2, 6 and 10 kGy for food of plant origin and 0.5, 1 and 2 kGy for meat items. The un-irradiated and irradiated samples were clearly differentiated on the basis of DNA fragmentation. During the electrophoresis study, it was found that in un-irradiated cells DNA remained intact and appeared as Comets without tail whereas in irradiated cells Comets with tails were visible due to stretching of fragmented DNA. Moreover, it was also revealed that the DNA tail length was dose dependent. Dry food stuffs (seeds) showed good results as compared to moist foods (meat, fruits and vegetables) due to the absence of background damage. (author)
O'Clock, George D
2016-08-01
Cellular engineering involves modification and control of cell properties, and requires an understanding of fundamentals and mechanisms of action for cellular derived product development. One of the keys to success in cellular engineering involves the quality and validity of results obtained from cell chemical signaling pathway assays. The accuracy of the assay data cannot be verified or assured if the effect of positive feedback, nonlinearities, and interrelationships between cell chemical signaling pathway elements are not understood, modeled, and simulated. Nonlinearities and positive feedback in the cell chemical signaling pathway can produce significant aberrations in assay data collection. Simulating the pathway can reveal potential instability problems that will affect assay results. A simulation, using an electrical analog for the coupled differential equations representing each segment of the pathway, provides an excellent tool for assay validation purposes. With this approach, voltages represent pathway enzyme concentrations and operational amplifier feedback resistance and input resistance values determine pathway gain and rate constants. The understanding provided by pathway modeling and simulation is strategically important in order to establish experimental controls for assay protocol structure, time frames specified between assays, and assay concentration variation limits; to ensure accuracy and reproducibility of results.
International Nuclear Information System (INIS)
Ratcliffe, W.A.; Corrie, J.E.T.; Dalziel, A.H.; Macpherson, J.S.
1982-01-01
Two direct radioimmunoassays for progesterone in 50 μL of unextracted serum or plasma with assays involving extraction of serum were compared. The direct assays include the use of either danazol at pH 7.4 or 8-anilino-1-naphthalenesulfonic acid at pH 4.0 to displace progesterone from serum binding-proteins. Progesterone is then assayed by using an antiserum to a progesterone 11α-hemisuccinyl conjugate and the radioligand 125 I-labeled progesterone 11α-glucuronyl tyramine, with separation by double-antibody techniques. Direct assays with either displacing agent gave good analytical recovery of progesterone added to human serum, and progesterone values for patients' specimens correlated well (r > 0.96) with results of assays involving extraction of serum. Precision was similar with each displacing agent over the working range 2.5-100 nmol/L and superior to that of extraction assays. We conclude that these direct assays of progesterone are analytically valid and more robust, precise, and technically convenient than many conventional methods involving extraction of serum
Absolute nuclear material assay
Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA
2010-07-13
A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.
Optimal use of tandem biotin and V5 tags in ChIP assays
Directory of Open Access Journals (Sweden)
Krpic Sanja
2009-02-01
Full Text Available Abstract Background Chromatin immunoprecipitation (ChIP assays coupled to genome arrays (Chip-on-chip or massive parallel sequencing (ChIP-seq lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes.
Optimal use of tandem biotin and V5 tags in ChIP assays
Kolodziej, Katarzyna E; Pourfarzad, Farzin; de Boer, Ernie; Krpic, Sanja; Grosveld, Frank; Strouboulis, John
2009-01-01
Background Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes. PMID:19196479
International Nuclear Information System (INIS)
1977-01-01
Methods are described for measuring catecholamine levels in human and animal body fluids and tissues using the catechol-O-methyl-transferase (COMT) radioassay. The assay involves incubating the biological sample with COMT and the tritiated methyl donor, S-adenosyl-L-methionine( 3 H)-methyl. The O-methylated ( 3 H) epinephrine and/or norepinephrine are extracted and oxidised to vanillin- 3 H which in turn is extracted and its radioactivity counted. When analysing dopamine levels the assay is extended by vanillin- 3 H and raising the pH of the aqueous periodate phase from which O-methylated ( 3 H) dopamine is extracted and counted. The assay may be modified depending on whether measurements of undifferentiated total endogenous catecholamine levels or differential analyses of the catecholamine levels are being performed. The sensitivity of the assay can be as low as 5 picograms for norepinephrine and epinephrine and 12 picograms for dopamine. The assemblance of the essential components of the assay into a kit for use in laboratories is also described. (U.K.)
Open innovation for phenotypic drug discovery: The PD2 assay panel.
Lee, Jonathan A; Chu, Shaoyou; Willard, Francis S; Cox, Karen L; Sells Galvin, Rachelle J; Peery, Robert B; Oliver, Sarah E; Oler, Jennifer; Meredith, Tamika D; Heidler, Steven A; Gough, Wendy H; Husain, Saba; Palkowitz, Alan D; Moxham, Christopher M
2011-07-01
Phenotypic lead generation strategies seek to identify compounds that modulate complex, physiologically relevant systems, an approach that is complementary to traditional, target-directed strategies. Unlike gene-specific assays, phenotypic assays interrogate multiple molecular targets and signaling pathways in a target "agnostic" fashion, which may reveal novel functions for well-studied proteins and discover new pathways of therapeutic value. Significantly, existing compound libraries may not have sufficient chemical diversity to fully leverage a phenotypic strategy. To address this issue, Eli Lilly and Company launched the Phenotypic Drug Discovery Initiative (PD(2)), a model of open innovation whereby external research groups can submit compounds for testing in a panel of Lilly phenotypic assays. This communication describes the statistical validation, operations, and initial screening results from the first PD(2) assay panel. Analysis of PD(2) submissions indicates that chemical diversity from open source collaborations complements internal sources. Screening results for the first 4691 compounds submitted to PD(2) have confirmed hit rates from 1.6% to 10%, with the majority of active compounds exhibiting acceptable potency and selectivity. Phenotypic lead generation strategies, in conjunction with novel chemical diversity obtained via open-source initiatives such as PD(2), may provide a means to identify compounds that modulate biology by novel mechanisms and expand the innovation potential of drug discovery.
International Nuclear Information System (INIS)
Penfold, Mark; Miao Zhenhua; Wang Yu; Haggerty, Shannon; Schleiss, Mark R.
2003-01-01
Cytomegaloviruses encode homologs of cellular immune effector proteins, including chemokines (CKs) and CK receptor-like G protein-coupled receptors (GPCRs). Sequence of the guinea pig cytomegalovirus (GPCMV) genome identified an open reading frame (ORF) which predicted a 101 amino acid (aa) protein with homology to the macrophage inflammatory protein (MIP) subfamily of CC (β) CKs, designated GPCMV-MIP. To assess functionality of this CK, recombinant GPCMV-MIP was expressed in HEK293 cells and assayed for its ability to bind to and functionally interact with a variety of GPCRs. Specific signaling was observed with the hCCR1 receptor, which could be blocked with hMIP -1α in competition experiments. Migration assays revealed that GPCMV-MIP was able to induce chemotaxis in hCCR1-L1.2 cells. Antisera raised against a GST-MIP fusion protein immunoprecipitated species of ∼12 and 10 kDa from GPCMV-inoculated tissue culture lysates, and convalescent antiserum from GPCMV-infected animals was immunoreactive with GST-MIP by ELISA assay. These results represent the first substantive in vitro characterization of a functional CC CK encoded by a cytomegalovirus
Directory of Open Access Journals (Sweden)
Guanghua Wang, Jizhang Zhou, Fuying Zheng, Guozhen Lin, Xiaoan Cao, Xiaowei Gong and Changqing Qiu*
2011-04-01
Full Text Available Dual-labeled fluorescence hybridization probe-based multiplex quantitative real-time polymerase chain reaction (qPCR assay was used for the detection of Clostridium perfringens toxin genes alpha (cpa, beta (cpb, iota (ia, epsilon (etx, beta2 (cpb2 and enterotoxin (cpe directly from the feces of cattle. Fecal samples from 261 lactating cattle, belonging to three dairy herds in Ningxia (China, were examined using the developed assays. The duplex qPCR assay revealed that cpa, etx, cpb2 and cpe toxin genes were detected in 176 (100%, 15 (8.5%, 142 (80.7% and 4 (2.3% of 176 PCR positive samples, respectively. The findings of this study revealed that C. perfringens beta2-toxin-producing strains were widely prevalent in lactating cows in Ningxia, possibly playing an important role in C. perfringens-associated diarrheal disease.
Molecular Identification, Enzyme Assay, and Metabolic Profiling of Trichoderma spp.
Bae, Soo-Jung; Park, Young-Hwan; Bae, Hyeun-Jong; Jeon, Junhyun; Bae, Hanhong
2017-06-28
The goal of this study was to identify and characterize selected Trichoderma isolates by metabolic profiling and enzyme assay for evaluation of their potential as biocontrol agents against plant pathogens. Trichoderma isolates were obtained from the Rural Development Administration Genebank Information Center (Wanju, Republic of Korea). Eleven Trichoderma isolates were re-identified using ribosomal DNA internal transcribed spacer (ITS) regions. ITS sequence results showed new identification of Trichoderma isolates. In addition, metabolic profiling of the ethyl acetate extracts of the liquid cultures of five Trichoderma isolates that showed the best anti- Phytophthora activities was conducted using gas chromatography-mass spectrometry. Metabolic profiling revealed that Trichoderma isolates shared common metabolites with well-known antifungal activities. Enzyme assays indicated strong cell walldegrading enzyme activities of Trichoderma isolates. Overall, our results indicated that the selected Trichoderma isolates have great potential for use as biocontrol agents against plant pathogens.
A novel assay to diagnose hereditary angioedema utilizing inhibition of bradykinin-forming enzymes
DEFF Research Database (Denmark)
Joseph, Kusumam; Bains, Sonia; Tholanikunnel, Baby G
2015-01-01
. This was evident regardless whether we measured factor XIIa-C1-INH or kallikrein-C1-INH complexes, and the two assays were in close agreement. By contrast, testing the same samples utilizing the commercial method (complex ELISA, Quidel Corp.) revealed levels of C1-INH between 0 and 57% of normal (mean, 38%) and 42...
Expert system for transuranic waste assay
Energy Technology Data Exchange (ETDEWEB)
Zoolalian, M.L.; Gibbs, A.; Kuhns, J.D.
1989-01-01
Transuranic wastes are generated at the Savannah River Site (SRS) as a result of routine production of nuclear materials. These wastes contain Pu-238 and Pu-239 and are placed into lined 55-gallon waste drums. The drums are placed on monitored storage pads pending shipment to the Waste Isolation Pilot Plant in New Mexico. A passive-active neutron (PAN) assay system is used to determine the mass of the radioactive material within the waste drums. Assay results are used to classify the wastes as either low-level or transuranic (TRU). During assays, the PAN assay system communicates with an IBM-AT computer. A Fortran computer program, called NEUT, controls and performs all data analyses. Unassisted, the NEUT program cannot adequately interpret assay results. To eliminate this limitation, an expert system shell was used to write a new algorithm, called the Transuranic Expert System (TRUX), to drive the NEUT program and add decision making capabilities for analysis of the assay results. The TRUX knowledge base was formulated by consulting with human experts in the field of neutron assay, by direct experimentation on the PAN assay system, and by observing operations on a daily basis. TRUX, with its improved ability to interpret assay results, has eliminated the need for close supervision by a human expert, allowing skilled technicians to operate the PAN assay system. 4 refs., 1 fig., 4 tabs.
Expert system for transuranic waste assay
International Nuclear Information System (INIS)
Zoolalian, M.L.; Gibbs, A.; Kuhns, J.D.
1989-01-01
Transuranic wastes are generated at the Savannah River Site (SRS) as a result of routine production of nuclear materials. These wastes contain Pu-238 and Pu-239 and are placed into lined 55-gallon waste drums. The drums are placed on monitored storage pads pending shipment to the Waste Isolation Pilot Plant in New Mexico. A passive-active neutron (PAN) assay system is used to determine the mass of the radioactive material within the waste drums. Assay results are used to classify the wastes as either low-level or transuranic (TRU). During assays, the PAN assay system communicates with an IBM-AT computer. A Fortran computer program, called NEUT, controls and performs all data analyses. Unassisted, the NEUT program cannot adequately interpret assay results. To eliminate this limitation, an expert system shell was used to write a new algorithm, called the Transuranic Expert System (TRUX), to drive the NEUT program and add decision making capabilities for analysis of the assay results. The TRUX knowledge base was formulated by consulting with human experts in the field of neutron assay, by direct experimentation on the PAN assay system, and by observing operations on a daily basis. TRUX, with its improved ability to interpret assay results, has eliminated the need for close supervision by a human expert, allowing skilled technicians to operate the PAN assay system. 4 refs., 1 fig., 4 tabs
COMPARATIVE STUDY ON MILK CASEIN ASSAY METHODS
Directory of Open Access Journals (Sweden)
RODICA CĂPRIłĂ
2008-05-01
Full Text Available Casein, the main milk protein was determined by different assay methods: the gravimetric method, the method based on the neutralization of the NaOH excess used for the casein precipitate solving and the method based on the titration of the acetic acid used for the casein precipitation. The last method is the simplest one, with the fewer steps, and also with the lowest error degree. The results of the experiment revealed that the percentage of casein from the whole milk protein represents between 72.6–81.3% in experiment 1, between 73.6–81.3% in experiment 2 and between 74.3–81% in experiment 3.
First results with a radioreceptor-assay (TRAK-Assay) for TSH-receptor-autoantibodies
International Nuclear Information System (INIS)
Becker, W.; Reiners, C.; Boerner, W.
1983-01-01
A new radioreceptor-assay (TRAK-assay) for autoantibodies against TSH-receptors was tested in 48 untreated thyrotoxic patients (26 regional autonomies, 22 toxic diffuse goiters). None of the 26 patients with regional autonomy showed positive autoantibody-titers. 4 patients with toxic diffuse goiter and thyrotoxic exophthalmos were TRAK-positive. Positive titers of microsomal and thyreoglobulin autoantibodies could be seen in 8 of 9 patients with positive TRAK-titers. In accordance with the conventional methods for detecting thyroid-stimulating immunoglobulins the new TRAK-assay seems to be suited for differentiating between immunogenic toxic diffuse goiter (Graves' disease) and goiter with disseminated autonomy as well as for prediction of relapse. (orig.) [de
The Cyclin-Dependent Kinase Ortholog pUL97 of Human Cytomegalovirus Interacts with Cyclins
Directory of Open Access Journals (Sweden)
Laura Graf
2013-12-01
Full Text Available The human cytomegalovirus (HCMV-encoded protein kinase, pUL97, is considered a cyclin-dependent kinase (CDK ortholog, due to shared structural and functional characteristics. The primary mechanism of CDK activation is binding to corresponding cyclins, including cyclin T1, which is the usual regulatory cofactor of CDK9. This study provides evidence of direct interaction between pUL97 and cyclin T1 using yeast two-hybrid and co-immunoprecipitation analyses. Confocal immunofluorescence revealed partial colocalization of pUL97 with cyclin T1 in subnuclear compartments, most pronounced in viral replication centres. The distribution patterns of pUL97 and cyclin T1 were independent of HCMV strain and host cell type. The sequence domain of pUL97 responsible for the interaction with cyclin T1 was between amino acids 231–280. Additional co-immunoprecipitation analyses showed cyclin B1 and cyclin A as further pUL97 interaction partners. Investigation of the pUL97-cyclin T1 interaction in an ATP consumption assay strongly suggested phosphorylation of pUL97 by the CDK9/cyclin T1 complex in a substrate concentration-dependent manner. This is the first demonstration of interaction between a herpesviral CDK ortholog and cellular cyclins.
Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J
2013-09-01
Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.
Suebsing, R; Pradeep, P J; Jitrakorn, S; Sirithammajak, S; Kampeera, J; Turner, W A; Saksmerprome, V; Withyachumnarnkul, B; Kiatpathomchai, W
2016-07-01
Infectious spleen and kidney necrosis virus (ISKNV) has recently been recognized as a causative agent of serious systemic disease in tilapia. Our objective was to establish a new colorimetric loop-mediated isothermal amplification (LAMP) assay with pre-addition of hydroxynapthol blue (blue-LAMP) to investigate ISKNV transmission in tilapia. The blue-LAMP, targeting a major capsid protein gene of ISKNV, was conducted at 65°C for 45 min, allowing unaided visual detection of the pathogen based on colour change without cross-amplification of other known fish pathogens tested. Comparison of blue-LAMP and PCR assays revealed a higher detection level for blue-LAMP assay (41·33%) in a population of farmed tilapia infected with ISKNV. The investigation of ISKNV transmission pattern in farmed red tilapia using the blue-LAMP revealed a possible matroclinical form. The presence of ISKNV in the gonad samples was confirmed by in situ LAMP assay. Positive signals only appeared in ovarian follicles, and not in oocytes. Moreover, tissue tropism assay revealed that the brain was the main target organ in both farmed red tilapia (40%) and Nile tilapia (20%). The developed blue-LAMP assay has the potential to be used as a viable tool for screening covert and natural infections of ISKNV in tilapia. The evidence of vertical transmission of ISKNV infection in tilapia indicates the seriousness of this disease and will require a close attention and collaboration between tilapia hatcheries and disease experts in order to find a solution. The new blue-LAMP assay is a time-saving and economically viable detection tool, which allows unaided visual detection for ISKNV in tilapia, and it could be applicable for field applications. Evidence on the vertical transmission of ISKNV in farmed tilapia suggests a need for developing farm management practices to control the spread of virus in aquaculture industries. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Meng Wang
2015-01-01
Full Text Available The safety of herbal medicine products has been a widespread concern due to their complex chemical nature and lack of proper evaluation methods. We have adapted a sensitive and reproducible multiparametric cell-based high-content analysis assay to evaluate the hepatic-safety of four Chinese medicine injections and validated it with classical animal-based toxicity assays. Our results suggested that the reported hepatotoxicity by one of the drugs, Fufangkushen injection, could be attributed at least in part to the interference of mitochondrial function in human HepG2 cells by some of its constituents. This method should be useful for both preclinical screen in a drug discovery program and postclinical evaluation of herbal medicine preparations.
Automation of the ELISpot assay for high-throughput detection of antigen-specific T-cell responses.
Almeida, Coral-Ann M; Roberts, Steven G; Laird, Rebecca; McKinnon, Elizabeth; Ahmed, Imran; Pfafferott, Katja; Turley, Joanne; Keane, Niamh M; Lucas, Andrew; Rushton, Ben; Chopra, Abha; Mallal, Simon; John, Mina
2009-05-15
The enzyme linked immunospot (ELISpot) assay is a fundamental tool in cellular immunology, providing both quantitative and qualitative information on cellular cytokine responses to defined antigens. It enables the comprehensive screening of patient derived peripheral blood mononuclear cells to reveal the antigenic restriction of T-cell responses and is an emerging technique in clinical laboratory investigation of certain infectious diseases. As with all cellular-based assays, the final results of the assay are dependent on a number of technical variables that may impact precision if not highly standardised between operators. When studies that are large scale or using multiple antigens are set up manually, these assays may be labour intensive, have many manual handling steps, are subject to data and sample integrity failure and may show large inter-operator variability. Here we describe the successful automated performance of the interferon (IFN)-gamma ELISpot assay from cell counting through to electronic capture of cytokine quantitation and present the results of a comparison between automated and manual performance of the ELISpot assay. The mean number of spot forming units enumerated by both methods for limiting dilutions of CMV, EBV and influenza (CEF)-derived peptides in six healthy individuals were highly correlated (r>0.83, pautomated system compared favourably with the manual ELISpot and further ensured electronic tracking, increased through-put and reduced turnaround time.
Further characterization of benzo[a]pyrene diol-epoxide (BPDE)-induced comet assay effects.
Bausinger, Julia; Schütz, Petra; Piberger, Ann Liza; Speit, Günter
2016-03-01
The present study aims to further characterize benzo[a]pyrene diol-epoxide (BPDE)-induced comet assay effects. Therefore, we measured DNA effects by the comet assay and adduct levels by high-performance liquid chromatography (HPLC) in human lymphocytes and A549 cells exposed to (±)-anti-benzo[a]pyrene-7,8-diol 9,10-epoxide [(±)-anti-BPDE] or (+)-anti-benzo[a]pyrene-7,8-diol 9,10-epoxide [(+)-anti-BPDE]. Both, the racemic form and (+)-anti-BPDE, which is the most relevant metabolite with regard to mutagenicity and carcinogenicity, induced DNA migration in cultured lymphocytes in the same range of concentrations to a similar extent in the alkaline comet assay after exposure for 2h. Nevertheless, (+)-anti-BPDE induced significantly enhanced DNA migration after 16 and 18h post-cultivation which was not seen in response to (±)-anti-BPDE. Combination of the comet assay with the Fpg (formamidopyrimidine-DNA glycosylase) protein did not enhance BPDE-induced effects and thus indicated the absence of Fpg-sensitive sites (oxidized purines, N7-guanine adducts, AP-sites). The aphidicolin (APC)-modified comet assay suggested significant excision repair activity of cultured lymphocytes during the first 18h of culture after a 2 h-exposure to BPDE. In contrast to these repair-related effects measured by the comet assay, HPLC analysis of stable adducts did not reveal any significant removal of (+)-anti-BPDE-induced adducts from lymphocytes during the first 22h of culture. On the other hand, HPLC measurements indicated that A549 cells repaired about 70% of (+)-anti-BPDE-induced DNA-adducts within 22h of release. However, various experiments with the APC-modified comet assay did not indicate significant repair activity during this period in A549 cells. The conflicting results obtained with the comet assay and the HPLC-based adduct analysis question the real cause for BPDE-induced DNA migration in the comet assay and the reliability of the APC-modified comet assay for the
Syndecan-4 associates with alpha-actinin
DEFF Research Database (Denmark)
Greene, Daniel K; Tumova, Sarka; Couchman, John R
2002-01-01
during the formation of focal adhesions. To date, a direct link between syndecan-4 and the cytoskeleton has remained elusive. We now demonstrate by Triton X-100 extraction immunoprecipitation and in vitro binding assays that the focal adhesion component alpha-actinin interacts with syndecan-4 in a beta...
Measurement of antiacetylcholine receptor auto-antibodies in ...
African Journals Online (AJOL)
Two different acetylcholine receptor (AChR) preparations derived from amputated human muscle (AChRAMP) and from the human rhabdomyosarcoma cell line TE671 (AChRTE67,) were compared in radio-immunoprecipitation assays for the detection of AChR auto-antibodies in serum specimens from 20 patients with ...
EB1 and EB3 promote cilia biogenesis by several centrosome-related mechanisms
DEFF Research Database (Denmark)
Schrøder, Jacob M; Larsen, Jesper; Komarova, Yulia
2011-01-01
surrounded by vesicles. Further, GST pull-down assays, mass spectrometry and immunoprecipitation indicated that EB1 and EB3 interact with proteins implicated in MT minus-end anchoring or vesicular trafficking to the cilia base, suggesting that EB1 and EB3 promote ciliogenesis by facilitating such trafficking...
Potential gene regulatory role for cyclin D3 in muscle cells
Indian Academy of Sciences (India)
Using chromatin immunoprecipitation assays, we demonstrated that expression of cyclin D3 in undifferentiated myoblasts altered histone epigenetic marks at promoters of muscle-specific genes like MyoD, Pax7, myogenin and muscle creatine kinase but not non-muscle genes. Cyclin D3 expression also reduced the mRNA ...
Single-Cell Based Quantitative Assay of Chromosome Transmission Fidelity.
Zhu, Jin; Heinecke, Dominic; Mulla, Wahid A; Bradford, William D; Rubinstein, Boris; Box, Andrew; Haug, Jeffrey S; Li, Rong
2015-03-30
Errors in mitosis are a primary cause of chromosome instability (CIN), generating aneuploid progeny cells. Whereas a variety of factors can influence CIN, under most conditions mitotic errors are rare events that have been difficult to measure accurately. Here we report a green fluorescent protein-based quantitative chromosome transmission fidelity (qCTF) assay in budding yeast that allows sensitive and quantitative detection of CIN and can be easily adapted to high-throughput analysis. Using the qCTF assay, we performed genome-wide quantitative profiling of genes that affect CIN in a dosage-dependent manner and identified genes that elevate CIN when either increased (icCIN) or decreased in copy number (dcCIN). Unexpectedly, qCTF screening also revealed genes whose change in copy number quantitatively suppress CIN, suggesting that the basal error rate of the wild-type genome is not minimized, but rather, may have evolved toward an optimal level that balances both stability and low-level karyotype variation for evolutionary adaptation. Copyright © 2015 Zhu et al.
Safeguards and Non-destructive Assay
International Nuclear Information System (INIS)
Carchon, R.; Bruggeman, M.
2001-01-01
SCK-CEN's programme on safeguards and non-destructive assay includes: (1) various activities to assure nuclear materials accountancy; (2) contributes to the implementation of Integrated Safeguards measures in Belgium and to assist the IAEA through the Belgian Support Programme; (3) renders services to internal and external customers in the field of safeguards; (4) improves passive neutron coincidence counting techniques for waste assay and safeguards verification measurements by R and D on correlation algorithms implemented via software or dedicated hardware; (5) improves gamma assay techniques for waste assay by implementing advanced scanning techniques and different correlation algorithms; and (6) develops numerical calibration techniques. Major achievements in these areas in 2000 are reported
Fu, Qinqin; Yuan, Y Adam
2013-03-01
Intensive research interest has focused on small RNA-processing machinery and the RNA-induced silencing complex (RISC), key cellular machines in RNAi pathways. However, the structural mechanism regarding RISC assembly, the primary step linking small RNA processing and RNA-mediated gene silencing, is largely unknown. Human RNA helicase A (DHX9) was reported to function as an RISC-loading factor, and such function is mediated mainly by its dsRNA-binding domains (dsRBDs). Here, we report the crystal structures of human RNA helicase A (RHA) dsRBD1 and dsRBD2 domains in complex with dsRNAs, respectively. Structural analysis not only reveals higher siRNA duplex-binding affinity displayed by dsRBD1, but also identifies a crystallographic dsRBD1 pair of physiological significance in cooperatively recognizing dsRNAs. Structural observations are further validated by isothermal titration calorimetric (ITC) assay. Moreover, co-immunoprecipitation (co-IP) assay coupled with mutagenesis demonstrated that both dsRBDs are required for RISC association, and such association is mediated by dsRNA. Hence, our structural and functional efforts have revealed a potential working model for siRNA recognition by RHA tandem dsRBDs, and together they provide direct structural insights into RISC assembly facilitated by RHA.
Rapid Estimation of Tocopherol Content in Linseed and Sunflower Oils-Reactivity and Assay
Directory of Open Access Journals (Sweden)
Tjaša Prevc
2015-08-01
Full Text Available The reactivity of tocopherols with 2,2-diphenyl-1-picrylhydrazyl (DPPH was studied in model systems in order to establish a method for quantifying vitamin E in plant oils. The method was optimized with respect to solvent composition of the assay medium, which has a large influence on the course of reaction of tocopherols with DPPH. The rate of reaction of α-tocopherol with DPPH is higher than that of γ-tocopherol in both protic and aprotic solvents. In ethyl acetate, routinely applied for the analysis of antioxidant potential (AOP of plant oils, reactions of tocopherols with DPPH are slower and concentration of tocopherols in the assay has a large influence on their molar reactivity. In 2-propanol, however, two electrons are exchanged for both α- and γ-tocopherols, independent of their concentration. 2-propanol is not toxic and is fully compatible with polypropylene labware. The chromatographically determined content of tocopherols and their molar reactivity in the DPPH assay reveal that only tocopherols contribute to the AOP of sunflower oil, whereas the contribution of tocopherols to the AOP of linseed oil is 75%. The DPPH assay in 2-propanol can be applied for rapid and cheap estimation of vitamin E content in plant oils where tocopherols are major antioxidants.
Rapid Estimation of Tocopherol Content in Linseed and Sunflower Oils-Reactivity and Assay.
Prevc, Tjaša; Levart, Alenka; Cigić, Irena Kralj; Salobir, Janez; Ulrih, Nataša Poklar; Cigić, Blaž
2015-08-13
The reactivity of tocopherols with 2,2-diphenyl-1-picrylhydrazyl (DPPH) was studied in model systems in order to establish a method for quantifying vitamin E in plant oils. The method was optimized with respect to solvent composition of the assay medium, which has a large influence on the course of reaction of tocopherols with DPPH. The rate of reaction of α-tocopherol with DPPH is higher than that of γ-tocopherol in both protic and aprotic solvents. In ethyl acetate, routinely applied for the analysis of antioxidant potential (AOP) of plant oils, reactions of tocopherols with DPPH are slower and concentration of tocopherols in the assay has a large influence on their molar reactivity. In 2-propanol, however, two electrons are exchanged for both α- and γ-tocopherols, independent of their concentration. 2-propanol is not toxic and is fully compatible with polypropylene labware. The chromatographically determined content of tocopherols and their molar reactivity in the DPPH assay reveal that only tocopherols contribute to the AOP of sunflower oil, whereas the contribution of tocopherols to the AOP of linseed oil is 75%. The DPPH assay in 2-propanol can be applied for rapid and cheap estimation of vitamin E content in plant oils where tocopherols are major antioxidants.
Establishment and clinical application of immunoradiometric assay for human growth hormone in serum
International Nuclear Information System (INIS)
Ji Jinfeng; Wu Congyuan; Niu Zhanpo; Zhang Kui; Song Ailing; Deng Jieying; Shi Mifan
1992-01-01
An immunoradiometric assay (IRMA) for human growth hormone (hGH) in serum is developed based on two high specific monoclonal antibodies against hGh. It can specifically detect the levels of serum bioactive hGh and had no cross-reaction with human prolactin (hPRL) and hGh oligmeric forms. The sensitivity was 0.2 ng/ml and the recovery for different concentrations of hGh was 92.0% ∼ 103.2%. The coefficients of variation for intra and inter-assay were<9.1% and <14.2%, respectively. Integral analysis of the results of RIA and IRMA with the patients' clinical manifestations revealed that hGh IRMA is better than hGh RIA in reflecting the clinical states of different acromegalic patients
Zhang, Cheng-Cheng; Li, Ru; Jiang, Honghui; Lin, Shujun; Rogalski, Jason C; Liu, Kate; Kast, Juergen
2015-02-06
Small GTPases are a family of key signaling molecules that are ubiquitously expressed in various types of cells. Their activity is often analyzed by western blot, which is limited by its multiplexing capability, the quality of isoform-specific antibodies, and the accuracy of quantification. To overcome these issues, a quantitative multiplexed small GTPase activity assay has been developed. Using four different binding domains, this assay allows the binding of up to 12 active small GTPase isoforms simultaneously in a single experiment. To accurately quantify the closely related small GTPase isoforms, a targeted proteomic approach, i.e., selected/multiple reaction monitoring, was developed, and its functionality and reproducibility were validated. This assay was successfully applied to human platelets and revealed time-resolved coactivation of multiple small GTPase isoforms in response to agonists and differential activation of these isoforms in response to inhibitor treatment. This widely applicable approach can be used for signaling pathway studies and inhibitor screening in many cellular systems.
Directory of Open Access Journals (Sweden)
Haoyou Wang
2017-04-01
Full Text Available Background/Aims: Long non-coding RNAs (lncRNAs are key players in the development and progression of human cancers. The lncRNA XIST (X-inactive specific transcript has been shown to be upregulated in human non-small cell lung cancer (NSCLC; however, its role and molecular mechanisms in NSCLC cell progression remain unclear. Methods: qRT-PCR was conducted to assess the expression of XIST and miR-186. Cell proliferation was detected using MTT assay. Cell invasion and migration were evaluated using transwell assay. Cell cycle distribution and apoptosis rates were analyzed by flow cytometry. Luciferase reporter assay was used to identify the direct regulation of XIST and miR-186. A RNA immunoprecipitation was used to analyze whether XIST was associated with the RNA-induced silencing complex (RISC. Results: We confirmed that XIST was upregulated in NSCLC cell lines and tissues. Functionally, XIST knockdown inhibited cancer cell proliferation and invasion, and induced apoptosis in vitro, and suppressed subcutaneous tumor growth in vivo. Mechanistic investigations revealed a reciprocal repressive interaction between XIST and miR-186-5p. Furthermore, we showed that miR-186-5p has a binding site for XIST. Our data also indicated that XIST and miR-186-5p are likely in the same RNA induced silencing complex. Conclusion: Together, our data revealed that XIST knockdown confers suppressive function in NSCLC and XIST may be a novel therapeutic marker in this disease.
Directory of Open Access Journals (Sweden)
Paromita Bag
Full Text Available Herpes genitalis, caused by HSV-2, is an incurable genital ulcerative disease transmitted by sexual intercourse. The virus establishes life-long latency in sacral root ganglia and reported to have synergistic relationship with HIV-1 transmission. Till date no effective vaccine is available, while the existing therapy frequently yielded drug resistance, toxicity and treatment failure. Thus, there is a pressing need for non-nucleotide antiviral agent from traditional source. Based on ethnomedicinal use we have isolated a compound 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole (HM from the traditional herb Ophiorrhiza nicobarica Balkr, and evaluated its efficacy on isolates of HSV-2 in vitro and in vivo. The cytotoxicity (CC50, effective concentrations (EC50 and the mode of action of HM was determined by MTT, plaque reduction, time-of-addition, immunofluorescence (IFA, Western blot, qRT-PCR, EMSA, supershift and co-immunoprecipitation assays; while the in vivo toxicity and efficacy was evaluated in BALB/c mice. The results revealed that HM possesses significant anti-HSV-2 activity with EC50 of 1.1-2.8 µg/ml, and selectivity index of >20. The time kinetics and IFA demonstrated that HM dose dependently inhibited 50-99% of HSV-2 infection at 1.5-5.0 µg/ml at 2-4 h post-infection. Further, HM was unable to inhibit viral attachment or penetration and had no synergistic interaction with acyclovir. Moreover, Western blot and qRT-PCR assays demonstrated that HM suppressed viral IE gene expression, while the EMSA and co-immunoprecipitation studies showed that HM interfered with the recruitment of LSD-1 by HCF-1. The in vivo studies revealed that HM at its virucidal concentration was nontoxic and reduced virus yield in the brain of HSV-2 infected mice in a concentration dependent manner, compared to vaginal tissues. Thus, our results suggest that HM can serve as a prototype to develop non-nucleotide antiviral lead targeting the viral IE
Bag, Paromita; Ojha, Durbadal; Mukherjee, Hemanta; Halder, Umesh Chandra; Mondal, Supriya; Chandra, Nidhi S; Nandi, Suman; Sharon, Ashoke; Sarkar, Mamta Chawla; Chakrabarti, Sekhar; Chattopadhyay, Debprasad
2013-01-01
Herpes genitalis, caused by HSV-2, is an incurable genital ulcerative disease transmitted by sexual intercourse. The virus establishes life-long latency in sacral root ganglia and reported to have synergistic relationship with HIV-1 transmission. Till date no effective vaccine is available, while the existing therapy frequently yielded drug resistance, toxicity and treatment failure. Thus, there is a pressing need for non-nucleotide antiviral agent from traditional source. Based on ethnomedicinal use we have isolated a compound 7-methoxy-1-methyl-4,9-dihydro-3H-pyrido[3,4-b]indole (HM) from the traditional herb Ophiorrhiza nicobarica Balkr, and evaluated its efficacy on isolates of HSV-2 in vitro and in vivo. The cytotoxicity (CC50), effective concentrations (EC50) and the mode of action of HM was determined by MTT, plaque reduction, time-of-addition, immunofluorescence (IFA), Western blot, qRT-PCR, EMSA, supershift and co-immunoprecipitation assays; while the in vivo toxicity and efficacy was evaluated in BALB/c mice. The results revealed that HM possesses significant anti-HSV-2 activity with EC50 of 1.1-2.8 µg/ml, and selectivity index of >20. The time kinetics and IFA demonstrated that HM dose dependently inhibited 50-99% of HSV-2 infection at 1.5-5.0 µg/ml at 2-4 h post-infection. Further, HM was unable to inhibit viral attachment or penetration and had no synergistic interaction with acyclovir. Moreover, Western blot and qRT-PCR assays demonstrated that HM suppressed viral IE gene expression, while the EMSA and co-immunoprecipitation studies showed that HM interfered with the recruitment of LSD-1 by HCF-1. The in vivo studies revealed that HM at its virucidal concentration was nontoxic and reduced virus yield in the brain of HSV-2 infected mice in a concentration dependent manner, compared to vaginal tissues. Thus, our results suggest that HM can serve as a prototype to develop non-nucleotide antiviral lead targeting the viral IE transcription for the
Srivastava, A K; Mohan, S; Singer, F R; Baylink, D J
2002-07-01
We isolated and characterized a peptide fragment corresponding to amino acid sequence 14-28 of human osteocalcin in urine from Paget's disease, and developed a polyclonal antibody reactive to this peptide in urine. We used this antibody to measure urinary fragments of osteocalcin and compared to efficacy of the urinary osteocalcin assay with a serum osteocalcin (sOC) assay (ELISA-Osteo, Cis-Bio International) to monitor the short-term changes in bone turnover in response to alendronate treatment. The synthetic peptide-based urinary osteocalcin (uOC) radioimmunoassay (RIA) showed an analytical sensitivity of 6.25 ng/mL, standard curve range of 3.12-400 ng/mL, and mean intra- (n = 20) and interassay (n = 30) coefficient of variation (CV) of sALP) (Alkphose-B, Metra Biosystems) in serum samples. The percent change data obtained between baseline and 30 days (n = 18) posttreatment suggested a rapid decline in uOC concentration (-27%, p sALP (-3.4%, p = 0.689), two specific markers of bone formation. As expected, due to the coupling of bone formation and bone resorption, the concentration of all markers showed a 30%-45% decline compared with baseline values after 90 days (n = 16) of treatment. Correlation of markers after a 30 day treatment with alendronate revealed a higher correlation (r = 0.61, p sALP (r = -0.14, p = 0.295) with uNTx. Similarly, correlation coefficients with r values between 0.48 and 0.55 (p < 0.05) were observed between uOC, sNTx, and sCTx, whereas no significant correlation was observed between sOC and sNTx or sCTx. These results provide indirect evidence that fragments measured by the urine assay probably originated from bone resorption, and suggest that the uOC assay could be used to assess short-term changes in bone metabolism with regard to osteocalcin.
Radioactive wastes assay technique and equipment
International Nuclear Information System (INIS)
Lee, K. M.; Hong, D. S; Kim, T. K.; Bae, S. M.; Shon, J. S.; Hong, K. P.
2004-12-01
The waste inventory records such as the activities and radio- nuclides contained in the waste packages are to be submitted with the radioactive wastes packages for the final disposal. The nearly around 10,000 drums of waste stocked in KAERI now should be assayed for the preparation of the waste inventory records too. For the successive execution of the waste assay, the investigation into the present waste assay techniques and equipment are to be taken first. Also the installation of the waste assay equipment through the comprehensive design, manufacturing and procurement should be proceeded timely. As the characteristics of the KAERI-stocked wastes are very different from that of the nuclear power plant and those have no regular waste streams, the application of the in-direct waste assay method using the scaling factors are not effective for the KAERI-generated wastes. Considering for the versal conveniency including the accuracy over the wide range of waste forms and the combination of assay time and sensitivity, the TGS(Tomographic Gamma Scanner) is appropriate as for the KAERI -generated radioactive waste assay equipment
Radioactive waste package assay facility. Volume 1. Application of assay technology
International Nuclear Information System (INIS)
Findlay, D.J.S.; Green, T.H.; Molesworth, T.V.; Staniforth, D.; Strachan, N.R.; Rogers, J.D.; Wise, M.O.; Forrest, K.R.
1992-01-01
This report, in three volumes, covers the work carried out by Taylor Woodrow Construction Ltd., and two major sub-contractors: Harwell Laboratory (AEA Technology) and Siemens Plessey Controls Ltd., on the development of a radioactive waste package assay facility, for cemented 500 litre intermediate level waste drums. In volume 1, the reasons for assay are considered together with the various techniques that can be used, and the information that can be obtained. The practical problems associated with the use of the various techniques in an integrated assay facility are identified, and the key parameters defined. Engineering and operational features are examined and provisional designs proposed for facilities at three throughput levels: 15,000, 750 and 30 drums per year respectively. The capital and operating costs for such facilities have been estimated. A number of recommendations are made for further work. 16 refs., 14 figs., 13 tabs
Elliott, D.G.; Applegate, L.J.; Murray, A.L.; Purcell, M.K.; McKibben, C.L.
2013-01-01
No gold standard assay exhibiting error-free classification of results has been identified for detection of Renibacterium salmoninarum, the causative agent of salmonid bacterial kidney disease. Validation of diagnostic assays for R. salmoninarum has been hindered by its unique characteristics and biology, and difficulties in locating suitable populations of reference test animals. Infection status of fish in test populations is often unknown, and it is commonly assumed that the assay yielding the most positive results has the highest diagnostic accuracy, without consideration of misclassification of results. In this research, quantification of R. salmoninarum in samples by bacteriological culture provided a standardized measure of viable bacteria to evaluate analytical performance characteristics (sensitivity, specificity and repeatability) of non-culture assays in three matrices (phosphate-buffered saline, ovarian fluid and kidney tissue). Non-culture assays included polyclonal enzyme-linked immunosorbent assay (ELISA), direct smear fluorescent antibody technique (FAT), membrane-filtration FAT, nested polymerase chain reaction (nested PCR) and three real-time quantitative PCR assays. Injection challenge of specific pathogen-free Chinook salmon, Oncorhynchus tshawytscha (Walbaum), with R. salmoninarum was used to estimate diagnostic sensitivity and specificity. Results did not identify a single assay demonstrating the highest analytical and diagnostic performance characteristics, but revealed strengths and weaknesses of each test.
Automation of the dicentric chromosome assay and related assays
International Nuclear Information System (INIS)
Balajee, Adayabalam S.; Dainiak, Nicholas
2016-01-01
Dicentric Chromosome Assay (DCA) is considered to be the 'gold standard' for personalized dose assessment in humans after accidental or incidental radiation exposure. Although this technique is superior to other cytogenetic assays in terms of specificity and sensitivity, its potential application to radiation mass casualty scenarios is highly restricted because DCA is time consuming and labor intensive when performed manually. Therefore, it is imperative to develop high throughput automation techniques to make DCA suitable for radiological triage scenarios. At the Cytogenetic Biodosimetry Laboratory in Oak Ridge, efforts are underway to develop high throughput automation of DCA. Current status on development of various automated cytogenetic techniques in meeting the biodosimetry needs of radiological/nuclear incident(s) will be discussed
Probing intracellular motor protein activity using an inducible cargo trafficking assay.
Kapitein, Lukas C; Schlager, Max A; van der Zwan, Wouter A; Wulf, Phebe S; Keijzer, Nanda; Hoogenraad, Casper C
2010-10-06
Although purified cytoskeletal motor proteins have been studied extensively with the use of in vitro approaches, a generic approach to selectively probe actin and microtubule-based motor protein activity inside living cells is lacking. To examine specific motor activity inside living cells, we utilized the FKBP-rapalog-FRB heterodimerization system to develop an in vivo peroxisomal trafficking assay that allows inducible recruitment of exogenous and endogenous kinesin, dynein, and myosin motors to drive specific cargo transport. We demonstrate that cargo rapidly redistributes with distinct dynamics for each respective motor, and that combined (antagonistic) actions of more complex motor combinations can also be probed. Of importance, robust cargo redistribution is readily achieved by one type of motor protein and does not require the presence of opposite-polarity motors. Simultaneous live-cell imaging of microtubules and kinesin or dynein-propelled peroxisomes, combined with high-resolution particle tracking, revealed that peroxisomes frequently pause at microtubule intersections. Titration and washout experiments furthermore revealed that motor recruitment by rapalog-induced heterodimerization is dose-dependent but irreversible. Our assay directly demonstrates that robust cargo motility does not require the presence of opposite-polarity motors, and can therefore be used to characterize the motile properties of specific types of motor proteins. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Radiometric assays for glycerol, glucose, and glycogen
International Nuclear Information System (INIS)
Bradley, D.C.; Kaslow, H.R.
1989-01-01
We have developed radiometric assays for small quantities of glycerol, glucose and glycogen, based on a technique described by Thorner and Paulus for the measurement of glycerokinase activity. In the glycerol assay, glycerol is phosphorylated with [32P]ATP and glycerokinase, residual [32P]ATP is hydrolyzed by heating in acid, and free [32P]phosphate is removed by precipitation with ammonium molybdate and triethylamine. Standard dose-response curves were linear from 50 to 3000 pmol glycerol with less than 3% SD in triplicate measurements. Of the substances tested for interference, only dihydroxyacetone gave a slight false positive signal at high concentration. When used to measure glycerol concentrations in serum and in media from incubated adipose tissue, the radiometric glycerol assay correlated well with a commonly used spectrophotometric assay. The radiometric glucose assay is similar to the glycerol assay, except that glucokinase is used instead of glycerokinase. Dose response was linear from 5 to 3000 pmol glucose with less than 3% SD in triplicate measurements. Glucosamine and N-acetylglucosamine gave false positive signals when equimolar to glucose. When glucose concentrations in serum were measured, the radiometric glucose assay agreed well with hexokinase/glucose-6-phosphate dehydrogenase (H/GDH)-based and glucose oxidase/H2O2-based glucose assays. The radiometric method for glycogen measurement incorporates previously described isolation and digestion techniques, followed by the radiometric assay of free glucose. When used to measure glycogen in mouse epididymal fat pads, the radiometric glycogen assay correlated well with the H/GDH-based glycogen assay. All three radiometric assays offer several practical advantages over spectral assays
Harmonization of radiobiological assays: why and how?
International Nuclear Information System (INIS)
Prasanna, Pataje G.
2014-01-01
The International Atomic Energy Agency has made available a technical manual for cytogenetic biodosimetry assays (dicentric chromosome aberration (DCA) and cytokinesis-block micronucleus (CBMN) assays) used for radiation dose assessment in radiation accidents. The International Standardization Organization, which develops standards and guidelines, also provides an avenue for laboratory accreditation, has developed guidelines and recommendations for performing cytogenetic biodosimetry assays. Harmonization of DCA and CBMN assays, has improved their accuracy. Double-blinded inter-laboratory comparison studies involving several networks have further validated DCA and CBMN assays and improved the confidence in their potential use for radiation dose assessment in mass casualties. This kind of international harmonization is lacking for pre-clinical radiobiology assays. The widely used pre-clinical assays that are relatively important to set stage for clinical trials include clonogenic assays, flow-cytometry assays, apoptotic assays, and tumor regression and growth delay assays. However, significant inter-laboratory variations occur with respect to data among laboratories. This raises concerns on the reliability and reproducibility of preclinical data that drives further development and translation. Lack of reproducibility may stem from a variety of factors such as poor scientist training, less than optimal experimental design, inadequate description of methodology, and impulse to publish only the positive data etc. Availability of technical manuals, standard operating procedures, accreditation avenues for laboratories performing such assays, inter-laboratory comparisons, and use of standardized protocols are necessary to enhance reliability and reproducibility. Thus, it is important that radiobiological assays are harmonized for laboratory protocols to ensure successful translation of pre-clinical research on radiation effect modulators to help design clinic trials with
The regulatory effects of low-dose ionizing radiation on Ikaros-autotaxin interaction
Energy Technology Data Exchange (ETDEWEB)
Kang, Hana; Cho, Seong Jun; Kim, Sung Jin; Nam, Seon Young; Yang, Kwang Hee [KHNP Radiation Health Institute, Korea Hydro and Nuclear Power Co, Seoul (Korea, Republic of)
2016-11-15
Ikaros, a transcription factor containing zinc-finger motif, has known as a critical regulator of hematopoiesis in immune system. Ikaros protein modulates the transcription of target genes via binding to the regulatory elements of the genes promoters. However the regulatory function of Ikaros in other organelle except nuclear remains to be determined. This study explored radiation-induced modulatory function of Ikaros in cytoplasm. The results showed that Ikaros protein lost its DNA binding ability after LDIR (low-dose ionizing radiation) exposure. Cell fractionation and Western blot analysis showed that Ikaros protein was translocated into cytoplasm from nuclear by LDIR. This was confirmed by immunofluorescence assay. We identified Autotaxin as a novel protein which potentially interacts with Ikaros through in vitro protein-binding screening. Co-immunoprecipitation assay revealed that Ikaros and Autotaxin are able to bind each other. Autotaxin is a crucial enzyme generating lysophosphatidic acid (LPA), a phospholipid mediator, which has potential regulatory effects on immune cell growth and motility. Our results indicate that LDIR potentially regulates immune system via protein-protein interaction of Ikaros and Autotaxin.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Institute of Scientific and Technical Information of China (English)
CHEN Li; CHEN Bo-bin; LI Jun-jie; JIN Wei; SHAO Zhi-min
2011-01-01
Objective To explore the activity of PEA3 ( polyomavirus enhancer activator 3 ) on CXCL12 (Chemokine CXC motif ligand 12) transcription and to reveal the role of PEA3 involved in CXCL12-mediated metastasis and angiogenesis in breast cancer. Methods Methods such as cell transfection, ChIP assay (chromatin immunoprecipitation ), and siRNA (small interfering RNA) were applied to demonstrate and confirm the interaction between PEA3 and CXCL12. Results Over-expression of PEA3 could increase the CXCL12 mRNA level and the CXCL12 promoter activity in human MCF-7 breast cancer cells. ChIP assay demonstrated that PEA3 could bind to the CXCL12 promoter in the cells transfected with PEA3 expression vector. PEA3 siRNA decreased CXCL12 promoter activity and the binding of PEA3 to the CXCL12 promoter in MCF-7 cells. Conclusions PEA3 could activate CXCL12 promoter transcription. It may be a potential mechanism of tumor angiogenesis and metastasis regarding of PEA3 and CXCL12.
Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng
2017-07-01
Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Hyun-Joo Park
Full Text Available The neuromedin B receptor (NMB-R, a member of the mammalian bombesin receptor family, is frequently overexpressed in various tumors. In the present study, we found that exposure to hypoxic conditions increases the levels of NMBR mRNA and protein in breast cancer cells, which are tightly regulated by hypoxia-inducible factor-1α (HIF-1α. We confirmed the effect of HIF-1α on NMBR transcription by performing an NMBR promoter-driven reporter assay and then identified a functional hypoxia-responsive element (HRE in the human NMBR promoter region. Further, the binding of HIF-1α to the NMBR promoter was corroborated by electrophoretic mobility shift and chromatin immunoprecipitation assays, which showed that HIF-1α specifically and directly bound to the NMBR promoter in response to hypoxia. Immunohistochemical analysis of a xenograft and a human breast cancer tissue array revealed a significant correlation between NMB-R and HIF-1α expression. Taken together, our findings indicate that hypoxia induces NMB-R expression through a novel mechanism to regulate HIF-1α expression in breast cancer cells.
Schmitt, Sebastian; Höfner, Georg; Wanner, Klaus T
2014-08-05
Transport assays for neurotransmitters based on radiolabeled substrates are widely spread and often indispensable in basic research and the drug development process, although the use of radioisotopes is inherently coupled to issues concerning radioactive waste and safety precautions. To overcome these disadvantages, we developed mass spectrometry (MS)-based transport assays for γ-aminobutyric acid (GABA), which is the major inhibitory neurotransmitter in the central nervous system (CNS). These "MS Transport Assays" provide all capabilities of [(3)H]GABA transport assays and therefore represent the first substitute for the latter. The performance of our approach is demonstrated for GAT1, the most important GABA transporter (GAT) subtype. As GABA is endogenously present in COS-7 cells employed as hGAT1 expression system, ((2)H6)GABA was used as a substrate to differentiate transported from endogenous GABA. To record transported ((2)H6)GABA, a highly sensitive, short, robust, and reliable HILIC-ESI-MS/MS quantification method using ((2)H2)GABA as an internal standard was developed and validated according to the Center for Drug Evaluation and Research (CDER) guidelines. Based on this LC-MS quantification, a setup to characterize hGAT1 mediated ((2)H6)GABA transport in a 96-well format was established, that enables automated processing and avoids any sample preparation. The K(m) value for ((2)H6)GABA determined for hGAT1 is in excellent agreement with results obtained from [(3)H]GABA uptake assays. In addition, the established assay format enables efficient determination of the inhibitory potency of GAT1 inhibitors, is capable of identifying those inhibitors transported as substrates, and furthermore allows characterization of efflux. The approach described here combines the strengths of LC-MS/MS with the high efficiency of transport assays based on radiolabeled substrates and is applicable to all GABA transporter subtypes.
Clonogenic assay: adherent cells.
Rafehi, Haloom; Orlowski, Christian; Georgiadis, George T; Ververis, Katherine; El-Osta, Assam; Karagiannis, Tom C
2011-03-13
The clonogenic (or colony forming) assay has been established for more than 50 years; the original paper describing the technique was published in 1956. Apart from documenting the method, the initial landmark study generated the first radiation-dose response curve for X-ray irradiated mammalian (HeLa) cells in culture. Basically, the clonogenic assay enables an assessment of the differences in reproductive viability (capacity of cells to produce progeny; i.e. a single cell to form a colony of 50 or more cells) between control untreated cells and cells that have undergone various treatments such as exposure to ionising radiation, various chemical compounds (e.g. cytotoxic agents) or in other cases genetic manipulation. The assay has become the most widely accepted technique in radiation biology and has been widely used for evaluating the radiation sensitivity of different cell lines. Further, the clonogenic assay is commonly used for monitoring the efficacy of radiation modifying compounds and for determining the effects of cytotoxic agents and other anti-cancer therapeutics on colony forming ability, in different cell lines. A typical clonogenic survival experiment using adherent cells lines involves three distinct components, 1) treatment of the cell monolayer in tissue culture flasks, 2) preparation of single cell suspensions and plating an appropriate number of cells in petri dishes and 3) fixing and staining colonies following a relevant incubation period, which could range from 1-3 weeks, depending on the cell line. Here we demonstrate the general procedure for performing the clonogenic assay with adherent cell lines with the use of an immortalized human keratinocyte cell line (FEP-1811). Also, our aims are to describe common features of clonogenic assays including calculation of the plating efficiency and survival fractions after exposure of cells to radiation, and to exemplify modification of radiation-response with the use of a natural antioxidant
Nikolova, Teodora; Marini, Federico; Kaina, Bernd
2017-10-01
Genotoxicity testing relies on the quantitative measurement of adverse effects, such as chromosome aberrations, micronuclei, and mutations, resulting from primary DNA damage. Ideally, assays will detect DNA damage and cellular responses with high sensitivity, reliability, and throughput. Several novel genotoxicity assays may fulfill these requirements, including the comet assay and the more recently developed γH2AX assay. Although they are thought to be specific for genotoxicants, a systematic comparison of the assays has not yet been undertaken. In the present study, we compare the γH2AX focus assay with the alkaline and neutral versions of the comet assay, as to their sensitivities and limitations for detection of genetic damage. We investigated the dose-response relationships of γH2AX foci and comet tail intensities at various times following treatment with four prototypical genotoxicants, methyl methanesulfonate (MMS), N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), mitomycin C, and hydrogen peroxide (H 2 O 2 ) and we tested whether there is a correlation between the endpoints, i.e., alkali-labile sites and DNA strand breaks on the one hand and the cell's response to DNA double-strand breaks and blocked replication forks on the other. Induction of γH2AX foci gave a linear dose response and all agents tested were positive in the assay. The increase in comet tail intensity was also a function of dose; however, mitomycin C was almost completely ineffective in the comet assay, and the doses needed to achieve a significant effect were somewhat higher for some treatments in the comet assay than in the γH2AX foci assay, which was confirmed by threshold analysis. There was high correlation between tail intensity and γH2AX foci for MMS and H 2 O 2 , less for MNNG, and none for mitomycin C. From this we infer that the γH2AX foci assay is more reliable, sensitive, and robust than the comet assay for detecting genotoxicant-induced DNA damage. Copyright © 2017 Elsevier
Yang, Jie; Wu, Renyi; Li, Wenji; Gao, Linbo; Yang, Yuqing; Li, Ping; Kong, Ah-Ng
2018-04-01
Corosolic acid (CRA) is found in various plants and has been used as a health food supplement worldwide. Although it has been reported that CRA exhibits significant anticancer activity, the effect of this compound on prostate cancer remains unknown. In this study, we investigated the effect of CRA on cellular transformation and the reactivation of nuclear factor erythroid 2-related factor 2 (Nrf2) through epigenetic regulation in TRAMP-C1 prostate cells. Specifically, we found that CRA inhibited anchorage-independent growth of prostate cancer TRAMP-C1 cells but not Nrf2 knockout prostate cancer TRAMP-C1 cells. Moreover, CRA induced mRNA and protein expression of Nrf2, heme oxygenase-1 (HO-1) and NAD(P)H Quinone Oxidoreductase 1 (NQO1). Bisulfite genomic sequencing and methylated DNA immunoprecipitation results revealed that CRA treatment decreased the level of methylation of the first five CpG sites of the Nrf2 promoter. Histone modification was analyzed using a chromatin immunoprecipitation (ChIP) assay, which revealed that CRA treatment increased the acetylation of histone H3 lysine 27 (H3K27ac) while decreasing the trimethylation of histone H3 lysine 27 (H3K27me3) in the promoter region of Nrf2. Furthermore, CRA treatment attenuated the protein expression of DNA methyltransferases (DNMTs) and histone deacetylases (HDACs). These findings indicate that CRA has a significant anticancer effect in TRAMP-C1 cells, which could be partly attributed to epigenetics including its ability to epigenetically restore the expression of Nrf2. © 2017 Wiley Periodicals, Inc.
Schuetz, Philipp; Bretscher, Celine; Bernasconi, Luca; Mueller, Beat
2017-06-01
Procalcitonin is a surrogate infection blood marker whose levels help estimate the likelihood of bacterial infections and correlate with their resolution. Recent trials have revealed the benefits of inclusion of procalcitonin in antibiotic stewardship protocols for initiation and discontinuation of antimicrobial therapy. Areas covered: Procalcitonin-guided antibiotic stewardship protocols have shown appreciable reductions in antibiotic use and duration of therapy in respiratory infections, sepsis, and other infections, with positive effects on clinical outcomes. Multiple fully automated and sensitive procalcitonin assays are routinely used in clinical practice. Utilization of these assays requires consideration of the clinical setting and knowledge of assay characteristics, particularly assay sensitivities, reproducibility, and performance across routinely used cut-off ranges. The authors provide an overview of the strengths and limitations of currently available procalcitonin assays and antibiotic therapy algorithms incorporating procalcitonin currently used in different clinical settings and in patients with different underlying infections. Expert commentary: Use of sensitive procalcitonin measurements in clinical algorithms can reduce antimicrobial overuse, decreasing the risk of side effects and controlling emerging bacterial multi-resistance. Before use in clinical practice, it is important to carefully assess the quality of novel PCT assays and rigorously evaluate them in target patient populations across clinically relevant cut-off ranges.
Multicentre comparison of a diagnostic assay
DEFF Research Database (Denmark)
Waters, Patrick; Reindl, Markus; Saiz, Albert
2016-01-01
) assays in neuromyelitis optica spectrum disorders (NMOSD). METHODS: Coded samples from patients with neuromyelitis optica (NMO) or NMOSD (101) and controls (92) were tested at 15 European diagnostic centres using 21 assays including live (n=3) or fixed cell-based assays (n=10), flow cytometry (n=4...
An ultrafiltration assay for lysyl oxidase
International Nuclear Information System (INIS)
Shackleton, D.R.; Hulmes, D.J.
1990-01-01
A modification of the original microdistillation assay for lysyl oxidase is described in which Amicon C-10 microconcentrators are used to separate, by ultrafiltration, the 3H-labeled products released from a [4,5-3H]-lysine-labeled elastin substrate. Enzyme activity is determined by scintillation counting of the ultrafiltrate, after subtraction of radioactivity released in the presence of beta-aminopropionitrile, a specific inhibitor of the enzyme. Conditions are described which optimize both the sensitivity and the efficient use of substrate. The assay shows linear inhibition of activity in up to 1 M urea; hence, as the enzyme is normally diluted in the assay, samples in 6 M urea can be assayed directly, without prior dialysis, and corrected for partial inhibition. Comparable results are obtained when enzyme activity is assayed by ultrafiltration or microdistillation. The assay is simple and convenient and, by using disposable containers throughout, it eliminates the need for time-consuming decontamination of radioactive glassware
Schoppee Bortz, Pamela D.; Wamhoff, Brian R.
2011-01-01
The “quantitative” ChIP, a tool commonly used to study protein-DNA interactions in cells and tissue, is a difficult assay often plagued with technical error. We present, herein, the process required to merge multiple protocols into a quick, reliable and easy method and an approach to accurately quantify ChIP DNA prior to performing PCR. We demonstrate that high intensity sonication for at least 30 min is required for full cellular disruption and maximum DNA recovery because ChIP lysis buffers fail to lyse formaldehyde-fixed cells. In addition, extracting ChIP DNA with chelex-100 yields samples that are too dilute for evaluation of shearing efficiency or quantification via nanospectrophotometry. However, DNA extracted from the Mock-ChIP supernatant via the phenol-chloroform-isoamyl alcohol (PCIA) method can be used to evaluate DNA shearing efficiency and used as the standard in a fluorescence-based microplate assay. This enabled accurate quantification of DNA in chelex-extracted ChIP samples and normalization to total DNA concentration prior to performing real-time PCR (rtPCR). Thus, a quick ChIP assay that can be completed in nine bench hours over two days has been validated along with a rapid, accurate and repeatable way to quantify ChIP DNA. The resulting rtPCR data more accurately depicts treatment effects on protein-DNA interactions of interest. PMID:22046253
Rizk, Mohamed Abdo; El-Sayed, Shimaa Abd El-Salam; Terkawi, Mohamed Alaa; Youssef, Mohamed Ahmed; El Said, El Said El Shirbini; Elsayed, Gehad; El-Khodery, Sabry; El-Ashker, Maged; Elsify, Ahmed; Omar, Mosaab; Salama, Akram; Yokoyama, Naoaki; Igarashi, Ikuo
2015-01-01
A rapid and accurate assay for evaluating antibabesial drugs on a large scale is required for the discovery of novel chemotherapeutic agents against Babesia parasites. In the current study, we evaluated the usefulness of a fluorescence-based assay for determining the efficacies of antibabesial compounds against bovine and equine hemoparasites in in vitro cultures. Three different hematocrits (HCTs; 2.5%, 5%, and 10%) were used without daily replacement of the medium. The results of a high-throughput screening assay revealed that the best HCT was 2.5% for bovine Babesia parasites and 5% for equine Babesia and Theileria parasites. The IC50 values of diminazene aceturate obtained by fluorescence and microscopy did not differ significantly. Likewise, the IC50 values of luteolin, pyronaridine tetraphosphate, nimbolide, gedunin, and enoxacin did not differ between the two methods. In conclusion, our fluorescence-based assay uses low HCT and does not require daily replacement of culture medium, making it highly suitable for in vitro large-scale drug screening against Babesia and Theileria parasites that infect cattle and horses.
Directory of Open Access Journals (Sweden)
Mohamed Abdo Rizk
Full Text Available A rapid and accurate assay for evaluating antibabesial drugs on a large scale is required for the discovery of novel chemotherapeutic agents against Babesia parasites. In the current study, we evaluated the usefulness of a fluorescence-based assay for determining the efficacies of antibabesial compounds against bovine and equine hemoparasites in in vitro cultures. Three different hematocrits (HCTs; 2.5%, 5%, and 10% were used without daily replacement of the medium. The results of a high-throughput screening assay revealed that the best HCT was 2.5% for bovine Babesia parasites and 5% for equine Babesia and Theileria parasites. The IC50 values of diminazene aceturate obtained by fluorescence and microscopy did not differ significantly. Likewise, the IC50 values of luteolin, pyronaridine tetraphosphate, nimbolide, gedunin, and enoxacin did not differ between the two methods. In conclusion, our fluorescence-based assay uses low HCT and does not require daily replacement of culture medium, making it highly suitable for in vitro large-scale drug screening against Babesia and Theileria parasites that infect cattle and horses.
Validation of a next-generation sequencing assay for clinical molecular oncology.
Cottrell, Catherine E; Al-Kateb, Hussam; Bredemeyer, Andrew J; Duncavage, Eric J; Spencer, David H; Abel, Haley J; Lockwood, Christina M; Hagemann, Ian S; O'Guin, Stephanie M; Burcea, Lauren C; Sawyer, Christopher S; Oschwald, Dayna M; Stratman, Jennifer L; Sher, Dorie A; Johnson, Mark R; Brown, Justin T; Cliften, Paul F; George, Bijoy; McIntosh, Leslie D; Shrivastava, Savita; Nguyen, Tudung T; Payton, Jacqueline E; Watson, Mark A; Crosby, Seth D; Head, Richard D; Mitra, Robi D; Nagarajan, Rakesh; Kulkarni, Shashikant; Seibert, Karen; Virgin, Herbert W; Milbrandt, Jeffrey; Pfeifer, John D
2014-01-01
Currently, oncology testing includes molecular studies and cytogenetic analysis to detect genetic aberrations of clinical significance. Next-generation sequencing (NGS) allows rapid analysis of multiple genes for clinically actionable somatic variants. The WUCaMP assay uses targeted capture for NGS analysis of 25 cancer-associated genes to detect mutations at actionable loci. We present clinical validation of the assay and a detailed framework for design and validation of similar clinical assays. Deep sequencing of 78 tumor specimens (≥ 1000× average unique coverage across the capture region) achieved high sensitivity for detecting somatic variants at low allele fraction (AF). Validation revealed sensitivities and specificities of 100% for detection of single-nucleotide variants (SNVs) within coding regions, compared with SNP array sequence data (95% CI = 83.4-100.0 for sensitivity and 94.2-100.0 for specificity) or whole-genome sequencing (95% CI = 89.1-100.0 for sensitivity and 99.9-100.0 for specificity) of HapMap samples. Sensitivity for detecting variants at an observed 10% AF was 100% (95% CI = 93.2-100.0) in HapMap mixes. Analysis of 15 masked specimens harboring clinically reported variants yielded concordant calls for 13/13 variants at AF of ≥ 15%. The WUCaMP assay is a robust and sensitive method to detect somatic variants of clinical significance in molecular oncology laboratories, with reduced time and cost of genetic analysis allowing for strategic patient management. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Bin Tang
Full Text Available B-cell leukemia/lymphoma 11B (Bcl11b is a transcription factor showing predominant expression in the striatum. To date, there are no known gene targets of Bcl11b in the nervous system. Here, we define targets for Bcl11b in striatal cells by performing chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq in combination with genome-wide expression profiling. Transcriptome-wide analysis revealed that 694 genes were significantly altered in striatal cells over-expressing Bcl11b, including genes showing striatal-enriched expression similar to Bcl11b. ChIP-seq analysis demonstrated that Bcl11b bound a mixture of coding and non-coding sequences that were within 10 kb of the transcription start site of an annotated gene. Integrating all ChIP-seq hits with the microarray expression data, 248 direct targets of Bcl11b were identified. Functional analysis on the integrated gene target list identified several zinc-finger encoding genes as Bcl11b targets, and further revealed a significant association of Bcl11b to brain-derived neurotrophic factor/neurotrophin signaling. Analysis of ChIP-seq binding regions revealed significant consensus DNA binding motifs for Bcl11b. These data implicate Bcl11b as a novel regulator of the BDNF signaling pathway, which is disrupted in many neurological disorders. Specific targeting of the Bcl11b-DNA interaction could represent a novel therapeutic approach to lowering BDNF signaling specifically in striatal cells.
The loss-of-allele assay for ES cell screening and mouse genotyping.
Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M
2010-01-01
Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction
Radioreceptor assay for insulin
Energy Technology Data Exchange (ETDEWEB)
Suzuki, Kazuo [Tokyo Univ. (Japan). Faculty of Medicine
1975-04-01
Radioreceptor assay of insulin was discussed from the aspects of the measuring method, its merits and problems to be solved, and its clinical application. Rat liver 10 x g pellet was used as receptor site, and enzymatic degradation of insulin by the system contained in this fraction was inhibited by adding 1 mM p-CMB. /sup 125/I-labelled porcine insulin was made by lactoperoxidase method under overnight incubation at 4/sup 0/C and later purification by Sephadex G-25 column and Whatman CF-11 cellulose powder. Dog pancreatic vein serum insulin during and after the glucose load was determined by radioreceptor assay and radioimmunoassay resulting that both measurements accorded considerably. Radioreceptor assay would clarify the pathology of disorders of glucose metabolism including diabetes.
Nano-immunosafety: issues in assay validation
International Nuclear Information System (INIS)
Boraschi, Diana; Italiani, Paola; Oostingh, Gertie J; Duschl, Albert; Casals, Eudald; Puntes, Victor F; Nelissen, Inge
2011-01-01
Assessing the safety of engineered nanomaterials for human health must include a thorough evaluation of their effects on the immune system, which is responsible for defending the integrity of our body from damage and disease. An array of robust and representative assays should be set up and validated, which could be predictive of the effects of nanomaterials on immune responses. In a trans-European collaborative work, in vitro assays have been developed to this end. In vitro tests have been preferred for their suitability to standardisation and easier applicability. Adapting classical assays to testing the immunotoxicological effects of nanoparticulate materials has raised a series of issues that needed to be appropriately addressed in order to ensure reliability of results. Besides the exquisitely immunological problem of selecting representative endpoints predictive of the risk of developing disease, assay results turned out to be significantly biased by artefactual interference of the nanomaterials or contaminating agents with the assay protocol. Having addressed such problems, a series of robust and representative assays have been developed that describe the effects of engineered nanoparticles on professional and non-professional human defence cells. Two of such assays are described here, one based on primary human monocytes and the other employing human lung epithelial cells transfected with a reporter gene.
Data transformation methods for multiplexed assays
Tammero, Lance F. Bentley; Dzenitis, John M; Hindson, Benjamin J
2013-07-23
Methods to improve the performance of an array assay are described. A correlation between fluorescence intensity-related parameters and negative control values of the assay is determined. The parameters are then adjusted as a function of the correlation. As a result, sensitivity of the assay is improved without changes in its specificity.
Spectrophotometric Enzyme Assays for High-Throughput Screening
Directory of Open Access Journals (Sweden)
Jean-Louis Reymond
2004-01-01
Full Text Available This paper reviews high-throughput screening enzyme assays developed in our laboratory over the last ten years. These enzyme assays were initially developed for the purpose of discovering catalytic antibodies by screening cell culture supernatants, but have proved generally useful for testing enzyme activities. Examples include TLC-based screening using acridone-labeled substrates, fluorogenic assays based on the β-elimination of umbelliferone or nitrophenol, and indirect assays such as the back-titration method with adrenaline and the copper-calcein fluorescence assay for aminoacids.
Brychkova, Galina; Yarmolinsky, Dmitry; Sagi, Moshe
2012-09-01
Adenosine 5'-phosphosulfate (APS) reductase (APR; EC 1.8.4.9) catalyzes the two-electron reduction of APS to sulfite and AMP, a key step in the sulfate assimilation pathway in higher plants. In spite of the importance of this enzyme, methods currently available for detection of APR activity rely on radioactive labeling and can only be performed in a very few specially equipped laboratories. Here we present two novel kinetic assays for detecting in vitro APR activity that do not require radioactive labeling. In the first assay, APS is used as substrate and reduced glutathione (GSH) as electron donor, while in the second assay APS is replaced by an APS-regenerating system in which ATP sulfurylase catalyzes APS in the reaction medium, which employs sulfate and ATP as substrates. Both kinetic assays rely on fuchsin colorimetric detection of sulfite, the final product of APR activity. Incubation of the desalted protein extract, prior to assay initiation, with tungstate that inhibits the oxidation of sulfite by sulfite oxidase activity, resulted in enhancement of the actual APR activity. The reliability of the two methods was confirmed by assaying leaf extract from Arabidopsis wild-type and APR mutants with impaired or overexpressed APR2 protein, the former lacking APR activity and the latter exhibiting much higher activity than the wild type. The assays were further tested on tomato leaves, which revealed a higher APR activity than Arabidopsis. The proposed APR assays are highly specific, technically simple and readily performed in any laboratory.
Radioenzymatic assay of DOPA (3,4-dihydroxyphenylalanine)
International Nuclear Information System (INIS)
Johnson, G.A.; Gren, J.M.; Kupiecki, R.
1978-01-01
We modified the single-isotope radioenzymatic assay for catecholamines [Life Sci. 21, 625(1977)] to assay 3,4-dihydroxyphenylalanine (DOPA). DOPA decarboxylase is used to convert DOPA to dopamine, which concurrently is converted to [ 3 H]-3-O-methyldopamine in the presence of catechol-O-methyltransferase and [methyl- 3 H]-S-adenosylmethionine and assayed radioenzymatically. For assay of plasma DOPA, 50 μl of untreated plasma is added directly into the incubation mixture. A duplicate mixture containing an internal standard requires a second 50-μl aliquot of plasma. Because the assay measures both DOPA and endogenous dopamine, two additional aliquots of plasma must be assayed for dopamine in the absence of the decarboxylase by the differential assay; DOPA is estimated by difference. The assay is sensitive to 25 pg (500 ng/liter of plasma). Analysis of DOPA (DOPA plus dopamine) and the concurrent differential assay of catecholamines in at least 10 samples can be done in a single working day. Plasma DOPA concentrations for 42 normotensive adults were 1430 +- 19 ng/liter (mean +- SEM). In contrast, dopamine concentrations for these same subjects averaged 23 +- 20 ng/liter. Values for the 24 women subjects (1510 +- 62 ng/liter) significantly (P = 0.04) exceeded those for the men
Directory of Open Access Journals (Sweden)
Amjad Hossain
2010-01-01
Full Text Available Human sperm assay (HSA is a preferred in house quality control and proficiency test (PT practiced in fertility laboratories. HSA is performed over varying durations, apparently without following set criteria. To better understand the assay time required for reprotoxicity testing in embryo culture media, we compared American-Association-of-Bioanalysts-(AAB- administered HSA data to our own assay performed using PT samples obtained from AAB. Participating laboratories were required to culture sperm for 48 hours to determine media acceptability. Conclusions drawn from 48- and 24-hour observations were the same, suggesting that HSA could identify reprotoxic media in less time than required by AAB. Our assay revealed that changes in motility grade in adulterated media are significantly different from those in control media. Furthermore, grade changes can be identified earlier than differences in motility loss between samples. Analyzing motility and motility quality together provides a method for establishing an optimal time for HSA.
Xu, Yan; Hadjiargyrou, M; Rafailovich, Miriam; Mironava, Tatsiana
2017-07-11
Increasing production of nanomaterials requires fast and proper assessment of its potential toxicity. Therefore, there is a need to develop new assays that can be performed in vitro, be cost effective, and allow faster screening of engineered nanomaterials (ENMs). Herein, we report that titanium dioxide (TiO 2 ) nanoparticles (NPs) can induce damage to adipose derived stromal cells (ADSCs) at concentrations which are rated as safe by standard assays such as measuring proliferation, reactive oxygen species (ROS), and lactate dehydrogenase (LDH) levels. Specifically, we demonstrated that low concentrations of TiO 2 NPs, at which cellular LDH, ROS, or proliferation profiles were not affected, induced changes in the ADSCs secretory function and differentiation capability. These two functions are essential for ADSCs in wound healing, energy expenditure, and metabolism with serious health implications in vivo. We demonstrated that cytotoxicity assays based on specialized cell functions exhibit greater sensitivity and reveal damage induced by ENMs that was not otherwise detected by traditional ROS, LDH, and proliferation assays. For proper toxicological assessment of ENMs standard ROS, LDH, and proliferation assays should be combined with assays that investigate cellular functions relevant to the specific cell type.
High-performance liquid chromatographic radioenzymatic assay for plasma catecyholamines
International Nuclear Information System (INIS)
Klaniecki, T.S.; Corder, C.N.; McDonald, R.H. Jr.; Feldman, J.A.
1977-01-01
A new assay method for plasma catecholamimes (CA) requiring only 50 μl has been developed, which uses high performance liquid chromatography (HPLC). The norepinephrine (NE), dopamine (D), and epinephrine (E) compounds found in plasma are radioactively o-methylated with S-[methyl- 3 H]-adenosyl-L-methionine ( 3 H-SAM) 3 H-SAM by the reaction of catechol-o-methyl transferase (COMT). The reaction is terminated and a standard mixture of nonradioactive o-methylated analogues of NE, D, and E is added to act as a carrier. Following separation by HPLC, the D,L-normetanephrine (NMN), 3-methoxy-4-hydroxyphenylethyl-amine or 3-methoxytyramine (3-MOT), and metanephrine (MN) radioactive peaks are collected which represent NE, D, and E, respectively. Then MNM and MN are oxidized to vanillin, and 3-MOT is acetylated. The products are subsequently separated by solvent extraction. This is necessary in order to avoid high radioactive blanks and to allow quantitation of the radioactivity by liquid scintillation spectrometry. The mean supine levels of NE, D, and E in normal subjects were respectively 182, 33, and 87 pg/ml of plasma. Similar assays on patients with pheochromocytoma revealed 797, 80, and 470 pg/ml
The fluorometric microculture cytotoxicity assay.
Lindhagen, Elin; Nygren, Peter; Larsson, Rolf
2008-01-01
The fluorometric microculture cytotoxicity assay (FMCA) is a nonclonogenic microplate-based cell viability assay used for measurement of the cytotoxic and/or cytostatic effect of different compounds in vitro. The assay is based on hydrolysis of the probe, fluorescein diacetate (FDA) by esterases in cells with intact plasma membranes. The assay is available as both a semiautomated 96-well plate setup and a 384-well plate version fully adaptable to robotics. Experimental plates are prepared with a small amount of drug solution and can be stored frozen. Cells are seeded on the plates and cell viability is evaluated after 72 h. The protocol described here is applicable both for cell lines and freshly prepared tumor cells from patients and is suitable both for screening in drug development and as a basis for a predictive test for individualization of anticancer drug therapy.
Solution assay instrument operations manual
International Nuclear Information System (INIS)
Li, T.K.; Marks, T.; Parker, J.L.
1983-09-01
An at-line solution assay instrument (SAI) has been developed and installed in a plutonium purification and americium recovery process area in the Los Alamos Plutonium Processing Facility. The instrument was designed for accurate, timely, and simultaneous nondestructive analysis of plutonium and americium in process solutions that have a wide range of concentrations and americium/plutonium ratios and for routine operation by process technicians who lack instrumentation background. The SAI, based on transmission-corrected, high-resolution gamma-ray spectroscopy, has two measurement stations attached to a single multichannel analyzer/computer system. To ensure the quality of assay results, the SAI has an internal measurement control program, which requires daily and weekly check runs and monitors key aspects of all assay runs. For a 25-ml sample, the assay precision is 5 g/l within a 2000-s count time
Making transuranic assay measurements using modern controllers
International Nuclear Information System (INIS)
Kuckertz, T.H.; Caldwell, J.T.; Medvick, P.A.; Kunz, W.E.; Hastings, R.D.
1987-01-01
This paper describes methodology and computer-controlled instrumentation developed at the Los Alamos National Laboratory that accurately performs nondestructive assays of large containers bearing transuranic wastes and nonradioactive matrix materials. These assay systems can measure fissile isotopes with 1-mg sensitivity and spontaneous neutron-emitting isotopes at a 10-mg sensitivity. The assays are performed by neutron interrogation, detection, and counting in a custom assay chamber. An International Business Machines Personal Computer (IBM-PC) is used to control the CAMAC-based instrumentation system that acquires the assay data. 6 refs., 7 figs
Time-resolved immunofluorometric assay of serum ferritin
Energy Technology Data Exchange (ETDEWEB)
Yan, Yao [China Inst. of Atomic Energy, Beijing (China)
2007-06-15
This assay is a solid phase, two-site fluoroimmunometric assay based on the direct sandwish technique. Standards or samples containing ferritin are first reacted with immobilized anti-ferritin antibodies. Then the europium-lablled antibodies are reacted with the bound antigen. The range of this assay is 2-1000 ng/mL. The analytical sentivity is better than 0.05 ng/mL. The intra-assay variation and inter-assay variation are both below 5%; This kit was compared with Wallac DELFIA kit. The correlation is r=0.96. (authors)
International Nuclear Information System (INIS)
Hart, H.
1980-01-01
In a method of immunological assay two different classes of particles which interact at short distances to produce characteristic detectable signals are employed in a modification of the usual latex fixation test. In one embodiment an aqueous suspension of antigen coated tritiated latex particles (LH) and antigen coated polystyrene scintillant particles (L*) is employed to assay antibody in the aqueous medium. The amount of (LH) (L*) dimer formation and higher order aggregation induced and therefore the concentration of antibody (or antigen) present which caused the aggregation can be determined by using standard liquid scintillation counting equipment. (author)
Reg IV is a direct target of intestinal transcriptional factor CDX2 in gastric cancer.
Directory of Open Access Journals (Sweden)
Yutaka Naito
Full Text Available REG4, which encodes Reg IV protein, is a member of the calcium-dependent lectin superfamily and potent activator of the epidermal growth factor receptor/Akt/activator protein-1 signaling pathway. Several human cancers overexpress Reg IV, and Reg IV expression is associated with intestinal phenotype differentiation. However, regulation of REG4 transcription remains unclear. In the present study, we investigated whether CDX2 regulates Reg IV expression in gastric cancer (GC cells. Expression of Reg IV and CDX2 was analyzed by Western blot and quantitative reverse transcription-polymerase chain reaction in 9 GC cell lines and 2 colon cancer cell lines. The function of the 5'-flanking region of the REG4 gene was characterized by luciferase assay. In 9 GC cell lines, endogenous Reg IV and CDX2 expression were well correlated. Using an estrogen receptor-regulated form of CDX2, rapid induction of Reg IV expression was observed in HT-29 cells. Reporter gene assays revealed an important role in transcription for consensus CDX2 DNA binding elements in the 5'-flanking region of the REG4 gene. Chromatin immunoprecipitation assays showed that CDX2 binds directly to the 5'-flanking region of REG4. These results indicate that CDX2 protein directly regulates Reg IV expression.
Bacteriophage amplification assay for detection of Listeria spp. using virucidal laser treatment
Directory of Open Access Journals (Sweden)
I.C. Oliveira
2012-09-01
Full Text Available A protocol for the bacteriophage amplification technique was developed for quantitative detection of viable Listeria monocytogenes cells using the A511 listeriophage with plaque formation as the end-point assay. Laser and toluidine blue O (TBO were employed as selective virucidal treatment for destruction of exogenous bacteriophage. Laser and TBO can bring a total reduction in titer phage (ca. 10(8 pfu/mL without affecting the viability of L. monocytogenes cells. Artificially inoculated skimmed milk revealed mean populations of the bacteria as low as between 13 cfu/mL (1.11 log cfu/mL, after a 10-h assay duration. Virucidal laser treatment demonstrated better protection of Listeria cells than the other agents previously tested. The protocol was faster and easier to perform than standard procedures. This protocol constitutes an alternative for rapid, sensitive and quantitative detection of L. monocytogenes.
Abramovič, Helena; Grobin, Blaž; Poklar, Nataša; Cigić, Blaž
2017-06-01
Antioxidant potential (AOP) is not only the property of the matrix analyzed but also depends greatly on the methodology used. The chromogenic radicals 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS•+), 2,2-diphenyl-1-picrylhydrazyl (DPPH•) and Folin-Ciocalteu (FC) assay were applied to estimate how the method and the composition of the assay solvent influence the AOP determined for coffee, tea, beer, apple juice and dietary supplements. Large differences between the AOP values depending on the reaction medium were observed, with the highest AOP determined mostly in the FC assay. In reactions with chromogenic radicals several fold higher values of AOP were obtained in buffer pH 7.4 than in water or methanol. The type of assay and solvent composition have similar influences on the reactivity of a particular antioxidant, either pure or as part of a complex matrix. The reaction kinetics of radicals with antioxidants in samples reveals that AOP depends strongly on incubation time, yet differently for each sample analyzed and the assay applied.
Energy Technology Data Exchange (ETDEWEB)
Vrijsen, R.; Rombaut, B.; Boeye, A. (Brussels Univ. (Belgium))
1983-04-29
Staphylococcus aureus (Cowan strain I) was used to absorb immune complexes from antiserum to poliovirus to which labeled N or H poliovirus antigens had been added, and the radioactivity in the pelleted organisms and in the supernatant was measured. Excellent agreement was obtained between values calculated separately from the pellet and supernatant readings, validating the use of supernatant measurements from a microtitration plate method.
Assessing sediment contamination using six toxicity assays
Directory of Open Access Journals (Sweden)
Allen G. BURTON Jr.
2001-08-01
Full Text Available An evaluation of sediment toxicity at Lake Orta, Italy was conducted to compare a toxicity test battery of 6 assays and to evaluate the extent of sediment contamination at various sediment depths. Lake Orta received excessive loadings of copper and ammonia during the 1900’s until a large remediation effort was conducted in 1989-90 using lime addition. Since that time, the lake has shown signs of a steady recovery of biological communities. The study results showed acute toxicity still exists in sediments at a depth of 5 cm and greater. Assays that detected the highest levels of toxicity were two whole sediment exposures (7 d using Hyalella azteca and Ceriodaphnia dubia. The MicrotoxR assay using pore water was the third most sensitive assay. The Thamnotox, Rototox, Microtox solid phase, and Seed Germination-Root Elongation (pore and solid phase assays showed occasional to no toxicity. Based on similarity of responses and assay sensitivity, the two most useful assays were the C. dubia (or H. azteca and Microtox pore water. These assays were effective at describing sediment toxicity in a weight-of-evidence approach.
Li, Juan; Jiang, Jiafu; Qian, Qian; Xu, Yunyuan; Zhang, Cui; Xiao, Jun; Du, Cheng; Luo, Wei; Zou, Guoxing; Chen, Mingluan; Huang, Yunqing; Feng, Yuqi; Cheng, Zhukuan; Yuan, Ming; Chong, Kang
2011-01-01
The kinesins are a family of microtubule-based motor proteins that move directionally along microtubules and are involved in many crucial cellular processes, including cell elongation in plants. Less is known about kinesins directly regulating gene transcription to affect cellular physiological processes. Here, we describe a rice (Oryza sativa) mutant, gibberellin-deficient dwarf1 (gdd1), that has a phenotype of greatly reduced length of root, stems, spikes, and seeds. This reduced length is due to decreased cell elongation and can be rescued by exogenous gibberellic acid (GA3) treatment. GDD1 was cloned by a map-based approach, was expressed constitutively, and was found to encode the kinesin-like protein BRITTLE CULM12 (BC12). Microtubule cosedimentation assays revealed that BC12/GDD1 bound to microtubules in an ATP-dependent manner. Whole-genome microarray analysis revealed the expression of ent-kaurene oxidase (KO2), which encodes an enzyme involved in GA biosynthesis, was downregulated in gdd1. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that GDD1 bound to the element ACCAACTTGAA in the KO2 promoter. In addition, GDD1 was shown to have transactivation activity. The level of endogenous GAs was reduced in gdd1, and the reorganization of cortical microtubules was altered. Therefore, BC12/GDD1, a kinesin-like protein with transcription regulation activity, mediates cell elongation by regulating the GA biosynthesis pathway in rice. PMID:21325138
Screening and identification of host factors interacting with UL14 of herpes simplex virus 1.
Wu, Fuqing; Xing, Junji; Wang, Shuai; Li, Meili; Zheng, Chunfu
2011-08-01
The UL14 protein of herpes simplex virus type 1 (HSV-1) is highly conserved in herpesvirus family. However, its exact function during the HSV-1 replication cycle is little known. In the present study, a high throughput yeast two-hybrid system was employed to screen the cellular factors interacting with UL14, and five target candidates were yielded: (1) TSC22 domain family protein 3 (TSC22D3); (2) Mediator of RNA polymerase II transcription subunit 8 isoform 1(MED8); (3) Runt-related transcription factor 3 (RUNX3); (4) Arrestin beta-2 (ARRB2); (5) Cereblon (CRBN). Indirect immunofluorescent assay showed that both TSC22D3 and MED8 co-localized with UL14. Co-immunoprecipitation assay demonstrated that UL14 could be immunoprecipitated by TSC22D3, suggesting that UL14 interacted with TSC22D3 under physiological condition. In summary, this study opened up new avenues toward delineating the function and physiological significance of UL14 during the HSV-1 replication cycle.
Pinon, J M; Thoannes, H; Gruson, N
1985-02-28
Enzyme-linked immuno-filtration assay is carried out on a micropore membrane. This doubly analytical technique permits simultaneous study of antibody specificity by immunoprecipitation and characterisation of antibody isotypes by immuno-filtration with enzyme-labelled antibodies. Recognition of the same T. gondii antigenic constituent by IgG, IgA, IgM or IgE antibodies produces couplets (IgG-IgM; IgG-IgA) or triplets (IgG-IgM-IgA; IgG-IgM-IgE) which identify the functional fractions of the toxoplasmosis antigen. In acquired toxoplasmosis, the persistence of IgM antibody long after infestation puts in question the implication of recent infestation normally linked to detection of this isotype. For sera of comparable titres, comparison of immunological profiles by the method described demonstrates disparities in the composition of the specific antibody content as expressed in international units. Use of the same method to detect IgM antibodies or distinguish between transmitted maternal IgG and IgG antibodies synthesised by the foetus or neonate makes a diagnosis of congenital toxoplasmosis possible in 85% of cases during the first few days of life. With the method described the diagnosis may be made on average 5 months earlier than with classical techniques. In the course of surveillance for latent congenital toxoplasmosis, the appearance of IgM or IgE antibodies raises the possibility of complications (hydrocephalus, chorioretinitis). After cessation of treatment, a rise in IgG antibodies indicating persistence of infection is detected earlier by the present than by classical methods.
Directory of Open Access Journals (Sweden)
Lauren Forbes
Full Text Available Mycobacterium tuberculosis (Mtb is well-established to be one of the most important bacterial pathogens for which new antimicrobial therapies are needed. Herein, we describe the development of a high throughput screening assay for the identification of molecules that are bactericidal against Mycobacteria. The assay utilizes the release of the intracellular enzyme adenylate kinase into the culture medium as a reporter of mycobacterial cell death. We demonstrate that the assay is selective for mycobactericidal molecules and detects anti-mycobacterial activity at concentrations below the minimum inhibitory concentration of many molecules. Thus, the AK assay is more sensitive than traditional growth assays. We have validated the AK assay in the HTS setting using the Mtb surrogate organism M. smegmatis and libraries of FDA approved drugs as well as a commercially available Diversity set. The screen of the FDA-approved library demonstrated that the AK assay is able to identify the vast majority of drugs with known mycobactericidal activity. Importantly, our screen of the Diversity set revealed that the increased sensitivity of the AK assay increases the ability of M. smegmatis-based screens to detect molecules with relatively poor activity against M. smegmatis but good to excellent activity against Mtb.
A multiwell format assay for heparanase.
Behzad, Farhad; Brenchley, Paul E C
2003-09-15
This assay employs a biotinylated heparan sulfate glycosaminoglycan (HSGAG) substrate that is covalently linked to the surface of 96-well immunoassay plates. The ratio of biotin:HSGAG and the coating concentration of substrate bound to the wells have been optimized and allow removal of biotin HSGAG within 60 min of incubation at 37 degrees C in assay buffer with a standard dilution of bacterial heparitinase or platelet heparanase. Loss of biotin signal from the well surface is detected on incubation with peroxidase-streptavidin followed by color development using 3,3',5,5'-tetramethylbenzidine as the peroxidase substrate. The new assay allows specific detection of heparanase activity in multiple samples in a total time of 3 h including a 1-h substrate digestion step and is a significant improvement with regard to sensitivity, specificity, and ease of handling of multiple samples compared to other described assays. Heparanase specifically degrades the biotinylated HSGAG substrate, when used with an optimized assay buffer. A range of enzymes including collagenase, trypsin, plasmin, pepsin, chondroitinases, hyaluronidase, and neuraminidase show no effect on the substrate under optimized assay conditions. The covalent linkage of the substrate to the well prevents leaching of substrate and allows preparation and long-term storage of substrate-coated plates. The assay can be used to detect heparanase levels in clinical samples and cell culture supernatants and is ideal as a screening method for antagonists of enzyme activity.
A quantitative comet infection assay for influenza virus
Lindsay, Stephen M.; Timm, Andrea; Yin, John
2011-01-01
Summary The virus comet assay is a cell-based virulence assay used to evaluate an antiviral drug or antibody against a target virus. The comet assay differs from the plaque assay in allowing spontaneous flows in 6-well plates to spread virus. When implemented quantitatively the comet assay has been shown to have an order-of-magnitude greater sensitivity to antivirals than the plaque assay. In this study, a quantitative comet assay for influenza virus is demonstrated, and is shown to have a 13-fold increase in sensitivity to ribavirin. AX4 cells (MDCK cells with increased surface concentration of α2–6 sialic acid, the influenza virus receptor) have reduced the comet size variability relative to MDCK cells, making them a better host cell for use in this assay. Because of enhanced antiviral sensitivity in flow-based assays, less drug is required, which could lead to lower reagent costs, reduced cytotoxicity, and fewer false-negative drug screen results. The comet assay also serves as a readout of flow conditions in the well. Observations from comets formed at varying humidity levels indicate a role for evaporation in the mechanism of spontaneous fluid flow in wells. PMID:22155578
Development of a surrogate angiogenic potency assay for clinical-grade stem cell production.
Lehman, Nicholas; Cutrone, Rochelle; Raber, Amy; Perry, Robert; Van't Hof, Wouter; Deans, Robert; Ting, Anthony E; Woda, Juliana
2012-09-01
Clinical results from acute myocardial infarction (AMI) patients treated with MultiStem®, a large-scale expanded adherent multipotent progenitor cell population (MAPC), have demonstrated a strong safety and benefit profile for these cells. The mechanism of benefit with MAPC treatment is a result, in part, of its ability to induce neovascularization through trophic support. Production of clinical-grade stem cell products requires the development of lot-release criteria based on potency assays that directly reflect the fundamental mechanistic pathway underlying the therapeutic response to verify manufacturing process consistency and product potency. Using an in vitro endothelial tube formation assay, a potency assay has been developed that reflects MAPC pro-angiogenic activity. Serum-free conditioned media collected from MAPC culture induced endothelial tube formation. A proteomic survey of angiogenic factors produced by the cells in vitro revealed candidate factors linked to angiogenic potency. Three cytokines, chemokine (C-X-C motif) ligand 5 (CXCL5), interleukin 8 (IL-8) and vascular endothelial growth factor (VEGF), were required for this angiogenic activity. Depletion of any of these factors from the media prevented tube formation, while adding back increasing amounts of these cytokines into the depleted serum-free conditioned media established the lower limits of each of the cytokines required to induce angiogenesis. A necessary threshold of angiogenic factor expression was established using an in vitro angiogenesis assay. By correlating the levels of the cytokines required to induce tube formation in vitro with levels of the factors found in the spent media from manufacturing production runs, detection of these factors was identified as a surrogate potency assay with defined pass/fail criteria.
Assay development status report for total cyanide
International Nuclear Information System (INIS)
Simpson, B.C.; Jones, T.E.; Pool, K.H.
1993-02-01
A validated cyanide assay that is applicable to a variety of tank waste matrices is necessary to resolve certain waste tank safety issues and for purposes of overall waste characterization. The target for this effort is an assay with an applicable range of greater than 1,000 ppM (0.10 wt%) total cyanide and a confidence level greater than 80%. Figure 1 illustrates the operating regime of the proposed cyanide assay method. The Assay Development Status Report for Total Cyanide will summarize the past experience with cyanide analyses on-tank waste matrices and will rate the status of the analytical methods used to assay total cyanide (CN - ion) in the tank waste matrices as acceptable or unacceptable. This paper will also briefly describe the current efforts for improving analytical resolution of the assays and the attempts at speciation
Prospects for cellular mutational assays in human populations
International Nuclear Information System (INIS)
Mendelsohn, M.L.
1984-01-01
Practical, sensitive, and effective human cellular assays for detecting somatic and germinal mutations would have great value in environmental mutagenesis and carcinogenesis studies. Such assays would fill the void between human mutagenicity and the data that exist from short-term tests and from mutagenicity in other species. This paper discusses the following possible human cellular assays: (1) HPRT (hypoxanthine phosphoribosyltransferase) somatic cell mutation based on 6-thioguanine resistance; (2) hemoglobin somatic cell mutation assay; (3) glycophorin somatic cell mutation assay; and (4) LDH-X sperm cell mutation assay. 18 references
Prospects for cellular mutational assays in human populations
Energy Technology Data Exchange (ETDEWEB)
Mendelsohn, M.L.
1984-06-29
Practical, sensitive, and effective human cellular assays for detecting somatic and germinal mutations would have great value in environmental mutagenesis and carcinogenesis studies. Such assays would fill the void between human mutagenicity and the data that exist from short-term tests and from mutagenicity in other species. This paper discusses the following possible human cellular assays: (1) HPRT (hypoxanthine phosphoribosyltransferase) somatic cell mutation based on 6-thioguanine resistance; (2) hemoglobin somatic cell mutation assay; (3) glycophorin somatic cell mutation assay; and (4) LDH-X sperm cell mutation assay. 18 references.
A radiochemical assay for biotin in biological materials
International Nuclear Information System (INIS)
Hood, R.L.
1975-01-01
A radiochemical assay for biotin is described. The assay was sensitive to one nanogram and simple enough for routine biotin analyses. The assay yielded results which were comparable to those obtained from a microbiological assay using Lactobacillus plantarum. (author)
Seevaratnam, Rajini; Patel, Barkha P; Hamadeh, Mazen J
2009-06-01
The Lowry and Bradford assays are the most commonly used methods of total protein quantification, yet vary in several aspects. To date, no comparisons have been made in skeletal muscle. We compared total protein concentrations of mouse red and white gastrocnemius, reagent stability, protein stability and range of linearity using both assays. The Lowry averaged protein concentrations 15% higher than the Bradford with a moderate correlation (r = 0.36, P = 0.01). However, Bland-Altman analysis revealed considerable bias (15.8 +/- 29.7%). Both Lowry reagents and its protein-reagent interactions were less stable over time than the Bradford. The linear range of concentration was smaller for the Lowry (0.05-0.50 mg/ml) than the Bradford (0-2.0 mg/ml). We conclude that the Bradford and Lowry measures of total protein concentration in skeletal muscle are not interchangeable. The Bradford and Lowry assays have various strengths and weaknesses in terms of substance interference and protein size. However, the Bradford provides greater reagent stability, protein-reagent stability and range of linearity, and requires less time to analyse compared to the Lowry assay.
Nichol, C; Masterson, W J
1987-08-01
When antigens prepared by detergent washes of Strongylus vulgaris and Parascaris equorum were probed in an enzyme-linked immunosorbent assay test with horse sera from single species infections of S. vulgaris and P. equorum, a high degree of cross-reaction between the species was demonstrated. Western blot analysis of four common horse nematode species showed a large number of common antigens when probed with horse infection sera. Antisera raised in rabbits against the four species, including S. vulgaris, were also found to cross-react considerably. Rabbit anti-S. vulgaris sera were affinity adsorbed over a series of affinity chromatography columns, bound with cross-reactive surface antigens, to obtain S. vulgaris-specific antisera and thereby identify S. vulgaris-specific antigens by Western blotting. These studies revealed potentially specific antigens of apparent molecular weights of 100,000, 52,000, and 36,000. Of these bands, only the 52 kDa and 36 kDa appeared to be found on the surface as judged by 125I-labelling of intact worms by the Iodogen method, although neither protein was immunoprecipitated by horse infection sera. Finally, immunoprecipitation of in vitro translated proteins derived from larval S. vulgaris RNA suggests that two proteins may be parasite-derived. These findings are discussed both with respect to the surface of S. vulgaris and to the use of these species-specific antigens in immunodiagnosis.
The Notch ligand Delta-like 1 integrates inputs from TGFbeta/Activin and Wnt pathways
Energy Technology Data Exchange (ETDEWEB)
Bordonaro, Michael, E-mail: mbordonaro@tcmedc.org; Tewari, Shruti, E-mail: stewari@tcmedc.org; Atamna, Wafa, E-mail: watamna@tcmedc.org; Lazarova, Darina L., E-mail: dlazarova@tcmedc.org
2011-06-10
Unlike the well-characterized nuclear function of the Notch intracellular domain, it has been difficult to identify a nuclear role for the ligands of Notch. Here we provide evidence for the nuclear function of the Notch ligand Delta-like 1 in colon cancer (CC) cells exposed to butyrate. We demonstrate that the intracellular domain of Delta-like 1 (Dll1icd) augments the activity of Wnt signaling-dependent reporters and that of the promoter of the connective tissue growth factor (CTGF) gene. Data suggest that Dll1icd upregulates CTGF promoter activity through both direct and indirect mechanisms. The direct mechanism is supported by co-immunoprecipitation of endogenous Smad2/3 proteins and Dll1 and by chromatin immunoprecipitation analyses that revealed the occupancy of Dll1icd on CTGF promoter sequences containing a Smad binding element. The indirect upregulation of CTGF expression by Dll1 is likely due to the ability of Dll1icd to increase Wnt signaling, a pathway that targets CTGF. CTGF expression is induced in butyrate-treated CC cells and results from clonal growth assays support a role for CTGF in the cell growth-suppressive role of butyrate. In conclusion, integration of the Notch, Wnt, and TGFbeta/Activin signaling pathways is in part mediated by the interactions of Dll1 with Smad2/3 and Tcf4.
Linearization of the Bradford Protein Assay
Ernst, Orna; Zor, Tsaffrir
2010-01-01
Determination of microgram quantities of protein in the Bradford Coomassie brilliant blue assay is accomplished by measurement of absorbance at 590 nm. This most common assay enables rapid and simple protein quantification in cell lysates, cellular fractions, or recombinant protein samples, for the purpose of normalization of biochemical measurements. However, an intrinsic nonlinearity compromises the sensitivity and accuracy of this method. It is shown that under standard assay conditions, t...
New automated pellet/powder assay system
International Nuclear Information System (INIS)
Olsen, R.N.
1975-01-01
This paper discusses an automated, high precision, pellet/ powder assay system. The system is an active assay system using a small isotopic neutron source and a coincidence detection system. The handling of the pellet powder samples has been automated and a programmable calculator has been integrated into the system to provide control and data analysis. The versatile system can assay uranium or plutonium in either active or passive modes
Passive nondestructive assay of nuclear materials
International Nuclear Information System (INIS)
Reilly, D.; Ensslin, N.; Smith, H. Jr.; Kreiner, S.
1991-03-01
The term nondestructive assay (NDA) is applied to a series of measurement techniques for nuclear fuel materials. The techniques measure radiation induced or emitted spontaneously from the nuclear material; the measurements are nondestructive in that they do not alter the physical or chemical state of the nuclear material. NDA techniques are characterized as passive or active depending on whether they measure radiation from the spontaneous decay of the nuclear material or radiation induced by an external source. This book emphasizes passive NDA techniques, although certain active techniques like gamma-ray absorption densitometry and x-ray fluorescence are discussed here because of their intimate relation to passive assay techniques. The principal NDA techniques are classified as gamma-ray assay, neutron assay, and calorimetry. Gamma-ray assay techniques are treated in Chapters 1--10. Neutron assay techniques are the subject of Chapters 11--17. Chapters 11--13 cover the origin of neutrons, neutron interactions, and neutron detectors. Chapters 14--17 cover the theory and applications of total and coincidence neutron counting. Chapter 18 deals with the assay of irradiated nuclear fuel, which uses both gamma-ray and neutron assay techniques. Chapter 19 covers perimeter monitoring, which uses gamma-ray and neutron detectors of high sensitivity to check that no unauthorized nuclear material crosses a facility boundary. The subject of Chapter 20 is attribute and semiquantitative measurements. The goal of these measurements is a rapid verification of the contents of nuclear material containers to assist physical inventory verifications. Waste and holdup measurements are also treated in this chapter. Chapters 21 and 22 cover calorimetry theory and application, and Chapter 23 is a brief application guide to illustrate which techniques can be used to solve certain measurement problems
Development and characterization of a high density SNP genotyping assay for cattle.
Directory of Open Access Journals (Sweden)
Lakshmi K Matukumalli
Full Text Available The success of genome-wide association (GWA studies for the detection of sequence variation affecting complex traits in human has spurred interest in the use of large-scale high-density single nucleotide polymorphism (SNP genotyping for the identification of quantitative trait loci (QTL and for marker-assisted selection in model and agricultural species. A cost-effective and efficient approach for the development of a custom genotyping assay interrogating 54,001 SNP loci to support GWA applications in cattle is described. A novel algorithm for achieving a compressed inter-marker interval distribution proved remarkably successful, with median interval of 37 kb and maximum predicted gap of <350 kb. The assay was tested on a panel of 576 animals from 21 cattle breeds and six outgroup species and revealed that from 39,765 to 46,492 SNP are polymorphic within individual breeds (average minor allele frequency (MAF ranging from 0.24 to 0.27. The assay also identified 79 putative copy number variants in cattle. Utility for GWA was demonstrated by localizing known variation for coat color and the presence/absence of horns to their correct genomic locations. The combination of SNP selection and the novel spacing algorithm allows an efficient approach for the development of high-density genotyping platforms in species having full or even moderate quality draft sequence. Aspects of the approach can be exploited in species which lack an available genome sequence. The BovineSNP50 assay described here is commercially available from Illumina and provides a robust platform for mapping disease genes and QTL in cattle.
Tait, Brian D.
2016-01-01
This review outlines the development of human leukocyte antigen (HLA) antibody detection assays and their use in organ transplantation in both antibody screening and crossmatching. The development of sensitive solid phase assays such as the enzyme-linked immunosorbent assay technique, and in particular the bead-based technology has revolutionized this field over the last 10–15 years. This revolution however has created a new paradigm in clinical decision making with respect to the detection of low level pretransplant HLA sensitization and its clinical relevance. The relative sensitivities of the assays used are discussed and the relevance of conflicting inter-assay results. Each assay has its advantages and disadvantages and these are discussed. Over the last decade, the bead-based assay utilizing the Luminex® fluorocytometer instrument has become established as the “gold standard” for HLA antibody testing. However, there are still unresolved issues surrounding this technique, such as the presence of denatured HLA molecules on the beads which reveal cryptic epitopes and the issue of appropriate fluorescence cut off values for positivity. The assay has been modified to detect complement binding (CB) in addition to non-complement binding (NCB) HLA antibodies although the clinical relevance of the CB and NCB IgG isotypes is not fully resolved. The increase sensitivity of the Luminex® bead assay over the complement-dependent cytotoxicity crossmatch has permitted the concept of the “virtual crossmatch” whereby the crossmatch is predicted to a high degree of accuracy based on the HLA antibody specificities detected by the solid phase assay. Dialog between clinicians and laboratory staff on an individual patient basis is essential for correct clinical decision making based on HLA antibody results obtained by the various techniques. PMID:28018342
Creton, Stuart; Aardema, Marilyn J.; Carmichael, Paul L.; Harvey, James S.; Martin, Francis L.; Newbold, Robert F.; O’Donovan, Michael R.; Pant, Kamala; Poth, Albrecht; Sakai, Ayako; Sasaki, Kiyoshi; Scott, Andrew D.; Schechtman, Leonard M.; Shen, Rhine R.; Tanaka, Noriho; Yasaei, Hemad
2012-01-01
Cell transformation assays (CTAs) have long been proposed as in vitro methods for the identification of potential chemical carcinogens. Despite showing good correlation with rodent bioassay data, concerns over the subjective nature of using morphological criteria for identifying transformed cells and a lack of understanding of the mechanistic basis of the assays has limited their acceptance for regulatory purposes. However, recent drivers to find alternative carcinogenicity assessment methodologies, such as the Seventh Amendment to the EU Cosmetics Directive, have fuelled renewed interest in CTAs. Research is currently ongoing to improve the objectivity of the assays, reveal the underlying molecular changes leading to transformation and explore the use of novel cell types. The UK NC3Rs held an international workshop in November 2010 to review the current state of the art in this field and provide directions for future research. This paper outlines the key points highlighted at this meeting. PMID:21852270
The tumor suppressor gene hypermethylated in cancer 1 is transcriptionally regulated by E2F1
DEFF Research Database (Denmark)
Jenal, Mathias; Trinh, Emmanuelle; Britschgi, Christian
2009-01-01
to the HIC1 promoter was shown by chromatin immunoprecipitation assays in human TIG3 fibroblasts expressing tamoxifen-activated E2F1. In agreement, activation of E2F1 in TIG3-E2F1 cells markedly increased HIC1 expression. Interestingly, expression of E2F1 in the p53(-/-) hepatocellular carcinoma cell line...
International Nuclear Information System (INIS)
Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J.
1997-01-01
The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched 235 U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for 137 Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs
Directory of Open Access Journals (Sweden)
Jean-Clement Mars
2018-01-01
Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.
Directory of Open Access Journals (Sweden)
Soheil eKeihan Falsafi
2015-10-01
Full Text Available GABAB receptors are heterodimeric G-protein coupled receptors known to be involved in learning and memory. Although a role for GABAB receptors in cognitive processes is evident, there is no information on hippocampal GABAB receptor complexes in a multiple T maze (MTM task, a robust paradigm for evaluation of spatial learning.Trained or untrained (yoked control C57BL/6J male mice (n=10/group were subjected to the MTM task and sacrificed 6 hours following their performance. Hippocampi were taken, membrane proteins extracted and run on blue native PAGE followed by immunoblotting with specific antibodies against GABAB1, GABAB1a and GABAB2. Immunoprecipitation with subsequent mass spectrometric identification of co-precipitates was carried out to show if GABAB1 and GABAB2 as well as other interacting proteins co-precipitate. An antibody shift assay (ASA and a proximity ligation assay (PLA were also used to see if the two GABAB subunits are present in the receptor complex.Single bands were observed on Western blots, each representing GABAB1, GABAB1a or GABAB2 at an apparent molecular weight of approximately 100 kDa. Subsequently, densitometric analysis revealed that levels of GABAB1 and GABAB1a but not GABAB2- containing receptor complexes were significantly higher in trained than untrained groups. Immunoprecipitation followed by mass spectrometric studies confirmed the presence of GABAB1, GABAB2, calcium calmodulin kinases I and II, GluA1 and GluA2 as constituents of the complex. ASA and PLA also showed the presence of the two subunits of GABAB receptor within the complex. It is shown that increased levels of GABAB1 subunit-containing complexes are paralleling performance in a land maze.
International Nuclear Information System (INIS)
Kim, Tae Woo; Kim, Byungtak; Kim, Ju Hee; Kang, Seongeun; Park, Sung-Bin; Jeong, Gookjoo; Kang, Han-Sung; Kim, Sun Jung
2013-01-01
MTO1 and MRPL41 are nuclear-encoded mitochondrial genes encoding a mitochondrial tRNA-modifying enzyme and a mitochondrial ribosomal protein, respectively. Although both genes have been known to have potential roles in cancer, little is known about their molecular regulatory mechanism, particularly from an epigenetic approach. In this study, we aimed to address their epigenetic regulation through the estrogen receptor (ER) in breast cancer. Digital differential display (DDD) was conducted to identify mammary gland-specific gene candidates including MTO1 and MRPL41. Promoter CpG methylation and expression in breast cancer cell lines and tissues were examined by methylation-specific PCR and real time RT-PCR. Effect of estradiol (E2), tamoxifen, and trichostatin A (TSA) on gene expression was examined in ER + and ER- breast cancer cell lines. Chromatin immunoprecipitation and luciferase reporter assay were performed to identify binding and influencing of the ER to the promoters. Examination of both cancer tissues and cell lines revealed that the two genes showed an opposite expression pattern according to ER status; higher expression of MTO1 and MRPL41 in ER- and ER+ cancer types, respectively, and their expression levels were inversely correlated with promoter methylation. Tamoxifen, E2, and TSA upregulated MTO1 expression only in ER+ cells with no significant changes in ER- cells. However, these chemicals upregulated MRPL41 expression only in ER- cells without significant changes in ER+ cells, except for tamoxifen that induced downregulation. Chromatin immunoprecipitation and luciferase reporter assay identified binding and influencing of the ER to the promoters and the binding profiles were differentially regulated in ER+ and ER- cells. These results indicate that different epigenetic status including promoter methylation and different responses through the ER are involved in the differential expression of MTO1 and MRPL41 in breast cancer
Directory of Open Access Journals (Sweden)
Ji Young Oh
2018-04-01
Full Text Available Background/Aims: Glucose plays an important role in stem cell fate determination and behaviors. However, it is still not known how glucose contributes to the precise molecular mechanisms responsible for stem cell migration. Thus, we investigate the effect of glucose on the regulation of the human umbilical cord blood-derived mesenchymal stem cell (hUCB-MSC migration, and analyze the mechanism accompanied by this effect. Methods: Western blot analysis, wound healing migration assays, immunoprecipitation, and chromatin immunoprecipitation assay were performed to investigate the effect of high glucose on hUCB-MSC migration. Additionally, hUCB-MSC transplantation was performed in the mouse excisional wound splinting model. Results: High concentration glucose (25 mM elicits hUCB-MSC migration compared to normal glucose and high glucose-pretreated hUCB-MSC transplantation into the wound sites in mice also accelerates skin wound repair. We therefore elucidated the detailed mechanisms how high glucose induces hUCB-MSC migration. We showed that high glucose regulates E-cadherin repression through increased Snail and EZH2 expressions. And, we found high glucose-induced reactive oxygen species (ROS promotes two signaling; JNK which regulates γ–secretase leading to the cleavage of Notch proteins and PI3K/Akt signaling which enhances GSK-3β phosphorylation. High glucose-mediated JNK/Notch pathway regulates the expression of EZH2, and PI3K/Akt/GSK-3β pathway stimulates Snail stabilization, respectively. High glucose enhances the formation of EZH2/Snail/HDAC1 complex in the nucleus, which in turn causes E-cadherin repression. Conclusion: This study reveals that high glucose-induced ROS stimulates the migration of hUCB-MSC through E-cadherin repression via Snail and EZH2 signaling pathways.
Radioreceptor assay: theory and applications to pharmacology
International Nuclear Information System (INIS)
Perret, G.; Simon, P.
1984-01-01
The aim of the first part of this work is to present the theory of the radioreceptor assay and to compare it to the other techniques of radioanalysis (radioimmunoassay, competitive protein binding assays). The technology of the radioreceptor assay is then presented and its components (preparation of the receptors, radioligand, incubation medium) are described. The analytical characteristics of the radioreceptor assay (specificity, sensitivity, reproductibility, accuracy) and the pharmacological significance of the results are discussed. The second part is devoted to the description of the radioreceptor assays of some pharmacological classes (neuroleptics, tricyclic antidepressants, benzodiazepines, β-blockers, anticholinergic drugs) and to their use in therapeutic drug monitoring. In conclusion, by their nature, radioreceptor assays are highly sensitive, reliable, precise, accurate and simple to perform. Their chief disadvantage relates to specificity, since any substance having an appreciable affinity to the receptor site will displace the specifically bound radioligand. Paradoxically in some cases, this lack of specificity may be advantageous in that it allows for the detection of not only the apparent compound but of active metabolites and endogenous receptor agonists as well and in that radioreceptors assays can be devised for a whole pharmacological class and not only for one drug as it is the case for classical physico-chemical techniques. For all these reasons future of radioreceptor assay in pharmacology appears promising [fr
Tian, Feng; Lyu, Jing; Shi, Jingyu; Yang, Mo
2017-03-15
In the past decades, Förster resonance energy transfer (FRET) has been applied in many biological applications to reveal the biological information at the nanoscale. Recently, graphene and graphene-like two-dimensional (2D) nanomaterials started to be used in FRET assays as donors or acceptors including graphene oxide (GO), graphene quantum dot (GQD), graphitic-carbon nitride nanosheets (g-C 3 N 4 ) and transition metal dichalcogenides (e.g. MoS 2 , MnO 2, and WS 2 ). Due to the remarkable properties such as large surface to volume ratio, tunable energy band, photoluminescence and excellent biocompatibility, these 2D nanomaterials based FRET assays have shown great potential in various biological applications. This review summarizes the recent development of graphene and graphene-like 2D nanomaterials based FRET assays in applications of biosensing, bioimaging, and drug delivery monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.
Assay optimization for molecular detection of Zika virus
Corman, Victor M.; Rasche, Andrea; Baronti, Cecile; Aldabbagh, Souhaib; Cadar, Daniel; Reusken, Chantal Bem; Pas, Suzan D.; Goorhuis, Abraham; Schinkel, Janke; Molenkamp, Richard; Kümmerer, Beate M.; Bleicker, Tobias; Brünink, Sebastian; Eschbach-Bludau, Monika; Eis-Hübinger, Anna M.; Koopmans, Marion P.; Schmidt-Chanasit, Jonas; Grobusch, Martin P.; de Lamballerie, Xavier; Drosten, Christian; Drexler, Jan Felix
2016-01-01
To examine the diagnostic performance of real-time reverse transcription (RT)-polymerase chain reaction (PCR) assays for Zika virus detection. We compared seven published real-time RT-PCR assays and two new assays that we have developed. To determine the analytical sensitivity of each assay, we
Zhang, Jin; Li, Hongxia
2015-05-01
Ovarian cancer has a poor prognosis, primarily due to the heterogeneity in chemosensitivity among patients. In the present study, this heterogeneity was evaluated in ovarian epithelial cancer (OEC) using an in vitro adenosine triphosphate tumor chemosensitivity assay (ATP-TCA). Specimens were collected from 80 patients who underwent cytoreductive surgery. Viable ovarian cancer cells obtained from malignant tissues were tested for sensitivity to paclitaxel (PTX), carboplatin (CBP), topotecan (TPT), gemcitabine (GEM), docetaxel (TXT), etoposide, bleomycin and 4-hydroperoxycyclophosphamide using ATP-TCA. The sensitivity, specificity, positive predictive value and negative predictive value for the clinical chemotherapy sensitivity of OEC were 88.6, 77.8, 83 and 84.8%, respectively. PTX demonstrated the highest sensitivity of all agents tested (82.5% in all specimens, 85.7% in recurrent specimens), followed by CBP (58.8 and 60.7%, respectively). The sensitivities to PTX and docetaxel (PIII) or low-differentiated specimens, respectively. The present study indicated that ATP-TCA is an effective method for guiding the choice of chemotherapy drugs. Notable heterogeneity of chemosensitivity was observed in the OEC specimens.
Skrlin, Ana; Kosor Krnic, Ela; Gosak, Darko; Prester, Berislav; Mrsa, Vladimir; Vuletic, Marko; Runac, Domagoj
2010-11-02
In vivo and in vitro potency assays have always been a critical tool for confirmation of protein activity. However, due to their complexity and time consuming procedures, it remains a challenge to find an alternative analytical approach that would enable their replacement with no impact on the quality of provided information. The goal of this research was to determine if a correlation between liquid chromatography assays and in vitro biological assay could be established for filgrastim (recombinant human granulocyte-colony stimulating factor, rhG-CSF) samples containing various amounts of related impurities. For that purpose, relevant filgrastim related impurities were purified to homogeneity and characterized by liquid chromatography and mass spectrometry. A significant correlation (R(2)>0.90) between the two types of assays was revealed. Potency of oxidized filgrastim was determined to be approximately 25% of filgrastim stated potency (1 x 10(8)IU/mg of protein). Formyl-methionine filgrastim had potency of 89% of the filgrastim stated potency, while filgrastim dimer had 67% of filgrastim stated potency. A mathematical model for the estimation of biological activity of filgrastim samples from chromatography data was established and a significant correlation between experimental potency values and potency values estimated by the mathematical model was obtained (R(2)=0.92). Based on these results a conclusion was made that reversed phase high performance liquid chromatography could be used as an alternative for the in vitro biological assay for potency assessment of filgrastim samples. Such an alternative model would enable substitution of a complex and time consuming biological assay with a robust and precise instrumental method in many practical cases. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Netzel, Brian C; Grebe, Stefan K G; Carranza Leon, B Gisella; Castro, M Regina; Clark, Penelope M; Hoofnagle, Andrew N; Spencer, Carole A; Turcu, Adina F; Algeciras-Schimnich, Alicia
2015-08-01
Measurement of thyroglobulin (Tg) by mass spectrometry (Tg-MS) is emerging as a tool for accurate Tg quantification in patients with anti-Tg autoantibodies (TgAbs). The objective of the study was to perform analytical and clinical evaluations of two Tg-MS assays in comparison with immunometric Tg assays (Tg-IAs) and Tg RIAs (Tg-RIAs) in a cohort of thyroid cancer patients. A total of 589 samples from 495 patients, 243 TgAb-/252 TgAb+, were tested by Beckman, Roche, Siemens-Immulite, and Thermo-Brahms Tg and TgAb assays, two Tg-RIAs, and two Tg-MS assays. The frequency of TgAb+ was 58%, 41%, 27%, and 39% for Roche, Beckman, Siemens-Immulite, and Thermo-Brahms, respectively. In TgAb- samples, clinical sensitivities and specificities of 100% and 74%-100%, respectively, were observed across all assays. In TgAb+ samples, all Tg-IAs demonstrated assay-dependent Tg underestimation, ranging from 41% to 86%. In TgAb+ samples, the use of a common cutoff (0.5 ng/mL) for the Tg-MS, three Tg-IAs, and the USC-RIA improved the sensitivity for the Tg-MSs and Tg-RIAs when compared with the Tg-IAs. In up to 20% of TgAb+ cases, Tg-IAs failed to detect Tg that was detectable by Tg-MS. In Tg-RIAs false-high biases were observed in TgAb+ samples containing low Tg concentrations. Tg-IAs remain the method of choice for Tg quantitation in TgAb- patients. In TgAb+ patients with undetectable Tg by immunometric assay, the Tg-MS will detect Tg in up to 20% additional cases. The Tg-RIA will detect Tg in approximately 35% cases, but a significant proportion of these will be clinical false-positive results. The undetectable Tg-MS seen in approximately 40% of TgAb+ cases in patients with disease need further evaluation.
Jaw1/LRMP has a role in maintaining nuclear shape via interaction with SUN proteins.
Kozono, Takuma; Tadahira, Kazuko; Okumura, Wataru; Itai, Nao; Tamura-Nakano, Miwa; Dohi, Taeko; Tonozuka, Takashi; Nishikawa, Atsushi
2018-06-06
Jaw1/LRMP is characterized as a type II integral membrane protein that is localized to endoplasmic reticulum (ER), however, its physiological functions have been poorly understood. An alignment of amino acid sequence of Jaw1 with KASH proteins, outer nuclear membrane proteins, revealed that Jaw1 has a partial homology to the KASH domain. Here, we show that the function of Jaw1 is to maintain nuclear shape in mouse melanoma cell line. The siRNA-mediated knockdown of Jaw1 caused a severe defect in nuclear shape, and the defect was rescued by ectopic expression of siRNA-resistant Jaw1. Since co-immunoprecipitation assay indicates that Jaw1 interacts with SUN proteins that are inner nuclear proteins and microtubules, this study suggests that Jaw1 has a role in maintaining nuclear shape via interactions with SUN proteins and microtubules.
DEFF Research Database (Denmark)
Møller, Peter; Möller, Lennart; Godschalk, Roger W L
2010-01-01
The alkaline single cell gel electrophoresis (comet) assay has become a widely used method for the detection of DNA damage and repair in cells and tissues. Still, it has been difficult to compare results from different investigators because of differences in assay conditions and because the data...... are reported in different units. The European Comet Assay Validation Group (ECVAG) was established for the purpose of validation of the comet assay with respect to measures of DNA damage formation and its repair. The results from this inter-laboratory validation trail showed a large variation in measured level...... reliability for the measurement of DNA damage by the comet assay but there is still a need for further validation to reduce both assay and inter-laboratory variation....
Anti-signal recognition particle autoantibody ELISA validation and clinical associations.
Aggarwal, Rohit; Oddis, Chester V; Goudeau, Danielle; Fertig, Noreen; Metes, Ilinca; Stephens, Chad; Qi, Zengbiao; Koontz, Diane; Levesque, Marc C
2015-07-01
The aim of this study was to develop and validate a quantitative anti-signal recognition particle (SRP) autoantibody serum ELISA in patients with myositis and longitudinal association with myositis disease activity. We developed a serum ELISA using recombinant purified full-length human SRP coated on ELISA plates and a secondary antibody that bound human IgG to detect anti-SRP binding. Protein immunoprecipitation was used as the gold standard for the presence of anti-SRP. Serum samples from three groups were analysed: SRP(+) myositis subjects by immunoprecipitation, SRP(-) myositis subjects by immunoprecipitation and non-myositis controls. The ELISA's sensitivity, specificity, positive predictive value and negative predictive value were evaluated. Percentage agreement and test-retest reliability were assessed. Serial samples from seven SRP immunoprecipitation-positive subjects were also tested, along with serum muscle enzymes and manual muscle testing. Using immunoprecipitation, we identified 26 SRP(+) myositis patients and 77 SRP(-) controls (including 38 patients with necrotizing myopathy). Non-myositis control patients included SLE (n = 4) and SSc (n = 7) patients. Anti-SRP positivity by ELISA showed strong agreement (97.1%) with immunoprecipitation (κ = 0.94). The sensitivity, specificity, positive predictive value, and negative predictive value of the anti-SRP ELISA were 88, 100, 100 and 96, respectively. The area under the curve was 0.94, and test-retest reliability was strong (r = 0.91, P < 0.001). Serial samples showed that anti-SRP levels paralleled changes in muscle enzymes and manual muscle testing. We developed a quantitative ELISA for detecting serum anti-SRP autoantibodies and validated the assay in myositis. Longitudinal assessment of SRP levels by ELISA may be a useful biomarker for disease activity. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions
Braun, Patrick; Delgado, Rafael; Drago, Monica; Fanti, Diana; Fleury, Hervé; Hofmann, Jörg; Izopet, Jacques; Kühn, Sebastian; Lombardi, Alessandra; Mancon, Alessandro; Marcos, Mª Angeles; Mileto, Davide; Sauné, Karine; O'Shea, Siobhan; Pérez-Rivilla, Alfredo; Ramble, John; Trimoulet, Pascale; Vila, Jordi; Whittaker, Duncan; Artus, Alain; Rhodes, Daniel
2017-07-01
Viral load monitoring is essential for patients under treatment for HIV. Beckman Coulter has developed the VERIS HIV-1 Assay for use on the novel, automated DxN VERIS Molecular Diagnostics System. ¥ OBJECTIVES: Evaluation of the clinical performance of the new quantitative VERIS HIV-1 Assay at multiple EU laboratories. Method comparison with the VERIS HIV-1 Assay was performed with 415 specimens at 5 sites tested with COBAS ® AmpliPrep/COBAS ® TaqMan ® HIV-1 Test, v2.0, 169 specimens at 3 sites tested with RealTime HIV-1 Assay, and 202 specimens from 2 sites tested with VERSANT HIV-1 Assay. Patient monitoring sample results from 4 sites were also compared. Bland-Altman analysis showed the average bias between VERIS HIV-1 Assay and COBAS HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay to be 0.28, 0.39, and 0.61 log 10 cp/mL, respectively. Bias at low end levels below 1000cp/mL showed predicted bias to be <0.3 log 10 cp/mL for VERIS HIV-1 Assay versus COBAS HIV-1 Test and RealTime HIV-1 Assay, and <0.5 log 10 cp/mL versus VERSANT HIV-1 Assay. Analysis on 174 specimens tested with the 0.175mL volume VERIS HIV-1 Assay and COBAS HIV-1 Test showed average bias of 0.39 log 10 cp/mL. Patient monitoring results using VERIS HIV-1 Assay demonstrated similar viral load trends over time to all comparators. The VERIS HIV-1 Assay for use on the DxN VERIS System demonstrated comparable clinical performance to COBAS ® HIV-1 Test, RealTime HIV-1 Assay, and VERSANT HIV-1 Assay. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Fleury, B.
1981-10-01
A solid phase method of radioimmunoassay utilizing a second antibody adsorbed onto tubes was developed. Polyethylene tubes were selected for their adsorption capacity. The following topics were emphasized: the rate of labelled antigen uptake on the second antibody adsorbed on the tubes through the medium of the first antibody; the influence of the second antibody on the antigen-first antibody reaction and comparison with the immunoprecipiting technique; the various factors able to influence the calibration curve and applications to assay optimization; the performances of hFSH AND hLH assays [fr
Immune chromatography: a quantitative radioimmunological assay
International Nuclear Information System (INIS)
Davis, J.W.; Demetriades, M.; Bowen, J.M.
1984-01-01
Immune chromatography, a radioimmunological binding assay, employs paper chromatography to separate immune complexes from free antigen and antibodies. During chromatography free antigen and antibodies become distributed throughout the paper, while immune complexes remain near the bottoms of the strips. The chromatographic differences can be made quantitative by using either iodinated antigens or antibodies. Under these conditions nanogram quantities of antigen can be detected or antibodies in sera diluted several 1000-fold. The immune chromatography assay can also be performed as an indirect assay, since the paper strips are cut from nitrocellulose paper. In this case the immune components are absorbed by the paper during chromatography. Antigen is then detected with an iodinated second antibody. The indirect immune chromatography assay is particularly useful for identifying different sera that react with the same antigen. Reaction with the first serum before chromatography reduces the amount of antigen available to the second serum following chromatography. In addition to characterizing the immune chromatography procedure, we discuss the possible applications of chromatography assays for the quantitation of other types of molecular binding interactions. (Auth.)
Introducing MINA--The Molecularly Imprinted Nanoparticle Assay.
Shutov, Roman V; Guerreiro, Antonio; Moczko, Ewa; de Vargas-Sansalvador, Isabel Perez; Chianella, Iva; Whitcombe, Michael J; Piletsky, Sergey A
2014-03-26
A new ELISA- (enzyme-linked immunosorbent assay)-like assay is demonstrated in which no elements of biological origin are used for molecular recognition or signaling. Composite imprinted nanoparticles that contain a catalytic core and which are synthesized by using a solid-phase approach can simultaneously act as recognition/signaling elements, and be used with minimal modifications to standard assay protocols. This assay provides a new route towards replacement of unstable biomolecules in immunoassays. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Akers, D.W.; Stoots, C.M.; Kraft, N.C.; Marts, D.J. [Idaho National Engineering Lab., Idaho Falls, ID (United States)
1997-11-01
The Rover Waste Assay System (RWAS) is a nondestructive assay system designed for the rapid assay of highly-enriched {sup 235}U contaminated piping, tank sections, and debris from the Rover nuclear rocket fuel processing facility at the Idaho Chemical Processing Plant. A scanning system translates a NaI(Tl) detector/collimator system over the structural components where both relative and calibrated measurements for {sup 137}Cs are made. Uranium-235 concentrations are in operation and is sufficiently automated that most functions are performed by the computer system. These functions include system calibration, problem identification, collimator control, data analysis, and reporting. Calibration of the system was done through a combination of measurements on calibration standards and benchmarked modeling. A description of the system is presented along with the methods and uncertainties associated with the calibration and analysis of the system for components from the Rover facility. 4 refs., 2 figs., 4 tabs.
Lenaerts, Charline; Bond, Liz; Tuytten, Robin; Blankert, Bertrand
2018-09-01
Marinobufagenin (MBG) is a bufadienolide cardiac inotrope implicated in volume expansion-mediated hypertensive states including essential hypertension and preeclampsia (PE). Endogenous MBG is an inhibitor of the α1-isoform of Na + ,K + -ATPase with vasoconstrictive and cardiotonic properties, causing hypertension and natriuresis. Elevated endogenous MBG-like material levels have been described by immunoassays in salt-sensitive pregnant and preeclamptic rats as well as in preeclamptic human patients. The rise of endogenous MBG-like material appears prior the development of the main symptoms of PE, leading us to consider MBG as one of the potential biomarkers for PE. The weak specificity and the high variability of the published immunoassays gives no certification about endogenous MBG existence. This led us to set-up a highly specific and sensitive analytical method to detect MBG in plasma at low levels relying on liquid chromatography combined to mass spectrometry (UHPLC-MS/MS) with recording of 7 highly specific MRM transitions for MBG. Pure MBG standard used in the method development was obtained by purification from the Bufo marinus toad venom. d 3 -25-hydroxyvitamin D3 was used as internal standard. An increasing organic gradient with mobile phase A and B composed of 97:3 (v/v) H 2 O: MeOH and 50:45:5 (v/v/v) MeOH:IPA:H 2 O at pH 4.5 respectively was used on a Pursuit 3 PFP column (100 mm × 3 mm; 3 µm) to allow elution and separation of the plasmatic compounds. Chromatographic analyses of plasma samples were preceded by a precipitation of proteins pretreatment. The developed UHPLC-MS/MS assay has been applied to early-pregnant women plasma samples allowing us to investigate MBG plasma levels. Thanks to the high specificity of the assay we were able to authenticate and certify the presence of endogenous MBG in early-pregnant women plasma with the use of the 7 selected specific mass transitions. These pioneering preliminary results are giving a
International Nuclear Information System (INIS)
Patzke, J.B.; Rosenberg, B.J.
1984-01-01
The accuracy of assays for monitoring concentrations of basic drugs in biological fluids containing a 1 -acid glycoproteins, such as blood (serum or plasma), is improved by the addition of certain organic phosphate compounds to minimize the ''protein effect.'' Kits containing the elements of the invention are also disclosed
2017-07-27
The Food and Drug Administration (FDA, Agency, or we) is classifying the assayed quality control material for clinical microbiology assays into class II (special controls). The special controls that will apply to the device are identified in this order and will be part of the codified language for the assayed quality control material for clinical microbiology assays' classification. The Agency is classifying the device into class II (special controls) to provide a reasonable assurance of safety and effectiveness of the device.
Capillary Electrophoresis Analysis of Conventional Splicing Assays
DEFF Research Database (Denmark)
de Garibay, Gorka Ruiz; Acedo, Alberto; García-Casado, Zaida
2014-01-01
of these assays is often challenging. Here, we explore this issue by conducting splicing assays in 31 BRCA2 genetic variants. All variants were assessed by RT-PCR followed by capillary electrophoresis and direct sequencing. If assays did not produce clear-cut outputs (Class-2 or Class-5 according to analytical...
Controlling variation in the comet assay
Directory of Open Access Journals (Sweden)
Andrew Richard Collins
2014-10-01
Full Text Available Variability of the comet assay is a serious issue, whether it occurs from experiment to experiment in the same laboratory, or between different laboratories analysing identical samples. Do we have to live with high variability, just because the comet assay is a biological assay rather than analytical chemistry? Numerous attempts have been made to limit variability by standardising the assay protocol, and the critical steps in the assay have been identified; agarose concentration, duration of alkaline incubation, and electrophoresis conditions (time, temperature and voltage gradient are particularly important. Even when these are controlled, variation seems to be inevitable. It is helpful to include in experiments reference standards, i.e. cells with a known amount of specific damage to the DNA. They can be aliquots frozen from a single large batch of cells, either untreated (negative controls or treated with, for example, H2O2 or X-rays to induce strand breaks (positive control for the basic assay, or photosensitiser plus light to oxidise guanine (positive control for Fpg- or OGG1-sensitive sites. Reference standards are especially valuable when performing a series of experiments over a long period - for example, analysing samples of white blood cells from a large human biomonitoring trial - to check that the assay is performing consistently, and to identify anomalous results necessitating a repeat experiment. The reference values of tail intensity can also be used to iron out small variations occurring from day to day. We present examples of the use of reference standards in human trials, both within one laboratory and between different laboratories, and describe procedures that can be used to control variation.
233U Assay A Neutron NDA System
International Nuclear Information System (INIS)
Hensley, D.C.; Lucero, A.J.; Pierce, L.
1998-01-01
The assay of highly enriched 233 U material presents some unique challenges. Techniques which apply to the assay of materials of Pu or enriched 235 U do not convert easily over to the assay of 233 U. A specialized neutron assay device is being fabricated to exploit the singles neutron signal, the weak correlated neutron signal, and an active correlated signal. These pieces of information when combined with γ ray isotopics information should give a good overall determination of 233 U material now stored in bldg. 3019 at the Oak Ridge National Laboratory
International Nuclear Information System (INIS)
Yoon, W.Y.; Meachum, T.R.; Blackwood, L.G.; Harker, Y.D.
2000-01-01
The Idaho National Engineering and Environmental Laboratory Stored Waste Examination Pilot Plant (SWEPP) passive active neutron (PAN) radioassay system is used to certify transuranic (TRU) waste drums in terms of quantifying plutonium and other TRU element activities. Depending on the waste form involved, significant systematic and random errors need quantification in addition to the counting statistics. To determine the total uncertainty of the radioassay results, a statistical sampling and verification approach has been developed. In this approach, the total performance of the PAN nondestructive assay system is simulated using the computer models of the assay system, and the resultant output is compared with the known input to assess the total uncertainty. The supporting steps in performing the uncertainty analysis for the passive assay measurements in particular are as follows: (1) Create simulated waste drums and associated conditions; (2) Simulate measurements to determine the basic counting data that would be produced by the PAN assay system under the conditions specified; and (3) Apply the PAN assay system analysis algorithm to the set of counting data produced by simulating measurements to determine the measured plutonium mass. The validity of this simulation approach was verified by comparing simulated output against results from actual measurements using known plutonium sources and surrogate waste drums. The computer simulation of the PAN system performance uses the Monte Carlo N-Particle (MCNP) Code System to produce a neutron transport calculation for a simulated waste drum. Specifically, the passive system uses the neutron coincidence counting technique, utilizing the spontaneous fission of 240 Pu. MCNP application to the SWEPP PAN assay system uncertainty analysis has been very useful for a variety of waste types contained in 208-ell drums measured by a passive radioassay system. The application of MCNP to the active radioassay system is also feasible
Wilbur, Ami E; Ford, Susan E; Gauthier, Julie D; Gomez-Chiarri, Marta
2012-12-27
The continuing challenges to the management of both wild and cultured eastern oyster Crassostrea virginica populations resulting from protozoan parasites has stimulated interest in the development of molecular assays for their detection and quantification. For Haplosporidium nelsoni, the causative agent of multinucleated sphere unknown (MSX) disease, diagnostic evaluations depend extensively on traditional but laborious histological approaches and more recently on rapid and sensitive (but not quantitative) end-point polymerase chain reaction (PCR) assays. Here, we describe the development and application of a quantitative PCR (qPCR) assay for H. nelsoni using an Applied Biosystems TaqMan® assay designed with minor groove binder (MGB) probes. The assay was highly sensitive, detecting as few as 20 copies of cloned target DNA. Histologically evaluated parasite density was significantly correlated with the quantification cycle (Cq), regardless of whether quantification was categorical (r2 = 0.696, p < 0.0001) or quantitative (r2 = 0.797, p < 0.0001). Application in field studies conducted in North Carolina, USA (7 locations), revealed widespread occurrence of the parasite with moderate to high intensities noted in some locations. In Rhode Island, USA, application of the assay on oysters from 2 locations resulted in no positives.
Computer-determined assay time based on preset precision
International Nuclear Information System (INIS)
Foster, L.A.; Hagan, R.; Martin, E.R.; Wachter, J.R.; Bonner, C.A.; Malcom, J.E.
1994-01-01
Most current assay systems for special nuclear materials (SNM) operate on the principle of a fixed assay time which provides acceptable measurement precision without sacrificing the required throughput of the instrument. Waste items to be assayed for SNM content can contain a wide range of nuclear material. Counting all items for the same preset assay time results in a wide range of measurement precision and wastes time at the upper end of the calibration range. A short time sample taken at the beginning of the assay could optimize the analysis time on the basis of the required measurement precision. To illustrate the technique of automatically determining the assay time, measurements were made with a segmented gamma scanner at the Plutonium Facility of Los Alamos National Laboratory with the assay time for each segment determined by counting statistics in that segment. Segments with very little SNM were quickly determined to be below the lower limit of the measurement range and the measurement was stopped. Segments with significant SNM were optimally assays to the preset precision. With this method the total assay time for each item is determined by the desired preset precision. This report describes the precision-based algorithm and presents the results of measurements made to test its validity
Blakeley, D; Sykes, D A; Ensor, P; Bertran, E; Aston, P J; Charlton, S J
2015-11-01
Plasma protein binding (PPB) influences the free fraction of drug available to bind to its target and is therefore an important consideration in drug discovery. While traditional methods for assessing PPB (e.g. rapid equilibrium dialysis) are suitable for comparing compounds with relatively weak PPB, they are not able to accurately discriminate between highly bound compounds (typically >99.5%). The aim of the present work was to use mathematical modelling to explore the potential utility of receptor binding and cellular functional assays to estimate the affinity of compounds for plasma proteins. Plasma proteins are routinely added to in vitro assays, so a secondary goal was to investigate the effect of plasma proteins on observed ligand-receptor interactions. Using the principle of conservation of mass and the law of mass action, a cubic equation was derived describing the ligand-receptor complex [LR] in the presence of plasma protein at equilibrium. The model demonstrates the profound influence of PPB on in vitro assays and identifies the utility of Schild analysis, which is usually applied to determine receptor-antagonist affinities, for calculating affinity at plasma proteins (termed KP ). We have also extended this analysis to functional effects using operational modelling and demonstrate that these approaches can also be applied to cell-based assay systems. These mathematical models can potentially be used in conjunction with experimental data to estimate drug-plasma protein affinities in the earliest phases of drug discovery programmes. © 2015 The British Pharmacological Society.
High throughput comet assay to study genotoxicity of nanomaterials
Directory of Open Access Journals (Sweden)
Naouale El Yamani
2015-06-01
per slide. Subsequent incubation with FPG revealed damage not seen with the basic assay for strand breaks (without FPG (Harris et al., 2015. Statistical evaluation showed that oleic acid coated Fe3O4 and TiO2 NMs are genotoxic, in the experimental conditions used. No differences were seen between cell lines representing a range of different tissues – demonstrating the general usefulness of in vitro models and the ability of cells to classify NMs as genotoxic and non-genotoxic (Cowie et al., 2015. We are currently studying the effects of 20 NMs in the NANoREG project using A549, BEAS B2 and TK6 cells - again demonstrating the usefulness of the HTP comet assay for nanogenotoxicity testing.
Serotype determination of Salmonella by xTAG assay.
Zheng, Zhibei; Zheng, Wei; Wang, Haoqiu; Pan, Jincao; Pu, Xiaoying
2017-10-01
Currently, no protocols or commercial kits are available to determine the serotypes of Salmonella by using Luminex MAGPIX®. In this study, an xTAG assay for serotype determination of Salmonella suitable for Luminex MAGPIX® is described and 228 Salmonella isolates were serotype determined by this xTAG assay. The xTAG assay consists of two steps: 1) Multiplex PCR to amplify simultaneously O, H and Vi antigen genes of Salmonella, and 2) Magplex-TAG™ microsphere hybridization to identify accurately the specific PCR products of different antigens. Compared with the serotyping results of traditional serum agglutination test, the sensitivity and specificity of the xTAG assay were 95.1% and 100%, respectively. The agreement rate of these two assays was 95.2%. Compared with Luminex xMAP® Salmonella Serotyping Assay (SSA) kit, the advantages of this xTAG assay are: First, the magnetic beads make it applicable to both the Luminex®100/200™ and MAGPIX® systems. Second, only primers rather than both primers and probes are needed in the xTAG assay, and the process of coupling antigen-specific oligonucleotide probes to beads is circumvented, which make the xTAG assay convenient to be utilized by other laboratories. The xTAG assay may serve as a rapid alternative or complementary method for traditional Salmonella serotyping tests, especially for laboratories that utilize the MAGPIX® systems. Copyright © 2017 Elsevier B.V. All rights reserved.
The comet assay: ready for 30 more years.
Møller, Peter
2018-02-24
During the last 30 years, the comet assay has become widely used for the measurement of DNA damage and repair in cells and tissues. A landmark achievement was reached in 2016 when the Organization for Economic Co-operation and Development adopted a comet assay guideline for in vivo testing of DNA strand breaks in animals. However, the comet assay has much more to offer than being an assay for testing DNA strand breaks in animal organs. The use of repair enzymes increases the range of DNA lesions that can be detected with the assay. It can also be modified to measure DNA repair activity. Still, despite the long-term use of the assay, there is a need for studies that assess the impact of variation in specific steps of the procedure. This is particularly important for the on-going efforts to decrease the variation between experiments and laboratories. The articles in this Special Issue of Mutagenesis cover important technical issues of the comet assay procedure, nanogenotoxicity and ionising radiation sensitivity on plant cells. The included biomonitoring studies have assessed seasonal variation and certain predictors for the basal level of DNA damage in white blood cells. Lastly, the comet assay has been used in studies on genotoxicity of environmental and occupational exposures in human biomonitoring studies and animal models. Overall, the articles in this Special Issue demonstrate the versatility of the comet assay and they hold promise that the assay is ready for the next 30 years.
Directory of Open Access Journals (Sweden)
Abigail R Wark
2011-03-01
Full Text Available Identifying the proximate and ultimate mechanisms of social behavior remains a major goal of behavioral biology. In particular, the complex social interactions mediating schooling behavior have long fascinated biologists, leading to theoretical and empirical investigations that have focused on schooling as a group-level phenomenon. However, methods to examine the behavior of individual fish within a school are needed in order to investigate the mechanisms that underlie both the performance and the evolution of schooling behavior. We have developed a technique to quantify the schooling behavior of an individual in standardized but easily manipulated social circumstances. Using our model school assay, we show that threespine sticklebacks (Gasterosteus aculeatus from alternative habitats differ in behavior when tested in identical social circumstances. Not only do marine sticklebacks show increased association with the model school relative to freshwater benthic sticklebacks, they also display a greater degree of parallel swimming with the models. Taken together, these data indicate that marine sticklebacks exhibit a stronger tendency to school than benthic sticklebacks. We demonstrate that these population-level differences in schooling tendency are heritable and are shared by individuals within a population even when they have experienced mixed-population housing conditions. Finally, we begin to explore the stimuli that elicit schooling behavior in these populations. Our data suggest that the difference in schooling tendency between marine and benthic sticklebacks is accompanied by differential preferences for social vs. non-social and moving vs. stationary shelter options. Our study thus provides novel insights into the evolution of schooling behavior, as well as a new experimental approach to investigate the genetic and neural mechanisms that underlie this complex social behavior.
Directory of Open Access Journals (Sweden)
Manu De Rycker
Full Text Available Human African Trypanosomiasis is a vector-borne disease of sub-Saharan Africa that causes significant morbidity and mortality. Current therapies have many drawbacks, and there is an urgent need for new, better medicines. Ideally such new treatments should be fast-acting cidal agents that cure the disease in as few doses as possible. Screening assays used for hit-discovery campaigns often do not distinguish cytocidal from cytostatic compounds and further detailed follow-up experiments are required. Such studies usually do not have the throughput required to test the large numbers of hits produced in a primary high-throughput screen. Here, we present a 384-well assay that is compatible with high-throughput screening and provides an initial indication of the cidal nature of a compound. The assay produces growth curves at ten compound concentrations by assessing trypanosome counts at 4, 24 and 48 hours after compound addition. A reduction in trypanosome counts over time is used as a marker for cidal activity. The lowest concentration at which cell killing is seen is a quantitative measure for the cidal activity of the compound. We show that the assay can identify compounds that have trypanostatic activity rather than cidal activity, and importantly, that results from primary high-throughput assays can overestimate the potency of compounds significantly. This is due to biphasic growth inhibition, which remains hidden at low starting cell densities and is revealed in our static-cidal assay. The assay presented here provides an important tool to follow-up hits from high-throughput screening campaigns and avoid progression of compounds that have poor prospects due to lack of cidal activity or overestimated potency.
On performance experience and measurements with Ningyo Waste Assay System (NWAS). 3
International Nuclear Information System (INIS)
Zaima, Naoki; Nakashima, Shin'ichi; Nakatsuka, Yoshiaki; Kado, Kazumi; Fujiki, Naoki
2014-03-01
A uranium mass assay system, NWAS (Ningyo Waste Assay System), for 200-litter wastes drums applied by NDA method was developed and accumulated the data of the actual uranium bearing wastes drums. The system consists of the 16 pieces of Helium-3 proportional counters for neutron detection generated from U-234(α,n) reaction or U-238 spontaneous fissions with polyethylene moderation and a Germanium solid state detector (Ge-SSD) for gamma ray detection as to determine uranium enrichment. In previous report, some measurement experiences had been introduced briefly. After that the measurements campaigns against the actual wastes drums stored in URCP had been carried out successfully, the uranium determination data of 850 drums had been accumulated approximately. Those characteristics were rich in variety including various kinds of matrices, uranium chemical compositions and range of uranium mass and so on. These works have contributed the decrease of the MUF in URCP, for which was the first purpose of introduction of NWAS. On the other hand several considerable problems on the system or methodology had been revealed technically or analytically through the measurements experiences. Such experiences are to be described precisely, in addition newly gained knowledge will be marshaled. Furthermore as the next improvement plans, the active neutrons assay for uranium bearing wastes drums are now progressing. The results of complications will lead us to the progressive next steps. (author)
Assays for calcitonin receptors
International Nuclear Information System (INIS)
Teitelbaum, A.P.; Nissenson, R.A.; Arnaud, C.D.
1985-01-01
The assays for calcitonin receptors described focus on their use in the study of the well-established target organs for calcitonin, bone and kidney. The radioligand used in virtually all calcitonin binding studies is 125 I-labelled salmon calcitonin. The lack of methionine residues in this peptide permits the use of chloramine-T for the iodination reaction. Binding assays are described for intact bone, skeletal plasma membranes, renal plasma membranes, and primary kidney cell cultures of rats. Studies on calcitonin metabolism in laboratory animals and regulation of calcitonin receptors are reviewed
Directory of Open Access Journals (Sweden)
Luc Séro
2013-11-01
Full Text Available Advanced glycation end-products (AGEs are involved in the pathogenesis of numerous diseases. Among them, cellular accumulation of AGEs contributes to vascular complications in diabetes. Besides using drugs to lower blood sugar, a balanced diet and the intake of herbal products potentially limiting AGE formation could be considered beneficial for patients’ health. The current paper presents a simple and cheap high-throughput screening (HTS assay based on AGE fluorescence and suitable for plant extract screening. We have already implemented an HTS assay based on vesperlysines-like fluorescing AGEs quickly (24 h formed from BSA and ribose under physiological conditions. However, interference was noted when fluorescent compounds and/or complex mixtures were tested. To overcome these problems and apply this HTS assay to plant extracts, we developed a technique for systematic quantification of both vesperlysines (λexc 370 nm; λem 440 nm and pentosidine-like (λexc 335 nm; λem 385 nm AGEs. In a batch of medicinal and food plant extracts, hits were selected as soon as fluorescence decreased under a fixed threshold for at least one wavelength. Hits revealed during this study appeared to contain well-known and powerful anti-AGE substances, thus demonstrating the suitability of this assay for screening crude extracts (0.1 mg/mL. Finally, quercetin was found to be a more powerful reference compound than aminoguanidine in such assay.
International Nuclear Information System (INIS)
Ding, Caiping; Yan, Yinghan; Zhang, Cuiling; Xian, Yuezhong; Xiang, Dongshan
2016-01-01
Greigite magnetic nanoparticles (Fe 3 S 4 -MNPs) were prepared and reveal a peroxidase-like activity. Kinetic studies revealed a pseudo-enzymatic activity that is much higher than that of other magnetic nanomaterial-based enzyme mimetics. This finding was exploited to design a photometric enzymatic glucose assay based on the formation of H 2 O 2 during enzymatic oxidation of glucose by glucose oxidase, and the formation of a blue product from an enzyme substrate that is catalytically oxidized by H 2 O 2 in the presence of Fe 3 S 4 -MNPs. Glucose can be detected in the 2 to 100 μM concentration range, and the low detection limit is 0.16 μM. The method was applied to quantify glucose in human serum. In our perception, this enzyme mimetic has a large potential in that it may be used in other oxidase based assays, but also in ELISAs. (author)
Integrated bioassays in microfluidic devices: botulinum toxin assays.
Mangru, Shakuntala; Bentz, Bryan L; Davis, Timothy J; Desai, Nitin; Stabile, Paul J; Schmidt, James J; Millard, Charles B; Bavari, Sina; Kodukula, Krishna
2005-12-01
A microfluidic assay was developed for screening botulinum neurotoxin serotype A (BoNT-A) by using a fluorescent resonance energy transfer (FRET) assay. Molded silicone microdevices with integral valves, pumps, and reagent reservoirs were designed and fabricated. Electrical and pneumatic control hardware were constructed, and software was written to automate the assay protocol and data acquisition. Detection was accomplished by fluorescence microscopy. The system was validated with a peptide inhibitor, running 2 parallel assays, as a feasibility demonstration. The small footprint of each bioreactor cell (0.5 cm2) and scalable fluidic architecture enabled many parallel assays on a single chip. The chip is programmable to run a dilution series in each lane, generating concentration-response data for multiple inhibitors. The assay results showed good agreement with the corresponding experiments done at a macroscale level. Although the system has been developed for BoNT-A screening, a wide variety of assays can be performed on the microfluidic chip with little or no modification.
Comet assay on mice testicular cells
Directory of Open Access Journals (Sweden)
Anoop Kumar Sharma
2015-05-01
Full Text Available Heritable mutations may result in a variety of adverse outcomes including genetic disease in the offspring. In recent years the focus on germ cell mutagenicity has increased and the “Globally Harmonized System of Classification and Labelling of Chemicals (GHS” has published classification criteria for germ cell mutagens (Speit et al., 2009. The in vivo Comet assay is considered a useful tool for investigating germ cell genotoxicity. In the present study DNA strand breaks in testicular cells of mice were investigated. Different classes of chemicals were tested in order to evaluate the sensitivity of the comet assay in testicular cells. The chemicals included environmentally relevant substances such as Bisphenol A, PFOS and Tetrabrombisphenol A. Statistical power calculations will be presented to aid in the design of future Comet assay studies on testicular cells. Power curves were provided with different fold changes in % tail DNA, different number of cells scored and different number of gels (Hansen et al., 2014. An example is shown in Figure 1. A high throughput version of the Comet assay was used. Samples were scored with a fully automatic comet assay scoring system that provided faster scoring of randomly selected cells.
Energy Technology Data Exchange (ETDEWEB)
Klapper, P.E.; Cleator, G.M.; Prinja-Wolks, D.; Morris, D.J. (Medical School, Manchester (United Kingdom). Department of Medical microbiology, Virology Unit); Morell, G. (Regional Blood Transfusion Centre, manchester (United Kingdom))
1990-03-01
An immunoradiometric assay (radio-immunosorbent test; RIST) for the detection of IgG antibodies to human herpesvirus 4 (human cytomegalovirus (CMV)) has been developed. The technique utilizes CMV antigen passively adsorbed to a polyvinyl microtitration plate and a radiolabelled murine monoclonal anti-human IgG antibody to detect binding of human antibody to the 'solid phase' reagent. The assay was optimized, and its specifity confirmed by testing paired acute and convalescent sera from patients with acute CMV or other human herpesvirus infections. To determine the assay's sensitivity 1433 blood donor sera were examined. The RIST was more sensitive than a standard complement fixation (CFT). Use of a monoclonal anti-human IgG antibody in the RIST reduced non-specific binding to the control uninfected cell antigen such that blood donor sera could be tested in the assay using only a CMV antigen without generating an unacceptable false positive rate. (author). 23 refs.; 1 tab.
233U Assay A Neutron NDA System
Energy Technology Data Exchange (ETDEWEB)
Hensley, D.C.; Lucero, A.J.; Pierce, L.
1998-11-17
The assay of highly enriched {sup 233}U material presents some unique challenges. Techniques which apply to the assay of materials of Pu or enriched {sup 235}U do not convert easily over to the assay of {sup 233}U. A specialized neutron assay device is being fabricated to exploit the singles neutron signal, the weak correlated neutron signal, and an active correlated signal. These pieces of information when combined with {gamma} ray isotopics information should give a good overall determination of {sup 233}U material now stored in bldg. 3019 at the Oak Ridge National Laboratory.
Directory of Open Access Journals (Sweden)
Kazutoyo Miura
Full Text Available Vaccines that interrupt malaria transmission are of increasing interest and a robust functional assay to measure this activity would promote their development by providing a biologically relevant means of evaluating potential vaccine candidates. Therefore, we aimed to qualify the standard membrane-feeding assay (SMFA. The assay measures the transmission-blocking activity of antibodies by feeding cultured P. falciparum gametocytes to Anopheles mosquitoes in the presence of the test antibodies and measuring subsequent mosquito infection. The International Conference on Harmonisation (ICH Harmonised Tripartite Guideline Q2(R1 details characteristics considered in assay validation. Of these characteristics, we decided to qualify the SMFA for Precision, Linearity, Range and Specificity. The transmission-blocking 4B7 monoclonal antibody was tested over 6 feeding experiments at several concentrations to determine four suitable concentrations that were tested in triplicate in the qualification experiments (3 additional feeds to evaluate Precision, Linearity and Range. For Specificity, 4B7 was tested in the presence of normal mouse IgG. We determined intra- and inter-assay variability of % inhibition of mean oocyst intensity at each concentration of 4B7 (lower concentrations showed higher variability. We also showed that % inhibition was dependent on 4B7 concentration and the activity is specific to 4B7. Since obtaining empirical data is time-consuming, we generated a model using data from all 9 feeds and simulated the effects of different parameters on final readouts to improve the assay procedure and analytical methods for future studies. For example, we estimated the effect of number of mosquitoes dissected on variability of % inhibition, and simulated the relationship between % inhibition in oocyst intensity and % inhibition of prevalence of infected mosquitos at different mean oocysts in the control. SMFA is one of the few biological assays used in
Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina
2009-12-01
Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.
Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).
Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M
2015-02-21
This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.
Chromosome aberration assays in Allium
Energy Technology Data Exchange (ETDEWEB)
Grant, W.F.
1982-01-01
The common onion (Allium cepa) is an excellent plant for the assay of chromosome aberrations after chemical treatment. Other species of Allium (A. cepa var. proliferum, A. carinatum, A. fistulosum and A. sativum) have also been used but to a much lesser extent. Protocols have been given for using root tips from either bulbs or seeds of Allium cepa to study the cytological end-points, such as chromosome breaks and exchanges, which follow the testing of chemicals in somatic cells. It is considered that both mitotic and meiotic end-points should be used to a greater extent in assaying the cytogenetic effects of a chemical. From a literature survey, 148 chemicals are tabulated that have been assayed in 164 Allium tests for their clastogenic effect. Of the 164 assays which have been carried out, 75 are reported as giving a positive reaction, 49 positive and with a dose response, 1 positive and temperature-related, 9 borderline positive, and 30 negative; 76% of the chemicals gave a definite positive response. It is proposed that the Allium test be included among those tests routinely used for assessing chromosomal damage induced by chemicals.
Multi-platform metabolomics assays for human lung lavage fluids in an air pollution exposure study.
Surowiec, Izabella; Karimpour, Masoumeh; Gouveia-Figueira, Sandra; Wu, Junfang; Unosson, Jon; Bosson, Jenny A; Blomberg, Anders; Pourazar, Jamshid; Sandström, Thomas; Behndig, Annelie F; Trygg, Johan; Nording, Malin L
2016-07-01
Metabolomics protocols are used to comprehensively characterize the metabolite content of biological samples by exploiting cutting-edge analytical platforms, such as gas chromatography (GC) or liquid chromatography (LC) coupled to mass spectrometry (MS) assays, as well as nuclear magnetic resonance (NMR) assays. We have developed novel sample preparation procedures combined with GC-MS, LC-MS, and NMR metabolomics profiling for analyzing bronchial wash (BW) and bronchoalveolar lavage (BAL) fluid from 15 healthy volunteers following exposure to biodiesel exhaust and filtered air. Our aim was to investigate the responsiveness of metabolite profiles in the human lung to air pollution exposure derived from combustion of biofuels, such as rapeseed methyl ester biodiesel, which are increasingly being promoted as alternatives to conventional fossil fuels. Our multi-platform approach enabled us to detect the greatest number of unique metabolites yet reported in BW and BAL fluid (82 in total). All of the metabolomics assays indicated that the metabolite profiles of the BW and BAL fluids differed appreciably, with 46 metabolites showing significantly different levels in the corresponding lung compartments. Furthermore, the GC-MS assay revealed an effect of biodiesel exhaust exposure on the levels of 1-monostearylglycerol, sucrose, inosine, nonanoic acid, and ethanolamine (in BAL) and pentadecanoic acid (in BW), whereas the LC-MS assay indicated a shift in the levels of niacinamide (in BAL). The NMR assay only identified lactic acid (in BW) as being responsive to biodiesel exhaust exposure. Our findings demonstrate that the proposed multi-platform approach is useful for wide metabolomics screening of BW and BAL fluids and can facilitate elucidation of metabolites responsive to biodiesel exhaust exposure. Graphical Abstract Graphical abstract illustrating the study workflow. NMR Nuclear Magnetic Resonance, LC-TOFMS Liquid chromatography-Time Of Flight Mass Spectrometry, GC Gas
Evaluation of the Abbott Real Time HCV genotype II assay for Hepatitis C virus genotyping.
Sariguzel, Fatma Mutlu; Berk, Elife; Gokahmetoglu, Selma; Ercal, Baris Derya; Celik, Ilhami
2015-01-01
The determination of HCV genotypes and subtypes is very important for the selection of antiviral therapy and epidemiological studies. The aim of this study was to evaluate the performance of Abbott Real Time HCV Genotype II assay in HCV genotyping of HCV infected patients in Kayseri, Turkey. One hundred patients with chronic hepatitis C admitted to our hospital were evaluated between June 2012 and December 2012, HCV RNA levels were determined by the COBAS® AmpliPrep/COBAS® TaqMan® 48 HCV test. HCV genotyping was investigated by the Abbott Real Time HCV Genotype II assay. With the exception of genotype 1, subtypes of HCV genotypes could not be determined by Abbott assay. Sequencing analysis was used as the reference method. Genotypes 1, 2, 3 and 4 were observed in 70, 4, 2 and 24 of the 100 patients, respectively, by two methods. The concordance between the two systems to determine HCV major genotypes was 100%. Of 70 patients with genotype 1, 66 showed infection with subtype 1b and 4 with subtype 1a by Abbott Real Time HCV Genotype II assay. Using sequence analysis, 61 showed infection with subtype 1b and 9 with subtype 1a. In determining of HCV genotype 1 subtypes, the difference between the two methods was not statistically significant (P>0.05). HCV genotype 4 and 3 samples were found to be subtype 4d and 3a, respectively, by sequence analysis. There were four patients with genotype 2. Sequence analysis revealed that two of these patients had type 2a and the other two had type 2b. The Abbott Real Time HCV Genotype II assay yielded results consistent with sequence analysis. However, further optimization of the Abbott Real Time HCV Genotype II assay for subtype identification of HCV is required.
Implementation and Use of State-of-the-Art, Cell-Based In Vitro Assays.
Langer, Gernot
2016-01-01
The impressive advances in the generation and interpretation of functional omics data have greatly contributed to a better understanding of the (patho-)physiology of many biological systems and led to a massive increase in the number of specific targets and phenotypes to investigate in both basic and applied research. The obvious complexity revealed by these studies represents a major challenge to the research community and asks for improved target characterisation strategies with the help of reliable, high-quality assays. Thus, the use of living cells has become an integral part of many research activities because the cellular context more closely represents target-specific interrelations and activity patterns. Although still predominant, the use of traditional two-dimensional (2D) monolayer cell culture models has been gradually complemented by studies based on three-dimensional (3D) spheroid (Sutherland 1988) and other 3D tissue culture systems (Santos et al. 2012; Matsusaki et al. 2014) in an attempt to employ model systems more closely representing the microenvironment of cells in the body. Hence, quite a variety of state-of-the-art cell culture models are available for the generation of novel chemical probes or the identification of starting points for drug development in translational research and pharma drug discovery. In order to cope with these information-rich formats and their increasing technical complexity, cell-based assay development has become a scientific research topic in its own right and is used to ensure the provision of significant, reliable and high-quality data outlasting any discussions related to the current "irreproducibility epidemic" (Dolgin 2014; Prinz et al. 2011; Schatz 2014). At the same time the use of cells in microplate assay formats has become state of the art and greatly facilitates rigorous cell-based assay development by providing the researcher with the opportunity to address the multitude of factors affecting the actual
Do detour tasks provide accurate assays of inhibitory control?
Whiteside, Mark A.; Laker, Philippa R.; Beardsworth, Christine E.
2018-01-01
Transparent Cylinder and Barrier tasks are used to purportedly assess inhibitory control in a variety of animals. However, we suspect that performances on these detour tasks are influenced by non-cognitive traits, which may result in inaccurate assays of inhibitory control. We therefore reared pheasants under standardized conditions and presented each bird with two sets of similar tasks commonly used to measure inhibitory control. We recorded the number of times subjects incorrectly attempted to access a reward through transparent barriers, and their latencies to solve each task. Such measures are commonly used to infer the differential expression of inhibitory control. We found little evidence that their performances were consistent across the two different Putative Inhibitory Control Tasks (PICTs). Improvements in performance across trials showed that pheasants learned the affordances of each specific task. Critically, prior experience of transparent tasks, either Barrier or Cylinder, also improved subsequent inhibitory control performance on a novel task, suggesting that they also learned the general properties of transparent obstacles. Individual measures of persistence, assayed in a third task, were positively related to their frequency of incorrect attempts to solve the transparent inhibitory control tasks. Neophobia, Sex and Body Condition had no influence on individual performance. Contrary to previous studies of primates, pheasants with poor performance on PICTs had a wider dietary breadth assayed using a free-choice task. Our results demonstrate that in systems or taxa where prior experience and differences in development cannot be accounted for, individual differences in performance on commonly used detour-dependent PICTS may reveal more about an individual's prior experience of transparent objects, or their motivation to acquire food, than providing a reliable measure of their inhibitory control. PMID:29593115
Principles of validation of diagnostic assays for infectious diseases
International Nuclear Information System (INIS)
Jacobson, R.H.
1998-01-01
Assay validation requires a series of inter-related processes. Assay validation is an experimental process: reagents and protocols are optimized by experimentation to detect the analyte with accuracy and precision. Assay validation is a relative process: its diagnostic sensitivity and diagnostic specificity are calculated relative to test results obtained from reference animal populations of known infection/exposure status. Assay validation is a conditional process: classification of animals in the target population as infected or uninfected is conditional upon how well the reference animal population used to validate the assay represents the target population; accurate predictions of the infection status of animals from test results (PV+ and PV-) are conditional upon the estimated prevalence of disease/infection in the target population. Assay validation is an incremental process: confidence in the validity of an assay increases over time when use confirms that it is robust as demonstrated by accurate and precise results; the assay may also achieve increasing levels of validity as it is upgraded and extended by adding reference populations of known infection status. Assay validation is a continuous process: the assay remains valid only insofar as it continues to provide accurate and precise results as proven through statistical verification. Therefore, the work required for validation of diagnostic assays for infectious diseases does not end with a time-limited series of experiments based on a few reference samples rather, to assure valid test results from an assay requires constant vigilance and maintenance of the assay, along with reassessment of its performance characteristics for each unique population of animals to which it is applied. (author)
MIYACHI, K; HIRANO, Y; HORIGOME, T; MIMORI, T; MIYAKAWA, H; ONOZUKA, Y; SHIBATA, M; HIRAKATA, M; SUWA, A; HOSAKA, H; MATSUSHIMA, S; KOMATSU, T; MATSUSHIMA, H; HANKINS, R W; FRITZLER, M J
2004-01-01
We have reported previously that p95c, a novel 95-kDa cytosolic protein, was the target of autoantibodies in sera of patients with autoimmune hepatic diseases. We studied 30 sera that were shown previously to immunoprecipitate a 95 kDa protein from [35S]-methionine-labelled HeLa lysates and had a specific precipitin band in immunodiffusion. Thirteen sera were available to test the ability of p95c antibodies to inhibit nuclear envelope assembly in an in vitro assay in which confocal fluorescence microscopy was also used to identify the stages at which nuclear assembly was inhibited. The percentage inhibition of nuclear envelope assembly of the 13 sera ranged from 7% to 99% and nuclear envelope assembly and the swelling of nucleus was inhibited at several stages. The percentage inhibition of nuclear assembly was correlated with the titre of anti-p95c as determined by immunodiffusion. To confirm the identity of this autoantigen, we used a full-length cDNA of the p97/valosin-containing protein (VCP) to produce a radiolabelled recombinant protein that was then used in an immunoprecipitation (IP) assay. Our study demonstrated that 12 of the 13 (93%) human sera with antibodies to p95c immunoprecipitated recombinant p97/VCP. Because p95c and p97 have similar molecular masses and cell localization, and because the majority of sera bind recombinant p97/VCP and anti-p95c antibodies inhibit nuclear assembly, this is compelling evidence that p95c and p97/VCP are identical. PMID:15147362
Mugii, Naoki; Hasegawa, Minoru; Matsushita, Takashi; Hamaguchi, Yasuhito; Oohata, Sacihe; Okita, Hirokazu; Yahata, Tetsutarou; Someya, Fujiko; Inoue, Katsumi; Murono, Shigeyuki; Fujimoto, Manabu; Takehara, Kazuhiko
2016-01-01
Objective Dysphagia develops with low frequency in patients with dermatomyositis. Our objective was to determine the clinical and laboratory features that can estimate the development of dysphagia in dermatomyositis. Methods This study included 92 Japanese patients with adult-onset dermatomyositis. The associations between dysphagia and clinical and laboratory features including disease-specific autoantibodies determined by immunoprecipitation assays were analyzed. Results Videofluoroscopy sw...
... this page: //medlineplus.gov/ency/article/003679.htm Factor IX assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
... this page: //medlineplus.gov/ency/article/003678.htm Factor VIII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
... this page: //medlineplus.gov/ency/article/003674.htm Factor II assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
... this page: //medlineplus.gov/ency/article/003676.htm Factor VII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...
Directory of Open Access Journals (Sweden)
Elena K Braithwaite
2010-08-01
Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.
Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping
2015-05-01
Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.
Motohashi, Hiromi; Mukudai, Yoshiki; Ito, Chihiro; Kato, Kosuke; Shimane, Toshikazu; Kondo, Seiji; Shirota, Tatsuo
2017-05-04
Although tumor protein D52 (TPD52) family proteins were first identified nearly 20 years ago, their molecular regulatory mechanisms remain unclear. Therefore, we investigated the post-transcriptional regulation of TPD52 family genes. An RNA immunoprecipitation (RIP) assay showed the potential binding ability of TPD52 family mRNAs to several RNA-binding proteins, and an RNA degradation assay revealed that TPD52 is subject to more prominent post-transcriptional regulation than are TPD53 and TPD54. We subsequently focused on the 3'-untranslated region (3'-UTR) of TPD52 as a cis -acting element in post-transcriptional gene regulation. Several deletion mutants of the 3'-UTR of TPD52 mRNA were constructed and ligated to the 3'-end of a reporter green fluorescence protein gene. An RNA degradation assay revealed that a minimal cis -acting region, located in the 78-280 region of the 5'-proximal region of the 3'-UTR, stabilized the reporter mRNA. Biotin pull-down and RIP assays revealed specific binding of the region to T-cell intracellular antigen 1 (TIA-1) and TIA-1-related protein (TIAR). Knockdown of TIA-1/TIAR decreased not only the expression, but also the stability of TPD52 mRNA; it also decreased the expression and stability of the reporter gene ligated to the 3'-end of the 78-280 fragment. Stimulation of transforming growth factor-β and epidermal growth factor decreased the binding ability of these factors, resulting in decreased mRNA stability. These results indicate that the 78-280 fragment and TIA-1/TIAR concordantly contribute to mRNA stability as a cis -acting element and trans -acting factor(s), respectively. Thus, we here report the specific interactions between these elements in the post-transcriptional regulation of the TPD52 gene. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Multiplexing a high-throughput liability assay to leverage efficiencies.
Herbst, John; Anthony, Monique; Stewart, Jeremy; Connors, David; Chen, Taosheng; Banks, Martyn; Petrillo, Edward W; Agler, Michele
2009-06-01
In order to identify potential cytochrome P-450 3A4 (drug-metabolizing enzyme) inducers at an early stage of the drug discovery process, a cell-based transactivation high-throughput luciferase reporter assay for the human pregnane X receptor (PXR) in HepG2 cells has been implemented and multiplexed with a viability end point for data interpretation, as part of a Lead Profiling portfolio of assays. As a routine part of Lead Profiling operations, assays are periodically evaluated for utility as well as for potential improvements in technology or process. We used a recent evaluation of our PXR-transactivation assay as a model for the application of Lean Thinking-based process analysis to lab-bench assay optimization and automation. This resulted in the development of a 384-well multiplexed homogeneous assay simultaneously detecting PXR transactivation and HepG2 cell cytotoxicity. In order to multiplex fluorescent and luminescent read-outs, modifications to each assay were necessary, which included optimization of multiple assay parameters such as cell density, plate type, and reagent concentrations. Subsequently, a set of compounds including known cytotoxic compounds and PXR inducers were used to validate the multiplexed assay. Results from the multiplexed assay correlate well with those from the singleplexed assay formats measuring PXR transactivation and viability separately. Implementation of the multiplexed assay for routine compound profiling provides improved data quality, sample conservation, cost savings, and resource efficiencies.
de Waaij, Dewi J; Ouburg, Sander; Dubbink, Jan Henk; Peters, Remco P H; Morré, Servaas A
2016-08-01
This is an evaluation study of the Presto(plus) Assay for T. vaginalis by comparing to the TIB MOLBIOL LightMix Kit Trichomonas vaginalis Assay using 615 dry collected vaginal and rectal swabs. Discordant samples were analyzed by the Qiagen® Microbial DNA qPCR for TV Assay. Both assays showed comparable performances (McNemar p>0.05). Copyright © 2016 Elsevier B.V. All rights reserved.
Nondestructive assay methods for irradiated nuclear fuels
International Nuclear Information System (INIS)
Hsue, S.T.; Crane, T.W.; Talbert, W.L. Jr.; Lee, J.C.
1978-01-01
This report is a review of the status of nondestructive assay (NDA) methods used to determine burnup and fissile content of irradiated nuclear fuels. The gamma-spectroscopy method measures gamma activities of certain fission products that are proportional to the burnup. Problems associated with this method are migration of the fission products and gamma-ray attenuation through the relatively dense fuel material. The attenuation correction is complicated by generally unknown activity distributions within the assemblies. The neutron methods, which usually involve active interrogation and prompt or delayed signal counting, are designed to assay the fissile content of the spent-fuel elements. Systems to assay highly enriched spent-fuel assemblies have been tested extensively. Feasibility studies have been reported of systems to assay light-water reactor spent-fuel assemblies. The slowing-down spectrometer and neutron resonance absorption methods can distinguish between the uranium and plutonium fissile contents, but they are limited to the assay of individual rods. We have summarized the status of NDA techniques for spent-fuel assay and present some subjects in need of further investigation. Accuracy of the burnup calculations for power reactors is also reviewed
Bosserman, Linda; Prendergast, Franklyn; Herbst, Roy; Fleisher, Martin; Salom, Emery; Strickland, Steven; Raptis, Anastasios; Hallquist, Allan; Perree, Mathieu; Rajurkar, Swapnil; Karimi, Misagh; Rogers, Karl; Davidson, Dirk; Willis, Carl; Penalver, Manuel; Homesley, Howard; Burrell, Matthew; Garrett, Audrey; Rutledge, James; Chernick, Michael; Presant, Cary A
2012-08-15
A drug-induced apoptosis assay, termed the microculture-kinetic (MiCK) assay, has been developed. Blinded clinical trials have shown higher response rates and longer survival in groups of patients with acute myelocytic leukemia and epithelial ovarian cancer who have been treated with drugs that show high apoptosis in the MiCK assay. Unblinded clinical trials in multiple tumor types have shown that the assay will be used frequently by clinicians to determine treatment, and when used, results in higher response rates, longer times to relapse, and longer survivals. Model economic analyses suggest possible cost savings in clinical use based on increased generic drug use and single-agent substitution for combination therapies. Two initial studies with drugs in development are promising. The assay may help reduce costs and speed time to drug approval. Correlative studies with molecular biomarkers are planned. This assay may have a role both in personalized clinical therapy and in more efficient drug development. ©2012 AACR.
An essential GT motif in the lamin A promoter mediates activation by CREB-binding protein
International Nuclear Information System (INIS)
Janaki Ramaiah, M.; Parnaik, Veena K.
2006-01-01
Lamin A is an important component of nuclear architecture in mammalian cells. Mutations in the human lamin A gene lead to highly degenerative disorders that affect specific tissues. In studies directed towards understanding the mode of regulation of the lamin A promoter, we have identified an essential GT motif at -55 position by reporter gene assays and mutational analysis. Binding of this sequence to Sp transcription factors has been observed in electrophoretic mobility shift assays and by chromatin immunoprecipitation studies. Further functional analysis by co-expression of recombinant proteins and ChIP assays has shown an important regulatory role for CREB-binding protein in promoter activation, which is mediated by the GT motif
Radioligand assay in reproductive biology
International Nuclear Information System (INIS)
Korenman, S.G.; Sherman, B.M.
1975-01-01
Radioligand assays have been developed for the principal reproductive steroids and peptide hormones. Specific binding reagents have included antibodies, plasma binders, and intracellular receptors. In each assay, problems of specificity, sensitivity, and nonspecific inhibitors were encountered. Many features of the endocrine physiology in childhood, during puberty, and in adulthood have been characterized. Hormonal evaluations of endocrine disorders of reproduction are characterized on the basis of their characteristic pathophysiologic alterations. (U.S.)
Thermometric enzyme linked immunosorbent assay: TELISA.
Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K
1977-08-11
A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.
van Doorn, H. Rogier; Koelewijn, Rob; Hofwegen, Henk; Gilis, Henk; Wetsteyn, Jose C. F. M.; Wismans, Pieter J.; Sarfati, Claudine; Vervoort, Tony; van Gool, Tom
2007-01-01
A homemade enzyme-linked immunosorbent assay (ELISA) (Academic Medical Center ELISA [AMC-ELISA]) and a dipstick assay for the detection of anti-Strongyloides stercoralis antibodies in serum were developed and evaluated together with two commercially available ELISAs (IVD-ELISA [IVD Research, Inc.
Parallel force assay for protein-protein interactions.
Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E
2014-01-01
Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.
Directory of Open Access Journals (Sweden)
Zsolt Czimmerer
Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.
Linearization of the bradford protein assay.
Ernst, Orna; Zor, Tsaffrir
2010-04-12
Determination of microgram quantities of protein in the Bradford Coomassie brilliant blue assay is accomplished by measurement of absorbance at 590 nm. This most common assay enables rapid and simple protein quantification in cell lysates, cellular fractions, or recombinant protein samples, for the purpose of normalization of biochemical measurements. However, an intrinsic nonlinearity compromises the sensitivity and accuracy of this method. It is shown that under standard assay conditions, the ratio of the absorbance measurements at 590 nm and 450 nm is strictly linear with protein concentration. This simple procedure increases the accuracy and improves the sensitivity of the assay about 10-fold, permitting quantification down to 50 ng of bovine serum albumin. Furthermore, the interference commonly introduced by detergents that are used to create the cell lysates is greatly reduced by the new protocol. A linear equation developed on the basis of mass action and Beer's law perfectly fits the experimental data.
Nondestructive assay of HTGR fuel rods
International Nuclear Information System (INIS)
Menlove, H.O.
1974-01-01
Performance characteristics of three different radioactive source NDA systems are compared for the assay of HTGR fuel rods and stacks of rods. These systems include the fast neutron Sb-Be assay system, the 252 Cf ''Shuffler,'' and the thermal neutron PAPAS assay system. Studies have been made to determinethe perturbation on the measurements from particle size, kernel Th/U ratio, thorium content, and hydrogen content. In addition to the total 235 U determination, the pellet-to-pellet or rod-to-rod uniformity of HTGR fuel rod stacks has been measured by counting the delayed gamma rays with a NaI through-hole in the PAPAS system. These measurements showed that rod substitutions can be detected easily in a fuel stack, and that detailed information is available on the loading variations in a uniform stack. Using a 1.0 mg 252 Cf source, assay rates of 2 to 4 rods/s are possible, thus facilitating measurement of 100 percent of a plant's throughput. (U.S.)
Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...
International Nuclear Information System (INIS)
Vrijsen, R.; Rombaut, B.; Boeye, A.
1983-01-01
Staphylococcus aureus (Cowan strain I) was used to absorb immune complexes from antiserum to poliovirus to which labeled N or H poliovirus antigens had been added, and the radioactivity in the pelleted organisms and in the supernatant was measured. Excellent agreement was obtained between values calculated separately from the pellet and supernatant readings, validating the use of supernatant measurements from a microtitration plate method. (Auth.)
Barcoded microchips for biomolecular assays.
Zhang, Yi; Sun, Jiashu; Zou, Yu; Chen, Wenwen; Zhang, Wei; Xi, Jianzhong Jeff; Jiang, Xingyu
2015-01-20
Multiplexed assay of analytes is of great importance for clinical diagnostics and other analytical applications. Barcode-based bioassays with the ability to encode and decode may realize this goal in a straightforward and consistent manner. We present here a microfluidic barcoded chip containing several sets of microchannels with different widths, imitating the commonly used barcode. A single barcoded microchip can carry out tens of individual protein/nucleic acid assays (encode) and immediately yield all assay results by a portable barcode reader or a smartphone (decode). The applicability of a barcoded microchip is demonstrated by human immunodeficiency virus (HIV) immunoassays for simultaneous detection of three targets (anti-gp41 antibody, anti-gp120 antibody, and anti-gp36 antibody) from six human serum samples. We can also determine seven pathogen-specific oligonucleotides by a single chip containing both positive and negative controls.
C-Cbl reverses HER2-mediated tamoxifen resistance in human breast cancer cells.
Li, Wei; Xu, Ling; Che, Xiaofang; Li, Haizhou; Zhang, Ye; Song, Na; Wen, Ti; Hou, Kezuo; Yang, Yi; Zhou, Lu; Xin, Xing; Xu, Lu; Zeng, Xue; Shi, Sha; Liu, Yunpeng; Qu, Xiujuan; Teng, Yuee
2018-05-02
Tamoxifen is a frontline therapy for estrogen receptor (ER)-positive breast cancer in premenopausal women. However, many patients develop resistance to tamoxifen, and the mechanism underlying tamoxifen resistance is not well understood. Here we examined whether ER-c-Src-HER2 complex formation is involved in tamoxifen resistance. MTT and colony formation assays were used to measure cell viability and proliferation. Western blot was used to detect protein expression and protein complex formations were detected by immunoprecipitation and immunofluorescence. SiRNA was used to examine the function of HER2 in of BT474 cells. An in vivo xenograft animal model was established to examine the role of c-Cbl in tumor growth. MTT and colony formation assay showed that BT474 cells are resistant to tamoxifen and T47D cells are sensitive to tamoxifen. Immunoprecipitation experiments revealed ER-c-Src-HER2 complex formation in BT474 cells but not in T47D cells. However, ER-c-Src-HER2 complex formation was detected after overexpressing HER2 in T47D cells and these cells were more resistant to tamoxifen. HER2 knockdown by siRNA in BT474 cells reduced ER-c-Src-HER2 complex formation and reversed tamoxifen resistance. ER-c-Src-HER2 complex formation was also disrupted and tamoxifen resistance was reversed in BT474 cells by the c-Src inhibitor PP2 and HER2 antibody trastuzumab. Nystatin, a lipid raft inhibitor, reduced ER-c-Src-HER2 complex formation and partially reversed tamoxifen resistance. ER-c-Src-HER2 complex formation was disrupted by overexpression of c-Cbl but not by the c-Cbl ubiquitin ligase mutant. In addition, c-Cbl could reverse tamoxifen resistance in BT474 cells, but the ubiquitin ligase mutant had no effect. The effect of c-Cbl was validated in BT474 tumor-bearing nude mice in vivo. Immunofluorescence also revealed ER-c-Src-HER2 complex formation was reduced in tumor tissues of nude mice with c-Cbl overexpression. Our results suggested that c-Cbl can reverse tamoxifen
Performance characteristics of the ARCHITECT anti-HCV assay.
Jonas, Gesa; Pelzer, Claudia; Beckert, Christian; Hausmann, Michael; Kapprell, Hans-Peter
2005-10-01
The ARCHITECT Anti-HCV assay is a fully automated high throughput chemiluminescent microparticle immunoassay (CMIA) for the detection of antibodies to structural and nonstructural proteins of the hepatitis C virus (HCV). To further enhance the performance of this test, the assay was modified to improve the specificity for blood donor specimens. The specificity of the enhanced ARCHITECT Anti-HCV assay was evaluated by screening blood donor samples randomly collected from various German blood banks, as well as hospitalized patient samples derived from Germany and the US. Additionally, antibody sensitivity was determined on commercially available anti-HCV seroconversion panels and on a commercially available worldwide anti-HCV genotype performance panel. Apparent specificity of the modified ARCHITECT Anti-HCV assay in a blood donor population consisting of 3811 specimens was 99.92%, compared to 99.76% for the current on-market assay. Additionally, antibody sensitivity was determined on commercially available anti-HCV seroconversion panels. Seroconversion sensitivity equivalent to or better than the current on-market product was observed by testing 33 seroconversion panels. This study demonstrates that the modified version of the ARCHITECT Anti-HCV assay shows improved specificity for blood donor specimens compared to the current assay on market without compromising sensitivity. With the availability of the improved ARCHITECT Anti-HCV assay and the recent launch of the ARCHITECT HIV Ag/Ab Combo assay, the ARCHITECT system now offers a full hepatitis/retrovirus menu with excellent performance on a high throughput, random access, automated analyzer, ideally suited for blood screening and diagnostic applications.
Ikeda, Mayumi; Ishima, Yu; Shibata, Akitomo; Chuang, Victor T G; Sawa, Tomohiro; Ihara, Hideshi; Watanabe, Hiroshi; Xian, Ming; Ouchi, Yuya; Shimizu, Taro; Ando, Hidenori; Ukawa, Masami; Ishida, Tatsuhiro; Akaike, Takaaki; Otagiri, Masaki; Maruyama, Toru
2017-05-29
Hydrogen sulfide (H 2 S) signaling involves polysulfide (RSS n SR') formation on various proteins. However, the current lack of sensitive polysulfide detection assays poses methodological challenges for understanding sulfane sulfur homeostasis and signaling. We developed a novel combined assay by modifying Sulfide Antioxidant Buffer (SAOB) to produce an "Elimination Method of Sulfide from Polysulfide" (EMSP) treatment solution that liberates sulfide, followed with methylene blue (MB) sulfide detection assay. The combined EMSP-MB sulfide detection assay performed on low molecular weight sulfur species showed that sulfide was produced from trisulfide compounds such as glutathione trisulfide and diallyl trisulfide, but not from the thiol compounds such as cysteine, cystine and glutathione. In the case of plasma proteins, this novel combined detection assay revealed that approximately 14.7, 1.7, 3.9, 3.7 sulfide mol/mol released from human serum albumin, α 1 -anti-trypsin, α 1 -acid glycoprotein and ovalbumin, respectively, suggesting that serum albumin is a major pool of polysulfide in human blood circulation. Taken together with the results of albumins of different species, the liberated sulfide has a good correlation with cysteine instead of methionine, indicating the site of incorporation of polysulfide is cysteine. With this novel sulfide detention assay, approximately 8,000, 120 and 1100 μM of polysulfide concentrations was quantitated in human healthy plasma, saliva and tear, respectively. Our promising polysulfide specific detection assay can be a very important tool because quantitative determination of polysulfide sheds light on the functional consequence of protein-bound cysteine polysulfide and expands the research area of reactive oxygen to reactive polysulfide species. Copyright © 2017 Elsevier B.V. All rights reserved.
Hossain, M A Motalib; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Hossain, S M Azad; Asing; Nizar, Nina Naquiah Ahmad; Uddin, Mohammad Nasir; Ali, Lokman; Asaduzzaman, Md; Akanda, Md Jahurul Haque
2017-06-01
Replacement of beef by buffalo and vice versa is frequent in global markets, but their authentication is challenging in processed foods due to the fragmentation of most biomarkers including DNA. The shortening of target sequences through use of two target sites might ameliorate assay reliability because it is highly unlikely that both targets will be lost during food processing. For the first time, we report a tetraplex polymerase chain reaction (PCR) assay targeting two different DNA regions in beef (106 and 120-bp) and buffalo (90 and 138-bp) mitochondrial genes to discriminate beef and buffalo in processed foods. All targets were stable under boiling, autoclaving and microwave cooking conditions. A survey in Malaysian markets revealed 71% beef curries contained buffalo but there was no buffalo in beef burgers. The assay detected down to 0.01ng DNA and 1% meat in admixed and burger products. Copyright © 2016 Elsevier Ltd. All rights reserved.
Short communication. Microculture syncytia assay for bovine leukemia virus
Energy Technology Data Exchange (ETDEWEB)
Paul, P.S.; Castro, A.E.; Pomeroy, K.A.; Johnson, D.W.; Muscoplat, C.C.
1978-01-01
A microculture syncytia assay for the detection of bovine leukemia virus (BLV) has been described and compared with the conventional macroculture assay. The microculture assay required fewer indicator cells, was as sensitive as the macroculture assay and provided a reproducible test for the detection and titration of BLV.
21 CFR 864.7525 - Heparin assay.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Heparin assay. 864.7525 Section 864.7525 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7525 Heparin assay. (a) Identification. A...
Hanko, Valoran P; Rohrer, Jeffrey S
2010-01-05
The current USP National Formulary contains 65 Monographs for drug formulations containing neomycin. All 65 Monographs prescribe a bioassay for neomycin assay. This bioassay, based on cell culture, is labor intensive, has poor precision, and cannot be adapted for purity or identification. High-performance anion-exchange chromatography with integrated pulsed amperometric detection (HPAE-IPAD), a liquid chromatography technique, has been shown to be suitable for neomycin purity analysis and neomycin assay of an over-the-counter first aid cream (Hanko and Rohrer [17]). Here we propose that an HPAE-IPAD assay can replace the bioassay in the 65 neomycin-containing Monographs. We applied the HPAE-IPAD assay to four neomycin-containing drug products representing the four classes of formulations found in the 65 Monographs, liquid, solid, suspension, and cream. Each drug was analyzed with two chromatography systems, and on 3 separate days. For all products, HPAE-IPAD measurements were precise and accurate with respect to the label concentrations. There was also high accuracy for spike recovery of neomycin from the four drug products throughout 70-150% of the labeled concentration. These results suggest that an HPAE-IPAD assay would be an accurate assay for neomycin, and would be faster and more precise than the current bioassay.
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
The narrow therapeutic window of glycated hemoglobin and assay variability.
Hosseini, S S; Bibler, I; Charles, M A
1999-12-01
Glycated hemoglobin is measured by a variety of assays, each of which has a unique normal level. Our purpose is to show that among the different assays available in the United States, using the same patient's blood sample, assay results may vary widely and may more or less easily achieve a glycated hemoglobin value within the normal range. The following assays were compared using the same patient's blood sample for each pair of assays: glycohemoglobin affinity assay (GHB Reader; Isolab, Akron, OH) versus gel electrophoresis assay (n = 76); Isolab versus ion capture assay (IMX; Abbott Laboratories, Irving, TX) (n = 57); monoclonal antibody assay (DCA2000; Bayer Diagnostics, Pittsburgh, PA) versus IMX (n = 100); and high-performance liquid chromatography (HPLC) assay (Bio-Rad Variant A1c; Bio-Rad Laboratories, Richmond, CA) versus IMX assay (n = 55). Our analyses indicate that a relative ranking can be established for the ease of achieving a normal glycated hemoglobin level. The ranking indicates that the most stringent or difficult assays for achieving a normal level are the Isolab and DCA2000 assays. The intermediate assays are the IMX and Bio-Rad Variant, and the easiest method for achieving a normal value is the gel electrophoresis assay. Our results indicate that various glycated hemoglobin assays vary widely and are associated with more or less difficulty for an individual patient to achieve a glycated hemoglobin level within the normal range. These results are especially significant with respect to (1) the clinically narrow therapeutic window of glycated hemoglobin values in type 1 diabetes to avoid rapidly advancing severe hypoglycemia rates and chronic microvascular complication rates, and (2) the glycated hemoglobin threshold for rapidly advancing macrovascular disease in both type 1 and type 2 patients.
Parallel force assay for protein-protein interactions.
Directory of Open Access Journals (Sweden)
Daniela Aschenbrenner
Full Text Available Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.
Have you stress tested your assay?
Directory of Open Access Journals (Sweden)
Zheng Cao
2016-08-01
Full Text Available Objectives: When a clinical assay is stressed with extraordinarily high volume of specimens over a short period of time, extra caution may be needed to avoid systematic errors and biases. Here we report our experience with a HgbA1c assay used for high volume wellness screening purpose, to illustrate the importance of stress testing during assay validation. Design and Methods: Over 15,000 whole blood specimens were tested for HgbA1c in a period of 2 months. HgbA1c was tested by an immunoturbidimetric method on a high through-put automation line. The HgbA1c population distribution in our study was compared to that from the NHANES database. Daily distributions of HgbA1c values â¥6%, means and medians were plotted. Correlation studies were performed between the high through-put immunoturbidimetric assay and a medium through-put HPLC method. Results: We observed a shift of HgbA1c distribution to the higher values compared to the NHANES. A bias of 15â20% was noted from further stress testing where large number of samples were batched and tested using the immunoturbidimetric assay. A 5â7% higher bias remained after implementing a cuvette washing program after each HgbA1c sample. We hypothesized this bias was caused by build-up of blood cell fragments in the cuvettes when continuous whole blood samples are run through the system. Our experience suggests stress testing needs to be incorporated early in the test validation process for high volume batched screening applications. This seemingly extra validation step may save significant troubleshooting and retesting efforts down the road. Keywords: Hemoglobin A1c, Immunoturbidimetric assay, HPLC, Quality assurance, Systematic bias, High volume, Automation
Rapid colorimetric assay for gentamicin injection.
Tarbutton, P
1987-01-01
A rapid colorimetric method for determining gentamicin concentration in commercial preparations of gentamicin sulfate injection was developed. Methods currently available for measuring gentamicin concentration via its colored complex with cupric ions in alkaline solution were modified to reduce the time required for a single analysis. The alkaline copper tartrate (ACT) reagent solution was prepared such that each milliliter contained 100 mumol cupric sulfate, 210 mumol potassium sodium tartrate, and 1.25 mmol sodium hydroxide. The assay involves mixing 0.3 mL gentamicin sulfate injection 40 mg/mL (of gentamicin), 1.0 mL ACT reagent, and 0.7 mL water; the absorbance of the resulting solution at 560 nm was used to calculate the gentamicin concentration in the sample. For injections containing 10 mg/mL of gentamicin, the amount of the injection was increased to 0.5 mL and water decreased to 0.5 mL. The concentration of gentamicin in samples representing 11 lots of gentamicin sulfate injection 40 mg/mL and 8 lots of gentamicin sulfate injection 10 mg/mL was determined. The specificity, reproducibility, and accuracy of the assay were assessed. The colored complex was stable for at least two hours. Gentamicin concentration ranged from 93.7 to 108% and from 95 to 109% of the stated label value of the 40 mg/mL and the 10 mg/mL injections, respectively. No components of the preservative system present in the injections interfered with the assay. Since other aminoglycosides produced a colored complex, the assay is not specific for gentamicin. The assay was accurate and reproducible over the range of 4-20 mg of gentamicin. This rapid and accurate assay can be easily applied in the hospital pharmacy setting.
Directory of Open Access Journals (Sweden)
Somayeh GHOTLOO
2015-12-01
Full Text Available Background:Limiting dilution assay is considered as the gold standard method for quantifying the number of parasites in the animal model of Leishmania infection. Nowadays, real-time PCR is being increasingly applied to quantify infectious agents. In the present study, a real-time PCR assay was developed to estimate parasite burdens in lymph nodes of Leishmania major infected BALB/C mice. Enumeration of parasites was also performed by limiting dilution assay and compared with the results of real-time PCR based quantification.Methods:The SYBR Green based real- time PCR assay was performed to amplify a 75 bp fragment of superoxide dismutase B1 gene in the lymph nodes of L. major infected BALB/C mice 8 weeks post infection. Mice were infected subcutaneously at the base of their tail with 2 × 105L. major promastigotes in the stationary phase of growth. To compare parasite burdens obtained by real-time PCR assay with those of limiting dilution assay, twelve 8-fold serial dilutions of the lymph node homogenates were prepared in the Schneider medium and incubated at 26°C.After 7 days, wells containing motile parasites were identified by direct observation under an inverted light microscope and the total number of parasites was estimated using the ELIDA software.Results:Spearman's correlation coefficient of the parasite burdens between real-time PCR and limiting dilution assay was 0.72 (Pvalue = 0.008.Conclusion:Real-time PCR assay is an appropriate replacement to existing limiting dilution assay in quantifying parasite burden in the experimental model of Leishmania infection.
Mass Spectrometry to Identify New Biomarkers of Nerve Agent Exposure
2010-04-01
preparations. Improving thermal stability by mutagene- sis or by selecting enzyme candidates in an extremophile biotope, e.g. thermophilic bacteria [36...target for oganophosphorus agent (OP) binding to enzymes is the active site serine in the consensus sequence GlyXSerXGly of acetylcholinesterase. By...human plasma. Task 6. Use a second method, for example enzyme activity assays or immunoprecipitation, to confirm the identity of soman-labeled proteins
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313
Sommer, Jurg M; Buyue, Yang; Bardan, Sara; Peters, Robert T; Jiang, Haiyan; Kamphaus, George D; Gray, Elaine; Pierce, Glenn F
2014-11-01
Due to variability in the one-stage clotting assay, the performance of new factor IX (FIX) products should be assessed in this assay. The objective of this field study was to evaluate the accuracy of measuring recombinant FIX Fc fusion protein (rFIXFc) activity in clinical haemostasis laboratories using the one-stage clotting assay. Human haemophilic donor plasma was spiked with rFIXFc or BeneFIX® at 0.80, 0.20, or 0.05 IU/ml based on label potency. Laboratories tested blinded samples using their routine one-stage assay and in-house FIX plasma standard. The mean spike recoveries for BeneFIX (n=30 laboratories) were 121 %, 144 %, and 168 % of expected at nominal 0.80, 0.20, and 0.05 IU/ml concentrations, respectively. Corresponding rFIXFc spike recoveries were 88 %, 107 %, and 132 % of expected, respectively. All BeneFIX concentrations were consistently overestimated by most laboratories. rFIXFc activity was reagent-dependent; ellagic acid and silica gave higher values than kaolin, which underestimated rFIXFc. BeneFIX demonstrated significantly reduced chromogenic assay activity relative to one-stage assay results and nominal activity, while rFIXFc activity was close to nominal activity at three concentrations with better dilution linearity than the typical one-stage assay. In conclusion, laboratory- and reagent-specific assay variabilities were revealed, with progressively higher variability at lower FIX concentrations. Non-parallelism against the FIX plasma standard was observed in all one-stage assays with rFIXFc and BeneFIX, leading to significant overestimation of FIX activity at lower levels and generally high inter-laboratory variability. Compared to the accuracy currently achieved in clinical laboratories when measuring other rFIX products, most laboratories measured rFIXFc activity with acceptable accuracy and reliability using routine one-stage assay methods and commercially available plasma standards.
Ding, Wei; Bishop, Michelle E; Lyn-Cook, Lascelles E; Davis, Kelly J; Manjanatha, Mugimane G
2016-05-04
Unrepaired DNA damage can lead to genetic instability, which in turn may enhance cancer development. Therefore, identifying potential DNA damaging agents is important for protecting public health. The in vivo alkaline comet assay, which detects DNA damage as strand breaks, is especially relevant for assessing the genotoxic hazards of xenobiotics, as its responses reflect the in vivo absorption, tissue distribution, metabolism and excretion (ADME) of chemicals, as well as DNA repair process. Compared to other in vivo DNA damage assays, the assay is rapid, sensitive, visual and inexpensive, and, by converting oxidative DNA damage into strand breaks using specific repair enzymes, the assay can measure oxidative DNA damage in an efficient and relatively artifact-free manner. Measurement of DNA damage with the comet assay can be performed using both acute and subchronic toxicology study designs, and by integrating the comet assay with other toxicological assessments, the assay addresses animal welfare requirements by making maximum use of animal resources. Another major advantage of the assays is that they only require a small amount of cells, and the cells do not have to be derived from proliferating cell populations. The assays also can be performed with a variety of human samples obtained from clinically or occupationally exposed individuals.
Ecotoxicological Assessment of Aquatic Genotoxicity Using the Comet Assay
Directory of Open Access Journals (Sweden)
KHUSNUL YAQIN
2006-09-01
Full Text Available Comet assay is a novel biological analysis, which is a sensitive, flexible, simple, rapid, and inexpensive method to assess aquatic genotoxicant. Since Singh and co-workers developed the method in 1988, its use has increased exponentially in various fields. This review discourses on the application of this assay in aquatic ecosystems. Various types of cells from various aquatic organisms have been tested by various genotoxicant both direct- and indirect-acting using the comet assay. The applications of this assay suggest that it is a useful assay to assess aquatic genotoxicants. However, there are some factors, which should be taken into account when using this assay as aquatic ecotoxicological assessment device such as inter-animal and cell variability.
Evaluation of the Abbott ARCHITECT Toxo IgM assay.
Sickinger, Eva; Braun, Hans-Bertram; Praast, Gerald; Stieler, Myriam; Gundlach, Cordelia; Birkenbach, Claudia; Prostko, John; Palafox, Mary Ann; Frias, Edwin; Hsu, Stephen; Matias, Matthew; Pucci, Dominick; Hausmann, Michael; Sagel, Ulrich; Smith, Darwin
2009-07-01
Development of the ARCHITECT Toxo IgM assay has been done to assist the clinician in acute Toxoplasma gondii infection detection, especially in pregnant women. Its use, in conjunction with ARCHITECT Toxo IgG and Toxo Avidity assays, will provide an array of assays particularly useful in the monitoring of pregnant females to determine the risk of maternal transmission of the parasite. Specificity results from 2 testing sites, using populations of pregnant females, hospital patients, and blood donors, demonstrated that the assay has an overall resolved relative specificity of 99.89% (confidence interval, 99.68-99.98%). Relative specificity for pregnant female specimens was 99.95% (n = 2031). Excellent seroconversion sensitivity was observed for the ARCHITECT Toxo IgM assay, which was similar to the Abbott AxSYM Toxo IgM assay (Abbott Laboratories, Abbott Park, IL). In more than 90% of the panels tested, the 1st bleed detected in the serial bleeds was the same for both assays.
Production and assay of forskolin antibodies
International Nuclear Information System (INIS)
Ho, L.T.; Ho, R.J.
1986-01-01
Forskolin (Fo), a cardiovascular active diterpene of plant origin, has been widely used as a research tool in regulation of the catalytic activity of adenylate cyclase (AC). A linear relationship of Fo binding to plasma membrane with activation of AC has been reported. The present abstract describes the production and assay of Fo antibodies (AB). 7-0-Hemisuccinyl-7-deacetyl Fo, coupled to either human serum albumin or goat IgG, was injected into goats to elicit AB to Fo haptan. AB to Fo in antiserum or an isolated IgG fraction was tested by two assay methods, a radioimmunoassay using 3 H-Fo as a tracer and a colorimetric enzyme-linked immunosorbent assay (ELISA) using horse radish peroxidase-rabbit anti goat IgG as indicator. The titers for Fo antiserum were 4000-10,000. In the defined assay condition, approximately 20-25% of the added 3 H-Fo was found to bind to AB. The bound radioactivity was displaced by Fo-HSA or Fo-goat IgG or free unlabelled Fo ranging from 0.5-50 pmol/tube, or 5-500 nM. The IC 50 was approximately 8-10 pmol/tube or 80-100 nM. The binding of HRP-rabbit anti goat IgG in the ELISA was inhibited by proper Fo conjugate. The development of methods for production and assay for Fo AB may be useful in the study of mechanism of activation of AC by Fo and Fo-like compound
Directory of Open Access Journals (Sweden)
Palladino Michael A
2012-12-01
Full Text Available Abstract Background Spermatic cord torsion can lead to testis ischemia (I and subsequent ischemia-reperfusion (I/R causing germ cell-specific apoptosis. Previously, we demonstrated that the hypoxia-inducible factor-1 (HIF-1 transcription factor, a key regulator of physiological responses to hypoxia, is abundant in Leydig cells in normoxic and ischemic testes. We hypothesize that testicular HIF-1 activates the expression of antiapoptotic target genes to protect Leydig cells from apoptosis. In silico analysis of testis genes containing a consensus hypoxia response element (HRE, 5’-RCGTG-3’ identified myeloid cell leukemia-1 (Mcl-1 as a potential HIF-1 target gene. The purpose of this study was to determine whether HIF-1 shows DNA-binding activity in normoxic and ischemic testes and whether Mcl-1 is a target gene of testicular HIF-1. Methods The testicular HIF-1 DNA-binding capacity was analyzed in vitro using a quantitative enzyme-linked immunosorbent assay (ELISA and electrophoretic mobility shift assays (EMSA. MCL-1 protein expression was evaluated by immunoblot analysis and immunohistochemistry. The binding of testicular HIF-1 to the Mcl-1 gene was examined via chromatin immunoprecipitation (ChIP analysis. Results The ELISA and EMSA assays demonstrated that testicular HIF-1 from normoxic and ischemic testes binds DNA equally strongly, suggesting physiological roles for HIF-1 in the normoxic testis, unlike most tissues in which HIF-1 is degraded under normoxic conditions and is only activated by hypoxia. MCL-1 protein was determined to be abundant in both normoxic and ischemic testes and expressed in Leydig cells. In a pattern identical to that of HIF-1 expression, the steady-state levels of MCL-1 were not significantly affected by I or I/R and MCL-1 co-localized with HIF-1α in Leydig cells. Chromatin immunoprecipitation (ChIP analysis using a HIF-1 antibody revealed sequences enriched for the Mcl-1 promoter. Conclusions The results
DEFF Research Database (Denmark)
Itenov, Theis S; Kirkby, Nikolai S; Bestle, Morten H
2015-01-01
BACKGROUD: Hyaluronic acid (HA) is proposed as a marker of functional liver capacity. The aim of the present study was to compare a new turbidimetric assay for measuring HA with the current standard method. METHODS: HA was measured by a particle-enhanced turbidimetric immunoassay (PETIA) and enzyme...
Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.
2010-01-01
Location analysis for estrogen receptor-? (ER?)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ER?-bound loci and quantify the incidence of ERE sequences under two stringencies of detection:
International Nuclear Information System (INIS)
Paunkovic, N.; Paunkovic, J.
2003-01-01
Radio receptor assays for the detection of TSH receptor antibodies in serum are typically based on binding the competition of TSH-R antibodies and 125I -labelled-TSH for membrane preparation of thyrocytes (TBII tests). The sensitivity of the available tests utilizing porcine cell membranes was found to be around 80%. A new test (TRAK Dyno human, BRAHMS) utilizes human recombinant TSH receptor and human standard material that is supposed to improve the performance of the test. We have compared the results of these two assays. The sensitivity of the TRAK Assay tested in 356 patients with untreated Grave's disease was found to be 85%, and 97.5% for TRAK Dyno human in 111 newly diagnosed patients. Both tests were performed from the same serum specimen for 60 of the investigated patients. The TRAK Assay was positive in 50 patients (83.2%) and TRAK Dyno human in 59 patients (98.3%). The specificity of the new radio receptor assay was also improved. (author)
Cell Culture Assay for Human Noroviruses [response
Energy Technology Data Exchange (ETDEWEB)
Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.
2007-07-01
We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools
Radioimmune assay of human platelet prostaglandin synthetase
International Nuclear Information System (INIS)
Roth, G.J.; Machuga, E.T.
1982-01-01
Normal platelet function depends, in part, on platelet PG synthesis. PG synthetase (cyclo-oxygenase) catalyzes the first step in PG synthesis, the formation of PGH 2 from arachidonic acid. Inhibition of the enzyme by ASA results in an abnormality in the platelet release reaction. Patients with pparent congenital abnormalities in the enzyme have been described, and the effects have been referred to as ''aspirin-like'' defects of the platelet function. These patients lack platelet PG synthetase activity, but the actual content of PG synthetase protein in these individuals' platelets is unknown. Therefore an RIA for human platelet PG synthetase would provide new information, useful in assessing the aspirin-like defects of platelet function. An RIA for human platelet PG synthetase is described. The assay utilizes a rabbit antibody directed against the enzyme and [ 125 I]-labelled sheep PG synthetase as antigen. The human platelet enzyme is assayed by its ability to inhibit precipitation of the [ 125 I]antigen. The assay is sensitive to 1 ng of enzyme. By the immune assay, human platelets contain approximately 1200 ng of PG synethetase protein per 1.5 mg of platelet protein (approximately 10 9 platelets). This content corresponds to 10,000 enzyme molecules per platelet. The assay provides a rapid and convenient assay for the human platelet enzyme, and it can be applied to the assessment of patients with apparent platelet PG synthetase (cyclo-oxygenase) deficiency
Complementing in vitro screening assays with in silico ...
High-throughput in vitro assays offer a rapid, cost-efficient means to screen thousands of chemicals across hundreds of pathway-based toxicity endpoints. However, one main concern involved with the use of in vitro assays is the erroneous omission of chemicals that are inactive under assay conditions but that can generate active metabolites under in vivo conditions. To address this potential issue, a case study will be presented to demonstrate the use of in silico tools to identify inactive parents with the ability to generate active metabolites. This case study used the results from an orthogonal assay designed to improve confidence in the identification of active chemicals tested across eighteen estrogen receptor (ER)-related in vitro assays by accounting for technological limitations inherent within each individual assay. From the 1,812 chemicals tested within the orthogonal assay, 1,398 were considered inactive. These inactive chemicals were analyzed using Chemaxon Metabolizer software to predict the first and second generation metabolites. From the nearly 1,400 inactive chemicals, over 2,200 first-generation (i.e., primary) metabolites and over 5,500 second-generation (i.e., secondary) metabolites were predicted. Nearly 70% of primary metabolites were immediately detoxified or converted to other metabolites, while over 70% of secondary metabolites remained stable. Among these predicted metabolites, those that are most likely to be produced and remain
Global optimization in the adaptive assay of subterranean uranium nodules
International Nuclear Information System (INIS)
Vulkan, U.; Ben-Haim, Y.
1989-01-01
An adaptive assay is one in which the design of the assay system is modified during operation in response to measurements obtained on-line. The present work has two aims: to design an adaptive system for borehole assay of isolated subterranean uranium nodules, and to investigate globality of optimal design in adaptive assay. It is shown experimentally that reasonably accurate estimates of uranium mass are obtained for a wide range of nodule shapes, on the basis of an adaptive assay system based on a simple geomorphological model. Furthermore, two concepts are identified which underlie the optimal design of the assay system. The adaptive assay approach shows promise for successful measurement of spatially random material in many geophysical applications. (author)
Sugiura, Aya; Iwahara, Kunihiro; Suga, Yasuyuki; Uchiyama, Sachinori; Maekawa, Masato
2012-04-01
We compared the ECLusys HIV combi assay (ECL HIV Ag/Ab) to the Lumipulse Forte (LPf HIV 1/2 Ab) and HISCL (HIS HIV 1/2 Ab) assays. In a dilution sensitivity test using dilution panels of WHO HIV antibody international reference panel (HIV-1 Subtype A, B, C, E, HIV-1 Group O, HIV-2) and HIV-1/2 Ab CE marked material(HIV-1, HIV-2) parent specimens, the ECL assay enabled detection at a higher level of sensitivity than either the LPf assay or the HIS assay for all dilution panels. In an early detection test in the early phase of infection in which a BBI HIV seroconversion panel was used, the ECL assay enabled detection 7 days after initial blood sample collection, whereas the LPf and HIS assays enabled detection after 27 days. In a specificity test using high RF positive specimens (n=33), pregnancy specimens (n=35), cytomegalovirus antibody positive specimens (n=36), and high M protein positive specimens (n=21) that were confirmed negative for HIV-1/2 antibodies by the LPf assay, negative results were obtained for all specimens on both the ECL assay and the HIS assay. In a correlation test using routinely collected clinical specimens (n=121), including positive stock specimens, the ECL and HIS assays demonstrated the highest agreement rate 98.3%. The above results confirmed that the fourth-generation reagent ECL assay, which simultaneously detects both HIV-1/2 antibodies and p24 antigens, is both highly sensitive and specific, and is a suitable assay for use in routine testing.
Monitoring environmental exposures with semen assays
International Nuclear Information System (INIS)
Anon.
1979-01-01
Semen studies in humans and animals have yielded extensive and compelling evidence that sperm can be used to assess reproductive potential and diagnose pathology. More recent studies on mutagens and carcinogens both at this and other laboratories suggest that a combination of mouse and human assays can be an efficient, effective approach to monitoring for reproductive hazards in the environment. We are investigating the potential of using variability in sperm morphology and DNA content to quantify and monitor the effects of environmental agents on the human testes. Here we review the status of human and mouse assays for environmental surveillance, discuss the genetic and fertility implications of chemically induced semen changes, and describe the high-speed flow methods being developed to automate sperm assays
Assay for mutagenesis in heterozygous diploid human lymphoblasts
Skopek, Thomas R.; Liber, Howard L.; Penman, Bruce W.; Thilly, William G.; Hoppe, IV, Henry
1981-01-01
An assay is disclosed for determining mutagenic damage caused by the administration of a known or suspected mutagen to diploid human lymphoblastoid cell lines. The gene locus employed for this assay is the gene for thymidine kinase, uridine kinase, or cytidine deaminase. Since human lymphoblastoid cells contain two genes for these enzymes, heterozygotes of human lymphoblastoid cells are used in this assay.
Clinical validation of the Tempus xO assay
Beaubier, Nike; Tell, Robert; Huether, Robert; Bontrager, Martin; Bush, Stephen; Parsons, Jerod; Shah, Kaanan; Baker, Tim; Selkov, Gene; Taxter, Tim; Thomas, Amber; Bettis, Sam; Khan, Aly; Lau, Denise; Lee, Christina; Barber, Matthew; Cieslik, Marcin; Frankenberger, Casey; Franzen, Amy; Weiner, Ali; Palmer, Gary; Lonigro, Robert; Robinson, Dan; Wu, Yi-Mi; Cao, Xuhong; Lefkofsky, Eric; Chinnaiyan, Arul; White, Kevin P.
2018-01-01
We have developed a clinically validated NGS assay that includes tumor, germline and RNA sequencing. We apply this assay to clinical specimens and cell lines, and we demonstrate a clinical sensitivity of 98.4% and positive predictive value of 100% for the clinically actionable variants measured by the assay. We also demonstrate highly accurate copy number measurements and gene rearrangement identification. PMID:29899824
Niu, Yuchun; Ma, Feng; Huang, Weimei; Fang, Shun; Li, Man; Wei, Ting; Guo, Linlang
2017-01-09
Taurine upregulated gene1 (TUG1) as a 7.1-kb lncRNA, has been shown to play an oncogenic role in various cancers. However, the biological functions of lncRNA TUG1 in small cell lung cancer (SCLC) remain unknown. The aim of this study is to explore the roles of TUG1 in cell growth and chemoresistance of SCLC and its possible molecular mechanism. The expression of TUG1 in thirty-three cases of SCLC tissues and SCLC cell line were examined by quantitative RT-PCR (qRT-PCR). The functional roles of TUG1 in SCLC were demonstrated by CCK8 assay, colony formation assay, wound healing assay and transwell assay, flow cytometry analysis and in vivo study through siRNA or shRNA mediated knockdown. Western blot assays were used to evaluate gene and protein expression in cell lines. Chromatin immunoprecipitation (ChIP) and RNA binding protein immunoprecipitation (RIP) were performed to confirm the molecular mechanism of TUG1 involved in cell growth and chemoresistance of small cell lung cancer. We found that TUG1 was overexpressed in SCLC tissues, and its expression was correlated with the clinical stage and the shorter survival time of SCLC patients. Moreover, downregulation of TUG1 expression could impair cell proliferation and increased cell sensitivity to anticancer drugs both in vitro and in vivo. We also discovered that TUG1 knockdown significantly promoted cell apoptosis and cell cycle arrest, and inhibited cell migration and invasion in vitro . We further demonstrated that TUG1 can regulate the expression of LIMK2b (a splice variant of LIM-kinase 2) via binding with enhancer of zeste homolog 2 (EZH2), and then promoted cell growth and chemoresistance of SCLC. Together, these results suggested that TUG1 mediates cell growth and chemoresistance of SCLC by regulating LIMK2b via EZH2.
Nondestructive assay measurements applied to reprocessing plants
International Nuclear Information System (INIS)
Ruhter, Wayne D.; Lee, R. Stephen; Ottmar, Herbert; Guardini, Sergio
1999-01-01
Nondestructive assay for reprocessing plants relies on passive gamma-ray spectrometry for plutonium isotopic and plutonium mass values of medium-to-low-density samples and holdup deposits; on active x-ray fluorescence and densitometry techniques for uranium and plutonium concentrations in solutions; on calorimetry for plutonium mass in product; and passive neutron techniques for plutonium mass in spent fuel, product, and waste. This paper will describe the radiation-based nondestructive assay techniques used to perform materials accounting measurements. The paper will also discuss nondestructive assay measurements used in inspections of reprocessing plants [ru
Directory of Open Access Journals (Sweden)
Gang Ma
2014-01-01
Full Text Available The inhibitory effect of rifampicin on the amyloid formation of hen egg white lysozyme was assessed with both Thioflavin T (ThT fluorescence assay and Fourier transform infrared (FTIR difference spectroscopy. We reveal that ThT fluorescence assay gives a false positive result due to rifampicin interference, while FTIR difference spectroscopy provides a reliable assessment. With FTIR, we show that rifampicin only has marginally inhibitory effect. We then propose that FTIR difference spectroscopy can potentially be a convenient method for inhibitor screening in amyloid study.
Comparison of Five Assays for Detection of Clostridium difficile Toxin
Chapin, Kimberle C.; Dickenson, Roberta A.; Wu, Fongman; Andrea, Sarah B.
2011-01-01
Performance characteristics of five assays for detection of Clostridium difficile toxin were compared using fresh stool samples from patients with C. difficile infection (CDI). Assays were performed simultaneously and according to the manufacturers' instructions. Patients were included in the study if they exhibited clinical symptoms consistent with CDI. Nonmolecular assays included glutamate dehydrogenase antigen tests, with positive findings followed by the Premier Toxin A and B Enzyme Immunoassay (GDH/EIA), and the C. Diff Quik Chek Complete test. Molecular assays (PCR) included the BD GeneOhm Cdiff Assay, the Xpert C. difficile test, and the ProGastro Cd assay. Specimens were considered true positive if results were positive in two or more assays. For each method, the Youden index was calculated and cost-effectiveness was analyzed. Of 81 patients evaluated, 26 (32.1%) were positive for CDI. Sensitivity of the BD GeneOhm Cdiff assay, the Xpert C. difficile test, the ProGastro Cd assay, C. Diff Quik Chek Complete test, and two-step GDH/EIA was 96.2%, 96.2%, 88.5%, 61.5%, and 42.3%, respectively. Specificity of the Xpert C. difficile test was 96.4%, and for the other four assays was 100%. Compared with nonmolecular methods, molecular methods detected 34.7% more positive specimens. Assessment of performance characteristics and cost-effectiveness demonstrated that the BD GeneOhm Cdiff assay yielded the best results. While costly, the Xpert C. difficile test required limited processing and yielded rapid results. Because of discordant results, specimen processing, and extraction equipment requirements, the ProGastro Cd assay was the least favored molecular assay. The GDH/EIA method lacked sufficient sensitivity to be recommended. PMID:21704273
Florea, Mara; Nau, Werner M
2010-03-07
A supramolecular tandem assay for direct continuous monitoring of nucleotide triphosphate-dependent enzymes such as potato apyrase is described. The underlying principle of the assay relies on the use of anion-receptor macrocycles in combination with fluorescent dyes as reporter pairs. A combinatorial approach was used to identify two complementary reporter pairs, i.e. an amino-gamma-cyclodextrin with 2-anilinonaphtalene-6-sulfonate (ANS) as dye (fluorescence enhancement factor of 17 upon complexation) and a polycationic cyclophane with 8-hydroxy-1,3,6-pyrene trisulfonate (HPTS) as dye (fluorescence decrease by a factor of more than 2000), which allow the kinetic monitoring of potato apyrase activity at different ATP concentration ranges (microM and mM) with different types of photophysical responses (switch-ON and switch-OFF). Competitive fluorescence titrations revealed a differential binding of ATP (strongest competitor) versus ADP and AMP, which constitutes the prerequisite for monitoring enzymatic conversions (dephosphorylation or phosphorylation) involving nucleotides. The assay was tested for different enzyme and substrate concentrations and exploited for the screening of activating additives, namely divalent transition metal ions (Ni(2+), Mg(2+), Mn(2+), and Ca(2+)). The transferability of the assay could be demonstrated by monitoring the dephosphorylation of other nucleotide triphosphates (GTP, TTP, and CTP).
Detection of radiation-induced apoptosis using the comet assay
International Nuclear Information System (INIS)
Wada, Seiichi; Kobayashi, Yasuhiko; Funayama, Tomoo; Yamamoto, Kazuo; Khoa, Tran Van; Natsuhori, Masahiro; Ito, Nobuhiko
2003-01-01
The electrophoresis pattern of apoptotic cells detected by the comet assay has a characteristic small head and spread tail. This image has been referred to as an apoptotic comet, but it has not been previously proven to be apoptotic cells by any direct method. In order to identify this image obtained by the comet assay as corresponding to an apoptotic cell, the frequency of appearance of apoptosis was examined using CHO-K1 and L5178Y cells which were exposed to gamma irradiation. As a method for detecting apoptosis, the terminal deoxynucleotidyl transferase mediated dUTP nick end labeling (TUNEL) assay was used. When the frequency of appearance of apoptotic cells following gamma irradiation was observed over a period of time, there was a significant increase in appearance of apoptosis when using the TUNEL assay. However, there was only a slight increase when using the comet assay. In order to verify the low frequency of appearance of apoptosis when using the comet assay, we attempted to use the TUNEL assay to satin the apoptotic comets detected in the comet assay. The apoptotic comets were TUNEL positive and the normal comets were TUNEL negative. This indicates that the apoptotic comets were formed from DNA fragments with 3'-hydroxy ends that are generated as cells undergo apoptosis. Therefore, it was understood that the characteristic pattern of apoptotic comets detected by the comet assay corresponds to cells undergoing apoptosis. (author)
Energy Technology Data Exchange (ETDEWEB)
J. W. Sterbentz; D. L. Chichester
2010-12-01
This is an end-of-year report for a project funded by the National Nuclear Security Administration's Office of Nuclear Safeguards (NA-241). The goal of this project is to investigate the feasibility of using Neutron Resonance Transmission Analysis (NRTA) to assay plutonium in commercial light-water-reactor spent fuel. This project is part of a larger research effort within the Next-Generation Safeguards Initiative (NGSI) to evaluate methods for assaying plutonium in spent fuel, the Plutonium Assay Challenge. The first-year goals for this project were modest and included: 1) developing a zero-order MCNP model for the NRTA technique, simulating data results presented in the literature, 2) completing a preliminary set of studies investigating important design and performance characteristics for the NRTA measurement technique, and 3) documentation of this work in an end of the year report (this report). Research teams at Los Alamos National Laboratory (LANL), Lawrence Berkeley National Laboratory (LBNL), Pacific Northwest National Laboratory (PNNL), and at several universities are also working to investigate plutonium assay methods for spent-fuel safeguards. While the NRTA technique is well proven in the scientific literature for assaying individual spent fuel pins, it is a newcomer to the current NGSI efforts studying Pu assay method techniques having just started in March 2010; several analytical techniques have been under investigation within this program for two to three years or more. This report summarizes a nine month period of work.
Aoki, Kimiko; Tanaka, Hiroyuki; Kawahara, Takashi
2018-07-01
The standard method for personal identification and verification of urine samples in doping control is short tandem repeat (STR) analysis using nuclear DNA (nDNA). The DNA concentration of urine is very low and decreases under most conditions used for sample storage; therefore, the amount of DNA from cryopreserved urine samples may be insufficient for STR analysis. We aimed to establish a multiplexed assay for urine mitochondrial DNA typing containing only trace amounts of DNA, particularly for Japanese populations. A multiplexed suspension-array assay using oligo-tagged microspheres (Luminex MagPlex-TAG) was developed to measure C-stretch length in hypervariable region 1 (HV1) and 2 (HV2), five single nucleotide polymorphisms (SNPs), and one polymorphic indel. Based on these SNPs and the indel, the Japanese population can be classified into five major haplogroups (D4, B, M7a, A, D5). The assay was applied to DNA samples from urine cryopreserved for 1 - 1.5 years (n = 63) and fresh blood (n = 150). The assay with blood DNA enabled Japanese subjects to be categorized into 62 types, exhibiting a discriminatory power of 0.960. The detection limit for cryopreserved urine was 0.005 ng of nDNA. Profiling of blood and urine pairs revealed that 5 of 63 pairs showed different C-stretch patterns in HV1 or HV2. The assay described here yields valuable information in terms of the verification of urine sample sources employing only trace amounts of recovered DNA. However, blood cannot be used as a reference sample.
Endoproteolytic activity assay in malting barley
Directory of Open Access Journals (Sweden)
Blanca Gómez Guerrero
2013-12-01
Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.
Some target assay uncertainties for passive neutron coincidence counting
International Nuclear Information System (INIS)
Ensslin, N.; Langner, D.G.; Menlove, H.O.; Miller, M.C.; Russo, P.A.
1990-01-01
This paper provides some target assay uncertainties for passive neutron coincidence counting of plutonium metal, oxide, mixed oxide, and scrap and waste. The target values are based in part on past user experience and in part on the estimated results from new coincidence counting techniques that are under development. The paper summarizes assay error sources and the new coincidence techniques, and recommends the technique that is likely to yield the lowest assay uncertainty for a given material type. These target assay uncertainties are intended to be useful for NDA instrument selection and assay variance propagation studies for both new and existing facilities. 14 refs., 3 tabs
International Nuclear Information System (INIS)
Raichvarg, D.; Tallet, F.; Lajeunie, E.; Bonnaire, Y.; Danglas, P.
1980-01-01
The concentrations of estrogens (E) and human placental lactogen (HLP) are estimated in sera by radio immuno-assay (RIA) and enzyme-immuno-assay (EIA). Statistical data indicate mean intra-assay variation coefficients of 7% and 12% for E and HLP tests, respectively. The correlation coefficient (RIA/EIA) are found higher than 0,9% for both hormonal assays. The dilution curves obtained by RIA and EIA are similar. However, Student'test gives a significant difference for E determination. In fact, total E and E 3 only are measured by EIA and RIA, respectively. In most cases biological interferences are negligible except for HLP in presence of higher protein or haemoglobin levels. RIA and EIA are performed to study serum HLP and E levels throughout normal pregnancies. Results allow to use EIA for HLP and E evaluations in pregnancy-monitoring [fr
Koppelman, M H G M; van Swieten, P; Cuijpers, H T M
2011-06-01
European regulations require testing of manufacturing plasma for parvovirus B19 (B19) DNA to limit the load of this virus to a maximum acceptable level of 10 IU/µL. To meet this requirement, most manufacturers introduced a test algorithm to identify and eliminate high-load donations before making large manufacturing pools of plasma units. Sanquin screens all donations using a commercial assay from Roche and an in-house assay. Between 2006 and 2009, 6.2 million donations were screened using two different polymerase chain reaction (PCR) assays targeting B19 DNA. Donations with B19 DNA loads of greater than 1 × 10(6) IU/mL showing significant differences in viral load between the two assays were further analyzed by sequencing analysis. A total of 396 donations with B19 DNA loads of greater than 1 × 10(6) IU/mL were identified. Fifteen samples (3.8%) had discordant test results; 10 samples (2.5%) were underquantified by the Roche assay, two samples (0.5%) were underquantified by the in-house assay, and three samples (0.8%) were not detected by the Roche assay. Sequencing analysis revealed mismatches in primer and probe-binding regions. Phylogenetic analysis showed that 12 samples were B19 Genotype 1. The three samples not detected by the Roche assay were B19 Genotype 2. This study shows that 3.8% of the viremic B19 DNA-positive donations are not quantified correctly by the Roche or in-house B19 DNA assays. B19 Genotype 1 isolates showing incorrect test results are more common than B19 Genotype 2 or 3 isolates. Newly designed B19 PCR assays for blood screening should preferably have multiplexed formats targeting multiple regions of the B19 genome. © 2010 American Association of Blood Banks.
Comparison of five assays for detection of Clostridium difficile toxin.
Chapin, Kimberle C; Dickenson, Roberta A; Wu, Fongman; Andrea, Sarah B
2011-07-01
Performance characteristics of five assays for detection of Clostridium difficile toxin were compared using fresh stool samples from patients with C. difficile infection (CDI). Assays were performed simultaneously and according to the manufacturers' instructions. Patients were included in the study if they exhibited clinical symptoms consistent with CDI. Nonmolecular assays included glutamate dehydrogenase antigen tests, with positive findings followed by the Premier Toxin A and B Enzyme Immunoassay (GDH/EIA), and the C. Diff Quik Chek Complete test. Molecular assays (PCR) included the BD GeneOhm Cdiff Assay, the Xpert C. difficile test, and the ProGastro Cd assay. Specimens were considered true positive if results were positive in two or more assays. For each method, the Youden index was calculated and cost-effectiveness was analyzed. Of 81 patients evaluated, 26 (32.1%) were positive for CDI. Sensitivity of the BD GeneOhm Cdiff assay, the Xpert C. difficile test, the ProGastro Cd assay, C. Diff Quik Chek Complete test, and two-step GDH/EIA was 96.2%, 96.2%, 88.5%, 61.5%, and 42.3%, respectively. Specificity of the Xpert C. difficile test was 96.4%, and for the other four assays was 100%. Compared with nonmolecular methods, molecular methods detected 34.7% more positive specimens. Assessment of performance characteristics and cost-effectiveness demonstrated that the BD GeneOhm Cdiff assay yielded the best results. While costly, the Xpert C. difficile test required limited processing and yielded rapid results. Because of discordant results, specimen processing, and extraction equipment requirements, the ProGastro Cd assay was the least favored molecular assay. The GDH/EIA method lacked sufficient sensitivity to be recommended. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Battery operated preconcentration-assisted lateral flow assay.
Kim, Cheonjung; Yoo, Yong Kyoung; Han, Sung Il; Lee, Junwoo; Lee, Dohwan; Lee, Kyungjae; Hwang, Kyo Seon; Lee, Kyu Hyoung; Chung, Seok; Lee, Jeong Hoon
2017-07-11
Paper-based analytical devices (e.g. lateral flow assays) are highly advantageous as portable diagnostic systems owing to their low costs and ease of use. Because of their low sensitivity and detection limits for biomolecules, these devices have several limitations in applications for real-field diagnosis. Here, we demonstrate a paper-based preconcentration enhanced lateral flow assay using a commercial β-hCG-based test. Utilizing a simple 9 V battery operation with a low power consumption of approximately 81 μW, we acquire a 25-fold preconcentration factor, demonstrating a clear sensitivity enhancement in the colorimetric lateral flow assay; consequently, clear colors are observed in a rapid kit test line, which cannot be monitored without preconcentration. This device can also facilitate a semi-quantitative platform using the saturation value and/or color intensity in both paper-based colorimetric assays and smartphone-based diagnostics.
Fluorescence lifetime assays: current advances and applications in drug discovery.
Pritz, Stephan; Doering, Klaus; Woelcke, Julian; Hassiepen, Ulrich
2011-06-01
Fluorescence lifetime assays complement the portfolio of established assay formats available in drug discovery, particularly with the recent advances in microplate readers and the commercial availability of novel fluorescent labels. Fluorescence lifetime assists in lowering complexity of compound screening assays, affording a modular, toolbox-like approach to assay development and yielding robust homogeneous assays. To date, materials and procedures have been reported for biochemical assays on proteases, as well as on protein kinases and phosphatases. This article gives an overview of two assay families, distinguished by the origin of the fluorescence signal modulation. The pharmaceutical industry demands techniques with a robust, integrated compound profiling process and short turnaround times. Fluorescence lifetime assays have already helped the drug discovery field, in this sense, by enhancing productivity during the hit-to-lead and lead optimization phases. Future work will focus on covering other biochemical molecular modifications by investigating the detailed photo-physical mechanisms underlying the fluorescence signal.
Elements of nondestructive assay (NDA) technology
International Nuclear Information System (INIS)
Anon.
1981-01-01
This session provides an introduction to nondestructive assay methods and instruments as they are applied to nuclear safeguards. The purpose of the sessions is to enable participants to: (1) discuss the general principles and major applications of NDA; (2) describe situations in which NDA is particularly useful for nuclear safeguards purposes; (3) distinguish between various passive and active gamma-ray and neutron NDA methods; (4) describe several NDA instruments that measure gamma rays, and identify assay situations particularly suited to gamma-ray techniques; (5) describe several NDA instruments that measure neutrons, and identify assay situations particularly suited to neutron techniques; (6) discuss the role of calorimetry in the NDA of plutonium-bearing materials; and (7) compare the advantages and disadvantages of various NDA methods for different types of nuclear materials
Detection of antibodies to the extractable nuclear antigens by enzyme linked immunosorbent assay
International Nuclear Information System (INIS)
Aziz, Khalil A.; Fzizal, Abul A.
2005-01-01
Anti-extractable nuclear antigen (ENA) antibodies are a group of autoantibodies that are directed against various components of the cell nucleus. Antibodies to these antigens are closely associated with connective tissue disease. Early diagnosis of these diseases can prove very difficult and therefore clinicians rely on the use of anti-ENA antibody testing for the exclusion. Old methods of testing are time consuming and require great skills. For these reasons clinical immunology laboratories are switching to testing for anti-ENA antibodies by enzyme linked immunosorbent assay (ELISA). The latter assays are more sensitive and require little skills. In the present study we have investigated a number of different ELISA preparations. The study was conducted at Birmingham Heartlands Hospital during the period 2003. We tested a number of ENA-positive and negative samples using 3 different commercial ELISA preparations and compared the results with traditional CCIE-assay. The present study revealed that some ELISA preparations can be more sensitive than CCIE method. Laboratories still using later method should switch to ELISA. However it is important that laboratories evaluate a long range of different ELISA preparations before selecting the most optimal one. In addition it is recommended that laboratories then audit results in order to determine true significance of such results. Finally until the true significance of ELISA generated results is known, positive ENA-results should be interpreted in conjunction with the clinical picture and this would require close liaison in between the clinical immunology laboratory and clinicians
Gavina, Ana; Antunes, Sara C.; Pinto, Glória; Claro, Maria Teresa; Santos, Conceição; Gonçalves, Fernando; Pereira, Ruth
2013-01-01
Site-specific risk assessment of contaminated areas indicates prior areas for intervention, and provides helpful information for risk managers. This study was conducted in the Ervedosa mine area (Bragança, Portugal), where both underground and open pit exploration of tin and arsenic minerals were performed for about one century (1857 – 1969). We aimed at obtaining ecotoxicological information with terrestrial and aquatic plant species to integrate in the risk assessment of this mine area. Further we also intended to evaluate if the assessment of other parameters, in standard assays with terrestrial plants, can improve the identification of phytotoxic soils. For this purpose, soil samples were collected on 16 sampling sites distributed along four transects, defined within the mine area, and in one reference site. General soil physical and chemical parameters, total and extractable metal contents were analyzed. Assays were performed for soil elutriates and for the whole soil matrix following standard guidelines for growth inhibition assay with Lemna minor and emergence and seedling growth assay with Zea mays. At the end of the Z. mays assay, relative water content, membrane permeability, leaf area, content of photosynthetic pigments (chlorophylls and carotenoids), malondialdehyde levels, proline content, and chlorophyll fluorescence (Fv/Fm and ΦPSII) parameters were evaluated. In general, the soils near the exploration area revealed high levels of Al, Mn, Fe and Cu. Almost all the soils from transepts C, D and F presented total concentrations of arsenic well above soils screening benchmark values available. Elutriates of several soils from sampling sites near the exploration and ore treatment areas were toxic to L. minor, suggesting that the retention function of these soils was seriously compromised. In Z. mays assay, plant performance parameters (other than those recommended by standard protocols), allowed the identification of more phytotoxic soils. The
Directory of Open Access Journals (Sweden)
Ana Gavina
Full Text Available Site-specific risk assessment of contaminated areas indicates prior areas for intervention, and provides helpful information for risk managers. This study was conducted in the Ervedosa mine area (Bragança, Portugal, where both underground and open pit exploration of tin and arsenic minerals were performed for about one century (1857-1969. We aimed at obtaining ecotoxicological information with terrestrial and aquatic plant species to integrate in the risk assessment of this mine area. Further we also intended to evaluate if the assessment of other parameters, in standard assays with terrestrial plants, can improve the identification of phytotoxic soils. For this purpose, soil samples were collected on 16 sampling sites distributed along four transects, defined within the mine area, and in one reference site. General soil physical and chemical parameters, total and extractable metal contents were analyzed. Assays were performed for soil elutriates and for the whole soil matrix following standard guidelines for growth inhibition assay with Lemna minor and emergence and seedling growth assay with Zea mays. At the end of the Z. mays assay, relative water content, membrane permeability, leaf area, content of photosynthetic pigments (chlorophylls and carotenoids, malondialdehyde levels, proline content, and chlorophyll fluorescence (Fv/Fm and ΦPSII parameters were evaluated. In general, the soils near the exploration area revealed high levels of Al, Mn, Fe and Cu. Almost all the soils from transepts C, D and F presented total concentrations of arsenic well above soils screening benchmark values available. Elutriates of several soils from sampling sites near the exploration and ore treatment areas were toxic to L. minor, suggesting that the retention function of these soils was seriously compromised. In Z. mays assay, plant performance parameters (other than those recommended by standard protocols, allowed the identification of more phytotoxic soils
Assay of ribulose bisphosphate carboxylase
International Nuclear Information System (INIS)
Pike, C.; Berry, J.
1987-01-01
Assays of ribulose bisphosphate carboxylase (rubisco) can be used to illustrate many properties of photosynthetic systems. Many different leaves have been assayed with this standard procedure. The tissue is ground with a mortar and pestle in extraction buffer. The supernatant after centrifugation is used as the source of enzyme. Buffer, RuBP, [ 14 C]-NaHCO 3 , and enzyme are combined in a scintillation vial; the reaction is run for 1 min at 30 0 . The acid-stable products are counted. Reproducibility in student experiments has been excellent. The assay data can be combined with analyses of leaf properties such as fresh and dry weight, chlorophyll and protein content, etc. Students have done projects such as the response of enzyme to temperature and to various inhibitors. They also report on the use of a transition state analog, carboxyarabinitol bisphosphate, to titrate the molar concentration of rubisco molecules (active sites) in an enzyme sample. Thus, using crude extracts the catalytic activity of a sample can be compared to the absolute quantity of enzyme or to the turnover number
Competitive binding assay for fructose 2,6-bisphosphate
International Nuclear Information System (INIS)
Thomas, H.; Uyeda, K.
1986-01-01
A new direct assay method for fructose 2,6-bisphosphate has been developed based on competitive binding of labeled and unlabeled fructose 2,6-P 2 to phosphofructokinase. Phosphofructokinase (0.5-1.3 pmol promoter) is incubated with saturating concentrations (5.0-5.5 pmol) of fructose 2,6[2- 32 P]P 2 and samples containing varying concentrations of fructose 2,6-P 2 . The resulting stable binary complex is retained on nitrocellulose filters with a binding efficiency of up to 70%. Standard curves obtained with this assay show strict linearity with varying fructose 2,6-P 2 in the range of 0.5 to 45 pmol, which exceeds the sensitivity of most of the previously described assay methods. Fructose 2,6-P 2 , ATP, and high concentrations of phosphate interfere with this assay. However, the extent of this inhibition is negligible since their tissue contents are one-half to one-tenth that examined. The new assay is simple, direct, rapid, and does not require pretreatment
Directory of Open Access Journals (Sweden)
Dawn N Birdsell
Full Text Available Single nucleotide polymorphisms (SNPs are abundant in genomes of all species and biologically informative markers extensively used across broad scientific disciplines. Newly identified SNP markers are publicly available at an ever-increasing rate due to advancements in sequencing technologies. Efficient, cost-effective SNP genotyping methods to screen sample populations are in great demand in well-equipped laboratories, but also in developing world situations. Dual Probe TaqMan assays are robust but can be cost-prohibitive and require specialized equipment. The Mismatch Amplification Mutation Assay, coupled with melt analysis (Melt-MAMA, is flexible, efficient and cost-effective. However, Melt-MAMA traditionally suffers from high rates of assay design failures and knowledge gaps on assay robustness and sensitivity. In this study, we identified strategies that improved the success of Melt-MAMA. We examined the performance of 185 Melt-MAMAs across eight different pathogens using various optimization parameters. We evaluated the effects of genome size and %GC content on assay development. When used collectively, specific strategies markedly improved the rate of successful assays at the first design attempt from ~50% to ~80%. We observed that Melt-MAMA accurately genotypes across a broad DNA range (~100 ng to ~0.1 pg. Genomic size and %GC content influence the rate of successful assay design in an independent manner. Finally, we demonstrated the versatility of these assays by the creation of a duplex Melt-MAMA real-time PCR (two SNPs and conversion to a size-based genotyping system, which uses agarose gel electrophoresis. Melt-MAMA is comparable to Dual Probe TaqMan assays in terms of design success rate and accuracy. Although sensitivity is less robust than Dual Probe TaqMan assays, Melt-MAMA is superior in terms of cost-effectiveness, speed of development and versatility. We detail the parameters most important for the successful application of
Substrate coated with receptor and labelled ligand for assays
International Nuclear Information System (INIS)
1980-01-01
Improvements in the procedures for assaying ligands are described. The assay consists of a polystyrene tube on which receptors are present for both the ligand to be assayed and a radioactively labelled form of the ligand. The receptors on the bottom portion of the tube are also coated with labelled ligands, thus eliminating the necessity for separate addition of the labelled ligand and sample during an assay. Examples of ligands to which this method is applicable include polypeptides, nucleotides, nucleosides and proteins. Specific examples are given in which the ligand to be assayed is digoxin, the labelled form of the ligand is 3-0-succinyl digoxyigenin tyrosine ( 125 I) and the receptor is digoxin antibody. (U.K.)
Posthuma-Trumpie, G.A.; Amerongen, van A.
2012-01-01
A simple version of immunochemical-based methods is the Lateral Flow Assay (LFA). It is a dry chemistry technique (reagents are included); the fluid from the sample runs through a porous membrane (often nitrocellulose) by capillary force. Typically the membrane is cut as a strip of 0.5*5 cm. In most
Directory of Open Access Journals (Sweden)
Grace Mary Leal-Bacelar
1995-04-01
Full Text Available An immunoprecipitation technique, ELIEDA (enzyme-linked-immuno-electro-diffusion assay, was evaluated for the diagnosis of Schistosoma mansoni infection with low worm burden. One hundred of serum samples from patients excreting less than 600 eggs per gram of feces (epg, with unrelated diseases and clinically healthy subjects were studied. In patients with egg counts higher than 200 epg, the sensitivities of IgM and IgG ELIEDA were 1.000 and 0.923, respectively, not differing from other Serologic techniques, such as indirect hemaglutination (IHAT, immunofluorescence (IFT tests and immuno-electrodiffusion assay (IEDA. However in patients with low egg counts (A técnica de imunoprecipitação ELIEDA (enzyme-linked-immuno-electro-diffusion-assay foi avaliada para fins diagnósticos da esquistossomose mansoni em pacientes com baixa carga parasitária. Amostras de soros de 50 pacientes com exame de fezes positivo para S. mansoni (carga parasitária < 600 ovos por grama de fezes = opg e 50 não esquistossomóticos (30 com outras afecções e 20 normais foram estudadas. Em pacientes com carga parasitária acima de 200 opg, a sensibilidade da técnica de ELIEDA, tanto para anticorpos IgG como IgM, respectivamente 1,000 e 0,923, não diferiu da observada para outras reações sorológicas, como a de hemaglutinação (RHA, imunofluorescênca (RIF e imunoeletrodifusão (IED. Entretanto, naqueles com baixa carga (< 100 opg, a ELIEDA-IgG mostrou resultados mais satisfatórios (0,821 que a ELIEDA-IgM (0,679, apresentando sensibilidade que não diferiu à da RIF-IgG (0,929; apesar de inferior à da RIF-IgM (0,964, a sensibilidade da ELIEDA-IgG foi superior à da RHA (0,607 e à da IED (0,536. Quanto à especificidade, esta foi comparável à dos demais testes estudados. Os dados indicam que a ELIEDA-IgG pode ser útil para diagnóstico da esquistossomose, mesmo em pacientes com pequena carga parasitária, com a vantagem de permitir estudos retrospectivos atrav
Development of a plutonium solution-assay instrument with isotopic capability
International Nuclear Information System (INIS)
Hsue, S.T.; Marks, T.
1992-01-01
A new generation of solution-assay instrument has been developed to satisfy all the assay requirements of an aqueous plutonium-recovery operation. The assay is based on a transmission-corrected passive assay technique. We have demonstrated that the system can cover a concentration range of 0.5--300 g/ell with simultaneous isotopic determination. The system can be used to assay input and eluate streams of the recovery operation. The system can be modified to measure low-concentration effluent solutions from the recovery operation covering 0.01--40 g/ell. The same system has also been modified to assay plutonium solutions enriched in 242 Pu. 6 refs
21 CFR 866.3305 - Herpes simplex virus serological assays.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Herpes simplex virus serological assays. 866.3305... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3305 Herpes simplex virus serological assays. (a) Identification. Herpes simplex virus serological assays are devices...
Application of neutron multiplicity counting to waste assay
Energy Technology Data Exchange (ETDEWEB)
Pickrell, M.M.; Ensslin, N. [Los Alamos National Lab., NM (United States); Sharpe, T.J. [North Carolina State Univ., Raleigh, NC (United States)
1997-11-01
This paper describes the use of a new figure of merit code that calculates both bias and precision for coincidence and multiplicity counting, and determines the optimum regions for each in waste assay applications. A {open_quotes}tunable multiplicity{close_quotes} approach is developed that uses a combination of coincidence and multiplicity counting to minimize the total assay error. An example is shown where multiplicity analysis is used to solve for mass, alpha, and multiplication and tunable multiplicity is shown to work well. The approach provides a method for selecting coincidence, multiplicity, or tunable multiplicity counting to give the best assay with the lowest total error over a broad spectrum of assay conditions. 9 refs., 6 figs.
Monitoring cyclodextrin-polyviologen pseudopolyrotaxanes with the Bradford assay.
Belitsky, Jason M; Nelson, Alshakim; Stoddart, J Fraser
2006-01-21
Self-assembled multivalent pseudopolyrotaxanes, composed of lactoside-bearing cyclodextrin (CD) rings threaded on linear polyviologen polymers, have been introduced recently as flexible and dynamic neoglycoconjugates. In the course of this research, it was found that polyviologens are responsive to the Bradford assay, which is traditionally highly selective for proteins. The response of the pseudopolyrotaxanes to the Bradford assay was dependant on, and thus indicative of, the degree of threading of the CD rings onto the polyelectrolyte. The assay was then used to report on the threading and dethreading of native and lactoside-bearing alpha-CD rings onto and off of polyviologen chains, a phenomenon which demonstrates the utility of biochemical assays to address problems unique to supramolecular chemistry.
LDLCHOLESTEROLEXAMINATION (LDL-C USINGHOMOGENEOUS ASSAY
Directory of Open Access Journals (Sweden)
Made DwiAmbara Putra
2013-07-01
Full Text Available Homogeneous method describe as a method that does not require separation of free and bound label. This method has the ability tofully automate the determination of LDL-C directly small sample volume sand short examination time. In addition this method use automated pipette and control of time and temperature more accurate. There are 5 methods i.e. Solubilization homogeneous LDL-C assay (SOL from KyowaMedex, Surfactant LDL-C assay (SUR from Daiichi Pure Chemicals, Protecting LDL-assay reagent (PRO from Wako Chemicals, LDL-C assaycatalase (CAT Denka Seiken and Calixarene of LDL-C assay (CAL from International Reagents Corporation. All method is to use a variety of detergents and other chemicals that cause blocking or dissolution of specific lipoprotein classes to achieve specificity for LDL. Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}
Marrow stem cell release in the autorepopulation assay
Energy Technology Data Exchange (ETDEWEB)
Maloney, M A; Patt, H M [California Univ., San Francisco (USA). Lab. of Radiobiology
1978-01-01
The early migration of stem cells from shielded marrow to an irradiated spleen has been re-evaluated, and the findings have been compared with the results of earlier studies. The composite data reveal a constant rate during the first 24 h after irradiation, with a slope of 1.6 cells per h and an intercept of 2.4. The positive intercept is interpreted to signify an immediate brief perturbation of CFU/sub s/ release. The low concentration of CFU/sub s/ in the bloodstream, despite their continuous migration from the shielded marrow, is indicative of a rapid, and probably greatly increased, blood turnover. Despite the constancy of stem cell seeding, it is not yet possible to determine whether the rate of stem cell release is different in shielded marrow than in normal marrow. The resolution of this question requires more precise information about spleen seeding efficiency in the autorepopulation assay and about the normal turnover rate of stem cells in the bloodstream.
Peacock, W Frank; Diercks, Deborah; Birkhahn, Robert; Singer, Adam J; Hollander, Judd E; Nowak, Richard; Safdar, Basmah; Miller, Chadwick D; Peberdy, Mary; Counselman, Francis; Chandra, Abhinav; Kosowsky, Joshua; Neuenschwander, James; Schrock, Jon; Lee-Lewandrowski, Elizabeth; Arnold, William; Nagurney, John
2016-09-01
We aimed to compare the diagnostic accuracy of the Alere Triage Cardio3 Tropinin I (TnI) assay (Alere, Inc., USA) and the PathFast cTnI-II (Mitsubishi Chemical Medience Corporation, Japan) against the central laboratory assay Singulex Erenna TnI assay (Singulex, USA). Using the Markers in the Diagnosis of Acute Coronary Syndromes (MIDAS) study population, we evaluated the ability of three different assays to identify patients with acute myocardial infarction (AMI). The MIDAS dataset, described elsewhere, is a prospective multicenter dataset of emergency department (ED) patients with suspected acute coronary syndrome (ACS) and a planned objective myocardial perfusion evaluation. Myocardial infarction (MI) was diagnosed by central adjudication. The C-statistic with 95% confidence intervals (CI) for diagnosing MI by using a common population (n=241) was 0.95 (0.91-0.99), 0.95 (0.91-0.99), and 0.93 (0.89-0.97) for the Triage, Singulex, and PathFast assays, respectively. Of samples with detectable troponin, the absolute values had high Pearson (R(P)) and Spearman (R(S)) correlations and were R(P)=0.94 and R(S)=0.94 for Triage vs Singulex, R(P)=0.93 and R(S)=0.85 for Triage vs PathFast, and R(P)=0.89 and R(S)=0.73 for PathFast vs Singulex. In a single comparative population of ED patients with suspected ACS, the Triage Cardio3 TnI, PathFast, and Singulex TnI assays provided similar diagnostic performance for MI.
Pathology consultation on anticoagulation monitoring: factor X-related assays.
Wool, Geoffrey D; Lu, Chuanyi M
2013-11-01
To review various anticoagulation therapies and related laboratory monitoring issues, with a focus on factor X-related chromogenic assays. A case-based approach is used to review pertinent published literatures and product inserts of anticoagulation drugs and to look back on clinical use of factor X-related chromogenic assays. The number of anticoagulants available to clinicians has increased greatly in the past decade. Whether and how these anticoagulants should be monitored are areas of uncertainty for clinicians, which can lead to misuse of laboratory assays and suboptimal patient management. Factor X-related assays are of particular concern because of the similar and often confusing test names. Based on a common clinical case scenario and literature review regarding anticoagulant monitoring, an up-to-date discussion and review of the various factor X-related assays are provided, focusing on the differences in test designs and clinical utilities between the chromogenic anti-Xa and chromogenic factor X activity assays. Anticoagulation therapy and related laboratory monitoring are rapidly evolving areas of clinical practices. A good knowledge of relevant laboratory assays and their clinical applications is necessary to help optimize patient care.
Directory of Open Access Journals (Sweden)
Thangavelu K
2004-01-01
Full Text Available Abstract Background The genus Morus, known as mulberry, is a dioecious and cross-pollinating plant that is the sole food for the domesticated silkworm, Bombyx mori. Traditional methods using morphological traits for classification are largely unsuccessful in establishing the diversity and relationships among different mulberry species because of environmental influence on traits of interest. As a more robust alternative, PCR based marker assays including RAPD and ISSR were employed to study the genetic diversity and interrelationships among twelve domesticated and three wild mulberry species. Results RAPD analysis using 19 random primers generated 128 discrete markers ranging from 500–3000 bp in size. One-hundred-nineteen of these were polymorphic (92%, with an average of 6.26 markers per primer. Among these were a few putative species-specific amplification products which could be useful for germplasm classification and introgression studies. The ISSR analysis employed six anchored primers, 4 of which generated 93 polymorphic markers with an average of 23.25 markers per primer. Cluster analysis of RAPD and ISSR data using the WINBOOT package to calculate the Dice coefficient resulted into two clusters, one comprising polyploid wild species and the other with domesticated (mostly diploid species. Conclusion These results suggest that RAPD and ISSR markers are useful for mulberry genetic diversity analysis and germplasm characterization, and that putative species-specific markers may be obtained which can be converted to SCARs after further studies.
A Continuous, Fluorogenic Sirtuin 2 Deacylase Assay
DEFF Research Database (Denmark)
Galleano, Iacopo; Schiedel, Matthias; Jung, Manfred
2016-01-01
and kinetic insight regarding sirtuin inhibitors, it is important to have access to efficient assays. In this work, we report readily synthesized fluorogenic substrates enabling enzyme-economical evaluation of SIRT2 inhibitors in a continuous assay format as well as evaluation of the properties of SIRT2...
Serafini, R; Varner, D D; Bissett, W; Blanchard, T L; Teague, S R; Love, C C
2015-09-15
Unilateral orchiectomy (UO) may interfere with thermoregulation of the remaining testis caused by inflammation surrounding the incision site, thus altering normal spermatogenesis and consequently sperm quality. Two measures of sperm DNA quality (neutral comet assay and the sperm chromatin structure assay [SCSA]) were compared before UO (0 days) and at 14, 30, and 60 days after UO to determine whether sperm DNA changed after a mild testis stress (i.e., UO). The percent DNA in the comet tail was higher at 14 and 60 days compared to 0 days (P comet tail measures (i.e., length, moment, migration) were higher at all time periods after UO compared to 0 days (P comet assay and the SCSA, which was not identified using traditional measures of sperm quality. Copyright © 2015 Elsevier Inc. All rights reserved.
First 25-hydroxyvitamin D assay for general chemistry analyzers.
Saida, Fakhri B; Chen, Xiaoru; Tran, Kiet; Dou, Chao; Yuan, Chong
2015-03-01
25-Hydroxyvitamin D [25(OH)D], the predominant circulating form of vitamin D, is an accurate indicator of the general vitamin D status of an individual. Because vitamin D deficiencies have been linked to several pathologies (including osteoporosis and rickets), accurate monitoring of 25(OH)D levels is becoming increasingly important in clinical settings. Current 25(OH)D assays are either chromatographic or immunoassay-based assays. These assays include HPLC, liquid chromatography-tandem mass spectrometry (LC-MS/MS), enzyme-immunosorbent, immunochemiluminescence, immunofluorescence and radioimmunoassay. All these assays use heterogeneous formats that require phase separation and special instrumentations. In this article, we present an overview of these assays and introduce the first homogeneous assay of 25(OH)D for use on general chemistry analyzers. A special emphasis is put on the unique challenges posed by the 25(OH)D analyte. These challenges include a low detection limit, the dissociation of the analyte from its serum transporter and the inactivation of various binding proteins without phase separation steps.
Polonis, Victoria R; Brown, Bruce K; Rosa Borges, Andrew; Zolla-Pazner, Susan; Dimitrov, Dimiter S; Zhang, Mei-Yun; Barnett, Susan W; Ruprecht, Ruth M; Scarlatti, Gabriella; Fenyö, Eva-Maria; Montefiori, David C; McCutchan, Francine E; Michael, Nelson L
2008-06-05
In AIDS vaccine development the pendulum has swung towards a renewed emphasis on the potential role for neutralizing antibodies in a successful global vaccine. It is recognized that vaccine-induced antibody performance, as assessed in the available neutralization assays, may well serve as a "gatekeeper" for HIV-1 subunit vaccine prioritization and advancement. As a result, development of a standardized platform for reproducible measurement of neutralizing antibodies has received considerable attention. Here we review current advancements in our knowledge of the performance of different types of antibodies in a traditional primary cell neutralization assay and the newer, more standardized TZM-bl reporter cell line assay. In light of recently revealed differences (see accompanying article) in the results obtained in these two neutralization formats, parallel evaluation with both platforms should be contemplated as an interim solution until a better understanding of immune correlates of protection is achieved.
The c-Myc (MYC) transcription factor is a major cancer driver and a well-validated therapeutic target. However, directly targeting MYC has been challenging. Thus, identifying proteins that interact with and regulate MYC may provide alternative strategies to inhibit its oncogenic activity. Here we report the development of a NanoLuc®-based protein-fragment complementation assay (NanoPCA) and mapping of the MYC protein interaction hub in live mammalian cells.
Enko, Dietmar; Fridrich, Leo; Rezanka, Erwin; Stolba, Robert; Ernst, Juliane; Wendler, Iris; Fabian, Daniel; Hauptlorenz, Susanne; Halwachs-Baumann, Gabriele
2014-01-01
Background: Over the last decade, clinical interest to evaluate human 25-hydroxy-vitamin D (25[OH]D) serum levels has increased exponentially. In the present study, four chemiluminescence immunoassays (CLIA), one radioimmunoassy (RIA), and one high performance liquid chromatography (HPLC) method were compared and also with the liquid chromatography-tandem mass spectrometry (LC-MS/MS) method in view of 25(OH)D serum level determination. Methods: For the method comparison, blood samples from 133 consecutive patients were prospectively collected. All participants gave written informed consent for their blood samples to be used in this study. They came to the Department of Nuclear Medicine of the Central Hospital Steyr (Austria) for osteodensidometric measurement as part of their preventive medical check-up. Pearson's correlation coefficients, Bland-Altman plots, and paired t-tests were calculated. Assay-specific reference ranges were considered using blood samples from persons with normal parathormone, calcium, and total-protein values (n = 97). Results: The highest correlation was between the HPLC and the LC-MS/MS method (r = 0.96). The lowest correlation was between the cobas Vitamin D3 assay (Roche) and any of the evaluated assays (r = 0.46 - 0.63). Bland-Altman plots revealed a big negative mean bias in three assays (cobas Vitamin D3 assay [Roche]: -22.8; DiaSorin LIAISON [25[OH]D total CLIA [Diasorin]: -18.4; Diasorin 25[OH]D125 I RIA [Diasorin]: -23.8 [nmol/L]) and a much smaller positive mean bias in the other assays (ClinRep complete 25[OH]D2/D3 HPLC kit [Recipe]: 2.7; ADVIA Centaur Vitamin D total assay [Siemens]: 8.2; IDS total vitamin D assay [Immunodiagnostic Systems]: 12.1 [nmol/L]) compared to the LC-MS/MS method. Meanwhile, the manufacturer has withdrawn the cobas Vitamin D3 assay from the market. Conclusions: Poor antibody specificity with cross-reactivity to other vitamin D metabolites, incomplete extraction of the 25(OH)D analyte from the vitamin D
Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum
2018-04-01
ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.
The glucose oxidase-peroxidase assay for glucose
The glucose oxidase-peroxidase assay for glucose has served as a very specific, sensitive, and repeatable assay for detection of glucose in biological samples. It has been used successfully for analysis of glucose in samples from blood and urine, to analysis of glucose released from starch or glycog...
Development of a heavy metals enzymatic-based assay using papain
International Nuclear Information System (INIS)
Shukor, Yunus; Baharom, Nor Azlan; Rahman, Fadhil Abd.; Abdullah, Mohd. Puad; Shamaan, Nor Aripin; Syed, Mohd. Arif
2006-01-01
A heavy metals enzymatic-based assay using papain was developed. Papain was assayed using the Casein-coomassie-dye-binding assay. The assay is sensitive to several heavy metals. The IC 50 (concentration of toxicant giving 50% inhibition) of Hg 2+ , Ag 2+ , Pb 2 , Zn 2+ is 0.39, 0.40, 2.16, 2.11 mg l -1 , respectively. For Cu 2+ and Cd 2+ the LOQ (limits of quantitation) is 0.004 and 0.1 mg l -1 , respectively. The IC 50 and LOQ values were found to be generally comparable to several other enzymatic and bioassays tests such as: immobilized urease, 15-min Microtox TM , 48 h Daphnia magna, and 96 h Rainbow trout. The papain assay is xenobiotics tolerant, has a wide pH for optimum activity, is temperature stable, and has a relatively quick assay time. The papain assay was used to identify polluted water samples from industrial sources in Penang, Malaysia. We found one site where the assay gave a positive toxic response. The toxicity of the site was confirmed using Atomic Emission Spectrometry analysis
Fujisawa, Masaki; Ito, Yasuhiro
2013-01-01
The developmental process of ripening is unique to fleshy fruits and a key factor in fruit quality. The tomato (Solanum lycopersicum) MADS-box transcription factor RIPENING INHIBITOR (RIN), one of the earliest-acting ripening regulators, is required for broad aspects of ripening, including ethylene-dependent and -independent pathways. However, our knowledge of direct RIN target genes has been limited, considering the broad effects of RIN on ripening. In a recent work published in The Plant Cell, we identified 241 direct RIN target genes by chromatin immunoprecipitation coupled with DNA microarray (ChIP-chip) and transcriptome analysis. Functional classification of the targets revealed that RIN participates in the regulation of many biological processes including well-known ripening processes such as climacteric ethylene production and lycopene accumulation. In addition, we found that ethylene is required for the full expression of RIN and several RIN-targeting transcription factor genes at the ripening stage. Here, based on our recently published findings and additional data, we discuss the ripening processes regulated by RIN and the interplay between RIN and ethylene. PMID:23518588
40 CFR 79.67 - Glial fibrillary acidic protein assay.
2010-07-01
... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Glial fibrillary acidic protein assay... Glial fibrillary acidic protein assay. (a) Purpose. Chemical-induced injury of the nervous system, i.e... paragraph (e)(3) in this section). Assays of glial fibrillary acidic protein (GFAP), the major intermediate...
Establishment of immunoradiometric assay for free prostate-specific antigen
International Nuclear Information System (INIS)
Ma Lianxue
2009-01-01
An immunoradiometric assay (IRMA) of free prostate specific antigen (F-PSA) in serum was established. One monoclonal antibody against total PSA (T-PSA) was coated on the plastic tubes, the other against F-PSA was labeled with 125 I. The sensitivity of assay was 0.04 μg/L (n=20, +2s), the CVs were 2.9%-4.0% for the intra-assay and 3.5%-10.5% for the inter-assay and the average recovery was 102.7%. The correlative equation comparing with the FPSA-RIA (CIS BIO) is y=0.965 1 χ -0.001 1, and r=0.996 4. This F-PSA IRMA is a sensitive and precise method in detecting F-PSA and fit for the vitro assay. (authors)
Targeted resequencing and variant validation using pxlence PCR assays
Directory of Open Access Journals (Sweden)
Frauke Coppieters
2016-01-01
Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.
Development of an integrated assay facility
International Nuclear Information System (INIS)
Molesworth, T.V.; Bailey, M.; Findlay, D.J.S.; Parsons, T.V.; Sene, M.R.; Swinhoe, M.T.
1990-01-01
The I.R.I.S. concept proposed the use of passive examination and active interrogation techniques in an integrated assay facility. A linac would generate the interrogating gamma and neutron beams. Insufficiently detailed knowledge about active neutron and gamma interrogation of 500 litre drums of cement immobilised intermediate level waste led to a research programme which is now in its main experimental stage. Measurements of interrogation responses are being made using simulated waste drums containing actinide samples and calibration sources, in an experimental assay assembly. Results show that responses are generally consistent with theory, but that improvements are needed in some areas. A preliminary appraisal of the engineering and economic aspects of integrated assay shows that correct operational sequencing is required to achieve the short cycle time needed for high throughput. The main engineering features of a facility have been identified
A new semiquantitative radiometric opsonin assay
International Nuclear Information System (INIS)
Yamamura, M.; Valdimarsson, H.
1978-01-01
A new semiquantitative radiometric opsonin assay is described. It was found that the opsonin activity generated by incubating brewer's yeast, Saccharomyces cerevisiae, in medium containing less than 5% human serum was exclusively complement dependent. In contrast, C.albicans was effectively opsonized in the absence of complement. Antibodies and the early classical complement pathway did not contribute to the opsonization of S.cerevisiae and neither did C5-9. The brewer's yeast assay can therefore be used for measuring selectively the opsonizing capacity of the alternative pathway. Sera from approximately 7% of apparently healthy adult controls consistently failed to generate significant opsonin activity while 8 out of 26 patients with suspected immune deficiency of unknown cause were defective in this assay. All opsonin deficient sera so far tested had haemolytically normal alternative pathway and Factor B activity. (author)
Xiang, Yuqian; Zhang, Junyu; Li, Qiaoli; Zhou, Xinyao; Wang, Teng; Xu, Mingqing; Xia, Shihui; Xing, Qinghe; Wang, Lei; He, Lin; Zhao, Xinzhi
2014-09-01
Utilizing epigenetic (DNA methylation) differences to differentiate between maternal peripheral blood (PBL) and fetal (placental) DNA has been a promising strategy for non-invasive prenatal testing (NIPT). However, the differentially methylated regions (DMRs) have yet to be fully ascertained. In the present study, we performed genome-wide comparative methylome analysis between maternal PBL and placental DNA from pregnancies of first trimester by methylated DNA immunoprecipitation-sequencing (MeDIP-Seq) and Infinium HumanMethylation450 BeadChip assays. A total of 36 931 DMRs and 45 804 differentially methylated sites (DMSs) covering the whole genome, exclusive of the Y chromosome, were identified via MeDIP-Seq and Infinium 450k array, respectively, of which 3759 sites in 2188 regions were confirmed by both methods. Not only did we find the previously reported potential fetal DNA markers in our identified DMRs/DMSs but also we verified fully the identified DMRs/DMSs in the validation round by MassARRAY EpiTYPER. The screened potential fetal DNA markers may be used for NIPT on aneuploidies and other chromosomal diseases, such as cri du chat syndrome and velo-cardio-facial syndrome. In addition, these potential markers may have application in the early diagnosis of placental dysfunction, such as pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Development of fluorescent methods for DNA methyltransferase assay
Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang
2017-03-01
DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.
Development of novel IVD assays: a manufacturer's perspective.
Metcalfe, Thomas A
2010-01-01
IVD manufacturers are heavily reliant on novel IVD assays to fuel their growth and drive innovation within the industry. They represent a key part of the IVD industry's value proposition to customers and the healthcare industry in general, driving product differentiation, helping to create demand for new systems and generating incremental revenue. However, the discovery of novel biomarkers and their qualification for a specific clinical purpose is a high risk undertaking and the large, risky investments associated with doing this on a large scale are incompatible with IVD manufacturer's business models. This article describes the sources of novel IVD assays, the processes for discovering and qualifying novel assays and the reliance of IVD manufacturers on collaborations and in-licensing to source new IVD assays for their platforms.
A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-03-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.
A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response
Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole
2009-01-01
IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219
Assaying Auxin Receptor Activity Using SPR Assays with F-Box Proteins and Aux/IAA Degrons.
Quareshy, Mussa; Uzunova, Veselina; Prusinska, Justyna M; Napier, Richard M
2017-01-01
The identification of TIR1 as an auxin receptor combined with advanced biophysical instrumentation has led to the development of real-time activity assays for auxins. Traditionally, molecules have been assessed for auxinic activity using bioassays, and agrochemical compound discovery continues to be based on "spray and pray" technologies. Here, we describe the methodology behind an SPR-based assay that uses TIR1 and related F-box proteins with surface plasmon resonance spectrometry for rapid compound screening. In addition, methods for collecting kinetic binding data and data processing are given so that they may support programs for rational design of novel auxin ligands.
Tiefenbacher, S; Bohra, R; Amiral, J; Bowyer, A; Kitchen, S; Lochu, A; Rosén, S; Ezban, M
2017-10-01
Essentials Nonacog beta pegol (N9-GP) is an extended half-life, recombinant human factor IX (FIX). One-stage clotting (OSC) and chromogenic FIX activity assays were assessed for N9-GP recovery. OSC STA ® -Cephascreen ® , ROX FIX and BIOPHEN FIX chromogenic assays were qualified for N9-GP. Other extended half-life factor products should be assessed in a similar way prior to approval. Background Nonacog beta pegol (N9-GP) is an extended half-life, glycoPEGylated recombinant human factor IX that is under development for the prophylaxis and treatment of bleeding episodes in hemophilia B patients. Considerable reagent-dependent variability has been observed when one-stage clotting assays are used to measure the recovery of recombinant FIX products, including N9-GP. Objective To qualify select one-stage clotting and chromogenic FIX activity assays for measuring N9-GP recovery. Methods The accuracy and precision of the one-stage clotting assay (with the STA-Cephascreen activated partial thromboplastin [APTT] reagent) and the ROX Factor IX and BIOPHEN Factor IX chromogenic assays for measuring N9-GP recovery were assessed in N9-GP-spiked hemophilia B plasma samples in a systematic manner at three independent sites, with manufacturer-recommended protocols and/or site-specific assay setups, including different instruments. Results For each of the three FIX activity assays qualified on five different reagent-instrument systems, acceptable intra-assay and interassay accuracy and precision, dilution integrity, reagent robustness and freeze-thaw and short-term sample stabilities were demonstrated. The STA-Cephascreen assay showed a limited reportable range at one of the three qualification sites, and the BIOPHEN Factor IX assay showed suspect low-end sensitivity at one of the three qualification sites. An individual laboratory would account for these limitations by adjusting the assay's reportable range; thus, these findings are not considered to impact the respective
Evaluation of three gentamicin serum assay techniques
International Nuclear Information System (INIS)
Matzke, G.R.; Gwizdala, C.; Wery, J.; Ferry, D.; Starnes, R.
1982-01-01
This investigation was designed to compare the enzyme-modified immunoassay (Syva--EMIT) with a radioimmunoassay (New England Nuclear--RIA) and the radiometric assay (Johnston--BACTEC) to determine the optimal assay for use in our aminoglycoside dosing service. The serum concentration determinations obtained via the three assay methods were analyzed by linear regression analysis. Significant positive correlations were noted between the three assay techniques (p less than 0.005) during both sample collection phases. The coefficients of determination for EMIT vs BACTEC and RIA vs BACTEC were 0.73 and 0.83 during phase 1, respectively, and 0.65 and 0.68 during phase 2, respectively. The slope of the regression lines also varied markedly during the two phases; 0.49 and 0.42 for EMIT and for RIA vs BACTEC, respectively, during phase 1 compound with 1.12 and 0.77, respectively, during phase 2. The differences noted in these relationships during phase 1 and 2 may be related to the alteration of the pH of the control sera utilized in the BACTEC assay. In contrast, RIA vs EMIT regression analysis indicated that existence of a highly significant relationship (p less than 0.0005 and r2 . 0.90). The EMIT technique was the easiest and most accurate for determination of serum gentamicin concentrations, whereas the BACTEC method was judged unacceptable for clinical use
Specific binding-adsorbent assay method and test means
International Nuclear Information System (INIS)
1981-01-01
A description is given of an improved specific binding assay method and test means employing a nonspecific adsorbent for the substance to be determined, particularly hepatitis B surface (HBsub(s)) antigen, in its free state or additionally in the form of its immune complex. The invention is illustrated by 1) the radioimmunoadsorbent assay for HBsub(s) antigen, 2) the radioimmunoadsorbent assay for HBsub(s) antigen in the form of immune complex with antibody, 3) a study of adsorption characteristics of various anion exchange materials for HBsub(s) antigen, 4) the use of hydrophobic adsorbents in a radioimmunoadsorbent assay for HBsub(s) antigen and 5) the radioimmunoadsorbent assay for antibody to HBsub(s) antigen. The advantages of the present method for detecting HBsub(s) antigen compared to previous methods include the manufacturing advantages of eliminating the need for insolubilised anti-HBsub(s) and the advantages of a single incubation step, fewer manipulations, storability of adsorbent materials, increased sensitivity and versatility of detecting HBsub(s) antigen in the form of its immune complex if desired. (U.K.)
Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei
2011-11-01
Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.
[PREPARATION OF HUMAN TISSUE PROTEIN EXTRACTS ENRICHED WITH THE SPHINGOMYELIN SYNTHASE 1].
Sudarkina, O Yu; Dergunova, L V
2015-01-01
Sphingomyelin synthase 1 (SMS 1) catalyzes sphingomyelin biosynthesis in eukaryotic cells. We previously studied the structure of the human SGMS1 gene, which encodes the enzyme and its numerous transcripts. The tissue-specific expression of the transcripts was also described. Analysis of the SMS1 protein expression in human tissues using immunoblotting of tissue extracts prepared in the RIPA (Radio Immuno-Precipitation Assay) buffer revealed a weak signal in renal cortex, testis, lung, and no signal in placenta and lymphatic node. In this work, a new method of preparation of the tissue protein extracts enriched with SMS1 was suggested. The method based on the consecutive extraction with a buffer containing 0.05 and 1 mg/ml of the Quillaja saponaria saponin allowed SMS1 to be detected in all tissues tested. The SMS1 content in the saponin extract of kidney cortex is about 12-fold higher compared to the RIPA extraction procedure.
Directory of Open Access Journals (Sweden)
Chenshuang Li
2018-01-01
Full Text Available Neural EGFL like 1 (Nell-1 is essential for chondrogenic differentiation, maturation, and regeneration. Our previous studies have demonstrated that Nell-1’s pro-chondrogenic activities are predominantly reliant upon runt-related transcription factor 3 (Runx3-mediated Indian hedgehog (Ihh signaling. Here, we identify the nuclear factor of activated T-cells 1 (Nfatc1 as the key transcriptional factor mediating the Nell-1 → Runx3 signal transduction in chondrocytes. Using chromatin immunoprecipitation assay, we were able to determine that Nfatc1 binds to the −833–−810 region of the Runx3-promoter in response to Nell-1 treatment. By revealing the Nell-1 → Nfatc1 → Runx3 → Ihh cascade, we demonstrate the involvement of Nfatc1, a nuclear factor of activated T-cells, in chondrogenesis, while providing innovative insights into developing a novel therapeutic strategy for cartilage regeneration and other chondrogenesis-related conditions.
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
Applying thermal neutron radiography to non-destructive assays of dynamic systems
International Nuclear Information System (INIS)
Silvani, Maria I.; Almeida, Gevaldo L. de; Goncalves, Marcelo J.; Lopes, Ricardo T.
2008-01-01
Dynamic processes or systems frequently can not have their behavior directly analyzed due to safety reasons or because they require destructive assays, which can not be always afforded when high-cost equipment, devices and components are involved. Under these circumstances, some kind of non-destructive technique should be applied to preserve the safety of the personnel performing the assay, as well as the integrity of the piece being inspected. Thermal neutrons are specially suited as a tool for this purpose, thanks to their capability to pass through metallic materials, which could be utterly opaque to X-rays. This paper describes the accomplishments achieved at the Instituto de Engenharia Nuclear / CNEN, Brazil, aiming at the development of an Image Acquisition System capable to perform non-destructive assays using thermal neutrons. It is comprised of a thermal neutron source provided by the Argonauta research reactor, a converter-scintillating screen, and a CCD-based video camera optically coupled to the screen through a dark chamber equipped with a mirror. The developed system has been used to acquire 2D neutron radiographic images of static devices to reveal their inner structure, as well as movies of running systems and working devices to verify its functioning and soundness. Radiographic images of objects taken at different angles would be later on used as projections to retrieve - through a proper unfolding software - their 3D images expressed as attenuation coefficients for thermal neutrons. A quantitative performance of the system has been assessed through its Modulation Transfer Function - MTF. In order to determine this curve, unique collimators designed to simulate different spatial frequencies have been manufactured. Besides that, images of some objects have been acquired with the system being developed as well as using the conventional radiographic film, allowing thus a qualitative comparison between them. (author)
Rose, Alexandra; Funk, Deborah; Neiger, Reto
2016-04-01
To compare total protein (TP) concentrations in canine pleural and abdominal fluid specimens as measured by refractometry and biuret assay. Diagnostic test evaluation. Data regarding 92 pleural and 148 abdominal fluid specimens from dogs with various diseases. TP concentrations in fluid specimens as measured by refractometry and biuret assay were recorded. Strength of association between sets of measurements was assessed by Spearman rank correlations and Bland-Altman plots. Optimal concentration cutoff for diagnostic discrimination between exudate and nonexudate was identified by construction of receiver operating characteristic curves. Median TP concentration in pleural fluid specimens was 2.7 g/dL (range, 0.3 to 4.8 g/dL) for refractometry and 2.9 g/dL (range, 0.7 to 5.8 g/dL) for biuret assay. Median TP concentration in abdominal fluid specimens was 3.5 g/dL (range, 0.1 to 6.0 g/dL) for refractometry and 3.5 g/dL (range, 0.6 to 5.7 g/dL) for biuret assay. Correlation was significant between refractometric and biuret results for pleural (ρ = 0.921) and abdominal (ρ = 0.908) fluid. Bland-Altman plots revealed bias of -0.18 g/dL for pleural fluid and -0.03 g/dL for abdominal fluid for refractometry versus biuret assay. With a TP concentration of ≥ 3 g/dL used to distinguish exudate from nonexudate, sensitivity of refractometry was 77% for pleural fluid and 80% for abdominal fluid. Specificity was 100% and 94%, respectively. Refractometry yielded acceptable results for measurement of TP concentration in canine pleural and abdominal fluid specimens, providing a more rapid and convenient method than biuret assay.
Microbead agglutination based assays
Kodzius, Rimantas; Castro, David; Foulds, Ian G.; Parameswaran, Ash M.; Sumanpreet, K. Chhina
2013-01-01
We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microbeads in the presence of a specific analyte thus enabling
Daikoku, Tohru; Kudoh, Ayumi; Fujita, Masatoshi; Sugaya, Yutaka; Isomura, Hiroki; Tsurumi, Tatsuya
2004-12-24
The Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is required for maintenance of the viral genome DNA during the latent phase of EBV replication but continues to be synthesized after the induction of viral productive replication. An EBV genome-wide chromatin immunoprecipitation assay revealed that EBNA1 constantly binds to oriP of the EBV genome during not only latent but also lytic infection. Although the total levels of EBNA1 proved constant throughout the latter, the levels of the oriP-bound form were increased as lytic infection proceeded. EBV productive DNA replication occurs at discrete sites in nuclei, called replication compartments, where viral replication proteins are clustered. Confocal laser microscopic analyses revealed that whereas EBNA1 was distributed broadly in nuclei as fine punctate dots during the latent phase of infection, the protein became redistributed to the viral replication compartments and localized as distinct spots within and/or nearby the compartments after the induction of lytic replication. Taking these findings into consideration, oriP regions of the EBV genome might be organized by EBNA1 into replication domains that may set up scaffolding for lytic replication and transcription.
Tanaka, Yosuke; Niwa, Shinsuke; Dong, Ming; Farkhondeh, Atena; Wang, Li; Zhou, Ruyun; Hirokawa, Nobutaka
2016-06-15
KIF1A is a major axonal transport motor protein, but its functional significance remains elusive. Here we show that KIF1A-haploinsufficient mice developed sensory neuropathy. We found progressive loss of TrkA(+) sensory neurons in Kif1a(+/-) dorsal root ganglia (DRGs). Moreover, axonal transport of TrkA was significantly disrupted in Kif1a(+/-) neurons. Live imaging and immunoprecipitation assays revealed that KIF1A bound to TrkA-containing vesicles through the adaptor GTP-Rab3, suggesting that TrkA is a cargo of the KIF1A motor. Physiological measurements revealed a weaker capsaicin response in Kif1a(+/-) DRG neurons. Moreover, these neurons were hyposensitive to nerve growth factor, which could explain the reduced neuronal survival and the functional deficiency of the pain receptor TRPV1. Because phosphatidylinositol 3-kinase (PI3K) signaling significantly rescued these phenotypes and also increased Kif1a mRNA, we propose that KIF1A is essential for the survival and function of sensory neurons because of the TrkA transport and its synergistic support of the NGF/TrkA/PI3K signaling pathway. Copyright © 2016 Elsevier Inc. All rights reserved.
A Broad RNA Virus Survey Reveals Both miRNA Dependence and Functional Sequestration
DEFF Research Database (Denmark)
Scheel, Troels K H; Luna, Joseph M; Liniger, Matthias
2016-01-01
, critically depended on the interaction of cellular miR-17 and let-7 with the viral 3' UTR. Unlike canonical miRNA interactions, miR-17 and let-7 binding enhanced pestivirus translation and RNA stability. miR-17 sequestration by pestiviruses conferred reduced AGO binding and functional de...... immunoprecipitation (CLIP) of the Argonaute (AGO) proteins to characterize strengths and specificities of miRNA interactions in the context of 15 different RNA virus infections, including several clinically relevant pathogens. Notably, replication of pestiviruses, a major threat to milk and meat industries...
Modular enrichment measurement system for in-situ enrichment assay
International Nuclear Information System (INIS)
Stewart, J.P.
1976-01-01
A modular enrichment measurement system has been designed and is in operation within General Electric's Nuclear Fuel Fabrication Facility for the in-situ enrichment assay of uranium-bearing materials in process containers. This enrichment assay system, which is based on the ''enrichment meter'' concept, is an integral part of the site's enrichment control program and is used in the in-situ assay of the enrichment of uranium dioxide (UO 2 ) powder in process containers (five gallon pails). The assay system utilizes a commercially available modular counting system and a collimnator designed for compatability with process container transport lines and ease of operator access. The system has been upgraded to include a microprocessor-based controller to perform system operation functions and to provide data acquisition and processing functions. Standards have been fabricated and qualified for the enrichment assay of several types of uranium-bearing materials, including UO 2 powders. The assay system has performed in excess of 20,000 enrichment verification measurements annually and has significantly contributed to the facility's enrichment control program
Neutron Assay System for Con?nement Vessel Disposition
International Nuclear Information System (INIS)
Frame, Katherine C.; Bourne, Mark M.; Crooks, William J.; Evans, Louise; Mayo, Douglas R.; Miko, David K.; Salazar, William R.; Stange, Sy; Valdez, Jose I.; Vigil, Georgiana M.
2012-01-01
Waste will be removed from confinement vessels remaining from 1970s-era experiments. Los Alamos has 9+ spherical confinement vessels remaining from experiments. Each vessel contains ∼ 500 lbs of radioactive debris such as actinide metals and oxides, metals, powdered silica, graphite, and wires and hardware. In order to dispose of the vessels, debris and contamination must be removed. Neutron assay system was designed to assay vessels before and after cleanout. System requirements are: (1) Modular and moveable; (2) Capable of detecting ∼100g 239 Pu equivalent in a 2-inch thick steel sphere with 6 foot diameter; and (3) Capable of safeguards-quality assays. Initial design parameters arethe use of 4-atm 3 He tubes with length of 6 feet, and 3 He tubes embedded in polyethelene for moderation. This paper describes the calibration of the Confinement Vessel Assay System (CVAS) and quantification of its uncertainties. Assay uncertainty depends on five factors: (1) Statistical uncertainty in the assay measurement; (2) Statistical uncertainty in the background measurement; (3) Statistical uncertainty in the isotopics determination - This should be much smaller than the other uncertainties; (4) Systematic uncertainty due to position bias; and (5) Systematic uncertainty due to fluctuations in cosmic ray spallation. This one can be virtually eliminated by performing the background measurement with an empty vessel - but that may not be possible. We used modeling and experiments to quantify the systematic uncertainties. The calibration assumes a uniform distribution of material, but reality will be different. MCNPX modeling was used to quantify the positional bias. The model was benchmarked to build confidence in its results. Material at top of vessel is 44% greater than amount assayed, according to singles. Material near 19-tube detector is 38% less than amount assayed, according to singles. Cosmic ray spallation contributes significantly to the background. Comparing rates
Sachse, Konrad; Rahman, Kh Shamsur; Schnee, Christiane; Müller, Elke; Peisker, Madlen; Schumacher, Thomas; Schubert, Evelyn; Ruettger, Anke; Kaltenboeck, Bernhard; Ehricht, Ralf
2018-03-16
Serological analysis of Chlamydia (C.) spp. infections is still mainly based on micro-immunofluorescence and ELISA. To overcome the limitations of conventional serology, we have designed a novel microarray carrying 52 synthetic peptides representing B-cell epitopes from immunodominant proteins of all 11 chlamydial species. The new assay has been validated using monospecific mouse hyperimmune sera. Subsequently, serum samples from cattle, sheep and humans with a known history of chlamydial infection were examined. For instance, the specific humoral response of sheep to treatment with a C. abortus vaccine has been visualized against a background of C. pecorum carriership. In samples from humans, dual infection with C. trachomatis and C. pneumoniae could be demonstrated. The experiments revealed that the peptide microarray assay was capable of simultaneously identifying specific antibodies to each Chlamydia spp. The actual assay represents an open platform test that can be complemented through future advances in Chlamydia proteome research. The concept of the highly parallel multi-antigen microarray proven in this study has the potential to enhance our understanding of antibody responses by defining not only a single quantitative response, but also the pattern of this response. The added value of using peptide antigens will consist in unprecedented serodiagnostic specificity.
Kraynak, A R; Barnum, J E; Cunningham, C L; Ng, A; Ykoruk, B A; Bennet, B; Stoffregen, D; Merschman, M; Freeland, E; Galloway, S M
2015-07-01
As part of the Japanese Center for the Validation of Alternative Methods (JaCVAM) initiative international validation study of the in vivo rat alkaline comet assay (comet assay), we examined the ability of the assay to determine the genotoxicity of 2-acetylaminofluorene (AAF), azidothymidine (AZT), cisplatin (CPN), and isobutyraldehyde (IBA) in liver and glandular stomach of male Sprague-Dawley rats. Rats were given oral doses of test compound or control once daily for three days. High dose levels were approximately maximum tolerated doses and were based on preliminary range-finding studies. Tissues were harvested 3h after the final dose (48h after the initial dose). A bone marrow micronucleus assay (MN) was also conducted on the rats treated with AZT, CPN, and IBA. Acute toxic effects of treatment were determined primarily through histomorphologic analysis of liver and stomach but also by body weight and serum liver enzyme changes. The comet assay was conducted on fresh tissue preparations but frozen samples from two studies were also assayed. Statistically significant dose-related differences in comet % DNA in tail were found in liver and stomach for the genotoxin AZT and in liver for the genotoxin CPN, but not in liver or stomach for the non-genotoxin IBA. Statistically significant differences in % DNA in tail were measured in liver for the low and mid dose of the genotoxin AAF, but not the high dose. The comet assays of frozen liver suspensions from CPN- and AAF-treated rats yielded comparable results to the assays of fresh preparations. There were no indications of significant toxicity induced by any treatment. The micronucleus assay was positive for CPN and AZT and negative for IBA. In conclusion, the in vivo comet assay is capable of detecting genotoxic effects of a variety of chemicals and may fill an important role in the genotoxicity test battery. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
International Nuclear Information System (INIS)
Barth, A.
1984-01-01
A comparative evaluation of two radioenzymatic procedures to determine the concentration of noradrenaline in the plasma - with linearity, sensitivity, specifity and accuracy serving as test criteria - led to the following results: In view of a probability of error in the order of 2% both methods were judged to show a satisfactory sensitivity. The specific of the COMT assay, by contrast with that of the PNMT assay, was found to be wanting, as the noradrenaline measurements in the presence of other biogenic amines were biassed in such a way that the values determined were higher than the actual concentrations. During antihypertensive treatment even minimal changes in the noradrenaline concentration can be ascertained on a quantitative basis. If suitable hardware is available, the COMT assay permits up to 25 single determinations to be carried out per day, while the number of double determinations is restricted to 7 per day. One advantage, however, lies in the fact that several catecholamines in the plasma can be detected simultaneously, if required. In cases where the noradrenaline concentration alone is to be determined for clinical purposes, preference should be given to the PNMT assay, as both tests showed equal linearity and sensitivity. (TRV) [de
Radioligand assay for biotin in liver tissues
International Nuclear Information System (INIS)
Rettenmaier, R.
1979-01-01
A radioligand assay for biotin in liver tissue is described. 3 H-biotin is used as tracer and avidin as binder. The biotin-loaded avidin is separated from free biotin on dextran-coated charcoal, which leaves the avidin-biotin complex in the supernatant liquid. Thus, the avidin-biotin complex can easily be utilized for determination of the radioactivity. Calibration with known additions of biotin in the range 0.25-8.0 ng per assay sample yields a linear logit-log plot. The biotin is extracted from liver tissues by enzymatic proteolysis with papain. This treatment is optimized to liberate the bound forms of the vitamin. Microbiological parallel assays with Lactobacillus plantarum were in good agreement with the radioligand assay giving a regression coefficient of 0.974(n=44). The coefficient of variation was found to be 4.2% in the range 500-1200 ng of biotin per g of liver tissue (n=46). The method is simple and reliable and allows the simultaneous analysis of a considerable number of samples. (Auth.)
Assays of D-Amino Acid Oxidase Activity
Directory of Open Access Journals (Sweden)
Elena Rosini
2018-01-01
Full Text Available D-amino acid oxidase (DAAO is a well-known flavoenzyme that catalyzes the oxidative FAD-dependent deamination of D-amino acids. As a result of the absolute stereoselectivity and broad substrate specificity, microbial DAAOs have been employed as industrial biocatalysts in the production of semi-synthetic cephalosporins and enantiomerically pure amino acids. Moreover, in mammals, DAAO is present in specific brain areas and degrades D-serine, an endogenous coagonist of the N-methyl-D-aspartate receptors (NMDARs. Dysregulation of D-serine metabolism due to an altered DAAO functionality is related to pathological NMDARs dysfunctions such as in amyotrophic lateral sclerosis and schizophrenia. In this protocol paper, we describe a variety of direct assays based on the determination of molecular oxygen consumption, reduction of alternative electron acceptors, or α-keto acid production, of coupled assays to detect the hydrogen peroxide or the ammonium production, and an indirect assay of the α-keto acid production based on a chemical derivatization. These analytical assays allow the determination of DAAO activity both on recombinant enzyme preparations, in cells, and in tissue samples.
Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression
International Nuclear Information System (INIS)
Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto; Osada, Shigehiro; Imagawa, Masayoshi
2009-01-01
The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins are known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.
Directory of Open Access Journals (Sweden)
Jae-Moon Shin
Full Text Available OBJECTIVE: Melittin (MEL, a major component of bee venom, has been associated with various diseases including arthritis, rheumatism and various cancers. In this study, the anti-angiogenic effects of MEL in CaSki cells that were responsive to the epidermal growth factor (EGF were examined. METHODOLOGY/PRINCIPAL FINDINGS: MEL decreased the EGF-induced hypoxia-inducible factor-1α (HIF-1α protein and significantly regulated angiogenesis and tumor progression. We found that inhibition of the HIF-1α protein level is due to the shortened half-life by MEL. Mechanistically, MEL specifically inhibited the EGF-induced HIF-1α expression by suppressing the phosphorylation of ERK, mTOR and p70S6K. It also blocked the EGF-induced DNA binding activity of HIF-1α and the secretion of the vascular endothelial growth factor (VEGF. Furthermore, the chromatin immunoprecipitation (ChIP assay revealed that MEL reduced the binding of HIF-1α to the VEGF promoter HRE region. The anti-angiogenesis effects of MEL were confirmed through a matrigel plus assay. CONCLUSIONS: MEL specifically suppressed EGF-induced VEGF secretion and new blood vessel formation by inhibiting HIF-1α. These results suggest that MEL may inhibit human cervical cancer progression and angiogenesis by inhibiting HIF-1α and VEGF expression.
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1α
International Nuclear Information System (INIS)
Esencay, Mine; Sarfraz, Yasmeen; Zagzag, David
2013-01-01
Glioblastomas, the most common and malignant brain tumors of the central nervous system, exhibit high invasive capacity, which hinders effective therapy. Therefore, intense efforts aimed at improved therapeutics are ongoing to delineate the molecular mechanisms governing glioma cell migration and invasion. In order to perform the studies, we employed optimal cell culture methods and hypoxic conditions, lentivirus-mediated knockdown of protein expression, Western Blot analysis, migration assays and immunoprecipitation. We determined statistical significance by unpaired t-test. In this report, we show that U87MG, LN229 and LN308 glioma cells express CXCR7 and that exposure to hypoxia upregulates CXCR7 protein expression in these cell lines. CXCR7-expressing U87MG, LN229 and LN308 glioma cells migrated towards stromal-derived factor (SDF)-1α/CXCL12 in hypoxic conditions in the Boyden chamber assays. While shRNA-mediated knockdown of CXCR7 expression did not affect the migration of any of the three cell lines in normoxic conditions, we observed a reduction in the migration of LN229 and LN308, but not U87MG, glioma cells towards SDF-1α in hypoxic conditions. In addition, knockdown of CXCR7 expression in LN229 and LN308 glioma cells decreased levels of SDF-1α-induced phosphorylation of ERK1/2 and Akt. Inhibiting CXCR4 in LN229 and LN308 glioma cells that were knocked down for CXCR7 did not further reduce migration towards SDF-1α in hypoxic conditions and did not affect the levels of phosphorylated ERK1/2 and Akt. Analysis of immunoprecipitated CXCR4 from LN229 and LN308 glioma cells revealed co-precipitated CXCR7. Taken together, our findings indicate that both CXCR4 and CXCR7 mediate glioma cell migration towards SDF-1α in hypoxic conditions and support the development of therapeutic agents targeting these receptors
Rad51-Rad52 mediated maintenance of centromeric chromatin in Candida albicans.
Directory of Open Access Journals (Sweden)
Sreyoshi Mitra
2014-04-01
Full Text Available Specification of the centromere location in most eukaryotes is not solely dependent on the DNA sequence. However, the non-genetic determinants of centromere identity are not clearly defined. While multiple mechanisms, individually or in concert, may specify centromeres epigenetically, most studies in this area are focused on a universal factor, a centromere-specific histone H3 variant CENP-A, often considered as the epigenetic determinant of centromere identity. In spite of variable timing of its loading at centromeres across species, a replication coupled early S phase deposition of CENP-A is found in most yeast centromeres. Centromeres are the earliest replicating chromosomal regions in a pathogenic budding yeast Candida albicans. Using a 2-dimensional agarose gel electrophoresis assay, we identify replication origins (ORI7-LI and ORI7-RI proximal to an early replicating centromere (CEN7 in C. albicans. We show that the replication forks stall at CEN7 in a kinetochore dependent manner and fork stalling is reduced in the absence of the homologous recombination (HR proteins Rad51 and Rad52. Deletion of ORI7-RI causes a significant reduction in the stalled fork signal and an increased loss rate of the altered chromosome 7. The HR proteins, Rad51 and Rad52, have been shown to play a role in fork restart. Confocal microscopy shows declustered kinetochores in rad51 and rad52 mutants, which are evidence of kinetochore disintegrity. CENP-ACaCse4 levels at centromeres, as determined by chromatin immunoprecipitation (ChIP experiments, are reduced in absence of Rad51/Rad52 resulting in disruption of the kinetochore structure. Moreover, western blot analysis reveals that delocalized CENP-A molecules in HR mutants degrade in a similar fashion as in other kinetochore mutants described before. Finally, co-immunoprecipitation assays indicate that Rad51 and Rad52 physically interact with CENP-ACaCse4 in vivo. Thus, the HR proteins Rad51 and Rad52
Microchemiluminescent assay system
Energy Technology Data Exchange (ETDEWEB)
Kiel, J.L.
1986-04-09
The patent concerns a microchemiluminescent assay system, which can be used to detect ionizing radiation, heat or specific substances. The method involves the use of a complex formed from serum albumin and a luminescer which, in the presence of ionizing radiation (heat, or a specific analyte), will emit light in an amount proportional to the amount of radiation, etc. (U.K.).
Characterization and Validation of the LT-SYS Copper Assay on a Roche Cobas 8000 c502 Analyzer.
Kraus, F Bernhard; Mischereit, Marlies; Eller, Christoph; Ludwig-Kraus, Beatrice
2017-02-01
Validation of the LT-SYS quantitative in vitro copper assay on a Roche Cobas 8000 c502 analyzer and comparison with a BIOMED assay on a Roche Cobas Mira analyzer. Imprecision and bias were quantified at different concentration levels (serum and plasma) over a 20-day period. Linearity was assessed covering a range from 4.08 µmol/L to 33.8 µmol/L. Limit of blank (LoB) and limit of detection (LoD) were established based on a total of 120 blank and low-level samples. The method comparison was based on 58 plasma samples. Within-run imprecision ranged from 0.7% to 1.2% and within-laboratory imprecision from 1.4% to 3.3%. Relative bias for the 2 serum pools with known target values was less than 2.5%. The assay did not deviate from linearity over the tested measuring range. LoB and LoD were 0.12 µmol/L and 0.23 µmol/L, respectively. The method comparison revealed an average deviation of 11.5% (2.016 µmol/L), and the linear regression fit was y = 1.464 + 0.795x. The LT-SYS copper assay characterized in this study showed a fully acceptable performance with good degrees of imprecision and bias, no deviation from linearity in the relevant measuring rangem, and very low LoB and LoD. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Use of polymeric dyes in lignin biodegradation assays
International Nuclear Information System (INIS)
Gold, M.H.; Alic, M.; Glenn, J.K.
1988-01-01
This paper reviews the historical use of various 14 C-radiolabeled and unlabeled substrates to screen for ligninolytic activity. The disadvantages of these assays are presented. The authors describe the development of assays utilizing polymeric dyes
Pi overlapping ring systems contained in a homogeneous assay: a novel homogeneous assay for antigens
Kidwell, David A.
1993-05-01
A novel immunoassay, Pi overlapping ring systems contained in a homogeneous assay (PORSCHA), is described. This assay relies upon the change in fluorescent spectral properties that pyrene and its derivatives show with varying concentration. Because antibodies and other biomolecules can bind two molecules simultaneously, they can change the local concentration of the molecules that they bind. This concentration change may be detected spectrally as a change in the fluorescence emission wavelength of an appropriately labeled biomolecule. Several tests of PORSCHA have been performed which demonstrate this principle. For example: with streptavidin as the binding biomolecule and a biotin labeled pyrene derivative, the production of the excimer emitting at 470 nm is observed. Without the streptavidin present, only the monomer emitting at 378 and 390 nm is observed. The ratio of monomer to excimer provides the concentration of unlabeled biotin in the sample. Approximately 1 ng/mL of biotin may be detected with this system using a 50 (mu) l sample (2 X 10-16 moles biotin). The principles behind PORSCHA, the results with the streptavidin/biotin system are discussed and extensions of the PORSCHA concept to antibodies as the binding partner and DNA in homogeneous assays are suggested.
International Nuclear Information System (INIS)
Sklyanskaya, E.I.; Varich, N.L.; Amvrosieva, T.V.; Kaverin, N.V.
1985-01-01
Phenotypically mixed virus yields, obtained by coinfection of MDCK cells with influenza A/WSN/33 and B/Lee/40 viruses, contained both A/WSN/33 and B/Lee/40 NP proteins, as revealed by polyacrylamide gel electrophoresis of the purified 14 C-amino acids-labeled virus. Virions were lysed with 0.6 M KCl-Triton X-100 buffer, and nucleocapsids were immunoprecipitated with antibodies against NP protein of influenza A virus. Polyacrylamide gel electrophoresis of the immunoprecipitate revealed NP protein of A/WSN/33 but not of B/Lee/40 virus. However, in similar experiments with the lysates of doubly infected cells, the band of B/Lee/40 NP protein was revealed in the polyacrylamide gel electrophoresis patterns of the immunoprecipitates. In an attempt to analyze the RNA content of the immune complexes, the authors absorbed the lysates of doubly infected [ 3 H]uridine-labeled cells with protein A-containing Staphylococcus aureus covered with antibodies against the NP protein of influenza A virus. RNA extracted from the immune complexes contained genomic RNA segments of both A/WSN/33 and B/Lee/40 viruses. In control samples containing an artificial mixture of cell lysates separately infected with each virus, the analysis revealed homologous components (i.e., A/WSN/33 NP protein or RNA segments) in the immune complexes. The results suggest the presence of phenotypically mixed nucleocapsids in the cells doubly infected with influenza A and B viruses; in the course of the virion formation, the nucleocapsids lacking the heterologous NP protein are selected
Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay
Directory of Open Access Journals (Sweden)
Farzaneh Lotfipour
2015-06-01
Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.
New low-viscosity overlay medium for viral plaque assays
Directory of Open Access Journals (Sweden)
Garten Wolfgang
2006-08-01
Full Text Available Abstract Background Plaque assays in cell culture monolayers under solid or semisolid overlay media are commonly used for quantification of viruses and antiviral substances. To overcome the pitfalls of known overlays, we tested suspensions of microcrystalline cellulose Avicel RC/CL™ as overlay media in the plaque and plaque-inhibition assay of influenza viruses. Results Significantly larger plaques were formed under Avicel-containing media, as compared to agar and methylcellulose (MC overlay media. The plaque size increased with decreasing Avicel concentration, but even very diluted Avicel overlays (0.3% ensured formation of localized plaques. Due to their low viscosity, Avicel overlays were easier to use than methylcellulose overlays, especially in the 96-well culture plates. Furthermore, Avicel overlay could be applied without prior removal of the virus inoculum thus facilitating the assay and reducing chances of cross-contamination. Using neuraminidase inhibitor oseltamivir carboxylate, we demonstrated applicability of the Avicel-based plaque reduction assay for testing of antiviral substances. Conclusion Plaque assay under Avicel-containing overlay media is easier, faster and more sensitive than assays under agar- and methylcellulose overlays. The assay can be readily performed in a 96-well plate format and seems particularly suitable for high-throughput virus titrations, serological studies and experiments on viral drug sensitivity. It may also facilitate work with highly pathogenic agents performed under hampered conditions of bio-safety labs.
Quantitative Fissile Assay In Used Fuel Using LSDS System
Lee, YongDeok; Jeon, Ju Young; Park, Chang-Je
2017-09-01
A quantitative assay of isotopic fissile materials (U235, Pu239, Pu241) was done at Korea Atomic Energy Research Institute (KAERI), using lead slowing down spectrometer (LSDS). The optimum design of LSDS was performed based on economics, easy maintenance and assay effectiveness. LSDS system consists of spectrometer, neutron source, detection and control. LSDS system induces fissile fission and fast neutrons are collected at fission chamber. The detected signal has a direct relation to the mass of existing fissile isotopes. Many current commercial assay technologies have a limitation in direct application on isotopic fissile assay of spent fuel, except chemical analysis. In the designed system, the fissile assay model was setup and the correction factor for self-shield was obtained. The isotopic fissile content assay was performed by changing the content of Pu239. Based on the fuel rod, the isotopic content was consistent with 2% uncertainty for Pu239. By applying the covering (neutron absorber), the effective shielding was obtained and the activation was calculated on the target. From the assay evaluation, LSDS technique is very powerful and direct to analyze the isotopic fissile content. LSDS is applicable for nuclear fuel cycle and spent fuel management for safety and economics. Additionally, an accurate fissile content will contribute to the international transparency and credibility on spent fuel.
International network for comparison of HIV neutralization assays: the NeutNet report.
Fenyö, Eva Maria; Heath, Alan; Dispinseri, Stefania; Holmes, Harvey; Lusso, Paolo; Zolla-Pazner, Susan; Donners, Helen; Heyndrickx, Leo; Alcami, Jose; Bongertz, Vera; Jassoy, Christian; Malnati, Mauro; Montefiori, David; Moog, Christiane; Morris, Lynn; Osmanov, Saladin; Polonis, Victoria; Sattentau, Quentin; Schuitemaker, Hanneke; Sutthent, Ruengpung; Wrin, Terri; Scarlatti, Gabriella
2009-01-01
Neutralizing antibody assessments play a central role in human immunodeficiency virus type-1 (HIV-1) vaccine development but it is unclear which assay, or combination of assays, will provide reliable measures of correlates of protection. To address this, an international collaboration (NeutNet) involving 18 independent participants was organized to compare different assays. Each laboratory evaluated four neutralizing reagents (TriMab, 447-52D, 4E10, sCD4) at a given range of concentrations against a panel of 11 viruses representing a wide range of genetic subtypes and phenotypes. A total of 16 different assays were compared. The assays utilized either uncloned virus produced in peripheral blood mononuclear cells (PBMCs) (virus infectivity assays, VI assays), or their Env-pseudotyped (gp160) derivatives produced in 293T cells (PSV assays) from molecular clones or uncloned virus. Target cells included PBMC and genetically-engineered cell lines in either a single- or multiple-cycle infection format. Infection was quantified by using a range of assay read-outs that included extracellular or intracellular p24 antigen detection, RNA quantification and luciferase and beta-galactosidase reporter gene expression. PSV assays were generally more sensitive than VI assays, but there were important differences according to the virus and inhibitor used. For example, for TriMab, the mean IC50 was always lower in PSV than in VI assays. However, with 4E10 or sCD4 some viruses were neutralized with a lower IC50 in VI assays than in the PSV assays. Inter-laboratory concordance was slightly better for PSV than for VI assays with some viruses, but for other viruses agreement between laboratories was limited and depended on both the virus and the neutralizing reagent. The NeutNet project demonstrated clear differences in assay sensitivity that were dependent on both the neutralizing reagent and the virus. No single assay was capable of detecting the entire spectrum of neutralizing
Novel Risk Stratification Assays for Acute Coronary Syndrome.
Ahmed, Haitham M; Hazen, Stanley L
2017-08-01
Since identification of aspartate aminotransferase as the first cardiac biomarker in the 1950s, there have been a number of new markers used for myocardial damage detection over the decades. There have also been several generations of troponin assays, each with progressively increasing sensitivity for troponin detection. Accordingly, the "standard of care" for myocardial damage detection continues to change. The purpose of this paper is to review the clinical utility, biological mechanisms, and predictive value of these various biomarkers in contemporary clinical studies. As of this writing, a fifth "next" generation troponin assay has now been cleared by the US Food and Drug Administration for clinical use in the USA for subjects presenting with suspected acute coronary syndromes. Use of these high-sensitivity assays has allowed for earlier detection of myocardial damage as well as greater negative predictive value for infarction after only one or two serial measurements. Recent algorithms utilizing these assays have allowed for more rapid rule-out of myocardial infarction in emergency department settings. In this review, we discuss novel assays available for the risk assessment of subjects presenting with chest pain, including both the "next generation" cardiac troponin assays as well as other novel biomarkers. We review the biological mechanisms for these markers, and explore the positive and negative predictive value of the assays in clinical studies, where reported. We also discuss the potential use of these new markers within the context of future clinical care in the modern era of higher sensitivity troponin testing. Finally, we discuss advances in new platforms (e.g., mass spectrometry) that historically have not been considered for rapid in vitro diagnostic capabilities, but that are taking a larger role in clinical diagnostics, and whose prognostic value and power promise to usher in new markers with potential for future clinical utility in acute coronary
[Evaluation of serum PIVKA-II by Lumipulse PrestoII assay].
Hiramatsu, Kumiko; Tanaka, Yasuhito; Takagi, Kazumi; Kani, Satomi; Goto, Takaaki; Takasaka, Yoshimitsu; Matsuura, Kentaro; Sugauchi, Fuminaka; Moriyama, Kazushige; Murakami, Hiroshi; Kitajima, Sachiko; Mizokami, Masashi
2009-03-01
Measurements of serum concentrations of Des-gamma-carboxy Prothrombin (PIVKA-II) are widely used for diagnosing hepatocellular carcinoma (HCC). Recently, in Lumipulsef assay, it was reported that antibodies against alkaline phosphatase (ALP) derived from anti bleeding sheets led false high values of PIVKA-II in the patients with HCC resection. To improve the previous issue, newly developed Lumipulse PrestoII assay was examined. (1) The assay was reliable and positively correlated with the previous assays (Lumipulse f and Picolumi, R = 0.997 and 0.994 (n=115), respectively). (2) Eleven cases, which had false high values of PIVKA-II by the Lumipulsef assay, were examined by the PrestoII assay with excess of inactive ALP. The false high values of 10 cases were improved, but only one was still high. False reactivity of this case was stronger than other cases, more effective adsorption was required. (3) Comparing the absorbent activity of inactive ALP among 6 different kinds, we found inactive ALP with much higher adsorbent activity. When this inactive ALP was applied to assay, false high values of PIVKA-II were improved in all 11 cases. In conclusion, the PrestoII assay, which applies the inactive ALP with high activity, is reliable and useful for clinical screening.
Drosophila comet assay: insights, uses, and future perspectives
Gaivão, Isabel; Sierra, L. María
2014-01-01
The comet assay, a very useful tool in genotoxicity and DNA repair testing, is being applied to Drosophila melanogaster since around 15 years ago, by several research groups. This organism is a valuable model for all kind of processes related to human health, including DNA damage response. The assay has been performed mainly in vivo using different larvae cell types (from brain, midgut, hemolymph, and imaginal disk), but also in vitro with the S2 cell line. Since its first application, it has been used to analyze the genotoxicity and action mechanisms of different chemicals, demonstrating good sensitivity and proving its usefulness. Moreover, it is the only assay that can be used to analyze DNA repair in somatic cells in vivo, comparing the effects of chemicals in different repair strains, and to quantitate repair activities in vitro. Additionally, the comet assay in Drosophila, in vivo and in vitro, has been applied to study the influence of protein overexpression on genome integrity and degradation. Although the assay is well established, it could benefit from some research to determine optimal experimental design to standardize it, and then to allow comparisons among laboratories independently of the chosen cell type. PMID:25221574
Quantitative CrAssphage PCR Assays for Human Fecal ...
Environmental waters are monitored for fecal pollution to protect public health and water resources. Traditionally, general fecal indicator bacteria are used; however, they cannot distinguish human fecal waste from pollution from other animals. Recently, a novel bacteriophage, crAssphage, was discovered by metagenomic data mining and reported to be abundant in and closely associated with human fecal waste. To confirm bioinformatic predictions, 384 primer sets were designed along the length of the crAssphage genome. Based upon initial screening, two novel crAssphage qPCR assays (CPQ_056 and CPQ_064) were designed and evaluated in reference fecal samples and water matrices. The assays exhibited high specificities (98.6%) when tested against a large animal fecal reference library and were highly abundant in raw sewage and sewage impacted water samples. In addition, CPQ_056 and CPQ_064 assay performance was compared to HF183/BacR287 and HumM2 methods in paired experiments. Findings confirm viral crAssphage qPCR assays perform at a similar level to well established bacterial human-associated fecal source identification technologies. These new viral based assays could become important water quality management and research tools. To inform the public.
Evaluation of a molybdenum assay canister
International Nuclear Information System (INIS)
Yoshizumi, T.T.; Keener, S.J.
1988-01-01
The performance characteristics of a commercial molybdenum assay canister were evaluated. The geometrical variation of the technetium-99m (/sup 99m/Tc) activity reading was studied as a function of the elution volume for the standard vials. It was found that the /sup 99m/Tc canister activity reading was ∼ 5% lower than that of the standard method. This is due to attenuation by the canister wall. However, the effect of the geometric variation on the clinical dose preparation was found to be insignificant. The molybdenum-99 ( 99 Mo) contamination level was compared by two methods: (1) the commercial canister and (2) the standard assay kit. The 99 Mo contamination measurements with the canister indicated consistently lower readings than those with the standard 99 Mo assay kit. The authors conclude that the canister may be used in the clinical settings. However, the user must be aware of the problems and the limitations associated with this canister
Comet assay on tetraploid yeast cells
DEFF Research Database (Denmark)
Rank, Jette; Syberg, Kristian; Jensen, Klara
2009-01-01
Tetraploid yeast cells (Saccharomyces cerevisiae) were used in the comet assay with the intention of developing a new, fast and easy assay for detecting environmental genotoxic agents without using higher organisms. Two DNA-damaging chemicals, H2O2 and acrylamide, together with wastewater from...... three municipal treatment plants were tested for their effect on the yeast-cell DNA. The main problem with using yeast in the comet assay is the necessity to degrade the cell wall. This was achieved by using Zymolase 100 T twice during the procedure, since Zymolase 20 T did not open the cell wall....... Analytical problems that arose due to the small amount of DNA in the yeast nuclei in haploid and diploid cells, which contain 13 Mbp and 26 Mbp DNA per cell, respectively, were solved by using tetraploid yeast cells (52 Mbp) instead. DNA damage was shown after exposure to H2O2 and acrylamide. The lowest dose...
Evaluation of a MTT assay in measurement of radiosensitizing effect
International Nuclear Information System (INIS)
Higuchi, Keiko; Mitsuhashi, Norio; Saitoh, Jun-ichi; Maebayashi, Katsuya; Sakurai, Hideyuki; Akimoto, Tetsuo; Niibe, Hideo
1999-01-01
The usefulness of a MTT assay by measuring the radiosensitizing effect of caffeine on rat yolk sac tumor cell line with a mutant-type p53 in vitro was evaluated. A rat yolk sac tumor cell line with a mutant-type p53, NMT-1R, was used in this study. The radiosensitivity of NMT-1R with or without caffeine was measured with a MTT assay. The results were compared with those by a clonogenic assay. Caffeine at a concentration of 2.0 mM which released radiation-induced G 2 block demonstrated a radiosensitizing effect, but caffeine at a concentration of 0.5 mM did not. The radiosensitizing effect of caffeine measured by a MTT assay correlated with that measured by a clonogenic assay. A MTT assay was useful to measure radiosensitivity and/or a radiosensitizing effect in vitro. (author)
Flow cytometric measurement of DNA level and steroid hormone receptor assay in breast cancer
International Nuclear Information System (INIS)
Zubrikhina, G.N.; Kuz'mina, Eh.V.; Bassalyk, L.S.; Murav'eva, N.I.
1989-01-01
DNA level measured by flow cytometry and estrogen and progesteron receptors assayed in tissue samples obtained from 85 malignant and 16 benign lesions of the breast. All the benign tumors revealed 2c DNA content and most of them were receptor-negative, while 74.1% of breast carcinomas displayed aneuploidy. Three patients (3.5%) had two lines of aneuploid cells. Many aneuploid tumors were receptor-negative. Preoperative radiation treatmet (14-20 Gy) did not significantly influence the level of steroid hormone receptors in tumors. Estrogen receptor level was higher in menopausal patients than in premenopausal ones
Braun, Patrick; Delgado, Rafael; Drago, Monica; Fanti, Diana; Fleury, Hervé; Izopet, Jacques; Lombardi, Alessandra; Marcos, MaAngeles; Sauné, Karine; O'Shea, Siobhan; Pérez-Rivilla, Alfredo; Ramble, John; Trimoulet, Pascale; Vila, Jordi; Whittaker, Duncan; Artus, Alain; Rhodes, Daniel
2017-10-01
Hepatitis B viral load testing is essential to treatment and monitoring decisions in patients with chronic Hepatitis B. Beckman Coulter has developed the VERIS HBV Assay (Veris) for use on the fully automated DxN VERIS Molecular Diagnostics System. 1 OBJECTIVES: To evaluate the clinical performance of the Veris HBV Assay at multiple EU laboratories STUDY DESIGN: Method comparison was performed with a total of 344 plasma specimens from HBV infected patients tested with Veris and COBAS ® TaqMan ® HBV Test (Cobas), 207 specimens tested with Veris and RealTime HBV Assay (RealTime), 86 specimens tested with Veris and VERSANT ® HBV Assay (Versant), and 74 specimens tested with Veris and artus ® HBV RG PCR kit (artus). Bland-Altman analysis showed average bias of -0.46 log 10 IU/mL between Veris and Cobas, -0.46 log 10 IU/mL between Veris and RealTime, -0.36 log 10 IU/mL between Veris and Versant, and -0.12 log 10 IU/mL between Veris and artus. Bias was consistent across the assay range. Patient monitoring results using Veris demonstrated similar viral load trends over time to Cobas, RealTime, and artus. The VERIS HBV Assay demonstrated comparable clinical performance, with varying degrees of negative bias, compared to other currently marketed assays for HBV DNA monitoring. This negative bias should be taken into consideration if switching monitoring methods to Veris. Copyright © 2017 Elsevier B.V. All rights reserved.
A fluorescence sedimentation assay for dsDNA antibodies
DEFF Research Database (Denmark)
Duus, K; Draborg, A H; Güven, E
2017-01-01
The Farr assay is a radioimmunoassay (RIA) for dsDNA antibodies, based on antibody precipitation using ammonium sulphate and quantification using radio-labelled dsDNA. The RIA-Farr assay offers outstanding clinical specificity and sensitivity for systemic lupus erythematosus (SLE) compared to other...... on precipitation with polyethylene glycol (PEG) and fluorescence of EvaGreen intercalated in dsDNA as detection principle. As dsDNA antibodies are quantified using fluorescence, the disadvantages of working with radioactivity are eliminated. The Fluoro-Farr assay was developed and validated, and the diagnostic...
The Statistics of wood assays for preservative retention
Patricia K. Lebow; Scott W. Conklin
2011-01-01
This paper covers general statistical concepts that apply to interpreting wood assay retention values. In particular, since wood assays are typically obtained from a single composited sample, the statistical aspects, including advantages and disadvantages, of simple compositing are covered.
Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun
2016-11-01
Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.
Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola
2016-03-01
HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Neutron Based Non-Destructive Assay (NDA) Measurement Systems for Safeguard
Energy Technology Data Exchange (ETDEWEB)
Swinhoe, Martyn Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-09-21
The objectives of this project are to introduce the assay methods for plutonium measurements using the HLNC; introduce the assay method for bulk uranium measurements using the AWCC; and introduce the assay method for fuel assembly measurements using the UNCL.
A molecular assay for sensitive detection of pathogen-specific T-cells.
Directory of Open Access Journals (Sweden)
Victoria O Kasprowicz
Full Text Available Here we describe the development and validation of a highly sensitive assay of antigen-specific IFN-γ production using real time quantitative PCR (qPCR for two reporters--monokine-induced by IFN-γ (MIG and the IFN-γ inducible protein-10 (IP10. We developed and validated the assay and applied it to the detection of CMV, HIV and Mycobacterium tuberculosis (MTB specific responses, in a cohort of HIV co-infected patients. We compared the sensitivity of this assay to that of the ex vivo RD1 (ESAT-6 and CFP-10-specific IFN-γ Elispot assay. We observed a clear quantitative correlation between the two assays (P<0.001. Our assay proved to be a sensitive assay for the detection of MTB-specific T cells, could be performed on whole blood samples of fingerprick (50 uL volumes, and was not affected by HIV-mediated immunosuppression. This assay platform is potentially of utility in diagnosis of infection in this and other clinical settings.
Ma, Zhaoxue; Hu, Xupeng; Cai, Wenjuan; Huang, Weihua; Zhou, Xin; Luo, Qian; Yang, Hongquan; Wang, Jiawei; Huang, Jirong
2014-01-01
An extraordinarily precise regulation of chlorophyll biosynthesis is essential for plant growth and development. However, our knowledge on the complex regulatory mechanisms of chlorophyll biosynthesis is very limited. Previous studies have demonstrated that miR171-targeted scarecrow-like proteins (SCL6/22/27) negatively regulate chlorophyll biosynthesis via an unknown mechanism. Here we showed that SCLs inhibit the expression of the key gene encoding protochlorophyllide oxidoreductase (POR) in light-grown plants, but have no significant effect on protochlorophyllide biosynthesis in etiolated seedlings. Histochemical analysis of β-glucuronidase (GUS) activity in transgenic plants expressing pSCL27::rSCL27-GUS revealed that SCL27-GUS accumulates at high levels and suppresses chlorophyll biosynthesis at the leaf basal proliferation region during leaf development. Transient gene expression assays showed that the promoter activity of PORC is indeed regulated by SCL27. Consistently, chromatin immunoprecipitation and quantitative PCR assays showed that SCL27 binds to the promoter region of PORC in vivo. An electrophoretic mobility shift assay revealed that SCL27 is directly interacted with G(A/G)(A/T)AA(A/T)GT cis-elements of the PORC promoter. Furthermore, genetic analysis showed that gibberellin (GA)-regulated chlorophyll biosynthesis is mediated, at least in part, by SCLs. We demonstrated that SCL27 interacts with DELLA proteins in vitro and in vivo by yeast-two-hybrid and coimmunoprecipitation analysis and found that their interaction reduces the binding activity of SCL27 to the PORC promoter. Additionally, we showed that SCL27 activates MIR171 gene expression, forming a feedback regulatory loop. Taken together, our data suggest that the miR171-SCL module is critical for mediating GA-DELLA signaling in the coordinate regulation of chlorophyll biosynthesis and leaf growth in light. PMID:25101599
Directory of Open Access Journals (Sweden)
Christine Rauer
Full Text Available Sterol regulatory element-binding proteins (SREBPs-1c and -2, which were initially discovered as master transcriptional regulators of lipid biosynthesis and uptake, were recently identified as novel transcriptional regulators of the sodium-iodide symporter gene in the thyroid, which is essential for thyroid hormone synthesis. Based on this observation that SREBPs play a role for thyroid hormone synthesis, we hypothesized that another gene involved in thyroid hormone synthesis, the thyroid peroxidase (TPO gene, is also a target of SREBP-1c and -2. Thyroid epithelial cells treated with 25-hydroxycholesterol, which is known to inhibit SREBP activation, had about 50% decreased mRNA levels of TPO. Similarly, the mRNA level of TPO was reduced by about 50% in response to siRNA mediated knockdown of both, SREBP-1 and SREBP-2. Reporter gene assays revealed that overexpression of active SREBP-1c and -2 causes a strong transcriptional activation of the rat TPO gene, which was localized to an approximately 80 bp region in the intron 1 of the rat TPO gene. In vitro- and in vivo-binding of both, SREBP-1c and SREBP-2, to this region in the rat TPO gene could be demonstrated using gel-shift assays and chromatin immunoprecipitation. Mutation analysis of the 80 bp region of rat TPO intron 1 revealed two isolated and two overlapping SREBP-binding elements from which one, the overlapping SRE+609/InvSRE+614, was shown to be functional in reporter gene assays. In connection with recent findings that the rat NIS gene is also a SREBP target gene in the thyroid, the present findings suggest that SREBPs may be possible novel targets for pharmacological modulation of thyroid hormone synthesis.
Comet Assay in Cancer Chemoprevention.
Santoro, Raffaela; Ferraiuolo, Maria; Morgano, Gian Paolo; Muti, Paola; Strano, Sabrina
2016-01-01
The comet assay can be useful in monitoring DNA damage in single cells caused by exposure to genotoxic agents, such as those causing air, water, and soil pollution (e.g., pesticides, dioxins, electromagnetic fields) and chemo- and radiotherapy in cancer patients, or in the assessment of genoprotective effects of chemopreventive molecules. Therefore, it has particular importance in the fields of pharmacology and toxicology, and in both environmental and human biomonitoring. It allows the detection of single strand breaks as well as double-strand breaks and can be used in both normal and cancer cells. Here we describe the alkali method for comet assay, which allows to detect both single- and double-strand DNA breaks.
Directory of Open Access Journals (Sweden)
Xiaomin Dong
2015-12-01
Full Text Available Long non-coding RNAs (lncRNAs (> 200 bp play crucial roles in transcriptional regulation during numerous biological processes. However, it is challenging to comprehensively identify lncRNAs, because they are often expressed at low levels and with more cell-type specificity than are protein-coding genes. In the present study, we performed ab initio transcriptome reconstruction using eight purified cell populations from mouse cortex and detected more than 5000 lncRNAs. Predicting the functions of lncRNAs using cell-type specific data revealed their potential functional roles in Central Nervous System (CNS development. We performed motif searches in ENCODE DNase I digital footprint data and Mouse ENCODE promoters to infer transcription factor (TF occupancy. By integrating TF binding and cell-type specific transcriptomic data, we constructed a novel framework that is useful for systematically identifying lncRNAs that are potentially essential for brain cell fate determination. Based on this integrative analysis, we identified lncRNAs that are regulated during Oligodendrocyte Precursor Cell (OPC differentiation from Neural Stem Cells (NSCs and that are likely to be involved in oligodendrogenesis. The top candidate, lnc-OPC, shows highly specific expression in OPCs and remarkable sequence conservation among placental mammals. Interestingly, lnc-OPC is significantly up-regulated in glial progenitors from experimental autoimmune encephalomyelitis (EAE mouse models compared to wild-type mice. OLIG2-binding sites in the upstream regulatory region of lnc-OPC were identified by ChIP (chromatin immunoprecipitation-Sequencing and validated by luciferase assays. Loss-of-function experiments confirmed that lnc-OPC plays a functional role in OPC genesis. Overall, our results substantiated the role of lncRNA in OPC fate determination and provided an unprecedented data source for future functional investigations in CNS cell types. We present our datasets and