WorldWideScience

Sample records for immunofluorescence conventional cell

  1. Immunofluorescence

    International Nuclear Information System (INIS)

    Bongertz, V.; Castro, B.G.

    1990-01-01

    The advantages of the immunofluorescence assay (IFA) that allowing the specific 'in situ' localization of the antigen-antibody interaction, of paramount importance when complex antigenic preparations, such as for instance tissue sections, are studied. (L.M.J.) [pt

  2. An Automatic Indirect Immunofluorescence Cell Segmentation System

    Directory of Open Access Journals (Sweden)

    Yung-Kuan Chan

    2014-01-01

    Full Text Available Indirect immunofluorescence (IIF with HEp-2 cells has been used for the detection of antinuclear autoantibodies (ANA in systemic autoimmune diseases. The ANA testing allows us to scan a broad range of autoantibody entities and to describe them by distinct fluorescence patterns. Automatic inspection for fluorescence patterns in an IIF image can assist physicians, without relevant experience, in making correct diagnosis. How to segment the cells from an IIF image is essential in developing an automatic inspection system for ANA testing. This paper focuses on the cell detection and segmentation; an efficient method is proposed for automatically detecting the cells with fluorescence pattern in an IIF image. Cell culture is a process in which cells grow under control. Cell counting technology plays an important role in measuring the cell density in a culture tank. Moreover, assessing medium suitability, determining population doubling times, and monitoring cell growth in cultures all require a means of quantifying cell population. The proposed method also can be used to count the cells from an image taken under a fluorescence microscope.

  3. In Situ Immunofluorescent Staining of Autophagy in Muscle Stem Cells

    KAUST Repository

    Castagnetti, Francesco

    2017-06-13

    Increasing evidence points to autophagy as a crucial regulatory process to preserve tissue homeostasis. It is known that autophagy is involved in skeletal muscle development and regeneration, and the autophagic process has been described in several muscular pathologies and agerelated muscle disorders. A recently described block of the autophagic process that correlates with the functional exhaustion of satellite cells during muscle repair supports the notion that active autophagy is coupled with productive muscle regeneration. These data uncover the crucial role of autophagy in satellite cell activation during muscle regeneration in both normal and pathological conditions, such as muscular dystrophies. Here, we provide a protocol to monitor the autophagic process in the adult Muscle Stem Cell (MuSC) compartment during muscle regenerative conditions. This protocol describes the setup methodology to perform in situ immunofluorescence imaging of LC3, an autophagy marker, and MyoD, a myogenic lineage marker, in muscle tissue sections from control and injured mice. The methodology reported allows for monitoring the autophagic process in one specific cell compartment, the MuSC compartment, which plays a central role in orchestrating muscle regeneration.

  4. In Situ Immunofluorescent Staining of Autophagy in Muscle Stem Cells

    KAUST Repository

    Castagnetti, Francesco; Fiacco, Elisabetta; Imbriano, Carol; Latella, Lucia

    2017-01-01

    with productive muscle regeneration. These data uncover the crucial role of autophagy in satellite cell activation during muscle regeneration in both normal and pathological conditions, such as muscular dystrophies. Here, we provide a protocol to monitor

  5. BLIND TRIALS EVALUATING IN VITRO INFECTIVITY OF CRYPTOSPORIDIUM PARVUM OOCYSTS USING CELL CULTURE IMMUNOFLUORESCENCE

    Science.gov (United States)

    An optimized cell culture-immunofluorescence (IFA) procedure, using the HCT-8 cell line, was evaluated in 'blind' trials to determine the sensitivity and reproducibility for measuring infectivity of flow cytometry prepared inocula of C. parvum oocysts. In separate trials, suspens...

  6. Immunofluorescent staining of nuclear antigen in lymphoid cells transformed by Herpesvirus papio (HVP).

    Science.gov (United States)

    Schmitz, H

    1981-01-01

    An improved fixation method for antigen detection in lymphoblastoid cells is described. Herpesvirus papio nuclear antigen (HUPNA) could be stained in several transformed lymphoid cell lines by anti-complement immunofluorescence (ACIF). Antibody to HUPNA was detected in many human sera containing antibodies to Epstein-Barr virus capsid and nuclear antigen (EBNA). Rheumatoid arthritis sera showed a high incidence of both anti-EBNA and anti-HUPNA antibodies.

  7. Variability in the recognition of distinctive immunofluorescence patterns in different brands of HEp-2 cell slides

    Directory of Open Access Journals (Sweden)

    Alessandra Dellavance

    2013-06-01

    Full Text Available INTRODUCTION: Indirect immunofluorescence on HEp-2 cells is considered the gold standard for the detection of autoantibodies against cellular antigens. However, the culture conditions, cell fixation and permeabilization processes interfere directly in the preservation and spatial distribution of antigens. Therefore, one can assume that certain peculiarities in the processing of cellular substrate may affect the recognition of indirect immunofluorescence patterns associated with several autoantibodies. OBJECTIVE: To evaluate a panel of serum samples representing nuclear, nucleolar, cytoplasmic, mitotic apparatus, and chromosome plate patterns on HEp-2 cell substrates from different suppliers. MATERIALS AND METHODS: Seven blinded observers, independent from the three selected reference centers, evaluated 17 samples yielding different nuclear, nucleolar, cytoplasmic and mitotic apparatus patterns on HEp-2 cell slides from eight different brands. The slides were coded to maintain confidentiality of both brands and participating centers. RESULTS: The 17 HEp-2 cell patterns were identified on most substrates. Nonetheless, some slides showed deficit in the expression of several patterns: nuclear coarse speckled/U1-ribonucleoprotein associated with antibodies against RNP (U1RNP, centromeric protein F (CENP-F, proliferating cell nuclear antigen (PCNA, cytoplasmic fine speckled associated with anti-Jo-1 antibodies (histidyl synthetase, nuclear mitotic apparatus protein 1 (NuMA-1 and nuclear mitotic apparatus protein 2 (NuMA-2. CONCLUSION: Despite the overall good quality of the assessed HEp-2 substrates, there was considerable inconsistency in results among different commercial substrates. The variations may be due to the evaluated batches, hence generalizations cannot be made as to the respective brands. It is recommended that each new batch or new brand be tested with a panel of reference sera representing the various patterns.

  8. An expert protocol for immunofluorescent detection of calcium channels in tsA-201 cells.

    Science.gov (United States)

    Koch, Peter; Herzig, Stefan; Matthes, Jan

    Pore-forming subunits of voltage gated calcium channels (VGCC) are large membrane proteins (260kDa) containing 24 transmembrane domains. Despite transfection with viral promoter driven vectors, biochemical analysis of VGCC is often hampered by rather low expression levels in heterologous systems rendering VGCC challenging targets. Especially in immunofluorescent detection, calcium channels are demanding proteins. We provide an expert step-by-step protocol with adapted conditions for handling procedures (tsA-201 cell culture, transient transfection, incubation time and temperature at 28°C or 37°C and immunostaining) to address the L-type calcium-channel pore Ca v 1.2 in an immunofluorescent approach. We performed immunocytochemical analysis of Ca v 1.2 expression at single-cell level in combination with detection of different markers for cellular organelles. We show confluency levels and shapes of tsA-201 cells at different time points during an experiment. Our experiments reveal sufficient levels of Ca v 1.2 protein and a correct Ca v 1.2 expression pattern in polygonal shaped cells already 12h after transfection. A sequence of elaborated protocol modifications allows subcellular localization analysis of Ca v 1.2 in an immunocytochemical approach. We provide a protocol that may be used to achieve insights into physiological and pathophysiological processes involving voltage gated calcium channels. Our protocol may be used for expression analysis of other challenging proteins and efficient overexpression may be exploited in related biochemical techniques requiring immunolabels. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Semi-automated, occupationally safe immunofluorescence microtip sensor for rapid detection of Mycobacterium cells in sputum.

    Directory of Open Access Journals (Sweden)

    Shinnosuke Inoue

    Full Text Available An occupationally safe (biosafe sputum liquefaction protocol was developed for use with a semi-automated antibody-based microtip immunofluorescence sensor. The protocol effectively liquefied sputum and inactivated microorganisms including Mycobacterium tuberculosis, while preserving the antibody-binding activity of Mycobacterium cell surface antigens. Sputum was treated with a synergistic chemical-thermal protocol that included moderate concentrations of NaOH and detergent at 60°C for 5 to 10 min. Samples spiked with M. tuberculosis complex cells showed approximately 10(6-fold inactivation of the pathogen after treatment. Antibody binding was retained post-treatment, as determined by analysis with a microtip immunosensor. The sensor correctly distinguished between Mycobacterium species and other cell types naturally present in biosafe-treated sputum, with a detection limit of 100 CFU/mL for M. tuberculosis, in a 30-minute sample-to-result process. The microtip device was also semi-automated and shown to be compatible with low-cost, LED-powered fluorescence microscopy. The device and biosafe sputum liquefaction method opens the door to rapid detection of tuberculosis in settings with limited laboratory infrastructure.

  10. A comparison of indirect immunofluorescence and electron microscopy for the diagnosis of some haemorrhagic viruses in cell cultures.

    Science.gov (United States)

    El Mekki, A A; van der Groen, G

    1981-09-01

    Yellow fever, dengue (types 1, 2 and 4), Chikungunya, Rift Valley fever, Ebola, Marburg, and Lassa viruses were inoculated into susceptible cell cultures and daily investigated by indirect immunofluorescence (IFA) and electron microscopy (EM) with a view to achieve an early detection-identification of these agents. Compared to the other cell lines tested (Vero, BHK-21 and Aedes albopictus), CV-1 cells were found to be more sensitive. Viral antigens were detected by IFA from a few hours post inoculation (CHIK and RVF) to a maximum of 3 days (YF and EBO). For most of the viruses studied, the cytopathic effect (CPE) commenced 2-3 days after the detection of viral antigens. Virus particles were detected by EM only in the case of EBO, MBG and LAS, before any CPE was observed in cell cultures.

  11. Isolation, Culture, Functional Assays, and Immunofluorescence of Myofiber-Associated Satellite Cells.

    Science.gov (United States)

    Vogler, Thomas O; Gadek, Katherine E; Cadwallader, Adam B; Elston, Tiffany L; Olwin, Bradley B

    2016-01-01

    Adult skeletal muscle stem cells, termed satellite cells, regenerate and repair the functional contractile cells in adult skeletal muscle called myofibers. Satellite cells reside in a niche between the basal lamina and sarcolemma of myofibers. Isolating single myofibers and their associated satellite cells provides a culture system that partially mimics the in vivo environment. We describe methods for isolating and culturing intact individual myofibers and their associated satellite cells from the mouse extensor digitorum longus muscle. Following dissection and isolation of individual myofibers we provide protocols for myofiber transplantation, satellite cell transfection, immune detection of satellite cell antigens, and assays to examine satellite cell self-renewal and proliferation.

  12. Semi-automated relative quantification of cell culture contamination with mycoplasma by Photoshop-based image analysis on immunofluorescence preparations.

    Science.gov (United States)

    Kumar, Ashok; Yerneni, Lakshmana K

    2009-01-01

    Mycoplasma contamination in cell culture is a serious setback for the cell-culturist. The experiments undertaken using contaminated cell cultures are known to yield unreliable or false results due to various morphological, biochemical and genetic effects. Earlier surveys revealed incidences of mycoplasma contamination in cell cultures to range from 15 to 80%. Out of a vast array of methods for detecting mycoplasma in cell culture, the cytological methods directly demonstrate the contaminating organism present in association with the cultured cells. In this investigation, we report the adoption of a cytological immunofluorescence assay (IFA), in an attempt to obtain a semi-automated relative quantification of contamination by employing the user-friendly Photoshop-based image analysis. The study performed on 77 cell cultures randomly collected from various laboratories revealed mycoplasma contamination in 18 cell cultures simultaneously by IFA and Hoechst DNA fluorochrome staining methods. It was observed that the Photoshop-based image analysis on IFA stained slides was very valuable as a sensitive tool in providing quantitative assessment on the extent of contamination both per se and in comparison to cellularity of cell cultures. The technique could be useful in estimating the efficacy of anti-mycoplasma agents during decontaminating measures.

  13. An immunofluorescence assay for extracellular matrix components highlights the role of epithelial cells in producing a stable, fibrillar extracellular matrix

    Directory of Open Access Journals (Sweden)

    Omar S. Qureshi

    2017-10-01

    Full Text Available Activated fibroblasts are considered major drivers of fibrotic disease progression through the production of excessive extracellular matrix (ECM in response to signals from damaged epithelial and inflammatory cells. Nevertheless, epithelial cells are capable of expressing components of the ECM, cross-linking enzymes that increase its stability and are sensitive to factors involved in the early stages of fibrosis. We therefore wanted to test the hypothesis that epithelial cells can deposit ECM in response to stimulation in a comparable manner to fibroblasts. We performed immunofluorescence analysis of components of stable, mature extracellular matrix produced by primary human renal proximal tubular epithelial cells and renal fibroblasts in response to cytokine stimulation. Whilst fibroblasts produced a higher basal level of extracellular matrix components, epithelial cells were able to deposit significant levels of fibronectin, collagen I, III and IV in response to cytokine stimulation. In response to hypoxia, epithelial cells showed an increase in collagen IV deposition but not in response to the acute stress stimuli aristolochic acid or hydrogen peroxide. When epithelial cells were in co-culture with fibroblasts we observed significant increases in the level of matrix deposition which could be reduced by transforming growth factor beta (TGF-β blockade. Our results highlight the role of epithelial cells acting as efficient producers of stable extracellular matrix which could contribute to renal tubule thickening in fibrosis.

  14. Aquaporin-4 autoantibodies in neuromyelitis optica spectrum disorders: comparison between tissue-based and cell-based indirect immunofluorescence assays

    Directory of Open Access Journals (Sweden)

    Chan Koon H

    2010-09-01

    Full Text Available Abstract Background Neuromyelitis optica spectrum disorders (NMOSD are severe central nervous system inflammatory demyelinating disorders (CNS IDD characterized by monophasic or relapsing, longitudinally extensive transverse myelitis (LETM and/or optic neuritis (ON. A significant proportion of NMOSD patients are seropositive for aquaporin-4 (AQP4 autoantibodies. We compared the AQP4 autoantibody detection rates of tissue-based indirect immunofluorescence assay (IIFA and cell-based IIFA. Methods Serum of Chinese CNS IDD patients were assayed for AQP4 autoantibodies by tissue-based IIFA using monkey cerebellum and cell-based IIFA using transfected HEK293 cells which express human AQP4 on their cell membranes. Results In total, 128 CNS IDD patients were studied. We found that 78% of NMO patients were seropositive for AQP4 autoantibodies by cell-based IIFA versus 61% by tissue-based IFA (p = 0.250, 75% of patients having relapsing myelitis (RM with LETM were seropositive by cell-based IIFA versus 50% by tissue-based IIFA (p = 0.250, and 33% of relapsing ON patients were seropositive by cell-based IIFA versus 22% by tissue-based IIFA (p = 1.000; however the differences were not statistically significant. All patients seropositive by tissue-based IIFA were also seropositive for AQP4 autoantibodies by cell-based IIFA. Among 29 NMOSD patients seropositive for AQP4 autoantibodies by cell-based IIFA, 20 (69% were seropositive by tissue-based IIFA. The 9 patients seropositive by cell-based IIFA while seronegative by tissue-based IIFA had NMO (3, RM with LETM (3, a single attack of LETM (1, relapsing ON (1 and a single ON attack (1. Among 23 NMO or RM patients seropositive for AQP4 autoantibodies by cell-based IIFA, comparison between those seropositive (n = 17 and seronegative (n = 6 by tissue-based IIFA revealed no differences in clinical and neuroradiological characteristics between the two groups. Conclusion Cell-based IIFA is slightly more sensitive

  15. Green Approach To Synthesize Crystalline Nanoscale ZnII-Coordination Polymers: Cell Growth Inhibition and Immunofluorescence Study.

    Science.gov (United States)

    Mukherjee, Somali; Ganguly, Sumi; Manna, Krishnendu; Mondal, Sanchaita; Mahapatra, Supratim; Das, Debasis

    2018-04-02

    Five new coordination polymers (CPs) namely, [{Zn(μ 2 -H 2 O) 0.5 (5N 3 -IPA)(2,2'-bpe)}] ∞ (1), [{Zn(μ 2 -H 2 O) 0.5 (5N 3 -IPA)(1,10-phen)}] ∞ (2), [{Zn(5N 3 -IPA)(1,2-bpe)}] ∞ (3), [{Zn(5N 3 -IPA)(1,2-bpey)}] ∞ (4), and [{Zn(H 2 O)(5N 3 -IPA)(4,4'-tme)}(H 2 O) 0.5 ] ∞ (5) (5N 3 -H 2 IPA = 5-azidoisophthalic acid, 2,2'-bpe= 2,2'-bipyridine, 1,10-phen = 1,10-phenanthroline, 1,2-bpe = 1,2-bis(4-pyridyl)ethane, 1,2-bpey = 1,2-bis(4-pyridyl)ethylene, 4,4'-tme = 4,4'-trimethylenedipyridine), have been synthesized based on a mixed ligand approach adopting a solvothermal technique. Depending upon the intrinsic structural flexibility of the bis-pyridyl coligands, interesting structural topologies have also been observed in the resulting CPs: Sra SrAl2 type topology for 3 and a 3-fold interpenetrated dmp topology for 4. A green hand grinding technique has been implemented to reduce the particle size of the CPs to generate nanoscale CPs (NCPs). SEM studies of NCPs reveal the formation of square and spherical particles for NCP 1 and 2, respectively, and nano rod for NCP 3, 4, and 5. Remarkably, when scaled down to nano range all the NCPs retain their crystalline nature. The cytotoxic activity of the NCPs (1-5) has been studied using human colorectal carcinoma cells (HCT 116). Significant cell death is observed for NCP 2, which is further corroborated by cell growth inhibition study. The observed cell death is likely to be due to mitochondrial-assisted apoptosis as is evident from immunofluorescence study.

  16. Direct immunofluorescence assay compared to cell culture for the diagnosis of mucocutaneous herpes simplex virus infections in children.

    Science.gov (United States)

    Caviness, A Chantal; Oelze, Lindsay L; Saz, Ulas E; Greer, Jewel M; Demmler-Harrison, Gail J

    2010-09-01

    Direct immunofluorescence assay (DFA) is commonly used for the rapid identification of herpes simplex virus (HSV) infection in mucocutaneous lesions, yet little is known about its diagnostic accuracy. To determine the diagnostic yield and accuracy of HSV DFA for the diagnosis of mucocutaneous HSV infection in pediatric patients. Retrospective cross-sectional study of all patients who underwent HSV DFA testing by the Texas Children's Hospital Diagnostic Virology between January 1, 1995 and December 31, 2005. HSV DFA sensitivity, specificity, positive likelihood ratio (LRs), and negative LRs were estimated using viral culture as the reference standard. 659 specimens were submitted for HSV DFA with concurrent viral cultures. Viral cultures were positive for HSV type 1 in 158 (24%) and HSV type 2 in 2 (0.3%). There were 433 different patients with a median age of 8.6 years. Types of lesions were as follows: 50% ulcerative, 26% vesicular, 8% erythema or purpura, 5% pustular, and 11% missing. Of the 659 specimens submitted for HSV DFA, 160 (24%) were inconclusive due to inadequate cells. Of the 499 adequate specimens, overall HSV DFA test accuracy was: sensitivity 61%, specificity 99%, LR positive 40, and LR negative 0.39. A quarter of specimens submitted for HSV DFA testing are not adequate for DFA testing. When HSV DFA can be performed, it is specific, but not sensitive, for the identification of mucocutaneous HSV infection in children. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  17. Cell-based quantification of biomarkers from an ultra-fast microfluidic immunofluorescent staining: application to human breast cancer cell lines

    Science.gov (United States)

    Migliozzi, D.; Nguyen, H. T.; Gijs, M. A. M.

    2018-02-01

    Immunohistochemistry (IHC) is one of the main techniques currently used in the clinics for biomarker characterization. It consists in colorimetric labeling with specific antibodies followed by microscopy analysis. The results are then used for diagnosis and therapeutic targeting. Well-known drawbacks of such protocols are their limited accuracy and precision, which prevent the clinicians from having quantitative and robust IHC results. With our work, we combined rapid microfluidic immunofluorescent staining with efficient image-based cell segmentation and signal quantification to increase the robustness of both experimental and analytical protocols. The experimental protocol is very simple and based on fast-fluidic-exchange in a microfluidic chamber created on top of the formalin-fixed-paraffin-embedded (FFPE) slide by clamping it a silicon chip with a polydimethyl siloxane (PDMS) sealing ring. The image-processing protocol is based on enhancement and subsequent thresholding of the local contrast of the obtained fluorescence image. As a case study, given that the human epidermal growth factor receptor 2 (HER2) protein is often used as a biomarker for breast cancer, we applied our method to HER2+ and HER2- cell lines. We report very fast (5 minutes) immunofluorescence staining of both HER2 and cytokeratin (a marker used to define the tumor region) on FFPE slides. The image-processing program can segment cells correctly and give a cell-based quantitative immunofluorescent signal. With this method, we found a reproducible well-defined separation for the HER2-to-cytokeratin ratio for positive and negative control samples.

  18. Immunofluorescence-based screening identifies germ cell associated microRNA 302 as an antagonist to p63 expression

    DEFF Research Database (Denmark)

    Scheel, Andreas Hans Joachim; Beyer, Ulrike; Agami, Reuven

    2009-01-01

    The tumor suppressor homologue p63 is required for proper skin and limb development, but specific isoforms of it also act as a "guardian of the germline." To gain insight into the regulation of p63 expression, we performed immunofluorescence-based screening assays. Using a large collection of micro...

  19. An Immunofluorescence-assisted Microfluidic Single Cell Quantitative Reverse Transcription Polymerase Chain Reaction Analysis of Tumour Cells Separated from Blood

    Directory of Open Access Journals (Sweden)

    Kazunori Hoshino

    2015-11-01

    matched the results from a few thousand cells. Some markers (e.g., ER, HER2 that are commonly used for cancer identification showed relatively large deviations in expres‐ sion levels. However, others (e.g., GRB7 showed devia‐ tions that are small enough to supplement single cell disease profiling.

  20. Immunofluorescence Microscopy and mRNA Analysis of Human Embryonic Stem Cells (hESCs) Including Primary Cilia Associated Signaling Pathways

    DEFF Research Database (Denmark)

    Vestergaard, Maj Linea; Awan, Aashir; Warzecha, Caroline Becker

    2016-01-01

    onto 16-well glass chambers, and continuing with the general IFM and qPCR anlysis. The techniques are illustrated with results on cellular localization of transcriptional factors and components of the Hedgehog, Wnt, PDGF, and TGFβ signaling pathways to primary cilia in stem cell maintenance......This chapter describes the procedures for immunofluorescence microscopy (IFM) and quantitative PCR (qPCR) analyses of human embryonic stem cells (hESCs) grown specifically under feeder-free conditions. A detailed protocol is provided outlining the steps from initially growing the cells, passaging...

  1. Elucidating the Burden of HIV in Tissues Using Multiplexed Immunofluorescence and In Situ Hybridization: Methods for the Single-Cell Phenotypic Characterization of Cells Harboring HIV In Situ.

    Science.gov (United States)

    Vasquez, Joshua J; Hussien, Rajaa; Aguilar-Rodriguez, Brandon; Junger, Henrik; Dobi, Dejan; Henrich, Timothy J; Thanh, Cassandra; Gibson, Erica; Hogan, Louise E; McCune, Joseph; Hunt, Peter W; Stoddart, Cheryl A; Laszik, Zoltan G

    2018-02-01

    Persistent tissue reservoirs of HIV present a major barrier to cure. Defining subsets of infected cells in tissues is a major focus of HIV cure research. Herein, we describe a novel multiplexed in situ hybridization (ISH) (RNAscope) protocol to detect HIV-DNA (vDNA) and HIV-RNA (vRNA) in formalin-fixed paraffin-embedded (FFPE) human tissues in combination with immunofluorescence (IF) phenotyping of the infected cells. We show that multiplexed IF and ISH (mIFISH) is suitable for quantitative assessment of HIV vRNA and vDNA and that multiparameter IF phenotyping allows precise identification of the cellular source of the ISH signal. We also provide semi-quantitative data on the impact of various tissue fixatives on the detectability of vDNA and vRNA with RNAscope technology. Finally, we describe methods to quantitate the ISH signal on whole-slide digital images and validation of the quantitative ISH data with quantitative real-time PCR for vRNA. It is our hope that this approach will provide insight into the biology of HIV tissue reservoirs and to inform strategies aimed at curing HIV.

  2. High-recovery visual identification and single-cell retrieval of circulating tumor cells for genomic analysis using a dual-technology platform integrated with automated immunofluorescence staining

    International Nuclear Information System (INIS)

    Campton, Daniel E; Ramirez, Arturo B; Nordberg, Joshua J; Drovetto, Nick; Clein, Alisa C; Varshavskaya, Paulina; Friemel, Barry H; Quarre, Steve; Breman, Amy; Dorschner, Michael; Blau, Sibel; Blau, C Anthony; Sabath, Daniel E; Stilwell, Jackie L; Kaldjian, Eric P

    2015-01-01

    Circulating tumor cells (CTCs) are malignant cells that have migrated from solid cancers into the blood, where they are typically present in rare numbers. There is great interest in using CTCs to monitor response to therapies, to identify clinically actionable biomarkers, and to provide a non-invasive window on the molecular state of a tumor. Here we characterize the performance of the AccuCyte® – CyteFinder® system, a comprehensive, reproducible and highly sensitive platform for collecting, identifying and retrieving individual CTCs from microscopic slides for molecular analysis after automated immunofluorescence staining for epithelial markers. All experiments employed a density-based cell separation apparatus (AccuCyte) to separate nucleated cells from the blood and transfer them to microscopic slides. After staining, the slides were imaged using a digital scanning microscope (CyteFinder). Precisely counted model CTCs (mCTCs) from four cancer cell lines were spiked into whole blood to determine recovery rates. Individual mCTCs were removed from slides using a single-cell retrieval device (CytePicker™) for whole genome amplification and subsequent analysis by PCR and Sanger sequencing, whole exome sequencing, or array-based comparative genomic hybridization. Clinical CTCs were evaluated in blood samples from patients with different cancers in comparison with the CellSearch® system. AccuCyte – CyteFinder presented high-resolution images that allowed identification of mCTCs by morphologic and phenotypic features. Spike-in mCTC recoveries were between 90 and 91%. More than 80% of single-digit spike-in mCTCs were identified and even a single cell in 7.5 mL could be found. Analysis of single SKBR3 mCTCs identified presence of a known TP53 mutation by both PCR and whole exome sequencing, and confirmed the reported karyotype of this cell line. Patient sample CTC counts matched or exceeded CellSearch CTC counts in a small feasibility cohort. The AccuCyte

  3. DNA Methylation Changes in Valproic Acid-Treated HeLa Cells as Assessed by Image Analysis, Immunofluorescence and Vibrational Microspectroscopy.

    Directory of Open Access Journals (Sweden)

    Giovana M B Veronezi

    Full Text Available Valproic acid (VPA, a well-known histone deacetylase inhibitor, has been reported to affect the DNA methylation status in addition to inducing histone hyperacetylation in several cell types. In HeLa cells, VPA promotes histone acetylation and chromatin remodeling. However, DNA demethylation was not checked in this cell model for standing effects longer than those provided by histone acetylation, which is a rapid and transient phenomenon. Demonstration of VPA-induced DNA demethylation in HeLa cells would contribute to understanding the effect of VPA on an aggressive tumor cell line. In the present work, DNA demethylation in VPA-treated HeLa cells was assessed by image analysis of chromatin texture, the abundance of 5-methylcytosine (5mC immunofluorescence signals and Fourier transform-infrared (FT-IR microspectroscopy centered on spectral regions related to the vibration of-CH3 groups. Image analysis indicated that increased chromatin unpacking promoted by a 4-h-treatment with 1.0 mM VPA persisted for 24 h in the absence of the drug, suggesting the occurrence of DNA demethylation that was confirmed by decreased 5mC immunofluorescence signals. FT-IR spectra of DNA samples from 1 mM or 20 mM VPA-treated cells subjected to a peak fitting analysis of the spectral window for-CH3 stretching vibrations showed decreased vibrations and energy of these groups as a function of the decreased abundance of 5mC induced by increased VPA concentrations. Only the 20 mM-VPA treatment caused an increase in the ratio of -CH3 bending vibrations evaluated at 1375 cm-1 in relation to in-plane vibrations of overall cytosines evaluated at 1492 cm-1. CH3 stretching vibrations showed to be more sensitive than-CH3 bending vibrations, as detected with FT-IR microspectroscopy, for studies aiming to associate vibrational spectroscopy and changes in DNA 5mC abundance.

  4. A Novel High-Content Immunofluorescence Assay as a Tool to Identify at the Single Cell Level γ-Globin Inducing Compounds.

    Directory of Open Access Journals (Sweden)

    Marta Durlak

    Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.

  5. Immunofluorescence Analysis of Testicular Biopsies With Germ Cell and Sertoli Cell Markers Shows Significant MVH Negative Germ Cell Depletion With Older Age of Orchidopexy

    DEFF Research Database (Denmark)

    Li, Ruili; Thorup, Jørgen Mogens; Sun, Cong

    2014-01-01

    Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses ...... age of orchidopexy using a germ cell marker and a Sertoli cell marker on testicular biopsies.......Undescended testis is the most common defect in newborn boys. It is associated with increased risks of infertility and testicular malignancy due to abnormal germ cell development in these testes. Early surgery may limit such risks. The aim of our study was to analyse germ cell development verses...

  6. Quantum dots immunofluorescence histochemical detection of EGFR gene mutations in the non-small cell lung cancers using mutation-specific antibodies

    Directory of Open Access Journals (Sweden)

    Qu YG

    2014-12-01

    Full Text Available Yan-Gang Qu,1 Qian Zhang,2 Qi Pan,3 Xian-Da Zhao,4 Yan-Hua Huang,2 Fu-Chun Chen,3 Hong-Lei Chen41Department of Pathology, The Central Hospital of Enshi Autonomous Prefecture, Enshi, 2Department of Molecular Pathology, Wuhan Nano Tumor Diagnosis Engineering Research Center, Wuhan, Hubei, People’s Republic of China; 3Department of Thoracosurgery, Traditional Chinese Medical Hospital of Wenling, Wenling, Zhejiang, People’s Republic of China; 4Department of Pathology, School of Basic Medical Science, Wuhan University, Wuhan, Hubei, People’s Republic of ChinaBackground: Epidermal growth factor receptor (EGFR mutation status plays an important role in therapeutic decision making for non-small cell lung cancer (NSCLC patients. Since EGFR mutation-specific antibodies (E746-A750del and L858R have been developed, EGFR mutation detection by immunohistochemistry (IHC is a suitable screening test. On this basis, we want to establish a new screening test, quantum dots immunofluorescence histochemistry (QDs-IHC, to assess EGFR gene mutation in NSCLC tissues, and we compared it to traditional IHC and amplification refractory mutation system (ARMS.Materials and methods: EGFR gene mutations were detected by QDs-IHC, IHC, and ADx-ARMS in 65 cases of NSCLC composed of 55 formalin-fixed, paraffin-embedded specimens and ten pleural effusion cell blocks, including 13 squamous cell carcinomas, two adenosquamous carcinomas, and 50 adenocarcinomas.Results: Positive rates of EGFR gene mutations detected by QDs-IHC, IHC, and ADx-ARMS were 40.0%, 36.9%, and 46.2%, respectively, in 65 cases of NSCLC patients. The sensitivity of QDs-IHC when detecting EGFR mutations, as compared to ADx-ARMS, was 86.7% (26/30; the specificity for both antibodies was 100.0% (26/26. IHC sensitivity was 80.0% (24/30 and the specificity was 92.31% (24/26. When detecting EGFR mutations, QDs-IHC and ADx-ARMS had perfect consistency (κ=0.882; P<0.01. Excellent agreement was observed

  7. Conventional radiology in the bony compromise of Langerhans cells Histiocytosis

    International Nuclear Information System (INIS)

    Morales, Nilson; Gonzalez, Claudia Patricia; Melendez, Patricia; Terselich, Gretty

    1999-01-01

    We present a descriptive study of 47 patients who attended the National Cancer Institute in Bogota, Colombia with pathological diagnosis of Langerhans cell histiocytosis. We reviewed the most frequent conventional x-ray findings

  8. All-solution-processed organic solar cells with conventional architecture

    NARCIS (Netherlands)

    Franeker, J.J. van; Voorthuijzen, W.P.; Gorter, H.; Hendriks, K.H.; Janssen, R.A.J.; Hadipour, A.; Andriessen, H.A.J.M.; Galagan, Y.O.

    2013-01-01

    Abstract All-solution processed organic solar cells with a conventional device structure were demonstrated. The evaporated low work function LiF/Al electrode was replaced by a printed high work function silver electrode combined with an additional electron transport layer (ETL). Two electron

  9. All-solution-processed organic solar cells with conventional architecture

    NARCIS (Netherlands)

    Franeker, van J.J.; Voorthuijzen, W.P.; Gorter, H.; Hendriks, K.H.; Janssen, R.A.J.; Hadipour, A.; Andriessen, R.; Galagan, Y.

    2013-01-01

    All-solution processed organic solar cells with a conventional device structure were demonstrated. The evaporated low work function LiF/Al electrode was replaced by a printed high work function silver electrode combined with an additional electron transport layer (ETL). Two electron transport layers

  10. Fluorescence cell imaging and manipulation using conventional halogen lamp microscopy.

    Directory of Open Access Journals (Sweden)

    Kazuo Yamagata

    Full Text Available Technologies for vitally labeling cells with fluorescent dyes have advanced remarkably. However, to excite fluorescent dyes currently requires powerful illumination, which can cause phototoxic damage to the cells and increases the cost of microscopy. We have developed a filter system to excite fluorescent dyes using a conventional transmission microscope equipped with a halogen lamp. This method allows us to observe previously invisible cell organelles, such as the metaphase spindle of oocytes, without causing phototoxicity. Cells remain healthy even after intensive manipulation under fluorescence observation, such as during bovine, porcine and mouse somatic cell cloning using nuclear transfer. This method does not require expensive epifluorescence equipment and so could help to reduce the science gap between developed and developing countries.

  11. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma.

    Science.gov (United States)

    Palmini, Gaia; Zonefrati, Roberto; Mavilia, Carmelo; Aldinucci, Alessandra; Luzi, Ettore; Marini, Francesca; Franchi, Alessandro; Capanna, Rodolfo; Tanini, Annalisa; Brandi, Maria Luisa

    2016-10-14

    The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed "cellular spheres". Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.

  12. Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

    Science.gov (United States)

    Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

    2005-01-01

    Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

  13. Disseminated leiomyoma cells can be identified following conventional myomectomy.

    Science.gov (United States)

    Sandberg, E M; van den Haak, L; Bosse, T; Jansen, F W

    2016-12-01

    Uncontained morcellation of leiomyomas during laparoscopic surgery has recently been discouraged, as undetected malignant tumours, namely leiomyosarcomas, could be fragmented which may result in upstaged disease. However, enucleating leiomyomas per se may be inappropriate from an oncological perspective because complete, radical resection of malignant tumours to prevent further tumour growth or recurrence is not achieved. Thus, the aim of this study was to determine whether spillage of leiomyoma cells occurs during laparotomic myomectomy. Observational study. Tertiary academic centre in the Netherlands. Women undergoing laparotomic myomectomy were included in the study. Peritoneal abdominal washings were obtained on two occasions during the myomectomy procedure; the first one immediately after opening the abdomen and the second one after resection of the leiomyoma(s). Cytological evaluation of the fluids was performed. The presence of leiomyoma cells in any of the washings. Five patients were included in this pilot study. All first washings were negative for leiomyoma cells. However, cytology positive for the presence of leiomyoma cells was found in three of the five second, post-myomectomy washings. Tissue spillage from leiomyoma(s) occurs during conventional open myomectomy. The clinical relevance of tissue dissemination after myomectomy is unclear but it cannot be excluded that this may negatively affect the patient's outcome if there is malignant change within the enucleated leiomyoma(s). Therefore, it is questionable whether morcellation in specially designed containment bags after laparoscopic myomectomy, guarantees any additional oncological safety. Even during conventional myomectomy, tissue spillage occurs during resection of leiomyoma(s). © 2016 Royal College of Obstetricians and Gynaecologists.

  14. Hepatic stellate cell-targeted imatinib nanomedicine versus conventional imatinib: A novel strategy with potent efficacy in experimental liver fibrosis.

    Science.gov (United States)

    El-Mezayen, Nesrine S; El-Hadidy, Wessam F; El-Refaie, Wessam M; Shalaby, Th I; Khattab, Mahmoud M; El-Khatib, Aiman S

    2017-11-28

    Liver fibrosis is a global health problem without approved treatment. Imatinib inhibits two key profibrotic pathways; platelet-derived growth factor (PDGF) and transforming growth factor-beta (TGF-β) and thus can be used to treat liver fibrosis. However, conventional imatinib therapy is hampered by low concentration at target tissue and increased toxicity to other tissues especially heart, lung and liver. Since hepatic stellate cells (HSCs) are the main contributors to liver fibrosis pathogenesis and sole hepatic vitamin A (V A ) storage cells, they can be actively targeted by coupling liposomes to V A . In this study, novel V A -coupled imatinib-loaded liposomes (ILC) were prepared and optimized regarding V A -coupling efficiency, imatinib entrapment efficiency, and particle size. Preferential accumulation of the selected formula in liver was proved by tracing intraperitoneally (i.p.)-injected V A -coupled liposomes loaded with Nile Red (LCNR) to rats with CCl 4 -induced liver fibrosis using live animal imaging. Co-localization of LCNR with immunofluorescently-labeled PDGFR-β in frozen liver tissue sections confirmed HSCs targeting. ILC bio-distribution, following single i.p. injection, revealed 13.5 folds higher hepatic accumulation than conventional imatinib in addition to limited bio-distribution to other organs including heart and lung reflecting diminished adverse effects. ILC therapy resulted in a potent inhibition of phosphorylated PDGFR-β expression when compared to conventional imatinib. Subsequently, there was a statistically significant improvement in liver function tests and reversal of hepatotoxicity along with liver fibrosis. Anti-fibrotic effect was evident from histopathologic Ishak score reduction as well as normalization of the level of profibrotic mediators (hydroxyproline, TGF-B and matrix metalloproteinase-2). Thus, HSC-targeted imatinib therapy shows outstanding anti-fibrotic effects with reduced cytotoxicity compared to conventional

  15. Comparison of gas membrane separation cascades using conventional separation cell and two-unit separation cells

    International Nuclear Information System (INIS)

    Ohno, Masayoshi; Morisue, Tetsuo; Ozaki, Osamu; Miyauchi, Terukatsu.

    1978-01-01

    The adoption of two-unit separation cells in radioactive rare gas membrane separation equipment enhances the separation factor, but increases the required membrane area and compressive power. An analytical economic evaluation was undertaken to compare the conventional separation cell with the two-unit separation cells, adopting as parameters the number of cascade stages, the membrane area and the operating power requirements. This paper describes the models used for evaluating the separation performance and the economics of cascade embodying these different concepts of separation cell taken up for study, and the results obtained for the individual concepts are mutually compared. It proved that, in respect of the number required of cascade stages, of operating power requirements and of the annual expenditure, better performance could always be expected of the two-unit separation cells as compared with the conventional separation cell, at least in the range of parameters adopted in this study. As regards the minimum membrane area, the conventional separation cell and the series-type separation cell yielded almost the same values, with the parallel-type separation cell falling somewhat behind. (auth.)

  16. Multicolor immunofluorescence reveals that p63- and/or K5-positive progenitor cells contribute to normal breast epithelium and usual ductal hyperplasia but not to low-grade intraepithelial neoplasia of the breast.

    Science.gov (United States)

    Boecker, Werner; Stenman, Göran; Schroeder, Tina; Schumacher, Udo; Loening, Thomas; Stahnke, Lisa; Löhnert, Catharina; Siering, Robert Michael; Kuper, Arthur; Samoilova, Vera; Tiemann, Markus; Korsching, Eberhard; Buchwalow, Igor

    2017-05-01

    We contend that knowledge about the cellular composition of normal breast epithelium is a prerequisite for understanding proliferative breast disease. Against this background, we used multicolor immunofluorescence to study normal breast epithelium and two types of intraepithelial proliferative breast lesion for expression of the p63, basal keratin K5, glandular keratin K8/18, SMA, ER-alpha, and Ki67. We studied eight normal breast epithelium samples, 12 cases of usual ductal hyperplasia, and 33 cases of low-grade intraepithelial neoplasia (9 flat epithelial atypia, 14 low-grade ductal carcinoma in situ and 10 cases of lobular neoplasia). Usual ductal hyperplasia showed striking similarity to normal luminal breast epithelium including p63+ and/or K5+ luminal progenitor cells and the full spectrum of luminal progeny cells. In normal breast epithelium and usual ductal hyperplasia, expression of ER-alpha was associated with lack of expression of the proliferation antigen Ki67. In contrast, we found in both types of low-grade intraepithelial neoplasia robust expression of keratin K8/18 and a positive association between ER-alpha and Ki67 expression. However, these lesions were consistently negative for p63 and/or K5. Our observational study supports the view that usual ductal hyperplasia and low-grade intraepithelial neoplasia are different entities rather than part of a spectrum of the same disease. We propose a new operational model of cell differentiation that may serve to better understand correlations between normal breast epithelium and proliferative breast diseases. From our data we conclude that p63+ and/or K5+ progenitor cells contribute to maintenance of normal epithelium and usual ductal hyperplasia, but not to low-grade intraepithelial neoplasia of the breast.

  17. Improving the performance of conventional and column froth flotation cells

    Energy Technology Data Exchange (ETDEWEB)

    Arnold, B.J. [CQ Inc., Homer City, PA (United States)

    1995-11-01

    Many existing mining operations hover on the brink of producing competitively priced fuel with marginally acceptable sulfur levels. To remain competitive, these operations need to improve the yield of their coal processing facilities, lower the sulfur content of their clean coal, or lower the ash content of their clean coal. Fine coal cleaning processes offer the best opportunity for coal producers to increase their yield of high quality product. Over 200 coal processing plants in the U.S. already employ some type of conventional or column flotation device to clean fines. an increase in efficiency in these existing circuits could be the margin required to make these coal producers competitive.

  18. Biostatistical analysis of quantitative immunofluorescence microscopy images.

    Science.gov (United States)

    Giles, C; Albrecht, M A; Lam, V; Takechi, R; Mamo, J C

    2016-12-01

    Semiquantitative immunofluorescence microscopy has become a key methodology in biomedical research. Typical statistical workflows are considered in the context of avoiding pseudo-replication and marginalising experimental error. However, immunofluorescence microscopy naturally generates hierarchically structured data that can be leveraged to improve statistical power and enrich biological interpretation. Herein, we describe a robust distribution fitting procedure and compare several statistical tests, outlining their potential advantages/disadvantages in the context of biological interpretation. Further, we describe tractable procedures for power analysis that incorporates the underlying distribution, sample size and number of images captured per sample. The procedures outlined have significant potential for increasing understanding of biological processes and decreasing both ethical and financial burden through experimental optimization. © 2016 The Authors Journal of Microscopy © 2016 Royal Microscopical Society.

  19. Conventional and novel stem cell based therapies for androgenic alopecia

    Directory of Open Access Journals (Sweden)

    Talavera-Adame D

    2017-08-01

    Full Text Available Dodanim Talavera-Adame,1 Daniella Newman,2 Nathan Newman1 1American Advanced Medical Corp. (Private Practice, Beverly Hills, CA, 2Western University of Health Sciences, Pomona, CA, USA Abstract: The prevalence of androgenic alopecia (AGA increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine. Keywords: stem cells, stem cell therapies, hair follicle, dermal papilla, androgenic alopecia, laser, hair regeneration

  20. Differences in gene expression of cells growing in conventional 2D versus 3D cell culture

    International Nuclear Information System (INIS)

    Zschenker, Oliver; Cordes, Nils; Streichert, Thomas

    2009-01-01

    Full text: Telomeres are DNA protein complexes on the ends of chromosomes that distinguish the ends of chromosomes from double strand breaks and prevent degradation or fusion by nonhomologous end-joining. The loss of telomeres is associated with a loss of heterochromatic features leading to a less compact chromatin structure which allows e.g. DNA repair proteins to get better access to the site of the DNA damage and facilitate chromosome fusions. Telomerase is an enzyme that can counteract the loss of telomeres by adding telomeric repeats on the ends of chromosomes. Since telomerase is active in most tumor cells, telomerase is suggested to be the reason for the unlimited number of cell divisions of cancer cells. TRF2 is one of the most important proteins of the Shelterin complex protecting the telomeres from shortening by inhibiting ATM which is up-stream of the DNA repair mechanisms. Thus, we are concentrating on TRF2 and telomerase to investigate the differences in DNA repair in telomeric (heterochromatic) versus euchromatic regions. Human cancer cells with differences in status of p53 and telomerase like A549, UT-SCC15 and FaDu cells are used. Without any treatment, FaDu cells express high levels of telomerase and TRF2 in conventional 2D cell culture which is in contrast to e.g. A549. We found that telomerase is even higher expressed in 3D than in 2D cell culture. To connect telomere associated processes to both repair of radiogenic DNA damage/lesions and to cell-extracellular matrix interactions, we performed whole genome microarray analysis. By comparing the differential expression of genes associated with these three cell functions, we intend to yield new molecular insight into radiotherapy relevant tumor characteristics, particularly radioresistance and DNA damage response network processing. (author)

  1. Conventional and novel stem cell based therapies for androgenic alopecia.

    Science.gov (United States)

    Talavera-Adame, Dodanim; Newman, Daniella; Newman, Nathan

    2017-01-01

    The prevalence of androgenic alopecia (AGA) increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine.

  2. Quantitative Immunofluorescence Analysis of Nucleolus-Associated Chromatin.

    Science.gov (United States)

    Dillinger, Stefan; Németh, Attila

    2016-01-01

    The nuclear distribution of eu- and heterochromatin is nonrandom, heterogeneous, and dynamic, which is mirrored by specific spatiotemporal arrangements of histone posttranslational modifications (PTMs). Here we describe a semiautomated method for the analysis of histone PTM localization patterns within the mammalian nucleus using confocal laser scanning microscope images of fixed, immunofluorescence stained cells as data source. The ImageJ-based process includes the segmentation of the nucleus, furthermore measurements of total fluorescence intensities, the heterogeneity of the staining, and the frequency of the brightest pixels in the region of interest (ROI). In the presented image analysis pipeline, the perinucleolar chromatin is selected as primary ROI, and the nuclear periphery as secondary ROI.

  3. Tissue-resident natural killer (NK) cells are cell lineages distinct from thymic and conventional splenic NK cells

    Science.gov (United States)

    Sojka, Dorothy K; Plougastel-Douglas, Beatrice; Yang, Liping; Pak-Wittel, Melissa A; Artyomov, Maxim N; Ivanova, Yulia; Zhong, Chao; Chase, Julie M; Rothman, Paul B; Yu, Jenny; Riley, Joan K; Zhu, Jinfang; Tian, Zhigang; Yokoyama, Wayne M

    2014-01-01

    Natural killer (NK) cells belong to the innate immune system; they can control virus infections and developing tumors by cytotoxicity and producing inflammatory cytokines. Most studies of mouse NK cells, however, have focused on conventional NK (cNK) cells in the spleen. Recently, we described two populations of liver NK cells, tissue-resident NK (trNK) cells and those resembling splenic cNK cells. However, their lineage relationship was unclear; trNK cells could be developing cNK cells, related to thymic NK cells, or a lineage distinct from both cNK and thymic NK cells. Herein we used detailed transcriptomic, flow cytometric, and functional analysis and transcription factor-deficient mice to determine that liver trNK cells form a distinct lineage from cNK and thymic NK cells. Taken together with analysis of trNK cells in other tissues, there are at least four distinct lineages of NK cells: cNK, thymic, liver (and skin) trNK, and uterine trNK cells. DOI: http://dx.doi.org/10.7554/eLife.01659.001 PMID:24714492

  4. Epidermis area detection for immunofluorescence microscopy

    Science.gov (United States)

    Dovganich, Andrey; Krylov, Andrey; Nasonov, Andrey; Makhneva, Natalia

    2018-04-01

    We propose a novel image segmentation method for immunofluorescence microscopy images of skin tissue for the diagnosis of various skin diseases. The segmentation is based on machine learning algorithms. The feature vector is filled by three groups of features: statistical features, Laws' texture energy measures and local binary patterns. The images are preprocessed for better learning. Different machine learning algorithms have been used and the best results have been obtained with random forest algorithm. We use the proposed method to detect the epidermis region as a part of pemphigus diagnosis system.

  5. Skin metastasis from conventional giant cell tumor of bone: conceptual significance

    International Nuclear Information System (INIS)

    Tyler, W.; Barrett, T.; Frassica, F.; McCarthy, E.

    2002-01-01

    A conventional giant cell tumor of the proximal femur recurred twice locally and developed pulmonary nodules. The lung lesions were felt to be an example of ''benign'' metastases. Eight months after the initial presentation, the patient developed a single skin nodule on the contralateral leg. Histologic features of the skin nodule showed conventional giant cell tumor identical to the bone lesion. This nodule is a manifestation of arterial metastasis typical of any malignant tumor and seemingly contradicts the concept of ''benign '' metastasis. (orig.)

  6. [Laboratory diagnosis of genital herpes--direct immunofluorescence method].

    Science.gov (United States)

    Majewska, Anna; Romejko-Wolniewicz, Ewa; Zareba-Szczudlik, Julia; Kilijańczyk, Marek; Gajewska, Małgorzata; Młynarczyk, Grazyna

    2013-07-01

    Aim of the study was to determine clinical usefulness of direct immunofluorescence method in the laboratory diagnosis of genital herpes in women. Overall 187 anogenital swabs were collected from 120 women. Using a dacron-tipped applicator 83 swabs were collected from women suspected of genital herpes and 104 from patients with no signs of genital infection. All samples were tested using cell culture (Vero cell line) and then direct immunofluorescence method (DIF) for the identification of antigens of herpes simplex viruses: HSV-1 and HSV-2. Characteristic cytopathic effect (CPE), indicative of alphaherpesvirus infection, was observed in 43.4% of cultures with clinical specimens collected from women with suspected genital herpes and in 29.8% of cultures of clinical specimens taken from patients with no clinical symptoms of genital herpes. Herpes simplex viruses were determined in 73 samples by direct immunofluorescence method after amplification of the virus in cell culture. The DIF test confirmed the diagnosis based on the microscopic CPE observation in 85%. In 15% of samples (taken from pregnant women without clinical signs of infection) we reported positive immunofluorescence in the absence of CPE. The frequency of antigen detection was statistically significantly higher in samples that were positive by culture study (chi-square test with Yates's correction, p genital herpes in swabs taken from the vestibule of the vagina and the vulva. However, there was no statistically significant difference in the frequency of detection of Herpes Simplex Virus antigens in specimens from different parts of the genital tract in both groups of women (chi-square test, p > 0.05). In our study HHV-1 was the main causative agent of genital herpes. The growing worldwide prevalence of genital herpes, challenges with the clinical diagnosis, and availability of effective antiviral therapy are the main reasons for a growing interest in rapid, proper laboratory diagnosis of infected

  7. Comparison between laser terahertz emission microscope and conventional methods for analysis of polycrystalline silicon solar cell

    Directory of Open Access Journals (Sweden)

    Hidetoshi Nakanishi

    2015-11-01

    Full Text Available A laser terahertz emission microscope (LTEM can be used for noncontact inspection to detect the waveforms of photoinduced terahertz emissions from material devices. In this study, we experimentally compared the performance of LTEM with conventional analysis methods, e.g., electroluminescence (EL, photoluminescence (PL, and laser beam induced current (LBIC, as an inspection method for solar cells. The results showed that LTEM was more sensitive to the characteristics of the depletion layer of the polycrystalline solar cell compared with EL, PL, and LBIC and that it could be used as a complementary tool to the conventional analysis methods for a solar cell.

  8. Direct immunofluorescence for the diagnosis of legionellosis

    Directory of Open Access Journals (Sweden)

    David JM Haldane

    1993-01-01

    Full Text Available Culture and direct immunofluorescent microscopy (DFA results for Legionella pneumophila were reviewed over a two-year period. In the first year, a positive result was defined as having at least one morphologically typical fluorescing organism. In the second year, a positive was defined as at least five typical fluorescing organisms. Despite these stricter criteria and other measures to reduce the possibility of reagent contamination, there was no statistically significant difference in the sensitivity or specificity of the DFA in the two years for sputa, deep specimens or overall. Of 37 sputum specimens from infected patients, 16 were positive on DFA. Thirty-two of 38 positive patients were detected by sputum culture. DFA can provide rapid diagnostic information but cannot be used to rule out the diagnosis. Sputum is a useful specimen for the initial laboratory investigation of patients with legionellosis.

  9. Bioenergy conversion and storage systems: from conventional electrochemical cells to hybrid bioelectronic devices

    DEFF Research Database (Denmark)

    Pankratov, Dmitrii; Chi, Qijin

    2017-01-01

    The rapid development and popularization of wearable and implantable self-sustainable electronics has increasingly demanded new-generation miniature and biocompatible power systems that can function under near-neutral pH solution and ambient conditions. Towards this end, enzymatic fuel cells (EFCs......) using biocatalysts can offer an effective alternative to conventional batteries or fuel cells attributed to high biocatalytic activity, substrate specified selectivity, and non-toxic end products with ecofriendly impacts. Newly emerging photobioelectrochemical cells (PBCs), exploiting photosynthetic...

  10. Conventional CD4+ T cells present bacterial antigens to induce cytotoxic and memory CD8+ T cell responses.

    Science.gov (United States)

    Cruz-Adalia, Aránzazu; Ramirez-Santiago, Guillermo; Osuna-Pérez, Jesús; Torres-Torresano, Mónica; Zorita, Virgina; Martínez-Riaño, Ana; Boccasavia, Viola; Borroto, Aldo; Martínez Del Hoyo, Gloria; González-Granado, José María; Alarcón, Balbino; Sánchez-Madrid, Francisco; Veiga, Esteban

    2017-11-17

    Bacterial phagocytosis and antigen cross-presentation to activate CD8 + T cells are principal functions of professional antigen presenting cells. However, conventional CD4 + T cells also capture and kill bacteria from infected dendritic cells in a process termed transphagocytosis (also known as transinfection). Here, we show that transphagocytic T cells present bacterial antigens to naive CD8 + T cells, which proliferate and become cytotoxic in response. CD4 + T-cell-mediated antigen presentation also occurs in vivo in the course of infection, and induces the generation of central memory CD8 + T cells with low PD-1 expression. Moreover, transphagocytic CD4 + T cells induce protective anti-tumour immune responses by priming CD8 + T cells, highlighting the potential of CD4 + T cells as a tool for cancer immunotherapy.

  11. Angle resolved characterization of nanostructured and conventionally textured silicon solar cells

    DEFF Research Database (Denmark)

    Davidsen, Rasmus Schmidt; Ormstrup, Jeppe; Ommen, Martin Lind

    2015-01-01

    current, open circuit voltage, fill factor (FF) and power conversion efficiency are each measured as function of the relative incident angle between the solar cell and the light source. The relative incident angle is varied from 0° to 90° in steps of 10° in orthogonal axes, such that each solar cell......We report angle resolved characterization of nanostructured and conventionally textured silicon solar cells. The nanostructured solar cells are realized through a single step, mask-less, scalable reactive ion etching (RIE) texturing of the surface. Photovoltaic properties including short circuit...

  12. A microfluidic-based lid device for conventional cell culture dishes to automatically control oxygen level.

    Science.gov (United States)

    Lee, Seung Yeob; Yang, Sung

    2018-04-25

    Most conventional hypoxic cell culture systems undergo reoxygenation during experimental manipulations, resulting in undesirable effects including the reduction of cell viability. A lid device was developed herein for conventional cell culture dishes to resolve this limitation. The integration of multilayered microfluidic channels inside a thin membrane was designed to prevent the reoxygenation caused by reagent infusion and automatically control the oxygen level. The experimental data clearly show the reducibility of the dissolved oxygen in the infusing reagent and the controllability of the oxygen level inside the dish. The feasibility of the device for hypoxia studies was confirmed by HIF-1α experiments. Therefore, the device could be used as a compact and convenient hypoxic cell culture system to prevent reoxygenation-related issues.

  13. A simple improvement of the conventional cryopreservation for human ES and iPS cells

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Midori Ozawa, Yutaka Ozawa, Masashi Iemura, Arihiro Kohara, Kana Yanagihara & Miho K Furue ### Abstract In this study, a simple method for the cryopreservation of human embryonic stem (ES) and induced pluripotent stem (iPS) cells is proposed. It is based on the conventional slow-freezing method with 10% DMSO and modified mainly in a thawing protocol without specific equipment or reagents. Recovery rate of the cells cryopreserved by this method was equally high, which is compa...

  14. Maraba MG1 Virus Enhances Natural Killer Cell Function via Conventional Dendritic Cells to Reduce Postoperative Metastatic Disease

    Science.gov (United States)

    Zhang, Jiqing; Tai, Lee-Hwa; Ilkow, Carolina S; Alkayyal, Almohanad A; Ananth, Abhirami A; de Souza, Christiano Tanese; Wang, Jiahu; Sahi, Shalini; Ly, Lundi; Lefebvre, Charles; Falls, Theresa J; Stephenson, Kyle B; Mahmoud, Ahmad B; Makrigiannis, Andrew P; Lichty, Brian D; Bell, John C; Stojdl, David F; Auer, Rebecca C

    2014-01-01

    This study characterizes the ability of novel oncolytic rhabdoviruses (Maraba MG1) to boost natural killer (NK) cell activity. Our results demonstrate that MG1 activates NK cells via direct infection and maturation of conventional dendritic cells. Using NK depletion and conventional dendritic cells ablation studies in vivo, we established that both are required for MG1 efficacy. We further explored the efficacy of attenuated MG1 (nonreplicating MG1-UV2min and single-cycle replicating MG1-Gless) and demonstrated that these viruses activate conventional dendritic cells, although to a lesser extent than live MG1. This translates to equivalent abilities to remove tumor metastases only at the highest viral doses of attenuated MG1. In tandem, we characterized the antitumor ability of NK cells following preoperative administration of live and attenuated MG1. Our results demonstrates that a similar level of NK activation and reduction in postoperative tumor metastases was achieved with equivalent high viral doses concluding that viral replication is important, but not necessary for NK activation. Biochemical characterization of a panel of UV-inactivated MG1 (2–120 minutes) revealed that intact viral particle and target cell recognition are essential for NK cell–mediated antitumor responses. These findings provide mechanistic insight and preclinical rationale for safe perioperative virotherapy to effectively reduce metastatic disease following cancer surgery. PMID:24695102

  15. Use of commercially available rabbit monoclonal antibodies for immunofluorescence double staining

    DEFF Research Database (Denmark)

    Bzorek, M.; Stamp, I.M.; Frederiksen, L.

    2008-01-01

    Immunohistochemistry, that is, the use of polyclonal and monoclonal antibodies to detect cell and tissue antigens at a microscopical level is a powerful tool for both research and diagnostic purposes. Especially in the field of hematologic disease, there is often a need to detect several antigens...... synchronously, and we report here a fast and easy technique for demonstrating more than 1 antigen in 1 slide using immunofluorescence. We have used commercially available rabbit monoclonal antibodies (Cyclin D1, CD3, CD5, CD23, etc.) paired with mouse monoclonal antibodies (CD7, CD20, CD79a, Pax-5, etc.......) for double immunofluorescence labeling on paraffin-embedded tissue sections. Commercially available rabbit monoclonal antibodies in combination with mouse monoclonal antibodies proved useful in double immunofluorescence labeling on paraffin-embedded tissue, and all combinations used yielded excellent results...

  16. Comparing milk yield, chemical properties and somatic cell count from organic and conventional mountain farming systems

    Directory of Open Access Journals (Sweden)

    Marcello Bianchi

    2010-01-01

    Full Text Available A study was undertaken to investigate the effects of farming systems (organic vs. conventional, diet (hay/concentrate vs. pasture and their interaction on milk yield, gross composition and fatty acid (FA profile of dairy cows bred in mountainous areas. For this purpose four dairy farms (two organic and two conventional were chosen in the alpine territory of Aosta Valley (NW Italy; individual milk yield was recorded daily and bulk milk samples were collected monthly from February to September 2007 to cover dietary variations. Higher levels of milk production (P<0.05 and lower milk protein amounts (P<0.01 were observed in the organic farms with respect to the conventional ones, while no significant differences were noticed in milk fat and lactose contents and in somatic cell count. Concerning fatty acids, only small differences were detected between organic and conventional milk and such differences seemed to be related mainly to the stabled period. Diet affected almost all variables studied: pasture feeding provided a significant improvement in the fatty acid composition in both organic and conventional systems leading to lower hypercholesterolemic saturated fatty acids, higher mono- and polyunsaturated fatty acids and conjugated linoleic acid amounts (P<0.001.

  17. Comparison of Nannochloropsis sp. cells disruption between hydrodynamic cavitation and conventional extraction

    Directory of Open Access Journals (Sweden)

    Setyawan Martomo

    2018-01-01

    Full Text Available Biodiesel production from microalgae is one of the solution of the future energy problem, but its production cost is still high. One of the costly stages of this process is the lipid extraction process. It can be reduced by microalgae cell disruption. One of the mechanical method to cell disruption with the lowest energy requirement is hydrodynamic cavitation. This aim of this study is to evaluate the distribution coefficient and the mass transfer coefficient value of lipid extraction of Nannochloropsis sp. assisted by hydrodynamic cavitation and compare with conventional extraction. The hydrodynamic cavitation extraction was done at 34 °C, 1 atm. The conventional extraction was done at 34 °C, 1 atm with stirring speed 260 and 1000 rpm. The experimental result shows that the distribution coefficient dependent on the temperature with the values for 50, 44, 38 and 34 °C were 0.502, 0.394, 0.349, and 0.314 respectively. And it was according to Van’ Hoff equation with the values of ΔH° was 20.718 kJ/mol and ΔS° was 58.05 J/mol/K. The hydrodynamic cavitation extraction was faster than conventional. The mass transfer coefficient values for hydrodynamic cavitation, conventional 260 rpm and 1000 rpm were 7.373, 0.534 and 0.121 1/s respectively.

  18. Automated Processing and Evaluation of Anti-Nuclear Antibody Indirect Immunofluorescence Testing.

    Science.gov (United States)

    Ricchiuti, Vincent; Adams, Joseph; Hardy, Donna J; Katayev, Alexander; Fleming, James K

    2018-01-01

    Indirect immunofluorescence (IIF) is considered by the American College of Rheumatology (ACR) and the international consensus on ANA patterns (ICAP) the gold standard for the screening of anti-nuclear antibodies (ANA). As conventional IIF is labor intensive, time-consuming, subjective, and poorly standardized, there have been ongoing efforts to improve the standardization of reagents and to develop automated platforms for assay incubation, microscopy, and evaluation. In this study, the workflow and performance characteristics of a fully automated ANA IIF system (Sprinter XL, EUROPattern Suite, IFA 40: HEp-20-10 cells) were compared to a manual approach using visual microscopy with a filter device for single-well titration and to technologist reading. The Sprinter/EUROPattern system enabled the processing of large daily workload cohorts in less than 8 h and the reduction of labor hands-on time by more than 4 h. Regarding the discrimination of positive from negative samples, the overall agreement of the EUROPattern software with technologist reading was higher (95.6%) than when compared to the current method (89.4%). Moreover, the software was consistent with technologist reading in 80.6-97.5% of patterns and 71.0-93.8% of titers. In conclusion, the Sprinter/EUROPattern system provides substantial labor savings and good concordance with technologist ANA IIF microscopy, thus increasing standardization, laboratory efficiency, and removing subjectivity.

  19. Automated Processing and Evaluation of Anti-Nuclear Antibody Indirect Immunofluorescence Testing

    Directory of Open Access Journals (Sweden)

    Vincent Ricchiuti

    2018-05-01

    Full Text Available Indirect immunofluorescence (IIF is considered by the American College of Rheumatology (ACR and the international consensus on ANA patterns (ICAP the gold standard for the screening of anti-nuclear antibodies (ANA. As conventional IIF is labor intensive, time-consuming, subjective, and poorly standardized, there have been ongoing efforts to improve the standardization of reagents and to develop automated platforms for assay incubation, microscopy, and evaluation. In this study, the workflow and performance characteristics of a fully automated ANA IIF system (Sprinter XL, EUROPattern Suite, IFA 40: HEp-20-10 cells were compared to a manual approach using visual microscopy with a filter device for single-well titration and to technologist reading. The Sprinter/EUROPattern system enabled the processing of large daily workload cohorts in less than 8 h and the reduction of labor hands-on time by more than 4 h. Regarding the discrimination of positive from negative samples, the overall agreement of the EUROPattern software with technologist reading was higher (95.6% than when compared to the current method (89.4%. Moreover, the software was consistent with technologist reading in 80.6–97.5% of patterns and 71.0–93.8% of titers. In conclusion, the Sprinter/EUROPattern system provides substantial labor savings and good concordance with technologist ANA IIF microscopy, thus increasing standardization, laboratory efficiency, and removing subjectivity.

  20. Probiotic Lactobacilli Modulate Staphylococcus aureus-Induced Activation of Conventional and Unconventional T cells and NK cells

    Directory of Open Access Journals (Sweden)

    Maria A Johansson

    2016-07-01

    Full Text Available Lactobacilli are probiotic commensal bacteria and potent modulators of immunity. When present in the gut or supplemented as probiotics, they beneficially modulate ex vivo immune responsiveness. Further, factors derived from several lactobacilli strains act immune regulato-ry in vitro. In contrast, Staphylococcus aureus (S. aureus is known to induce excessive T cell activation. In this study we aimed to investigate S. aureus-induced activation of human muco-sal associated invariant T cells (MAIT cells, γδ T cells, NK cells, as well as of conventional CD4+ and CD8+ T cells in vitro. Further, we investigated if lactobacilli-derived factors could modulate their activation.PBMC were cultured with S. aureus 161:2 cell free supernatant (CFS, staphylococcal en-terotoxin A or CD3/CD28-beads alone or in combination with Lactobacillus rhamnosus (L. rhamnosus GG-CFS or Lactobacillus reuteri (L. reuteri DSM 17938-CFS, and activation of T and NK cells was evaluated. S. aureus-CFS induced IFN-γ and CD107a expression as well as proliferation. Co-stimulation with lactobacilli-CFS dampened lymphocyte activation in all cell types analysed. Pre-incubation with lactobacilli-CFS was enough to reduce subsequent activation and the ab-sence of APC or APC-derived IL-10 did not prevent lactobacilli-mediated dampening. Final-ly, lactate selectively dampened activation of unconventional T cells and NK cells. In summary, we show that molecules present in the lactobacilli-CFS are able to directly dampen in vitro activation of conventional and unconventional T cells and of NK cells. This study provides novel insights on the immune modulatory nature of probiotic lactobacilli and suggests a role for lactobacilli in modulation of induced T and NK cell activation.

  1. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology.

    Science.gov (United States)

    Shivakumarswamy, Udasimath; Arakeri, Surekha U; Karigowdar, Mahesh H; Yelikar, Br

    2012-01-01

    The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS) method. To compare the morphological features of the CS method with those of the cell block (CB) method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the 'z test' was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer's χ(2)test was used to identify the additional yield for malignancy by the CB method. Cellularity and additional yield for malignancy was 15% more by the CB method. The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  2. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available Background: The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS method. Aims: To compare the morphological features of the CS method with those of the cell block (CB method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. Materials and Methods: The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the ′z test′ was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer′s χ2 test was used to identify the additional yield for malignancy by the CB method. Results: Cellularity and additional yield for malignancy was 15% more by the CB method. Conclusions: The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  3. [Standardized indirect immunofluorescence. Differentiation of mitochondrial, microsomal and ribosomal antibodies].

    Science.gov (United States)

    Storch, W

    1977-02-15

    By an extensive standardisation of the indirect immunofluorescence for the demonstration espeially of mitochondrial antibodies we succeeded in recognizing atypical fluorescence patterns and in describing their exact localisation. On the basis of absorption studies with mitochondrias, microsomas and ribosomas by comparative observation of sections of liver, stomach and kidneys of rats the preferred sort of reaction and the intensity of fluorescence of antibodies against mitochondria, microsomas and ribosomas were empirically established. Antimitochondrial antibodies react above all with the parietal cells of the stomach and the distal epithelia of the tubulus of the kidney. Antibodies against microsomas of liver and kidney are characterized by a brilliant diffuse cytoplasmatic fluorescence of the hepatocytes and by a comparatively weaker fluorescence of exclusively proximal tubuli of the kidneys of rats. Antibodies against ribosomas lead to a fluorescence especially of the main cells of the stomach. The differentiation of several cytoplasmatic antibodies is among others of interest for the diagnosis of certain autoimmune diseases. Although there are numerous still unclear findings and "overlap" phenomena the existence of high titre antibodies against mitochondrias speaks for a primarily biliary cirrhosis or a pseudo-LE-syndrome, the existence of antibodies against microsomas of kidney and liver of rats for a special form of a chronically active hepatitis and the existence of the very rare antibodies against ribosomas for an active lupus erythematodes disseminatus.

  4. NKp46+CD3+ cells - a novel non-conventional T-cell subset in cattle exhibiting both NK cell and T-cell features

    Science.gov (United States)

    Connelley, Timothy K.; Longhi, Cassandra; Burrells, Alison; Degnan, Kathryn; Hope, Jayne; Allan, Alasdair; Hammond, John A.; Storset, Anne K.; Morrison, W. Ivan

    2014-01-01

    The NKp46 receptor demonstrates a high degree of lineage-specificity, being expressed almost exclusively in natural killer cells. Previous studies have demonstrated NKp46 expression by T-cells, but NKp46+CD3+ cells are rare and almost universally associated with NKp46 acquisition by T-cells following stimulation. In this study we demonstrate the existence of a population of NKp46+CD3+ cells resident in normal bovine PBMC which include cells of both the αβ TCR+ and γδ TCR+ lineages and is present at a frequency of 0.1-1.7%. NKp46+CD3+ cells express transcripts for a broad repertoire of both natural killer (NKR) and T-cell receptors (TCR) and also the CD3ζ, DAP10 and FcεR1γ but not DAP12 adaptor proteins. In vitro functional analysis of NKp46+CD3+ cells confirm that NKp46, CD16 and CD3 signalling pathways are all functionally competent and capable of mediating-re-direct cytolysis. However, only CD3 cross-ligation elicits IFN-γ release. NKp46+CD3+ cells exhibit cytotoxic activity against autologous Theileria parva infected cells in vitro and during in vivo challenge with this parasite an expansion of NKp46+CD3+ cells was observed in some animals, indicating the cells have the potential to act as an anti-pathogen effector population. The results presented herein identifies and describes a novel non-conventional NKp46+CD3+ T-cell subset that is phenotypically and functionally distinct from conventional NK and T-cells. The ability to exploit both NKR and TCR suggests these cells may fill a functional niche at the interface of innate and adaptive immune responses. PMID:24639352

  5. Human NKp44+IL-22+ cells and LTi-like cells constitute a stable RORC+ lineage distinct from conventional natural killer cells

    NARCIS (Netherlands)

    Crellin, Natasha K.; Trifari, Sara; Kaplan, Charles D.; Cupedo, Tom; Spits, Hergen

    2010-01-01

    Lymphoid tissue inducer (LTi) cells are required for lymph node formation during fetal development, and recent evidence implies a role in mucosal immunity in the adult. LTi cells share some phenotypic features of conventional natural killer (NK; cNK) cells; however, little is known to date about the

  6. Dopaminergic Immunofluorescence Studies in Kidney Tissue.

    Science.gov (United States)

    Gildea, J J; Van Sciver, R E; McGrath, H E; Kemp, B A; Jose, P A; Carey, R M; Felder, R A

    2017-01-01

    The kidney is a highly integrated system of specialized differentiated cells that are responsible for fluid and electrolyte balance in the body. While much of today's research focuses on isolated nephron segments or cells from nephron segments grown in tissue culture, an often overlooked technique that can provide a unique view of many cell types in the kidney is slice culture. Here, we describe techniques that use freshly excised kidney tissue from rats to perform a variety of experiments shortly after isolating the tissue. By slicing the rat kidney in a "bread loaf" format, multiple studies can be performed on slices from the same tissue in parallel. Cryosectioning and staining of the tissue allow for the evaluation of physiological or biochemical responses in a wide variety of specific nephron segments. The procedures described within this chapter can also be extended to human or mouse kidney tissue.

  7. Liquid balance monitoring inside conventional, Retrofit, and bio-reactor landfill cells.

    Science.gov (United States)

    Abichou, Tarek; Barlaz, Morton A; Green, Roger; Hater, Gary

    2013-10-01

    The Outer Loop landfill bioreactor (OLLB) in Louisville, KY, USA has been the site of a study to evaluate long-term bioreactor performance at a full-scale operational landfill. Three types of landfill units were studied including a conventional landfill (Control cell), a new landfill area that had an air addition and recirculation piping network installed as waste was being placed (As-Built cell), and a conventional landfill that was modified to allow for liquids recirculation (Retrofit cell). During the monitoring period, the Retrofit, Control, and As-Built cells received 48, 14, and 213LMg(-1) (liters of liquids per metric ton of waste), respectively. The leachate collection system yielded 60, 57 and 198LMg(-1) from the Retrofit, Control, and As-Built cells, respectively. The head on liner in all cells was below regulatory limits. In the Control and As-Built cells, leachate head on liner decreased once waste placement stopped. The measured moisture content of the waste samples was consistent with that calculated from the estimate of accumulated liquid by the liquid balance. Additionally, measurements on excavated solid waste samples revealed large spatial variability in waste moisture content. The degree of saturation in the Control cells decreased from 85% to 75%. The degree of saturation increased from 82% to 83% due to liquids addition in the Retrofit cells and decreased back to 80% once liquid addition stopped. In the As-Built cells, the degree of saturation increased from 87% to 97% during filling activities and then started to decrease soon after filling activities stopped to reach 92% at the end of the monitoring period. The measured leachate generation rates were used to estimate an in-place saturated hydraulic conductivity of the MSW in the range of 10(-8) to 10(-7)ms(-1) which is lower than previous reports. In the Control and Retrofit cells, the net loss in liquids, 43 and 12LMg(-1), respectively, was similar to the measured settlement of 15% and 5

  8. Estimation of antibodies to human cytomegalovirus by immunofluorescence and radioimmunoassay

    International Nuclear Information System (INIS)

    Jankowski, M.; Gut, W.; Nawrocka, E.

    1980-01-01

    The 125 I labelled IgG fraction against rabbit IgG of goat origin was employed for the detection of CMV IgG and IgM antibodies in the double indirect radioimmunoassay. The results were compared with those obtained in complement fixation, indirect immunofluorescence and anti-complement immunofluorescence tests. The application of labelled anti-fc antisera, instead of antisera against whole IgG in the tests for detection of specific CMV IgG antibody resulted in increased sensitivity of radioimmunoassay and reduction of non-specific cytoplasmatic reactions in preparations stained by indirect immunofluorescence. The absorption of sera with protein A rich staphylococci and aggregates to immunoglobulin eliminated unwanted secondary IgM staining caused by rheumatoid factors both in indirect immunofluorescence and radioimmunoassay tests for CMV antibodies. (author)

  9. Comparison of magnetic resonance angiography and conventional angiography in sickle cell disease: clinical significance and realibility

    International Nuclear Information System (INIS)

    Kandeel, A.Y.; Zimmerman, R.A.; Ohene-Frempong, K.

    1996-01-01

    We retrospectively reviewed the medical records and conventional angiograms of 21 patients with known sickle cell disease, who underwent a total of 50 magnetic resonance imaging (MRI) and magnetic resonance angiography (MRA) studies. MRA and conventional angiography were assessed separately for evidence of stenosis or occulusion. Follow up MRI/MRA studies were also assessed for evidence of progression, regression or stability of the disease in these patients. In the carotid circulation, MRA made the correct diagnosis in 85% of the vessels evaluated with a sensitivity of 80.5% and a specificity of 94%. MRA was also found to show evidence of disease progression, more often than did MRI or the clinical condition of the patients. (orig.)

  10. Neural Stem Cells: Implications for the Conventional Radiotherapy of Central Nervous System Malignancies

    International Nuclear Information System (INIS)

    Barani, Igor J.; Benedict, Stanley H.; Lin, Peck-Sun

    2007-01-01

    Advances in basic neuroscience related to neural stem cells and their malignant counterparts are challenging traditional models of central nervous system tumorigenesis and intrinsic brain repair. Neurogenesis persists into adulthood predominantly in two neurogenic centers: subventricular zone and subgranular zone. Subventricular zone is situated adjacent to lateral ventricles and subgranular zone is confined to the dentate gyrus of the hippocampus. Neural stem cells not only self-renew and differentiate along multiple lineages in these regions, but also contribute to intrinsic brain plasticity and repair. Ionizing radiation can depopulate these exquisitely sensitive regions directly or impair in situ neurogenesis by indirect, dose-dependent and inflammation-mediated mechanisms, even at doses <2 Gy. This review discusses the fundamental neural stem cell concepts within the framework of cumulative clinical experience with the treatment of central nervous system malignancies using conventional radiotherapy

  11. Differential requirement for the CD45 splicing regulator hnRNPLL for accumulation of NKT and conventional T cells.

    Directory of Open Access Journals (Sweden)

    Mehmet Yabas

    Full Text Available Natural killer T (NKT cells represent an important regulatory T cell subset that develops in the thymus and contains immature (NK1.1(lo and mature (NK1.1(hi cell subsets. Here we show in mice that an inherited mutation in heterogeneous ribonucleoprotein L-like protein (hnRNPLL(thunder, that shortens the survival of conventional T cells, has no discernible effect on NKT cell development, homeostasis or effector function. Thus, Hnrpll deficiency effectively increases the NKT∶T cell ratio in the periphery. However, Hnrpll mutation disrupts CD45RA, RB and RC exon silencing of the Ptprc mRNA in both NKT and conventional T cells, and leads to a comparably dramatic shift to high molecular weight CD45 isoforms. In addition, Hnrpll mutation has a cell intrinsic effect on the expression of the developmentally regulated cell surface marker NK1.1 on NKT cells in the thymus and periphery but does not affect cell numbers. Therefore our results highlight both overlapping and divergent roles for hnRNPLL between conventional T cells and NKT cells. In both cell subsets it is required as a trans-acting factor to regulate alternative splicing of the Ptprc mRNA, but it is only required for survival of conventional T cells.

  12. Immunofluorescent determination of wheat protein in meat products

    Directory of Open Access Journals (Sweden)

    Michaela Petrášová

    2014-02-01

    Full Text Available In food industry nowadays, there are various plant-origin protein additives which are meant for production of meat products. Among the most frequent additives of this type there are different kinds of flour, starch, fiber, and plant-origin proteins. Their usage at present is limited by the existing legislation not to prevent consumer deception but also for reasons of possible influence on consumer health. Therefore, this problem is paid a lot of attention not only in the Czech Republic but also all over the world. The main risk is seen in the impossibility to choose a suitable foodstuff for an individual prone to allergic reactions. Potential allergens are also often plant-origin raw materials which are added into foodstuffs for their technological qualities and low price. Wheat is widely cultivated cereal as well as an important source of proteins. After ingestion or inhalation, wheat proteins may cause adverse reactions. These adverse effects include a wide range of disorders which are dependent on the method of contact with wheat protein. These adverse effects can then take the form of various clinical manifestations, such as celiac disease, T-cell mediated inflammatory bowel disease, dermatitis, skin rash, breathing difficulties, allergy to pollen or to wheat flour or food allergy to foodstuffs containing gluten. The only possible protection against adverse immune reactions for those with food allergies is strictly excluding the allergen from their diet. Although the number of studies dealing with the reduction or loss of allergenicity is increasing, yet these practices are not common. Most of the population suffering from food allergies is thus still dependent on strict exclusion of foodstuffs causing adverse allergic reactions from their diet. In order to avoid misleading consumers and also to protect allergic consumers, analytical methods applicable to all types of foodstuffs have been developed. Unfortunately, detection of allergens in

  13. IFDOTMETER: A New Software Application for Automated Immunofluorescence Analysis.

    Science.gov (United States)

    Rodríguez-Arribas, Mario; Pizarro-Estrella, Elisa; Gómez-Sánchez, Rubén; Yakhine-Diop, S M S; Gragera-Hidalgo, Antonio; Cristo, Alejandro; Bravo-San Pedro, Jose M; González-Polo, Rosa A; Fuentes, José M

    2016-04-01

    Most laboratories interested in autophagy use different imaging software for managing and analyzing heterogeneous parameters in immunofluorescence experiments (e.g., LC3-puncta quantification and determination of the number and size of lysosomes). One solution would be software that works on a user's laptop or workstation that can access all image settings and provide quick and easy-to-use analysis of data. Thus, we have designed and implemented an application called IFDOTMETER, which can run on all major operating systems because it has been programmed using JAVA (Sun Microsystems). Briefly, IFDOTMETER software has been created to quantify a variety of biological hallmarks, including mitochondrial morphology and nuclear condensation. The program interface is intuitive and user-friendly, making it useful for users not familiar with computer handling. By setting previously defined parameters, the software can automatically analyze a large number of images without the supervision of the researcher. Once analysis is complete, the results are stored in a spreadsheet. Using software for high-throughput cell image analysis offers researchers the possibility of performing comprehensive and precise analysis of a high number of images in an automated manner, making this routine task easier. © 2015 Society for Laboratory Automation and Screening.

  14. Conditional ablation of CD205+ conventional dendritic cells impacts the regulation of T-cell immunity and homeostasis in vivo.

    Science.gov (United States)

    Fukaya, Tomohiro; Murakami, Ryuichi; Takagi, Hideaki; Sato, Kaori; Sato, Yumiko; Otsuka, Haruna; Ohno, Michiko; Hijikata, Atsushi; Ohara, Osamu; Hikida, Masaki; Malissen, Bernard; Sato, Katsuaki

    2012-07-10

    Dendritic cells (DCs) are composed of multiple subsets that play a dual role in inducing immunity and tolerance. However, it is unclear how CD205(+) conventional DCs (cDCs) control immune responses in vivo. Here we generated knock-in mice with the selective conditional ablation of CD205(+) cDCs. CD205(+) cDCs contributed to antigen-specific priming of CD4(+) T cells under steady-state conditions, whereas they were dispensable for antigen-specific CD4(+) T-cell responses under inflammatory conditions. In contrast, CD205(+) cDCs were required for antigen-specific priming of CD8(+) T cells to generate cytotoxic T lymphocytes (CTLs) mediated through cross-presentation. Although CD205(+) cDCs were involved in the thymic generation of CD4(+) regulatory T cells (Tregs), they maintained the homeostasis of CD4(+) Tregs and CD4(+) effector T cells in peripheral and mucosal tissues. On the other hand, CD205(+) cDCs were involved in the inflammation triggered by Toll-like receptor ligand as well as bacterial and viral infections. Upon microbial infections, CD205(+) cDCs contributed to the cross-priming of CD8(+) T cells for generating antimicrobial CTLs to efficiently eliminate pathogens, whereas they suppressed antimicrobial CD4(+) T-cell responses. Thus, these findings reveal a critical role for CD205(+) cDCs in the regulation of T-cell immunity and homeostasis in vivo.

  15. Liquid balance monitoring inside conventional, Retrofit, and bio-reactor landfill cells

    Energy Technology Data Exchange (ETDEWEB)

    Abichou, Tarek, E-mail: abichou@eng.fsu.edu [Department of Civil and Environmental Engineering, Florida State University, 2525 Pottsdamer Street, Tallahassee, FL 32311 (United States); Barlaz, Morton A. [Department of Civil, Construction, and Environmental Engineering, North Carolina State University, Raleigh, NC 27695 (United States); Green, Roger; Hater, Gary [Waste Management Inc., Cincinnati, OH 45211 (United States)

    2013-10-15

    Highlights: • The Retrofit, Control, and As-Built cells received 48, 14, and 213 L Mg{sup −1} (liters of liquids per metric ton of waste). • The leachate collection system yielded 60, 57 and 198 L Mg{sup −1} from the Retrofit, Control, and As-Built cells. • The head on liner in all cells was below regulatory limits. • Measured moisture content of the waste samples was consistent with that calculated from accumulated liquid by balance. • The in-place saturated hydraulic conductivity of the MSW was calculated to be in the range of 10{sup −8} to 10{sup −7} m s{sup −1}. - Abstract: The Outer Loop landfill bioreactor (OLLB) in Louisville, KY, USA has been the site of a study to evaluate long-term bioreactor performance at a full-scale operational landfill. Three types of landfill units were studied including a conventional landfill (Control cell), a new landfill area that had an air addition and recirculation piping network installed as waste was being placed (As-Built cell), and a conventional landfill that was modified to allow for liquids recirculation (Retrofit cell). During the monitoring period, the Retrofit, Control, and As-Built cells received 48, 14, and 213 L Mg{sup −1} (liters of liquids per metric ton of waste), respectively. The leachate collection system yielded 60, 57 and 198 L Mg{sup −1} from the Retrofit, Control, and As-Built cells, respectively. The head on liner in all cells was below regulatory limits. In the Control and As-Built cells, leachate head on liner decreased once waste placement stopped. The measured moisture content of the waste samples was consistent with that calculated from the estimate of accumulated liquid by the liquid balance. Additionally, measurements on excavated solid waste samples revealed large spatial variability in waste moisture content. The degree of saturation in the Control cells decreased from 85% to 75%. The degree of saturation increased from 82% to 83% due to liquids addition in the Retrofit

  16. Liquid balance monitoring inside conventional, Retrofit, and bio-reactor landfill cells

    International Nuclear Information System (INIS)

    Abichou, Tarek; Barlaz, Morton A.; Green, Roger; Hater, Gary

    2013-01-01

    Highlights: • The Retrofit, Control, and As-Built cells received 48, 14, and 213 L Mg −1 (liters of liquids per metric ton of waste). • The leachate collection system yielded 60, 57 and 198 L Mg −1 from the Retrofit, Control, and As-Built cells. • The head on liner in all cells was below regulatory limits. • Measured moisture content of the waste samples was consistent with that calculated from accumulated liquid by balance. • The in-place saturated hydraulic conductivity of the MSW was calculated to be in the range of 10 −8 to 10 −7 m s −1 . - Abstract: The Outer Loop landfill bioreactor (OLLB) in Louisville, KY, USA has been the site of a study to evaluate long-term bioreactor performance at a full-scale operational landfill. Three types of landfill units were studied including a conventional landfill (Control cell), a new landfill area that had an air addition and recirculation piping network installed as waste was being placed (As-Built cell), and a conventional landfill that was modified to allow for liquids recirculation (Retrofit cell). During the monitoring period, the Retrofit, Control, and As-Built cells received 48, 14, and 213 L Mg −1 (liters of liquids per metric ton of waste), respectively. The leachate collection system yielded 60, 57 and 198 L Mg −1 from the Retrofit, Control, and As-Built cells, respectively. The head on liner in all cells was below regulatory limits. In the Control and As-Built cells, leachate head on liner decreased once waste placement stopped. The measured moisture content of the waste samples was consistent with that calculated from the estimate of accumulated liquid by the liquid balance. Additionally, measurements on excavated solid waste samples revealed large spatial variability in waste moisture content. The degree of saturation in the Control cells decreased from 85% to 75%. The degree of saturation increased from 82% to 83% due to liquids addition in the Retrofit cells and decreased back to 80

  17. Mpl traffics to the cell surface through conventional and unconventional routes.

    Science.gov (United States)

    Cleyrat, Cédric; Darehshouri, Anza; Steinkamp, Mara P; Vilaine, Mathias; Boassa, Daniela; Ellisman, Mark H; Hermouet, Sylvie; Wilson, Bridget S

    2014-09-01

    Myeloproliferative neoplasms (MPNs) are often characterized by JAK2 or calreticulin (CALR) mutations, indicating aberrant trafficking in pathogenesis. This study focuses on Mpl trafficking and Jak2 association using two model systems: human erythroleukemia cells (HEL; JAK2V617F) and K562 myeloid leukemia cells (JAK2WT). Consistent with a putative chaperone role for Jak2, Mpl and Jak2 associate on both intracellular and plasma membranes (shown by proximity ligation assay) and siRNA-mediated knockdown of Jak2 led to Mpl trapping in the endoplasmic reticulum (ER). Even in Jak2 sufficient cells, Mpl accumulates in punctate structures that partially colocalize with ER-tracker, the ER exit site marker (ERES) Sec31a, the autophagy marker LC3 and LAMP1. Mpl was fused to miniSOG, a genetically encoded tag for correlated light and electron microscopy. Results suggest that a fraction of Mpl is taken up into autophagic structures from the ER and routed to autolyososomes. Surface biotinylation shows that both immature and mature Mpl reach the cell surface; in K562 cells Mpl is also released in exosomes. Both forms rapidly internalize upon ligand addition, while recovery is primarily attributed to immature Mpl. Mpl appears to reach the plasma membrane via both conventional ER-Golgi and autolysosome secretory pathways, as well as recycling. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Conventional dendritic cells at the crossroads between immunity and cholesterol homeostasis in atherosclerosis.

    Science.gov (United States)

    Gautier, Emmanuel L; Huby, Thierry; Saint-Charles, Flora; Ouzilleau, Betty; Pirault, John; Deswaerte, Virginie; Ginhoux, Florent; Miller, Elizabeth R; Witztum, Joseph L; Chapman, M John; Lesnik, Philippe

    2009-05-05

    Immunoinflammatory mechanisms are implicated in the atherogenic process. The polarization of the immune response and the nature of the immune cells involved, however, are major determinants of the net effect, which may be either proatherogenic or antiatherogenic. Dendritic cells (DCs) are central to the regulation of immunity, the polarization of the immune response, and the induction of tolerance to antigens. The potential role of DCs in atherosclerosis, however, remains to be defined. We created a mouse model in which the lifespan and immunogenicity of conventional DCs are enhanced by specific overexpression of the antiapoptotic gene hBcl-2 under the control of the CD11c promoter. When studied in either low-density lipoprotein receptor-deficient or apolipoprotein E-deficient backgrounds, DC-hBcl2 mice exhibited an expanded DC population associated with enhanced T-cell activation, a T-helper 1 and T-helper 17 cytokine expression profile, and elevated production of T-helper 1-driven IgG2c autoantibodies directed against oxidation-specific epitopes. This proatherogenic signature, however, was not associated with acceleration of atherosclerotic plaque progression, because expansion of the DC population was unexpectedly associated with an atheroprotective decrease in plasma cholesterol levels. Conversely, depletion of DCs in hyperlipidemic CD11c-diphtheria toxin receptor/apolipoprotein E-deficient transgenic mice resulted in enhanced cholesterolemia, thereby arguing for a close relationship between the DC population and plasma cholesterol levels. Considered together, the present data reveal that conventional DCs are central to the atherosclerotic process, because they are directly implicated in both cholesterol homeostasis and the immune response.

  19. Molecular Morphology of Pituitary Cells, from Conventional Immunohistochemistry to Fluorescein Imaging

    Directory of Open Access Journals (Sweden)

    R. Yoshiyuki Osamura

    2011-04-01

    Full Text Available In situ hybridization (ISH at the electron microscopic (EM level is essential for elucidating the intracellular distribution and role of mRNA in protein synthesis. EM-ISH is considered to be an important tool for clarifying the intracellular localization of mRNA and the exact site of pituitary hormone synthesis on the rough endoplasmic reticulum. A combined ISH and immunohistochemistry (IHC under EM (EM-ISH&IHC approach has sufficient ultrastructural resolution, and provides two-dimensional images of the subcellular localization of pituitary hormone and its mRNA in a pituitary cell. The advantages of semiconductor nanocrystals (quantum dots, Qdots and confocal laser scanning microscopy (CLSM enable us to obtain three-dimensional images of the subcellular localization of pituitary hormone and its mRNA. Both EM-ISH&IHC and ISH & IHC using Qdots and CLSM are useful for understanding the relationships between protein and mRNA simultaneously in two or three dimensions. CLSM observation of rab3B and SNARE proteins such as SNAP-25 and syntaxin has revealed that both rab3B and SNARE system proteins play important roles and work together as the exocytotic machinery in anterior pituitary cells. Another important issue is the intracellular transport and secretion of pituitary hormone. We have developed an experimental pituitary cell line, GH3 cell, which has growth hormone (GH linked to enhanced yellow fluorescein protein (EYFP. This stable GH3 cell secretes GH linked to EYFP upon stimulation by Ca2+ influx or Ca2+ release from storage. This GH3 cell line is useful for the real-time visualization of the intracellular transport and secretion of GH. These three methods from conventional immunohistochemistry and fluorescein imaging allow us to consecutively visualize the process of transcription, translation, transport and secretion of anterior pituitary hormone.

  20. Immunofluorescence detection of pea protein in meat products.

    Science.gov (United States)

    Petrášová, Michaela; Pospiech, Matej; Tremlová, Bohuslava; Javůrková, Zdeňka

    2016-08-01

    In this study we developed an immunofluorescence method to detect pea protein in meat products. Pea protein has a high nutritional value but in sensitive individuals it may be responsible for causing allergic reactions. We produced model meat products with various additions of pea protein and flour; the detection limit (LOD) of the method for pea flour was 0.5% addition, and for pea protein it was 0.001% addition. The repeatabilities and reproducibilities for samples both positive and negative for pea protein were all 100%. In a blind test with model products and commercial samples, there was no statistically significant difference (p > 0.05) between the declared concentrations of pea protein and flour and the immunofluorescence method results. Sensitivity was 1.06 and specificity was 1.00. These results show that the immunofluorescence method is suitable for the detection of pea protein in meat products.

  1. Indirect immunofluorescence staining of Chlamydia trachomatis inclusions in microculture plates with monoclonal antibodies.

    Science.gov (United States)

    Zapata, M; Chernesky, M; Mahony, J

    1984-06-01

    Indirect immunofluorescence (IF) staining, using a monoclonal antibody, detected two- to fourfold more inclusions than did iodine staining. Of 274 clinical specimens, 53 (19.3%) were positive by IF on passage 1 as compared with 33 (12%) by iodine staining (P less than 0.005). IF-stained inclusions in McCoy cells in the bottom of microculture wells were readily viewed with a long-focal-length objective at a magnification of 250 X.

  2. Indirect immunofluorescence staining of Chlamydia trachomatis inclusions in microculture plates with monoclonal antibodies.

    OpenAIRE

    Zapata, M; Chernesky, M; Mahony, J

    1984-01-01

    Indirect immunofluorescence (IF) staining, using a monoclonal antibody, detected two- to fourfold more inclusions than did iodine staining. Of 274 clinical specimens, 53 (19.3%) were positive by IF on passage 1 as compared with 33 (12%) by iodine staining (P less than 0.005). IF-stained inclusions in McCoy cells in the bottom of microculture wells were readily viewed with a long-focal-length objective at a magnification of 250 X.

  3. Clec9a-Mediated Ablation of Conventional Dendritic Cells Suggests a Lymphoid Path to Generating Dendritic Cells In Vivo

    Directory of Open Access Journals (Sweden)

    Johanna Salvermoser

    2018-04-01

    Full Text Available Conventional dendritic cells (cDCs are versatile activators of immune responses that develop as part of the myeloid lineage downstream of hematopoietic stem cells. We have recently shown that in mice precursors of cDCs, but not of other leukocytes, are marked by expression of DNGR-1/CLEC9A. To genetically deplete DNGR-1-expressing cDC precursors and their progeny, we crossed Clec9a-Cre mice to Rosa-lox-STOP-lox-diphtheria toxin (DTA mice. These mice develop signs of age-dependent myeloproliferative disease, as has been observed in other DC-deficient mouse models. However, despite efficient depletion of cDC progenitors in these mice, cells with phenotypic characteristics of cDCs populate the spleen. These cells are functionally and transcriptionally similar to cDCs in wild type control mice but show somatic rearrangements of Ig-heavy chain genes, characteristic of lymphoid origin cells. Our studies reveal a previously unappreciated developmental heterogeneity of cDCs and suggest that the lymphoid lineage can generate cells with features of cDCs when myeloid cDC progenitors are impaired.

  4. Mechanism of chromium poisoning the conventional cathode material for solid oxide fuel cells

    Science.gov (United States)

    Zhang, Xiaoqiang; Yu, Guangsen; Zeng, Shumao; Parbey, Joseph; Xiao, Shuhao; Li, Baihai; Li, Tingshuai; Andersson, Martin

    2018-03-01

    Chromium poisoning the La0.875Sr0.125MnO3 (LSM) cathode for solid oxide fuel cells is a critical issue that can strongly affect the stability. In this study, we evaluate the temperature distribution in a SOFC based on a 3D model and then combine conductivity test and material computation to reveal the effects of chromium in SUS430 stainless steels on LSM conductivities. The starch concentration in LSM pellets and the applied pressure on the contact with interconnect materials show close relationships with the chromium poisoning behavior. The density functional theory (DFT) computing results indicate that chromium atoms preferably adsorb on the MnO2-terminated and La (Sr)-O-terminated (001) surfaces. The resulting conclusions are expected to deeply understand mechanism of chromium deactivating conventional cathodes at some typical operational conditions, and offer crucial information to optimize the structure to avoid the poisoning effect.

  5. Secondary leukemia associated with a conventional dose of etoposide: review of serial germ cell tumor protocols.

    Science.gov (United States)

    Nichols, C R; Breeden, E S; Loehrer, P J; Williams, S D; Einhorn, L H

    1993-01-06

    Case reports have suggested that treatment with high-dose etoposide can result in development of a unique secondary leukemia. This study was designed to estimate the risk of developing leukemia for patients receiving conventional doses of etoposide along with cisplatin and bleomycin. We reviewed the records at Indiana University of all untreated patients entering clinical trials using etoposide at conventional doses (cumulative dose, 2000 mg/m2 or less) for germ cell cancer between 1982 and 1991. The records of all patients who received a chemotherapy regimen containing etoposide, ifosfamide, or cisplatin after failing to respond to primary chemotherapy were also reviewed. Between 1982 and 1991, 538 patients entered serial clinical trials with planned cumulative etoposide doses of 1500-2000 mg/m2 in combination with cisplatin plus either ifosfamide or bleomycin. Of these 538 patients, 348 received an etoposide combination as initial chemotherapy and 190 received etoposide as part of salvage treatment. To date, 315 patients are alive, with median follow-up of 4.9 years, and 337 patients have had follow-up beyond 2 years. Two patients (0.37%) developed leukemia. One developed acute undifferentiated leukemia with a t(4;11) (q21;q23) cytogenetic abnormality 2.0 years after starting etoposide-based therapy, and one developed acute myelomonoblastic leukemia with no chromosome abnormalities 2.3 years after beginning chemotherapy. During this period, several hundred patients were treated with etoposide-based chemotherapy and did not enter clinical trials. Three of these patients are known to have developed hematologic abnormalities, including one patient with acute monoblastic leukemia with a t(11;19)(q13;p13) abnormality. Secondary leukemia after treatment with a conventional dose of etoposide does occur, but the low incidence does not alter the risk-to-benefit ratio of etoposide-based chemotherapy in germ cell cancer. The reports of leukemia associated with high doses of

  6. Role of direct immunofluorescence in the diagnosis of glomerulonephritis

    Directory of Open Access Journals (Sweden)

    Archana C Buch

    2015-01-01

    Full Text Available Background: Immunofluorescence microscopy is a vital tool for the diagnosis of glomerular diseases. This study was carried out to study patterns of glomerulonephritis (GN and to record the sensitivity of direct immunofluorescence (DIF in renal lesions. The DIF findings were correlated with clinical and histopathology findings and discrepancies were analyzed. Materials and Methods: The cross-sectional analytical study was conducted during the period July 2011 to July 2013 at a tertiary care Hospital, Department of Pathology. A total of 75 renal biopsies were received for routine and immunofluorescence studies in which histopathology and clinical data were reviewed and analyzed. Results: The sensitivity of DIF was 87.9% and specificity was 70.5%. The maximum number of cases were seen in the age group 41-50 years. The pattern of GN by DIF was minimal change disease (MCD in 24%, IgA nephropathy in 13%, focal segmental glomerulosclerosis in 9% and membranoproliferative glomerulonephritis in 8% of the cases. Twelve histopathologically proven cases of GN were negative on DIF. One case of MCD on histopathology was diagnosed as IgM nephropathy based on DIF. Conclusion: Direct immunofluorescence forms an important diagnostic tool in reaching the exact diagnosis in various types of GN presenting with overlapping clinical and histomorphological features.

  7. IRF8 Transcription Factor Controls Survival and Function of Terminally Differentiated Conventional and Plasmacytoid Dendritic Cells, Respectively

    DEFF Research Database (Denmark)

    Sichien, Dorine; Scott, Charlotte L; Martens, Liesbet

    2016-01-01

    Interferon regulatory factor-8 (IRF8) has been proposed to be essential for development of monocytes, plasmacytoid dendritic cells (pDCs) and type 1 conventional dendritic cells (cDC1s) and remains highly expressed in differentiated DCs. Transcription factors that are required to maintain the ide...

  8. Conventional-Dose versus High-Dose Chemotherapy for Relapsed Germ Cell Tumors

    Directory of Open Access Journals (Sweden)

    Deaglan J. McHugh

    2018-01-01

    Full Text Available The majority of metastatic germ cell tumors (GCTs are cured with cisplatin-based chemotherapy, but 20–30% of patients will relapse after first-line chemotherapy and require additional salvage strategies. The two major salvage approaches in this scenario are high-dose chemotherapy (HDCT with autologous stem cell transplant (ASCT or conventional-dose chemotherapy (CDCT. Both CDCT and HDCT have curative potential in the management of relapsed/refractory GCT. However, due to a lack of conclusive randomized trials, it remains unknown whether sequential HDCT or CDCT represents the optimal initial salvage approach, with practice varying between tertiary institutions. This represents the most pressing question remaining for defining GCT treatment standards and optimizing outcomes. The authors review prognostic factors in the initial salvage setting as well as the major studies assessing the efficacy of CDCT, HDCT, or both, describing the strengths and weaknesses that formed the rationale behind the ongoing international phase III “TIGER” trial.

  9. Phosphoproteomics Reveals Regulatory T Cell-Mediated DEF6 Dephosphorylation That Affects Cytokine Expression in Human Conventional T Cells

    KAUST Repository

    Joshi, Rubin N.

    2017-09-25

    Regulatory T cells (Tregs) control key events of immune tolerance, primarily by suppression of effector T cells. We previously revealed that Tregs rapidly suppress T cell receptor (TCR)-induced calcium store depletion in conventional CD4CD25 T cells (Tcons) independently of IP levels, consequently inhibiting NFAT signaling and effector cytokine expression. Here, we study Treg suppression mechanisms through unbiased phosphoproteomics of primary human Tcons upon TCR stimulation and Treg-mediated suppression, respectively. Tregs induced a state of overall decreased phosphorylation as opposed to TCR stimulation. We discovered novel phosphosites (T595_S597) in the DEF6 (SLAT) protein that were phosphorylated upon TCR stimulation and conversely dephosphorylated upon coculture with Tregs. Mutation of these DEF6 phosphosites abrogated interaction of DEF6 with the IP receptor and affected NFAT activation and cytokine transcription in primary Tcons. This novel mechanism and phosphoproteomics data resource may aid in modifying sensitivity of Tcons to Treg-mediated suppression in autoimmune disease or cancer.

  10. NKT Cell-TCR Expression Activates Conventional T Cells in Vivo, but Is Largely Dispensable for Mature NKT Cell Biology

    Science.gov (United States)

    Vahl, J. Christoph; Heger, Klaus; Knies, Nathalie; Hein, Marco Y.; Boon, Louis; Yagita, Hideo; Polic, Bojan; Schmidt-Supprian, Marc

    2013-01-01

    Natural killer T (NKT) cell development depends on recognition of self-glycolipids via their semi-invariant Vα14i-TCR. However, to what extent TCR-mediated signals determine identity and function of mature NKT cells remains incompletely understood. To address this issue, we developed a mouse strain allowing conditional Vα14i-TCR expression from within the endogenous Tcrα locus. We demonstrate that naïve T cells are activated upon replacement of their endogenous TCR repertoire with Vα14i-restricted TCRs, but they do not differentiate into NKT cells. On the other hand, induced TCR ablation on mature NKT cells did not affect their lineage identity, homeostasis, or innate rapid cytokine secretion abilities. We therefore propose that peripheral NKT cells become unresponsive to and thus are independent of their autoreactive TCR. PMID:23853545

  11. NKT cell-TCR expression activates conventional T cells in vivo, but is largely dispensable for mature NKT cell biology.

    Directory of Open Access Journals (Sweden)

    J Christoph Vahl

    Full Text Available Natural killer T (NKT cell development depends on recognition of self-glycolipids via their semi-invariant Vα14i-TCR. However, to what extent TCR-mediated signals determine identity and function of mature NKT cells remains incompletely understood. To address this issue, we developed a mouse strain allowing conditional Vα14i-TCR expression from within the endogenous Tcrα locus. We demonstrate that naïve T cells are activated upon replacement of their endogenous TCR repertoire with Vα14i-restricted TCRs, but they do not differentiate into NKT cells. On the other hand, induced TCR ablation on mature NKT cells did not affect their lineage identity, homeostasis, or innate rapid cytokine secretion abilities. We therefore propose that peripheral NKT cells become unresponsive to and thus are independent of their autoreactive TCR.

  12. Multiplexed Immunofluorescence Reveals Potential PD-1/PD-L1 Pathway Vulnerabilities in Craniopharyngioma.

    Science.gov (United States)

    Coy, Shannon; Rashid, Rumana; Lin, Jia-Ren; Du, Ziming; Donson, Andrew M; Hankinson, Todd C; Foreman, Nicholas K; Manley, Peter E; Kieran, Mark W; Reardon, David A; Sorger, Peter K; Santagata, Sandro

    2018-03-02

    Craniopharyngiomas are neoplasms of the sellar/parasellar region that are classified into adamantinomatous (ACP) and papillary (PCP) subtypes. Surgical resection of craniopharyngiomas is challenging, and recurrence is common, frequently leading to profound morbidity. BRAF V600E mutations render PCP susceptible to BRAF/MEK inhibitors, but effective targeted therapies are needed for ACP. We explored the feasibility of targeting the PD-1/PD-L1 immune checkpoint pathway in ACP and PCP. We mapped and quantified PD-L1 and PD-1 expression in ACP and PCP resections using immunohistochemistry, immunofluorescence, and RNA in situ hybridization. We used tissue-based cyclic immunofluorescence (t-CyCIF) to map the spatial distribution of immune cells and characterize cell cycle and signaling pathways in ACP tumor cells which intrinsically express PD-1. All ACP (15±14% of cells, n=23, average±S.D.) and PCP (35±22% of cells, n=18) resections expressed PD-L1. In ACP, PD-L1 was predominantly expressed by tumor cells comprising the cyst-lining. In PCP, PD-L1 was highly-expressed by tumor cells surrounding the stromal fibrovascular cores. ACP also exhibited tumor cell-intrinsic PD-1 expression in whorled epithelial cells with nuclear-localized beta-catenin. These cells exhibited evidence of elevated mTOR and MAPK signaling. Profiling of immune populations in ACP and PCP showed a modest density of CD8+ T-cells. ACP exhibit PD-L1 expression in the tumor cyst-lining and intrinsic PD-1 expression in cells proposed to comprise an oncogenic stem-like population. In PCP, proliferative tumor cells express PD-L1 in a continuous band at the stromal-epithelial interface. Targeting PD-L1 and/or PD-1 in both subtypes of craniopharyngioma might therefore be an effective therapeutic strategy.

  13. Surface-biofunctionalized multicore/shell CdTe@SiO2 composite particles for immunofluorescence assay

    Science.gov (United States)

    Jing, Lihong; Li, Yilin; Ding, Ke; Qiao, Ruirui; Rogach, Andrey L.; Gao, Mingyuan

    2011-12-01

    Strongly fluorescent multicore/shell structured CdTe@SiO2 composite particles of ~ 50 nm were synthesized via the reverse microemulsion method by using CdTe quantum dots co-stabilized by thioglycolic acid and thioglycerol. The optical stability of the CdTe@SiO2 composite particles in a wide pH range, under prolonged UV irradiation in pure water, or in different types of physiological buffers was systematically investigated. Towards immunofluorescence assay, both poly(ethylene glycol) (PEG) and carboxyl residues were simultaneously grafted on the surface of the silanol-terminated CdTe@SiO2 composite particles upon further reactions with silane reagents bearing a PEG segment and carboxyl group, respectively, in order to suppress the nonspecific interactions of the silica particles with proteins and meanwhile introduce reactive moieties to the fluorescent particles. Agarose gel electrophoresis, dynamic light scattering and conventional optical spectroscopy were combined to investigate the effectiveness of the surface modifications. Via the surface carboxyl residue, various antibodies were covalently conjugated to the fluorescent particles and the resultant fluorescent probes were used in detecting cancer cells through both direct fluorescent antibody and indirect fluorescent antibody assays, respectively.

  14. Pathogenic TH17 inflammation is sustained in the lungs by conventional dendritic cells and Toll-like receptor 4 signaling.

    Science.gov (United States)

    Shalaby, Karim H; Lyons-Cohen, Miranda R; Whitehead, Gregory S; Thomas, Seddon Y; Prinz, Immo; Nakano, Hideki; Cook, Donald N

    2017-11-14

    Mechanisms that elicit mucosal T H 17 cell responses have been described, yet how these cells are sustained in chronically inflamed tissues remains unclear. We sought to understand whether maintenance of lung T H 17 inflammation requires environmental agents in addition to antigen and to identify the lung antigen-presenting cell (APC) types that sustain the self-renewal of T H 17 cells. Animals were exposed repeatedly to aspiration of ovalbumin alone or together with environmental adjuvants, including common house dust extract (HDE), to test their role in maintaining lung inflammation. Alternatively, antigen-specific effector/memory T H 17 cells, generated in culture with CD4 + T cells from Il17a fate-mapping mice, were adoptively transferred to assess their persistence in genetically modified animals lacking distinct lung APC subsets or cell-specific Toll-like receptor (TLR) 4 signaling. T H 17 cells were also cocultured with lung APC subsets to determine which of these could revive their expansion and activation. T H 17 cells and the consequent neutrophilic inflammation were poorly sustained by inhaled antigen alone but were augmented by inhalation of antigen together with HDE. This was associated with weight loss and changes in lung physiology consistent with interstitial lung disease. The effect of HDE required TLR4 signaling predominantly in lung hematopoietic cells, including CD11c + cells. CD103 + and CD11b + conventional dendritic cells interacted directly with T H 17 cells in situ and revived the clonal expansion of T H 17 cells both ex vivo and in vivo, whereas lung macrophages and B cells could not. T H 17-dependent inflammation in the lungs can be sustained by persistent TLR4-mediated activation of lung conventional dendritic cells. Published by Elsevier Inc.

  15. Three new chondrosarcoma cell lines: one grade III conventional central chondrosarcoma and two dedifferentiated chondrosarcomas of bone

    Science.gov (United States)

    2012-01-01

    Background Chondrosarcoma is the second most common primary sarcoma of bone. High-grade conventional chondrosarcoma and dedifferentiated chondrosarcoma have a poor outcome. In pre-clinical research aiming at the identification of novel treatment targets, the need for representative cell lines and model systems is high, but availability is scarce. Methods We developed and characterized three cell lines, derived from conventional grade III chondrosarcoma (L835), and dedifferentiated chondrosarcoma (L2975 and L3252) of bone. Proliferation and migration were studied and we used COBRA-FISH and array-CGH for karyotyping and genotyping. Immunohistochemistry for p16 and p53 was performed as well as TP53 and IDH mutation analysis. Cells were injected into nude mice to establish their tumorigenic potential. Results We show that the three cell lines have distinct migrative properties, L2975 had the highest migration rate and showed tumorigenic potential in mice. All cell lines showed chromosomal rearrangements with complex karyotypes and genotypic aberrations were conserved throughout late passaging of the cell lines. All cell lines showed loss of CDKN2A, while TP53 was wild type for exons 5–8. L835 has an IDH1 R132C mutation, L2975 an IDH2 R172W mutation and L3252 is IDH wild type. Conclusions Based on the stable culturing properties of these cell lines and their genotypic profile resembling the original tumors, these cell lines should provide useful functional models to further characterize chondrosarcoma and to evaluate new treatment strategies. PMID:22928481

  16. Three new chondrosarcoma cell lines: one grade III conventional central chondrosarcoma and two dedifferentiated chondrosarcomas of bone

    International Nuclear Information System (INIS)

    Oosterwijk, Jolieke G van; Bovée, Judith VMG; Jong, Danielle de; Ruler, Maayke AJH van; Hogendoorn, Pancras CW; Dijkstra, PD Sander; Rijswijk, Carla SP van; Machado, Isidro; Llombart-Bosch, Antonio; Szuhai, Karoly

    2012-01-01

    Chondrosarcoma is the second most common primary sarcoma of bone. High-grade conventional chondrosarcoma and dedifferentiated chondrosarcoma have a poor outcome. In pre-clinical research aiming at the identification of novel treatment targets, the need for representative cell lines and model systems is high, but availability is scarce. We developed and characterized three cell lines, derived from conventional grade III chondrosarcoma (L835), and dedifferentiated chondrosarcoma (L2975 and L3252) of bone. Proliferation and migration were studied and we used COBRA-FISH and array-CGH for karyotyping and genotyping. Immunohistochemistry for p16 and p53 was performed as well as TP53 and IDH mutation analysis. Cells were injected into nude mice to establish their tumorigenic potential. We show that the three cell lines have distinct migrative properties, L2975 had the highest migration rate and showed tumorigenic potential in mice. All cell lines showed chromosomal rearrangements with complex karyotypes and genotypic aberrations were conserved throughout late passaging of the cell lines. All cell lines showed loss of CDKN2A, while TP53 was wild type for exons 5–8. L835 has an IDH1 R132C mutation, L2975 an IDH2 R172W mutation and L3252 is IDH wild type. Based on the stable culturing properties of these cell lines and their genotypic profile resembling the original tumors, these cell lines should provide useful functional models to further characterize chondrosarcoma and to evaluate new treatment strategies

  17. IDENTIFICATION OF CANINE VISCERAL LEISHMANIASIS IN A PREVIOUSLY UNAFFECTED AREA BY CONVENTIONAL DIAGNOSTIC TECHNIQUES AND CELL-BLOCK FIXATION

    Directory of Open Access Journals (Sweden)

    Tuanne Rotti ABRANTES

    2016-01-01

    Full Text Available After the report of a second case of canine visceral leishmaniasis (CVL in São Bento da Lagoa, Itaipuaçu, in the municipality of Maricá, Rio de Janeiro State, an epidemiological survey was carried out, through active search, totaling 145 dogs. Indirect immunofluorescence assay (IFA, enzyme-linked immunosorbent assay (ELISA, and rapid chromatographic immunoassay based on dual-path platform (DPP(r were used to perform the serological examinations. The parasitological diagnosis of cutaneous fragments was performed by parasitological culture, histopathology, and immunohistochemistry. In the serological assessment, 21 dogs were seropositive by IFA, 17 by ELISA, and 11 by DPP(r, with sensitivity of 66.7%, 66.7% and 50%, and specificity of 87.2%, 90.2% and 94%, respectively for each technique. The immunohistochemistry of bone marrow using the cell-block technique presented the best results, with six positive dogs found, three of which tested negative by the other parasitological techniques. Leishmania sp. was isolated by parasitological culture in three dogs. The detection of autochthonous Leishmania infantum in Itaipuaçu, and the high prevalence of seropositive dogs confirm the circulation of this parasite in the study area and alert for the risk of expansion in the State of Rio de Janeiro.

  18. Stereotactic body radiation therapy versus conventional radiation therapy in patients with early stage non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jeppesen, Stefan Starup; Schytte, Tine; Jensen, Henrik R

    2013-01-01

    Abstract Introduction. Stereotactic body radiation therapy (SBRT) for early stage non-small cell lung cancer (NSCLC) is now an accepted and patient friendly treatment, but still controversy exists about its comparability to conventional radiation therapy (RT). The purpose of this single...... and SBRT predicted improved prognosis. However, staging procedure, confirmation procedure of recurrence and technical improvements of radiation treatment is likely to influence outcomes. However, SBRT seems to be as efficient as conventional RT and is a more convenient treatment for the patients....

  19. IL-23 (Interleukin-23)-Producing Conventional Dendritic Cells Control the Detrimental IL-17 (Interleukin-17) Response in Stroke.

    Science.gov (United States)

    Gelderblom, Mathias; Gallizioli, Mattia; Ludewig, Peter; Thom, Vivien; Arunachalam, Priyadharshini; Rissiek, Björn; Bernreuther, Christian; Glatzel, Markus; Korn, Thomas; Arumugam, Thiruma Valavan; Sedlacik, Jan; Gerloff, Christian; Tolosa, Eva; Planas, Anna M; Magnus, Tim

    2018-01-01

    Inflammatory mechanisms can exacerbate ischemic tissue damage and worsen clinical outcome in patients with stroke. Both αβ and γδ T cells are established mediators of tissue damage in stroke, and the role of dendritic cells (DCs) in inducing the early events of T cell activation and differentiation in stroke is not well understood. In a murine model of experimental stroke, we defined the immune phenotype of infiltrating DC subsets based on flow cytometry of surface markers, the expression of ontogenetic markers, and cytokine levels. We used conditional DC depletion, bone marrow chimeric mice, and IL-23 (interleukin-23) receptor-deficient mice to further explore the functional role of DCs. We show that the ischemic brain was rapidly infiltrated by IRF4 + /CD172a + conventional type 2 DCs and that conventional type 2 DCs were the most abundant subset in comparison with all other DC subsets. Twenty-four hours after ischemia onset, conventional type 2 DCs became the major source of IL-23, promoting neutrophil infiltration by induction of IL-17 (interleukin-17) in γδ T cells. Functionally, the depletion of CD11c + cells or the genetic disruption of the IL-23 signaling abrogated both IL-17 production in γδ T cells and neutrophil infiltration. Interruption of the IL-23/IL-17 cascade decreased infarct size and improved neurological outcome after stroke. Our results suggest a central role for interferon regulatory factor 4-positive IL-23-producing conventional DCs in the IL-17-dependent secondary tissue damage in stroke. © 2017 American Heart Association, Inc.

  20. The Outcome of Conventional External Beam Radiotherapy for Patients with Squamous Cell Carcinoma of the Esophagus

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Ji Young [Chosun University College of Medicine, Gwangju (Korea, Republic of)

    2008-03-15

    The best treatment for advanced esophageal cancer is chemoradiotherapy followed by surgery. In spite of the advance of multimodality therapy, most patients with esophageal cancer are treated with radiation therapy alone. This study reports the outcome of the use of conventional external beam radiotherapy alone for the treatment of esophageal cancer. Between January 1998 and December 2005, 30 patients with squamous cell carcinoma of the esophagus were treated with external beam radiotherapy using a total dose exceeding 40 Gy. Radiotherapy was delivered with a total dose of 44-60 Gy (median dose, 57.2 Gy) over 36 {approx}115 days (median time, 45 days). Thirteen patients (43.3%) had a history of disorders such as diabetes, hypertension, tuberculosis, lye stricture, asthma, cerebral infarct, and cancers. Four patients metachronously had double primary cancers. The most common location of a tumor was the mid-thoracic portion of the esophagus (56.7%). Tumor lengths ranged from 2 cm to 11 cm, with a median length of 6 cm. For AJCC staging, stage III was the most common (63.3%). Five patients had metastases at diagnosis. The median overall survival was 8.3 months. The survival rates at 1-year and 2-years were 33.3% and 18.7%, respectively. The complete response rate 1{approx}3 months after radiotherapy was 20% (6/30) and the partial response rate was 70% (21/30). Sixteen patients (53.3%) had an improved symptom of dysphagia. Significant prognostic factors were age, tumor length, stage, degree of dysphagia at the time of diagnosis and tumor response. Cox regression analysis revealed the aim of treatment, clinical tumor response and tumor length as independent prognostic factors for overall survival. Twenty-eight patients had local failure and another four patients had metastases. Three patients were detected with double primary cancers in this analysis. A complication of esophageal stricture was observed in three patients (10%), and radiation pneumonitis occurred in two

  1. The Outcome of Conventional External Beam Radiotherapy for Patients with Squamous Cell Carcinoma of the Esophagus

    International Nuclear Information System (INIS)

    Jang, Ji Young

    2008-01-01

    The best treatment for advanced esophageal cancer is chemoradiotherapy followed by surgery. In spite of the advance of multimodality therapy, most patients with esophageal cancer are treated with radiation therapy alone. This study reports the outcome of the use of conventional external beam radiotherapy alone for the treatment of esophageal cancer. Between January 1998 and December 2005, 30 patients with squamous cell carcinoma of the esophagus were treated with external beam radiotherapy using a total dose exceeding 40 Gy. Radiotherapy was delivered with a total dose of 44-60 Gy (median dose, 57.2 Gy) over 36 ∼115 days (median time, 45 days). Thirteen patients (43.3%) had a history of disorders such as diabetes, hypertension, tuberculosis, lye stricture, asthma, cerebral infarct, and cancers. Four patients metachronously had double primary cancers. The most common location of a tumor was the mid-thoracic portion of the esophagus (56.7%). Tumor lengths ranged from 2 cm to 11 cm, with a median length of 6 cm. For AJCC staging, stage III was the most common (63.3%). Five patients had metastases at diagnosis. The median overall survival was 8.3 months. The survival rates at 1-year and 2-years were 33.3% and 18.7%, respectively. The complete response rate 1∼3 months after radiotherapy was 20% (6/30) and the partial response rate was 70% (21/30). Sixteen patients (53.3%) had an improved symptom of dysphagia. Significant prognostic factors were age, tumor length, stage, degree of dysphagia at the time of diagnosis and tumor response. Cox regression analysis revealed the aim of treatment, clinical tumor response and tumor length as independent prognostic factors for overall survival. Twenty-eight patients had local failure and another four patients had metastases. Three patients were detected with double primary cancers in this analysis. A complication of esophageal stricture was observed in three patients (10%), and radiation pneumonitis occurred in two patients (6

  2. Diagnostic significance of colloid body deposition in direct immunofluorescence

    Directory of Open Access Journals (Sweden)

    Chularojanamontri Leena

    2010-01-01

    Full Text Available Background: Colloid bodies (CB in direct immunofluorescence (DIF studies are usually found in interface dermatitis. Furthermore, CB can be found in various skin diseases and even in normal skin. Aim: To evaluate the diagnostic value of CB deposits in DIF studies. Methods: From 1996-2007, data from 502 patients where DIF studies showed immunoreactants at CB were enrolled. The definite diagnoses of these patients were based on clinical, histopathological and immunofluorescent findings. The results of DIF studies were analyzed. Results: Immunoreactants at CB were detected in 44.4%, 43.8%, 4.2%, 3.8%, and 2.2% of interface dermatitis, vasculitis, autoimmune vesiculobullous disease, panniculitis, and scleroderma/morphea, respectively. The most common immunoreactant deposit of all diseases was Immunoglobulin M (IgM. Brighter intensity and higher quantity of CB was detected frequently in the group with interface dermatitis. Conclusions: Immunoreactant deposits at CB alone can be found in various diseases but a strong intensity and high quantity favor the diagnosis of interface dermatitis. CB plus dermoepidermal junction (DEJ deposits are more common in interface dermatitis than any other disease. Between lichen planus (LP and discoid lupus erythematosus (DLE, CB alone is more common in LP; whereas, CB plus DEJ and superficial blood vessel (SBV is more common in DLE. The most common pattern in both diseases is CB plus DEJ. The quantity and intensity of CB in LP is higher than in DLE.

  3. Endothelial cell loss and refractive predictability in femtosecond laser-assisted cataract surgery compared with conventional cataract surgery

    DEFF Research Database (Denmark)

    Krarup, Therese; Holm, Lars Morten; la Cour, Morten

    2014-01-01

    and the contralateral eye operated by CPS (stop and chop technique). Both eyes had intraocular aspheric lenses implanted. Uncorrected distance visual acuity (UDVA), corrected distance visual acuity (CDVA), central corneal endothelial cell count and hexagonality with a non-contact specular microscope were assessed......PURPOSE: To investigate the amount of endothelial cell loss (ECL) and refractive predictability by femtosecond laser-assisted cataract surgery (FLACS) compared to conventional phacoemulsification cataract surgery (CPS). METHODS: Forty-seven patients had one eye operated by FLACS...

  4. Conventional cytogenetic characterization of a new cell line, ACP01, established from a primary human gastric tumor

    Directory of Open Access Journals (Sweden)

    E.M. Lima

    2004-12-01

    Full Text Available Gastric cancer is the second most frequent type of neoplasia and also the second most important cause of death in the world. Virtually all the established cell lines of gastric neoplasia were developed in Asian countries, and western countries have contributed very little to this area. In the present study we describe the establishment of the cell line ACP01 and characterize it cytogenetically by means of in vitro immortalization. Cells were transformed from an intestinal-type gastric adenocarcinoma (T4N2M0 originating from a 48-year-old male patient. This is the first gastric adenocarcinoma cell line established in Brazil. The most powerful application of the cell line ACP01 is in the assessment of cytotoxicity. Solid tumor cell lines from different origins have been treated with several conventional and investigational anticancer drugs. The ACP01 cell line is triploid, grows as a single, non-organized layer, similar to fibroblasts, with focus formation, heterogeneous division, and a cell cycle of approximately 40 h. Chromosome 8 trisomy, present in 60% of the cells, was the most frequent cytogenetic alteration. These data lead us to propose a multifactorial triggering of gastric cancer which evolves over multiple stages involving progressive genetic changes and clonal expansion.

  5. LKB1 mediates the development of conventional and innate T cells via AMP-dependent kinase autonomous pathways.

    Directory of Open Access Journals (Sweden)

    Marouan Zarrouk

    Full Text Available The present study has examined the role of the serine/threonine kinase LKB1 in the survival and differentiation of CD4/8 double positive thymocytes. LKB1-null DPs can respond to signals from the mature α/β T-cell-antigen receptor and initiate positive selection. However, in the absence of LKB1, thymocytes fail to mature to conventional single positive cells causing severe lymphopenia in the peripheral lymphoid tissues. LKB1 thus appears to be dispensable for positive selection but important for the maturation of positively selected thymocytes. LKB1 also strikingly prevented the development of invariant Vα14 NKT cells and innate TCR αβ gut lymphocytes. Previous studies with gain of function mutants have suggested that the role of LKB1 in T cell development is mediated by its substrate the AMP-activated protein kinase (AMPK. The present study now analyses the impact of AMPK deletion in DP thymocytes and shows that the role of LKB1 during the development of both conventional and innate T cells is mediated by AMPK-independent pathways.

  6. Comparative analysis of conventional natural killer cell responses to acute infection with Toxoplasma gondii strains of different virulence

    Directory of Open Access Journals (Sweden)

    Daria L Ivanova

    2016-09-01

    Full Text Available Conventional Natural Killer Cells (cNK, members of group 1 innate lymphoid cells, are a diverse cell subpopulation based on surface receptor expression, maturation and functional potential. cNK cells are critical for early immunity to T. gondii via IFNγ production. Acute cNK cell responses to infection with different strains of T. gondii have not yet been characterized in detail. Here we comprehensively performed this analysis with Type I virulent RH, and Type II avirulent ME49 and fully attenuated Type I cps1-1 strains. In response to these three parasite strains, murine cNK cells produce IFNγ, become cytotoxic and polyfunctional (IFNγ+CD107a+ at the site of infection. In contrast to virulent RH and avirulent ME49 T. gondii strains, attenuated cps1-1 induced only local cNK cell responses. Infections with RH and ME49 parasites significantly decreased cNK cell frequency and numbers in spleen 5 days post infection compared to cps1-1 parasites. cNK cell subsets expressing activating receptors Ly49H, Ly49D, NKG2D and inhibitory receptors Ly49I and NKG2A/CD94 were similar when compared between the strains and at 5 days post infection. cNK cells were not proliferating (Ki67- 5 days post infection with any of the strains. cNK cell maturation as measured by CD27, CD11b and KLRG1 was affected after infection with different parasite strains. RH and ME49 infection significantly reduced mature cNK cell frequency and increased immature cNK cell populations compared to cps1-1 infection. Interestingly, KLRG1 was highly expressed on immature cNK cells after RH infection. After RH and ME49 infections, CD69+ cNK cells were present at higher numbers than after cps1-1 infection, which may correlate with loss of the mature cNK cell population. Cytokine multiplex analysis indicated cNK cell responses correlated with peritoneal exudate cell (PEC, spleen and serum proinflammatory cytokine levels including IL-12. qPCR analysis of parasite-specific B1 gene revealed

  7. The Effects of Nonuniform Illumination on the Electrical Performance of a Single Conventional Photovoltaic Cell

    Directory of Open Access Journals (Sweden)

    Damasen Ikwaba Paul

    2015-01-01

    Full Text Available Photovoltaic (PV concentrators are a promising approach for lowering PV electricity costs in the near future. However, most of the concentrators that are currently used for PV applications yield nonuniform flux profiles on the surface of a PV module which in turn reduces its electrical performance if the cells are serially connected. One way of overcoming this effect is the use of PV modules with isolated cells so that each cell generates current that is proportional to the energy flux absorbed. However, there are some cases where nonuniform illumination also exists in a single cell in an isolated cells PV module. This paper systematically studied the effect of nonuniform illumination on various cell performance parameters of a single monocrystalline standard PV cell at low and medium energy concentration ratios. Furthermore, the effect of orientation, size, and geometrical shapes of nonuniform illumination was also investigated. It was found that the effect of nonuniform illumination on various PV cell performance parameters of a single standard PV cell becomes noticeable at medium energy flux concentration whilst the location, size, and geometrical shape of nonuniform illumination have no effect on the performance parameters of the cell.

  8. Application of indirect immunofluorescent test with an improved HEp-2 substrate tranfected with human Ro60/SSA autoantigens

    International Nuclear Information System (INIS)

    Lv Liangjing; Chen Shunle; Gu Yueying; Shen Nan; Bao Chunde; Wang Yuan; Xue Feng; Ye Peng; Yu Chongzhao

    2006-01-01

    To develop an improved substrate for indirect immunofluorescent test (IIF) to detect anti-Ro/SSA autoantibodies, the human 60-kDa Ro/SSA autoantigens (Ro60) cDNAs were obtained from placental cDNA library using PCR and were cloned into the mammalian expression vectorpEGFP-C1. Then the recombinant plasmids were transfected into HEp-2 cells. We con- firmed the overexpression, localization and antigenicity of fusion proteins in transfected cells by means of fluorescence microscopy, immunoblotting and IIF. HEp-2 and HEp-Ro60 was analyzed by IIF using a panel of 10 precipitinpositive anti-Ro human sera simultaneously. Stable expression of Ro60-GFP (green fluorescent protein) fusion proteins maintained ten more generations. And Ro60-GFP kept the antigenicity of Ro and had its own characteristic immunofluorescent pattern in HEp-Ro60 cells. The transfectants dramatically increased the sensitivity of IIF testing (a mean increase of 6.7-fold in endpoint titer, P<0.01). Eight (8/10) positive an- ti-Ro sera showed characteristic immunofluorescent pattern on HEp-Ro60, including two sera which were antinuclear antibodies (ANA) negative on untransfected HEp-2. IIF-ANA in all healthy sera were negative on HEp-Ro60. As a kind of new substrate of IIF, the Ro60 transfectants can be used to detect anti-Ro antibodies. In addition, transfected HEp-2 cells kept the immunofluorescent property of HEp-2 cells in IIF-ANA tests and could be employed as substrate for the routine IIF-ANA detection. The method improved the sensitivity of IIF-ANA. (authors)

  9. Use of non-conventional cell disruption method for extraction of proteins from black yeasts

    Directory of Open Access Journals (Sweden)

    Maja eLeitgeb

    2016-04-01

    Full Text Available The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2 by varying pressure at fixed temperature (35 °C. The black yeasts cell walls were disrupted and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV-Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2 treated cells. The advantages of the proposed method are in a simple use which is also possible for heat sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions.

  10. Use of Non-Conventional Cell Disruption Method for Extraction of Proteins from Black Yeasts

    Science.gov (United States)

    Čolnik, Maja; Primožič, Mateja; Knez, Željko; Leitgeb, Maja

    2016-01-01

    The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum, and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2) by varying pressure at fixed temperature (35°C). The black yeasts cell walls were disrupted, and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase, and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV–Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2-treated cells. The advantages of the proposed method are in a simple use, which is also possible for heat-sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions. PMID:27148527

  11. Staining pattern classification of antinuclear autoantibodies based on block segmentation in indirect immunofluorescence images.

    Directory of Open Access Journals (Sweden)

    Jiaqian Li

    Full Text Available Indirect immunofluorescence based on HEp-2 cell substrate is the most commonly used staining method for antinuclear autoantibodies associated with different types of autoimmune pathologies. The aim of this paper is to design an automatic system to identify the staining patterns based on block segmentation compared to the cell segmentation most used in previous research. Various feature descriptors and classifiers are tested and compared in the classification of the staining pattern of blocks and it is found that the technique of the combination of the local binary pattern and the k-nearest neighbor algorithm achieve the best performance. Relying on the results of block pattern classification, experiments on the whole images show that classifier fusion rules are able to identify the staining patterns of the whole well (specimen image with a total accuracy of about 94.62%.

  12. EUROPattern Suite technology for computer-aided immunofluorescence microscopy in autoantibody diagnostics.

    Science.gov (United States)

    Krause, C; Ens, K; Fechner, K; Voigt, J; Fraune, J; Rohwäder, E; Hahn, M; Danckwardt, M; Feirer, C; Barth, E; Martinetz, T; Stöcker, W

    2015-04-01

    Antinuclear autoantibodies (ANA) are highly informative biomarkers in autoimmune diagnostics. The increasing demand for effective test systems, however, has led to the development of a confusingly large variety of different platforms. One of them, the indirect immunofluorescence (IIF), is regarded as the common gold standard for ANA screening, as described in a position statement by the American College of Rheumatology in 2009. Technological solutions have been developed aimed at standardization and automation of IIF to overcome methodological limitations and subjective bias in IIF interpretation. In this review, we present the EUROPattern Suite, a system for computer-aided immunofluorescence microscopy (CAIFM) including automated acquisition of digital images and evaluation of IIF results. The system was originally designed for ANA diagnostics on human epithelial cells, but its applications have been extended with the latest system update version 1.5 to the analysis of antineutrophil cytoplasmic antibodies (ANCA) and anti-dsDNA antibodies. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  13. Establishment and conventional cytogenetic characterization of three gastric cancer cell lines.

    Science.gov (United States)

    Leal, Mariana Ferreira; Martins do Nascimento, José Luiz; da Silva, Carla Elvira Araújo; Vita Lamarão, Maria Fernanda; Calcagno, Danielle Queiroz; Khayat, André Salim; Assumpção, Paulo Pimentel; Cabral, Isabel Rosa; de Arruda Cardoso Smith, Marília; Burbano, Rommel Rodríguez

    2009-11-01

    Gastric cancer is the fourth most frequent type of cancer and the second most frequent cause of cancer mortality worldwide. Only a modest number of gastric carcinoma cell lines have been isolated thus far. Here we describe the establishment and cytogenetic characterization of three new gastric cancer cell lines obtained from primary gastric adenocarcinoma (ACP02 and ACP03) and cancerous ascitic fluid (AGP01) of individuals from northern Brazil. ACP02, ACP03, and AGP01 cell lines are presently in the 60th passage. The cell lines grew in a disorganized single layer with some agglomerations and heterogeneous divisions (bipolar and multipolar). All cell lines exhibited a composite karyotype with several clonal chromosome alterations. Trisomy 8 was the most frequent alteration. Chromosome 8 aneusomy was confirmed by fluorescence in situ hybridization. All cell lines also exhibited trisomy 7 and deletion of chromosome arm 17p. These results suggest that, although frequent chromosome alterations are commonly observed due to culture process, the ACP02, ACP03, and AGP01 cell lines and primary gastric cancer from individuals of northern Brazil share genetic alterations, supporting use of these cell lines as a model of gastric carcinogenesis in this population.

  14. Comparison of the toxicity of smoke from conventional and harm reduction cigarettes using human embryonic stem cells.

    Science.gov (United States)

    Lin, Sabrina; Fonteno, Shawn; Weng, Jo-Hao; Talbot, Prue

    2010-11-01

    This study evaluated the hypothesis that smoke from harm reduction cigarettes impedes attachment and proliferation of H9 human embryonic stem cells (hESCs). Smoke from three harm reduction brands was compared with smoke from a conventional brand. Doses of smoke were measured in puff equivalents (PE) (1 PE = the amount of smoke in one puff that dissolves in 1 ml of medium). Cytotoxic doses were determined using morphological criteria and trypan blue staining, and apoptosis was confirmed using Magic Red staining. Attachment and proliferation of hESC were followed at a noncytotoxic dose in time-lapse videos collected using BioStation technology. Data were mined from videos either manually or using video bioinformatics subroutines developed with CL-Quant software. Mainstream (MS) and sidestream (SS) smoke from conventional and harm reduction cigarettes induced apoptosis in hESC colonies at 1 PE. At 0.1 PE (noncytotoxic), SS smoke from all brands inhibited attachment of hESC colonies to Matrigel with the strongest inhibition occurring in harm reduction brands. At 0.1 PE, SS smoke, but not MS smoke, from all brands inhibited hESC growth, and two harm reduction brands were more potent than the conventional brand. In general, hESC appeared more sensitive to smoke than their mouse ESC counterparts. Although harm reduction cigarettes are often marketed as safer than conventional brands, our assays show that SS smoke from harm reduction cigarettes was at least as potent or in some cases more potent than smoke from a conventional brand and that SS smoke was more inhibitory than MS smoke in all assays.

  15. Immunofluorescence detection of milk protein in meat products

    Directory of Open Access Journals (Sweden)

    Michaela Petrášová

    2015-05-01

    Full Text Available Nowadays there are various vegetable protein additives intended for the manufacture of meat products in the food industry. These ingredients include both, plant-origin as well as animal-origin proteins. The most common vegetable additives include various types of flour, starch, fiber and plant protein. Among animal proteins, the most commonly used are plasma, collagen or milk protein. Milk protein is added to meat products due to its functional properties, such as emulsifying fats, improving the holding capacity of meat, improving juiciness, gel-forming capacity and affecting the taste of the product. Usage of these proteins, however, is currently limited by the effective legislation, not only in order to prevent consumer deception, but also because of their potential impact on consumers' health of. Thus, this issue has received considerable attention not only in the Czech Republic, but also globally. The main risk is the impossibility of selecting a suitable foodstuff for individuals with potential allergic reactions. The only option for allergic consumers to protect themselves is to strictly exclude the given allergen from their diet. Although the number of studies dealing with the reduction or loss of allergenicity is increasing, yet these practices are not common. Most of the population suffering from food allergies is thus still dependent on strict exclusion of foodstuffs causing adverse allergic reactions from their diet. Detection of allergens in foodstuffs is unfortunately quite difficult due to the fact that they occur in trace amounts and are often masked by different parts of the foodstuff. This research dealt with the detection of milk protein in meat products purchased in the market network of the Czech Republic, whereas declaration given by the manufacturer on the packaging for the small meat products purchased from the market was used to verify the detection of milk protein by the immunofluorescence method. 20 products were

  16. Double-label immunofluorescence method for simultaneous detection of adenovirus and herpes simplex virus from the eye.

    Science.gov (United States)

    Walpita, P; Darougar, S

    1989-07-01

    The development and application of a double-label immunofluorescence method which has the potential to screen for single or dual infections from any site, in single shell vial cultures, is described. In this study, a total of 1,141 ocular specimens were inoculated in shell vials, centrifuged at 15,000 X g for 1 h, incubated at 37 degrees C for 48 h, and fixed in methanol at room temperature for 15 min. The virus inclusions were detected by staining with a double-label indirect immunofluorescence procedure using mixtures of appropriate first antibodies, followed by fluorescein- and rhodamine-conjugated second antibodies. Each specimen was also inoculated in parallel by the conventional virus isolation method. The sensitivity and specificity of the double-label shell vial procedure were comparable to those with the conventional method, and the former test took only 48 h to complete. The test offers a rapid and simple single-vial procedure which allows for individual or simultaneous detection of multiple pathogens. It results in savings in time and cost over the conventional virus isolation method and other shell vial procedures.

  17. Quantum-dot-based immunofluorescent imaging of HER2 and ER provides new insights into breast cancer heterogeneity

    International Nuclear Information System (INIS)

    Chen Chuang; Li Yan; Peng Jun; Xu Hao; Tang Hongwu; Zhang Zhiling; Pang Daiwen; Xia Heshun; Wu Qiongshui; Zeng Libo; Zhu Xiaobo

    2010-01-01

    Breast cancer (BC) is a heterogeneous tumor, and better understanding of its heterogeneity is essential to improving treatment effect. Quantum dot (QD)-based immunofluorescent nanotechnology (QD-IHC) for molecular pathology has potential advantages in delineating tumor heterogeneity. This potential is explored in this paper by QD-IHC imaging of HER2 and ER. BC heterogeneity can be displayed more clearly and sensitively by QD-IHC than conventional IHC in BC tissue microarrays. Furthermore, the simultaneous imaging of ER and HER2 might help understand their interactions during the process of evolution of heterogeneous BC.

  18. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  19. Systemic lupus erythematosus and the Crithidia luciliae immunofluorescent test

    International Nuclear Information System (INIS)

    Whitehouse, I.J.; Fehr, K.; Wagenhaeuser, F.J.

    1983-01-01

    A comparative study of the Crithidia luciliae immunofluorescence (CL-IF) assay and an adapted Farr radioimmunoassay (RIA), for the measurement of antibodies to native deoxyribonucleic acid, was performed using forty-two sera from patients with systematic lupus erythematosus (SLE) and another forty-two from patients with rheumatoid arthritis. Both assays were specific for SLE. The CL-IF assay was statistically significantly more sensitive than the adapted RIA assay. This significant difference was due to greater sensitivity of the CL-IF assay in the cases of sera from patients with SLE of slight activity. Additional advantages of the CL-IF assay were its use to classify the immunoglobulin types of the antibodies (most commonly IgG or IgM) and to measure complement-fixing antibodies to native deoxyribonucleic acid; it affords a simple method of selecting and following SLE patients at risk of developing severe renal disease. These advantages plus the simplicity and inexpensiveness of the CL-IF assay make it a useful tool, especially for use in small laboratories, for the study of antibodies to native deoxyribonucleic acid in patients with SLE. (orig.) [de

  20. The distribution of lymphoid cells in the small intestine of germ-free and conventional piglets

    Czech Academy of Sciences Publication Activity Database

    Potočková, Hana; Šinkorová, Jana; Kárová, Kristýna; Šinkora, Marek

    2015-01-01

    Roč. 51, č. 1 (2015), s. 99-107 ISSN 0145-305X R&D Projects: GA ČR GAP502/12/0110 Institutional support: RVO:61388971 Keywords : Porcine immune system * Lymphocyte subpopulations * Cell surface molecules Subject RIV: EC - Immunology Impact factor: 3.620, year: 2015

  1. Conventional and 360 degree electron tomography of a micro-crystalline silicon solar cell

    DEFF Research Database (Denmark)

    Duchamp, Martial; Ramar, Amuthan; Kovács, András

    2011-01-01

    Bright-field (BF) and annular dark-field (ADF) electron tomography in the transmission electron microscope (TEM) are used to characterize elongated porous regions or cracks (simply referred to as cracks thereafter) in micro-crystalline silicon (μc-Si:H) solar cell. The limitations of inferring...

  2. Production of bovine cloned embryos with donor cells frozen at a slow cooling rate in a conventional freezer (20 C)

    Science.gov (United States)

    Chacon, L.; Gomez, M.C.; Jenkins, J.A.; Leibo, S.P.; Wirtu, G.; Dresser, B.L.; Pope, C.E.

    2009-01-01

    Summary Usually, fibroblasts are frozen in dimethyl sulphoxide (DMSO, 10% v/v) at a cooling rate of 1 C/min in a low-temperature (80 C) freezer (LTF) before storage in liquid nitrogen (LN2); however, a LTF is not always available. The purpose of the present study was to evaluate apoptosis and viability of bovine fibroblasts frozen in a LTF or conventional freezer (CF; 20 C) and their subsequent ability for development to blastocyst stage after fusion with enucleated bovine oocytes. Percentages of live cells frozen in LTF (49.5%) and CF (50.6%) were similar, but significantly less than non-frozen control (88%). In both CF and LTF, percentages of live apoptotic cells exposed to LN2 after freezing were lower (4% and 5%, respectively) as compared with unexposed cells (10% and 18%, respectively). Cells frozen in a CF had fewer cell doublings/24 h (0.45) and required more days (9.1) to reach 100% confluence at the first passage (P) after thawing and plating as compared with cells frozen in a LTF (0.96 and 4.0 days, respectively). Hypoploidy at P12 was higher than at P4 in cells frozen in either a CF (37.5% vs. 19.2%) or in a LTF (30.0% vs. 15.4%). A second-generation cryo-solution reduced the incidence of necrosis (29.4%) at 0 h after thawing as compared with that of a first generation cryo-solution (DMEM + DMSO, 60.2%). The percentage of apoptosis in live cells was affected by cooling rate (CF = 1.9% vs. LFT = 0.7%). Development of bovine cloned embryos to the blastocyst stage was not affected by cooling rate or freezer type. ?? 2009 Cambridge University Press.

  3. Flow cytometric bacterial cell counts challenge conventional heterotrophic plate counts for routine microbiological drinking water monitoring

    KAUST Repository

    Van Nevel, S.

    2017-02-08

    Drinking water utilities and researchers continue to rely on the century-old heterotrophic plate counts (HPC) method for routine assessment of general microbiological water quality. Bacterial cell counting with flow cytometry (FCM) is one of a number of alternative methods that challenge this status quo and provide an opportunity for improved water quality monitoring. After more than a decade of application in drinking water research, FCM methodology is optimised and established for routine application, supported by a considerable amount of data from multiple full-scale studies. Bacterial cell concentrations obtained by FCM enable quantification of the entire bacterial community instead of the minute fraction of cultivable bacteria detected with HPC (typically < 1% of all bacteria). FCM measurements are reproducible with relative standard deviations below 3% and can be available within 15 min of samples arriving in the laboratory. High throughput sample processing and complete automation are feasible and FCM analysis is arguably less expensive than HPC when measuring more than 15 water samples per day, depending on the laboratory and selected staining procedure(s). Moreover, many studies have shown FCM total (TCC) and intact (ICC) cell concentrations to be reliable and robust process variables, responsive to changes in the bacterial abundance and relevant for characterising and monitoring drinking water treatment and distribution systems. The purpose of this critical review is to initiate a constructive discussion on whether FCM could replace HPC in routine water quality monitoring. We argue that FCM provides a faster, more descriptive and more representative quantification of bacterial abundance in drinking water.

  4. Flow cytometric bacterial cell counts challenge conventional heterotrophic plate counts for routine microbiological drinking water monitoring

    KAUST Repository

    Van Nevel, S.; Koetzsch, S.; Proctor, C.R.; Besmer, M.D.; Prest, E.I.; Vrouwenvelder, Johannes S.; Knezev, A.; Boon, N.; Hammes, F.

    2017-01-01

    Drinking water utilities and researchers continue to rely on the century-old heterotrophic plate counts (HPC) method for routine assessment of general microbiological water quality. Bacterial cell counting with flow cytometry (FCM) is one of a number of alternative methods that challenge this status quo and provide an opportunity for improved water quality monitoring. After more than a decade of application in drinking water research, FCM methodology is optimised and established for routine application, supported by a considerable amount of data from multiple full-scale studies. Bacterial cell concentrations obtained by FCM enable quantification of the entire bacterial community instead of the minute fraction of cultivable bacteria detected with HPC (typically < 1% of all bacteria). FCM measurements are reproducible with relative standard deviations below 3% and can be available within 15 min of samples arriving in the laboratory. High throughput sample processing and complete automation are feasible and FCM analysis is arguably less expensive than HPC when measuring more than 15 water samples per day, depending on the laboratory and selected staining procedure(s). Moreover, many studies have shown FCM total (TCC) and intact (ICC) cell concentrations to be reliable and robust process variables, responsive to changes in the bacterial abundance and relevant for characterising and monitoring drinking water treatment and distribution systems. The purpose of this critical review is to initiate a constructive discussion on whether FCM could replace HPC in routine water quality monitoring. We argue that FCM provides a faster, more descriptive and more representative quantification of bacterial abundance in drinking water.

  5. Development and Characterization of Non-Conventional Micro-Porous Layers for PEM Fuel Cells

    Directory of Open Access Journals (Sweden)

    Riccardo Balzarotti

    2015-07-01

    Full Text Available Gas diffusion medium (GDM is a crucial component in proton exchange membrane fuel cells (PEMFCs. Being composed of a gas diffusion layer (GDL with a micro-porous layer (MPL coated onto it, it ensures a proper water management due to the highly hydrophobic materials employed in cell assembly. In current commercial applications, the desired water repellent behaviour is usually obtained by using polytetrafluoroethylene (PTFE. In this work, Fluorolink® P56 (Solvay Specialty Polymers, Milan, Italy, a commercially available, anionic, segmented high molecular weight polyfluorourethane with perfluoropolyether groups was extensively evaluated as an alternative to PTFE for micro-porous layer hydrophobization. A change in polymer used is desirable in order to simplify the production process, both in terms of ink formulation and thermal treatment, as well as to get a higher hydrophobicity and, consequently, more efficient water management. Innovative prepared samples were compared to a PTFE-based GDM, in order to assess differences both from morphological and from an electrochemical point of view.

  6. Dual-color immunofluorescent labeling with quantum dots of the diabetes-associated proteins aldose reductase and Toll-like receptor 4 in the kidneys of diabetic rats

    Directory of Open Access Journals (Sweden)

    Liu XM

    2015-05-01

    Full Text Available Xiaomin Liu,1,* Rui Hu,2,* Hongwei Lian,1,3 Yang Liu,4 Jing Liu,1 Jianwei Liu,1 Guimiao Lin,5 Liwei Liu,6 Xiaojian Duan,1 Ken-Tye Yong,2 Ling Ye1 1Institute of Gerontology and Geriatrics, Chinese PLA General Hospital, Beijing Key Lab of Aging and Geriatrics, Beijing, People’s Republic of China; 2School of Electrical and Electronic Engineering, Nanyang Technological University, Singapore, Singapore; 3Department of Emergency Medicine, Peking University Third Hospital, Beijing, 4Department of Geriatric Nephrology, Chinese PLA General Hospital, Beijing, 5Key Lab of Biomedical Engineering, School of Medical Sciences, Shenzhen University, Shenzhen, 6School of Science, Changchun University of Science and Technology, Changchun, People’s Republic of China *These authors contributed equally to this work Abstract: Diabetes is one of the major chronic diseases diagnosed worldwide with a common complication of diabetic nephropathy (DN. There are multiple possible mechanisms associated with DN. Aldose reductase (AR and Toll-like receptor 4 (TLR4 may be involved in the occurrence and development of DN. Here, we describe the distribution of AR and TLR4 in cells and renal tissues of diabetic rats through a quantum dot (QD-based immunofluorescence technique and conventional immunohistochemistry. As a new type of nanosized fluorophore, QDs have been recognized in imaging applications and have broad prospects in biomedical research. The results of the reported study demonstrate that both the AR and the TLR4 proteins were upregulated in the renal tissues of diabetic rats. Further, to explore the relationship between AR and TLR4 in the pathogenesis of DN, a dual-color immunofluorescent labeling technique based on QDs was applied, where the expressions of AR and TLR4 in the renal tissues of diabetic rats were simultaneously observed – for the first time, as far as we are aware. The optimized QD-based immunofluorescence technique has not only shown a satisfying

  7. Oxidative stress, genotoxicity, and vascular cell adhesion molecule expression in cells exposed to particulate matter from combustion of conventional diesel and methyl ester biodiesel blends

    DEFF Research Database (Denmark)

    Hemmingsen, Jette Gjerke; Møller, Peter; Nøjgaard, Jakob Klenø

    2011-01-01

    cells (HUVECs). Viability and production of reactive oxygen species (ROS) were investigated in all cell types. We collected particles from combustion of D(100) and 20% (w/w) blends of animal fat or rapeseed oil methyl esters in light-duty vehicle engines complying with Euro2 or Euro4 standards......Our aim was to compare hazards of particles from combustion of biodiesel blends and conventional diesel (D(100)) in old and improved engines. We determined DNA damage in A549 cells, mRNA levels of CCL2 and IL8 in THP-1 cells, and expression of ICAM-1 and VCAM-1 in human umbilical cord endothelial....... Particles emitted from the Euro4 engine were smaller in size and more potent than particles emitted from the Euro2 engine with respect to ROS production and DNA damage, but similarly potent concerning cytokine mRNA expression. Particles emitted from combustion of biodiesel blends were larger in size...

  8. Validation of commercially available sphingosine kinase 2 antibodies for use in immunoblotting, immunoprecipitation and immunofluorescence [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Heidi A. Neubauer

    2017-03-01

    Full Text Available Sphingosine kinase 2 (SK2 is a ubiquitously expressed lipid kinase that has important, albeit complex and poorly understood, roles in regulating cell survival and cell death. In addition to being able to promote cell cycle arrest and apoptosis under certain conditions, it has recently been shown that SK2 can promote neoplastic transformation and tumorigenesis in vivo. Therefore, well validated and reliable tools are required to study and better understand the true functions of SK2. Here, we compare two commercially available SK2 antibodies: a rabbit polyclonal antibody from Proteintech that recognizes amino acids 266-618 of human SK2a, and a rabbit polyclonal antibody from ECM Biosciences that recognizes amino acids 36-52 of human SK2a. We examine the performance of these antibodies for use in immunoblotting, immunoprecipitation and immunofluorescence staining of endogenous SK2, using human HEK293 and HeLa cell lines, as well as mouse embryonic fibroblasts (MEFs. Furthermore, we assess the specificity of these antibodies to the target protein through the use of siRNA-mediated SK2 knockdown and SK2 knockout (Sphk2-/- MEFs. Our results demonstrate that the Proteintech anti-SK2 antibody reproducibly displayed superior sensitivity and selectivity towards SK2 in immunoblot analyses, while the ECM Biosciences anti-SK2 antibody was reproducibly superior for SK2 immunoprecipitation and detection by immunofluorescence staining. Notably, both antibodies produced non-specific bands and staining in the MEFs, which was not observed with the human cell lines. Therefore, we conclude that the Proteintech SK2 antibody is a valuable reagent for use in immunoblot analyses, and the ECM Biosciences SK2 antibody is a useful tool for SK2 immunoprecipitation and immunofluorescence staining, at least in the human cell lines employed in this study.

  9. COMPARISON OF CONVENTIONAL RADIATIOTHERAPY AND ACCELERATED HYPERFRACTIONATED RADIATIOTHERAPY IN CHEMORADIATION TREATMENT FOR SMALL CELL LUNG CANCER

    Directory of Open Access Journals (Sweden)

    I. A. Gulidov

    2013-01-01

    Full Text Available The 5-year treatment outcomes of 69 patients with stage IIA–IIIA locally advanced small cell lung cancer have been presented. Accelerated hyperfractionated radiotherapy was administered in the uneven daily dose fractionation (single dose of 1 + 1,5 Gy with a 5–6hour interval to a total dose of 60–70 Gy depending on the health status and lung function. The complete response was achieved in 13 (42 % patients, the median survival was 28 months and the 5-year survival rate was 26,2 %. Grade III lung and pericardium toxicities (according to RTOG toxicity scale were observed in 3,2 % and 6,5 % of patients, respectively. No grade III–IV radiation-induced blood and esophageal damages were found.

  10. HLA-haploidentical transplantation with regulatory and conventional T-cell adoptive immunotherapy prevents acute leukemia relapse.

    Science.gov (United States)

    Martelli, Massimo F; Di Ianni, Mauro; Ruggeri, Loredana; Falzetti, Franca; Carotti, Alessandra; Terenzi, Adelmo; Pierini, Antonio; Massei, Maria Speranza; Amico, Lucia; Urbani, Elena; Del Papa, Beatrice; Zei, Tiziana; Iacucci Ostini, Roberta; Cecchini, Debora; Tognellini, Rita; Reisner, Yair; Aversa, Franco; Falini, Brunangelo; Velardi, Andrea

    2014-07-24

    Posttransplant relapse is still the major cause of treatment failure in high-risk acute leukemia. Attempts to manipulate alloreactive T cells to spare normal cells while killing leukemic cells have been unsuccessful. In HLA-haploidentical transplantation, we reported that donor-derived T regulatory cells (Tregs), coinfused with conventional T cells (Tcons), protected recipients against graft-versus-host disease (GVHD). The present phase 2 study investigated whether Treg-Tcon adoptive immunotherapy prevents posttransplant leukemia relapse. Forty-three adults with high-risk acute leukemia (acute myeloid leukemia 33; acute lymphoblastic leukemia 10) were conditioned with a total body irradiation-based regimen. Grafts included CD34(+) cells (mean 9.7 × 10(6)/kg), Tregs (mean 2.5 × 10(6)/kg), and Tcons (mean 1.1 × 10(6)/kg). No posttransplant immunosuppression was given. Ninety-five percent of patients achieved full-donor type engraftment and 15% developed ≥grade 2 acute GVHD. The probability of disease-free survival was 0.56 at a median follow-up of 46 months. The very low cumulative incidence of relapse (0.05) was significantly better than in historical controls. These results demonstrate the immunosuppressive potential of Tregs can be used to suppress GVHD without loss of the benefits of graft-versus-leukemia (GVL) activity. Humanized murine models provided insights into the mechanisms underlying separation of GVL from GVHD, suggesting the GVL effect is due to largely unopposed Tcon alloantigen recognition in bone marrow. © 2014 by The American Society of Hematology.

  11. Study on conventional carbon characteristics as counter electrode for dye sensitized solar cells

    International Nuclear Information System (INIS)

    Fajar, Muhammad Noer; Endarko

    2017-01-01

    Activated carbon (AC), black carbon (BC), and graphite were deposited onto ITO (Indium Tin Oxide) glass for counter electrode application in Dye-Sensitized Solar Cells. SEM-EDX was used to observe and analyse the morphology and composition of electrodes. The results showed that the particle distribution of the graphite electrode observed was approximately 34% with a size of 1 to 2 µm and BC electrode about 20% have a size of 0.5 to 1 µm, while AC electrode has a size of 0 – 0.5 µm observed around 20%. AC electrode has a more porous and uniform particle aggregates compared to BC and graphite electrodes. The efficiency of the counter electrode was measured using the solar simulator. The highest efficiency was at 0.011516% for the counter electrode that was fabricated by AC. Meanwhile, black carbon and graphite electrodes were achieved at 0.008744% and 0.010561%, respectively. The results proved that the porosity and the uniform aggregate of the particles were the most significant factors to improve the performance of DSSC. (paper)

  12. Perforating elastic fibers ('elastic fiber trapping') in the differentiation of keratoacanthoma, conventional squamous cell carcinoma and pseudocarcinomatous epithelial hyperplasia.

    Science.gov (United States)

    Shah, Kabeer; Kazlouskaya, Viktoryia; Lal, Karan; Molina, David; Elston, Dirk M

    2014-02-01

    Keratoacanthoma (KA), an epithelial neoplasm occurring in sun-exposed skin of the elderly, is considered a well-differentiated form of conventional squamous cell carcinoma (SCC) that often follows a course of spontaneous regression. Distinguishing KA from conventional SCC or pseudocarcinomatous epithelial hyperplasia ensures proper diagnosis, treatment and management. For some time, perforating elastic fibers have been utilized in differentiating KA from SCC. This phenomenon may also occur in association with scars and hypertrophic lupus erythematosus (LE). To assess the diagnostic utility of perforating elastic fibers, we compared their incidence in KA, SCC, scars with overlying pseudocarcinomatous hyperplasia, hypertrophic LE, hypertrophic lichen planus (LP) and lichen simplex chronicus (LSC). A retrospective case search identified 359 lesions and the presence of perforating elastic fibers was evaluated using routinely stained sections. This phenomenon was documented in all studied groups except hypertrophic LP. The incidence was found to be 71% in KA, 37% in SCC, and was lowest in inflammatory conditions with associated pseudocarcinomatous hyperplasia (hypertrophic LP 0%, hypertrophic LE 5.9% and LSC 28.2%). The observed frequency in pseudocarcinomatous hyperplasia overlying scars (57.8%) vs. KA (71%) was not statistically different. Although elastic fiber trapping has potential value as a diagnostic criterion for KA, dermatopathologists should consider its limitations. Its diagnostic utility was greatest in distinguishing KA from hypertrophic LE and hypertrophic LP. Conversely, elastic trapping is not helpful differentiating pseudocarcinomatous hyperplasia from recurrent/persistent KA following surgery. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Aging Impairs the Ability of Conventional Dendritic Cells to Cross-Prime CD8+ T Cells upon Stimulation with a TLR7 Ligand.

    Directory of Open Access Journals (Sweden)

    Estefanía R Zacca

    Full Text Available The aging process is accompanied by altered immune system functioning and an increased risk of infection. Dendritic cells (DCs are antigen-presenting cells that play a key role in both adaptive and innate immunity, but how aging affects DCs and their influence on immunity has not been thoroughly established. Here we examined the function of conventional DCs (cDCs in old mice after TLR7 stimulation, focusing on their ability to cross-prime CD8+ T cells. Using polyU, a synthetic ssRNA analog, as TLR7 ligand and OVA as an antigen (Ag model, we found that cDCs from old mice have a poor ability to stimulate a CD8+ T cell-mediated cytotoxic response. cDCs from old mice exhibit alterations in Ag-processing machinery and TLR7 activation. Remarkably, CD8α+ cDCs from old mice have an impaired ability to activate naïve CD8+ T cells and, moreover, a lower capacity to mature and to process exogenous Ag. Taken together, our results suggest that immunosenescence impacts cDC function, affecting the activation of naïve CD8+ T cells and the generation of effector cytotoxic T cells.

  14. Conventional CD11chigh Dendritic Cells Are Important for T Cell Priming during the Initial Phase of Plasmodium yoelii Infection, but Are Dispensable at Later Time Points.

    Science.gov (United States)

    Ueffing, Kristina; Abberger, Hanna; Westendorf, Astrid M; Matuschewski, Kai; Buer, Jan; Hansen, Wiebke

    2017-01-01

    Dendritic cells (DCs) are highly specialized antigen-presenting cells that orchestrate adaptive immune responses to pathogens. During malaria infection pro- and anti-inflammatory T cell responses have to be tightly balanced to ensure parasite clearance without induction of severe immune pathologies. However, the precise role of CD11c high DCs in this process is still discussed controversially. Here, we demonstrate that long-term depletion of conventional CD11c high DCs in Plasmodium yoelii ( P. yoelii )-infected diphtheria toxin (DT)-treated RosaiDTR/CD11c-cre mice interferes with the activation of CD8 + and CD4 + T cells as well as CD4 + Foxp3 + regulatory T cells at early time points during infection. Moreover, systemic levels of the pro-inflammatory cytokines IFN-γ and TNF-α were decreased in P. yoelii -infected mice deficient for CD11c high DCs compared to infected RosaiDTR controls. To further elucidate the importance of CD11c high DCs during the later phase of infection, we treated RosaiDTR/CD11c-cre and control mice with DT only from day 4 of P. yoelii infection onward. Strikingly, this approach had no impact on the activation and IFN-γ production of CD4 + and CD8 + effector T cells. These results indicate that CD11c high DCs play a crucial role in eliciting effector T cell responses during the initial phase, but are dispensable during ongoing infection with P. yoelii .

  15. Conventional CD11chigh Dendritic Cells Are Important for T Cell Priming during the Initial Phase of Plasmodium yoelii Infection, but Are Dispensable at Later Time Points

    Directory of Open Access Journals (Sweden)

    Kristina Ueffing

    2017-10-01

    Full Text Available Dendritic cells (DCs are highly specialized antigen-presenting cells that orchestrate adaptive immune responses to pathogens. During malaria infection pro- and anti-inflammatory T cell responses have to be tightly balanced to ensure parasite clearance without induction of severe immune pathologies. However, the precise role of CD11chigh DCs in this process is still discussed controversially. Here, we demonstrate that long-term depletion of conventional CD11chigh DCs in Plasmodium yoelii (P. yoelii-infected diphtheria toxin (DT-treated RosaiDTR/CD11c-cre mice interferes with the activation of CD8+ and CD4+ T cells as well as CD4+Foxp3+ regulatory T cells at early time points during infection. Moreover, systemic levels of the pro-inflammatory cytokines IFN-γ and TNF-α were decreased in P. yoelii-infected mice deficient for CD11chigh DCs compared to infected RosaiDTR controls. To further elucidate the importance of CD11chigh DCs during the later phase of infection, we treated RosaiDTR/CD11c-cre and control mice with DT only from day 4 of P. yoelii infection onward. Strikingly, this approach had no impact on the activation and IFN-γ production of CD4+ and CD8+ effector T cells. These results indicate that CD11chigh DCs play a crucial role in eliciting effector T cell responses during the initial phase, but are dispensable during ongoing infection with P. yoelii.

  16. HEMORRHAGIC-FEVER VIRUS-INFECTIONS IN AN ISOLATED RAIN-FOREST AREA OF CENTRAL LIBERIA - LIMITATIONS OF THE INDIRECT IMMUNOFLUORESCENCE SLIDE TEST FOR ANTIBODY SCREENING IN AFRICA

    NARCIS (Netherlands)

    van der Waals, F. W.; Pomeroy, K. L.; Goudsmit, J.; Asher, D. M.; Gajdusek, D. C.

    1986-01-01

    Serum samples from 119 healthy individuals and 106 epilepsy patients inhabiting Grand Bassa County, Liberia, were tested for antibodies to hemorrhagic fever viruses (HFV) by indirect immunofluorescence. E6 Vero cells infected with Lassa fever virus (LAS), Rift Valley Fever virus (RVF), Congo

  17. Influence of in vitro supplementation with lipids from conventional and Alpine milk on fatty acid distribution and cell growth of HT-29 cells

    Directory of Open Access Journals (Sweden)

    Dänicke Sven

    2011-08-01

    Full Text Available Abstract Background To date, the influence of milk and dairy products on carcinogenesis remains controversial. However, lipids of ruminant origin such as conjugated linoleic acids (CLA are known to exhibit beneficial effects in vitro and in vivo. The aim of the present study was to determine the influence of milk lipids of different origin and varying quality presenting as free fatty acid (FFA solutions on cellular fatty acid distribution, cellular viability, and growth of human colon adenocarcinoma cells (HT-29. Methods FAME of conventional and Alpine milk lipids (MLcon, MLalp and cells treated with FFA derivatives of milk lipids were analyzed by means of GC-FID and Ag+-HPLC. Cellular viability and growth of the cells were determined by means of CellTiter-Blue®-assay and DAPI-assay (4',6-diamidino-2-phenylindole dihydrochloride, respectively. Results Supplementation with milk lipids significantly decreased viability and growth of HT-29 cells in a dose- and time-dependent manner. MLalp showed a lower SFA/MUFA ratio, a 8 fold increased CLA content, and different CLA profile compared to MLcon but did not demonstrate additional growth-inhibitory effects. In addition, total concentration and fatty acid distribution of cellular lipids were altered. In particular, treatment of the cells yielded highest amounts of two types of milk specific major fatty acids (μg FA/mg cellular protein after 8 h of incubation compared to 24 h; 200 μM of MLcon (C16:0, 206 ± 43, 200 μM of MLalp (C18:1 c9, (223 ± 19. Vaccenic acid (C18:1 t11 contained in milk lipids was converted to c9,t11-CLA in HT-29 cells. Notably, the ratio of t11,c13-CLA/t7,c9-CLA, a criterion for pasture feeding of the cows, was significantly changed after incubation for 8 h with lipids from MLalp (3.6 - 4.8, compared to lipids from MLcon (0.3 - 0.6. Conclusions Natural lipids from conventional and Alpine milk showed similar growth inhibitory effects. However, different changes in cellular

  18. Immunofluorescence pattern of antinuclear antibody and its association with autoantibody profile in systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Sadia Sharmin

    2016-08-01

    Full Text Available Background: Antinuclear antibody (ANA is useful in the diagnosis of systemic lupus erythematosus (SLE. Association of specific autoantibodies with the immunofluorescence pattern of ANA in SLE as noted in Western literature has been taken as reference in all over the world. However, in Bangladesh such research work or data correlating the autoantibodies and their ANA patterns is inadequate. Objective: To identify an association between immunofluorescence patterns of antinuclear antibody on HEp-2 cell and more specific antinuclear reactivities (e.g. anti-dsDNA and anti-extractable nuclear antigen in the serum samples of SLE patients.Methods: Serum samples of 37 SLE patients who were diagnosed by ARA (American Rheumatism Association classification criteria and laboratory tests, attending at lupus clinic of Bangabandhu Sheikh Mujib Medical University (BSMMU during the study period of six months were subjected for ANA testing by Indirect Imrnunofluorescence (IIF on HEp-2 cell, anti-dsDNA by ELISA and anti- extractable nuclear antigen (anti-ENA by Dot Immunoblot. Dot blot strips were tested for anti-Sm, anti-RNP, anti-SSA/Ro, and anti-SSB/La. Results: Out of 37 SLE patients 32 (86.5% cases were ANA positive by IIF on HEp-2 cell. ANA positive sera exhibited three fluorescence patterns such as speckled (43.7%, peripheral (34.3% and homogenous pattern (21.8%. Peripheral pattern (100% was strongly associated with anti-dsDNA (p<0.05 and homogenous pattern (85.7% was also predominantly associated with anti-dsDNA (p<0.05. Speckled pattern (85.6% was significantly associated with anti-ENA (p<0.05. Anti-dsDNA was positive in 75% of SLE cases and majority (45.8% of which showed peripheral pattern whereas anti-ENA was positive in 48.6% cases and majority (70.5% of which showed speckled pattern. The most commonly identified antinuclear autoreactivity was directed towards anti-RNP (22.2% then anti-Sm (16.6%, anti-SSA (16.6% and anti-SSB (11.1 %. Multiple anti

  19. Fuel Cells in the Waste-to-Energy Chain Distributed Generation Through Non-Conventional Fuels and Fuel Cells

    CERN Document Server

    McPhail, Stephen J; Moreno, Angelo

    2012-01-01

    As the availability of fossils fuels becomes more limited, the negative impact of their consumption becomes an increasingly relevant factor in our choices with regards to primary energy sources. The exponentially increasing demand for energy is reflected in the mass generation of by-products and waste flows which characterize current society’s development and use of fossil sources. The potential for recoverable material and energy in these ever-increasing refuse flows is huge, even after the separation of hazardous constituent elements, allowing safe and sustainable further exploitation of an otherwise 'wasted' resource.  Fuel Cells in the Waste-to-Energy Chain explores the concept of waste-to-energy through a 5 step process which reflects the stages during the transformation of  refuse flows to a valuable commodity such as clean energy. By providing selected, integrated alternatives to the current centralized, wasteful, fossil-fuel based infrastructure, Fuel Cells in the Waste-to-Energy Chain explores ho...

  20. Realization of radiobiological in vitro cell experiments at conventional X-ray tubes and unconventional radiation sources

    International Nuclear Information System (INIS)

    Beyreuther, Elke

    2010-01-01

    More than hundred years after the discovery of X-rays different kinds of ionizing radiation are ubiquitous in medicine, applied to clinical diagnostics and cancer treatment as well. Irrespective of their nature, the widespread application of radiation implies its precise dosimetric characterization and detailed knowledge of the radiobiological effects induced in cancerous and normal tissue. Starting with in vitro cell irradiation experiments, which define basic parameters for the subsequent tissue and animal studies, the whole multi-stage process is completed by clinical trials that translate the results of fundamental research into clinical application. In this context, the present dissertation focuses on the establishment of radiobiological in vitro cell experiments at unconventional, but clinical relevant radiation qualities. In the first part of the present work the energy dependent biological effectiveness of photons was studied examining low-energy X-rays (≤ 50 keV), as used for mammography, and high-energy photons (≥ 20 MeV) as proposed for future radiotherapy. Cell irradiation experiments have been performed at conventional X-ray tubes providing low-energy photons and 200 kV reference radiation as well. In parallel, unconventional quasi-monochromatic channeling X-rays and high-energy bremsstrahlung available at the radiation source ELBE of the Forschungszentrum Dresden-Rossendorf were considered for radiobiological experimentation. For their precise dosimetric characterization dosimeters based on the thermally stimulated emission of exoelectrons and on radiochromic films were evaluated, whereas just the latter was found to be suitable for the determination of absolute doses and spatial dose distributions at cell position. Standard ionization chambers were deployed for the online control of cell irradiation experiments. Radiobiological effects were analyzed in human mammary epithelial cells on different subcellular levels revealing an increasing amount

  1. Realization of radiobiological in vitro cell experiments at conventional X-ray tubes and unconventional radiation sources

    Energy Technology Data Exchange (ETDEWEB)

    Beyreuther, Elke

    2010-09-10

    More than hundred years after the discovery of X-rays different kinds of ionizing radiation are ubiquitous in medicine, applied to clinical diagnostics and cancer treatment as well. Irrespective of their nature, the widespread application of radiation implies its precise dosimetric characterization and detailed knowledge of the radiobiological effects induced in cancerous and normal tissue. Starting with in vitro cell irradiation experiments, which define basic parameters for the subsequent tissue and animal studies, the whole multi-stage process is completed by clinical trials that translate the results of fundamental research into clinical application. In this context, the present dissertation focuses on the establishment of radiobiological in vitro cell experiments at unconventional, but clinical relevant radiation qualities. In the first part of the present work the energy dependent biological effectiveness of photons was studied examining low-energy X-rays (≤ 50 keV), as used for mammography, and high-energy photons (≥ 20 MeV) as proposed for future radiotherapy. Cell irradiation experiments have been performed at conventional X-ray tubes providing low-energy photons and 200 kV reference radiation as well. In parallel, unconventional quasi-monochromatic channeling X-rays and high-energy bremsstrahlung available at the radiation source ELBE of the Forschungszentrum Dresden-Rossendorf were considered for radiobiological experimentation. For their precise dosimetric characterization dosimeters based on the thermally stimulated emission of exoelectrons and on radiochromic films were evaluated, whereas just the latter was found to be suitable for the determination of absolute doses and spatial dose distributions at cell position. Standard ionization chambers were deployed for the online control of cell irradiation experiments. Radiobiological effects were analyzed in human mammary epithelial cells on different subcellular levels revealing an increasing amount

  2. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression

    OpenAIRE

    Lou Yongli; Guo Dewei; Zhang Hui; Song Laijun

    2016-01-01

    In this study, we investigated the therapeutic effects of Human Mesenchymal Stem Cells (hMSCs) cultured by hanging drop and conventional culturing methods on cerebellar repair in hypoxic-ischemic (HI) brain injured mice. Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) was used to analyze the expression levels of three stemness genes, Oct4, Sox2 and Nanog, and the migration related gene CXCR4. MSC prepared by hanging drop or conventional techniques were adminis...

  3. AMP deaminase histochemical activity and immunofluorescent isozyme localization in rat skeletal muscle

    Science.gov (United States)

    Thompson, J. L.; Sabina, R. L.; Ogasawara, N.; Riley, D. A.

    1992-01-01

    The cellular distribution of AMP deaminase (AMPda) isozymes was documented for rat soleus and plantaris muscles, utilizing immunofluorescence microscopy and immunoprecipitation methods. AMPda is a ubiquitous enzyme existing as three distinct isozymes, A, B and C, which were initially purified from skeletal muscle, liver (and kidney), and heart, respectively. AMPda-A is primarily concentrated subsarcolemmally and intermyofibrillarly within muscle cells, while isozymes B and C are concentrated within non-myofiber elements of muscle tissue. AMPda-B is principally associated with connective tissues surrounding neural elements and the muscle spindle capsule, and AMPda-C is predominantly associated with circulatory elements, such as arterial and venous walls, capillary endothelium, and red blood cells. These specific localizations, combined with documented differences in kinetic properties, suggest multiple functional roles for the AMPda isozymes or temporal segregation of similar AMPda functions. Linkage of the AMPda substrate with adenosine production pathways at the AMP level and the localization of isozyme-C in vascular tissue suggest a regulatory role in the microcirculation.

  4. Spatial Mixture Modelling for Unobserved Point Processes: Examples in Immunofluorescence Histology.

    Science.gov (United States)

    Ji, Chunlin; Merl, Daniel; Kepler, Thomas B; West, Mike

    2009-12-04

    We discuss Bayesian modelling and computational methods in analysis of indirectly observed spatial point processes. The context involves noisy measurements on an underlying point process that provide indirect and noisy data on locations of point outcomes. We are interested in problems in which the spatial intensity function may be highly heterogenous, and so is modelled via flexible nonparametric Bayesian mixture models. Analysis aims to estimate the underlying intensity function and the abundance of realized but unobserved points. Our motivating applications involve immunological studies of multiple fluorescent intensity images in sections of lymphatic tissue where the point processes represent geographical configurations of cells. We are interested in estimating intensity functions and cell abundance for each of a series of such data sets to facilitate comparisons of outcomes at different times and with respect to differing experimental conditions. The analysis is heavily computational, utilizing recently introduced MCMC approaches for spatial point process mixtures and extending them to the broader new context here of unobserved outcomes. Further, our example applications are problems in which the individual objects of interest are not simply points, but rather small groups of pixels; this implies a need to work at an aggregate pixel region level and we develop the resulting novel methodology for this. Two examples with with immunofluorescence histology data demonstrate the models and computational methodology.

  5. Antibodies to UV irradiated DNA: the monitoring of DNA damage by ELISA and indirect immunofluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Wani, A A; Gibson-D' Ambrosio, R E; D' Ambrosio, S M [Ohio State Univ., Columbus (USA). Dept. of Radiology

    1984-10-01

    The enzyme-linked immunosorbant assay (ELISA) was modified to (1) characterize antibodies raised in rabbits against UV-irradiated single-stranded DNA (UVssDNA) complexed with methylated BSA and (2) directly detect pyrimidine dimers in irradiated DNA. The antisera specifically bound to UVssDNA, UVpoly(dT) and to a limited extent to UVdsDNA and UVpoly(dC). Fifty per cent of the maximum antibody binding was observed at a 1-5000 dilution against UVssDNA. Binding to ssDNA and poly(dT) was observed only at much higher concentrations of antibody, whereas no binding to double stranded DNA (dsDNA) was observed. The extent of binding of the antibody was dependent on the UV dose to DNA and the concentration of antigen immobilized on the plate. The ability of various irradiated molecules, DNA, homopolymers and linkers to act as inhibitors of antibody binding establishes that the antigenic determinants are mainly thymine homodimers with lower affinity for cytosine dimers. Potential usefulness of the antibodies to directly quantitate pyrimidine dimers in cells exposed to UV radiation was determined by indirect immunofluorescence. Flow cytometric analysis of immunostained human lymphocytes irradiated with 254 nm radiation indicated that greater than 50% of the population had significantly higher fluorescent intensity than unirradiated cells.

  6. Evaluation on the Clinical Efficacy of Dendritic Cell-Activated Cytokine-Induced Killer Cells Combined with Conventional Therapy in the Treatment of Malignant Tumors

    Directory of Open Access Journals (Sweden)

    Hong WEI

    2016-06-01

    Full Text Available Objective: To evaluate the clinical efficacy of dendritic cell-activated cytokine-induced killer (DC-CIK cells combined with conventional therapy in the treatment of malignant tumors.Methods: A total of 100 patients with malignant tumors were randomly divided into two groups. Treatment group received conventional therapy combined with DC-CIK while control group received conventional therapy alone. The short-term efficacy, adverse reactions and changes of lymphocyte subpopulation were all compared between two groups after treatment.Results: The overall response rate (ORR was higher in treatment group (86.00% than in control group (54.00%, the difference was statistically significant (P<0.05. White blood cell count (WBC reduced after treatment when compared with treatment before (P=0.001, but liver and kidney function had no obvious change in treatment group (P>0.05. WBC reduced markedly, but the level of alanine aminotransferase (ALT increased obviously after treatment in control group (P<0.001. WBC was higher, but the level of ALT was lower in treatment group than in control group (P<0.001. However, there was no difference between two groups regarding serum creatinine (Scr and blood urea nitrogen (BUN (P>0.05. In treatment group, the levels of CD3+, CD3+CD4+, CD3+CD8+, and CD3+CD56+ increased (P<0.05, but the level of CD4+/CD8+ had no significant change (P>0.05. In control group, the levels of CD3+ and CD3+CD4+ reduced (P<0.05, while the levels of CD3+CD8+, CD3+CD56+ and CD4+/CD8+ had no significant change (P>0.05. The levels of CD3+, CD3+CD4+, CD3+CD8+ and CD3+CD56+ in treatment group were higher than those in control group (P<0.01, whereas CD4+/CD8+ was lower than that in control group (P<0.01.Conclusion: DC-CIK combined with conventional therapy, safe and effective, is capable of promoting the recovery of leukocytes and liver and kidney function, and improving the cellular immune function, which may provide a new therapeutic regimen for

  7. Immunofluorescence Plaque Assay for African Swine Fever Virus

    Science.gov (United States)

    Tessler, J.; Hess, W. R.; Pan, I. C.; Trautman, R.

    1974-01-01

    Suitably diluted cell culture adapted African swine fever virus preparations were inoculated on VERO cell monolayers and grown on coverslips. Gum tragacanth was used as an overlay. After three days incubation at 37°C the infected cultures were fixed with acetone and stained with fluorescent antibody conjugate. Fluorescing plaques consisted of 20-30 infected cells. Three statistical criteria for a quantitatively reliable assay were met: the Poisson distribution for plaque counts, linearity of the relationship between the concentration of virus and the plaque count and reproducibility of replicate titrations. The method is suitable for counts up to at least 70 plaques per 5 cm2 coverslip and computed titers are reproducible within 0.16 log units with a total of 300 plaques enumerated. PMID:4279763

  8. Dumping convention

    International Nuclear Information System (INIS)

    Roche, P.

    1992-01-01

    Sea dumping of radioactive waste has, since 1983, been precluded under a moratorium established by the London Dumping Convention. Pressure from the nuclear industry to allow ocean dumping of nuclear waste is reported in this article. (author)

  9. Thermo economic comparison of conventional micro combined heat and power systems with solid oxide fuel cell systems for small scale applications

    DEFF Research Database (Denmark)

    Batens, Ellen; Cuellar, Rafael; Marissal, Matthieu

    2013-01-01

    out a thermo economic comparison of a conventional micro combined heat and power systems with solid oxide fuel cell systems. A model to estimate the savings and cost targets for solid oxide fuel cell systems is presented. A comparison between fuel cell technologies in the danish market with “state......Fuel cells have the potential to reduce domestic energy consumption by providing both heat and electricity at the point of use. However, the cost of installing the fuel cell must be sufficiently competitive to be recovered by the savings made over its lifetime. The goal of this paper is to carry...... of the art” traditional heat and power generation technologies currently used in Denmark is considered. The conventional method of covering electrical, heating (e.g. hot water) and cooling (e.g. space cooling) load demands is by purchasing electricity from the electricity network grid and with a fossil fuel...

  10. Health-Related Quality-of-Life Outcomes Following IMRT Versus Conventional Radiotherapy for Oropharyngeal Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Yao Min; Karnell, Lucy H.; Funk, Gerry F.; Lu Heming; Dornfeld, Ken; Buatti, John M.

    2007-01-01

    Purpose: To compare health-related quality-of-life (HRQOL) outcomes of patients with oropharyngeal squamous cell carcinoma treated using intensity-modulated radiotherapy (IMRT) vs. conventional radiotherapy (CRT). Patients and Methods: Patients with oropharyngeal squamous cell carcinoma were extracted from the database of an ongoing longitudinal Outcome Assessment Project. Eligible criteria included (1) treated with definitive radiation, and (2) provided 12-month posttreatment HRQOL data. Excluded were 7 patients who received IMRT before October 1, 2002, during this institution's developmental phase of the IMRT technique. The HRQOL outcomes of patients treated with IMRT were compared with those of patients who received CRT. Results: Twenty-six patients treated using IMRT and 27 patients treated using CRT were included. Patients in the IMRT group were older and had more advanced-stage diseases and more patients received concurrent chemotherapy. However, the IMRT group had higher mean Head and Neck Cancer Inventory scores (which represent better outcomes) for each of the four head-and-neck cancer-specific domains, including eating, speech, aesthetics, and social disruption, at 12 months after treatment. A significantly greater percentage of patients in the CRT group had restricted diets compared with those in the IMRT group (48.0% vs. 16.0%, p = 0.032). At 3 months after treatment, both groups had significant decreases from pretreatment eating scores. However, the IMRT group had a significant improvement during the first year, but the CRT group had only small improvement. Conclusions: Proper delivery of IMRT can improve HRQOL for patients with oropharyngeal cancer compared with CRT

  11. Comparison of first-tier cell-free DNA screening for common aneuploidies with conventional publically funded screening.

    Science.gov (United States)

    Langlois, Sylvie; Johnson, JoAnn; Audibert, François; Gekas, Jean; Forest, Jean-Claude; Caron, André; Harrington, Keli; Pastuck, Melanie; Meddour, Hasna; Tétu, Amélie; Little, Julian; Rousseau, François

    2017-12-01

    This study evaluates the impact of offering cell-free DNA (cfDNA) screening as a first-tier test for trisomies 21 and 18. This is a prospective study of pregnant women undergoing conventional prenatal screening who were offered cfDNA screening in the first trimester with clinical outcomes obtained on all pregnancies. A total of 1198 pregnant women were recruited. The detection rate of trisomy 21 with standard screening was 83% with a false positive rate (FPR) of 5.5% compared with 100% detection and 0% FPR for cfDNA screening. The FPR of cfDNA screening for trisomies 18 and 13 was 0.09% for each. Two percent of women underwent an invasive diagnostic procedure based on screening or ultrasound findings; without the cfDNA screening, it could have been as high as 6.8%. Amongst the 640 women with negative cfDNA results and a nuchal translucency (NT) ultrasound, only 3 had an NT greater or equal to 3.5 mm: one had a normal outcome and two lost their pregnancy before 20 weeks. cfDNA screening has the potential to be a highly effective first-tier screening approach leading to a significant reduction of invasive diagnostic procedures. For women with a negative cfDNA screening result, NT measurement has limited clinical utility. © 2017 John Wiley & Sons, Ltd.

  12. Is High Dose Therapy Superior to Conventional Dose Therapy as Initial Treatment for Relapsed Germ Cell Tumors? The TIGER Trial

    Directory of Open Access Journals (Sweden)

    Darren R. Feldman, Robert Huddart, Emma Hall, Jörg Beyer, Thomas Powles

    2011-01-01

    Full Text Available Metastatic germ cell tumours (GCTs are usually cured with cisplatin based chemotherapy and standard treatment algorithms are established. However when this treatment fails and the disease relapses, standard treatment is much more uncertain. Both conventional dose therapy (CDT and high dose therapy (HDT are widely used, due to the lack of conclusive data supporting one specific approach. A recent retrospective analysis focusing on this population suggested a significant benefit for HDT. Retrospective analyses are prone to bias, and therefore while this data is provocative it is by no mean conclusive. For this reason the international community is supporting a prospective randomised trial in this area comparing CDT(TIP with sequential HDT (TICE. The planned open labelled randomised phase III study (TIGER is due to open in 2011 and will recruit 390 patients to detect a 13% difference in 2 year progression free survival (primary endpoint. It is hoped that this large study will conclusively resolve the uncertainty which currently exists.

  13. Detection of serum antitrichomonal antibodies in urogenital trichomoniasis by immunofluorescence.

    Directory of Open Access Journals (Sweden)

    Bhatt R

    1992-04-01

    Full Text Available Trichomonas vaginalis is a frequently encountered genital pathogen in both males and females. In females, vaginitis due to this parasite is one of the most common manifestation. The indirect fluorescent technique (IFA test was carried out to detect antitrichomonal antibodies in 370 female patients using whole cell antigen. Seventy one (19.18% gave positive reaction for either of the class IgG, IgM and IgA antibodies. The level of the IgG class antibodies was found to be higher i.e. 58 (81.69% than IgM 11 (15.27% antibodies, which may be suggestive of past infection or a prolonged manifestation by the organisms.

  14. The Role of Non-Conventional Supports for Single-Atom Platinum-Based Catalysts in Fuel-Cell Technology: A Theoretical Surface Science Approach

    Science.gov (United States)

    2013-02-05

    could be a promising catalyst for PEM fuel cells. Introduction: Proton exchange membrane fuel cells ( PEMFCs ) have found wide potential...Unfortunately, due to their high cost and low lifespan, wide-scale commercialization of PEMFCs has been greatly impeded and much effort has been made to...lower its cost as well as to improve its durability over time. In an attempt to alleviate the high-cost associated with conventional PEMFC catalysts

  15. Profiling of Cytokines Secreted by Conventional Aqueous Outflow Pathway Endothelial Cells Activated In Vitro and Ex Vivo With Laser Irradiation.

    Science.gov (United States)

    Alvarado, Jorge A; Chau, Phuonglan; Wu, Jianfeng; Juster, Richard; Shifera, Amde Selassie; Geske, Michael

    2015-11-01

    To profile which cytokine genes are differentially expressed (DE) as up- or downregulated by cultured human trabecular meshwork (TMEs) and Schlemm's canal endothelial cells (SCEs) after three experimental treatments consisting of selective laser trabeculoplasty (SLT) irradiation, exposure to media conditioned either by SLT-irradiated TMEs (TME-cm) or by SCEs (SCE-cm). Also, to profile which cytokines are upregulated ex vivo in SLT-irradiated human conventional aqueous outflow pathway (CAOP) tissues. After each treatment, Affymetrix microarray assays were used to detect upregulated and downregulated genes for cytokines and their receptors in TMEs and SCEs. ELISA and protein antibody arrays were used to detect upregulated cytokines secreted in SLT-irradiated CAOP tissues ex vivo. The SLT irradiation upregulated numerous cytokine genes in TMEs, but only a few in SCEs. Exposure to TME- and SCE-cm induced SCEs to upregulate many more cytokine genes than TMEs. Selective laser trabeculoplasty irradiation and exposure to TME-cm downregulated several cytokine genes in TMEs but none in SCEs. Selective laser trabeculoplasty irradiation induced one upregulated and three downregulated cytokine-receptor genes in TMEs but none in SCEs. Exposure to TME-cm induced upregulation of one and downregulation of another receptor gene in TMEs, whereas two unique cytokine-receptor genes were upregulated in SCEs. Cytokine protein expression analysis showed that at least eight cytokines were upregulated in SLT-irradiated human CAOP tissues in situ/ex vivo. This study has helped us identify a cytokine signaling pathway and to consider newly identified mechanisms regulating aqueous outflow that may lay the foundation for the future development of cytokine-based glaucoma therapies.

  16. 4-1BB Signaling in Conventional T Cells Drives IL-2 Production That Overcomes CD4+CD25+FoxP3+ T Regulatory Cell Suppression.

    Directory of Open Access Journals (Sweden)

    Hampartsoum B Barsoumian

    Full Text Available Costimulation with the recombinant SA-4-1BBL agonist of 4-1BB receptor on conventional CD4+ T cells (Tconvs overcomes the suppression mediated by naturally occurring CD4+CD25+FoxP3+ T regulatory cells (Tregs. The mechanistic basis of this observation has remained largely unknown. Herein we show that Tconvs, but not Tregs, are the direct target of SA-4-1BBL-mediated evasion of Treg suppression. IL-2 produced by Tconvs in response to 4-1BB signaling is both necessary and sufficient for overcoming Treg suppression. Supernatant from Tconvs stimulated with SA-4-1BBL contains high levels of IL-2 and overcomes Treg suppression in ex vivo Tconv:Treg cocultures. Removal of IL-2 from such supernatant restores Treg suppression and repletion of Tconv:Treg cocultures with exogenous recombinant IL-2 overcomes suppression. This study establishes 4-1BB signaling as a key circuit that regulates physical and functional equilibrium between Tregs and Tconvs with important implications for immunotherapy for indications where a fine balance between Tregs and Teffs plays a decisive role.

  17. Heterogeneity mapping of protein expression in tumors using quantitative immunofluorescence.

    Science.gov (United States)

    Faratian, Dana; Christiansen, Jason; Gustavson, Mark; Jones, Christine; Scott, Christopher; Um, InHwa; Harrison, David J

    2011-10-25

    Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of areas of distinct differentiation into recognized histological subtypes, or different pathological grade, often there are more subtle differences in phenotype which defy accurate classification (Figure 1). Ultimately, since morphology is dictated by the underlying molecular phenotype, areas with visible differences are likely to be accompanied by differences in the expression of proteins which orchestrate cellular function and behavior, and therefore, appearance. The significance of visible and invisible (molecular) heterogeneity for prognosis is unknown, but recent evidence suggests that, at least at the genetic level, heterogeneity exists in the primary tumor(1,2), and some of these sub-clones give rise to metastatic (and therefore lethal) disease. Moreover, some proteins are measured as biomarkers because they are the targets of therapy (for instance ER and HER2 for tamoxifen and trastuzumab (Herceptin), respectively). If these proteins show variable expression within a tumor then therapeutic responses may also be variable. The widely used histopathologic scoring schemes for immunohistochemistry either ignore, or numerically homogenize the quantification of protein expression. Similarly, in destructive techniques, where the tumor samples are homogenized (such as gene expression profiling), quantitative information can be elucidated, but spatial information is lost. Genetic heterogeneity mapping approaches in pancreatic cancer have relied either on generation of a single cell suspension(3), or on macrodissection(4). A recent study has used quantum dots in order to map morphologic and molecular heterogeneity in prostate cancer tissue(5), providing proof of principle that morphology and molecular mapping is feasible, but falling short of quantifying the heterogeneity. Since immunohistochemistry is, at best, only semi

  18. Comparative study of P19 EC stem cell differentiation in between conventional hanging drop and the zebrafish chorion as a bio-derived material.

    Science.gov (United States)

    Dae Seok Na; Lee, Hwang; Sun Uk Kim; Chang Nam Hwang; Sang Ho Lee; Ji Yoon Kang; Jai Kyeong Kim; James Jungho Pak

    2008-07-01

    Various materials including glass and polymers have been widely used for stem cell culture due to their biocompatibility. However, the roles of these materials are fundamentally limited because they cannot realize or imitate the complex biological functions of living tissues, except in very simple cases. Here, the development of a bio-derived material suitable for stem cell culture and improvement of differentiation efficiency to specific cell lineages with no stimulating agents by using a chorion obtained from a fertilized zebrafish egg through the removal of the yolk and embryonic cell mass from the egg is reported. Mouse P19 EC stem cells introduced into the empty chorion form a uniform embryoid body (EB) without addition of any inducing agent. It is demonstrated that the zebrafish chorion with nanopores improves efficiencies greatly in the EB formation, cell proliferation, and lineage-specific differentiations compared to those of the conventional hanging drop culture method.

  19. Comparison between xCELLigence biosensor technology and conventional cell culture system for real-time monitoring human tenocytes proliferation and drugs cytotoxicity screening.

    Science.gov (United States)

    Chiu, Chih-Hao; Lei, Kin Fong; Yeh, Wen-Ling; Chen, Poyu; Chan, Yi-Sheng; Hsu, Kuo-Yao; Chen, Alvin Chao-Yu

    2017-10-16

    Local injections of anesthetics, NSAIDs, and corticosteroids for tendinopathies are empirically used. They are believed to have some cytotoxicity toward tenocytes. The maximal efficacy dosages of local injections should be determined. A commercial 2D microfluidic xCELLigence system had been developed to detect real-time cellular proliferation and their responses to different stimuli and had been used in several biomedical applications. The purpose of this study is to determine if human tenocytes can successfully proliferate inside xCELLigence system and the result has high correlation with conventional cell culture methods in the same condition. First passage of human tenocytes was seeded in xCELLigence and conventional 24-well plates. Ketorolac tromethamine, bupivacaine, methylprednisolone, and betamethasone with different concentrations (100, 50, and 10% diluted of clinical usage) were exposed in both systems. Gene expression of type I collagen, type III collagen, tenascin-C, decorin, and scleraxis were compared between two systems. Human tenocytes could proliferate both in xCELLigence and conventional cell culture systems. Cytotoxicity of each drug revealed dose-dependency when exposed to tenocytes in both systems. Significance was found between groups. All the four drugs had comparable cytotoxicity in their 100% concentration. When 50% concentration was used, betamethasone had a relatively decreased cytotoxicity among them in xCELLigence but not in conventional culture. When 10% concentration was used, betamethasone had the least cytotoxicity. Strong and positive correlation was found between cell index of xCELLigence and result of WST-1 assay (Pearson's correlation [r] = 0.914). Positive correlation of gene expression between tenocytes in xCELLigence and conventional culture was also observed. Type I collagen: [r] = 0.823; type III collagen: [r] = 0.899; tenascin-C: [r] = 0.917; decorin: [r] = 0.874; and scleraxis: [r] = 0.965. Human

  20. Improved detection of Pneumocystis carinii by an immunofluorescence technique using monoclonal antibodies

    DEFF Research Database (Denmark)

    Orholm, M; Holten-Andersen, W; Lundgren, Jens Dilling

    1990-01-01

    To assess whether a recently developed indirect immunofluorescent stain using monoclonal antibodies was more sensitive in detecting Pneumocystis carinii than the combination of Giemsa and methenamine silver nitrate stains which has routinely been used in the laboratory, 88 lavage fluid specimens...... silver nitrate and toluidine blue O. Immunofluorescence using the monoclonal antibodies from the NIH was significantly more sensitive than any other single staining method and than the combination of Giemsa and methenamine silver nitrate staining. The study also showed that the cytospin centrifuge...

  1. Irradiation of mammalian cells in the presence of diamide and low concentrations of oxygen at conventional and at ultrahigh dose rates

    International Nuclear Information System (INIS)

    Clark, E.P.; Michaels, H.B.; Peterson, E.C.; Epp, E.R.

    1983-01-01

    The response of cultured CHO cells to ultrahigh-dose-radiation (approx.10 9 Gy/sec) has been previously studied extensively using the thin-layer cell-handling technique developed in this laboratory. When the cells are equilibrated with a low concentration of oxygen, e.g., 0.44% O 2 , a breaking survival curve, due to radiolytic depletion of the oxygen, is observed. Hypoxic cells irradiated in the presence of the nitroimidazoles (e.g., misonidazole) are sensitized at ultrahigh dose rates in a dose-modifying manner, similar to that observed at conventional dose rates. These radiosensitizer compounds, if present in cells equilibrated with a low concentration of oxygen, prevent the breaking behavior of the survival curve, an observation believed to be due to the sensitizer interfering with the oxygen depletion process, leaving oxygen free to sensitize. Such experiments have recently been extended to studies with diamide, which, unlike the other sensitizers tested, acts primarily as a shoulder-modifying rather than a dose-modifying agent in hypoxic mammalian cells. These data indicate that diamide is active as a sensitizer at ultrahigh dose rates in a manner similar to that observed at conventional dose rates, and does modify the shape of the breaking survival curve observed with low concentrations of oxygen

  2. An electrochemical cell for in operando studies of lithium/sodium batteries using a conventional x-ray powder diffractometer

    DEFF Research Database (Denmark)

    Shen, Yanbin; Pedersen, Erik Ejler; Christensen, Mogens

    2014-01-01

    An electrochemical cell has been designed for powder X-ray diffraction (PXRD) studies of lithium ion batteries (LIB) and sodium ion batteries (SIB) in operando with high time resolution using conventional powder X-ray diffractometer. The cell allows for studies of both anode and cathode electrode...... to operate and maintain. Test examples on lithium insertion/extraction in two spinel-type LIB electrode materials (Li4Ti5O12 anode and LiMn2O4 cathode) are presented as well as first results on sodium extraction from a layered SIB cathode material (Na0.84Fe0.56Mn0.44O2)....

  3. A Unique Immunofluorescence Protocol to Detect Protein Expression in Vascular Tissues: Tacking a Long Standing Pathological Hitch

    Directory of Open Access Journals (Sweden)

    Puneet GANDHI

    2018-01-01

    Full Text Available Objective: Autofluorescence induced interference is one of the major drawbacks in immunofluorescence analysis of formalin-fixed paraffin-embedded tissues, as it decreases the signal-to-noise ratio of specific labeling. Apart from aldehyde-fixation induced artifacts; collagen and elastin, red blood cells and endogenous fluorescent pigment lipofuscin are prime sources of autofluorescence in vascular and aging tissues. We describe herein, an optimized indirect-immunofluorescence method for archival formalin-fixed paraffin-embedded tissues tissues and cryo sections, using a combination of 3-reagents in a specific order, to achieve optimal fluorescence signals and imaging. Material and Method: Human telomerase reverse transcriptase, a protein implicated as a proliferation marker, was chosen relevant to its expression in solid tumors along with 3 other intracellular proteins exhibiting nuclear and/or cytoplasmic expression. Staining was performed on 10 glioma tissue sections along with 5 of their cryo sections, 5 sections each of hepatocellular, lung, papillary-thyroid and renal cell carcinoma, with 10 non-malignant brain tissue samples serving as control. Specimens were imaged using epifluorescence microscopy, followed by software-based quantification of fluorescence signals for statistical analysis and validation. Results: We observed that the combined application of sodium-borohydride followed by crystal violet before antigen retrieval and a Sudan black B treatment after secondary antibody application proved to be most efficacious for masking autofluorescence/non-specific background in vascular tissues. Conclusion: This unique trio-methodology provides quantifiable observations with maximized fluorescence signal intensity of the target protein for longer retention time of the signal even after prolonged storage. The results can be extrapolated to other human tissues for different protein targets.

  4. Comparative evaluation of multiple fractions per day radiotherapy and conventional fractionated radiotherapy in squamous cell carcinoma of esophagus

    International Nuclear Information System (INIS)

    Andrabi, W.H.; Akhtar, S.; Kharadi, M.Y.; Mushtaq, G.; Zargar, S.A.

    1999-01-01

    Dose fractionated is important in radiotherapy in order to achieve the desired results. There are regimes which are accepted and followed worldwide. Five fractions per week for a full course of treatment is regarded as standard fractionation regimen. Interest has lately been developed to alter this and try regimes like hyper and accelerated fractionations. In the former, smaller doses per fraction than usual are given in several fractions on each treating day, with no change in overall time. In the latter, conventionally sized fractions are given as two or three per day with a shortening of overall time. As the dose fraction in our case is high, we spilt the full course of treatment introducing a gap of one week between the treatment schedules. The results obtained are fairly good in comparison with conventional radiotherapy regimes. (author)

  5. SA-4-1BBL costimulation inhibits conversion of conventional CD4+ T cells into CD4+ FoxP3+ T regulatory cells by production of IFN-γ.

    Directory of Open Access Journals (Sweden)

    Shravan Madireddi

    Full Text Available Tumors convert conventional CD4(+ T cells into induced CD4(+CD25(+FoxP3(+ T regulatory (iTreg cells that serve as an effective means of immune evasion. Therefore, the blockade of conventional CD4(+ T cell conversion into iTreg cells represents an attractive target for improving the efficacy of various immunotherapeutic approaches. Using a novel form of 4-1BBL molecule, SA-4-1BBL, we previously demonstrated that costimulation via 4-1BB receptor renders both CD4(+and CD8(+ T effector (Teff cells refractory to inhibition by Treg cells and increased intratumoral Teff/Treg cell ratio that correlated with therapeutic efficacy in various preclinical tumor models. Building on these studies, we herein show for the first time, to our knowledge, that signaling through 4-1BB inhibits antigen- and TGF-β-driven conversion of naïve CD4(+FoxP3(- T cells into iTreg cells via stimulation of IFN-γ production by CD4(+FoxP3(- T cells. Importantly, treatment with SA-4-1BBL blocked the conversion of CD4(+FoxP3(- T cells into Treg cells by EG.7 tumors. Taken together with our previous studies, these results show that 4-1BB signaling negatively modulate Treg cells by two distinct mechanisms: i inhibiting the conversion of CD4(+FoxP3(- T cells into iTreg cells and ii endowing Teff cells refractory to inhibition by Treg cells. Given the dominant role of Treg cells in tumor immune evasion mechanisms, 4-1BB signaling represents an attractive target for favorably tipping the Teff:Treg balance toward Teff cells with important implications for cancer immunotherapy.

  6. New insights into non-conventional epitopes as T cell targets: The missing link for breaking immune tolerance in autoimmune disease?

    Science.gov (United States)

    Harbige, James; Eichmann, Martin; Peakman, Mark

    2017-11-01

    The mechanism by which immune tolerance is breached in autoimmune disease is poorly understood. One possibility is that post-translational modification of self-antigens leads to peripheral recognition of neo-epitopes against which central and peripheral tolerance is inadequate. Accumulating evidence points to multiple mechanisms through which non-germline encoded sequences can give rise to these non-conventional epitopes which in turn engage the immune system as T cell targets. In particular, where these modifications alter the rules of epitope engagement with MHC molecules, such non-conventional epitopes offer a persuasive explanation for associations between specific HLA alleles and autoimmune diseases. In this review article, we discuss current understanding of mechanisms through which non-conventional epitopes may be generated, focusing on several recently described pathways that can transpose germline-encoded sequences. We contextualise these discoveries around type 1 diabetes, the prototypic organ-specific autoimmune disease in which specific HLA-DQ molecules confer high risk. Non-conventional epitopes have the potential to act as tolerance breakers or disease drivers in type 1 diabetes, prompting a timely re-evaluation of models of a etiopathogenesis. Future studies are required to elucidate the disease-relevance of a range of potential non-germline epitopes and their relationship to the natural peptide repertoire. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Optimization of the silicon subcell for III-V on silicon multijunction solar cells: Key differences with conventional silicon technology

    Science.gov (United States)

    García-Tabarés, Elisa; Martín, Diego; García, Iván; Lelièvre, Jean François; Rey-Stolle, Ignacio

    2012-10-01

    Dual-junction solar cells formed by a GaAsP or GaInP top cell and a silicon (Si) bottom cell seem to be attractive candidates to materialize the long sought-for integration of III-V materials on Si for photovoltaic (PV) applications. Such integration would offer a cost breakthrough for PV technology, unifying the low cost of Si and the efficiency potential of III-V multijunction solar cells. The optimization of the Si solar cells properties in flat-plate PV technology is well-known; nevertheless, it has been proven that the behavior of Si substrates is different when processed in an MOVPE reactor In this study, we analyze several factors influencing the bottom subcell performance, namely, 1) the emitter formation as a result of phosphorus diffusion; 2) the passivation quality provided by the GaP nucleation layer; and 3) the process impact on the bottom subcell PV properties.

  8. Comparative evaluation of optical methods and conventional isotope techniques for the detection of insulin receptors in heterogenous cell systems

    International Nuclear Information System (INIS)

    Thun, C.

    1984-01-01

    The findings of studies using radioactively labelled (I-125) insulin to characterise its binding to various heterogenous cell systems had led to a classification of the relevant receptors with those of high affinity and low capacity or vice versa. This, in turn, raised questions as to the binding properties of each individual cell or cell material of a heterogenous nature. Apparently homogenous (lymphocytes) and heterogenous (blood and islet cells) cell populations were investigated on the basis of various techniques for the separate evaluation of individual cells, which were cytofluorometry using FITC insulin and the analysis of gold insulin under the electron microscope. For the association kinetics and equilibration analysis or affinity and receptor quantity a radioactive tracer and light microscope were used. Insulin was shown to bind to erythrocytes, reticulocytes, monocytes and lymphocytes and this result finds confirmation in the relevant literature. Furthermore, binding parameters could be determined for isolated islet cells. Cytofluorometry pointed to the fact that the insulin receptors of an apparently homogenous cell system differed in affinity and number and permitted the use of a multiple parameter procedure. Thus, it holds out promise as a method to be routinely used in the clinical diagnosis of binding parameters, without requiring previous separation procedures that are complicated or involve a loss of material. Transmission electron microscopy permitted conclusions to be drawn as to the type of cell to which insulin is attached. Owing to the use of gold insulin it was possible to throw some light on the factors determining the fate of membrane-bound insulin during its uptake into the cell. (TRV) [de

  9. Expression of E-cadherin and β-catenin in basaloid and conventional squamous cell carcinoma of the oral cavity: are potential prognostic markers?

    International Nuclear Information System (INIS)

    Hanemann, João Adolfo Costa; Oliveira, Denise Tostes; Nonogaki, Suely; Nishimoto, Inês Nobuko; Carli, Marina Lara de; Landman, Gilles; Kowalski, Luiz Paulo

    2014-01-01

    Basaloid squamous cell carcinoma presents with a preference for the head and neck region, and shows a distinct aggressive behavior, with frequent local recurrences, regional and distant metastasis. The alterations in the cadherin-catenin complex are fundamental requirements for the metastasis process, and this is the first study to evaluate the immunostaining of E-cadherin and β-catenin in oral basaloid squamous cell carcinoma. Seventeen cases of this tumor located exclusively in the mouth were compared to 26 cases of poorly differentiated squamous cell carcinoma and 28 cases of well to moderately differentiated squamous cell carcinoma matched by stage and tumor site. The immunostaining of E-cadherin and β-catenin were evaluated in the three groups and compared to their clinicopathological features and prognosis. For groups poorly differentiated squamous cell carcinoma and basaloid squamous cell carcinoma, reduction or absence of E-cadherin staining was observed in more than 80.0% of carcinomas, and it was statistically significant compared to well to moderately differentiated squamous cell carcinoma (p = .019). A strong expression of β-catenin was observed in 26.9% and 20.8% of well to moderately differentiated squamous cell carcinoma and poorly differentiated squamous cell carcinoma, respectively, and in 41.2% of basaloid squamous cell carcinoma. The 5-year and 10-year overall and disease-free survival rates demonstrated no significant differences among all three groups. The clinical and biological behavior of three groups of the oral cavity tumors evaluated are similar. E-cadherin and β-catenin immunostaining showed no prognostic value for basaloid and conventional squamous cell carcinomas

  10. Expression of E-cadherin and β-catenin in basaloid and conventional squamous cell carcinoma of the oral cavity: are potential prognostic markers?

    Science.gov (United States)

    Hanemann, João Adolfo Costa; Oliveira, Denise Tostes; Nonogaki, Suely; Nishimoto, Inês Nobuko; de Carli, Marina Lara; Landman, Gilles; Kowalski, Luiz Paulo

    2014-06-03

    Basaloid squamous cell carcinoma presents with a preference for the head and neck region, and shows a distinct aggressive behavior, with frequent local recurrences, regional and distant metastasis. The alterations in the cadherin-catenin complex are fundamental requirements for the metastasis process, and this is the first study to evaluate the immunostaining of E-cadherin and β-catenin in oral basaloid squamous cell carcinoma. Seventeen cases of this tumor located exclusively in the mouth were compared to 26 cases of poorly differentiated squamous cell carcinoma and 28 cases of well to moderately differentiated squamous cell carcinoma matched by stage and tumor site. The immunostaining of E-cadherin and β-catenin were evaluated in the three groups and compared to their clinicopathological features and prognosis. For groups poorly differentiated squamous cell carcinoma and basaloid squamous cell carcinoma, reduction or absence of E-cadherin staining was observed in more than 80.0% of carcinomas, and it was statistically significant compared to well to moderately differentiated squamous cell carcinoma (p = .019). A strong expression of β-catenin was observed in 26.9% and 20.8% of well to moderately differentiated squamous cell carcinoma and poorly differentiated squamous cell carcinoma, respectively, and in 41.2% of basaloid squamous cell carcinoma. The 5-year and 10-year overall and disease-free survival rates demonstrated no significant differences among all three groups. The clinical and biological behavior of three groups of the oral cavity tumors evaluated are similar. E-cadherin and β-catenin immunostaining showed no prognostic value for basaloid and conventional squamous cell carcinomas.

  11. 4D super-resolution microscopy with conventional fluorophores and single wavelength excitation in optically thick cells and tissues.

    Directory of Open Access Journals (Sweden)

    David Baddeley

    Full Text Available BACKGROUND: Optical super-resolution imaging of fluorescently stained biological samples is rapidly becoming an important tool to investigate protein distribution at the molecular scale. It is therefore important to develop practical super-resolution methods that allow capturing the full three-dimensional nature of biological systems and also can visualize multiple protein species in the same sample. METHODOLOGY/PRINCIPAL FINDINGS: We show that the use of a combination of conventional near-infrared dyes, such as Alexa 647, Alexa 680 and Alexa 750, all excited with a 671 nm diode laser, enables 3D multi-colour super-resolution imaging of complex biological samples. Optically thick samples, including human tissue sections, cardiac rat myocytes and densely grown neuronal cultures were imaged with lateral resolutions of ∼15 nm (std. dev. while reducing marker cross-talk to <1%. Using astigmatism an axial resolution of ∼65 nm (std. dev. was routinely achieved. The number of marker species that can be distinguished depends on the mean photon number of single molecule events. With the typical photon yields from Alexa 680 of ∼2000 up to 5 markers may in principle be resolved with <2% crosstalk. CONCLUSIONS/SIGNIFICANCE: Our approach is based entirely on the use of conventional, commercially available markers and requires only a single laser. It provides a very straightforward way to investigate biological samples at the nanometre scale and should help establish practical 4D super-resolution microscopy as a routine research tool in many laboratories.

  12. Hypofractionation results in reduced tumor cell kill compared to conventional fractionation for tumors with regions of hypoxia.

    Science.gov (United States)

    Carlson, David J; Keall, Paul J; Loo, Billy W; Chen, Zhe J; Brown, J Martin

    2011-03-15

    Tumor hypoxia has been observed in many human cancers and is associated with treatment failure in radiation therapy. The purpose of this study is to quantify the effect of different radiation fractionation schemes on tumor cell killing, assuming a realistic distribution of tumor oxygenation. A probability density function for the partial pressure of oxygen in a tumor cell population is quantified as a function of radial distance from the capillary wall. Corresponding hypoxia reduction factors for cell killing are determined. The surviving fraction of a tumor consisting of maximally resistant cells, cells at intermediate levels of hypoxia, and normoxic cells is calculated as a function of dose per fraction for an equivalent tumor biological effective dose under normoxic conditions. Increasing hypoxia as a function of distance from blood vessels results in a decrease in tumor cell killing for a typical radiotherapy fractionation scheme by a factor of 10(5) over a distance of 130 μm. For head-and-neck cancer and prostate cancer, the fraction of tumor clonogens killed over a full treatment course decreases by up to a factor of ∼10(3) as the dose per fraction is increased from 2 to 24 Gy and from 2 to 18 Gy, respectively. Hypofractionation of a radiotherapy regimen can result in a significant decrease in tumor cell killing compared to standard fractionation as a result of tumor hypoxia. There is a potential for large errors when calculating alternate fractionations using formalisms that do not account for tumor hypoxia. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Indirect micro-immunofluorescence test for detecting type-specific antibodies to herpes simplex virus.

    Science.gov (United States)

    Forsey, T; Darougar, S

    1980-02-01

    A rapid indirect micro-immunofluorescence test capable of detecting and differentiating type-specific antibodies to herpes simplex virus is described. The test proved highly sensitive and, in 80 patients with active herpes ocular infection, antibody was detected in 94%. No anti-herpes antibody was detected in a control group of 20 patients with adenovirus infections. Testing of animal sera prepared against herpes simplex virus types 1 and 2 and of human sera from cases of ocular and genital herpes infections showed that the test can differentiate antibodies to the infecting serotypes. Specimens of whole blood, taken by fingerprick, and eye secretions, both collected on cellulose sponges, could be tested by indirect micro-immunofluorescence. Anti-herpes IgG, IgM, and IgA can also be detected.

  14. Effect of In Vitro Exposure of Corticosteroid Drugs, Conventionally Used in AMD Treatment, on Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Raffaele Nuzzi

    2012-01-01

    Full Text Available Age-related macular degeneration (AMD is a leading cause of legal blindness in individuals over 60 years of age, characterized by the dysfunction of retinal pigmented epithelium cells, specifically in the macular area. Despite several treatment options, AMD therapy remains difficult, especially for exudative AMD. Multipotent mesenchymal stem cells (MSCs, with great plasticity and immunomodulant properties, are a promising cell source for cellular therapy and tissue engineering. We evaluated the effects of steroid drugs, often used to treat AMD, in association with MSCs, in view of a possible application together to treat AMD. Morphology, viability, growth kinetics, and immunophenotype were evaluated on healthy donors’ MSCs, treated with triamcinolone acetonide, alcohol-free triamcinolone acetonide, micronized intravitreal triamcinolone and dexamethasone at different concentrations, and in a human retinal pigment epithelial cell line supernatant (ARPE-19. The morphological analysis of MSCs in their standard medium showed a negative correlation with drug concentrations, due to the numerous crystals. Dexamethasone was the least toxic corticosteroid used in this study. ARPE-19 seemed to help cells preserve the typical MSC morphology. In conclusion, this in vitro study demonstrated that high doses of corticosteroid drugs have a negative effect on MSCs, reduced in the presence of a conditioned media.

  15. Fibrinogen Demonstration in Oral Lichen Planus: An Immunofluorescence Study on Archival Tissues.

    Science.gov (United States)

    Shirol, Pallavi D; Naik, Veena; Kale, Alka

    2015-10-01

    Lichen planus is a premalignant condition with minimal diagnostic aids. This study is an attempt to use paraffin embedded sections of lichen planus with immunofluorescein stain and to evaluate the immunofluorescent sections to establish pattern of fibrinogen deposition. Thirty-five paraffin embedded sections of old and new cases of oral lichen planus (study group) and five normal oral mucosa (control group) were chosen. Two sections of each (H & E) case were taken, one was stained with hematoxylin and eosin and another with fluorescein isothiocynate conjugate (FITC) polyclonal rabbit antibody against fibrinogen. Fluorescent findings were examined with a fluorescent microscope. A high statistical significant correlation was found in respect to fluorescence positivity, intensity of fluorescence and distribution of fluorescence each with p < 0.0001 and fluorescence at blood vessel walls (p = 0.0003). This study suggested that paraffin embedded sections can be successfully used in direct immunofluorescence staining in routine set up where only formalin fixed tissues are received. Paraffin embedded sections can be successfully used in direct immunofluorescence staining when only formalin fixed tissues are received.

  16. Conventional alpha beta (αβ) T cells do not contribute to acute intestinal ischemia-reperfusion injury in mice.

    Science.gov (United States)

    Yu, Yi; Feng, Xiaoyan; Vieten, Gertrud; Dippel, Stephanie; Imvised, Tawan; Gueler, Faikah; Ure, Benno M; Kuebler, Jochen F; Klemann, Christian

    2017-01-01

    Ischemia-reperfusion injury (IRI) is associated with significant patient mortality and morbidity. The complex cascade of IRI is incompletely understood, but inflammation is known to be a key mediator. In addition to the predominant innate immune responses, previous research has also indicated that αβ T cells contribute to IRI in various organ models. The aim of this study was to clarify the role αβ T cells play in IRI to the gut. Adult wild-type (WT) and αβ T cell-deficient mice were subjected to acute intestinal IRI with 30min ischemia followed by 4h reperfusion. The gene expression of pro-inflammatory cytokines was measured by qPCR, and the influx of leukocyte subpopulations in the gut was assessed via flow cytometry and histology. Pro-inflammatory cytokines in the serum were measured, and transaminases were assessed as an indicator of distant organ IRI. Intestinal IRI led to an increased expression of pro-inflammatory cytokines in the gut tissue and an influx of leukocytes that predominantly consisted of neutrophils and macrophages. Furthermore, intestinal IRI increased serum IL-6, TNF-α, and ALT/AST levels. The αβ T cell-deficient mice did not exhibit a more significant increase in pro-inflammatory cytokines in the gut or serum following IR than the WT mice. There was also no difference between WT- and αβ T cell-deficient mice in terms of neutrophil infiltration or macrophage activation. Furthermore, the increase in transaminases was equal in both groups indicating that the level of distant organ injury was comparable. An increasing body of evidence demonstrates that αβ T cells play a key role in IRI. In the gut, however, αβ T cells are not pivotal in the first hours following acute IRI as deficiency does not impact cytokine production, neutrophil recruitment, macrophage activation, or distant organ injury. Thus, αβ T cells may be considered innocent bystanders during the acute phase of intestinal IRI.

  17. Conventional alpha beta (αβ T cells do not contribute to acute intestinal ischemia-reperfusion injury in mice.

    Directory of Open Access Journals (Sweden)

    Yi Yu

    Full Text Available Ischemia-reperfusion injury (IRI is associated with significant patient mortality and morbidity. The complex cascade of IRI is incompletely understood, but inflammation is known to be a key mediator. In addition to the predominant innate immune responses, previous research has also indicated that αβ T cells contribute to IRI in various organ models. The aim of this study was to clarify the role αβ T cells play in IRI to the gut.Adult wild-type (WT and αβ T cell-deficient mice were subjected to acute intestinal IRI with 30min ischemia followed by 4h reperfusion. The gene expression of pro-inflammatory cytokines was measured by qPCR, and the influx of leukocyte subpopulations in the gut was assessed via flow cytometry and histology. Pro-inflammatory cytokines in the serum were measured, and transaminases were assessed as an indicator of distant organ IRI.Intestinal IRI led to an increased expression of pro-inflammatory cytokines in the gut tissue and an influx of leukocytes that predominantly consisted of neutrophils and macrophages. Furthermore, intestinal IRI increased serum IL-6, TNF-α, and ALT/AST levels. The αβ T cell-deficient mice did not exhibit a more significant increase in pro-inflammatory cytokines in the gut or serum following IR than the WT mice. There was also no difference between WT- and αβ T cell-deficient mice in terms of neutrophil infiltration or macrophage activation. Furthermore, the increase in transaminases was equal in both groups indicating that the level of distant organ injury was comparable.An increasing body of evidence demonstrates that αβ T cells play a key role in IRI. In the gut, however, αβ T cells are not pivotal in the first hours following acute IRI as deficiency does not impact cytokine production, neutrophil recruitment, macrophage activation, or distant organ injury. Thus, αβ T cells may be considered innocent bystanders during the acute phase of intestinal IRI.

  18. Effectiveness of mesenchymal stems cells cultured by hanging drop vs. conventional culturing on the repair of hypoxic-ischemic-damaged mouse brains, measured by stemness gene expression

    Directory of Open Access Journals (Sweden)

    Lou Yongli

    2016-01-01

    Full Text Available In this study, we investigated the therapeutic effects of Human Mesenchymal Stem Cells (hMSCs cultured by hanging drop and conventional culturing methods on cerebellar repair in hypoxic-ischemic (HI brain injured mice. Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR was used to analyze the expression levels of three stemness genes, Oct4, Sox2 and Nanog, and the migration related gene CXCR4. MSC prepared by hanging drop or conventional techniques were administered intranasally to nine day old mice, and analyzed by MRI at day 28. Results indicate that the MSCs, especially the hanging drop cultured MSCs, significantly improved the mice’s cerebellar damage repair. MSCs derived from the hanging drop culture were smaller than those from the conventional culture. The gene expression levels were significantly increased for the MSCs derived from the hanging drop culture. The mechanism might relate to the fact that the hanging drop cultured MSCs can be kept in an undifferentiated state, resulting in its higher expression level of migration receptor of CXCR4.

  19. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  20. Cyclooxygenase-2 mediated regulation of E-cadherin occurs in conventional but not early-onset gastric cancer cell lines

    NARCIS (Netherlands)

    Sitarz, R.; Leguit, R. J.; de Leng, W. W. J.; Morsink, F. H. M.; Polkowski, W. P.; Maciejewski, R.; Offerhaus, G. J. A.; Milne, A. N.

    2009-01-01

    COX-2 and E-cadherin, involved in invasion and metastasis, are molecules critical for gastric carcinogenesis. A relationship between them is documented in non-small cell lung and prostate cancer. We present novel evidence of a relationship between COX-2 and E-cadherin expression in gastric cancer.

  1. Allograft tolerance in pigs after fractionated lymphoid irradiation. II. Kidney graft after conventional total lymphoid irradiation and bone marrow cell grafting

    International Nuclear Information System (INIS)

    Fradelizi, D.; Mahouy, G.; de Riberolles, C.; Lecompte, Y.; Alhomme, P.; Douard, M.C.; Chotin, G.; Martelli, H.; Daburon, F.; Vaiman, M.

    1981-01-01

    Experiments with pigs have been performed in order to establish bone marrow chimerism and kidney graft tolerance between SLA genotyped semi-incompatible animals. Recipients were conditioned by means of conventional fractionated total lymphoid irradiation (TLI) delivered by a vertical cobalt source. The principal lymphoid regions of the pig, including thymus and spleen, were submitted to irradiation. Two protocols were tested: A = 250 cGy four times a week x 13 times (TLI) (two animals) and B = 350 cGy three times a week x 8 times (TLI) (four animals). Bone marrow cells were injected 24 h after the last irradiation. One day later, bilateral nephrectomy and the graft of one kidney from the bone marrow cell donor were performed simultaneously. Results convinced us that application of the TLI protocol to humans is not yet practicable and that further experimental work is needed

  2. Effect of vitrification on number of inner cell mass in mouse blastocysts in conventional straw, closed pulled straw, open pulled straw and cryoloop carriers

    International Nuclear Information System (INIS)

    Ghasem, S.; Negar, K.

    2013-01-01

    Objective: To compare the effect of using open and closed carriers on count of inner cell mass in vitrified mouse blastocyst after warming. Methods: The experimental study was conducted at Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, from April to September 2010. Forty female NMRI (Naval Medical Research Institute, USA) mice were injected with pregnant mares serum gonadotropin and human chorionic gonadotropin in order to induce super ovulation. Following the latter injection, two or three females were caged with the same-breed male mice. The presence of vaginal plug was examined the following morning. To collect blastocyst embryos, the pregnant females were sacrificed by cervical dislocation at 88-90 hours after the injection and dissected. Blastocysts were collected in phosphate-buffered saline and allocated to four groups: vitrification in conventional straw, closed pulled straw, open pulled straw and cryoloop. The vitrification solution was ethylene glycol, Ficol and sucrose (EFS) 20% and 40%. After storage for 1 month in liquid nitrogen, the blastocysts were thawed in 0.5 M sucrose then cultured in M16 medium. After 6 hours of culture, the number of expanded blastocysts was recorded and stained by double-dye technique. After staining, the number of total cell and inner cell mass was calculated. Results: The re-expansion rate of blastocysts in the cryoloop group (n=90; 78.26%) was significantly higher (p<0.05) than open pulled straw (n=83; 69.16%), closed pulled straw (n=68; 54.83%) and conventional straws (n=63; 51.21%) groups. Significant differences (p<0.05) in the number of inner cell mass in blastocysts vitrified in open pulled straws, closed straws and cryoloop with blastocysts cryopreserved in conventional straws. Conclusion: The re-expansion rate and total cell number of mouse blastocysts vitrified using open system had a better result compared with the closed system. The value of cryoloop and open pulled straws as carriers in

  3. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  4. Immunofluorescent histological studies of the role of fibronectin in the expression of the associative preferences of embryonic tissues.

    Science.gov (United States)

    Armstrong, P B; Armstrong, M T

    1981-08-01

    The identity of the chemical factors controlling the spreading behaviour of sheets of cells was examined in organ culture. When aggregates of two dissimilar tissues are apposed in organ culture, one tissue spreads reproducibly over the surface of the second. The present study employed indirect immunofluorescent localization techniques to evaluate the hypothesis that the spreading behaviour of chick embryonic heart tissue in culture is dominated by the presence or absence of the cell-surface and extracellular matrix protein fibronectin in the surface layers of the aggregates. Specifically, the hypothesis proposes that aggregates that display surface fibronectin earlier after culturing and/or in higher quantities segregate internally to aggregates that are slower to develop a surface layer of fibronectin or in which this layer contains reduced amounts of fibronectin. The hypothesis has been supported for 3 categories of behaviour of chick embryo heart tissue: (1) myocyte aggregates spread over myocyte aggregates containing a 20% admixture of heart fibroblasts, which in turn spread over heart fibroblast aggregates; (2) 5-day embryonic ventricle-tissue fragments maintained in culture for 0.5 days spread over ventricle fragments cultured for 2.5 days; and (3) 2-day embryonic ventricle spreads over 5-day ventricle. In all these situations, the aggregate type that segregates to an internal position displays more fibronectin at its surface than aggregate types that spread to occupy an external position. Evidence is presented that the fibronectin in heart tissue aggregates is elaborated by heart fibroblasts.

  5. A Comparison of Anti-Nuclear Antibody Quantification Using Automated Enzyme Immunoassays and Immunofluorescence Assays

    DEFF Research Database (Denmark)

    Baronaite, Renata; Engelhart, Merete; Mørk Hansen, Troels

    2014-01-01

    using IFA and automated EIA techniques. The IFA results generated by two independent laboratories were compared with the EIA results from antibodies against double-stranded DNA (dsDNA), from ANA screening, and from tests of the seven included subantigens. The final IFA and EIA results for 386 unique......, with Cohen's kappa value of 0.30 (95% confidence interval (CI) = 0.14-0.46), which decreased to 0.23 (95% CI = 0.06-0.40) when the results for dsDNA were omitted. The EIA method was less reliable for assessing nuclear and speckled reactivity patterns, whereas the IFA method presented difficulties detecting...... dsDNA and Ro activity. The automated EIA method was performed in a similar way to the conventional IFA method using HEp-2 cells; thus, automated EIA may be used as a screening test....

  6. Retrospective analysis of chronomodulated chemotherapy versus conventional chemotherapy with paclitaxel, carboplatin, and 5-fluorouracil in patients with recurrent and/or metastatic head and neck squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Chen D

    2013-10-01

    Full Text Available Dan Chen, Jue Cheng, Kai Yang, Yue Ma, Fang Yang Department of Oral and Maxillofacial Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing, People's Republic of China Background: Chronomodulated chemotherapy has emerged as a new therapy as a result of recent studies focusing on the biological clock. It has been demonstrated that combination chronomodulated chemotherapy of platinum-based drugs and 5-fluorouracil (5-Fu can significantly improve efficacy and reduce the incidence of adverse events in patients with metastatic colorectal cancer, as compared with conventional chemotherapy. However, the results may be different in different tumors. Recurrent and metastatic head and neck squamous cell carcinoma (HNSCC is very difficult to treat, with an extremely unfavorable prognosis. So far, no report is available on chronomodulated chemotherapy for HNSCC. Methods: Retrospective analyses were made on 49 patients with local recurrent and/or metastatic HNSCC who underwent palliative treatments with paclitaxel, carboplatin, and 5-Fu. The patients were divided into a chronomodulated chemotherapy group (28 patients and a conventional chemotherapy group (21 patients according to their administration times. The two groups were compared for tumor objective response rate, overall survival (OS, progression-free survival (PFS, and the incidence of adverse events. Results: The tumor objective response rate and patients' OS were significantly higher and longer in the chronomodulated chemotherapy group than in the conventional chemotherapy group (71.43% versus 42.86%, respectively, P0.05. The global incidence of adverse events in the chronomodulated chemotherapy group was significantly lower than that in the conventional chemotherapy group (46.43% versus 76.19%, P<0.05, with significantly lower incidence of grade 3–4 adverse events (7.14% versus 33.33%, P<0.05. Conclusion: Chronomodulated chemotherapy with paclitaxel, carboplatin, and

  7. Superior induction of T cell responses to conserved HIV-1 regions by electroporated alphavirus replicon DNA compared to that with conventional plasmid DNA vaccine.

    Science.gov (United States)

    Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter

    2012-04-01

    Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.

  8. Conventional clinical and prognostic variables in 150 oral squamous cell carcinoma cases from the indigenous population of Karachi.

    Science.gov (United States)

    Alamgir, Muhammad Mohiuddin; Jamal, Qamar; Mirza, Talat

    2016-01-01

    To analyze clinical and prognostic variables of Oral Squamous Cell Carcinoma (OSCC) cases from the indigenous population of Karachi and to correlate with the common risk factor of tobacco habit. The study was conducted at Ziauddin University, Karachi. One hundred fifty OSCC cases were collected from the Oncology Department of Ziauddin University Hospital, North Nazimabad, Karachi and Otolaryngology ward of Civil Hospital, Karachi, during 2011 and 2015. The reporting included demographic details and variables like intra-oral subsites, clinical stage and histological grade. Recurrence of tumor after initial resection was also documented. The patient's population comprised of 98 males and 52 females. The mean age was 47.1± 12.22 (range:20-78 years). Maximum numbers were seen in the 41-50 years age group. Urdu-speaking community was the most affected ethnic group (n=75). Clinico-pathological analysis revealed that majority of cases were moderately differentiated (59%) and were either clinical stage II (35%) or IV (29%) tumors. The most common intra-oral subsite came out to be buccal mucosa of cheeks (56%) followed by lateral borders of tongue (21%), lips (13%), alveolar (6%), palate (2.6%) floor of mouth (1.3%), etc. Recurrence was observed in 08 out of 150 cases. All patients underwent primary resection±neck dissection and reconstruction where possible. Overall experience with oral squamous cell carcinoma shows that it has a high tendency for local invasion as well as dissemination to regional lymph nodes, i.e. cervical lymph nodes, both are associated with a poor prognosis. Preventable risk factor of tobacco chewing has been observed in majority of these cases.

  9. Analysis of prognostic factors in patients with non-small cell lung cancer treated conventional radical teleradiotherapy

    International Nuclear Information System (INIS)

    Pluta, E.

    2007-01-01

    Radical surgery is the treatment of choice in non-small cell lung cancer, however, only about 20-30% of patients with early stage of disease (stage I, II and possibly IIIA) qualify for it. For the remaining patients, unable to tolerate surgery because of underlying medial disease, advanced age, respiratory insufficiency, or those who refused to undergo operation, radiation therapy is a clinically accepted alternative. Five - year survival for patients receiving radical radiation treatment alone ranges from 12-32%. We reviewed the records of 227 patients with inoperable non-small cell lung cancer, treated in our Institute between 1970-1990. In our group: 40% patients have unresectable tumor, 21% had bad pulmonary function tests results, 15% had cardiac risk, 6% were over 76 years of age, and 18% refused to agree to surgery. Treatment was delivered using megavoltage irradiation in doses ranging from 60 to 72 Gy. The survival probability was calculated by the Kaplan-Meier method. Overall survival (OS) probability at two years was 34% and at five years - 10%. Two - years local control was observed in 54% and five-year in 41%. The disease - specific survival (DSS) rates at 2 and 5 years were 30% and 8% respectively. The significant favorable prognostic factor for DSS and OS were tumor size (T1,T2, N0) and early stage (I), no weight loss, and complete radiological regression of the tumor 8 weeks after irradiation. The significant favorable prognostic factors for local control were good performance status (over 80 points acc. to Karnofsky scale), no weight loss, early stage (I), and complete radiological regression of the tumor 8 weeks after irradiation. 1. New therapeutic strategies involving chemotherapy should be considered for larger tumors (T2, T3, N1, N2). 2. Patients with a good performance status and small tumor (T1N0, T2N0) would benefit most from treatment with radiation alone. (author)

  10. Immunofluorescence in multiple tissues utilizing serum from a patient affected by systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Piotr Brzezinski

    2012-01-01

    Full Text Available Introduction: Lupus erythematosus is a chronic, inflammatory autoimmune disease that can affect multiple organs. Lupus can affect many parts of the body, especially in systemic lupus erythematosus (SLE; affected tissues may include the joints, skin, kidneys, heart, lungs, blood vessels, and brain. Case report: A 46-year-old female presented with pruritus, photosensitivity and edema of the cheeks of about 2 years duration, and was evaluated by a dermatologist. On examination, multiple telangiectasias were present on the cheeks, with erythema, edema and a malar rash observed. A review of systems documented breathing difficulty and pleuitic pain, joint pain and joint edema, photosensitivity, cardiac dysrhythmia, and periodic pain in the back close to the kidneys. Methods: Skin biopsies for hematoxylin and eosin testing, as well for direct and indirect immunofluorescence were performed, in addition to multiple diagnostic blood tests, chest radiography and directed immunologic testing. Results: The blood testing showed elevated C-reactive protein. Direct and indirect immunofluorescence testing utilizing monkey esophagus, mouse and pig heart and kidney, normal human eyelid skin and veal brain demonstrated strong reactivity to several components of smooth muscle, nerves, blood vessels, skin basement membrane zone and sweat gland ducts and skin meibomian glands. Anti-endomysium antibodies were detected as well as others, especially using FITC conjugated Complement/C1q, FITC conjugated anti-human immunoglobulin IgG and FITC conjugated anti-human fibrinogen. Conclusions: We conclude that both direct and indirect immunofluorescence using several substrates can unveil previously undocumented autoantibodies in multiple organs in lupus erythematosus, and that these findings could be utilized to complement existing diagnostic testing for this disorder.

  11. Concurrent radiotherapy and carboplatin in non small-cell lung cancer: a pilot study using conventional and accelerated fractionation

    International Nuclear Information System (INIS)

    Ball, D.; Bishop, J.; Crennan, E.; Olver, I.

    1991-01-01

    Thirteen patients with unresectable non small cell lung cancer were treated with radical radiotherapy and carboplatin administered in order to ascertain the toxicity of concurent carboplatin/radiotherapy. The first 6 patients were treated to a total dose of 60 Gy in 30 fractions in 6 weeks, with carboplatin 70 mg/m 2 /day on days 1 to 5 during weeks 1 and 5 of radiotherapy. The remaining 7 patients were given 60 Gy in 30 fractions in 3 weeks, treating twice a day (accelerated fractionation). Carboplatin was given as above but only during week 1 of radiotherapy. Twelve patients completed radiotherapy without interruption but 2 patients developed grade 3 neutropenia. Major toxicity was oesophagitis, one patient requiring nasogastric feeding. Average duration of dysphagia (any grade) in the accelerated fractionation group was 21 weeks. Four patients achieved good partial responses even though initial tumour volume was large. It is concluded that this treatment is associated with increased but acceptable early mucosal toxicity. 6 refs., 1 tab., 1 fig

  12. Atomic Layer Deposition on Porous Materials: Problems with Conventional Approaches to Catalyst and Fuel Cell Electrode Preparation

    Directory of Open Access Journals (Sweden)

    Tzia Ming Onn

    2018-03-01

    Full Text Available Atomic layer deposition (ALD offers exciting possibilities for controlling the structure and composition of surfaces on the atomic scale in heterogeneous catalysts and solid oxide fuel cell (SOFC electrodes. However, while ALD procedures and equipment are well developed for applications involving flat surfaces, the conditions required for ALD in porous materials with a large surface area need to be very different. The materials (e.g., rare earths and other functional oxides that are of interest for catalytic applications will also be different. For flat surfaces, rapid cycling, enabled by high carrier-gas flow rates, is necessary in order to rapidly grow thicker films. By contrast, ALD films in porous materials rarely need to be more than 1 nm thick. The elimination of diffusion gradients, efficient use of precursors, and ligand removal with less reactive precursors are the major factors that need to be controlled. In this review, criteria will be outlined for the successful use of ALD in porous materials. Examples of opportunities for using ALD to modify heterogeneous catalysts and SOFC electrodes will be given.

  13. Early mortality after radical radiotherapy for non-small-cell lung cancer: comparison of PET-staged and conventionally staged cohorts treated at a large tertiary referral center

    International Nuclear Information System (INIS)

    Mac Manus, Michael P.; Wong, Kevin; Hicks, Rodney J.; Matthews, Jane P.; Wirth, Andrew; Ball, David L.

    2002-01-01

    Purpose: At our center, approximately 30% of radical radiotherapy (RRT) candidates become ineligible for RRT for non-small-cell lung cancer (NSCLC) after positron emission tomography (PET). We hypothesized that early cancer death rates would be lower in patients receiving RRT after PET staging compared with conventionally staged patients. Methods and Materials: Two prospective cohorts were compared. Cohort 1 consisted of all participants in an Australian randomized trial from our center given 60 Gy conventionally fractionated RRT with or without concurrent carboplatin from 1989 to 1995. Eligible patients had Stage I-III, Eastern Cooperative Oncology Group status 0 or 1, <10% weight loss, and had not undergone PET. Cohort 2 included all RRT candidates between November 1996 and April 1999 who received RRT after PET staging and fulfilled the above criteria for stage, Eastern Cooperative Oncology Group status, and weight loss. Results: Eighty and 77 eligible patients comprised the PET and non-PET groups, respectively. The PET-selected patients had significantly less weight loss; 73% and 49% of the PET and non-PET patients, respectively, received chemotherapy. The median survival was 31 months for PET patients and 16 months for non-PET patients. Mortality from NSCLC and other causes in the first year was 17% and 8% for PET patients and 32% and 4% for non-PET patients, respectively. The hazard ratio for NSCLC mortality for PET vs. non-PET patients was 0.49 (p=0.0016) on unifactorial analysis and was 0.55 (p = 0.0075) after adjusting for chemotherapy, which significantly improved survival. Conclusion: Patients selected for RRT after PET have lower early cancer mortality than those selected using conventional imaging

  14. Development of immunofluorescence colony staining (IFC) for detection of Xanthomonas campestris pv. vesicatoria and Clavibacter michiganensis subsp michiganensis in tomato seeds

    NARCIS (Netherlands)

    Nemeth, J.; Vuurde, van J.W.L.

    2006-01-01

    Immunofluorescence colony-staining (IFC) is based on sample pour plating in combination with immunofluorescence staining for recognition of the target colony. IFC was optimised for detecting Xanthomonas campestris pv. vesicatoria (Xcv) and Clavibacter michiganensis subsp. michiganensis (Cmm) in

  15. Nail unit in collagen vascular diseases: A clinical, histopathological and direct immunofluorescence study

    Directory of Open Access Journals (Sweden)

    Nabil P

    2006-01-01

    Full Text Available Background: Abnormalities of the nail unit are common in patients with connective tissue diseases. Clinical examination of the nail unit, coupled with biopsy of proximal nail fold offers an additional advantage in the diagnosis. Purpose: Our aim was to record clinical changes of the nail unit in connective tissue diseases and to study the histopathological (both H and E and periodic acid Schiff and direct immunofluorescence (DIF findings of nail-fold biopsy. Materials and Methods: Thirty-eight confirmed cases connective tissue diseases attending skin OPD were enrolled in the study. After detailed clinical examination of the nail unit, a crescentric biopsy was taken from the proximal nail fold (PNF. Histopathological and DIF studies were was carried out. Findings: Nail changes could be demonstrated in 65% connective tissue diseases. Specific histopathological (H and E and immunofluorescence findings were also encountered in many patients. Conclusion: Clinical examination of the nail unit offers additional clue in the diagnosis of connective tissue diseases. Though DIF of PNF biopsy is useful in the diagnosis, it is not an ideal site for H and E study, as the yield is very low. Limitations: Lack of adequate comparison group and non-utilization of capillary microscopy for the detection of nail fold capillary abnormalities.

  16. Kidney lesions in Rocky Mountain spotted fever: a light-, immunofluorescence-, and electron-microscopic study.

    Science.gov (United States)

    Bradford, W. D.; Croker, B. P.; Tisher, C. C.

    1979-01-01

    The essential pathologic lesion in Rocky Mountain spotted fever (RMSF) is a vasculitis that may involve the kidneys as well as the heart, brain, skin, and subcutaneous tissues. Histopathologic information concerning the response of the kidneys in RMSF is rather limited, however. In this study renal tissue from 17 children who died of RMSF was examined by light, electron, and immunofluorescence microscopy. A lymphocytic or mixed inflammation, or both, involving vessels and interstitium of the kidney was found in all patients. In addition, 10 patients had histologic evidence of acute tubular necrosis, and another 3 had glomerular lesions consisting of focal segmental tuft necrosis or increased cellularity secondary to neutophilic infiltration, or both. Immunofluorescence- and electron-microscopic studies failed to demonstrate immune-complex deposition within glomeruli, a finding that suggests that immunoglobulin and classic immune complexes were not involved in the pathogenesis of the renal lesions at the time of death. These findings suggest the possibility that the pathogenesis of the renal lesion in RMSF may be due to a direct action of the organism (Rickettsia rickettsii) on the vessel wall. Images Figure 2 Figure 1 PMID:525676

  17. Choice of Illumination System & Fluorophore for Multiplex Immunofluorescence on FFPE Tissue Sections.

    Directory of Open Access Journals (Sweden)

    Sandrine Prost

    Full Text Available The recent availability of novel dyes and alternative light sources to facilitate complex tissue immunofluorescence studies such as multiplex labelling has not been matched by reports critically evaluating the considerations and relative benefits of these new tools, particularly in combination. Product information is often limited to wavelengths used for older fluorophores (FITC, TRITC & corresponding Alexa dyes family. Consequently, novel agents such as Quantum dots are not widely appreciated or used, despite highly favourable properties including extremely bright emission, stability and potentially reduced tissue autofluorescence at the excitation wavelength. Using spectral analysis, we report here a detailed critical appraisal and comparative evaluation of different light sources and fluorophores in multiplex immunofluorescence of clinical biopsy sections. The comparison includes mercury light, metal halide and 3 different LED-based systems, using 7 Qdots (525, 565, 585, 605, 625, 705, Cy3 and Cy5. We discuss the considerations relevant to achieving the best combination of light source and fluorophore for accurate multiplex fluorescence quantitation. We highlight practical limitations and confounders to quantitation with filter-based approaches.

  18. Original Approach for Automated Quantification of Antinuclear Autoantibodies by Indirect Immunofluorescence

    Directory of Open Access Journals (Sweden)

    Daniel Bertin

    2013-01-01

    Full Text Available Introduction. Indirect immunofluorescence (IIF is the gold standard method for the detection of antinuclear antibodies (ANA which are essential markers for the diagnosis of systemic autoimmune rheumatic diseases. For the discrimination of positive and negative samples, we propose here an original approach named Immunofluorescence for Computed Antinuclear antibody Rational Evaluation (ICARE based on the calculation of a fluorescence index (FI. Methods. We made comparison between FI and visual evaluations on 237 consecutive samples and on a cohort of 25 patients with SLE. Results. We obtained very good technical performance of FI (95% sensitivity, 98% specificity, and a kappa of 0.92, even in a subgroup of weakly positive samples. A significant correlation between quantification of FI and IIF ANA titers was found (Spearman's ρ=0.80, P<0.0001. Clinical performance of ICARE was validated on a cohort of patients with SLE corroborating the fact that FI could represent an attractive alternative for the evaluation of antibody titer. Conclusion. Our results represent a major step for automated quantification of IIF ANA, opening attractive perspectives such as rapid sample screening and laboratory standardization.

  19. Characterisation of L-Type Amino Acid Transporter 1 (LAT1 Expression in Human Skeletal Muscle by Immunofluorescent Microscopy

    Directory of Open Access Journals (Sweden)

    Nathan Hodson

    2017-12-01

    Full Text Available The branch chain amino acid leucine is a potent stimulator of protein synthesis in skeletal muscle. Leucine rapidly enters the cell via the L-Type Amino Acid Transporter 1 (LAT1; however, little is known regarding the localisation and distribution of this transporter in human skeletal muscle. Therefore, we applied immunofluorescence staining approaches to visualise LAT1 in wild type (WT and LAT1 muscle-specific knockout (mKO mice, in addition to basal human skeletal muscle samples. LAT1 positive staining was visually greater in WT muscles compared to mKO muscle. In human skeletal muscle, positive LAT1 staining was noted close to the sarcolemmal membrane (dystrophin positive staining, with a greater staining intensity for LAT1 observed in the sarcoplasmic regions of type II fibres (those not stained positively for myosin heavy-chain 1, Type II—25.07 ± 5.93, Type I—13.71 ± 1.98, p < 0.01, suggesting a greater abundance of this protein in these fibres. Finally, we observed association with LAT1 and endothelial nitric oxide synthase (eNOS, suggesting LAT1 association close to the microvasculature. This is the first study to visualise the distribution and localisation of LAT1 in human skeletal muscle. As such, this approach provides a validated experimental platform to study the role and regulation of LAT1 in human skeletal muscle in response to various physiological and pathophysiological models.

  20. Modified vaccinia virus Ankara triggers type I IFN production in murine conventional dendritic cells via a cGAS/STING-mediated cytosolic DNA-sensing pathway.

    Directory of Open Access Journals (Sweden)

    Peihong Dai

    2014-04-01

    Full Text Available Modified vaccinia virus Ankara (MVA is an attenuated poxvirus that has been engineered as a vaccine against infectious agents and cancers. Our goal is to understand how MVA modulates innate immunity in dendritic cells (DCs, which can provide insights to vaccine design. In this study, using murine bone marrow-derived dendritic cells, we assessed type I interferon (IFN gene induction and protein secretion in response to MVA infection. We report that MVA infection elicits the production of type I IFN in murine conventional dendritic cells (cDCs, but not in plasmacytoid dendritic cells (pDCs. Transcription factors IRF3 (IFN regulatory factor 3 and IRF7, and the positive feedback loop mediated by IFNAR1 (IFN alpha/beta receptor 1, are required for the induction. MVA induction of type I IFN is fully dependent on STING (stimulator of IFN genes and the newly discovered cytosolic DNA sensor cGAS (cyclic guanosine monophosphate-adenosine monophosphate synthase. MVA infection of cDCs triggers phosphorylation of TBK1 (Tank-binding kinase 1 and IRF3, which is abolished in the absence of cGAS and STING. Furthermore, intravenous delivery of MVA induces type I IFN in wild-type mice, but not in mice lacking STING or IRF3. Treatment of cDCs with inhibitors of endosomal and lysosomal acidification or the lysosomal enzyme Cathepsin B attenuated MVA-induced type I IFN production, indicating that lysosomal enzymatic processing of virions is important for MVA sensing. Taken together, our results demonstrate a critical role of the cGAS/STING-mediated cytosolic DNA-sensing pathway for type I IFN induction in cDCs by MVA. We present evidence that vaccinia virulence factors E3 and N1 inhibit the activation of IRF3 and the induction of IFNB gene in MVA-infected cDCs.

  1. Forkhead-Box-P3 Gene Transfer in Human CD4+ T Conventional Cells for the Generation of Stable and Efficient Regulatory T Cells, Suitable for Immune Modulatory Therapy

    Directory of Open Access Journals (Sweden)

    Laura Passerini

    2017-10-01

    Full Text Available The development of novel approaches to control immune responses to self- and allogenic tissues/organs represents an ambitious goal for the management of autoimmune diseases and in transplantation. Regulatory T cells (Tregs are recognized as key players in the maintenance of peripheral tolerance in physiological and pathological conditions, and Treg-based cell therapies to restore tolerance in T cell-mediated disorders have been designed. However, several hurdles, including insufficient number of Tregs, their stability, and their antigen specificity, have challenged Tregs clinical applicability. In the past decade, the ability to engineer T cells has proven a powerful tool to redirect specificity and function of different cell types for specific therapeutic purposes. By using lentivirus-mediated gene transfer of the thymic-derived Treg transcription factor forkhead-box-P3 (FOXP3 in conventional CD4+ T cells, we converted effector T cells into Treg-like cells, endowed with potent in vitro and in vivo suppressive activity. The resulting CD4FOXP3 T-cell population displays stable phenotype and suppressive function. We showed that this strategy restores Treg function in T lymphocytes from patients carrying mutations in FOXP3 [immune-dysregulation, polyendocrinopathy, enteropathy, X-linked (IPEX], in whom CD4FOXP3 T cell could be used as therapeutics to control autoimmunity. Here, we will discuss the potential advantages of using CD4FOXP3 T cells for in vivo application in inflammatory diseases, where tissue inflammation may undermine the function of natural Tregs. These findings pave the way for the use of engineered Tregs not only in IPEX syndrome but also in autoimmune disorders of different origin and in the context of stem cell and organ transplantation.

  2. High-dose myeloablative versus conventional low-dose radioimmunotherapy (RIT) of mantle cell lymphoma (MCL) with the chimeric anti-CD20 antibody C2B8

    International Nuclear Information System (INIS)

    Behr, T.M.; Gotthardt, M.; Schipperm, M.L.; Gratz, S.; Behe, M.P.; Brittinger, G.; Woermann, B.; Becker, W.

    2002-01-01

    CD20 has been used as target molecule for low-dose as well as high-dose, myeloablative RIT of B-cell NHL. MCL is an especially aggressive, prognostically unfavorable form of B-cell NHL. The aim of this study was to investigate whether high-dose, myeloablative RIT with the 131 I-labeled chimeric anti-CD20 antibody C2B8 (rituxan, Mabthera, Roche) may be therapeutically more effective than conventional low-dose therapy in MCL. A total of twelve patients with chemorefractory or relapsed mantle cell lymphoma were studied so far (all of them having relapsed after high-dose chemotherapy, seven of them combined with 12 Gy TBI). A diagnostic-dosimetric study was performed with 10 mCi of 131 I-C2B8 at a protein dose of 2.5 mg/kg. In case of splenic pooling, the protein dose was increased until a more 'favorable' biodistribution was obtained. Therapy was performed with conventional (30-75 mCi; n=4) or myeloablative activities (261-515 mCi; n=8) of 131 I-C2B8 at the previously optimized protein dose, aiming at whole-body doses of ≤ 0.8 Gy (for low-dose RIT) or lung doses of ≤ 27 Gy (for high-dose RIT). Clinical follow-up was obtained for up to 42 months. Overall, in 11 patients the 2.5 mg/kg protein dose was used, whereas in one patient with marked splenomegaly, 10 mg/kg were necessary to overcome the splenic antigenic sink. In the high-dose patients, non-hematologic toxicity was restricted to mild to moderate nausea, fever, transient bilirubin or liver enzyme elevations. Despite thyroid blocking, 6/8 high-dose (in contrast to 0/4 low-dose) patients developed hypothyroidism, requiring thyroxine substitution at 6-18 months after RIT. The response rate in the low-dose arm was only 1(PR)/4, whereas 7/8 high-dose patients experienced complete and the remainder a partial remission. 6 high-dose patients are still in CR (one of them relapsed locally at 3 months, one systemically at 26 months after RIT), and 7 are still alive for up to 42+ months. In contrast to low-dose therapy

  3. Comparative determination of the rheumatic factor by means of agglutination, immunofluorescence and radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Jaeger, L.; Storz, H.; Hein, G.; Schlenvoigt, G. (Friedrich-Schiller-Universitaet, Jena (German Democratic Republic). Bereich Medizin)

    1982-01-01

    The rheumatic factor (RF) was determined by means of agglutination, immunofluorescence (IF) test and radioimmunoassay (RIPEGA) in random groups of 56 patients with rheumatoid arthritis (RA), 13 patients with seronegative RA and 39 patients with psoriasis arthropathica. All three methods are of equal value with regard to the number of positive results. Further classification of seronegative patients, i.e. patients with a negative agglutination reaction and the clinical symptoms of RA is possible with the IF method and, above all, by means of RIPEGA. But because of the comprehensive test devices the two methods are only an alternative. Titer differences are attributed to the different indication principles and the immunological heterogeneity of RF. An improvement of the diagnosis of activity was not possible.

  4. Comparative determination of the rheumatic factor by means of agglutination, immunofluorescence and radioimmunoassay

    International Nuclear Information System (INIS)

    Jaeger, L.; Storz, H.; Hein, G.; Schlenvoigt, G.

    1982-01-01

    The rheumatic factor (RF) was determined by means of agglutination, immunofluorescence (IF) test and radioimmunoassay (RIPEGA) in random groups of 56 patients with rheumatoid arthritis (RA), 13 patients with seronegative RA and 39 patients with psoriasis arthropathica. All three methods are of equal value with regard to the number of positive results. Further classification of seronegative patients, i.e. patients with a negative agglutination reaction and the clinical symptoms of RA is possible with the IF method and, above all, by means of RIPEGA. But because of the comprehensive test devices the two methods are only an alternative. Titer differences are attributed to the different indication principles and the immunological heterogeneity of RF. An improvement of the diagnosis of activity was not possible. (author)

  5. Evaluation of a Direct Immunofluorescent Assay and/or Conjunctival Cytology for Detection of Canine Distemper Virus Antigen.

    Science.gov (United States)

    Athanasiou, Labrini V; Kantere, Maria C; Kyriakis, Constantinos S; Pardali, Dimitra; Adamama Moraitou, Katerina; Polizopoulou, Zoe S

    2018-04-01

    Canine distemper is a common and potentially lethal multisystemic disease caused by the Canine distemper virus (CDV). We evaluated the diagnostic performance of direct immunofluorescent assay (FA) and cytology to detect CDV antigen in conjunctival cells compared with an established polymerase chain reaction (PCR) detection assay used as a gold standard for CDV diagnosis. Samples were collected from 57 young dogs presenting with central nervous system signs compatible with distemper disease. Exfoliative epithelial cells were collected from the right and left conjunctiva of each animal using nylon-bristled cytobrushes for cytology and cotton swabs for FA and PCR. For the direct FA, samples were stained with anti-CDV polyclonal antiserum conjugated to fluorescein isothiocyanate and imaged using a fluorescent microscope. Out of 57 dogs tested, 19 were PCR positive (15 positive in direct FA and 4 positive in cytology, including one that was negative by PCR), whereas 37 dogs were negative in all methods. A good agreement was observed between the FA and PCR, with a κ-value of 0.833 (95% CI: 0.678-0.989). Meanwhile, there was poor agreement between cytology and PCR (κ-value of 0.164; 95% CI: -0.045 to 0.373) and a fair agreement between FA and cytology (κ-value of 0.231; 95% CI: -0.026 to 0.487). Our results indicated a poor performance of cytology for the detection of CDV antigen. In contrast, FA is a 100% specific and an adequately sensitive assay (sensitivity: 78.95%, negative likelihood ratio: 0.21, 95% CI: 0.09-0.50) for antemortem diagnosis of canine distemper.

  6. Investigation of sulfur interactions on a conventional nickel-based solid oxide fuel cell anode during methane steam and dry reforming

    Science.gov (United States)

    Jablonski, Whitney S.

    Solid oxide fuel cells (SOFC) are an attractive energy source because they do not have undesirable emissions, are scalable, and are feedstock flexible, which means they can operate using a variety of fuel mixtures containing H2 and hydrocarbons. In terms of fuel flexibility, most potential fuel sources contain sulfur species, which severely poison the nickel-based anode. The main objective of this thesis is to systematically evaluate sulfur interactions on a conventional Ni/YSZ anode and compare sulfur poisoning during methane steam and dry reforming (SMR and DMR) to a conventional catalyst (Sud Chemie, Ni/K2O-CaAl2O4). Reforming experiments (SMR and DMR) were carried out in a packed bed reactor (PBR), and it was demonstrated that Ni/YSZ is much more sensitive to sulfur poisoning than Ni/K2O-CaAl2O4 as evidenced by the decline in activity to zero in under an hour for both SMR and DMR. Adsorption and desorption of H2S and SO2 on both catalysts was evaluated, and despite the low amount of accessible nickel on Ni/YSZ (14 times lower than Ni/K2O-CaAl2O4), it adsorbs 20 times more H2S and 50 times more SO2 than Ni/K 2O-CaAl2O4. A one-dimensional, steady state PBR model (DetchemPBED) was used to evaluate SMR and DMR under poisoning conditions using the Deutschmann mechanism and a recently published sulfur sub-mechanism. To fit the observed deactivation in the presence of 1 ppm H2S, the adsorption/desorption equilibrium constant was increased by a factor 16,000 for Ni/YSZ and 96 for Ni/K2O-CaAl2O4. A tubular SAE reactor was designed and fabricated for evaluating DMR in a reactor that mimics an SOFC. Evidence of hydrogen diffusion through a supposedly impermeable layer indicated that the tubular SAE reactor has a major flaw in which gases diffuse to unintended parts of the tube. It was also found to be extremely susceptible to coking which leads to cell failure even in operating regions that mimic real biogas. These problems made it impossible to validate the tubular SAE

  7. Comparison of new immunofluorescence method for detection of soy protein in meat products with immunohistochemical, histochemical, and ELISA methods

    Directory of Open Access Journals (Sweden)

    Michaela Petrášová

    2014-01-01

    Full Text Available Soy proteins are commonly used in the food industry thanks to their technological properties. However, soy is, along with cow’s milk, eggs, wheat, peanuts, tree nuts, fish, crustaceans, and molluscs, responsible for around 90% of food allergies, and is also one of the foodstuffs that can cause anaphylaxis. The aim of this work was to compare the immunofluorescence method for the detection of soy protein in meat products purchased from the retail market with other microscopic methods (immunohistochemical and histochemical, with the ELISA reference method and with the confirmatory results. Within the research, 127 meat products purchased in the retail network were examined using the immunofluorescence method used for the detection of soy protein. The method was compared to Enzyme-Linked ImmunoSorbent Assay (ELISA, immunohistochemical, and histochemical methods. According to McNemar’s test, non-compliance between the immunofluorescence method and immunohistochemical method was low. In addition, a significant difference between the fluorescence method and ELISA (P P < 0.01 was found. The immunofluorescence method was also compared with confirmatory results. According to McNemar’s test, non-compliance between the immunofluorescence method and confirmatory results was low. The results showed the possibilities of this new method to detect the content of soy protein in meat products.

  8. Dye Sensitized Solar Cell with Conventionally Annealed and Post-Hydrothermally Treated Nanocrystalline Semiconductor Oxide TiO2 Derived from Sol-Gel Process

    Directory of Open Access Journals (Sweden)

    Akhmad Yuwono

    2011-05-01

    Full Text Available Dye-sensitized solar cell (DSSC is one of the very promising alternative renewable energy sources to anticipate the declination in the fossil fuel reserves in the next few decades and to make use of the abundance of intensive sunlight energy in tropical countries like Indonesia. In the present study, TiO2 nanoparticles of different nanocrystallinity was synthesized via sol−gel process with various water to inorganic precursor ratio (Rw of 0.85, 2.00 and 3.50 upon sol preparation, followed with subsequent drying, conventional annealing and post-hydrothermal treatments. The resulting nanoparticles were integrated into the DSSC prototype and sensitized with an organic dye made of the extract of red onion. The basic performance of the fabricated DSSC has been examined and correlated to the crystallite size and band gap energy of TiO2 nanoparticles. It was found that post-hydrothermally treated TiO2 nanoparticles derived from sol of 2.00 Rw, with the most enhanced nanocrystalline size of 12.46 nm and the lowest band gap energy of 3.48 eV, showed the highest open circuit voltage (Voc of 69.33 mV.

  9. Comparative analysis of novel and conventional Hsp90 inhibitors on HIF activity and angiogenic potential in clear cell renal cell carcinoma: implications for clinical evaluation

    International Nuclear Information System (INIS)

    Bohonowych, Jessica ES; Peng, Shuping; Gopal, Udhayakumar; Hance, Michael W; Wing, Shane B; Argraves, Kelley M; Lundgren, Karen; Isaacs, Jennifer S

    2011-01-01

    Perturbing Hsp90 chaperone function targets hypoxia inducible factor (HIF) function in a von Hippel-Lindau (VHL) independent manner, and represents an approach to combat the contribution of HIF to cell renal carcinoma (CCRCC) progression. However, clinical trials with the prototypic Hsp90 inhibitor 17-AAG have been unsuccessful in halting the progression of advanced CCRCC. Here we evaluated a novel next generation small molecule Hsp90 inhibitor, EC154, against HIF isoforms and HIF-driven molecular and functional endpoints. The effects of EC154 were compared to those of the prototypic Hsp90 inhibitor 17-AAG and the histone deacetylase (HDAC) inhibitor LBH589. The findings indicate that EC154 is a potent inhibitor of HIF, effective at doses 10-fold lower than 17-AAG. While EC154, 17-AAG and the histone deacetylase (HDAC) inhibitor LBH589 impaired HIF transcriptional activity, CCRCC cell motility, and angiogenesis; these effects did not correlate with their ability to diminish HIF protein expression. Further, our results illustrate the complexity of HIF targeting, in that although these agents suppressed HIF transcripts with differential dynamics, these effects were not predictive of drug efficacy in other relevant assays. We provide evidence for EC154 targeting of HIF in CCRCC and for LBH589 acting as a suppressor of both HIF-1 and HIF-2 activity. We also demonstrate that 17-AAG and EC154, but not LBH589, can restore endothelial barrier function, highlighting a potentially new clinical application for Hsp90 inhibitors. Finally, given the discordance between HIF activity and protein expression, we conclude that HIF expression is not a reliable surrogate for HIF activity. Taken together, our findings emphasize the need to incorporate an integrated approach in evaluating Hsp90 inhibitors within the context of HIF suppression

  10. Comparative analysis of novel and conventional Hsp90 inhibitors on HIF activity and angiogenic potential in clear cell renal cell carcinoma: implications for clinical evaluation

    Directory of Open Access Journals (Sweden)

    Bohonowych Jessica ES

    2011-12-01

    Full Text Available Abstract Background Perturbing Hsp90 chaperone function targets hypoxia inducible factor (HIF function in a von Hippel-Lindau (VHL independent manner, and represents an approach to combat the contribution of HIF to cell renal carcinoma (CCRCC progression. However, clinical trials with the prototypic Hsp90 inhibitor 17-AAG have been unsuccessful in halting the progression of advanced CCRCC. Methods Here we evaluated a novel next generation small molecule Hsp90 inhibitor, EC154, against HIF isoforms and HIF-driven molecular and functional endpoints. The effects of EC154 were compared to those of the prototypic Hsp90 inhibitor 17-AAG and the histone deacetylase (HDAC inhibitor LBH589. Results The findings indicate that EC154 is a potent inhibitor of HIF, effective at doses 10-fold lower than 17-AAG. While EC154, 17-AAG and the histone deacetylase (HDAC inhibitor LBH589 impaired HIF transcriptional activity, CCRCC cell motility, and angiogenesis; these effects did not correlate with their ability to diminish HIF protein expression. Further, our results illustrate the complexity of HIF targeting, in that although these agents suppressed HIF transcripts with differential dynamics, these effects were not predictive of drug efficacy in other relevant assays. Conclusions We provide evidence for EC154 targeting of HIF in CCRCC and for LBH589 acting as a suppressor of both HIF-1 and HIF-2 activity. We also demonstrate that 17-AAG and EC154, but not LBH589, can restore endothelial barrier function, highlighting a potentially new clinical application for Hsp90 inhibitors. Finally, given the discordance between HIF activity and protein expression, we conclude that HIF expression is not a reliable surrogate for HIF activity. Taken together, our findings emphasize the need to incorporate an integrated approach in evaluating Hsp90 inhibitors within the context of HIF suppression.

  11. Correlation of antinuclear antibody immunofluorescence patterns with immune profile using line immunoassay in the Indian scenario

    Directory of Open Access Journals (Sweden)

    Sebastian Wendy

    2010-07-01

    Full Text Available Background: Immunity status, individual response to disease and types of antibodies produced are well known to vary from person to person, place to place and probably from population to population. A broad spectrum of specific auto antibodies that have so far been associated with specific rheumatic diseases, as noted in Western literature, has been well taken as a reference standard all over the world. There is neither research work nor any data correlating the auto antibodies and their antinuclear antibody (ANA patterns with the immunoprofile in the Indian population to date. Aims: To understand a definite association between ANA patterns and specific antibodies in the serum in the Indian study population and to document similarities / differences with the West. Settings and Design: This prospective and retrospective double blind study was undertaken on the South Indian population referred for ANA testing by Indirect Immunofluorescence method and by immunoline methods. Materials and Methods: Serum samples of patients from a random South Indian population who sought medical help for rheumatic disease were subjected for ANA testing by indirect immunofluorescence (IIF method and line immunoassay during the study period of 27 months. Serum samples were processed in dilution of 1:100 using HEp - 2010 / liver biochip (Monkey (EUROIMMUN AG. The serum samples which were further processed for line immunoassay were treated in 1:100 dilution on nylon strips coated with recombinant and purified antigens as discrete lines with plastic backing (EUROIMMUN AG coated with antigens nRNP / Sm, Sm, SSA, Ro-52, SSB, Scl-70, PM-Scl, PCNA, Jo-1, CENP-B, dsDNA, nucleosomes, histones, ribosomal protein-P, anti-mitochondrial antibodies (AMA-M2 along with a control band. The analysis was done by comparing the intensity of the reaction with positive control line by image analysis. Results: The antinuclear antibody indirect immunofluorescence (ANA - IIF patterns obtained

  12. Indirect immunofluorescence assay for the simultaneous detection of antibodies against clinically important old and new world hantaviruses.

    Directory of Open Access Journals (Sweden)

    Sabine Lederer

    Full Text Available In order to detect serum antibodies against clinically important Old and New World hantaviruses simultaneously, multiparametric indirect immunofluorescence assays (IFAs based on biochip mosaics were developed. Each of the mosaic substrates consisted of cells infected with one of the virus types Hantaan (HTNV, Puumala (PUUV, Seoul (SEOV, Saaremaa (SAAV, Dobrava (DOBV, Sin Nombre (SNV or Andes (ANDV. For assay evaluation, serum IgG and IgM antibodies were analyzed using 184 laboratory-confirmed hantavirus-positive sera collected at six diagnostic centers from patients actively or previously infected with the following hantavirus serotypes: PUUV (Finland, n=97; SEOV (China, n=5; DOBV (Romania, n=7; SNV (Canada, n=23; ANDV (Argentina and Chile, n=52. The control panel comprised 89 sera from healthy blood donors. According to the reference tests, all 184 patient samples were seropositive for hantavirus-specific IgG (n=177; 96% and/or IgM (n=131; 72%, while all control samples were tested negative. In the multiparametric IFA applied in this study, 183 (99% of the patient sera were IgG and 131 (71% IgM positive (accordance with the reference tests: IgG, 96%; IgM, 93%. Overall IFA sensitivity for combined IgG and IgM analysis amounted to 100% for all serotypes, except for SNV (96%. Of the 89 control sera, 2 (2% showed IgG reactivity against the HTNV substrate, but not against any other hantavirus. Due to the high cross-reactivity of hantaviral nucleocapsid proteins, endpoint titrations were conducted, allowing serotype determination in >90% of PUUV- and ANDV-infected patients. Thus, multiparametric IFA enables highly sensitive and specific serological diagnosis of hantavirus infections and can be used to differentiate PUUV and ANDV infection from infections with Murinae-borne hantaviruses (e.g. DOBV and SEOV.

  13. Anti-human neutrophil antigen-1a, -1b, and -2 antibodies in neonates and children with immune neutropenias analyzed by extracted granulocyte antigen immunofluorescence assay.

    Science.gov (United States)

    Onodera, Rie; Kurita, Emi; Taniguchi, Kikuyo; Karakawa, Shuhei; Okada, Satoshi; Kihara, Hirotaka; Fujii, Teruhisa; Kobayashi, Masao

    2017-11-01

    Anti-human neutrophil antigen (HNA) antibodies have been implicated in the development of neonatal alloimmune neutropenia (NAN) and autoimmune neutropenia (AIN). There are many conventional assay methods that detect anti-HNA antibodies. However, a method to measure multiple samples and detect several anti-HNA antibodies simultaneously is needed. We developed a new method, the extracted granulocyte antigen immunofluorescence assay (EGIFA), to analyze anti-HNA-1a, -1b, and -2 antibodies in sera. The results obtained by EGIFA were evaluated in comparison with those from several standard assay methods. Anti-HNA antibodies in serum samples from nine familial cases with suspected NAN (n = 19) and children with suspected AIN (n = 88) were also measured by EGIFA. The evaluation of nine serum samples with anti-HNA antibodies suggested that EGIFA demonstrated equivalent specificity and superior sensitivity to monoclonal antibody-specific immobilization of granulocyte antigens and had comparable sensitivity to the granulocyte indirect immunofluorescence test. EGIFA successfully detected anti-HNA-1a or -1b antibodies in seven of nine familial cases with suspected NAN. EGIFA detected anti-HNA antibodies in 40.9% of children with suspected AIN. Among them, isolated anti-HNA-1a or -1b antibody was detected in 4.5 or 12.5% of children, respectively, and anti-HNA-2 antibody was identified in 3.4% of children. The 30.8% (16 of 52) of children negative for anti-HNA antibody by EGIFA were positive for anti-HLA antibody. EGIFA facilitated the measurement of anti-HNA-1a, -1b, and/or -2 antibodies in sera. The prompt measurement of anti-HNA antibodies will improve the diagnosis and clinical management of patients with suspected NAN or AIN. © 2017 AABB.

  14. Detection of viral infection by immunofluorescence in formalin-fixed tissues, pretreated with trypsin

    Directory of Open Access Journals (Sweden)

    O. M. Barth

    1988-06-01

    Full Text Available The presence of viral antigen in sections from formalin-fixed and paraffin-embedded human tissues was demonstrated by trypsin digestion followed by direct or indirect immunofluorescence. The specimens may be used for retrospective diagnosis. The immunofluorescence technique has to be adapted to the suspected virus infection on the basis of previous histopathology study. Variations of trypsin concentration time and temperature of incubation, expose different viral antigens and have to be previously tested for each unknown system. For measles virus detection in lung a stronger digestion has to be applied as compared to adenovirus or respiratory disease viruses in the same tisue. Flavivirus in liver tissue needs a weaker digestion. The reproducibility of the method makes it useful as a routine technique in diagnosis of virus infection.A presença de antígeno viral em cortes de tecidos humanos fixados em formol e emblocados em parafina foi demonstrada pela digestão com tripsina foi demonstrada pela ingestão com tripsina seguida de imunofluorescência direta ou indireta. Os espécimens podem ser utilizados para diagnoses retrospectivas. A técnica da imunofluorescência deve ser adaptada à infecção viral suspeita segundo diagnosie histopatológica prévia. Os parâmetros para a digestão do tecido pela tripsina, relacionados à concentração, duração de atuação e temperatura, expõem diferentes antígenos virais e devem ser previamente testados para cada sistema a ser estabelecido. Uma digestão mais intensa deve ser aplicada para a detecção do vírus do sarampo em tecido pulmonar do que para adenovírus ou vírus respiratório sincicial no mesmo tecido. Por outro lado, o vírus da febre amarela em tecido de fígado necessita de uma digestão mais fraca.

  15. Feasibility and efficacy of helical intensity-modulated radiotherapy for stage III non-small cell lung cancer in comparison with conventionally fractionated 3D-CRT.

    Science.gov (United States)

    He, Jian; Huang, Yan; Chen, Yixing; Shi, Shiming; Ye, Luxi; Hu, Yong; Zhang, Jianying; Zeng, Zhaochong

    2016-05-01

    The standard treatment for stage III non-small-cell lung cancer (NSCLC) is still 60 Gy in conventional fractions combined with concurrent chemotherapy; however, the resulting local controls are disappointing. The aim of this study was to compare and assess the feasibility and efficacy of hypofractionated chemoradiotherapy using helical tomotherapy (HT) with conventional fractionation as opposed to using three-dimensional conformal radiotherapy (3D-CRT) for stage III NSCLC. Sixty-nine patients with stage III (AJCC 7th edition) NSCLC who underwent definitive radiation treatment at our institution between July 2011 and November 2013 were reviewed and analyzed retrospectively. A dose of 60 Gy in 20 fractions was delivered in the HT group (n=34), whereas 60 Gy in 30 fractions in the 3D-CRT group (n=35). Primary endpoints were toxicity, overall response rate, overall survival (OS) and progression-free survival (PFS). The median follow-up period was 26.4 months. V20 (P=0.005), V30 (P=0.001), V40 (P=0.004), mean lung dose (P=0.000) and max dose of spinal cord (P=0.005) were significantly lower in the HT group than in the 3D-CRT group. There was no significant difference in the incidences of acute radiation pneumonitis (RP) ≥ grade 2 between the two groups, whereas the incidences of acute radiation esophagitis ≥ grade 2 were significantly lower in the HT group than in the 3D-CRT group (P=0.027). Two-year overall response rate was significantly higher in the HT group than in the 3D-CRT group (P=0.015). One- and 2-year OS rates were significantly higher in the HT group (95.0% and 68.7%, respectively) than in the 3D-CRT group (85.5% and 47.6%, respectively; P=0.0236). One- and 2-year PFS rates were significantly higher in the HT group (57.8% and 26.3%, respectively) than in the 3D-CRT group (32.7% and 11.4%, respectively; P=0.0351). Univariate analysis indicated that performance status (PS), T stage and radiotherapy technique were significant prognostic factors for both OS

  16. A prospective randomized trial of hyperfractionated versus conventional once daily radiation for advanced squamous cell carcinomas of the larynx and pharynx

    International Nuclear Information System (INIS)

    Cummings, B.J.; Keane, T.J.; Pintilie, M.; O'Sullivan, B.; Payne, D.; Warde, P.; McLean, M.; Waldron, J.; Liu, F.-F.; Gullane, P.

    1996-01-01

    Purpose: To examine the effects of an increased dose of radiation therapy (RT) delivered by a hyperfractionated schedule compared to conventional once daily RT on toxicity, locoregional control and survival in the treatment of squamous cell carcinomas (SCC) of the larynx and pharynx. Materials/Methods: Between 1988 and 1995 336 patients were randomized to receive RT with curative intent. Eligible patients had biopsy proven SCC of the larynx or pharynx, with TN stages (AJC-UICC 1987) T3 or T4 N0, or any T with any N+. All patients were M0. Patients were stratified by site (larynx/oropharynx/hypopharynx), node status (clinically positive/negative), and performance status. Patients were treated with either 51 Gy TAD/20 fractions/4 wk (2.55 Gy 1x/d, conventional RT=CRT) or 58 Gy TAD/40 fractions/4 wk (1.45 Gy 2x/d, hyperfractionated RT=HFRT). Patients underwent EUA and selective biopsies 10 wk after RT; surgical salvage was performed for residual or recurrent cancer whenever possible. Results: The primary cancer arose in the oropharynx (138), larynx (133) or hypopharynx (65). T stages were distributed T1 22, T2 72, T3 133 and T4 109. N stage distribution was N0 127, N1 74, N2 117 and N3 18. The proportion of patients with acute mucosal toxicity (RTOG Grade 3 or 4) was increased by HFRT (60% versus 40%), but other acute and late toxicity was not significantly different. There was no difference in the incidence of morbidity in the two treatment groups in those who underwent surgery following RT. The locoregional control rates at 3 yrs for all cases were 45% (HFRT) vs 40% (CRT) log rank p=0.16; for primary tumors <4 cm 54% (HFRT) vs 42% (CRT) p=0.04; for primary tumors ≥ 4 cm 38% (HFRT) vs 41% (CRT) p=0.73. Local control was improved to some extent in SCC which arose in all sites, but most noticeably in hypopharyngeal cancers. The disease free survival rates at 3 yr for all cases were 37% (HFRT) vs 30% (CRT) p=0.15; for primary tumors < 4 cm 47% (HFRT) vs 34% (CRT) p=0

  17. Accuracy of molecular diagnostics in pemphigus and bullous pemphigoid: comparison of commercial and modified mosaic indirect immunofluorescence tests as well as enzyme-linked immunosorbent assays.

    Science.gov (United States)

    Gornowicz-Porowska, Justyna; Seraszek-Jaros, Agnieszka; Bowszyc-Dmochowska, Monika; Kaczmarek, Elżbieta; Pietkiewicz, Paweł; Bartkiewicz, Paweł; Dmochowski, Marian

    2017-02-01

    Pemphigus and bullous pemphigoid (BP) are identified by autoantibodies (abs) against desmoglein 1, 3 (DSG1/3) and BP180/BP230, respectively. A novel mosaic to indirect immunofluorescence (IIF) using purified BP180 recombinant proteins spotted on slide and transfected cells expressing BP230, DSG1, DSG3 is available. The commercial (IgG detection) and modified (IgG4 detection) mosaic for indirect immunofluorescence (IIFc - IIF commercial, IIFm - IIF modified) and IgG ELISAs were evaluated in pemphigus and bullous pemphigoid (BP) molecular diagnostics. To compare diagnostic accuracy of commercial (IgG detection) and modified (IgG4 detection) mosaic IIF assay and to examine the diagnostic value of ELISAs in relation to mosaic IIF in routine laboratory diagnostics of pemphigus and BP. Sera from 37 BP and 19 pemphigus patients were studied. Associations between tests were assessed using Fisher's exact test. There are associations between the positive/negative samples detected by IIFc with desmoglein1 (DSG1)/desmoglein3 (DSG3)/BP230 transfected cells and ELISAs and no association between anti-BP180 IgG detection by IIFc and ELISA. IIFm with DSG1 and DSG3 showed both 100% sensitivity and 100% and 78% specificity, respectively, and 100% and 83% positive predictive value in relation to IIFc. IIFm with BP230 had 87% specificity, 55% sensitivity, whereas IIFm with BP180 had a 100% sensitivity and 13% specificity in relation to IIFc. The IIFc with DSG1/DSG3/BP230 transfected cells, excluding BP180 spots, is an alternative method to ELISA in pemphigus/BP diagnostics. IgG4 antibodies, both pathogenically and diagnostically important, are inconsistently detectable with IIFm.

  18. Accuracy of molecular diagnostics in pemphigus and bullous pemphigoid: comparison of commercial and modified mosaic indirect immunofluorescence tests as well as enzyme-linked immunosorbent assays

    Directory of Open Access Journals (Sweden)

    Justyna Gornowicz-Porowska

    2017-02-01

    Full Text Available Introduction : Pemphigus and bullous pemphigoid (BP are identified by autoantibodies (abs against desmoglein 1, 3 (DSG1/3 and BP180/BP230, respectively. A novel mosaic to indirect immunofluorescence (IIF using purified BP180 recombinant proteins spotted on slide and transfected cells expressing BP230, DSG1, DSG3 is available. The commercial (IgG detection and modified (IgG4 detection mosaic for indirect immunofluorescence (IIFc – IIF commercial, IIFm – IIF modified and IgG ELISAs were evaluated in pemphigus and bullous pemphigoid (BP molecular diagnostics. Aim : To compare diagnostic accuracy of commercial (IgG detection and modified (IgG4 detection mosaic IIF assay and to examine the diagnostic value of ELISAs in relation to mosaic IIF in routine laboratory diagnostics of pemphigus and BP. Material and methods : Sera from 37 BP and 19 pemphigus patients were studied. Associations between tests were assessed using Fisher’s exact test. Results: There are associations between the positive/negative samples detected by IIFc with desmoglein1 (DSG1/desmoglein3 (DSG3/BP230 transfected cells and ELISAs and no association between anti-BP180 IgG detection by IIFc and ELISA. IIFm with DSG1 and DSG3 showed both 100% sensitivity and 100% and 78% specificity, respectively, and 100% and 83% positive predictive value in relation to IIFc. IIFm with BP230 had 87% specificity, 55% sensitivity, whereas IIFm with BP180 had a 100% sensitivity and 13% specificity in relation to IIFc. Conclusions : The IIFc with DSG1/DSG3/BP230 transfected cells, excluding BP180 spots, is an alternative method to ELISA in pemphigus/BP diagnostics. IgG4 antibodies, both pathogenically and diagnostically important, are inconsistently detectable with IIFm.

  19. A Novel Tool for High-Throughput Screening of Granulocyte-Specific Antibodies Using the Automated Flow Cytometric Granulocyte Immunofluorescence Test (Flow-GIFT

    Directory of Open Access Journals (Sweden)

    Xuan Duc Nguyen

    2011-01-01

    Full Text Available Transfusion-related acute lung injury (TRALI is a severe complication related with blood transfusion. TRALI has usually been associated with antibodies against leukocytes. The flow cytometric granulocyte immunofluorescence test (Flow-GIFT has been introduced for routine use when investigating patients and healthy blood donors. Here we describe a novel tool in the automation of the Flow-GIFT that enables a rapid screening of blood donations. We analyzed 440 sera from healthy female blood donors for the presence of granulocyte antibodies. As positive controls, 12 sera with known antibodies against anti-HNA-1a, -b, -2a; and -3a were additionally investigated. Whole-blood samples from HNA-typed donors were collected and the test cells isolated using cell sedimentation in a Ficoll density gradient. Subsequently, leukocytes were incubated with the respective serum and binding of antibodies was detected using FITC-conjugated antihuman antibody. 7-AAD was used to exclude dead cells. Pipetting steps were automated using the Biomek NXp Multichannel Automation Workstation. All samples were prepared in the 96-deep well plates and analyzed by flow cytometry. The standard granulocyte immunofluorescence test (GIFT and granulocyte agglutination test (GAT were also performed as reference methods. Sixteen sera were positive in the automated Flow-GIFT, while five of these sera were negative in the standard GIFT (anti—HNA 3a, n = 3; anti—HNA-1b, n = 1 and GAT (anti—HNA-2a, n = 1. The automated Flow-GIFT was able to detect all granulocyte antibodies, which could be only detected in GIFT in combination with GAT. In serial dilution tests, the automated Flow-GIFT detected the antibodies at higher dilutions than the reference methods GIFT and GAT. The Flow-GIFT proved to be feasible for automation. This novel high-throughput system allows an effective antigranulocyte antibody detection in a large donor population in order to prevent TRALI due to transfusion of

  20. A novel tool for high-throughput screening of granulocyte-specific antibodies using the automated flow cytometric granulocyte immunofluorescence test (Flow-GIFT).

    Science.gov (United States)

    Nguyen, Xuan Duc; Dengler, Thomas; Schulz-Linkholt, Monika; Klüter, Harald

    2011-02-03

    Transfusion-related acute lung injury (TRALI) is a severe complication related with blood transfusion. TRALI has usually been associated with antibodies against leukocytes. The flow cytometric granulocyte immunofluorescence test (Flow-GIFT) has been introduced for routine use when investigating patients and healthy blood donors. Here we describe a novel tool in the automation of the Flow-GIFT that enables a rapid screening of blood donations. We analyzed 440 sera from healthy female blood donors for the presence of granulocyte antibodies. As positive controls, 12 sera with known antibodies against anti-HNA-1a, -b, -2a; and -3a were additionally investigated. Whole-blood samples from HNA-typed donors were collected and the test cells isolated using cell sedimentation in a Ficoll density gradient. Subsequently, leukocytes were incubated with the respective serum and binding of antibodies was detected using FITC-conjugated antihuman antibody. 7-AAD was used to exclude dead cells. Pipetting steps were automated using the Biomek NXp Multichannel Automation Workstation. All samples were prepared in the 96-deep well plates and analyzed by flow cytometry. The standard granulocyte immunofluorescence test (GIFT) and granulocyte agglutination test (GAT) were also performed as reference methods. Sixteen sera were positive in the automated Flow-GIFT, while five of these sera were negative in the standard GIFT (anti-HNA 3a, n = 3; anti-HNA-1b, n = 1) and GAT (anti-HNA-2a, n = 1). The automated Flow-GIFT was able to detect all granulocyte antibodies, which could be only detected in GIFT in combination with GAT. In serial dilution tests, the automated Flow-GIFT detected the antibodies at higher dilutions than the reference methods GIFT and GAT. The Flow-GIFT proved to be feasible for automation. This novel high-throughput system allows an effective antigranulocyte antibody detection in a large donor population in order to prevent TRALI due to transfusion of blood products.

  1. Segment and fit thresholding: a new method for image analysis applied to microarray and immunofluorescence data.

    Science.gov (United States)

    Ensink, Elliot; Sinha, Jessica; Sinha, Arkadeep; Tang, Huiyuan; Calderone, Heather M; Hostetter, Galen; Winter, Jordan; Cherba, David; Brand, Randall E; Allen, Peter J; Sempere, Lorenzo F; Haab, Brian B

    2015-10-06

    Experiments involving the high-throughput quantification of image data require algorithms for automation. A challenge in the development of such algorithms is to properly interpret signals over a broad range of image characteristics, without the need for manual adjustment of parameters. Here we present a new approach for locating signals in image data, called Segment and Fit Thresholding (SFT). The method assesses statistical characteristics of small segments of the image and determines the best-fit trends between the statistics. Based on the relationships, SFT identifies segments belonging to background regions; analyzes the background to determine optimal thresholds; and analyzes all segments to identify signal pixels. We optimized the initial settings for locating background and signal in antibody microarray and immunofluorescence data and found that SFT performed well over multiple, diverse image characteristics without readjustment of settings. When used for the automated analysis of multicolor, tissue-microarray images, SFT correctly found the overlap of markers with known subcellular localization, and it performed better than a fixed threshold and Otsu's method for selected images. SFT promises to advance the goal of full automation in image analysis.

  2. Human cryptosporidiosis: detection of specific antibodies in the serum by an indirect immunofluorescence

    Directory of Open Access Journals (Sweden)

    Braz Lúcia M.A.

    1996-01-01

    Full Text Available Cryptosporidium sp., a coccidian parasite usually found in the faeces of cattle, has been recently implicated as an agent of human intestinal disease, mainly in immunocompromised patients. In the study realized, by an indirect immunofluorescence technique, specific immunoglobulins (IgG and IgM have been demonstrated in human serum against Cryptosporidium oocysts. Purified oocysts were used as antigens in the indirect immunofluorecence assay. After analyzing this test in sera from selected groups of patients, the frequency of both specific IgG and IgM of immunocompetent children who were excreting oocysts in their faeces was 62% and in children with negative excretion of oocysts was 20% and 40%, respectively. In adults infected with the human immunodeficiency virus (HIV and who were excreting Cryptosporidium in their stools, the frequency was 57% for IgG but only 2% for IgM. Twenty three percent of immunocompromised adults with not determined excretion of oocysts in their stools had anti-Cryptosporidium IgG in their sera. Children infected with human immunodeficiency virus had no IgM and only 14% had IgG detectable in their sera. The indirect immunoflorescence assay, when used with other parasitological techniques appears to be useful for retrospective population studies and for diagnosis of acute infection. The humoral immune response of HIV positive patients to this protozoan agent needs clarification.

  3. Pattern of glomerular diseases in oman: A study based on light microscopy and immunofluorescence

    Directory of Open Access Journals (Sweden)

    Nasar Yousuf Alwahaibi

    2013-01-01

    Full Text Available Light microscopy and immunofluorescence play an important part in the final diagnosis of renal biopsy. The aim of this study was to analyze the pattern of various glomerular diseases in Oman. A total of 424 renal biopsies were retrospectively analyzed at the Sultan Qaboos University Hospital between 1999 and 2010. Focal and segmental glomerulosclerosis (FSGS, minimal change disease (MCD, membranous glomerulopathy (MGN and IgA nephropathy were the most common primary glomerular diseases encountered, accounting for 21.2%, 17%, 12.3% and 8.3%, respectively, of all cases. Lupus nephritis was the most common secondary glomerular disease and was the most prevalent among all biopsies, accounting for 30.4% of all biopsies. Amyloidosis was seen in only two cases. The presence of fluorescein isothiocyanatefibrin in all renal cases was low when compared with IgG, IgA, IgM, C3 and C1q markers. In conclusion, based on the findings of this study, lupus nephritis was the most common of all glomerular diseases and FSGS was the most common primary glomerular disease. The importance of fluorescein isothiocyanate-fibrin in the diagnosis of renal biopsy needs to be further investigated.

  4. Chemical Weapons Convention

    National Research Council Canada - National Science Library

    1997-01-01

    On April 29, 1997, the Convention on the Prohibition of the Development, Production, Stockpiling, and Use of Chemical Weapons and on Their Destruction, known as the Chemical Weapons Convention (CWC...

  5. Superiority of conventional intensity-modulated radiotherapy over helical tomotherapy in locally advanced non-small cell lung cancer. A comparative plan analysis

    Energy Technology Data Exchange (ETDEWEB)

    Song, C. [National Cancer Center, Research Institute and Hospital, Goyang (Korea, Republic of). Proton Therapy Center; Seoul National Univ. College of Medicine (Korea, Republic of). Dept. of Radiation Oncology; Pyo, H.; Kim, J. [Sungkyunkwan Univ. School of Medicine, Samsung Medical Center, Seoul (Korea, Republic of). Dept. of Radiation Oncology; Lim, Y.K.; Kim, D.W.; Cho, K.H. [National Cancer Center, Research Institute and Hospital, Goyang (Korea, Republic of). Proton Therapy Center; Kim, W.C. [Inha Univ. School of Medicine, Incheon (Korea, Republic of). Dept. of Radiation Oncology; Kim, H.J. [Seoul National Univ. College of Medicine (Korea, Republic of). Dept. of Radiation Oncology

    2012-10-15

    Purpose: To compare helical tomotherapy (HT) and conventional intensity-modulated radiotherapy (IMRT) using a variety of dosimetric and radiobiologic indexes in patients with locally advanced non-small cell lung cancer (LA-NSCLC). Patients and methods: A total of 20 patients with LA-NSCLC were enrolled. IMRT plans with 4-6 coplanar beams and HT plans were generated for each patient. Dose distributions and dosimetric indexes for the tumors and critical structures were computed for both plans and compared. Results: Both modalities created highly conformal plans. They did not differ in the volumes of lung exposed to > 20 Gy of radiation. The average mean lung dose, volume receiving {>=} 30 Gy, and volume receiving {>=} 10 Gy in HT planning were 18.3 Gy, 18.5%, and 57.1%, respectively, compared to 19.4 Gy, 25.4%, and 48.9%, respectively, with IMRT (p = 0.004, p < 0.001, and p < 0.001). The differences between HT and IMRT in lung volume receiving {>=} 10-20 Gy increased significantly as the planning target volume (PTV) increased. For 6 patients who had PTV greater than 700 cm{sup 3}, IMRT was superior to HT for 5 patients in terms of lung volume receiving {>=} 5-20 Gy. The integral dose to the entire thorax in HT plans was significantly higher than in IMRT plans. Conclusion: HT gave significantly better control of mean lung dose and volume receiving {>=} 30-40 Gy, whereas IMRT provided better control of the lung volume receiving {>=} 5-15 Gy and the integral dose to entire thorax. In most patients with PTV greater than 700 cm{sup 3}, IMRT was superior to HT in terms of lung volume receiving {>=} 5-20 Gy. It is therefore advised that caution should be exercised when planning LA-NSCLC using HT. (orig.)

  6. Characterization of pars intermedia connections in amphibians by biocytin tract tracing and immunofluorescence aided by confocal microscopy

    NARCIS (Netherlands)

    Jansen, K; Fabro, C; Artero, C; Feuilloley, M; Vaudry, H; Fasolo, A; Franzoni, MF

    Biocytin, recently introduced in neuroanatomical studies, was used as a retrograde tract tracer in combination with immunofluorescence in order to analyse the neurochemical characters of some central neuronal projections to the pars intermedia in two amphibian species, the anuran Rana esculenta and

  7. The Hague Judgments Convention

    DEFF Research Database (Denmark)

    Nielsen, Peter Arnt

    2011-01-01

    The Hague Judgments Convention of 2005 is the first global convention on international jurisdiction and recognition and enforcement of judgments in civil and commercial matters. The author explains the political and legal background of the Convention, its content and certain crucial issues during...

  8. A molecular method for typing Herpes simplex virus isolates as an alternative to immunofluorescence methods

    Directory of Open Access Journals (Sweden)

    Abraham A

    2009-01-01

    Full Text Available Background: Typing of Herpes simplex virus (HSV isolates is required to identify the virus isolated in culture. The methods available for this include antigen detection by immunofluorescence (IF assays and polymerase chain reaction (PCR. This study was undertaken to standardize a molecular method for typing of HSV and compare it with a commercial IF reagent for typing. Objectives: To compare a molecular method for typing HSV isolates with a monoclonal antibody (MAb based IF test. Study design : This cross-sectional study utilized four reference strains and 42 HSV isolates obtained from patients between September 1998 and September 2004. These were subjected to testing using an MAb-based IF test and a PCR that detects the polymerase ( pol gene of HSV isolates. Results: The observed agreement of the MAb IF assay with the pol PCR was 95.7%. Fifty four point eight percent (23/42 of isolates tested by IF typing were found to be HSV-1, 40.5% (17/42 were HSV-2, and two (4.8% were untypable using the MAb IF assay. The two untypable isolates were found to be HSV-2 using the pol PCR. In addition, the cost per PCR test for typing is estimated to be around Rs 1,300 (USD 30, whereas the cost per MAb IF test is about Rs 1,500 (USD 35 including all overheads (reagents, instruments, personnel time, and consumables. Conclusion: The pol PCR is a cheaper and more easily reproducible method for typing HSV isolates as compared to the IF test. It could replace the IF-based method for routine typing of HSV isolates as availability of PCR machines (thermal cyclers is now more widespread than fluorescence microscopes in a country like India.

  9. Determination of cutoff of ELISA and immunofluorescence assay for scrub typhus

    Directory of Open Access Journals (Sweden)

    Nitin Gupta

    2016-01-01

    Full Text Available Background: The most common method employed for diagnosis of scrub typhus is serology. It is widely known that demonstration of ≥4-fold rise in titers of antibody in paired sera is required for diagnosis. However, for guidance of initial treatment, there is a need for rapid diagnosis at the time of admission. Therefore, there is a need for standardized region specific cutoff titers at the time of admission. Materials and Methods: A total of 258 patients of all age groups with clinically suspected scrub typhus over a period of 24 months (October 2013-October 2015 were enrolled. Serum samples of these patients were subjected to immunofluorescent antibody (IFA for immunoglobulin M (IgM (Fuller Labs, USA with dilutions of 1:64, 1:128, 1:256, and 1:512. Serum samples of all 258 patients were subjected to IgM ELISA (Inbios Inc., USA. Any patient with response to antibiotics within 48 h accompanied by either presence of an eschar or positivity by polymerase chain reaction was taken as positive. Receiver operating characteristic (ROC curve was drawn to generate cutoff for these tests. Results: A total of 20 patients were diagnosed as cases of scrub typhus. The ROC curve analysis revealed a cutoff optical density value of 0.87 with sensitivity and specificity of 100% and 94.12%, respectively. ROC curve analysis of IFA revealed sensitivity and specificity of 100% and 93.5%, respectively at 1:64 dilution. Conclusion: Considering cost constraints, centers in and around New Delhi region can use the cutoffs we determined for the diagnosis of scrub typhus.

  10. Neuromyelitis optica immunoglobulin G in Chinese patients detected by immunofluorescence assay on a monkey brain substrate.

    Science.gov (United States)

    Long, Youming; Hu, Xueqiang; Peng, Fuhua; Lu, Zhengqi; Wang, Yuge; Yang, Yu; Qiu, Wei

    2012-01-01

    Serum neuromyelitis optica immunoglobulin G (NMO-IgG) is used as a biomarker to differentiate between neuromyelitis optica (NMO) and multiple sclerosis (MS). However, the original assay is expensive and complex and shows low sensitivity. Here, we investigated the potential of NMO-IgG detection using an indirect immunofluorescence (IIF) assay on monkey brains. NMO-IgG seroprevalence was determined in 168 samples by an IIF assay on a monkey brain substrate. The data were compared with those from a standard mouse brain IIF assay using McNemar and kappa tests. Thirty-one of 50 (62%) NMO patients, 7 of 18 (38.9%) longitudinally extensive transverse myelitis patients, 6 of 57 (10.5%) MS patients, and 5 of 10 (50%) optic neuritis patients were seropositive for NMO-IgG. None of the acute partial transverse myelitis patients (n = 3) or healthy controls (n = 20) was positive. Thus, the sensitivity of the test was 62% for the patients with clinically definite NMO. The specificity was 89.5%, considering the 57 MS patients as the control group. The modified IIF assay on monkey brains and the standard IIF assay based on mouse brains were not significantly different (McNemar test; p = 1.000). The two assays were concordant in 39 seropositive samples and 100 seronegative samples (kappa test; kappa = 0.592, p monkey brain assay was no better than the standard mouse brain IIF assay, we affirmed that NMO-IgG is a sensitive and specific biomarker to differentiate between NMO and MS. Copyright © 2011 S. Karger AG, Basel.

  11. NHS-based Tandem Mass Tagging of Proteins at the Level of Whole Cells: A Critical Evaluation in Comparison to Conventional TMT-Labeling Approaches for Quantitative Proteome Analysis.

    Science.gov (United States)

    Megger, Dominik A; Pott, Leona L; Rosowski, Kristin; Zülch, Birgit; Tautges, Stephanie; Bracht, Thilo; Sitek, Barbara

    2017-01-01

    Tandem mass tags (TMT) are usually introduced at the levels of isolated proteins or peptides. Here, for the first time, we report the labeling of whole cells and a critical evaluation of its performance in comparison to conventional labeling approaches. The obtained results indicated that TMT protein labeling using intact cells is generally possible, if it is coupled to a subsequent enrichment using anti-TMT antibody. The quantitative results were similar to those obtained after labeling of isolated proteins and both were found to be slightly complementary to peptide labeling. Furthermore, when using NHS-based TMT, no specificity towards cell surface proteins was observed in the case of cell labeling. In summary, the conducted study revealed first evidence for the general possibility of TMT cell labeling and highlighted limitations of NHS-based labeling reagents. Future studies should therefore focus on the synthesis and investigation of membrane impermeable TMTs to increase specificity towards cell surface proteins.

  12. Phytoplankton IF-FISH: Species-specific labeling of cellular proteins by immunofluorescence (IF) with simultaneous species identification by fluorescence immunohybridization (FISH).

    Science.gov (United States)

    Meek, Megan E; Van Dolah, Frances M

    2016-05-01

    Phytoplankton rarely occur as unialgal populations. Therefore, to study species-specific protein expression, indicative of physiological status in natural populations, methods are needed that will both assay for a protein of interest and identify the species expressing it. Here we describe a protocol for IF-FISH, a dual labeling procedure using immunofluorescence (IF) labeling of a protein of interest followed by fluorescence in situ hybridization (FISH) to identify the species expressing that protein. The protocol was developed to monitor expression of the cell cycle marker proliferating cell nuclear antigen (PCNA) in the red tide dinoflagellate, Karenia brevis, using a large subunit (LSU) rRNA probe to identify K. brevis in a mixed population of morphologically similar Karenia species. We present this protocol as proof of concept that IF-FISH can be successfully applied to phytoplankton cells. This method is widely applicable for the analysis of single-cell protein expression of any protein of interest within phytoplankton communities. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Sensitivity of direct immunofluorescence in oral diseases. Study of 125 cases.

    Science.gov (United States)

    Sano, Susana Mariela; Quarracino, María Cecilia; Aguas, Silvia Cristina; González, Ernestina Jesús; Harada, Laura; Krupitzki, Hugo; Mordoh, Ana

    2008-05-01

    Direct immunofluorescence (DIF) is widely used for the diagnosis of bullous diseases and other autoimmune pathologies such as oral lichen planus. There is no evidence in the literature on how the following variants influence the detection rate of DIF: intraoral site chosen for the biopsy, perilesional locus or distant site from the clinical lesion, number of biopsies and instrument used. to determine if the following variants influenced the sensitivity (detection rate): intraoral site chosen for the biopsy, perilesional or distant site from the clinical lesion, number of biopsies and instrument used (punch or scalpel). A retrospective study was done at the Cátedra de Patología y Clínica Bucodental II at the Facultad de Odontología, Universidad de Buenos Aires; 136 clinical medical histories were revised for the period March 2000 - March 2005 corresponding to patients with clinical diagnosis of OLP and bullous diseases (vulgar pemphigus, bullous pemphigoid and cicatricial pemphigoid). DIF detection rate was 65.8% in patients with OLP, 66.7% in cicatricial pemphigoid patients, in bullous pemphigoid 55.6%, in pemphigus vulgaris 100%, and in those cases in which certain diagnosis could not be obtained, the DIF positivity rate was 45.5% (Pearson chi(2) (4)= 21.5398 Pr= 0.000). There was no statistically significant difference between the different sites of biopsy (Fisher exact test: 0.825). DIF detection rate in perilesional biopsies was 66.1% and in those distant from the site of clinical lesion was 64.7% (Pearson chi(2) v1)= 0.0073 Pr= 0.932. When the number of biopsies were incremented, DIF detection rate also incremented (Pearson chi(2) = 8.7247 Pr= 0.003). The biopsies taken with punch had a higher detection rate than those taken with scalpel (39.1% versus 71.7%) (Pearson chi(2) = 49.0522 Pr= 0.000). While not statistically significant, the tendency outlined in this study indicates there are intraoral regions in which the detection rate of the DIF technique is

  14. Stereotactic body radiation therapy versus conventional radiation therapy in patients with early stage non-small cell lung cancer - An updated retrospective study on local failure and survival rates

    International Nuclear Information System (INIS)

    Jeppesen, Stefan S.; Schytte, Tine; Hansen, Olfred; Jensen, Henrik R.; Brink, Carsten

    2013-01-01

    Introduction: Stereotactic body radiation therapy (SBRT) for early stage non-small cell lung cancer (NSCLC) is now an accepted and patient friendly treatment, but still controversy exists about its comparability to conventional radiation therapy (RT). The purpose of this single-institutional report is to describe survival outcome for medically inoperable patients with early stage NSCLC treated with SBRT compared with high dose conventional RT. Material and methods: From August 2005 to June 2012, 100 medically inoperable patients were treated with SBRT at Odense Univ. Hospital. The thoracic RT consisted of 3 fractions (F) of 15-22 Gy delivered in nine days. For comparison a group of 32 medically inoperable patients treated with conventional RT with 80 Gy/35-40 F (5 F/week) in the period of July 1998 to August 2011 were analyzed. All tumors had histological or cytological proven NSCLC T1-2N0M0. Results: The median overall survival was 36.1 months versus 24.4 months for SBRT and conventional RT, respectively (p = 0.015). Local failure-free survival rates at one year were in SBRT group 93 % versus 89 % in the conventional RT group and at five years 69 % versus 66 %, SBRT and conventional RT respectively (p = 0.99). On multivariate analysis, female gender and performance status of 0-1 and SBRT predicted improved prognosis. Conclusion: In a cohort of patients with NSCLC there was a significant difference in overall survival favoring SBRT. Performance status of 0-1, female gender and SBRT predicted improved prognosis. However, staging procedure, confirmation procedure of recurrence and technical improvements of radiation treatment is likely to influence outcomes. However, SBRT seems to be as efficient as conventional RT and is a more convenient treatment for the patients

  15. Application of a sepharose bead immunofluorescence assay and a solid-phase radioimmunoassay to the bovine leukemia virus system

    International Nuclear Information System (INIS)

    Fiebach, H.; Uckert, W.; Micheel, B.

    1982-01-01

    Several fluorescence assays with bovine leukemia virus (BLV) conjugated to activated Sepharose 4B were used for the detection of BLV and anti-BLV antibodies. These tests were compared with a solid-phase radioimmunoassay and found to be in the same sensitivity range. Sepharose bead immunofluorescence assay and solid-phase radioimmunoassay can be applied to the diagnosis of BLV infection in cattle. (author)

  16. Application of a sepharose bead immunofluorescence assay and a solid-phase radioimmunoassay to the bovine leukemia virus system

    Energy Technology Data Exchange (ETDEWEB)

    Fiebach, H.; Uckert, W.; Micheel, B. (Akademie der Wissenschaften der DDR, Berlin. Zentralinstitut fuer Krebsforschung)

    Several fluorescence assays with bovine leukemia virus (BLV) conjugated to activated Sepharose 4B were used for the detection of BLV and anti-BLV antibodies. These tests were compared with a solid-phase radioimmunoassay and found to be in the same sensitivity range. Sepharose bead immunofluorescence assay and solid-phase radioimmunoassay can be applied to the diagnosis of BLV infection in cattle.

  17. Convention on nuclear safety

    International Nuclear Information System (INIS)

    1994-01-01

    The Convention on Nuclear Safety was adopted on 17 June 1994 by Diplomatic Conference convened by the International Atomic Energy Agency at its Headquarters from 14 to 17 June 1994. The Convention will enter into force on the ninetieth day after the date of deposit with the Depository (the Agency's Director General) of the twenty-second instrument of ratification, acceptance or approval, including the instruments of seventeen States, having each at leas one nuclear installation which has achieved criticality in a reactor core. The text of the Convention as adopted is reproduced in the Annex hereto for the information of all Member States

  18. Detection of the thraustochytrid protist Ulkenia visurgensis in a hydroid, using immunofluorescence

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, S.

    to November 1986 By treating the samples with antiserum prepared against this organism and conjugated with FITC stain, the protist was regularly found to occur in association with a hydroid Several cells of the organism were observed in the coelenteron...

  19. Minamata Convention on Mercury

    Science.gov (United States)

    On November 6, 2013 the United States signed the Minamata Convention on Mercury, a new multilateral environmental agreement that addresses specific human activities which are contributing to widespread mercury pollution

  20. Immunofluorescent detection in the ovary of host antibodies against a secretory ferritin injected into female Haemaphysalis longicornis ticks.

    Science.gov (United States)

    Galay, Remil Linggatong; Matsuo, Tomohide; Hernandez, Emmanuel Pacia; Talactac, Melbourne Rio; Kusakisako, Kodai; Umemiya-Shirafuji, Rika; Mochizuki, Masami; Fujisaki, Kozo; Tanaka, Tetsuya

    2018-04-01

    Due to the continuous threat of ticks and tick-borne diseases to human and animal health worldwide, and the drawbacks of chemical acaricide application, many researchers are exploring vaccination as an alternative tick control method. Earlier studies have shown that host antibodies can circulate in the ticks, but it has not been confirmed whether these antibodies can be passed on to the eggs. We previously reported that ticks infesting rabbits immunized with a recombinant secretory ferritin of Haemaphysalis longicornis (HlFER2) had reduced egg production and hatching. Here we attempted to detect the presence of antibodies against HlFER2 in the ovary and eggs of female ticks through immunofluorescent visualization. Purified anti-HlFER2 antibodies or rabbit IgG for control was directly injected to engorged female H. longicornis. Ovaries and eggs after oviposition were collected and prepared for an indirect immunofluorescent antibody test. Positive fluorescence was detected in ovaries one day post-injection of anti-HlFER2 antibodies. Through silencing of Hlfer2 gene, we also determined whether the injected antibodies can specifically bind to native HlFER2. Immunofluorescence was observed in the oocytes of dsLuciferase control ticks injected with anti-HlFER2 antibodies, but not in the oocytes of Hlfer2-silenced ticks also injected with anti-HlFER2 antibodies. Our current findings suggest that host antibodies can be passed on to the oocytes, which is significant in formulating a vaccine that can disrupt tick reproduction. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Hepatitis B Core Antigen in Hepatocytes of Chronic Hepatitis B: Comparison between Indirect Immunofluorescence and Immunoperoxidase Method

    Science.gov (United States)

    Tabassum, Shahina; Al-Mahtab, Mamun; Nessa, Afzalun; Jahan, Munira; Shamim Kabir, Chowdhury Mohammad; Kamal, Mohammad; Cesar Aguilar, Julio

    2015-01-01

    Background Hepatitis B virus (HBV) infection has many faces. Precore and core promoter mutants resemble inactive carrier status. The identification of hepatitis B core antigen (HBcAg) in hepatocytes may have variable clinical significance. The present study was undertaken to detect HBcAg in chronic hepatitis B (CHB) patients and to assess the efficacy of detection system by indirect immunofluorescence (IIF) and indirect immunoperoxidase (IIP). Materials and methods The study was done in 70 chronic HBV-infected patients. Out of 70 patients, eight (11.4%) were hepatitis B e antigen (HBeAg) positive and 62 (88.57%) were HBeAg negative. Hepatitis B core antigen was detected by indirect immunofluorescence (IIF) and indirect immunoperoxidase (IIP) methods in liver tissue. Results All HBeAg positive patients expressed HBcAg by both IIF and IIP methods. Out of 62 patients with HBeAg-negative CHB, HBcAg was detected by IIF in 55 (88.7%) patients and by IIP in 51 (82.26%) patients. A positive relation among viral load and HBcAg detection was also found. This was more evident in the case of HBeAg negative patients and showed a positive relation with HBV DNA levels. Conclusion Hepatitis B core antigen can be detected using the IIF from formalin fixed paraffin block preparation and also by IIP method. This seems to reflect the magnitudes of HBV replication in CHB. How to cite this article Raihan R, Tabassum S, Al-Mahtab M, Nessa A, Jahan M, Kabir CMS, Kamal M, Aguilar JC. Hepatitis B Core Antigen in Hepatocytes of Chronic Hepatitis B: Comparison between Indirect Immunofluorescence and Immunoperoxidase Method. Euroasian J Hepato-Gastroenterol 2015;5(1):7-10. PMID:29201677

  2. Conventional and molecular cytogenetics of human non-medullary thyroid carcinoma: characterization of eight cell line models and review of the literature on clinical samples

    International Nuclear Information System (INIS)

    Ribeiro, Franclim Ricardo; Meireles, Ana Margarida; Rocha, Ana Sofia; Teixeira, Manuel Rodrigues

    2008-01-01

    Cell lines are often poorly characterized from a genetic point of view, reducing their usefulness as tumor models. Our purpose was to assess the genetic background of eight commonly used human thyroid carcinoma models and to compare the findings with those reported for primary tumors of the gland. We used chromosome banding analysis and comparative genomic hybridization to profile eight non-medullary thyroid carcinoma cell lines of papillary (TPC-1, FB2, K1 and B-CPAP), follicular (XTC-1) or anaplastic origin (8505C, C643 and HTH74). To assess the representativeness of the findings, we additionally performed a thorough review of cytogenetic (n = 125) and DNA copy number information (n = 270) available in the literature on clinical samples of thyroid carcinoma. The detailed characterization of chromosomal markers specific for each cell line revealed two cases of mistaken identities: FB2 was shown to derive from TPC-1 cells, whereas K1 cells have their origin in cell line GLAG-66. All cellular models displayed genomic aberrations of varying complexity, and recurrent gains at 5p, 5q, 8q, and 20q (6/7 cell lines) and losses at 8p, 13q, 18q, and Xp (4/7 cell lines) were seen. Importantly, the genomic profiles were compatible with those of the respective primary tumors, as seen in the meta-analysis of the existing literature data. We provide the genomic background of seven independent thyroid carcinoma models representative of the clinical tumors of the corresponding histotypes, and highlight regions of recurrent aberrations that may guide future studies aimed at identifying target genes. Our findings further support the importance of routinely performing cytogenetic studies on cell lines, to detect cross-contamination mishaps such as those identified here

  3. Targeting CD28, CTLA-4 and PD-L1 costimulation differentially controls immune synapses and function of human regulatory and conventional T-cells.

    Directory of Open Access Journals (Sweden)

    Nahzli Dilek

    Full Text Available CD28, CTLA-4 and PD-L1, the three identified ligands for CD80/86, are pivotal positive and negative costimulatory molecules that, among other functions, control T cell motility and formation of immune synapse between T cells and antigen-presenting cells (APCs. What remains incompletely understood is how CD28 leads to the activation of effector T cells (Teff but inhibition of suppression by regulatory T cells (Tregs, while CTLA-4 and PD-L1 inhibit Teff function but are crucial for the suppressive function of Tregs. Using alloreactive human T cells and blocking antibodies, we show here by live cell dynamic microscopy that CD28, CTLA-4, and PD-L1 differentially control velocity, motility and immune synapse formation in activated Teff versus Tregs. Selectively antagonizing CD28 costimulation increased Treg dwell time with APCs and induced calcium mobilization which translated in increased Treg suppressive activity, in contrast with the dampening effect on Teff responses. The increase in Treg suppressive activity after CD28 blockade was also confirmed with polyclonal Tregs. Whereas CTLA-4 played a critical role in Teff by reversing TCR-induced STOP signals, it failed to affect motility in Tregs but was essential for formation of the Treg immune synapse. Furthermore, we identified a novel role for PD-L1-CD80 interactions in suppressing motility specifically in Tregs. Thus, our findings reveal that the three identified ligands of CD80/86, CD28, CTLA-4 and PD-L1, differentially control immune synapse formation and function of the human Teff and Treg cells analyzed here. Individually targeting CD28, CTLA-4 and PD-L1 might therefore represent a valuable therapeutic strategy to treat immune disorders where effector and regulatory T cell functions need to be differentially targeted.

  4. Application of photostable quantum dots for indirect immunofluorescent detection of specific bacterial serotypes on small marine animals

    International Nuclear Information System (INIS)

    Decho, Alan W; Beckman, Erin M; Chandler, G Thomas; Kawaguchi, Tomohiro

    2008-01-01

    An indirect immunofluorescence approach was developed using semiconductor quantum dot nanocrystals to label and detect a specific bacterial serotype of the bacterial human pathogen Vibrio parahaemolyticus, attached to small marine animals (i.e. benthic harpacticoid copepods), which are suspected pathogen carriers. This photostable labeling method using nanotechnology will potentially allow specific serotypes of other bacterial pathogens to be detected with high sensitivity in a range of systems, and can be easily applied for sensitive detection to other Vibrio species such as Vibrio cholerae

  5. Evaluation of immunofluorescence microscopy and enzyme-linked immunosorbent assay in detection of Cryptosporidium and Giardia infections in asymptomatic dogs

    DEFF Research Database (Denmark)

    Rimhanen-Finne, R.; Enemark, Heidi L.; Kolehmainen, J.

    2007-01-01

    The performance of immunofluorescence microscopy (IF) and enzyme-linked immunosorbent assay (ELISA) in canine feces was evaluated. IF and Cryptosporidium ELISA detected 10(5) oocysts/g, while the detection limit for Giardia ELISA was 10(4) cysts/g. The Cryptosporidium ELISA showed 94% specificity...... zoonotic character of Cryptosporidium and Giardia infections in 150 asymptomatic Finnish dogs from the Helsinki area were studied. The overall proportion of dogs positive for Cryptosporidium was 5% (7/150) and that for Giardia 5% (8/150). In dogs...

  6. Children with acute lymphoblastic leukemia show high numbers of CD4+ and CD8+ T-cells which are reduced by conventional chemotherapy

    OpenAIRE

    Mohamed Labib Salem; Mohamed Ramadan El-Shanshory; Nabila Ibrahim El-Desouki; Said Hammad Abdou; Mohamed Attia Attia; Abdel-Aziz Awad Zidan; Shymaa Sobhy Mourad

    2015-01-01

    Background: Acute lymphoblastic leukemia (ALL) is considered as one of the most common cancer in pediatric malignancies. Among ALL, B-cell Acute Lymphoblastic Leukemia (B-ALL) represents 80% to 85% of the childhood ALL. Problem: Although anti B-ALL chemotherapy kill B-ALL, it associates with alteration in the numbers of CD4+ and CD8+ T-cells, and thus impacts the overall immunity. Aim: To evaluate the impact of anti B-ALL on the numbers of CD4+ and CD8+ T-cells in correlation to the n...

  7. Climate change convention

    International Nuclear Information System (INIS)

    Russell, D.

    1992-01-01

    Principles that guide Canada's Green Plan with respect to global warming are outlined. These include respect for nature, meeting environmental goals in an economically beneficial manner, efficient use of resources, shared responsibilities, federal leadership, and informed decision making. The policy side of the international Framework Convention on Climate Change is then discussed and related to the Green Plan. The Convention has been signed by 154 nations and has the long-term objective of stabilizing anthropogenic greenhouse gas concentrations in the atmosphere at levels that prevent dangerous interference with the climate system. Some of the Convention's commitments toward achieving that objective are only applicable to the developed countries. Five general areas of commitment are emissions reductions, assistance to developing countries, reporting requirements, scientific and socioeconomic research, and education. The most controversial area is that of limiting emissions. The Convention has strong measures for public accountability and is open to future revisions. Canada's Green Plan represents one country's response to the Convention commitments, including a national goal to stabilize greenhouse gas emissions at the 1990 level by the year 2000

  8. Weekly monitoring of the effects of conventional external beam radiation therapy on patients with head and neck, chest, and pelvis cancer by means of blood cells count

    Energy Technology Data Exchange (ETDEWEB)

    Lundgren, Maria da Salete Fonseca dos Santos [Hospital Universitario Oswaldo Cruz, Recife, PE (Brazil). Radiotherapy Unit]. E-mail: salete@lundgren.med.br; Cavalcanti, Maria do Socorro de Mendonca [Universidade de Pernambuco, Recife, PE (Brazil); Sampaio, Divaldo de Almeida [Centro de Hematologia de Pernambuco (Hemope), Recife, PE (Brazil)

    2008-01-15

    Objective: To evaluate the necessity of weekly monitoring by means of leukocyte and platelet counts of patients with head and neck, chest, and pelvis cancer submitted to conventional radiotherapy. Materials and methods: A hundred and one adult patients with cancer of head and neck (n = 11), chest (n = 35) and pelvis (n = 55), submitted to radiotherapy were assessed by means of leukocyte and platelet counts on a weekly basis, with a comparison between the results before and during the treatment and in correlation with the area treated, patient's sex and age group. Results: The most significant decrease in leukocytes was observed in the fourth week, when lymphocytes, total leukocytes, neutrophils, monocytes and platelets presented a decrease of 53.5%, 26.8%, 19.4%, 22.2% and 14.6%, respectively, in comparison with the values found before the beginning of the therapy. Geometric means for pelvis during the treatment were lower than those for chest, and head and neck. Lymphocytes demonstrated to be more sensitive to radiation therapy. No alteration was found in leukocyte or platelet counts in correlation with patients' sex or age. Conclusion: Based on the results of the present study, weekly leukocyte and platelet counts do not seem to be useful in the assessment patients submitted to conventional radiotherapy for localized cancer. (author)

  9. Rapid Identification of Dengue Virus Serotypes Using Monoclonal Antibodies in an Indirect Immunofluorescence Test.

    Science.gov (United States)

    1982-06-18

    encephalitis(TBH-28), West Nile(E-101), Yellow fever(French neurotropic and 17D strains), and Zika . Two Sandfly Fever viruses (213452 and Candiru) were...were provided as first passage isolates ( Aedes pseudoscutellaris cells, AP-61) or human serum from recent dengue virus patients. African isolates... viruses of the Phlebovirus genus (Table 1). Several monoclonal antibody preparations reacted solely with dengue virus serotypes. Two preparations (13E7 and

  10. Practical application of immunofluorescence for the detection of bacterial contaminants during vinification

    Directory of Open Access Journals (Sweden)

    Marielle Bouix

    1997-03-01

    Full Text Available This study presents a rapid and specific microscopie technique for detecting and identifying populations of lactic acid bacteria in musts, wines, and inoculum starter cultures. Through the use of fluorescent antibodies, this procedure can be performed in less than two hours, and it is effective with Leuconostoc, Pediococcus and Lactobacillus concentrations as small as 102 cells/ml. Implementation of this technique will assist winemakers in controlling malolactic fermentations and in preventing lactic acid bacterial spoilage.

  11. Protein-free transfection of CHO host cells with an IgG-fusion protein: selection and characterization of stable high producers and comparison to conventionally transfected clones.

    Science.gov (United States)

    Lattenmayer, Christine; Loeschel, Martina; Schriebl, Kornelia; Steinfellner, Willibald; Sterovsky, Thomas; Trummer, Evelyn; Vorauer-Uhl, Karola; Müller, Dethardt; Katinger, Hermann; Kunert, Renate

    2007-04-15

    In order to improve the current techniques of cell cultivation in the absence of serum, we have developed a protein-free transfection protocol for CHO cells, based on the Nucleofector technology. After starting with a heterogeneous pool of primary transfectants which express the fusion protein EpoFc, we isolated single clones and compared them with parallel clones generated by lipofection in serum-dependent cultivation. Our intensive characterization program was based on determination of specific productivity (q(p)) and analysis of genetic parameters. In two nucleofection experiments, transfection with 5 microg of DNA resulted in best productivities of the primary cell pools. After subcloning, the q(p) could be raised up to 27 pg x cells(-1) x day(-1). While the serum-dependent transfectants exhibited specific productivities up to 57 pg x cells(-1) x day(-1) in serum-dependent cultivation, a significant decrease that resulted in the range of q(p) of the protein-free transfectants was observed after switching to protein-free conditions. Investigation of genetic parameters revealed higher mRNA levels and gene copy numbers (GCN) for the protein-free adapted serum-dependent transfectants. Therefore, we assume that problems during protein-free adaptation (PFA) lead to a less efficient translation machinery after serum deprivation. We describe the generation of stable-producing recombinant CHO clones by protein-free transfection of a protein-free adapted host cell line, which reduces the risk of adverse clonal changes after PFA. The main advantage of this approach is the earlier predictability of clone behavior, which makes the generation of production clones by protein-free transfection, a viable and highly efficient strategy for recombinant cell line development. (c) 2006 Wiley Periodicals, Inc.

  12. Incorporation of Viral Glycoprotein VSV-G Improves the Delivery of DNA by Erythrocyte Ghost into Cells Refractory to Conventional Transfection.

    Science.gov (United States)

    Liu, Xin; Li, Yun-Pan; Zhong, Zhen-Min; Tan, Hui-Qi; Lin, Hao-Peng; Chen, Shao-Jun; Fu, Yu-Cai; Xu, Wen-Can; Wei, Chi-Ju

    2017-02-01

    The objective of this study was to formulate a novel gene delivery system based on the erythrocyte ghost (EG) integrated with fusogenic viral glycoprotein vesicular stomatitis virus glycoprotein G (VSV-G). VSV-G proteins were harvested as condition medium of Ad293 cells carrying a VSV-G transgene and then incorporated into EG. Plasmid DNA was condensed by various transfection reagents. A luciferase expression construct (pGL3-control) and a DsRed expression cassette (pCMV-DsRed) were used to evaluate the delivery efficiency of DNA/EG/VSV-G complexes. VSV-G proteins could be incorporated into EG in static incubation under acidic conditions as evidenced by the Western blot analysis. Condensed plasmid DNA was bound mostly to the outer surface of EG, which could be detected by electromicroscopy and measured by electrophoresis. EG/VSV-G complexes stimulated the delivery of pGL3-control into Ad293 cells significantly with the luciferase activity increased about 4-fold as compared to that of the control. The delivery of pCMV-DsRed was also enhanced with the percentage of DsRed-positive Ad293 cells increased from 55 % to about 80 %. Moreover, the transfection efficiency in 3T3, HeLa, INS-1, and bone marrow stem cell (BMSC) cells increased about 2-3-fold. Finally, confocal microscopy analysis showed that incorporation of VSV-G significantly enhanced the endocytosis of EG into target cells. In the present study, a novel type of non-viral DNA delivery vehicle consisting of EG and fusogenic VSV-G proteins was formulated, which showed superior transfection efficiency even in cells resistant to classical transfection.

  13. Resistance to penicillin of Staphylococcus aureus isolates from cows with high somatic cell counts in organic and conventional dairy herds in Denmark

    DEFF Research Database (Denmark)

    Bennedsgaard, Torben W.; Thamsborg, Stig M.; Aarestrup, Frank Møller

    2006-01-01

    Background: Quarter milk samples from cows with high risk of intramammary infection were examined to determine the prevalence of Staphylococcus aureus (SA) and penicillin resistant SA (SAr) in conventional and organic dairy herds and herds converting to organic farming in a combined longitudinal......: 2%-5%) respectively. The prevalence of penicillin resistance among SA infected cows was 12% (95% confidence interval: 6%-19%) when calculated from the first herd visits. No statistically significant differences were observed in the prevalence of SAr or the proportion of isolates resistant...... to penicillin between herd groups. Conclusion: The proportion of isolates resistant to penicillin was low compared to studies in other countries except Norway and Sweden. Based on the low prevalence of penicillin resistance of SA, penicillin should still be the first choice of antimicrobial agent for treatment...

  14. Evaluating the antidiabetic effects of Chinese herbal medicine: Xiao-Ke-An in 3T3-L1 cells and KKAy mice using both conventional and holistic omics approaches.

    Science.gov (United States)

    Yang, Zhenzhong; Wang, Linli; Zhang, Feng; Li, Zheng

    2015-08-13

    Xiao-Ke-An (XKA) is a Chinese medicine widely used for treating type 2 diabetes mellitus (T2D). It is composed of eight herbal medicines traditionally used for T2D, including Rehmannia glutinosa Libosch, Anemarrhena asphodeloides Bunge, Coptis chinensis Franch, etc. The aim of the present study was to investigate the antidiabetic effects of XKA with both conventional and holistic omics approaches. The antidiabetic effect of XKA was first investigated in 3T3-L1 cells to study the effect of XKA on adipogenesis in vitro. Oil Red O staining was performed to determine the lipid accumulation. The intracellular total cholesterol (TC) and triglyceride (TG) contents in XKA treated 3T3-L1 cells were also evaluated. The therapeutic effects of XKA was further evaluated in KKAy mice with both conventional and holistic omics approaches. Body weight, fasting and non-fasting blood glucose, and oral glucose tolerance were measured during the experiment. At the time of sacrifice, serum was collected for the measurement of TG, TC, high-density lipoprotein cholesterol (HDL-c) and low-density lipoprotein cholesterol (LDL-c). The liver, kidney, spleen, pancreas, heart and adipose tissues were harvested and weighted. The liver was used for further microarray experiment. Omics approaches were adopted to evaluate the holistic rebalancing effect of XKA at molecular network level. XKA significantly inhibited adipogenic differentiation, lowered the intracellular TC and TG contents in 3T3-L1 cells. XKA improved the glucose homeostasis and lipid metabolism, ameliorated insulin resistance in KKAy mice. Furthermore, XKA also exhibited effective therapeutic effects by reversing the molecular T2D disease network from an unbalanced state. This study investigated the antidiabetic effects of XKA with both conventional and holistic omics approaches, providing both phenotypic evidence and underlying action mechanisms for the clinical use of XKA treating T2D.

  15. Performance analysis of automated evaluation of Crithidia luciliae-based indirect immunofluorescence tests in a routine setting - strengths and weaknesses.

    Science.gov (United States)

    Hormann, Wymke; Hahn, Melanie; Gerlach, Stefan; Hochstrate, Nicola; Affeldt, Kai; Giesen, Joyce; Fechner, Kai; Damoiseaux, Jan G M C

    2017-11-27

    Antibodies directed against dsDNA are a highly specific diagnostic marker for the presence of systemic lupus erythematosus and of particular importance in its diagnosis. To assess anti-dsDNA antibodies, the Crithidia luciliae-based indirect immunofluorescence test (CLIFT) is one of the assays considered to be the best choice. To overcome the drawback of subjective result interpretation that inheres indirect immunofluorescence assays in general, automated systems have been introduced into the market during the last years. Among these systems is the EUROPattern Suite, an advanced automated fluorescence microscope equipped with different software packages, capable of automated pattern interpretation and result suggestion for ANA, ANCA and CLIFT analysis. We analyzed the performance of the EUROPattern Suite with its automated fluorescence interpretation for CLIFT in a routine setting, reflecting the everyday life of a diagnostic laboratory. Three hundred and twelve consecutive samples were collected, sent to the Central Diagnostic Laboratory of the Maastricht University Medical Centre with a request for anti-dsDNA analysis over a period of 7 months. Agreement between EUROPattern assay analysis and the visual read was 93.3%. Sensitivity and specificity were 94.1% and 93.2%, respectively. The EUROPattern Suite performed reliably and greatly supported result interpretation. Automated image acquisition is readily performed and automated image classification gives a reliable recommendation for assay evaluation to the operator. The EUROPattern Suite optimizes workflow and contributes to standardization between different operators or laboratories.

  16. Optimization of Single- and Dual-Color Immunofluorescence Protocols for Formalin-Fixed, Paraffin-Embedded Archival Tissues.

    Science.gov (United States)

    Kajimura, Junko; Ito, Reiko; Manley, Nancy R; Hale, Laura P

    2016-02-01

    Performance of immunofluorescence staining on archival formalin-fixed paraffin-embedded human tissues is generally not considered to be feasible, primarily due to problems with tissue quality and autofluorescence. We report the development and application of procedures that allowed for the study of a unique archive of thymus tissues derived from autopsies of individuals exposed to atomic bomb radiation in Hiroshima, Japan in 1945. Multiple independent treatments were used to minimize autofluorescence and maximize fluorescent antibody signals. Treatments with NH3/EtOH and Sudan Black B were particularly useful in decreasing autofluorescent moieties present in the tissue. Deconvolution microscopy was used to further enhance the signal-to-noise ratios. Together, these techniques provide high-quality single- and dual-color fluorescent images with low background and high contrast from paraffin blocks of thymus tissue that were prepared up to 60 years ago. The resulting high-quality images allow the application of a variety of image analyses to thymus tissues that previously were not accessible. Whereas the procedures presented remain to be tested for other tissue types and archival conditions, the approach described may facilitate greater utilization of older paraffin block archives for modern immunofluorescence studies. © 2016 The Histochemical Society.

  17. A novel immunofluorescence flow cytometry technique detects the expansion of brown tides caused by Aureoumbra lagunensis to the Caribbean Sea.

    Science.gov (United States)

    Koch, F; Kang, Y; Villareal, T A; Anderson, D M; Gobler, C J

    2014-08-01

    During the past 3 decades, brown tides caused by the pelagophytes Aureococcus anophagefferens and Aureoumbra lagunensis have caused ecological and economic damage to coastal ecosystems across the globe. While blooms of A. lagunensis had previously been confined to Texas, in 2012, an expansive brown tide occurred on Florida's East Coast, causing widespread disruption within the Indian River and Mosquito Lagoons and generating renewed interest in this organism. A major impediment to detailed investigations of A. lagunensis in an ecosystem setting has been the absence of a rapid and reliable method for cell quantification. The combination of their small size (3 to 5 μm) and nondescript extracellular features makes identification and enumeration of these cells with conventional methods a challenge. Here we report the development of an immunological-based flow cytometry method that uses a fluorescently labeled antibody developed against A. lagunensis. This method is species specific, sensitive (detection limit of 1.5 × 10(3) cells ml(-1)), precise (1% relative standard deviation of replicated samples), and accurate (108% ± 8% recovery of spiked samples) over a wide range of cell concentrations. Furthermore, this method effectively quantifies A. lagunensis in both glutaraldehyde- and formalin-preserved samples, yields a high throughput of samples (∼35 samples h(-1)), and is cost-effective, making it an ideal tool for managers and scientists. This method successfully documented the recurrence of a brown tide bloom in Florida in 2013. Bloom densities were highest in June (>2.0 × 10(6) cells ml(-1)) and spanned >60 km from the Ponce de Leon inlet in the northern Mosquito Lagoon south to Titusville in the Indian River Lagoon. Low levels of A. lagunensis cells were found >250 km south of this region. This method also quickly and accurately identified A. lagunensis as the causative agent of a 2013 brown tide bloom in Guantanamo Bay, Cuba, and thus should prove useful for

  18. Tritium and OSPAR convention

    International Nuclear Information System (INIS)

    2009-01-01

    The missions and the organisation of the OSPAR convention on protection of the NE Atlantic marine environment are given. The OSPAR strategy for the radioactive substances is stated. The results of work programme of the radioactive Substances committee are described and the consensus reached by contracting parties on the appropriate arrangements for this radionuclide is presented. (authors)

  19. Revised C++ coding conventions

    CERN Document Server

    Callot, O

    2001-01-01

    This document replaces the note LHCb 98-049 by Pavel Binko. After a few years of practice, some simplification and clarification of the rules was needed. As many more people have now some experience in writing C++ code, their opinion was also taken into account to get a commonly agreed set of conventions

  20. Global climate convention

    International Nuclear Information System (INIS)

    Simonis, U.E.

    1991-01-01

    The effort of negotiate a global convention on climate change is one of mankind's great endeavours - and a challenge to economists and development planners. The inherent linkages between climate and the habitability of the earth are increasingly well recognized, and a convention could help to ensure that conserving the environment and developing the economy in the future must go hand in hand. Due to growing environmental concern the United Nations General Assembly has set into motion an international negotiating process for a framework convention on climate change. One the major tasks in these negotiations is how to share the duties in reducing climate relevant gases, particularly carbon dioxide (CO 2 ), between the industrial and the developing countries. The results and proposals could be among the most far-reaching ever for socio-economic development, indeed for global security and survival itself. While the negotiations will be about climate and protection of the atmosphere, they will be on fundamental global changes in energy policies, forestry, transport, technology, and on development pathways with low greenhouse gas emissions. Some of these aspects of a climate convention, particularly the distributional options and consequences for the North-South relations, are addressed in this chapter. (orig.)

  1. The effect of deep frying or conventional oven cooking on inactivation of Shiga toxin-producing cells of Escherichia coli (STEC) in meatballs

    Science.gov (United States)

    We investigated the effects deep frying or oven cooking on inactivation of Shiga toxin-producing cells of Escherichia coli (STEC) in meatballs. A finely-ground veal and/or a beef-pork-veal mixture were inoculated (ca. 7.0 log CFU/g) with an eight-strain, genetically-marked cocktail of rifampicin-res...

  2. Five compared with six fractions per week of conventional radiotherapy of squamous-cell carcinoma of head and neck: DAHANCA 6 and 7 randomised controlled trial

    DEFF Research Database (Denmark)

    Overgaard, Jens; Hansen, Hanne Sand; Specht, Lena

    2003-01-01

    Although head and neck cancer can be cured by radiotherapy, the optimum treatment time for locoregional control is unclear. We aimed to find out whether shortening of treatment time by use of six instead of five radiotherapy fractions per week improves the tumour response in squamous-cell carcinoma....

  3. IL-15 Renders Conventional Lymphocytes Resistant to Suppressive Functions of Regulatory T Cells through Activation of the Phosphatidylinositol 3-Kinase Pathway

    NARCIS (Netherlands)

    Ahmed, Melika Ben; Hmida, Nadia Belhadj; Moes, Nicolette; Buyse, Sophie; Abdeladhim, Maha; Louzir, Hechmi; Cerf-Bensussan, Nadine

    2009-01-01

    IL-15 drives chronic inflammation in several human diseases. We have recently shown that IL-15 inhibits the immunosuppressive effects of TGF-beta through blockage of the Smad3-signaling pathway. Data pointing to reciprocal interactions between TGF-beta and CD4(+) regulatory T cells led us to

  4. Serine34 phosphorylation of RHO guanine dissociation inhibitor (RHOGDI{alpha}) links signaling from conventional protein kinase C to RHO GTPase in cell adhesion

    DEFF Research Database (Denmark)

    Dovas, Athanassios; Choi, Youngsil; Yoneda, Atsuko

    2010-01-01

    . Phosphospecific antibodies reveal endogenous phosphorylation in several cell types that is sensitive to adhesion events triggered, for example, by hepatocyte growth factor. Phosphorylation is also sensitive to PKC inhibition. Together with FRET microscopy sensing GTP-RhoA levels, the data reveal a common pathway...

  5. A direct view by immunofluorescent comet assay (IFCA) of DNA damage induced by nicking and cutting enzymes, ionizing (137)Cs radiation, UV-A laser microbeam irradiation and the radiomimetic drug bleomycin.

    Science.gov (United States)

    Grigaravicius, Paulius; Rapp, Alexander; Greulich, Karl Otto

    2009-03-01

    In DNA repair research, DNA damage is induced by different agents, depending on the technical facilities of the investigating researchers. A quantitative comparison of different investigations is therefore often difficult. By using a modified variant of the neutral comet assay, where the histone H1 is detected by immunofluorescence [immunofluorescent comet assay (IFCA)], we achieve previously unprecedented resolution in the detection of fragmented chromatin and show that trillions of ultraviolet A photons (of a few eV), billions of bleomycin (BLM) molecules and thousands of gamma quanta (of 662 keV) generate, in first order, similar damage in the chromatin of HeLa cells. A somewhat more detailed inspection shows that the damage caused by 20 Gy ionizing radiation and by a single laser pulse of 10 microJ are comparable, while the damage caused by 12 microg/ml BLM depends highly on the individual cell. Taken together, this work provides a detailed view of DNA fragmentation induced by different treatments and allows comparing them to some extent, especially with respect to the neutral comet assay.

  6. Localisation of calcium-binding proteins in ram spermatozoa using the immunofluorescence technique

    International Nuclear Information System (INIS)

    Sabrina Sukardi; Watson, P.F.

    2000-01-01

    Localization of two calcium-binding proteins (proteins A and B) believed to be involve in membrane fusion on whole spermatozoa were carried out in two stages; before and after the acrosome reaction, the reaction being a prerequisite to fertilization. Determination of the acrosome reaction and sperm viability is carried out using fluorescent dyes i.e., FITC-conjugated Pisum sativum agglutinin (PSA) and propidium iodide (PI) respectively. Polyclonal antibodies were raised in rabbits. Ejaculated semen was diluted in buffer and loaded into tubes. Acrosome reaction was induced with calcium ionophore A23187 at 390 degree C. PI was added to the sub-samples at time 0 and 45 minutes. Excess PI, ionophore and seminal plasma was filtered out with a syringe. Smears were made on slides and air-dried. The cells were pemeabilised with ethanol and rinsed in PBS. Batch 1 slides were incubated with FITC-PSA in the dark while batch H slides were incubated in 1% sheep serum. Batch II slides were then rinsed in PBS twice and incubated in both antiserum and pre-immune serum (negative control). These slides were then incubated in FITC-conjugated secondary antibody (anti-rabbit IgG) and kept in the dark. After final washing and mounted, both batches of slides were viewed immediately using fluorescence microscope. Results obtained before acrosome reaction showed localization of both antibodies to the whole sperm head, along the midpiece and tail. The acrosomes were also intact and cells were viable. After the acrosome reaction, localization of both antibodies were observed at the post-acrosomal region, midpiece, tail and the equatorial segment with no binding to the acrosome. Cells were mainly acrosome-reacted and dying. No binding was observed with pre-immune serum. Results indicate that the antigens were present in the acrosome and the change in binding suggests that the antigens have been redistributed after commencement of the acrosome reaction. The findings suggest that the proteins

  7. Accelerated hypofractionated radiation therapy compared to conventionally fractionated radiation therapy for the treatment of inoperable non-small cell lung cancer

    Directory of Open Access Journals (Sweden)

    Amini Arya

    2012-03-01

    Full Text Available Abstract Background While conventionally fractionated radiation therapy alone is an acceptable option for poor prognostic patients with unresectable stage III NSCLC, we hypothesized that accelerated hypofractionated radiotherapy will have similar efficacy without increasing toxicity. Methods This is a retrospective analysis of 300 patients diagnosed with stage III NSCLC treated between 1993 and 2009. Patients included in the study were medically or surgically inoperable, were free of metastatic disease at initial workup and did not receive concurrent chemotherapy. Patients were categorized into three groups. Group 1 received 45 Gy in 15 fractions over 3 weeks (Accelerated Radiotherapy (ACRT while group 2 received 60-63 Gy (Standard Radiation Therapy 1 (STRT1 and group 3 received > 63 Gy (Standard Radiation Therapy (STRT2. Results There were 119 (39.7% patients in the ACRT group, 90 (30.0% in STRT1 and 91 (30.3% in STRT2. More patients in the ACRT group had KPS ≤ 60 (p 5% (p = 0.002, and had stage 3B disease (p Conclusions Despite the limitations of a retrospective analysis, our experience of accelerated hypofractionated radiation therapy with 45 Gy in 15 fractions appears to be an acceptable treatment option for poor performance status patients with stage III inoperable tumors. Such a treatment regimen (or higher doses in 15 fractions should be prospectively evaluated using modern radiation technologies with the addition of sequential high dose chemotherapy in stage III NSCLC.

  8. Detection of cerebrovascular disease in patients with sickle cell disease using transcranial Doppler sonography: correlation with MRI, MRA and conventional angiography

    Energy Technology Data Exchange (ETDEWEB)

    Verlhac, S. [Service de Radiologie, Centre Hospitalier Intercommunal, 94 - Creteil (France); Bernaudin, F. [Service de Pediatrie, Centre Hospitalier Intercommunal, 94 - Creteil (France); Tortrat, D. [Association Claude Bernard, 75 - Paris (France); Brugieres, P. [Service de Neuroradiologie, Hopital Henri Mondor, 94 - Creteil (France); Mage, K. [Service de Radiologie, Centre Hospitalier Intercommunal, 94 - Creteil (France); Gaston, A. [Service de Neuroradiologie, Hopital Henri Mondor, 94 - Creteil (France); Reinert, P. [Service de Pediatrie, Centre Hospitalier Intercommunal, 94 - Creteil (France)

    1995-11-01

    A prospective study of 58 patients with sickle cell disease (SCD) by transcranial Doppler sonography (TCD) included both MRI and MRA in patients over 7 years of age and those with abnormal TCD. Arteriography was performed in cases where a stenosis was suspected on TCD. Middle cerebral artery (MCA) and basilar artery (BA) velocities were significantly higher in the sickle cell hemoglobin SS group than in the hemoglobin SC group. Patients with a MCA mean velocity of over 1.90 m/s had stenoses found by arteriography. Patients with unilaterally undetectable MCA flow had experienced a stroke and MCA thrombosis was confirmed at MRA and arteriography. We concluded that TCD is valuable in detecting arterial stenosis in SCD and will lead to consideration of these patients for intensive therapy, such as bone marrow transplantation (BMT) or transfusion regimes. (orig.)

  9. Detection of cerebrovascular disease in patients with sickle cell disease using transcranial Doppler sonography: correlation with MRI, MRA and conventional angiography

    International Nuclear Information System (INIS)

    Verlhac, S.; Bernaudin, F.; Tortrat, D.; Brugieres, P.; Mage, K.; Gaston, A.; Reinert, P.

    1995-01-01

    A prospective study of 58 patients with sickle cell disease (SCD) by transcranial Doppler sonography (TCD) included both MRI and MRA in patients over 7 years of age and those with abnormal TCD. Arteriography was performed in cases where a stenosis was suspected on TCD. Middle cerebral artery (MCA) and basilar artery (BA) velocities were significantly higher in the sickle cell hemoglobin SS group than in the hemoglobin SC group. Patients with a MCA mean velocity of over 1.90 m/s had stenoses found by arteriography. Patients with unilaterally undetectable MCA flow had experienced a stroke and MCA thrombosis was confirmed at MRA and arteriography. We concluded that TCD is valuable in detecting arterial stenosis in SCD and will lead to consideration of these patients for intensive therapy, such as bone marrow transplantation (BMT) or transfusion regimes. (orig.)

  10. Analysis of environmental factors impacting the life cycle cost analysis of conventional and fuel cell/battery-powered passenger vehicles. Final report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-01-31

    This report presents the results of the further developments and testing of the Life Cycle Cost (LCC) Model previously developed by Engineering Systems Management, Inc. (ESM) on behalf of the U.S. Department of Energy (DOE) under contract No. DE-AC02-91CH10491. The Model incorporates specific analytical relationships and cost/performance data relevant to internal combustion engine (ICE) powered vehicles, battery powered electric vehicles (BPEVs), and fuel cell/battery-powered electric vehicles (FCEVs).

  11. Conventions and Institutional Logics

    DEFF Research Database (Denmark)

    Westenholz, Ann

    Two theoretical approaches – Conventions and Institutional Logics – are brought together and the similarities and differences between the two are explored. It is not the intention to combine the approaches, but I would like to open both ‘boxes’ and make them available to each other with the purpose...... of creating a space for dialog. Both approaches were developed in the mid-1980s as a reaction to rational-choice economic theory and collectivistic sociological theory. These two theories were oversimplifying social life as being founded either in actor-micro level analyses or in structure-macro level...... analyses. The theoretical quest of both Conventions and Institutional Logics has been to understand the increasing indeterminacy, uncertainty and ambiguity in people’s lives where a sense of reality, of value, of moral, of feelings is not fixed. Both approaches have created new theoretical insights...

  12. Manado Convention Centre (Megastructures)

    OpenAIRE

    Anggianto, Rio M; Rate, Johannes Van

    2013-01-01

    Proyek Manado Convention Center ini pada dasarnya merupakan wadah atau sarana komunikasi antara dua pihak dengan penerapkan berbagai metode komunikasi langsung tatap muka baik itu dari perorangan terhadap kelompok, kelompok terhadap kelompok atau kelompok terhadap masyarakat. Dan pada era kini hal ini menjadi suatu kebutuhan yang dianganggap penting. Kota Manado seringkali menjadi tuan rumah suatu konverensi dengan jumlah peserta yang tergolong besar karena cakupannya sampai manca negara....

  13. The conventional quark picture

    International Nuclear Information System (INIS)

    Dalitz, R.H.

    1976-01-01

    For baryons, mesons and deep inelastic phenomena the ideas and the problems of the conventional quark picture are pointed out. All observed baryons fit in three SU(3)-multiplets which cluster into larger SU(6)-multiplets. No mesons are known which have quantum numbers inconsistent with belonging to a SU(3) nonet or octet. The deep inelastic phenomena are described in terms of six structure functions of the proton. (BJ) [de

  14. Glutamic acid decarboxylase isoform distribution in transgenic mouse septum: an anti-GFP immunofluorescence study.

    Science.gov (United States)

    Verimli, Ural; Sehirli, Umit S

    2016-09-01

    The septum is a basal forebrain region located between the lateral ventricles in rodents. It consists of lateral and medial divisions. Medial septal projections regulate hippocampal theta rhythm whereas lateral septal projections are involved in processes such as affective functions, memory formation, and behavioral responses. Gamma-aminobutyric acidergic neurons of the septal region possess the 65 and 67 isoforms of the enzyme glutamic acid decarboxylase. Although data on the glutamic acid decarboxylase isoform distribution in the septal region generally appears to indicate glutamic acid decarboxylase 67 dominance, different studies have given inconsistent results in this regard. The aim of this study was therefore to obtain information on the distributions of both of these glutamic acid decarboxylase isoforms in the septal region in transgenic mice. Two animal groups of glutamic acid decarboxylase-green fluorescent protein knock-in transgenic mice were utilized in the experiment. Brain sections from the region were taken for anti-green fluorescent protein immunohistochemistry in order to obtain estimated quantitative data on the number of gamma-aminobutyric acidergic neurons. Following the immunohistochemical procedures, the mean numbers of labeled cells in the lateral and medial septal nuclei were obtained for the two isoform groups. Statistical analysis yielded significant results which indicated that the 65 isoform of glutamic acid decarboxylase predominates in both lateral and medial septal nuclei (unpaired two-tailed t-test p glutamic acid decarboxylase isoform 65 in the septal region in glutamic acid decarboxylase-green fluorescent protein transgenic mice.

  15. Direct immunofluorescence and enzyme-linked immunosorbent assays for evaluating chlorinated hydrocarbon degrading bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Brigmon, R.L.; Franck, M.M.; Brey, J.; Fliermans, C.B. [Westinghouse Savannah River, Aiken, SC (United States). Environmental Biotechnology Section; Scott, D.; Lanclos, K. [Medical Coll. of Georgia, Augusta, GA (United States)

    1997-06-01

    Immunological procedures were developed to enumerate chlorinated hydrocarbon degrading bacteria. Polyclonal antibodies (Pabs) were produced by immunizing New Zealand white rabbits against 18 contaminant-degrading bacteria. These included methanotrophic and chlorobenzene (CB) degrading species. An enzyme-linked immunosorbent assay (ELISA) was used to test for specificity and sensitivity of the Pabs. Direct fluorescent antibodies (DFAs) were developed with these Pabs against select methanotrophic bacteria isolated from a trichloroethylene (TCE) contaminated landfill at the Savannah River Site (SRS) and cultures from the American Type Culture Collection (ATCC). Analysis of cross reactivity testing data showed some of the Pabs to be group specific while others were species specific. The threshold of sensitivity for the ELISA is 105 bacteria cells/ml. The DFA can detect as few as one bacterium per ml after concentration. Results from the DFA and ELISA techniques for enumeration of methanotrophic bacteria in groundwater were higher but not significantly different (P < 0.05) compared to indirect microbiological techniques such as MPN. These methods provide useful information on in situ community structure and function for bioremediation applications within 1--4 hours of sampling.

  16. Comparison of immunofluorescence investigations and a new anti-DNA-antibody radioimmunoassay for the diagnosis of connective tissue diseases

    International Nuclear Information System (INIS)

    Neumeier, D.; Vogt, W.; Knedel, M.

    1976-01-01

    The procedure of determining the anti-DNA antibody activity is simplified by high-molecular double strand DNA labelled with 125 I. Cases of suspected connective tissue disease should first be examined by immunofluorescence microscopy, since this method can detect a wider spectrum of diseases with similar symptoms. For a differential diagnosis of SLE, the anti-DNA antibody activity is then investigated by a radioimmunoassay. When assessing the antibody activity, the following criteria should be kept in mind: - Findings of less than 10 units/ml serum do not indicate pathological changes, - Higher antibody activities up to 35 units/ml serum may occur in SLE patients but are also possible in other ANA positive diseases with similar symptoms, - Activities over 35 units/ml serum are nearly always a sign of SLE. (orig./GSE) [de

  17. Comparison of immunofluorescence investigations and a new anti-DNA-antibody radioimmunoassay for the diagnosis of connective tissue diseases

    Energy Technology Data Exchange (ETDEWEB)

    Neumeier, D; Vogt, W; Knedel, M

    1976-01-01

    The procedure of determining the anti-DNA antibody activity is simplified by high-molecular double strand DNA labelled with /sup 125/I. Cases of suspected connective tissue disease should first be examined by immunofluorescence microscopy, since this method can detect a wider spectrum of diseases with similar symptoms. For a differential diagnosis of SLE, the anti-DNA antibody activity is then investigated by a radioimmunoassay. When assessing the antibody activity, the following criteria should be kept in mind: - Findings of less than 10 units/ml serum do not indicate pathological changes, - Higher antibody activities up to 35 units/ml serum may occur in SLE patients but are also possible in other ANA positive diseases with similar symptoms, - Activities over 35 units/ml serum are nearly always a sign of SLE.

  18. Neuroprotective effect of edaravone in experimental glaucoma model in rats: a immunofluorescence and biochemical analysis

    Directory of Open Access Journals (Sweden)

    Arzu Toruk Aksar

    2015-04-01

    Full Text Available AIM: To evaluate the neuroprotective activity of systemically administered edaravone in early and late stage of experimental glaucoma in rats. METHODS: In this study, 60 Wistar albino rats were used. Experimental glaucoma model was created by injecting hyaluronic acid to the anterior chamber once a week for 6wk in 46 of 60 subjects. Fourteen subjects without any medication were included as control group. Edaravone administered intraperitoneally 3 mg/kg/d to the 15 of 30 subjects starting at the onset of glaucoma induction and also administered intraperitoneally 3 mg/kg/d to the other 15 subjects starting at three weeks after the onset of glaucoma induction. The other 16 subjects who underwent glaucoma induction was administered any therapy. Retinal ganglion cells (RGCs have been marked with dextran tetramethylrhodamine (DTMR retrograde at the end of the sixth week and after 48h, subjects were sacrificed by the method of cardiac perfusion. Alive RGC density was assessed in the whole-mount retina. Whole-mount retinal tissues homogenized and nitric oxide (NO, malondialdehyde (MDA and total antioxidant capacity (TAC values were measured biochemically. RESULTS: RGCs counted with Image-Pro Plus program, in the treatment group were found to be statistically significantly protected, compared to the glaucoma group (Bonferroni, P<0.05. The neuroprotective activity of edaravone was found to be more influential by administration at the start of the glaucoma process. Statistically significant lower NO levels were determined in the glaucoma group comparing treatment groups (Bonferroni, P<0.05. MDA levels were found to be highest in untreated glaucoma group, TAC levels were found to be lower in the glaucoma induction groups than the control group (Bonferroni, P<0.05. CONCLUSION: Systemic administration of Edaravone in experimental glaucoma showed potent neuroprotective activity. The role of oxidative stress causing RGC damage in glaucoma was supported by this

  19. Use of a Granulocyte Immunofluorescence Assay Designed for Humans for Detection of Antineutrophil Cytoplasmic Antibodies in Dogs with Chronic Enteropathies.

    Science.gov (United States)

    Florey, J; Viall, A; Streu, S; DiMuro, V; Riddle, A; Kirk, J; Perazzotti, L; Affeldt, K; Wagner, R; Vaden, S; Harris, T; Allenspach, K

    2017-07-01

    Perinuclear antineutrophil cytoplasmic antibodies (pANCA) previously have been shown to be serum markers in dogs with chronic enteropathies, with dogs that have food-responsive disease (FRD) having higher frequencies of seropositivity than dogs with steroid-responsive disease (SRD). The indirect immunofluorescence (IIF) assay used in previous publications is time-consuming to perform, with low interobserver agreement. We hypothesized that a commercially available granulocyte IIF assay designed for humans could be used to detect perinuclear antineutrophil cytoplasmic antibodies in dogs. Forty-four dogs with FRD, 20 dogs with SRD, 20 control dogs, and 38 soft-coated wheaten terrier (SCWT) or SCWT-cross dogs. A granulocyte assay designed for humans was used to detect pANCA, cANCA, and antinuclear antibodies (ANA), as well as antibodies against proteinase-3 protein (PR-3) and myeloperoxidase protein (MPO) in archived serum samples. Sensitivity of the granulocyte assay to predict FRD in dogs was 0.61 (95% confidence interval (CI), 0.45, 0.75), and specificity was 1.00 (95% CI, 0.91, 1.00). A significant association was identified between positive pANCA or cANCA result and diagnosis of FRD (P < 0.0001). Agreement between the two assays to detect ANCA in the same serum samples from SCWT with protein-losing enteropathy/protein-losing nephropathy (PLE/PLN) was substantial (kappa, 0.77; 95% CI, 0.53, 1.00). Eight ANCA-positive cases were positive for MPO or PR-3 antibodies. The granulocyte immunofluorescence assay used in our pilot study was easy and quick to perform. Agreement with the previously published method was good. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  20. Strategic interaction and conventions

    Directory of Open Access Journals (Sweden)

    Espinosa, María Paz

    2012-03-01

    Full Text Available The scope of the paper is to review the literature that employs coordination games to study social norms and conventions from the viewpoint of game theory and cognitive psychology. We claim that those two alternative approaches are in fact complementary, as they provide different insights to explain how people converge to a unique system of self-fulfilling expectations in presence of multiple, equally viable, conventions. While game theory explains the emergence of conventions relying on efficiency and risk considerations, the psychological view is more concerned with frame and labeling effects. The interaction between these alternative (and, sometimes, competing effects leads to the result that coordination failures may well occur and, even when coordination takes place, there is no guarantee that the convention eventually established will be the most efficient.

    El objetivo de este artículo es presentar la literatura que emplea los juegos de coordinación para el estudio de normas y convenciones sociales, que se han analizado tanto desde el punto de vista de la teoría de juegos como de la psicología cognitiva. Argumentamos en este trabajo que estos dos enfoques alternativos son en realidad complementarios, dado que ambos contribuyen al entendimiento de los procesos mediante los cuales las personas llegan a coordinarse en un único sistema de expectativas autorrealizadas, en presencia de múltiples convenciones todas ellas igualmente viables. Mientras que la teoría de juegos explica la aparición de convenciones basándose en argumentos de eficiencia y comportamientos frente al riesgo, el enfoque de la psicología cognitiva utiliza en mayor medida consideraciones referidas al entorno y naturaleza de las decisiones. La interacción entre estos efectos diferentes (y en ocasiones, rivales desemboca con frecuencia en fallos de coordinación y, aun cuando la coordinación se produce, no hay garantía de que la convención en vigor sea la m

  1. Digitization of conventional radiographs

    International Nuclear Information System (INIS)

    Wenz, W.; Buitrago-Tellez, C.; Blum, U.; Hauenstein, K.H.; Gufler, H.; Meyer, E.; Ruediger, K.

    1992-01-01

    The diagnostic value of a digitization system for analogue films based on a charge-coupled-device (CCD) scanner with adjustable resolution of 2.5 or 5 lp/mm was assessed. Some 110 skeletal radiographs, 50 contrast studies, including 25 of patients with Crohn's disease, and 70 abdominal plain films before and after successful lithotripsy for renal stones were digitized. Receiver operating characteristic (ROC) studies showed improved detection of cortical and trabecular defects with contrast-optimized digitized films. Edge enhancement algorithms yielded no additional information. Inflammatory lesions of Crohn's disease were detected equally well by conventional films and digitized images. A statistically significant improvement (p [de

  2. Conventional RF system design

    International Nuclear Information System (INIS)

    Puglisi, M.

    1994-01-01

    The design of a conventional RF system is always complex and must fit the needs of the particular machine for which it is planned. It follows that many different design criteria should be considered and analyzed, thus exceeding the narrow limits of a lecture. For this reason only the fundamental components of an RF system, including the generators, are considered in this short seminar. The most common formulas are simply presented in the text, while their derivations are shown in the appendices to facilitate, if desired, a more advanced level of understanding. (orig.)

  3. Conventional magnets. Pt. 1

    International Nuclear Information System (INIS)

    Marks, N.

    1994-01-01

    The design and construction of conventional, steel-cored, direct-current magnets are discussed. Laplace's equation and the associated cylindrical harmonic solutions in two dimensions are established. The equations are used to define the ideal pole shapes and required excitation for dipole, quadrupole and sextupole magnets. Standard magnet geometries are then considered and criteria determining the coil design are presented. The use of codes for predicting flux density distributions and the iterative techniques used for pole face design are then discussed. This includes a description of the use of two-dimensional codes to generate suitable magnet end geometries. Finally, standard constructional techniques for cores and coils are described. (orig.)

  4. Development of fibre and parenchyma cells in the bamboo Phyllostachys viridi-glaucescens

    International Nuclear Information System (INIS)

    Crow, E.

    2000-02-01

    The development of the shoot apex and the ontogeny of fibre and parenchyma cells in elongating shoots of the bamboo Phyllostachys viridi-glaucescens (Carr.) Riv. and Riv., seen under the light microscope is described. Fibre cells differentiated from cells of the procambium, whilst the parenchyma cells differentiated from cells of the primary thickening meristem which surround the procambium strands. Three stages of early fibre and parenchyma cell development were identified and these are referred to in subsequent studies of cell wall development. The cytology of developing internodal fibre and parenchyma cells seen under the transmission electron microscope (TEM) is described. There were few ultrastructural features to distinguish the two cell types. Thiery's PATAg test was performed to identify organelles which may be associated with the synthesis of polysaccharides destined for the cell wall. The ultrastructural results are discussed in terms of the process of cell wall deposition. Observations were made of cytoskeletal elements using indirect immunofluorescence techniques. Orientations of cortical microtubules differed from those of the microfilaments throughout early development. Filaments on the inner walls of cells seen under the conventional scanning electron microscope (SEM) were cytoskeletal-like in their orientation and form. Immunogold labelling techniques were performed in an attempt to confirm their identity. Staining with safranin and alcian blue allowed an anatomical description of wall development in fibre and parenchyma cells. These studies were coupled with observations using polarizing optics where cellulose microfibril orientations of the primary and secondary wall layers were established. The field emission scanning electron microscope (FESEM) was used to describe microfibril orientations seen on the inner wall of developing and maturing fibre and parenchyma cells. Chemical extraction of wall matrix materials was necessary for maturing tissue

  5. HMB-45 reactivity in conventional uterine leiomyosarcomas.

    Science.gov (United States)

    Simpson, Karen W; Albores-Saavedra, Jorge

    2007-01-01

    We studied the human melanoma black-45 (HMB-45) reactivity in 25 uterine leiomyosarcomas including 23 conventional and 2 myxoid variants. Eleven tumors were poorly differentiated, and 14 were well to moderately differentiated. Nine uterine leiomyosarcomas labeled with HMB-45 in 10% or less of the tumor cells. Six were poorly differentiated and 3 were well differentiated. Our study indicates that 36% of conventional leiomyosarcomas focally express HMB-45. HMB-45 reactivity was more common in the poorly differentiated than in the well-differentiated group of leiomyosarcomas. In light of our findings and of those recently reported in the literature, we believe that the term PEComa should not be used for uterine leiomyosarcomas with clear cells or for conventional leiomyosarcomas that stain positively with HMB-45.

  6. Demonstration of strong enterobacterial reactivity of CD4+CD25- T cells from conventional and germ-free mice which is counter-regulated by CD4+CD25+ T cells

    DEFF Research Database (Denmark)

    Gad, Monika; Pedersen, Anders Elm; Kristensen, Nanna N

    2004-01-01

    Unfractionated CD4+ T cells from the gut-associated lymphoid tissue (GALT) and peripheral lymph nodes are unresponsive when exposed to enterobacterial antigens in vitro. Under similar conditions, CD4+ T cells depleted in vivo or in vitro of CD4+CD25+ T cells proliferate extensively. The CD4+CD25- T...

  7. Development of conventional and single-chamber planar solid oxide fuel cells by screen-printing; Developpement de piles a combustible de type SOFC, conventionnelles et mono-chambres, en technologie planaire par serigraphie

    Energy Technology Data Exchange (ETDEWEB)

    Rotureau, D.

    2005-06-15

    This work is the first of a new research theme of the laboratory in the field of solid oxide planar fuel cells. With his high experience in the sensor field, the objectives were to realize prototypes using a 'low cost' technology like screen-printing, using classical materials in the field of fuel cells, rather than researching new materials having optimum properties which may be damaged during the realisation of the complete fuel cell. These materials are yttria stabilised zirconia (YSZ) for electrolyte, strontium doped lanthanum manganite (LSM) for cathode and a nickel oxide-YSZ cermet (NiO-YSZ) for anode. The first part of the study consists in structural and electrical characterizations of chosen materials, both on dense pellets and on screen-printed layers of YSZ, LSM or NiO-YSZ. These characterizations showed a good adequation of our materials for a fuel cell application. The second part consists in testing realised prototypes on electrolyte support and on anode support with screen-printed electrodes and electrolyte. The weak obtained performances are mainly due to the low functional temperature (800 C), the thickness of the electrolyte support (about 1 mm) and the porosity of the YSZ screen-printed layers. Finally, we tested in the same time an original device in which both electrodes are exposed to a fuel and air mixture. This promising device inspired from the research on potentiometric sensors developed in the team by N. Guillet (2001), avoids the tightness problem encountered with two gaseous chambers. Moreover, the performances obtained are just twice below than those obtained with a conventional fuel cell with two gaseous chambers. (author)

  8. Histomorphological and immunofluorescence evaluation of clear corneal incisions after microcoaxial phacoemulsification with 2.2 mm and 1.8 mm systems.

    Science.gov (United States)

    Vasavada, Abhay R; Johar, Kaid; Praveen, Mamidipudi R; Vasavada, Viraj A; Arora, Anshul I

    2013-04-01

    To compare changes in the incision's histomorphology and denaturation of collagen I in rabbit eyes having microcoaxial phacoemulsification through 2.2 mm and 1.8 mm incision-compatible systems. Randomized experimental trial. Iladevi Cataract & IOL Research Centre, Ahmedabad, India. Thirty rabbit eyes were randomized into Group 1 (microcoaxial phacoemulsification through 2.2 mm incisions using Infiniti system [torsional ultrasound]) and Group 2 (microcoaxial phacoemulsification through 1.8 mm incisions using Stellaris system [longitudinal ultrasound]). Each group was then divided into 3 subgroups of 5 eyes each based on 1 of the 3 intervention options: phacoemulsification only, intraocular lens (IOL) insertion only, and phacoemulsification with IOL insertion. Left eyes were randomized for microcoaxial phacoemulsification, and right eyes were treated as controls. After phacoemulsification, eyes in Group 1 showed loss of epithelium at the roof of the incisions and Descemet membrane detachment at the floor of the incisions. These findings did not change after IOL insertion. After phacoemulsification, eyes in Group 2 showed loss of epithelium, but Descemet membrane remained attached. There was a longitudinal split in the incision's stroma in the direction of internal entry. The stromal damage increased after IOL implantation. Immunofluorescence studies showed no obvious irregularities in the arrangement of collagen I in either group. A dot blot analysis showed significant denaturation of collagen I in Group 2. The histomorphology of the 2.2 mm system incision showed localized Descemet membrane detachment and endothelial cell loss. The 1.8 mm system incision showed exaggerated stromal damage after IOL insertion. Copyright © 2013 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  9. A quantum dot-immunofluorescent labeling method to investigate the interactions between a crinivirus and its whitefly vector

    Directory of Open Access Journals (Sweden)

    James C. K. Ng

    2013-04-01

    Full Text Available Successful vector-mediated plant virus transmission entails an intricate but poorly understood interplay of interactions among virus, vector, and plant. The complexity of interactions requires continually improving/evaluating tools and methods for investigating the determinants that are central to mediating virus transmission. A recent study using an organic fluorophore (Alexa Fluor-based immunofluorescent localization assay demonstrated that specific retention of Lettuce infectious yellows virus (LIYV virions in the anterior foregut or cibarium of its whitefly vector is required for virus transmission. Continuous exposure of organic fluorophore to high excitation light intensity can result in diminished or loss of signals, potentially confounding the identification of important interactions associated with virus transmission. This limitation can be circumvented by incorporation of photostable fluorescent nanocrystals, such as quantum dots (QDs, into the assay. We have developed and evaluated a QD-immunofluorescent labeling method for the in vitro and in situ localization of LIYV virions based on the recognition specificity of streptavidin-conjugated QD605 (S-QD605 for biotin-conjugated anti-LIYV IgG (B-αIgG. IgG biotinylation was verified in a blot overlay assay by probing SDS-PAGE separated B-αIgG with S-QD605. Immunoblot analyses of LIYV using B-αIgG and S-QD605 resulted in a virus detection limit comparable to that of DAS-ELISA. In membrane feeding experiments, QD signals were observed in the anterior foregut or cibarium of virion-fed whitefly vectors but absent in those of virion-fed whitefly non-vectors. Specific virion retention in whitefly vectors corresponded with successful virus transmission. A fluorescence photobleaching assay of viruliferous whiteflies fed B-αIgG and S-QD605 vs. those fed anti-LIYV IgG and Alexa Fluor 488-conjugated IgG revealed that QD signal was stable and deteriorated ∼7 to 8 fold slower than that of Alexa

  10. CD335 (NKp46+ T-Cell Recruitment to the Bovine Upper Respiratory Tract during a Primary Bovine Herpesvirus-1 Infection

    Directory of Open Access Journals (Sweden)

    Rahwa A. Osman

    2017-10-01

    Full Text Available Bovine natural killer (NK cells were originally defined by the NK activation receptor CD335 [natural killer cell p46-related protein (NKp46], but following the discovery of NKp46 expression on human T-cells, the definition of conventional bovine NK cells was modified to CD335+CD3− cells. Recently, a bovine T-cell population co-expressing CD335 was identified and these non-conventional T-cells were shown to produce interferon (IFN-γ and share functional properties with both conventional NK cells and T-cells. It is not known, however, if CD335+ bovine T-cells are recruited to mucosal surfaces and what chemokines play a role in recruiting this unique T-cell subpopulation. In this study, bovine herpesvirus-1 (BHV-1, which is closely related to herpes simplex virus-1, was used to investigate bovine lymphocyte cell populations recruited to the upper respiratory tract following a primary respiratory infection. Immunohistochemical staining with individual monoclonal antibodies revealed significant (P < 0.05 recruitment of CD335+, CD3+, and CD8+ lymphocyte populations to the nasal turbinates on day 5 following primary BHV-1 infection. Dual-color immunofluorescence revealed that cells recruited to nasal turbinates were primarily T-cells that co-expressed both CD335 and CD8. This non-conventional T-cell population represented 77.5% of CD355+ cells and 89.5% of CD8+ cells recruited to nasal turbinates on day 5 post-BHV-1 infection. However, due to diffuse IFN-γ staining of nasal turbinate tissue, it was not possible to directly link increased IFN-γ production following BHV-1 infection with the recruitment of non-conventional T-cells. Transcriptional analysis revealed CCL4, CCL5, and CXCL9 gene expression was significantly (P < 0.05 upregulated in nasal turbinate tissue following BHV-1 infection. Therefore, no single chemokine was associated with recruitment of non-conventional T-cells. In conclusion, the specific recruitment of CD335+ and CD8

  11. DETECTION OF ANTIBODIES TO CANDIDA ALBICANS GERM TUBE BY IMMUNOFLUORESCENCE IN IMMUNOSUPPRESSED MICE WITH EXPERIMENTAL SYSTEMIC CANDIDIASIS

    Directory of Open Access Journals (Sweden)

    F. Zaini

    2007-07-01

    Full Text Available "nThe increasing incidence of systemic candidiasis, which parallels the use of invasive and immunosuppressive medical procedures, necessitates development of rapid and cost effective tests for diagnosis of systemic candidiasis. Therefore in this study 85 mice were first immunosuppressed by cyclophosphamide and then infected by Candida albicans NCPF 3153. Other 85 mice were employed as control. The case and control mice were bled and then autopsied. Hearts and kidneys were checked by direct, histopathological and cultural examination for systemic candidiasis. The 85 sera from histological proven cases and 85 control mice were adsorbed with heat killed blastospores of same strain of C. albicans. Anti-Candida albicans germ tube antibodies were detected by indirect immunofluorescence assay for diagnosis of invasive candidiasis in case and control mice. In addition, sera from 35 mice with proven cryptococcosis were also tested. While 84 mice with proven systemic candidiasis (100% had anti-germ tube antibodies, these antibodies were absent in all controls and mice with cryptococcosis. The specificity was 100%, indicating a high degree of discrimination was possible between systemic candidiasis and cryptococcosis in the mice studied. It must be concluded that anti-germ tube responses did not appear to be significantly reduced in immunocompromised mice.

  12. Performance of an ELISA and Indirect Immunofluorescence Assay in Serological Diagnosis of Zoonotic Cutaneous Leishmaniasis in Iran

    Directory of Open Access Journals (Sweden)

    Bahador Sarkari

    2014-01-01

    Full Text Available Serological assays have been extensively evaluated for diagnosis of visceral leishmaniasis (VL and considered as a routine method for diagnosis of VL while these methods are not properly evaluated for diagnosis of cutaneous leishmaniasis (CL. This study aimed to assess the performance of indirect immunofluorescent-antibody test (IFA and enzyme-linked immunosorbent assay (ELISA for serodiagnosis of cutaneous leishmaniasis in Iran. Sixty-one sera samples from parasitologically confirmed CL patients and 50 sera from healthy controls along with 50 sera from non-CL patients were collected. Antigen was prepared from promastigotes and amastigotes of Leishmania major. IFA was used to detect anti-Leishmania IgG while ELISA was used to detect anti-Leishmania IgM, total IgG, or IgG subclasses (IgG1 and 4. ELISA, for detection of total IgG and IgM, showed sensitivity of 83.6% and 84.7% and specificity of 62.7% and 54.6%, respectively. Sensitivity and specificity of ELISA for detecting IgG1 and IgG4 were 64%, 75% and 85%, 49%, respectively. Sensitivity and specificity of IFA were 91.6% and 81%. Conclusion. Findings of this study demonstrated that serological test, especially IFA, can be used for proper diagnosis of CL.

  13. Diagnostic utility of a direct immunofluorescence test to detect feline coronavirus antigen in macrophages in effusive feline infectious peritonitis.

    Science.gov (United States)

    Litster, A L; Pogranichniy, R; Lin, T-L

    2013-11-01

    The antemortem diagnosis of feline infectious peritonitis (FIP) remains challenging in clinical practice, since current testing methods have suboptimal diagnostic accuracy. Immunohistochemical testing of biopsy specimens and postmortem examination are the standard diagnostic methods, although direct immunofluorescence (DIF) testing to detect feline coronavirus in macrophages in effusion specimens has been reported to have 100% specificity and has been recommended as an antemortem confirmatory test. The aim of this study was to compare the results of DIF testing in antemortem feline effusions with postmortem results using field samples. Effusion specimens were collected antemortem from 17 cats and tested by DIF, followed by postmortem examination. Histopathological examination of specimens collected at postmortem confirmed FIP in 10/17 cases and ruled out FIP out in 7/17 cases. Antemortem DIF testing was positive in all 10 cases confirmed as FIP at postmortem examination. In the seven cats where FIP was ruled out at postmortem examination, DIF was negative in five cases and positive in the remaining two cases. The calculated sensitivity of DIF testing was 100% and the specificity was 71.4%. Duplicate effusion specimens from eight cats that were initially DIF positive were stored refrigerated (4 °C) or at room temperature (22-25 °C) and subjected to serial DIF testing to determine the duration of positive results. DIF-positive specimens stored at both temperatures retained their positive status for at least 2 days. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. E-Cigarette Aerosol Exposure Induces Reactive Oxygen Species, DNA Damage, and Cell Death in Vascular Endothelial Cells.

    Science.gov (United States)

    Anderson, Chastain; Majeste, Andrew; Hanus, Jakub; Wang, Shusheng

    2016-12-01

    Cigarette smoking remains one of the leading causes of preventable death worldwide. Vascular cell death and dysfunction is a central or exacerbating component in the majority of cigarette smoking related pathologies. The recent development of the electronic nicotine delivery systems known as e-cigarettes provides an alternative to conventional cigarette smoking; however, the potential vascular health risks of e-cigarette use remain unclear. This study evaluates the effects of e-cigarette aerosol extract (EAE) and conventional cigarette smoke extract (CSE) on human umbilical vein endothelial cells (HUVECs). A laboratory apparatus was designed to produce extracts from e-cigarettes and conventional cigarettes according to established protocols for cigarette smoking. EAE or conventional CSE was applied to human vascular endothelial cells for 4-72 h, dependent on the assay. Treated cells were assayed for reactive oxygen species, DNA damage, cell viability, and markers of programmed cell death pathways. Additionally, the anti-oxidants α-tocopherol and n-acetyl-l-cysteine were used to attempt to rescue e-cigarette induced cell death. Our results indicate that e-cigarette aerosol is capable of inducing reactive oxygen species, causing DNA damage, and significantly reducing cell viability in a concentration dependent fashion. Immunofluorescent and flow cytometry analysis indicate that both the apoptosis and programmed necrosis pathways are triggered by e-cigarette aerosol treatment. Additionally, anti-oxidant treatment provides a partial rescue of the induced cell death, indicating that reactive oxygen species play a causal role in e-cigarette induced cytotoxicity. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. ESD and the Rio Conventions

    Science.gov (United States)

    Sarabhai, Kartikeya V.; Ravindranath, Shailaja; Schwarz, Rixa; Vyas, Purvi

    2012-01-01

    Chapter 36 of Agenda 21, a key document of the 1992 Earth Summit, emphasised reorienting education towards sustainable development. While two of the Rio conventions, the Convention on Biological Diversity (CBD) and the United Nations Framework Convention on Climate Change (UNFCCC), developed communication, education and public awareness (CEPA)…

  16. IgA anti-Actin antibodies in children with celiac disease: comparison of immunofluorescence with Elisa assay in predicting severe intestinal damage

    Directory of Open Access Journals (Sweden)

    Mora Stefano

    2010-03-01

    Full Text Available Abstract Background Previous studies have demonstrated that the presence of serum IgA antibodies against actin filaments (AAA in patients with celiac disease (CD is strongly associated with mucosal damage and severe degrees of villous atrophy. The aims of the present study were (1 to verify the effectiveness of IgA-AAA in newly diagnosed CD patients in a clinical setting (2 to compare the immunofluorescence assay with ELISA assay; (3 to compare the correlation of our IgA anti-tissue transglutaminase antibodies (tTG-Ab class with mucosal intestinal lesions. Methods 90 patients underwent endoscopy and multiple biopsies for suspected CD on the basis of symptoms, in presence of positive tTG-Ab tests. Twenty biopsied and 25 not-biopsied subjects with negative tTG-Ab were tested as control groups. IgA-AAA assays were performed by indirect immunofluorescence using rat epithelial intestinal cells, and by ELISA with a commercial kit. tTG-Ab assay was a radio-binding assay. Intestinal specimens were collected by upper endoscopy and the histological study was done according to the Marsh's classification modified by Oberhuber (M/O. Auto-antibodies assays and histological evaluation have been performed blindly by skilled operators. Results CD diagnosis was confirmed in 82 patients (type I M/O in 2 patients, IIIA in 18 patients, IIIB in 29 patients and IIIC in 33 patients. Two patients with type 1 lesion in presence of positive tTG-Ab and abdominal complaints, started a gluten free diet. The rate of IgA-AAA positivity (sensitivity by IFI and ELISA in histologically proven celiac disease patients, were 5.5% and 25% patients in IIIA, 27.5% and 34.4% patients in IIIB, 78.8% and 75% in IIIC patients, respectively. Patients with normal or nearly normal mucosa, regardless of tTG-Ab status, presented negative IgA-AAA IFI assay. On the other hand, 1 patient with normal mucosa but positive tTG-Ab, also presented positive IgA-AAA ELISA. All healthy non biopsied

  17. LL-37-derived short antimicrobial peptide KR-12-a5 and its d-amino acid substituted analogs with cell selectivity, anti-biofilm activity, synergistic effect with conventional antibiotics, and anti-inflammatory activity.

    Science.gov (United States)

    Kim, Eun Young; Rajasekaran, Ganesan; Shin, Song Yub

    2017-08-18

    KR-12-a5 is a 12-meric α-helical antimicrobial peptide (AMP) with dual antimicrobial and anti-inflammatory activities designed from human cathelicidin LL-37. We designed and synthesized a series of d-amino acid-substituted analogs of KR-12-a5 with the aim of developing novel α-helical AMPs that possess higher cell selectivity than KR-12-a5, while maintaining the anti-inflammatory activity. d-amino acid incorporation into KR-12-a5 induced a significant improvement in the cell selectivity by 2.6- to 13.6-fold as compared to KR-12-a5, while maintaining the anti-inflammatory activity. Among the three analogs, KR-12-a5 (6- D L) with d-amino acid in the polar-nonpolar interface (Leu 6 ) showed the highest cell selectivity (therapeutic index: 61.2). Similar to LL-37, KR-12-a5 and its analogs significantly inhibited the expression and secretion of NO, TNF-α, IL-6 and MCP-1 from LPS-stimulated RAW264.7 cells. KR-12-a5 and its analogs showed a more potent antimicrobial activity against antibiotic-resistant bacteria, including clinically isolated MRSA, MDRPA, and VREF than LL-37 and melittin. Furthermore, compared to LL-37, KR-12-a5 and its analogs showed greater synergistic effects with conventional antibiotics, such as chloramphenicol, ciprofloxacin, and oxacillin against MDRPA; KR-12-a5 and its analogs had a FICI range between 0.25 and 0.5, and LL-37 had a range between 0.75 and 1.5. KR-12-a5 and its analogs were found to be more effective anti-biofilm agents against MDRPA than LL-37. In addition, KR-12-a5 and its analogs maintained antimicrobial activity in physiological salts and human serum. SYTOX Green uptake and membrane depolarization studies revealed that KR-12-a5 and its analogs kills microbial cells by permeabilizing the cell membrane and damaging membrane integrity. Taken together, our results suggest that KR-12-a5 and its analogs can be developed further as novel antimicrobial/anti-inflammatory agents to treat antibiotic-resistant infections. Copyright

  18. The detection of Giardia muris and Giardia lamblia cysts by immunofluorescence in animal tissues and fecal samples subjected to cycles of freezing and thawing.

    Science.gov (United States)

    Erlandsen, S L; Sherlock, L A; Bemrick, W J

    1990-04-01

    The effects of freezing and thawing on the detection of selected Giardia spp. cysts were investigated using immunofluorescence, bright field microscopy, and low voltage scanning electron microscopy (SEM). Giardia muris cysts were obtained from either animal carcasses, fecal pellets, or isolated cyst preparations, whereas Giardia lamblia cysts were isolated from fecal samples. These samples were stained using an immunofluorescence technique after 1-3 freezing (-16 C) and thawing (20 C) cycles. Cysts were detected successfully by immunofluorescence in all samples. However, in those samples subjected to freeze-thawing, the cyst walls often became distorted and then were not detectable by bright field microscopy. Low voltage SEM demonstrated that the filaments in the distorted cyst wall underwent rearrangements of interfilament spacing. Quantitation of cyst recovery after freezing and thawing demonstrated that a substantial loss occurred after 1 cycle of alternating temperature when low concentrations of cysts were used, but not with high concentrations of cysts. Cyst recovery, after 3 freezing and thawing cycles, was dramatically lowered irrespective of the initial cyst concentration. These results demonstrated that immunofluorescence was an effective technique for the detection of Giardia spp. cysts in frozen samples and would suggest that freezing and thawing of fecal samples could prevent the detection of cysts when only bright field microscopy was employed.

  19. Longitudinal study of the indirect immunofluorescence and complement fixation tests for diagnosis of chagas' disease in immunosuppressed patients submitted to renal transplantation

    Directory of Open Access Journals (Sweden)

    José Fernando de Castro Figueiredo

    1993-12-01

    Full Text Available Clinical and serological follow-up of 7 patients submitted to renal transplantation and presenting positive serological reactions to Chagas 'disease before immunossupression did not show significant changes in indirect immunofluorescence and complement fixation titres for Chagas ' disease, or signs and symptoms indicating exacerbation of the disease during follow- up. In addition, 18 of 66 recipients of renal transplants considered to be non-chagasic before immunosuppression showed at least one positive result to the indirect immunofluorescence test for Chagas ' disease during the study period. The results suggest that the immunosuppression State induced in chagasic patients submitted to renal transplant did notpromoted exacerbation of the chronic infection in these patients and not interfere with the serological response of chronic chagasics, thus permitting the use of these serologic reactions for diagnostic purposes in these cases. However, the positive results ofthe indirect immunofluorescence test in non- chagasic patients indicate the needforjudicious interpretation ofthe indirect immunofluorescence test for the diagnosis of Chagas' disease in renal transplanted patients.

  20. Application of the Aarhus Convention

    Directory of Open Access Journals (Sweden)

    Tubić Bojan

    2011-01-01

    Full Text Available Convention on access to information, public participation in decision-making and access to justice in environmental matters (Aarhus Convention has been adopted in 1998 and entered into force three years later. It envisages three elements for strengthening democratic procedures in decision-making: access to information, public participation and access to justice. At the first meeting of the Member States the Aarhus Convention Compliance Committee was founded. The European Union is a party of the Convention and it has implemented the provisions in its legal order. After entering into force of the Convention, several Directives that regulate these issues in the EU have been enacted. Republic of Serbia has ratified the Convention in 2009 and it is currently in the process of its implementation by involving private subjects in decision-making on environmental issues.

  1. Understanding the conventional arms trade

    Science.gov (United States)

    Stohl, Rachel

    2017-11-01

    The global conventional arms trade is worth tens of billions of dollars every year and is engaged in by every country in the world. Yet, it is often difficult to control the legal trade in conventional arms and there is a thriving illicit market, willing to arm unscrupulous regimes and nefarious non-state actors. This chapter examines the international conventional arms trade, the range of tools that have been used to control it, and challenges to these international regimes.

  2. Comparison of Conventional and Semi-Conventional Management ...

    African Journals Online (AJOL)

    Comparison of Conventional and Semi-Conventional Management Systems on the Performance and Carcass Yield of Broiler Chickens. ... TO AFRICAN RESEARCH. AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING AJOL · RESOURCES ... Journal Home > Vol 20, No 1 (2018) >. Log in or ...

  3. Three-dimensional (3D)- computed tomography bronchography and angiography combined with 3D-video-assisted thoracic surgery (VATS) versus conventional 2D-VATS anatomic pulmonary segmentectomy for the treatment of non-small cell lung cancer.

    Science.gov (United States)

    She, Xiao-Wei; Gu, Yun-Bin; Xu, Chun; Li, Chang; Ding, Cheng; Chen, Jun; Zhao, Jun

    2018-02-01

    Compared to the pulmonary lobe, the anatomical structure of the pulmonary segment is relatively complex and prone to variation, thus the risk and difficulty of segmentectomy is increased. We compared three-dimensional computed tomography bronchography and angiography (3D-CTBA) combined with 3D video-assisted thoracic surgery (3D-VATS) to perform segmentectomy to conventional two-dimensional (2D)-VATS for the treatment of non-small cell lung cancer (NSCLC). We retrospectively reviewed the data of randomly selected patients who underwent 3D-CTBA combined with 3D-VATS (3D-CTBA-VATS) or 2D-VATS at the Department of Thoracic Surgery, The First Affiliated Hospital of Soochow University Hospital, from January 2014 to May 2017. The operative duration of 3D group was significantly shorter than the 2D group (P 0.05). The extent of intraoperative bleeding and postoperative drainage in the 3D group was significantly lower than in the 2D group (P 3D group was shorter than in the 2D group (P 0.05). However, hemoptysis and pulmonary air leakage (>3d) occurred significantly less frequently in the 3D than in the 2D group (P 3D-CTBA-VATS is a more accurate and smooth technique and leads to reduced intraoperative and postoperative complications. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  4. [Application of Immunohistochemistry and Immunofluorescence Staining in Detection of Phospholipase A2 Receptor on Paraffin Section of Renal Biopsy Tissue].

    Science.gov (United States)

    Dong, Hong-rui; Wang, Yan-yan; Wang, Guo-qin; Sun, Li-jun; Cheng, Hong; Chen, Yi-pu

    2015-10-01

    immunohistochemical staining and immunofluorescence staining, the preferred method of antigen repair is water bath heat repair plus trypsin repair.

  5. Towards a Theory of Convention

    DEFF Research Database (Denmark)

    Hansen, Pelle Guldborg

    2006-01-01

    Some thirty years ago Lewis published his Convention: A philosophical Study (Lewis 1969). Besides exciting the logical community by providing the seminal analysis work on common knowledge, it also laid the foundations for the formal approach to the study of social conventions by means of game the...

  6. Improvement of the performance of a new type of single chamber microbial fuel cell compared to a conventional cell; Mejora del desempeno de un nuevo tipo de celda de combustible microbiana de una camara comparado con una celda convencional

    Energy Technology Data Exchange (ETDEWEB)

    Vazquez Larios, A.L.; Vazquez-Huerta, G.; Esparza-Garcia, F.; Solorza-Feria, O.; Poggi Varaldo, H.M. [Centro de Investigacion y de Estudios Avanzados del IPN, Mexico D.F. (Mexico)]. E-mail: hectorpoggi2001@gmail.com; linevazquez@yahoo.com.mx

    2009-09-15

    The objective of this work was to design, build and operate a new type of microbial fuel cell (MFC-A) and evaluate the architectural changes in the production of electricity. The results were compared with those of a standard fuel cell (MFC-B). The MFC-A consisted of a horizontal acrylate cylinder with two systems of sandwiched electrodes (each with a anode proton exchange membrane-cathode) separated by 78 mm. The MFC-B consisted of an anode and a cathode each in the opposite faces of the cell. The internal resistance of the cells were determined with polarization curves. The cells were operated in batch during 50 h at 30 degrees Celsius obtained with 38 mW/m{sup 2} and 5 mW/m{sup 2} for MFC-A and MFC-B, respectively. The changes in the architecture of the cell and design of the electrodes occurred at a power density 8 times greater, associated with the decrease in internal resistance of 1200 and 3900 {Omega} for MFC-A and MFC-B, respectively. The change in architecture (double electrode in the same volume for MFC-A) enabled obtaining a 13 times greater potential per unit volume, with 922 mW/m{sup 3} in the new MFC-A cell versus 69 mW/m{sup 3} in MFC-B. [Spanish] El objetivo de este trabajo fue disenar, construir y operar una celda de combustible microbiana de nuevo tipo (CCM-A), y evaluar los cambios de arquitectura en la produccion de electricidad. Los resultados fueron comparados con los de una celda de combustible estandar (CCM-B). La CCM-A consistio de un cilindro horizontal de acrilato, con dos sistemas de electrodos emparedados (cada uno con catodo/membrana de intercambio protonico/anodo) separados por 78 mm. La CCM-B consistio de un anodo y un catodo cada uno en las caras opuestas de la celda. Las Ri de las celdas fueron determinadas por curva de polarizacion. Las celdas fueron operadas en lote durante 50 h, a 30 grados centigrados, y fueron inoculadas con un inoculo sulfato reductor (In-SR) y cargadas con un extracto modelo similar al perfil de metabolitos

  7. Combined SPECT/CT improves detection of initial bone invasion and determination of resection margins in squamous cell carcinoma of the head and neck compared to conventional imaging modalities

    Energy Technology Data Exchange (ETDEWEB)

    Kolk, A. [Technische Universitaet Muenchen, Klinikum rechts der Isar, Department of Oral and Maxillofacial Surgery, Munich (Germany); Klinikum rechts der Isar, Technische Universitaet Muenchen, Klinik und Poliklinik fuer Mund-Kiefer und Gesichtschirurgie, Muenchen (Germany); Schuster, T. [Technische Universitaet Muenchen, Klinikum rechts der Isar, Institute of Medical Statistics and Epidemiology, Munich (Germany); Chlebowski, A.; Kesting, M.; Bissinger, O.; Weitz, J. [Technische Universitaet Muenchen, Klinikum rechts der Isar, Department of Oral and Maxillofacial Surgery, Munich (Germany); Lange, P. [Technische Universitaet Muenchen, Klinikum rechts der Isar, Department of Diagnostic Radiology, Munich (Germany); Scheidhauer, K.; Schwaiger, M.; Dinges, J. [Technische Universitaet Muenchen, Klinikum rechts der Isar, Department of Nuclear Medicine, Munich (Germany)

    2014-07-15

    Knowledge of the presence and extent of bone infiltration is crucial for planning the resection of potential bone-infiltrating squamous cell carcinomas of the head and neck (HNSCC). Routinely, plain-film radiography, multislice computed tomography (MSCT) and magnetic resonance imaging (MRI) are used for preoperative staging, but they show relatively high rates of false-positive and false-negative findings. Scintigraphy with {sup 99m}Tc-bisphosphonate has the ability to show increased metabolic bone activity. If combined with anatomical imaging (e.g. (SPECT)/CT), it facilitates the precise localization of malignant bone lesions. The aim of this study was to analyse the indications and advantages of SPECT/CT compared with standard imaging modalities and histology with regard to specificity and sensitivity A longitudinally evaluated group of 30 patients with biopsy-proven HNSCC adjacent to the mandible underwent {sup 99m}Tc-bisphosphonate SPECT/CT, MRI, MSCT and conventional radiography before partial or rim resection of the mandible was performed. Bone infiltration was first evaluated with plain films, MSCT and MRI. In a second reading, SPECT/CT data were taken into account. The results (region and certainty of bone invasion) were evaluated among the different imaging modalities and finally compared with histological specimens from surgical resection as the standard of reference. For a better evaluation of the hybrid property of SPECT/CT, a retrospectively evaluated group of 20 additional patients with tumour locations similar to those of the longitudinally examined SPECT/CT group underwent SPECT, MSCT and MRI. To assess the influence of dental foci on the specificity of the imaging modalities, all patients were separated into two subgroups depending on the presence or absence of teeth in the area of potential tumour-bone contact. Histologically proven bone infiltration was found in 17 patients (57 %) when analysed by conventional imaging modalities. SPECT/CT data

  8. Combined SPECT/CT improves detection of initial bone invasion and determination of resection margins in squamous cell carcinoma of the head and neck compared to conventional imaging modalities

    International Nuclear Information System (INIS)

    Kolk, A.; Schuster, T.; Chlebowski, A.; Kesting, M.; Bissinger, O.; Weitz, J.; Lange, P.; Scheidhauer, K.; Schwaiger, M.; Dinges, J.

    2014-01-01

    Knowledge of the presence and extent of bone infiltration is crucial for planning the resection of potential bone-infiltrating squamous cell carcinomas of the head and neck (HNSCC). Routinely, plain-film radiography, multislice computed tomography (MSCT) and magnetic resonance imaging (MRI) are used for preoperative staging, but they show relatively high rates of false-positive and false-negative findings. Scintigraphy with 99m Tc-bisphosphonate has the ability to show increased metabolic bone activity. If combined with anatomical imaging (e.g. (SPECT)/CT), it facilitates the precise localization of malignant bone lesions. The aim of this study was to analyse the indications and advantages of SPECT/CT compared with standard imaging modalities and histology with regard to specificity and sensitivity A longitudinally evaluated group of 30 patients with biopsy-proven HNSCC adjacent to the mandible underwent 99m Tc-bisphosphonate SPECT/CT, MRI, MSCT and conventional radiography before partial or rim resection of the mandible was performed. Bone infiltration was first evaluated with plain films, MSCT and MRI. In a second reading, SPECT/CT data were taken into account. The results (region and certainty of bone invasion) were evaluated among the different imaging modalities and finally compared with histological specimens from surgical resection as the standard of reference. For a better evaluation of the hybrid property of SPECT/CT, a retrospectively evaluated group of 20 additional patients with tumour locations similar to those of the longitudinally examined SPECT/CT group underwent SPECT, MSCT and MRI. To assess the influence of dental foci on the specificity of the imaging modalities, all patients were separated into two subgroups depending on the presence or absence of teeth in the area of potential tumour-bone contact. Histologically proven bone infiltration was found in 17 patients (57 %) when analysed by conventional imaging modalities. SPECT/CT data revealed

  9. Revision of the Paris Convention and the Brussels Supplementary Convention

    International Nuclear Information System (INIS)

    Busekist, Otto von.

    1977-01-01

    The Paris Convention and the Brussels Supplementary Convention have in substance remained unchanged since their adoption in 1960 and 1963, respectively. During that period, nuclear industry and technology have developed considerably while the financial and monetary bases of the Conventions have been shattered. The amounts of liability and compensation have been eroded by inflation, and the gold-based unit of account in which these amounts are expressed has lost its original meaning after the abolition of the official gold price. The question of revising the Conventions, in particular of raising those amounts and of replacing the unit of account, is therefore being studied by the Group of Governmental Experts on Third party Liability in the Field of Nuclear Energy of the OECD Nuclear Energy Agency. (auth.) [fr

  10. The nuclear liability conventions revised

    International Nuclear Information System (INIS)

    Reyners, P.

    2004-01-01

    The signature on 12 February 2004 of the Protocols amending respectively the 1960 Paris Convention and the 1963 Brussels Supplementary Convention was the second step of the process of modernisation of the international nuclear liability regime after the adoption in September 1997 of a Protocol revising the 1963 Vienna Convention and of a new Convention on Supplementary Compensation for Nuclear Damage. The common objective of the new instruments is to provide more funds to compensate a larger number of potential victims in respect of a broader range of damage. Another goal of the revision exercise was to maintain the compatibility between the Paris and Vienna based systems, a commitment enshrined in the 1988 Joint Protocol, as well as to ascertain that Paris/Brussels countries could also become a Party to the Convention on Supplementary Compensation. However, while generally consistent vis a vis the Joint Protocol, the provisions of the Paris and Vienna Conventions, as revised, differ on some significant aspects. Another remaining issue is whether the improved international nuclear liability regime will succeed in attracting in the future a larger number of countries, particularly outside Europe, and will so become truly universal. Therefore, the need for international co-operation to address these issues, to facilitate the adoption of new implementing legislation and to ensure that this special regime keeps abreast of economic and technological developments, is in no way diminished after the revision of the Conventions.(author)

  11. The evolution of development conventions

    Directory of Open Access Journals (Sweden)

    Fabio Stefano Erber

    2012-04-01

    Full Text Available This paper presents a conceptual view on development and its translation into development policies. It argues that society's perception of development is structured by conventions, which provide a view of the past, present and future and, at the same time, allows a certain hierarchy of problems and solutions to such problems. The prevalence of a specific convention depends on the international conditions faced by this society and on the distribution of economic and political power within that society. Therefore, in complex societies there is always a struggle for hegemony between competing development conventions.

  12. Evolutionary Games and Social Conventions

    DEFF Research Database (Denmark)

    Hansen, Pelle Guldborg

    2007-01-01

    -defined metaphors of individual learning and social imitation processes, from which a revised theory of convention may be erected (see Sugden 2004, Binmore 1993 and Young 1998). This paper makes a general argument in support of the evolutionary turn in the theory of convention by a progressive exposition of its...... in Aumann (1976) and which, together with the assumptions of perfect rationality, came to be defining of classical game theory. However, classical game theory is currently undergoing severe crisis as a tool for exploring social phenomena; a crisis emerging from the problem of equilibrium selection around......Some thirty years ago Lewis published his Convention: A Philosophical Study (Lewis, 2002). This laid the foundation for a game-theoretic approach to social conventions, but became more famously known for its seminal analysis of common knowledge; the concept receiving its canonical analysis...

  13. Computer-assisted enzyme immunoassays and simplified immunofluorescence assays: applications for the diagnostic laboratory and the veterinarian's office.

    Science.gov (United States)

    Jacobson, R H; Downing, D R; Lynch, T J

    1982-11-15

    A computer-assisted enzyme-linked immunosorbent assay (ELISA) system, based on kinetics of the reaction between substrate and enzyme molecules, was developed for testing large numbers of sera in laboratory applications. Systematic and random errors associated with conventional ELISA technique were identified leading to results formulated on a statistically validated, objective, and standardized basis. In a parallel development, an inexpensive system for field and veterinary office applications contained many of the qualities of the computer-assisted ELISA. This system uses a fluorogenic indicator (rather than the enzyme-substrate interaction) in a rapid test (15 to 20 minutes' duration) which promises broad application in serodiagnosis.

  14. Paris convention - Decisions, recommendations, interpretations

    International Nuclear Information System (INIS)

    1990-01-01

    This booklet is published in a single edition in English and French. It contains decisions, recommendations and interpretations concerning the 1960 Paris Convention on Third Party Liability in the Field of Nuclear Energy adopted by the OECD Steering Committee and the OECD Council. All the instruments are set out according to the Article of the Convention to which they relate and explanatory notes are added where necessary [fr

  15. Novel versus conventional antipsychotic drugs.

    Science.gov (United States)

    Love, R C

    1996-01-01

    Novel antipsychotic agents differ from conventional ones in several key characteristics, including effectiveness, adverse reactions, and receptor-binding profile. Most of the newer agents have an affinity for the serotonin 5HT2 receptor that is at least 10 times greater than that for the dopamine D2 receptor. This increased affinity for the serotonin receptor may be responsible for another distinguishing characteristic of novel antipsychotic agents--decreased frequency of extrapyramidal side effects. These side effects, which include pseudoparkinsonism, acute dystonias, and akathisia, frequently are the reason for noncompliance with conventional drug therapy. The newer drugs are often effective in patients resistant to treatment with conventional agents. They also appear to reduce the negative symptoms of schizophrenia in many patients.

  16. The prospect of conventional disarmament

    International Nuclear Information System (INIS)

    Adeniji, O.

    1989-01-01

    The prospect of conventional disarmament in Europe holds out great consequences not only for the continent but also for the entire world. The arms race both in its nuclear and conventional aspects has been the single most important element of the destabilizing factors in international relations since 1945. Though initially borne out of the ideological division of Europe and the consequent quest for strategic military superiority, it soon developed a technological momentum of its own, becoming more the cause than the effect of the distrust in the relationship of the two alliances. The issue of conventional weapons was raised for negotiations side by side with that of nuclear weapons when the United Nations took up the question of disarmament in 1946. Due, however, to the unforeseen and most dangerous advance in nuclear weaponry, the fear engendered shifted all attention at the multilateral level to nuclear weapons. Except in Europe where the Mutual and Balanced Force Reduction Talks in Central Europe were initiated, conventional weapons disarmament did not attract multilateral attention again until the First Special Session of the United nations General Assembly Devoted to Disarmament in 1978. The Final Document of the Special Session did accord highest priority to negotiations on nuclear weapons. However, it also affirmed that side by side with negotiations on nuclear weapons, the limitation and gradual reduction of armed forces and conventional weapons should be resolutely pursued within the framework of general and complete disarmament. States with the largest military arsenals, it was stated, had a special responsibility in pursuing conventional armaments reduction. Underscoring the central role of Europe further, the Final Document postulated that the achievement of a more stable situation at a lower level of military potential would contribute toward strengthening of security in Europe and constitute a significant step toward international peace and security

  17. Green tea extract selectively targets nanomechanics of live metastatic cancer cells

    International Nuclear Information System (INIS)

    Cross, Sarah E; Gimzewski, James K; Jin Yusheng; Lu Qingyi; Rao Jianyu

    2011-01-01

    Green tea extract (GTE) is known to be a potential anticancer agent (Yang et al 2009 Nat. Rev. Cancer 9 429-39) with various biological activities (Lu et al 2005 Clin. Cancer Res. 11 1675-83; Yang et al 1998 Carcinogenesis 19 611-6) yet the precise mechanism of action is still unclear. The biomechanical response of GTE treated cells taken directly from patient's body samples was measured using atomic force microscopy (AFM) (Binnig et al 1986 Phys. Rev. Lett. 56 930). We found significant increase in stiffness of GTE treated metastatic tumor cells, with a resulting value similar to untreated normal mesothelial cells, whereas mesothelial cell stiffness after GTE treatment is unchanged. Immunofluorescence analysis showed an increase in cytoskeletal-F-actin in GTE treated tumor cells, suggesting GTE treated tumor cells display mechanical, structural and morphological features similar to normal cells, which appears to be mediated by annexin-I expression, as determined by siRNA analysis of an in vitro cell line model. Our data indicates that GTE selectively targets human metastatic cancer cells but not normal mesothelial cells, a finding that is significantly advantageous compared to conventional chemotherapy agents.

  18. Conventional imaging in paediatric uroradiology

    International Nuclear Information System (INIS)

    Riccabona, M.; Lindbichler, F.; Sinzig, M.

    2002-01-01

    Objective: To briefly describe basic conventional imaging in paediatric uroradiology. Method: The state of the art performance of standard imaging techniques (intravenous urography (IVU), voiding cystourethrography (VCU), and ultrasound (US)) is described, with emphasis on technical aspects, indications, and patient preparation such as adequate hydration. Only basic applications as used in routine clinical work are included. Result and conclusion: Conventional imaging methods are irreplaceable. They cover the majority of daily clinical routine queries, with consecutive indication of more sophisticated modalities in those patients who need additional imaging for establishing the final diagnosis or outlining therapeutic options

  19. Conventional imaging in paediatric uroradiology

    Energy Technology Data Exchange (ETDEWEB)

    Riccabona, M. E-mail: michael.riccabona@kfunigraz.ac.at; Lindbichler, F.; Sinzig, M

    2002-08-01

    Objective: To briefly describe basic conventional imaging in paediatric uroradiology. Method: The state of the art performance of standard imaging techniques (intravenous urography (IVU), voiding cystourethrography (VCU), and ultrasound (US)) is described, with emphasis on technical aspects, indications, and patient preparation such as adequate hydration. Only basic applications as used in routine clinical work are included. Result and conclusion: Conventional imaging methods are irreplaceable. They cover the majority of daily clinical routine queries, with consecutive indication of more sophisticated modalities in those patients who need additional imaging for establishing the final diagnosis or outlining therapeutic options.

  20. The European Convention on bioethics.

    Science.gov (United States)

    Byk, C

    1993-03-01

    Benefiting from a widely recognised experience of the field of bioethics, the Council of Europe which represents all the democratic countries of Europe, has embarked on the ambitious task of drafting a European Convention on bioethics. The purpose of this text is to set out fundamental values, such as respect for human dignity, free informed consent and non-commercialisation of the human body. In addition to this task, protocols will provide specific standards for the different fields concerned with the application of biomedical sciences. The convention and the first two protocols (human experiments and organ transplants) are due to be ready for signature by mid 1994.

  1. Conventional and unconventional political participation

    International Nuclear Information System (INIS)

    Opp, K.D.

    1985-01-01

    A non-recursive model is proposed and empirically tested with data of opponents of nuclear power. In explaining conventional and unconventional participation the theory of collective action is applied and modified in two respects: the perceived influence on the elimination of collective evils are taken into account; the selective incentives considered are non-material ones. These modifications proved to be valid: the collective good variables and non-material incentives were important determinants for the two forms of participation. Another result was that there is a reciprocal causal relationship between conventional and unconventional participation. (orig./PW) [de

  2. Comparison of electron microscopy, enzyme-linked immunosorbent assay, solid-phase radioimmunoassay, and indirect immunofluorescence for detection of human rotavirus antigen in faeces

    Energy Technology Data Exchange (ETDEWEB)

    Birch, C J; Lehmann, N I; Hawker, A J; Marshall, J A; Gust, I D [Fairfield Hospital for Communicable Diseases, Victoria (Australia). Virology Dept.

    1979-07-01

    Four techniques were compared for their practicability, speed, and sensitivity for the detection of human rotavirus. Radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) were found to be the most sensitive means of identifying rotavirus and, once processed, up to 40 specimens could be examined daily. Electron microscopy, although less sensitive than these techniques, had the advantage of being able to detect other viral agents present in faecal extracts. Indirect immunofluorescence failed to detect rotavirus as often as the other three methods. In laboratories where routine examination of faecal specimens from patients with gastroenteritis is required, ELISA and RIA are useful alternatives to electron microscopy.

  3. Comparison of enzyme-linked immunosorbent assay, radioimmunoassay, complement fixation, anticomplement immunofluorescence and passive haemaglutination techniques for detecting cytomegalovirus IgG antibody

    Energy Technology Data Exchange (ETDEWEB)

    Booth, J C; Hannington, G; Bakir, T M.F.; Stern, H; Kangro, H; Griffiths, P D; Heath, R B [Saint George' s Hospital Medical School, London (UK); Saint Bartholomew' s Hospital, London (UK))

    1982-12-01

    The radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) techniques were found to be comparable in sensitivity and specificity for detecting cytomegalovirus IgG antibody, and 10 to 100 times more sensitive than complement-fixation (CF), anticomplement immunofluorescence (ACIF) and passive haemagglutination (PHA). In screening tests for antibody, the frequency of false-positive and -negative results was 0.6% for RIA and ELISA, 1.5% for CF, 1.6% for ACIF and 3.6% for PHA. PHA was the least satisfactory test, largely because of technical problems.

  4. Dew drops on spider web appearance: a newly named pattern of IgG4 deposition in pemphigus with direct immunofluorescence

    Directory of Open Access Journals (Sweden)

    Marian Dmochowski

    2017-08-01

    Full Text Available Novel appearances in cutaneous pathology as well as mucocutaneous clinical signs are being described which indicate that this is still an attractive area for exploration. The H + E histology terms of “decorated tomb stoning” and “undecorated tomb stoning”, advocated by some pathologists, are misleading and as such should be avoided. Here, an appearance of IgG4 pemphigus deposits examined cost-effectively with direct immunofluorescence and suggested to be called “dew drops on spider web” is depicted in depth.

  5. Comparison of electron microscopy, enzyme-linked immunosorbent assay, solid-phase radioimmunoassay, and indirect immunofluorescence for detection of human rotavirus antigen in faeces

    International Nuclear Information System (INIS)

    Birch, C.J.; Lehmann, N.I.; Hawker, A.J.; Marshall, J.A.; Gust, I.D.

    1979-01-01

    Four techniques were compared for their practicability, speed, and sensitivity for the detection of human rotavirus. Radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) were found to be the most sensitive means of identifying rotavirus and, once processed, up to 40 specimens could be examined daily. Electron microscopy, although less sensitive than these techniques, had the advantage of being able to detect other viral agents present in faecal extracts. Indirect immunofluorescence failed to detect rotavirus as often as the other three methods. In laboratories where routine examination of faecal specimens from patients with gastroenteritis is required, ELISA and RIA are useful alternatives to electron microscopy. (author)

  6. Grounding Damage to Conventional Vessels

    DEFF Research Database (Denmark)

    Lützen, Marie; Simonsen, Bo Cerup

    2003-01-01

    The present paper is concerned with rational design of conventional vessels with regard to bottom damage generated in grounding accidents. The aim of the work described here is to improve the design basis, primarily through analysis of new statistical data for grounding damage. The current regula...

  7. Conventional and Non-Conventional Yeasts in Beer Production

    Directory of Open Access Journals (Sweden)

    Angela Capece

    2018-06-01

    Full Text Available The quality of beer relies on the activity of fermenting yeasts, not only for their good fermentation yield-efficiency, but also for their influence on beer aroma, since most of the aromatic compounds are intermediate metabolites and by-products of yeast metabolism. Beer production is a traditional process, in which Saccharomyces is the sole microbial component, and any deviation is considered a flaw. However, nowadays the brewing sector is faced with an increasing demand for innovative products, and it is diffusing the use of uncharacterized autochthonous starter cultures, spontaneous fermentation, or non-Saccharomyces starters, which leads to the production of distinctive and unusual products. Attempts to obtain products with more complex sensory characteristics have led one to prospect for non-conventional yeasts, i.e., non-Saccharomyces yeasts. These generally are characterized by low fermentation yields and are more sensitive to ethanol stress, but they provide a distinctive aroma and flavor. Furthermore, non-conventional yeasts can be used for the production of low-alcohol/non-alcoholic and light beers. This review aims to present the main findings about the role of traditional and non-conventional yeasts in brewing, demonstrating the wide choice of available yeasts, which represents a new biotechnological approach with which to target the characteristics of beer and to produce different or even totally new beer styles.

  8. Construction of iron-polymer-graphene nanocomposites with low nonspecific adsorption and strong quenching ability for competitive immunofluorescent detection of biomarkers in GM crops.

    Science.gov (United States)

    Yin, Kaifei; Liu, Anran; Shangguan, Li; Mi, Li; Liu, Xu; Liu, Yuanjian; Zhao, Yuewu; Li, Ying; Wei, Wei; Zhang, Yuanjian; Liu, Songqin

    2017-04-15

    We developed a new immunofluorescent biosensor by utilizing a novel nanobody (Nb) and iron-polymer-graphene nanocomposites for sensitive detection of 5-enolpyruvylshikimate-3-phosphate synthase from Agrobacdterium tumefaciens strain CP4 (CP4-EPSPS), which considered as biomarkers of genetically modified (GM) crops. Specifically, we prepared iron doped polyacrylic hydrazide modified reduced graphene nanocomposites (Fe@RGO/PAH) by in-situ polymerization approach and subsequent a one-pot reaction with hydrazine. The resulting Fe@RGO/PAH nanocomposites displayed low nonspecific adsorption to analytes (11% quenching caused by nonspecific adsorption) due to electrostatic, energetic and steric effect of the nanocomposites. After Nb immobilizing, the as-prepared Fe@RGO/PAH/Nbs showed good selectivity and high quenching ability (92% quenching) in the presence of antigen (Ag) and polyethylene glycol (PEG) modified CdTe QDs (Ag/QDs@PEG), which is a nearly 4 fold than that of the unmodified GO in same condition. The high quenching ability of Fe@RGO/PAH/Nbs can be used for detection of CP4-EPSPS based on competitive immunoassay with a linearly proportional concentration range of 5-100ng/mL and a detection limit of 0.34ng/mL. The good stability, reproducibility and specificity of the resulting immunofluorescent biosensor are demonstrated and might open a new window for investigation of fluorescent sensing with numerous multifunctional graphene based materials. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Interleukin-6, C-reactive protein, and expression of human leukocyte antigen-DR on peripheral blood mononuclear cells in patients after laparoscopic vs. conventional bowel resection - A randomized study

    NARCIS (Netherlands)

    Dunker, M. S.; ten Hove, T.; Bemelman, W. A.; Slors, J. F. M.; Gouma, D. J.; van Deventer, S. J. H.

    2003-01-01

    PURPOSE: The aim of the study was to investigate the effect of surgical trauma in terms of approach (laparoscopic vs. conventional surgery) and extent of bowel resection (ileocolic resection vs. colectomy) on interleukin-6 level, C-reactive protein level, and expression of human leukocyte antigen-DR

  10. Quasisymmetry equations for conventional stellarators

    International Nuclear Information System (INIS)

    Pustovitov, V.D.

    1994-11-01

    General quasisymmetry condition, which demands the independence of B 2 on one of the angular Boozer coordinates, is reduced to two equations containing only geometrical characteristics and helical field of a stellarator. The analysis is performed for conventional stellarators with a planar circular axis using standard stellarator expansion. As a basis, the invariant quasisymmetry condition is used. The quasisymmetry equations for stellarators are obtained from this condition also in an invariant form. Simplified analogs of these equations are given for the case when averaged magnetic surfaces are circular shifted torii. It is shown that quasisymmetry condition can be satisfied, in principle, in a conventional stellarator by a proper choice of two satellite harmonics of the helical field in addition to the main harmonic. Besides, there appears a restriction on the shift of magnetic surfaces. Thus, in general, the problem is closely related with that of self-consistent description of a configuration. (author)

  11. Dilution Confusion: Conventions for Defining a Dilution

    Science.gov (United States)

    Fishel, Laurence A.

    2010-01-01

    Two conventions for preparing dilutions are used in clinical laboratories. The first convention defines an "a:b" dilution as "a" volumes of solution A plus "b" volumes of solution B. The second convention defines an "a:b" dilution as "a" volumes of solution A diluted into a final volume of "b". Use of the incorrect dilution convention could affect…

  12. Apocryphal Angels in Nun Convents

    Directory of Open Access Journals (Sweden)

    Mario Ávila Vivar

    2018-01-01

    Full Text Available The preponderance of studies about viceregal angelic series, and the widespread belief that the representation of apocryphal angels is a specific peculiarity of viceregal angelology, have created such a close relation between it and the apocryphal angels, that they are even considered as synonymous. However, both the texts and the presence of this angels in the spanish convents of the XVII century, evidence that the apocryphal angels appeared and they were represented in Spain long before that in its american viceregal. Therefore, it is here where their origins and their meaning should be sought.

  13. Cell differentiation in cardiac myxomas: confocal microscopy and gene expression analysis after laser capture microdissection.

    Science.gov (United States)

    Pucci, Angela; Mattioli, Claudia; Matteucci, Marco; Lorenzini, Daniele; Panvini, Francesca; Pacini, Simone; Ippolito, Chiara; Celiento, Michele; De Martino, Andrea; Dolfi, Amelio; Belgio, Beatrice; Bortolotti, Uberto; Basolo, Fulvio; Bartoloni, Giovanni

    2018-05-22

    Cardiac myxomas are rare tumors with a heterogeneous cell population including properly neoplastic (lepidic), endothelial and smooth muscle cells. The assessment of neoplastic (lepidic) cell differentiation pattern is rather difficult using conventional light microscopy immunohistochemistry and/or whole tissue extracts for mRNA analyses. In a preliminary study, we investigated 20 formalin-fixed and paraffin-embedded cardiac myxomas by means of conventional immunohistochemistry; in 10/20 cases, cell differentiation was also analyzed by real-time RT-PCR after laser capture microdissection of the neoplastic cells, whereas calretinin and endothelial antigen CD31 immunoreactivity was localized in 4/10 cases by double immunofluorescence confocal microscopy. Gene expression analyses of α-smooth muscle actin, endothelial CD31 antigen, alpha-cardiac actin, matrix metalloprotease-2 (MMP2) and tissue inhibitor of matrix metalloprotease-1 (TIMP1) was performed on cDNA obtained from either microdissected neoplastic cells or whole tumor sections. We found very little or absent CD31 and α-Smooth Muscle Actin expression in the microdissected cells as compared to the whole tumors, whereas TIMP1 and MMP2 genes were highly expressed in both ones, greater levels being found in patients with embolic phenomena. α-Cardiac Actin was not detected. Confocal microscopy disclosed two different signals corresponding to calretinin-positive myxoma cells and to endothelial CD31-positive cells, respectively. In conclusion, the neoplastic (lepidic) cells showed a distinct gene expression pattern and no consistent overlapping with endothelial and smooth muscle cells or cardiac myocytes; the expression of TIMP1 and MMP2 might be related to clinical presentation; larger series studies using also systematic transcriptome analysis might be useful to confirm the present results.

  14. Naturally acquired Lawsonia intracellularis infection in pigs studied from weaning to slaughter by indirect immunofluorescence antibody test and polymerase chain reaction on faeces

    DEFF Research Database (Denmark)

    Jensen, Tim Kåre; Vigre, Håkan; Sørensen, Vibeke

    2005-01-01

    by immunofluorescence antibody test compared to 24% by immunohistochemistry on ileal samples. Thus, applied at the time of slaughter the antibody test appeared to be a highly sensitive ante-mortem diagnostic tool for identifying L. intracelluaris exposed pigs with or without current proliferative enteropathy. (c) 2004......The course of naturally acquired Lawsonia intracellularis infection was studied in 41 pigs by testing blood and faeces samples collected four to seven times from before weaning to slaughter 5 months old. At slaughter, a sample of ileum was taken for histopathology. In the first sampling when...... later on shed and/or were seropositive for L. intracellularis. The lowest prevalence of L. intracellularis was observed in 6-13 weeks old pigs and it seemed as though L. intracellularis in early infected pigs only activates a minor antibody response. At slaughter 66% of the pigs were found positive...

  15. Reações de imunofluorescência indireta: algumas modificações de sua técnica Indirect immunofluorescence tests: some modifications of their technique

    Directory of Open Access Journals (Sweden)

    Cláudio Santos Ferreira

    1973-09-01

    Full Text Available Propõem-se modificações de procedimentos rotineiros de reações de imunofluorescência indireta. A eluição das amostras de sangue dessecado contidas em papel-filtro é feita em placas ("godets" com tampas. Alças de níquel-cromo substituem pipetas capilares para a transferência de amostras de eluatos para as lâminas de microscopia. Propõe-se uma técnica rápida e eficiente de lavagem das preparações.Some simplifications intended for routine operations included immunofluorescence tests are proposed. The elution of dried blood samples is performed on test plates (water-color mixing plates, with a lid instead of in test tubes. Nickel-chromium wire loops are substituted for capillary pipettes in transferring eluate samples to microscope slides. A rapid and efficient washing technique is proposed.

  16. Evaluation of a direct immunofluorescent antibody (difma test using Leishmania genus - specific monoclonal antibody in the routine diagnosis of cutaneous leishmaniasis

    Directory of Open Access Journals (Sweden)

    Martha E. Chico

    1995-06-01

    Full Text Available A direct immunofluorescent antibody (DIFMA test using a Leishmania genus- specific monoclonal antibody was evaluated in the routine diagnosis of cutaneous leishmaniasis (CL in Ecuador. This test was compared with the standard diagnostic techniques of scrapings, culture and histology. Diagnostic samples were taken from a total of 90 active dermal ulcers from patients from areas of Ecuador known to be endemic for cutaneous leishmaniasis. DIFMA was positive in all lesions. It was shown to be significantly superior to standard diagnostic methods either alone or in combination. The sensitivity of DIFMA did not diminish with chronicity of lesions. This test proved to be extremely useful in the routine diagnosis of CL because it is highly sensitive, is easy to use and produces rapid results.

  17. Comparison between immunomagnetic separation, coupled with immunofluorescence, and the techniques of Faust et al. and of Lutz for the diagnosis of Giardia lamblia cysts in human feces

    Directory of Open Access Journals (Sweden)

    Souza Doris Sobral Marques

    2003-01-01

    Full Text Available In the present study, the performance of Immunomagnetic Separation technique, coupled with Immunofluorescence (IMS-IFA, was compared with the FAUST et al. and Lutz parasitological techniques for the detection of Giardia lamblia cysts in human feces. One hundred and twenty-seven samples were evaluated by the three techniques at the same time showing a rate of cyst detection of 27.5% by IMS-IFA and 15.7% by both Faust et al. and Lutz techniques. Data analysis showed a higher sensitivity of IMS-IFA for the detection of G. lamblia cysts in comparison with the techniques of FAUST et al. and Lutz. The use of this methodology as a routine procedure enables the processing of many samples simultaneously, in order to increase recovery rate of G. lamblia cysts and reduce the time of sample storage.

  18. Quantum Dots-Based Immunofluorescent Imaging of Stromal Fibroblasts Caveolin-1 and Light Chain 3B Expression and Identification of Their Clinical Significance in Human Gastric Cancer

    Directory of Open Access Journals (Sweden)

    Honglei Chen

    2012-10-01

    Full Text Available Caveolin-1 (Cav-1 expression deficiency and autophagy in tumor stromal fibroblasts (hereafter fibroblasts are involved in tumor proliferation and progression, particularly in breast and prostate cancer. The aim of this study was to detect the expression of fibroblastic Cav-1 and LC3B, markers of autophagy, in gastric cancer (GC and to analyze their clinical significances. Furthermore, because Epstein-Barr virus (EBV-associated GC (EBVaGC is a unique subtype of GC; we compared the differential expression of fibroblastic Cav-1 and LC3B in EBVaGC and non-EBVaGC. Quantum dots (QDs-based immunofluorescence histochemistry was used to examine the expression of fibroblastic Cav-1 and LC3B in 118 cases of GC with adequate stroma. QDs-based double immunofluorescence labeling was performed to detect the coexpression of Cav-1 and LC3B proteins. EBV-encoded small RNA was detected by QDs-based fluorescence in situ hybridization to identify EBVaGC. Multivariate analysis indicated that low fibroblastic Cav-1 level was an independent prognosticator (p = 0.029 that predicted poorer survival of GC patients. Positive fibroblastic LC3B was correlated with lower invasion (p = 0.032 and was positively associated with Cav-1 expression (r = 0.432, p < 0.001. EBV infection did not affect fibroblastic Cav-1 and LC3B expression. In conclusion, positive fibroblastic LC3B correlates with lower invasion, and low expression of fibroblastic Cav-1 is a novel predictor of poor GC prognosis.

  19. Diverticular Disease: Reconsidering Conventional Wisdom

    Science.gov (United States)

    Peery, Anne F.; Sandler, Robert S.

    2013-01-01

    Colonic diverticula are common in developed countries and complications of colonic diverticulosis are responsible for a significant burden of disease. Several recent publications have called into question long held beliefs about diverticular disease. Contrary to conventional wisdom, studies have not shown that a high fiber diet protects against asymptomatic diverticulosis. The risk of developing diverticulitis among individuals with diverticulosis is lower than the 10–25% commonly quoted, and may be as low as 1% over 11 years. Nuts and seeds do not increase the risk of diverticulitis or diverticular bleeding. It is unclear whether diverticulosis, absent diverticulitis or overt colitis, is responsible for chronic gastrointestinal symptoms or worse quality of life. The role of antibiotics in acute diverticulitis has been challenged by a large randomized trial that showed no benefit in selected patients. The decision to perform elective surgery should be made on a case-by-case basis and not routinely after a second episode of diverticulitis, when there has been a complication, or in young people. A colonoscopy should be performed to exclude colon cancer after an attack of acute diverticulitis but may not alter outcomes among individuals who have had a colonoscopy prior to the attack. Given these surprising findings, it is time to reconsider conventional wisdom about diverticular disease. PMID:23669306

  20. Implementing the chemical weapons convention

    Energy Technology Data Exchange (ETDEWEB)

    Kellman, B.; Tanzman, E. A.

    1999-12-07

    In 1993, as the CWC ratification process was beginning, concerns arose that the complexity of integrating the CWC with national law could cause each nation to implement the Convention without regard to what other nations were doing, thereby causing inconsistencies among States as to how the CWC would be carried out. As a result, the author's colleagues and the author prepared the Manual for National Implementation of the Chemical Weapons Convention and presented it to each national delegation at the December 1993 meeting of the Preparatory Commission in The Hague. During its preparation, the Committee of CWC Legal Experts, a group of distinguished international jurists, law professors, legally-trained diplomats, government officials, and Parliamentarians from every region of the world, including Central Europe, reviewed the Manual. In February 1998, they finished the second edition of the Manual in order to update it in light of developments since the CWC entered into force on 29 April 1997. The Manual tries to increase understanding of the Convention by identifying its obligations and suggesting methods of meeting them. Education about CWC obligations and available alternatives to comply with these requirements can facilitate national response that are consistent among States Parties. Thus, the Manual offers options that can strengthen international realization of the Convention's goals if States Parties act compatibly in implementing them. Equally important, it is intended to build confidence that the legal issues raised by the Convention are finite and addressable. They are now nearing competition of an internet version of this document so that interested persons can access it electronically and can view the full text of all of the national implementing legislation it cites. The internet address, or URL, for the internet version of the Manual is http: //www.cwc.ard.gov. This paper draws from the Manual. It comparatively addresses approximately thirty

  1. Implementing the chemical weapons convention

    International Nuclear Information System (INIS)

    Kellman, B.; Tanzman, E. A.

    1999-01-01

    In 1993, as the CWC ratification process was beginning, concerns arose that the complexity of integrating the CWC with national law could cause each nation to implement the Convention without regard to what other nations were doing, thereby causing inconsistencies among States as to how the CWC would be carried out. As a result, the author's colleagues and the author prepared the Manual for National Implementation of the Chemical Weapons Convention and presented it to each national delegation at the December 1993 meeting of the Preparatory Commission in The Hague. During its preparation, the Committee of CWC Legal Experts, a group of distinguished international jurists, law professors, legally-trained diplomats, government officials, and Parliamentarians from every region of the world, including Central Europe, reviewed the Manual. In February 1998, they finished the second edition of the Manual in order to update it in light of developments since the CWC entered into force on 29 April 1997. The Manual tries to increase understanding of the Convention by identifying its obligations and suggesting methods of meeting them. Education about CWC obligations and available alternatives to comply with these requirements can facilitate national response that are consistent among States Parties. Thus, the Manual offers options that can strengthen international realization of the Convention's goals if States Parties act compatibly in implementing them. Equally important, it is intended to build confidence that the legal issues raised by the Convention are finite and addressable. They are now nearing competition of an internet version of this document so that interested persons can access it electronically and can view the full text of all of the national implementing legislation it cites. The internet address, or URL, for the internet version of the Manual is http: //www.cwc.ard.gov. This paper draws from the Manual. It comparatively addresses approximately thirty

  2. The raw milk quality from organic and conventional agriculture

    Directory of Open Access Journals (Sweden)

    Juraj Čuboň

    2008-01-01

    Full Text Available In the experiment the parameters of milk quality from organic and conventional dairy farm were analyzed. The number of somatic cells was 219. 103 . ml−1 in the organic milk and 242. 103 . ml−1 in the conventional milk. It seems that conditions of organic farming could be able to have a positive effect of health of mammary gland. We found the highest number of somatic cells at the end of the year (336.103 . ml−1 in organic milk in December, respectively 336.103 . ml−1 in conventional milk in November. The total bacteria count was higher in organic milk (86.103 CFU . ml−1 than conventional (51.103 CFU . ml−1 likewise the number of coliform bacteria. Number of coliform bacteria was by conventional milk under 1000 CFU . ml−1 for all samples. The highest number of coliform bacteria in organic milk was achieved in February (1000 CFU . ml−1. We found higher content of fat (4.23 g . 100g−1 and protein (3.41 g . 100g−1 by organic milk in comparison with the conventional milk (4.11 g . 100g−1, resp. 3.39 g . 100g−1. The higher content of protein and fat in organic milk and the higher protein content in conventional milk were determined in December. The heat resistance was determined by 96 % ethanol required to coagulation of 2 ml of milk. The conventional milk has significantly lower heat resistance (1.38 ml than the organic one (1.86 ml. Better heat stability by organic milk and higher content of Ca (144.29 mg . 100g−1 correspond with higher technological quality of organic milk.

  3. Modification of radiosensitivity of mammalian cells by means of hyperthermia and chemical agent. Coordinated programme on improvement of cancer therapy by the combination of treatment by conventional radiation and physical or chemical means

    International Nuclear Information System (INIS)

    Djordjevic, O.

    1984-11-01

    The effect of the treatment of the cultured mammalian cells with a relatively new anti-cancer drug teniposide (VM26), radiation (4 Gy), hyperthermia (42 deg. C and 45 deg. C) and caffeine, in various combinations, has been studied. The following conclusions can be drawn from the data obtained: The cultured mammalian cells respond to the anti-cancer drug VM26 treatment in a dose and time dependent manner. Significant potentiation of cell killing was demonstrated when they are exposed simultaneously to VM26 and hyperthermia. Post-treatment incubation of the cells in non-toxic concentration of caffeine (2 mM) has produced a marked potentiation of the lethal effect, indicating that caffeine interferes with the repair processes in these cells. Combination of VM26, hyperthermia and caffeine produced a maximum killing effect compared to VM26 treatment only. When the cells are exposed to initial (90 min. at 42 deg. C or 40 min. at 45 deg. C) and subsequent hyperthermia (60 min. at 42 deg. C or 60 min. at 45 deg. C) the thermotolerance will develop depending on the degree of initial and subsequent temperature. The combination of hyperthermia with irradiation results in a potentiation of the effect of treatment compared to the treatment with only irradiation or hyperthermia. Maximum killing of the cells will be obtained when irradiation is applied immediately after hyperthermia. The results obtained should be regarded as useful in case of clinical application of the tested agents

  4. Mobilization of Viable Tumor Cells Into the Circulation During Radiation Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Olga A. [Division of Radiation Oncology and Cancer Imaging, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Molecular Radiation Biology Laboratory, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); The Sir Peter MacCallum Department of Oncology, University of Melbourne, Melbourne, VIC (Australia); Anderson, Robin L. [The Sir Peter MacCallum Department of Oncology, University of Melbourne, Melbourne, VIC (Australia); Metastasis Research Laboratory, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Russell, Prudence A. [Department of Anatomical Pathology, St. Vincent Hospital, Fitzroy, VIC (Australia); Ashley Cox, R. [Division of Radiation Oncology and Cancer Imaging, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Ivashkevich, Alesia [Molecular Radiation Biology Laboratory, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Laboratory of DNA Repair and Genomics, Centre for Innate Immunity and Infectious Disease, Monash Institute for Medical Research, Monash University, Clayton, VIC (Australia); Swierczak, Agnieszka; Doherty, Judy P. [Metastasis Research Laboratory, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Jacobs, Daphne H.M. [Division of Radiation Oncology and Cancer Imaging, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Smith, Jai [Molecular Radiation Biology Laboratory, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Siva, Shankar; Daly, Patricia E. [Division of Radiation Oncology and Cancer Imaging, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); Ball, David L. [Division of Radiation Oncology and Cancer Imaging, Peter MacCallum Cancer Centre, East Melbourne, VIC (Australia); The Sir Peter MacCallum Department of Oncology, University of Melbourne, Melbourne, VIC (Australia); and others

    2014-02-01

    Purpose: To determine whether radiation therapy (RT) could mobilize viable tumor cells into the circulation of non-small cell lung cancer (NSCLC) patients. Methods and Materials: We enumerated circulating tumor cells (CTCs) by fluorescence microscopy of blood samples immunostained with conventional CTC markers. We measured their DNA damage levels using γ-H2AX, a biomarker for radiation-induced DNA double-strand breaks, either by fluorescence-activated cell sorting or by immunofluorescence microscopy. Results: Twenty-seven RT-treated NSCLC patients had blood samples analyzed by 1 or more methods. We identified increased CTC numbers after commencement of RT in 7 of 9 patients treated with palliative RT, and in 4 of 8 patients treated with curative-intent RT. Circulating tumor cells were also identified, singly and in clumps in large numbers, during RT by cytopathologic examination (in all 5 cases studied). Elevated γ-H2AX signal in post-RT blood samples signified the presence of CTCs derived from irradiated tumors. Blood taken after the commencement of RT contained tumor cells that proliferated extensively in vitro (in all 6 cases studied). Circulating tumor cells formed γ-H2AX foci in response to ex vivo irradiation, providing further evidence of their viability. Conclusions: Our findings provide a rationale for the development of strategies to reduce the concentration of viable CTCs by modulating RT fractionation or by coadministering systemic therapies.

  5. Mobilization of Viable Tumor Cells Into the Circulation During Radiation Therapy

    International Nuclear Information System (INIS)

    Martin, Olga A.; Anderson, Robin L.; Russell, Prudence A.; Ashley Cox, R.; Ivashkevich, Alesia; Swierczak, Agnieszka; Doherty, Judy P.; Jacobs, Daphne H.M.; Smith, Jai; Siva, Shankar; Daly, Patricia E.; Ball, David L.

    2014-01-01

    Purpose: To determine whether radiation therapy (RT) could mobilize viable tumor cells into the circulation of non-small cell lung cancer (NSCLC) patients. Methods and Materials: We enumerated circulating tumor cells (CTCs) by fluorescence microscopy of blood samples immunostained with conventional CTC markers. We measured their DNA damage levels using γ-H2AX, a biomarker for radiation-induced DNA double-strand breaks, either by fluorescence-activated cell sorting or by immunofluorescence microscopy. Results: Twenty-seven RT-treated NSCLC patients had blood samples analyzed by 1 or more methods. We identified increased CTC numbers after commencement of RT in 7 of 9 patients treated with palliative RT, and in 4 of 8 patients treated with curative-intent RT. Circulating tumor cells were also identified, singly and in clumps in large numbers, during RT by cytopathologic examination (in all 5 cases studied). Elevated γ-H2AX signal in post-RT blood samples signified the presence of CTCs derived from irradiated tumors. Blood taken after the commencement of RT contained tumor cells that proliferated extensively in vitro (in all 6 cases studied). Circulating tumor cells formed γ-H2AX foci in response to ex vivo irradiation, providing further evidence of their viability. Conclusions: Our findings provide a rationale for the development of strategies to reduce the concentration of viable CTCs by modulating RT fractionation or by coadministering systemic therapies

  6. Conventional power sources for colliders

    International Nuclear Information System (INIS)

    Allen, M.A.

    1987-07-01

    At SLAC we are developing high peak-power klystrons to explore the limits of use of conventional power sources in future linear colliders. In an experimental tube we have achieved 150 MW at 1 μsec pulse width at 2856 MHz. In production tubes for SLAC Linear Collider (SLC) we routinely achieve 67 MW at 3.5 μsec pulse width and 180 pps. Over 200 of the klystrons are in routine operation in SLC. An experimental klystron at 8.568 GHz is presently under construction with a design objective of 30 MW at 1 μsec. A program is starting on the relativistic klystron whose performance will be analyzed in the exploration of the limits of klystrons at very short pulse widths

  7. Laparoscopic splenectomy using conventional instruments

    Directory of Open Access Journals (Sweden)

    Dalvi A

    2005-01-01

    Full Text Available INTRODUCTION : Laparoscopic splenectomy (LS is an accepted procedure for elective splenectomy. Advancement in technology has extended the possibility of LS in massive splenomegaly [Choy et al., J Laparoendosc Adv Surg Tech A 14(4, 197-200 (2004], trauma [Ren et al., Surg Endosc 15(3, 324 (2001; Mostafa et al., Surg Laparosc Endosc Percutan Tech 12(4, 283-286 (2002], and cirrhosis with portal hypertension [Hashizume et al., Hepatogastroenterology 49(45, 847-852 (2002]. In a developing country, these advanced gadgets may not be always available. We performed LS using conventional and reusable instruments in a public teaching the hospital without the use of the advanced technology. The technique of LS and the outcome in these patients is reported. MATERIALS AND METHODS : Patients undergoing LS for various hematological disorders from 1998 to 2004 were included. Electrocoagulation, clips, and intracorporeal knotting were the techniques used for tackling short-gastric vessels and splenic pedicle. Specimen was delivered through a Pfannensteil incision. RESULTS : A total of 26 patients underwent LS. Twenty-two (85% of patients had spleen size more than 500 g (average weight being 942.55 g. Mean operative time was 214 min (45-390 min. The conversion rate was 11.5% ( n = 3. Average duration of stay was 5.65 days (3-30 days. Accessory spleen was detected and successfully removed in two patients. One patient developed subphrenic abscess. There was no mortality. There was no recurrence of hematological disease. CONCLUSION : Laparoscopic splenectomy using conventional equipment and instruments is safe and effective. Advanced technology has a definite advantage but is not a deterrent to the practice of LS.

  8. Adenomyoepithelial tumours and myoepithelial carcinomas of the breast – a spectrum of monophasic and biphasic tumours dominated by immature myoepithelial cells

    Directory of Open Access Journals (Sweden)

    Herbst Hermann

    2005-07-01

    Full Text Available Abstract Background Adenomyoepithelial tumours and myoepithelial carcinomas of the breast are primarily defined by the presence of neoplastic cells with a myoepithelial immunophenotype. Current classification schemes are based on purely descriptive features and an assessment of individual prognosis is still problematic. Methods A series of 27 adenomyoepithelial tumours of the breast was analysed immunohistochemically with antibodies directed against various cytokeratins, p63, smooth muscle alpha-actin (SMA and vimentin. Additionally, double immunofluorescence and comparative genomic hybridisation (CGH was performed. Results Immunohistochemically, all the tumours showed a constant expression of high molecular weight cytokeratins (Ck Ck5 and Ck14, p63, SMA and vimentin. With exception of one case diagnosed as myoepithelial carcinoma, all tested tumours expressed low molecular weight cytokeratin Ck18 in variable proportions of cells. Even in monophasic tumours lacking obvious glandular differentiation in conventional staining, a number of neoplastic cells still expressed those cytokeratins. Double immunofluorescence revealed tumour cells exclusively staining for Ck5/Ck14 in the presence of other cell populations that co-expressed high molecular weight Ck5/Ck14 as well as either low molecular weight Ck8/18 or SMA. Based on morphology, we assigned the series to three categories, benign, borderline and malignant. This classification was supported by a stepwise increase in cytogenetic alterations on CGH. Conclusion Adenomyoepithelial tumours comprise a spectrum of neoplasms consisting of an admixture of glandular and myoepithelial differentiation patterns. As a key component SMA-positive cells co-expressing cytokeratins could be identified. Although categorisation of adenomyoepithelial tumours in benign, borderline and malignant was supported by results of CGH, any assessment of prognosis requires to be firmly based on morphological grounds. At present

  9. Paris Convention on third party liability in the field of nuclear energy and Brussels Convention Supplementary to the Paris Convention

    International Nuclear Information System (INIS)

    1989-01-01

    This new bilingual (English and French) edition of the 1960 Paris Convention and 1963 Brussels Supplementary Convention incorporates the provisions of the Protocols which amended each of them on two occasions, in 1964 and 1982. The Expose des motifs to the Paris Convention, as revised in 1982 is also included in this pubication. (NEA) [fr

  10. Conventional and advanced liquid biofuels

    Directory of Open Access Journals (Sweden)

    Đurišić-Mladenović Nataša L.

    2016-01-01

    Full Text Available Energy security and independence, increase and fluctuation of the oil price, fossil fuel resources depletion and global climate change are some of the greatest challanges facing societies today and in incoming decades. Sustainable economic and industrial growth of every country and the world in general requires safe and renewable resources of energy. It has been expected that re-arrangement of economies towards biofuels would mitigate at least partially problems arised from fossil fuel consumption and create more sustainable development. Of the renewable energy sources, bioenergy draws major and particular development endeavors, primarily due to the extensive availability of biomass, already-existence of biomass production technologies and infrastructure, and biomass being the sole feedstock for liquid fuels. The evolution of biofuels is classified into four generations (from 1st to 4th in accordance to the feedstock origin; if the technologies of feedstock processing are taken into account, than there are two classes of biofuels - conventional and advanced. The conventional biofuels, also known as the 1st generation biofuels, are those produced currently in large quantities using well known, commercially-practiced technologies. The major feedstocks for these biofuels are cereals or oleaginous plants, used also in the food or feed production. Thus, viability of the 1st generation biofuels is questionable due to the conflict with food supply and high feedstocks’ cost. This limitation favoured the search for non-edible biomass for the production of the advanced biofuels. In a general and comparative way, this paper discusses about various definitions of biomass, classification of biofuels, and brief overview of the biomass conversion routes to liquid biofuels depending on the main constituents of the biomass. Liquid biofuels covered by this paper are those compatible with existing infrastructure for gasoline and diesel and ready to be used in

  11. Biomass energy conversion: conventional and advanced technologies

    Energy Technology Data Exchange (ETDEWEB)

    Young, B C; Hauserman, W B [Energy and Environmental Research Center, University of North Dakota, Grand Forks, ND (United States)

    1995-12-01

    Increasing interest in biomass energy conversion in recent years has focused attention on enhancing the efficiency of technologies converting biomass fuels into heat and power, their capital and operating costs and their environmental emissions. Conventional combustion systems, such as fixed-bed or grate units and entrainment units, deliver lower efficiencies (<25%) than modem coal-fired combustors (30-35%). The gasification of biomass will improve energy conversion efficiency and yield products useful for heat and power generation and chemical synthesis. Advanced biomass gasification technologies using pressurized fluidized-bed systems, including those incorporating hot-gas clean-up for feeding gas turbines or fuel cells, are being demonstrated. However, many biomass gasification processes are derivatives of coal gasification technologies and do not exploit the unique properties of biomass. This paper examines some existing and upcoming technologies for converting biomass into electric power or heat. Small-scale 1-30 MWe units are emphasized, but brief reference is made to larger and smaller systems, including those that bum coal-biomass mixtures and gasifiers that feed pilot-fuelled diesel engines. Promising advanced systems, such as a biomass integrated gasifier/gas turbine (BIG/GT) with combined-cycle operation and a biomass gasifier coupled to a fuel cell, giving cycle efficiencies approaching 50% are also described. These advanced gasifiers, typically fluid-bed designs, may be pressurized and can use a wide variety of biomass materials to generate electricity, process steam and chemical products such as methanol. Low-cost, disposable catalysts are becoming available for hot-gas clean-up (enhanced gas composition) for turbine and fuel cell systems. The advantages, limitations and relative costs of various biomass gasifier systems are briefly discussed. The paper identifies the best known biomass power projects and includes some information on proposed and

  12. Biomass energy conversion: conventional and advanced technologies

    International Nuclear Information System (INIS)

    Young, B.C.; Hauserman, W.B.

    1995-01-01

    Increasing interest in biomass energy conversion in recent years has focused attention on enhancing the efficiency of technologies converting biomass fuels into heat and power, their capital and operating costs and their environmental emissions. Conventional combustion systems, such as fixed-bed or grate units and entrainment units, deliver lower efficiencies (<25%) than modem coal-fired combustors (30-35%). The gasification of biomass will improve energy conversion efficiency and yield products useful for heat and power generation and chemical synthesis. Advanced biomass gasification technologies using pressurized fluidized-bed systems, including those incorporating hot-gas clean-up for feeding gas turbines or fuel cells, are being demonstrated. However, many biomass gasification processes are derivatives of coal gasification technologies and do not exploit the unique properties of biomass. This paper examines some existing and upcoming technologies for converting biomass into electric power or heat. Small-scale 1-30 MWe units are emphasized, but brief reference is made to larger and smaller systems, including those that bum coal-biomass mixtures and gasifiers that feed pilot-fuelled diesel engines. Promising advanced systems, such as a biomass integrated gasifier/gas turbine (BIG/GT) with combined-cycle operation and a biomass gasifier coupled to a fuel cell, giving cycle efficiencies approaching 50% are also described. These advanced gasifiers, typically fluid-bed designs, may be pressurized and can use a wide variety of biomass materials to generate electricity, process steam and chemical products such as methanol. Low-cost, disposable catalysts are becoming available for hot-gas clean-up (enhanced gas composition) for turbine and fuel cell systems. The advantages, limitations and relative costs of various biomass gasifier systems are briefly discussed. The paper identifies the best known biomass power projects and includes some information on proposed and

  13. Identification of mononuclear cells in human blood. II. Evaluation of morphological and immunological aspects of native and formaldehyde-fixed cell populations

    NARCIS (Netherlands)

    Schuit, H.R.E.; Hijmans, W.

    1980-01-01

    The presence of surface-associated immunoglobulins and Fc receptors on mononuclear cells from normal human blood waas investigated by the direct immunofluorescence technique combined with phase-contrast microscopy. Formaldehyde-fixed cells were compared to unfixed cells and to cells preincubated at

  14. Comparative evaluation of the three different surface treatments - conventional, laser and Nano technology methods in enhancing the surface characteristics of commercially pure titanium discs and their effects on cell adhesion: An in vitro study.

    Science.gov (United States)

    Vignesh; Nayar, Sanjna; Bhuminathan; Mahadevan; Santhosh, S

    2015-04-01

    The surface area of the titanium dental implant materials can be increased by surface treatments without altering their shape and form, thereby increasing the biologic properties of the biomaterial. A good biomaterial helps in early cell adhesion and cell signaling. In this study, the commercially pure titanium surfaces were prepared to enable machined surfaces to form a control material and to be compared with sandblasted and acid-etched surfaces, laser treated surfaces and titanium dioxide (20 nm) Nano-particle coated surfaces. The surface elements were characterized. The biocompatibility was evaluated by cell culture in vitro using L929 fibroblasts. The results suggested that the titanium dioxide Nano-particle coated surfaces had good osteoconductivity and can be used as a potential method for coating the biomaterial.

  15. Role of non-conventional T lymphocytes in respiratory infections: the case of the pneumococcus.

    Directory of Open Access Journals (Sweden)

    Stoyan Ivanov

    2014-10-01

    Full Text Available Non-conventional T lymphocytes constitute a special arm of the immune system and act as sentinels against pathogens at mucosal surfaces. These non-conventional T cells (including mucosal-associated invariant T [MAIT] cells, gamma delta [γδ] T cells, and natural killer T [NKT] cells display several innate cell-like features and are rapidly activated by the recognition of conserved, stress-induced, self, and microbial ligands. Here, we review the role of non-conventional T cells during respiratory infections, with a particular focus on the encapsulated extracellular pathogen Streptococcus pneumoniae, the leading cause of bacterial pneumonia worldwide. We consider whether MAIT cells, γδ T cells, and NKT cells might offer opportunities for preventing and/or treating human pneumococcus infections.

  16. Subclass of individual IgA-secreting human lymphocytes. Investigation of in vivo pneumococcal polysaccharide-induced and in vitro mitogen-induced blood B cells by monolayer plaque-forming cell assays

    DEFF Research Database (Denmark)

    Heilmann, C; Barington, T; Sigsgaard, T

    1988-01-01

    The subclass of individual human IgA B cells was investigated by means of monolayer plaque-forming cell assays permitting analysis of all IgA-secreting cells as well as of cells secreting IgA anti-pneumococcal polysaccharide antibody. Center cells were examined by indirect immunofluorescence...

  17. Detection of Lawsonia intracellularis in formalin-fixed porcine intestinal tissue samples: comparison of immunofluorescence and in-situ hybridization, and evaluation of the effects of controlled autolysis.

    Science.gov (United States)

    Jensen, T K; Boesen, H T; Vigre, H; Boye, M

    2010-01-01

    Two methods, an immunofluorescence assay (IFA; with a Lawsonia intracellularis-specific monoclonal antibody) and fluorescent in-situ hybridization (FISH; with a specific oligonucleotide probe targeting 16S ribosomal RNA of the bacterium), were compared for their ability to detect L. intracellularis (the cause of porcine proliferative enteritis [PE]) in formalin-fixed samples of intestinal tissue. Of 69 intestinal samples with gross lesions of PE, 63 were positive by both FISH and IFA, but six were positive only by IFA. This indicated that the sensitivity of FISH was 91% that of IFA. However, both methods had a specificity of 100%. Fifty normal porcine intestines were negative by both tests. IFA was much less susceptible than FISH to the effects of autolysis. Thus, three of nine samples from pigs with PE were FISH-negative after being kept at 20 degrees C for 4 days, and seven were FISH negative after 2 weeks; after 4 weeks at this temperature, however, six of the nine samples were still IFA positive. After being kept at 4 degrees C for 12 weeks, the majority of samples (> or = 66%) were positive by both methods.

  18. Comparative evaluations of the detection of antinuclear antibodies by means of various immunofluorescence techniques and by means of a radioimmunoassay under particular consideration of disseminated Lupus erythematodus

    International Nuclear Information System (INIS)

    Gemuend, R.

    1980-01-01

    On a group of 146 test persons (in 50 cases desseminated lupus erythematodus had been confirmed), for the first time comparative evaluations were made with four methods (A to D) under the application of a repurified fluorescinisothiocyanat FITC) serum, in order to detect antinuclear antibodies (ANA). The ANA detection was obtained by immunofluorescence (IFL) on frozen sections of mouse livers; by IFL on chicken erythrocytes smears, previously treated with hydrochloric acid; by IFL on ethanol-fixed flagellates Crithidia luciliae; and by the radioimmunoassay (RIA) of a test kit with reference sera. These two tests served to detect antibodies - with respect to negative DNA - which are of particular importance in lupous nephritis. A good correlation of both methods was proved by means of various statistic methods and by follow-up observations and examinations of the reference sera. Possible reasons responsible for the deviations, which were found between the two tests, are described. Of all 4 tests, RIA and IFL on Crithida resulted to be the most closely ones to the relevant laboratory values and reflect very evidently the activity of the desseminated lupus erethematodus. The particularly well correlation with the blood sedimentation rate, proteinuria and with the complement level becomes very obvious. The advantages and disadvantages of the applied methods are discussed and it is emphasized that at present the method of choice for the detection of DNA antibodies is the combined examination of the patient serum, both, in the IFL on Crithidia and in the RIA. (orig./MG) [de

  19. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    Science.gov (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. PAPNET-assisted primary screening of conventional cervical smears.

    Science.gov (United States)

    Cenci, M; Nagar, C; Vecchione, A

    2000-01-01

    The PAPNET System is the only device with a neural-network-based-artificial intelligence to detect and show the images of abnormal cells on the monitor to be evaluated in an interactive way. We effectively used the PAPNET in rescreening of conventional cervical smears and we detected its advantages and its disadvantages. In this paper, we report our results from PAPNET-assisted primary screening performed on 20,154 conventional smears. The smears were classified as Negative or as Review. The Negative cases were rapidly rescreened mainly near the coverslip edges, which are the slide areas not analyzed by automated devices because of focusing problems. The Review cases were fully reanalyzed by the optic microscope. In summary, 140 positive smears were detected: 57 cases showed changes due to HPV, 63 LSIL, 15 HSIL, and 5 carcinomas. Therefore, the PAPNET System was confirmed as useful in primary screening of conventional cervical samples as well as rescreening.

  1. Evaluation and Comparison of the Pathogenicity and Host Immune Responses Induced by a G2b Taiwan Porcine Epidemic Diarrhea Virus (Strain Pintung 52) and Its Highly Cell-Culture Passaged Strain in Conventional 5-Week-Old Pigs.

    Science.gov (United States)

    Chang, Yen-Chen; Kao, Chi-Fei; Chang, Chia-Yu; Jeng, Chian-Ren; Tsai, Pei-Shiue; Pang, Victor Fei; Chiou, Hue-Ying; Peng, Ju-Yi; Cheng, Ivan-Chen; Chang, Hui-Wen

    2017-05-19

    A genogroup 2b (G2b) porcine epidemic diarrhea virus (PEDV) Taiwan Pintung 52 (PEDVPT) strain was isolated in 2014. The pathogenicity and host antibody responses elicited by low-passage (passage 5; PEDVPT-P5) and high-passage (passage 96; PEDVPT-P96) PEDVPT strains were compared in post-weaning PEDV-seronegative pigs by oral inoculation. PEDVPT-P5-inoculation induced typical diarrhea during 1-9 days post inoculation with fecal viral shedding persisting for 26 days. Compared to PEDVPT-P5, PEDVPT-P96 inoculation induced none-to-mild diarrhea and lower, delayed fecal viral shedding. Although PEDVPT-P96 elicited slightly lower neutralizing antibodies and PEDV-specific immunoglobulin G (IgG) and immunoglobulin A (IgA) titers, a reduction in pathogenicity and viral shedding of the subsequent challenge with PEDVPT-P5 were noted in both PEDVPT-P5- and PEDVPT-P96-inoculated pigs. Alignment and comparison of full-length sequences of PEDVPT-P5 and PEDVPT-P96 revealed 23 nucleotide changes and resultant 19 amino acid substitutions in non-structure proteins 2, 3, 4, 9, 14, 15, spike, open reading frame 3 (ORF3), and membrane proteins with no detectable deletion or insertion. The present study confirmed the pathogenicity of the PEDVPT isolate in conventional post-weaning pigs. Moreover, data regarding viral attenuation and potency of induced antibodies against PEDVPT-P5 identified PEDVPT-P96 as a potential live-attenuated vaccine candidate.

  2. Rhegmatogenous retinal detachment and conventional surgical treatment.

    Science.gov (United States)

    Golubovic, M

    2013-01-01

    The aim of the paper was to present the efficacy and indications for application of conventional surgical treatment of retinal detachment by using external implants, that is,application of encircling band and buckle. This study comprised patients from the University Eye Clinic in Skopje. A total of 33 patients were diagnosed and surgically treated in the period between May 2010 and August 2011. Conventional surgery was applied in smaller number of patients whose changes of the vitreous body were manifested by detachment of posterior hyaloid membrane, syneresis, with appearance of a small number of pigment cells in the vitreous body and synchysis, and the very retina was with fresh detachment without folds or epiretinal changes (that is, PVR A grade). There were a larger number of patients with more distinct proliferative changes of the vitreous body and of the retina, grades PVR B to C1-C2, and who also underwent the same surgical approach. Routine ophthalmologic examinations were performed, including: determination of visual acuity by Snellen's optotypes, determination of eye pressure with Schiotz's tonometer, examination of anterior segment on biomicroscopy, indirect biomicroscopy of posterior eye segment (vitreous body and retina) and examination on biomicroscopy with Goldmann prism, B scan echography of the eyes before and after surgical treatment. Conventional treatment was used by external application of buckle or application of buckle and encircling band. In case of one break, radial buckle was applied and in case of multiple breaks in one quadrant limbus parallel buckle was applied. Besides buckle, encircling band was applied in patients with total or subtotal retinal detachment with already present distinct changes in the vitreous body (PVR B or C1-C2) and degenerative changes in the vitreous body. Breaks were closed with cryopexy. The results obtained have shown that male gender was predominant and that the disease was manifested in younger male adults

  3. 15 CFR 742.18 - Chemical Weapons Convention (CWC or Convention).

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Chemical Weapons Convention (CWC or... REGULATIONS CONTROL POLICY-CCL BASED CONTROLS § 742.18 Chemical Weapons Convention (CWC or Convention). States... Use of Chemical Weapons and on Their Destruction, also known as the Chemical Weapons Convention (CWC...

  4. Thy-1+ dendritic cells in murine epidermis are bone marrow-derived

    International Nuclear Information System (INIS)

    Breathnach, S.M.; Katz, S.I.

    1984-01-01

    Thy-1+, Ly-5+ dendritic cells have recently been described as a resident cell population in murine epidermis, but their ontogeny and function are unknown. The origin and turnover of epidermal Thy-1+ cells utilizing chimeric mice were investigated. Lethally x-irradiated AKR/J (Thy-1.1+) and AKR/Cum (Thy-1.2+) mice were reconstituted with allogeneic bone marrow cells with or without thymocytes from congenic AKR/Cum or AKR/J mice, respectively. The density of residual indigenous Thy-1.1+ cells in AKR/J chimeras and Thy-1.2+ cells in AKR/Cum chimeras was substantially reduced following x-irradiation, as determined by immunofluorescence staining of epidermal sheets. Epidermal repopulation by allogeneic Thy-1+ dendritic epidermal cells was first observed at 5 weeks in AKR/J chimeras and at 7 weeks in AKR/Cum chimeras and progressed slowly. Repopulation was not enhanced by increasing the number of allogeneic bone marrow cells injected from 2 X 10(7) to 10(8) cells or by the addition of 8 X 10(7) allogeneic thymocytes to the donor inoculate. Epidermal repopulation by allogeneic Thy-1.2+ cells was not seen in AKR/J mice reconstituted with syngeneic bone marrow cells and allogeneic Thy-1.2+ AKR/Cum thymocytes. Taken together, these results indicate that Thy-1+ dendritic epidermal cells are derived from the bone marrow and suggest that they are not related to conventional peripheral T-lymphocytes

  5. Human rights and conventionality control in Mexico

    Directory of Open Access Journals (Sweden)

    Azul América Aguiar-Aguilar

    2014-12-01

    Full Text Available The protection of human rights in Mexico has, de jure, suffered an important change in the last years, given a new judicial interpretation delivered by the National Supreme Court of Justice that allows the use of conventionality control, which means, that it allows federal and state judges to verify the conformity of domestic laws with those established in the Inter-American Convention of Human Rights. To what extent domestic actors are protecting human rights using this new legal tool called conventionality control? In this article I explore whom and how is conventionality control being used in Mexico. Using N-Vivo Software I reviewed concluded decisions delivered by intermediate level courts (Collegiate Circuit Courts in three Mexican states. The evidence points that conventionality control is a very useful tool especially to defenders, who appear in sentences claiming compliance with the commitments Mexico has acquired when this country ratified the Convention.

  6. A sensitive, reproducible and objective immunofluorescence analysis method of dystrophin in individual fibers in samples from patients with duchenne muscular dystrophy.

    Directory of Open Access Journals (Sweden)

    Chantal Beekman

    Full Text Available Duchenne muscular dystrophy (DMD is characterized by the absence or reduced levels of dystrophin expression on the inner surface of the sarcolemmal membrane of muscle fibers. Clinical development of therapeutic approaches aiming to increase dystrophin levels requires sensitive and reproducible measurement of differences in dystrophin expression in muscle biopsies of treated patients with DMD. This, however, poses a technical challenge due to intra- and inter-donor variance in the occurrence of revertant fibers and low trace dystrophin expression throughout the biopsies. We have developed an immunofluorescence and semi-automated image analysis method that measures the sarcolemmal dystrophin intensity per individual fiber for the entire fiber population in a muscle biopsy. Cross-sections of muscle co-stained for dystrophin and spectrin have been imaged by confocal microscopy, and image analysis was performed using Definiens software. Dystrophin intensity has been measured in the sarcolemmal mask of spectrin for each individual muscle fiber and multiple membrane intensity parameters (mean, maximum, quantiles per fiber were calculated. A histogram can depict the distribution of dystrophin intensities for the fiber population in the biopsy. This method was tested by measuring dystrophin in DMD, Becker muscular dystrophy, and healthy muscle samples. Analysis of duplicate or quadruplicate sections of DMD biopsies on the same or multiple days, by different operators, or using different antibodies, was shown to be objective and reproducible (inter-assay precision, CV 2-17% and intra-assay precision, CV 2-10%. Moreover, the method was sufficiently sensitive to detect consistently small differences in dystrophin between two biopsies from a patient with DMD before and after treatment with an investigational compound.

  7. Evaluation of Immunofluorescence Antibody Test Used for the Diagnosis of Canine Leishmaniasis in the Mediterranean Basin: A Systematic Review and Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Amel Adel

    Full Text Available With an expected sensitivity (Se of 96% and specificity (Sp of 98%, the immunofluorescence antibody test (IFAT is frequently used as a reference test to validate new diagnostic methods and estimate the canine leihmaniasis (CanL true prevalence in the Mediterranean basin. To review the diagnostic accuracy of IFAT to diagnose CanL in this area with reference to its Se and Sp and elucidate the potential causes of their variations, a systematic review was conducted (31 studies for the 26-year period. Three IFAT validation methods stood out: the classical contingency table method, methods based on statistical models and those based on experimental studies. A variation in the IFAT Se and Sp values and cut-off values was observed. For the classical validation method based on a meta-analysis, the Se of IFAT was estimated in this area as 89.86% and 31.25% in symptomatic and asymptomatic dogs, respectively. The Sp of IFAT was estimated in non-endemic and endemic areas as 98.12% and 96.57%, respectively. IFAT can be considered as a good standard test in non-endemic areas for CanL, but its accuracy declines in endemic areas due to the complexity of the disease. Indeed, the accuracy of IFAT is due to the negative results obtained in non-infected dogs from non-endemic areas and to the positive results obtained in sera of symptomatic dogs living in endemic areas. But IFAT results are not unequivocal when it comes to determining CanL infection on asymptomatic dogs living in endemic areas. Statistical methods might be a solution to overcome the lack of gold standard, to better categorize groups of animals investigated, to assess optimal cut-off values and to allow a better estimate of the true prevalence aiming information on preventive/control measures for CanL.

  8. [Immunofluorescence assay with Crithidia luciliae for the detection of anti-DNA antibodies. Atypical images and their relationship with Chagas' disease and leishmaniasis].

    Science.gov (United States)

    Griemberg, Gloria; Ferrarotti, Nidia F; Svibel, Graciela; Ravelli, Maria R; Taranto, Nestor J; Malchiodi, Emilio L; Pizzimenti, Maria C

    2006-01-01

    Anti-native DNA antibodies can be detected by indirect immunofluorescence assay with Crithidia luciliae, displaying an annular image due to a kinetoplast containing double stranded DNA. Other structures such as membrane, flagellum and basal corpuscle can be stained as well, showing what is called atypical fluorescent images. As C. luciliae belongs to the Trypanosomatidae family, which include the human pathogens Trypanosoma cruzi and Leishmania spp., it was considered that these atypical images could be caused by cross-reactions. Serological studies for Chagas' disease were performed in 105 serum samples displaying atypical images. Sixty four percent of the samples from non endemic and 78.3% from endemic areas for Chagas' disease showed fluorescence in both, membrane and flagellum (joint image). Fifty samples from normal blood donors and 57 samples from patients with conective tissue diseases were tested with C. luciliae. None of them presented the joint image except for two patients with lupus who were also chagasic. In addition, 54 samples from chagasic patients were studied and all of them presented the joint image. We also studied 46 samples from patients with leishmaniasis from whom 28 were coinfected with T. cruzi. The joint image was observed in 88.0% of the samples with leishmaniasis and in 89.3% of the co-infected samples. The results suggest that C. luciliae could be used as an economical, and of low risk, alternative substrate for the serological diagnosis of Chagas' disease, even though it does not discriminate for Leishmania spp. infection. This study also suggests that whenever atypical images are observed in C. luciliae during the search for anti-DNA antibodies, it would be convenient to submit the patient to clinical and serological tests for the diagnosis of leishmaniosis and Chagas' disease.

  9. Modulation of lymphocyte nuclear matrix organization in vivo by 5,6-dichloro-1-beta-D-ribofuranosyl benzimidazole: an autoradiographic and immunofluorescence study.

    Science.gov (United States)

    Chaly, N; Cadrin, M; Kaplan, J G; Brown, D L

    1988-01-01

    Assembly of active nuclei in lymphocytes stimulated by mitogen is paralleled by the elaboration of a structurally and biochemically complex nuclear matrix (NM). To examine the dynamics of individual NM polypeptide components during blastogenesis, we have applied immunofluorescence labelling with anti-NM antibodies to concanavalin A-stimulated mouse splenocytes. Whereas peripherin and PI2 antigens did not reorganize during stimulation, labelling of PI1 and small nuclear ribonucleoprotein (snRNP) antigens increased markedly in intensity and redistributed in concert with the previously reported NM restructuring. Double-labelling showed, furthermore, that snRNPs and the internal staining component of PI1 were largely co-localized. As an approach to studying the role of RNA and RNA synthesis in NM organization, we have further examined the effects of the inhibitor of RNA synthesis, 5,6-dichloro-1-beta-D-ribofuranosyl benzimidazole (DRB), on NM antigen distribution. The rapid inhibition of 3H-uridine incorporation by DRB was accompanied by coordinate aggregation of snRNPs and of the internal PI1 component into large, brightly stained patches. Both 3H-uridine incorporation levels and antigen localization were readily reversed upon removal of DRB. We conclude that NM antigens behave independently during nuclear and NM assembly and that NM organization, as reflected by NM antigen distribution, is modulated by con A- and DRB-induced alterations in RNA synthesis. We propose, furthermore, that the PI1 antigen plays a role in RNA metabolism, and is possibly involved in RNA transport to the nuclear periphery.

  10. Merchant shipping (Safety Convention) Act 1977

    International Nuclear Information System (INIS)

    1977-01-01

    When this Act comes into force, it will enable the United Kingdom to ratify and to give effect to the 1974 International Convention for the Safety of Life at Sea (the SOLAS Convention) which replaces the SOLAS Convention of 1960. Under the Act, the Secretary of State may make such rules as he considers appropriate regarding ships provided with nuclear power plants in accordance with Chapter VIII of the Annex to the 1974 Convention and to Recommendations attached to it, dealing with nuclear ships, and insofar as those provisions have not been implemented by the Merchant Shipping Acts 1894 to 1974. (NEA) [fr

  11. Computer Understanding of Conventional Metaphoric Language

    National Research Council Canada - National Science Library

    Martin, James H

    1990-01-01

    .... This approach asserts that the interpretation of conventional metaphoric language should proceed through the direct application of specific knowledge about the metaphors in the language. MIDAS...

  12. The climate change convention and human health.

    Science.gov (United States)

    Rowbotham, E J

    1995-01-01

    The United Nations Framework Convention on Climate Change, signed at Rio in June 1992, is intended to minimize climate change and its impact. Much of its text is ambiguous and it is not specifically directed to health considerations. It is, however, recognized that adverse effects of climate change on health are a concern of humankind, and health is an integral part of the Convention. The Convention includes commitments by the developed countries to reduce emissions of greenhouse gases and to increase public awareness of these commitments. The significance of the Convention in these respects is discussed critically and future developments considered.

  13. Hematopoietic Stem and Progenitor Cell Expansion in Contact with Mesenchymal Stromal Cells in a Hanging Drop Model Uncovers Disadvantages of 3D Culture

    Directory of Open Access Journals (Sweden)

    Olga Schmal

    2016-01-01

    Full Text Available Efficient ex vivo expansion of hematopoietic stem cells with a concomitant preservation of stemness and self-renewal potential is still an unresolved ambition. Increased numbers of methods approaching this issue using three-dimensional (3D cultures were reported. Here, we describe a simplified 3D hanging drop model for the coculture of cord blood-derived CD34+ hematopoietic stem and progenitor cells (HSPCs with bone marrow-derived mesenchymal stromal cells (MSCs. When seeded as a mixed cell suspension, MSCs segregated into tight spheroids. Despite the high expression of niche-specific extracellular matrix components by spheroid-forming MSCs, HSPCs did not migrate into the spheroids in the initial phase of coculture, indicating strong homotypic interactions of MSCs. After one week, however, HSPC attachment increased considerably, leading to spheroid collapse as demonstrated by electron microscopy and immunofluorescence staining. In terms of HSPC proliferation, the conventional 2D coculture system was superior to the hanging drop model. Furthermore, expansion of primitive hematopoietic progenitors was more favored in 2D than in 3D, as analyzed in colony-forming assays. Conclusively, our data demonstrate that MSCs, when arranged with a spread (monolayer shape, exhibit better HSPC supportive qualities than spheroid-forming MSCs. Therefore, 3D systems are not necessarily superior to traditional 2D culture in this regard.

  14. Hematopoietic Stem and Progenitor Cell Expansion in Contact with Mesenchymal Stromal Cells in a Hanging Drop Model Uncovers Disadvantages of 3D Culture.

    Science.gov (United States)

    Schmal, Olga; Seifert, Jan; Schäffer, Tilman E; Walter, Christina B; Aicher, Wilhelm K; Klein, Gerd

    2016-01-01

    Efficient ex vivo expansion of hematopoietic stem cells with a concomitant preservation of stemness and self-renewal potential is still an unresolved ambition. Increased numbers of methods approaching this issue using three-dimensional (3D) cultures were reported. Here, we describe a simplified 3D hanging drop model for the coculture of cord blood-derived CD34(+) hematopoietic stem and progenitor cells (HSPCs) with bone marrow-derived mesenchymal stromal cells (MSCs). When seeded as a mixed cell suspension, MSCs segregated into tight spheroids. Despite the high expression of niche-specific extracellular matrix components by spheroid-forming MSCs, HSPCs did not migrate into the spheroids in the initial phase of coculture, indicating strong homotypic interactions of MSCs. After one week, however, HSPC attachment increased considerably, leading to spheroid collapse as demonstrated by electron microscopy and immunofluorescence staining. In terms of HSPC proliferation, the conventional 2D coculture system was superior to the hanging drop model. Furthermore, expansion of primitive hematopoietic progenitors was more favored in 2D than in 3D, as analyzed in colony-forming assays. Conclusively, our data demonstrate that MSCs, when arranged with a spread (monolayer) shape, exhibit better HSPC supportive qualities than spheroid-forming MSCs. Therefore, 3D systems are not necessarily superior to traditional 2D culture in this regard.

  15. The protocol amending the 1963 Vienna Convention

    International Nuclear Information System (INIS)

    Lamm, V.

    2006-01-01

    Technically the Vienna Convention was revised by the adoption of the protocol to amend the instrument. and according to Article 19 of the protocol 'A State which is Party to this Protocol but not to the 1963 Vienna Convention shall be bound by the provisions of that Convention as amended by this Protocol in relation to other States Parties hereto, and failing an expression of a different intention by that State at the time of deposit of an instrument referred to in Article 20 shall be bound by the provisions of the 1963 Vienna Convention in relation to States which are only Parties thereto'. This solution has created a special situation, because after the entry into force of the protocol there will be living together or operating in practice 'two' Vienna Conventions, notably the convention's original text of 1963 and its new version as amended by the protocol. After the protocol has come into force, a state may only accede to the amended version, but in the inter se relations of the States Party to the 'old' Vienna Convention the provisions of that convention will remain in force until such time as they have acceded to the new protocol. This rather complicated situation is nevertheless understandable and is fully in accord with Article 40 of the 1969 Vienna Convention on the Law of Treaties, which provides for the amendment of multilateral treaties. In 1989 the negotiations on the revision of the Vienna Convention had begun with the aim of strengthening the existing nuclear liability regime and of improving the situation of potential victims of nuclear accidents. The Protocol to Amend the Vienna Convention serves those purposes; it also reflects a good compromise, since it is the outcome of a negotiation process in which experts from both nuclear and non-nuclear states, from Contacting Parties and non-Contracting Parties were very active. That affords some assurance that the compromise solution reached is acceptable to all States participating in the adoption of

  16. 7 CFR 58.316 - Conventional churns.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Conventional churns. 58.316 Section 58.316 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards....316 Conventional churns. Churns shall be constructed of aluminum, stainless steel or equally corrosion...

  17. Influence of Kosher (Shechita) and conventional slaughter ...

    African Journals Online (AJOL)

    Influence of Kosher (Shechita) and conventional slaughter techniques on shear force, drip and cooking loss of beef. ... South African Journal of Animal Science ... force values for meat samples from cattle slaughtered by the Kosher method compared to those from cattle slaughtered by the conventional slaughter method.

  18. Comparison of community managed projects and conventional ...

    African Journals Online (AJOL)

    Comparison of community managed projects and conventional approaches in rural water supply of Ethiopia. ... African Journal of Environmental Science and Technology ... This study aimed to compare Community Managed Projects (CMP) approach with the conventional approaches (Non-CMP) in the case of Ethiopia.

  19. Suction v. conventional curettage in incomplete abortion

    African Journals Online (AJOL)

    Suction v. conventional curettage in incomplete abortion. A randomised controlled trial. D. A. A. VERKUYL, C. A. CROWTHER .Abstract This randomised controlled trial of 357 patients who had had an incomplete abortion compared suction curettage with conventional curettage for evacuation ofthe uterus. The 179 patients ...

  20. numerical assessment of conventional regulation effectiveness

    African Journals Online (AJOL)

    Benkoussas B, Djedjig R, and Vauquelin O

    2016-05-01

    May 1, 2016 ... The effectiveness of an underground smoke control system mainly depends on fire safety engineering that is ... In the same context, this work aims firstly, at investigating the effectiveness of conventional regulation applied to .... 5a). Fig.4. Station smoke behavior for conventional ventilation regulation. Fig.5a.

  1. AECT Convention, Orlando, Florida 2008 Report

    Science.gov (United States)

    Vega, Eddie

    2009-01-01

    This article presents several reports that highlight the events at the 2008 Association for Educational Communications and Technology (AECT) International Convention in Orlando, Florida. At the annual convention this year, the Multimedia Production Division goal was to continue to share information about the latest tools in multimedia production,…

  2. Oral delivery of [D-Leu-4]-OB3 and MA-[D-Leu-4]-OB3, synthetic peptide leptin mimetics: Immunofluorescent localization in the mouse hypothalamus.

    Science.gov (United States)

    Anderson, Brian M; Jacobson, Lauren; Novakovic, Zachary M; Grasso, Patricia

    2017-06-01

    This study describes the localization of [D-Leu-4]-OB3 and MA-[D-Leu-4]-OB3, synthetic peptide leptin mimetics, in the hypothalamus of Swiss Webster and C57BL/6J wild-type mice, leptin-deficient ob/ob mice, and leptin-resistant diet-induced obese (DIO) mice. The mice were given [D-Leu-4]-OB3 or MA-[D-Leu-4]-OB3 in 0.3% dodecyl maltoside by oral gavage. Once peak serum concentrations were reached, the mice received a lethal dose of pentobarbital and were subjected to intracardiac perfusion fixation. The brains were excised, post-fixed in paraformaldehyde, and cryo-protected in sucrose. Free-floating frozen coronal sections were cut at 25-µm and processed for imaging by immunofluorescence microscopy. In all four strains of mice, dense staining was concentrated in the area of the median eminence, at the base and/or along the inner wall of the third ventricle, and in the brain parenchyma at the level of the arcuate nucleus. These results indicate that [D-Leu-4]-OB3 and MA-[D-Leu-4]-OB3 cross the blood-brain barrier and concentrate in an area of the hypothalamus known to regulate energy balance and glucose homeostasis. Most noteworthy is the localization of [D-Leu-4]-OB3 immunoreactivity within the hypothalamus of DIO mice via a conduit that is closed to leptin in this rodent model, and in most cases of human obesity. Together with our previous studies describing the effects of [D-Leu-4]-OB3 and MA-[D-Leu-4]-OB3 on energy balance, glucose regulation, and signal transduction pathway activation, these findings are consistent with a central mechanism of action for these synthetic peptide leptin mimetics, and suggest their potential usefulness in the management of leptin-resistant obesity and type 2 diabetes in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Digital vs. conventional implant impressions: efficiency outcomes.

    Science.gov (United States)

    Lee, Sang J; Gallucci, German O

    2013-01-01

    The aim of this pilot study was to evaluate the efficiency, difficulty and operator's preference of a digital impression compared with a conventional impression for single implant restorations. Thirty HSDM second year dental students performed conventional and digital implant impressions on a customized model presenting a single implant. The outcome of the impressions was evaluated under an acceptance criteria and the need for retake/rescan was decided. The efficiency of both impression techniques was evaluated by measuring the preparation, working, and retake/scan time (m/s) and the number of retakes/rescans. Participants' perception on the level of difficulty for the both impressions was assessed with a visual analogue scale (VAS) questionnaire. Multiple questionnaires were obtained to assess the participants' perception on preference, effectiveness and proficiency. Mean total treatment time was of 24:42 m/s for conventional and 12:29 m/s for digital impressions (P impressions (P impression (P impression technique and 30.63 (±17.57) for digital impression technique (P = 0.006). Sixty percent of the participants preferred the digital impression, 7% the conventional impression technique and 33% preferred either technique. Digital impressions resulted in a more efficient technique than conventional impressions. Longer preparation, working, and retake time were consumed to complete an acceptable conventional impression. Difficulty was lower for the digital impression compared with the conventional ones when performed by inexperienced second year dental students. © 2012 John Wiley & Sons A/S.

  4. Convention on supplementary compensation for nuclear damage

    International Nuclear Information System (INIS)

    Chinese Nuclear Society, Beijing; U.S. Nuclear Energy Institute

    2000-01-01

    The Contracting parties recognize the importance of the measures provided in the Vienna Convention on Civil Liability for Nuclear Damage and the Paris Convention on Third party liability in the Field of Nuclear Energy as well as in national legislation on compensation for nuclear damage consistent with the principles of these conventions. The Contracting parties desire to establish a worldwide liability regime to supplement and enhance these measures with a view to increasing the amount of compensation for nuclear damage and encourage regional and global co-operation to promote a higher level of nuclear safety in accordance with the principle of international partnership and solidarity

  5. National report of Brazil. Nuclear Safety Convention

    International Nuclear Information System (INIS)

    1998-09-01

    This document represents the national report prepared as a fulfillment of the brazilian obligations related to the Convention on Nuclear Safety. In chapter 2 some details are given about the existing nuclear installations. Chapter 3 provides details about the legislation and regulations, including the regulatory framework and the regulatory body. Chapter 4 covers general safety considerations as described in articles 10 to 16 of the Convention. Chapter 5 addresses to the safety of the installations during siting, design, construction and operation. Chapter 6 describes planned activities to further enhance nuclear safety. Chapter 7 presents the final remarks related to the degree of compliance with the Convention obligations

  6. In situ detection of the activation of Rac1 and RalA small GTPases in mouse adipocytes by immunofluorescent microscopy following in vivo and ex vivo insulin stimulation.

    Science.gov (United States)

    Takenaka, Nobuyuki; Nihata, Yuma; Ueda, Sho; Satoh, Takaya

    2017-11-01

    Rac1 has been implicated in insulin-dependent glucose uptake by mechanisms involving plasma membrane translocation of the glucose transporter GLUT4 in skeletal muscle. Although the uptake of glucose is also stimulated by insulin in adipose tissue, the role for Rac1 in adipocyte insulin signaling remains controversial. As a step to reveal the role for Rac1 in adipocytes, we aimed to establish immunofluorescent microscopy to detect the intracellular distribution of activated Rac1. The epitope-tagged Rac1-binding domain of a Rac1-specific target was utilized as a probe that specifically recognizes the activated form of Rac1. Rac1 activation in response to ex vivo and in vivo insulin stimulations in primary adipocyte culture and mouse white adipose tissue, respectively, was successfully observed by immunofluorescent microscopy. These Rac1 activations were mediated by phosphoinositide 3-kinase. Another small GTPase RalA has also been implicated in insulin-stimulated glucose uptake in skeletal muscle and adipose tissue. Similarly to Rac1, immunofluorescent microscopy using an activated RalA-specific polypeptide probe allowed us to detect intracellular distribution of insulin-activated RalA in adipocytes. These novel approaches to visualize the activation status of small GTPases in adipocytes will largely contribute to the understanding of signal transduction mechanisms particularly for insulin action. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Microtissues Enhance Smooth Muscle Differentiation and Cell Viability of hADSCs for Three Dimensional Bioprinting

    Directory of Open Access Journals (Sweden)

    Jin Yipeng

    2017-07-01

    Full Text Available Smooth muscle differentiated human adipose derived stem cells (hADSCs provide a crucial stem cell source for urinary tissue engineering, but the induction of hADSCs for smooth muscle differentiation still has several issues to overcome, including a relatively long induction time and equipment dependence, which limits access to abundant stem cells within a short period of time for further application. Three-dimensional (3D bioprinting holds great promise in regenerative medicine due to its controllable construction of a designed 3D structure. When evenly mixed with bioink, stem cells can be spatially distributed within a bioprinted 3D structure, thus avoiding drawbacks such as, stem cell detachment in a conventional cell-scaffold strategy. Notwithstanding the advantages mentioned above, cell viability is often compromised during 3D bioprinting, which is often due to pressure during the bioprinting process. The objective of our study was to improve the efficiency of hADSC smooth muscle differentiation and cell viability of a 3D bioprinted structure. Here, we employed the hanging-drop method to generate hADSC microtissues in a smooth muscle inductive medium containing human transforming growth factor β1 and bioprinted the induced microtissues onto a 3D structure. After 3 days of smooth muscle induction, the expression of α-smooth muscle actin and smoothelin was higher in microtissues than in their counterpart monolayer cultured hADSCs, as confirmed by immunofluorescence and western blotting analysis. The semi-quantitative assay showed that the expression of α-smooth muscle actin (α-SMA was 0.218 ± 0.077 in MTs and 0.082 ± 0.007 in Controls; smoothelin expression was 0.319 ± 0.02 in MTs and 0.178 ± 0.06 in Controls. Induced MTs maintained their phenotype after the bioprinting process. Live/dead and cell count kit 8 assays showed that cell viability and cell proliferation in the 3D structure printed with microtissues were higher at all time

  8. Immunohistochemical localization of glucagon and pancreatic polypeptide on rat endocrine pancreas: coexistence in rat islet cells

    Directory of Open Access Journals (Sweden)

    YH Huang

    2009-08-01

    Full Text Available We used immunofluorescence double staining method to investigate the cellular localization of glucagon and pancreatic polypeptide (PP in rat pancreatic islets. The results showed that both A-cells (glucagon-secreting cells and PP-cells (PPsecreting cells were located in the periphery of the islets. However, A-cells and PP-cells had a different regional distribution. Most of A-cells were located in the splenic lobe but a few of them were in the duodenal lobe of the pancreas. In contrast, the majority of PP-cells were found in the duodenal lobe and a few of them were in the splenic lobe of the pancreas. Furthermore, we found that 67.74% A-cells had PP immunoreactivity, 70.92% PP-cells contained glucagon immunoreactivity with immunofluorescence double staining. Our data support the concept of a common precursor stem cell for pancreatic hormone-producing cells.

  9. French Economics of Convention and Economic Sociology

    DEFF Research Database (Denmark)

    Jagd, Søren

    foundation of markets and of money may be an occasion for economic sociology to focus even more on elaborating on the institutional void created by traditional economic theory. A second point is that economic sociology could benefit from the perspective of a plurality of forms of coordination involved......The French Economics of convention tradition has developed to be an influential research tradition situated in the area between economics and sociology. The aim of the paper is to explore some of the themes that may be common to economics of conventions and economic sociology by looking more...... closely into three recent texts from the economics of convention tradition discussing, in slightly different ways, differences and similarities between economics of convention and economic sociology. It is argued that André Orléan’s point that a common aim could be to ‘denaturalise’ the institutional...

  10. Numerical assessment of conventional regulation effectiveness for ...

    African Journals Online (AJOL)

    ... depends on fire safety engineering that is provided, and which is generally established using smoke spread field and temperature distribution predictions. ... conventional regulation; ventilation strategies; smoke temperature; smoke barriers ...

  11. Convention on supplementary compensation for nuclear damage

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-07-22

    The document reproduces the text of the Convention on Supplementary Compensation for Nuclear Damage which was adopted on 12 September 1997 by a Diplomatic Conference held between 8-12 September 1997 in Vienna

  12. Foster parenting, human imprinting and conventional handling ...

    African Journals Online (AJOL)

    p2492989

    Foster parenting, human imprinting and conventional handling affects survival and early .... bird may subsequently direct its sexual attention to those humans on whom it was imprinted (Bubier et al., ..... The mind through chicks' eyes: memory,.

  13. Convention on supplementary compensation for nuclear damage

    International Nuclear Information System (INIS)

    1998-01-01

    The document reproduces the text of the Convention on Supplementary Compensation for Nuclear Damage which was adopted on 12 September 1997 by a Diplomatic Conference held between 8-12 September 1997 in Vienna

  14. Medan Convention & Exhibition Center (Arsitektur Ekspresionisme)

    OpenAIRE

    Iskandar, Nurul Auni

    2015-01-01

    Medan is one of the third largest city in Indonesia, which is currently being developed, and a city with lots of activities. In the city of Medan has a high investment opportunities for a convention, because of its strategic position in Southeast Asia and also supported by the facility and the potential for tourism in North Sumatra, Medan city has the potential for industrial MICE (Meeting, Incentive, Conference, Exhibition). The construction of Medan Convention & Exhibition Cente...

  15. Technical Efficiency Performance of Conventional Banks

    OpenAIRE

    Endri, Endri

    2012-01-01

    This study aims to measure the performance of the technical efficiency of the conventional commercial banks during the period 2008-2009 by using non-parametric method of Data Envelopment Analysis (DEA). Test results showed that the total of all conventional commercial banks during the period 2008-2009 has not shown that optimal performance in which the level of technical efficiency is still below 100 percent. Appalling conditions, the efficiency of national banks experienced a decline of 73.5...

  16. Human Monoclonal Islet Cell Antibodies From a Patient with Insulin- Dependent Diabetes Mellitus Reveal Glutamate Decarboxylase as the Target Antigen

    Science.gov (United States)

    Richter, Wiltrud; Endl, Josef; Eiermann, Thomas H.; Brandt, Michael; Kientsch-Engel, Rosemarie; Thivolet, Charles; Jungfer, Herbert; Scherbaum, Werner A.

    1992-09-01

    The autoimmune phenomena associated with destruction of the β cell in pancreatic islets and development of type 1 (insulin-dependent) diabetes mellitus (IDDM) include circulating islet cell antibodies. We have immortalized peripheral blood lymphocytes from prediabetic individuals and patients with newly diagnosed IDDM by Epstein-Barr virus transformation. IgG-positive cells were selected by anti-human IgG-coupled magnetic beads and expanded in cell culture. Supernatants were screened for cytoplasmic islet cell antibodies using the conventional indirect immunofluorescence test on cryostat sections of human pancreas. Six islet cell-specific B-cell lines, originating from a patient with newly diagnosed IDDM, could be stabilized on a monoclonal level. All six monoclonal islet cell antibodies (MICA 1-6) were of the IgG class. None of the MICA reacted with human thyroid, adrenal gland, anterior pituitary, liver, lung, stomach, and intestine tissues but all six reacted with pancreatic islets of different mammalian species and, in addition, with neurons of rat cerebellar cortex. MICA 1-6 were shown to recognize four distinct antigenic epitopes in islets. Islet cell antibody-positive diabetic sera but not normal human sera blocked the binding of the monoclonal antibodies to their target epitopes. Immunoprecipitation of 35S-labeled human islet cell extracts revealed that a protein of identical size to the enzyme glutamate decarboxylase (EC 4.1.1.15) was a target of all MICA. Furthermore, antigen immunotrapped by the MICA from brain homogenates showed glutamate decarboxylase enzyme activity. MICA 1-6 therefore reveal glutamate decarboxylase as the predominant target antigen of cytoplasmic islet cell autoantibodies in a patient with newly diagnosed IDDM.

  17. Immunocytochemical characterization of the cell walls of bean cell suspensions during habituation and dehabituation to dichlobenil

    DEFF Research Database (Denmark)

    Garcia-Angulo, P.; Willats, W. G. T.; Encina, A. E.

    2006-01-01

    The effects of the cellulose inhibitor dichlobenil on the cell wall composition and structure during the habituation/dehabituation process of suspension-cultured bean cells were assessed. A range of techniques were used including cell wall fractionation, sugar analysis, immunofluorescence...... and fluorochrome labelling of resin-embedded sections, and immunodot assays (IDAs) of cell wall fractions. The cell walls from bean cell suspensions with initial levels of habituation to dichlobenil had decreased levels of cellulose, but this effect lessened with increasing numbers of subcultures. All cell walls...

  18. Nanoscale Mechanical Stimulation of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    H Nikukar

    2014-05-01

    We observed significant responses after 1 and 2-week stimulations in cell number, cell shapes and phenotypical markers. Microarray was performed for all groups. Cell count showed normal cell growth with stimulation. However, cell surface area, cell perimeter, and arboration after 1-week stimulation showed significant increases. Immunofluorescent studies have showed significant increase in osteocalcin production after stimulation. Conclusions: Nanoscale mechanical vibration showed significant changes in human mesenchymal stem cell behaviours. Cell morphology changed to become more polygonal and increased expression of the osteoblast markers were noted. These findings with gene regulation changes suggesting nanoscale mechanostimulation has stimulated osteoblastogenesis.  Keywords:  Mesenchymal, Nanoscale, Stem Cells.

  19. Desarrollo de improntas para el diagnóstico del virus Epstein-Barr por inmunofluorescencia indirecta Development of slides for Epstein-Barr virus diagnosis by indirect immunofluorescence

    Directory of Open Access Journals (Sweden)

    Germán R. Pérez

    2005-08-01

    mononucleosis. Detection of anti-viral capside antigen (VCA antibodies indicates previous or present EBV infection. Moreover, high titles of anti-VCA antibodies are observed in EBV-associated neoplasic disorders, such as lymphomas in AIDS patients. The objective of this study was the development and optimization of P3HR1 cell slides for the EBV serologic detection by indirect immunofluorescence (IIF assay. P3HR1 exponential growth culture cells were stimulated with phorbol-12-mirystoil-13-acetate, collected at different time points and used for slide preparation. IIF assay was performed in each slide using an anti-EBV positive serum as primary antibody. An 11% increase in VCA expression was observed at 40 hours post-stimulation. Data was confirmed by western blot and immunodetection. Intra- and inter-lot precisions of the developed slides were evaluated for IgG and IgM antibodies using EBV-positive sera and positive samples for other members of the Herpesviridae family. Neither false-positive or false negative results were obtained for EBV detection nor cross-reaction was observed with other members of the Herpesviridae family with the developed slides. In conclusion, the slides here presented can be a useful instrument for acute EBV infection diagnosis and for the serologic detection of IgG anti-VCA antibodies in EBV-associated neoplastic disorders.

  20. Nonparenchymal cells cultivated from explants of fibrotic liver resemble endothelial and smooth muscle cells from blood vessel walls

    International Nuclear Information System (INIS)

    Voss, B.; Rauterberg, J.; Pott, G.; Brehmer, U.; Allam, S.; Lehmann, R.; von Bassewitz, D.B.

    1982-01-01

    Tissue specimens from human fibrotic liver obtained by needle biopsy were cultured. Two cell types emerged from the tissue explants. From their morphology and biosynthetic products they resembled smooth muscle cells and endothelial cells from blood vessel walls. In the endothelial cells, factor VIII-associated protein was demonstrated by indirect immunofluorescence. Synthesis of collagen types I and III, basement membrane collagen types IV and V, and fibronectin by both cell types was observed by immunofluorescence microscopy. Homogeneous cultures of smooth muscle cells were observed in subcultures. After incubation with [ 14 C]glycine, collagen was isolated and characterized by CM cellulose chromatography, and consisted mainly of types I and III. These data suggest involvement of mesenchymal cells in hepatic fibrosis; they presumably originate from blood vessel or sinusoidal walls

  1. Transfrontier nuclear civil liability without international conventions

    International Nuclear Information System (INIS)

    Dogauchi, M.

    1992-01-01

    Japan is not a contracting party of any international convention in the field of nuclear civil liability, and neither are other east Asian countries who have or will soon have nuclear plants. Therefore, the ordinary rules on private international law will play an important role in dealing with transfrontier nuclear civil liability. Above all, the problems on judicial jurisdiction and governing law are crucial points. With regard to the relations between the above countries and the countries whose legal systems are within the framework of Paris or Vienna Conventions, geographical scopes of these conventions are to be considered. There are two different parts in the international civil liability conventions: uniform civil liability law and mutual funds. As to the first, it is important that, even without the conventions, the basic structure of the nuclear civil liability laws in non-member countries are almost the same with those of members. In any event, considering that the establishment of a single international regime to cover all countries will be hardly possible, legal consequences under the private international law will be explored. (author)

  2. Compact Ignition Tokamak conventional facilities optimization

    International Nuclear Information System (INIS)

    Commander, J.C.; Spang, N.W.

    1987-01-01

    A high-field ignition machine with liquid-nitrogen-cooled copper coils, designated the Compact Ignition Tokamak (CIT), is proposed for the next phase of the United States magnetically confined fusion program. A team of national laboratory, university, and industrial participants completed the conceptual design for the CIT machine, support systems and conventional facilities. Following conceptual design, optimization studies were conducted with the goal of improving machine performance, support systems design, and conventional facilities configuration. This paper deals primarily with the conceptual design configuration of the CIT conventional facilities, the changes that evolved during optimization studies, and the revised changes resulting from functional and operational requirements (F and ORs). The CIT conventional facilities conceptual design is based on two premises: (1) satisfaction of the F and ORs developed in the CIT building and utilities requirements document, and (2) the assumption that the CIT project will be sited at the Princeton Plasma Physics Laboratory (PPPL) in order that maximum utilization can be made of existing Tokamak Fusion Test Reactor (TFTR) buildings and utilities. The optimization studies required reevaluation of the F and ORs and a second look at TFTR buildings and utilities. Some of the high-cost-impact optimization studies are discussed, including the evaluation criteria for a change from the conceptual design baseline configuration. The revised conventional facilities configuration are described and the estimated cost impact is summarized

  3. Conventions and workflows for using Situs

    International Nuclear Information System (INIS)

    Wriggers, Willy

    2012-01-01

    Recent developments of the Situs software suite for multi-scale modeling are reviewed. Typical workflows and conventions encountered during processing of biophysical data from electron microscopy, tomography or small-angle X-ray scattering are described. Situs is a modular program package for the multi-scale modeling of atomic resolution structures and low-resolution biophysical data from electron microscopy, tomography or small-angle X-ray scattering. This article provides an overview of recent developments in the Situs package, with an emphasis on workflows and conventions that are important for practical applications. The modular design of the programs facilitates scripting in the bash shell that allows specific programs to be combined in creative ways that go beyond the original intent of the developers. Several scripting-enabled functionalities, such as flexible transformations of data type, the use of symmetry constraints or the creation of two-dimensional projection images, are described. The processing of low-resolution biophysical maps in such workflows follows not only first principles but often relies on implicit conventions. Situs conventions related to map formats, resolution, correlation functions and feature detection are reviewed and summarized. The compatibility of the Situs workflow with CCP4 conventions and programs is discussed

  4. The protocol amending the 1963 Vienna Convention

    International Nuclear Information System (INIS)

    Lamm, V.

    1998-01-01

    In the first stage of the revision process, the only goal was to amend certain provisions of the Vienna Convention. Later, in what might be called the second stage, the question was seriously raised of establishing a new supplementary convention by which additional funds were to be provided by the international community of States. Most experts felt that the nuclear liability regime of the Vienna Convention, as amended, would really serve the interests of potential victims of nuclear incidents only if it were supported by an international supplementary fund providing additional compensation for nuclear damage to that provided by the operator. Thus, the Standing Committee started to consider the establishment, under the Vienna Convention, of a mechanism for mobilizing additional funds for compensation of nuclear damage. During the negotiations it was deemed necessary to establish a separate treaty for such a supplementary fund, and indeed, efforts were undertaken to draw up such an instrument concurrently with the revision of the Vienna Convention. (K.A.)

  5. Distribution of kappa and lambda light chain isotypes among human blood immunoglobulin-secreting cells after vaccination with pneumococcal polysaccharides

    DEFF Research Database (Denmark)

    Heilmann, C; Barington, T

    1989-01-01

    The light chain isotype of immunoglobulin-secreting blood cells was investigated by means of monolayer plaque-forming cell assays allowing direct immunofluorescence staining for cytoplasmic kappa and lambda light chains in centre cells. The study revealed that cultured, polyclonally activated...

  6. Economic Sociology and Economics of Convention

    DEFF Research Database (Denmark)

    Jagd, Søren

    This paper is part of a larger exploration of the French Economics of Convention tradition. The aim of the paper is to explore potential themes of common interest to economic sociology and Economics of Conventions. The paper is in two parts. First, I summarise the main theoretical features of EC...... the institutional framework of social action. Second, I explore two issues raised by economics of conventions that may be particularly important to consider for economic sociology. The first issue is the explicit exploration of the consequences of a plurality of forms of justification suggested by Luc Boltanski...... and Laurent Thévenot in ‘économie de la grandeur’. This perspective has already been taken up in economic sociology in David Stark’s notion of a ‘Sociology of Worth’. The second issue, recently suggested by André Orléan, is the need to denaturalise economic theory and economic action to demonstrate the social...

  7. Economics of Convention and New Economic Sociology

    DEFF Research Database (Denmark)

    Jagd, Søren

    2007-01-01

    The aim of the article is to explore potential common themes in economic sociology and economics of conventions. The article explores two issues raised by economics of conventions that may be of particular importance to economic sociology. First, the explicit exploration of the consequences...... of a plurality of forms of justification, as elaborated in économie de la grandeur. This perspective was recently taken up in economic sociology by David Stark's introduction of the notion ‘sociology of worth'. The second issue, recently suggested by André Orléan, is the need to denaturalize economic theory...... and economic action to demonstrate the social constructed nature of economic action. It is argued that these two issues demonstrate that a fruitful dialogue is indeed possible between economic sociology and economics of convention and should be encouraged....

  8. Prerequisites for a nuclear weapons convention

    International Nuclear Information System (INIS)

    Liebert, W.

    1999-01-01

    A Nuclear Weapons Convention (NWC) would prohibit the research, development, production, testing, stockpiling, transfer, use and threat of use of nuclear weapons and would serve their total elimination.' In this fashion it follows the model laid out by the biological and chemical weapons conventions. The NWC would encompass a few other treaties and while replacing them should learn from their experiences. The Nuclear Weapons Convention should at some given point in the future replace the Non-Proliferation Treaty (NPT) and so resolve its contradictions and shortcomings. The main objectives of an NWC Would be: reduction of the nuclear arsenals of the 'five' nuclear weapons powers down to zero within a set of fixed periods of time; elimination of stockpiles of weapons-usable materials and, where existent, nuclear warheads in de-facto nuclear weapon and threshold states; providing assurance that all states will retain their non-nuclear status forever

  9. Communicating novel and conventional scientific metaphors

    DEFF Research Database (Denmark)

    Knudsen, Sanne

    2005-01-01

    . But we still need empirical studies of the career of metaphors in scientific discourse and of the communicative strategies identifying a given metaphor as either novel or conventional. This paper presents a case study of the discursive development of the metaphor of "the genetic code" from......Metaphors are more popular than ever in the study of scientific reasoning and culture because of their innovative and generative powers. It is assumed, that novel scientific metaphors become more clear and well-defined, as they become more established and conventional within the relevant discourses...... the introduction of the metaphor to it was established as an entire network of interrelated conventional metaphors. Not only do the strategies in communicating the metaphor change as the metaphor becomes more established within the discourse, but the genres in which the metaphor is developed and interpreted...

  10. Stained glass solar windows for the swiss tech convention center.

    Science.gov (United States)

    Barraud, Emmanuel

    2013-01-01

    As a world first, 300 m² of dye-sensitized solar cells will be integrated into the facade of the EPFL's Convention Center. This prototype will constitute the first application of such technology to a public building. The translucent panels are constructed and assembled by local small and medium businesses and make use of an invention by EPFL researcher Michael Grätzel. This project is embedded within the framework of the partnership established in 2009 between EPFL and Romande Energie - whose aim is to create one of the largest solar energy parks in Switzerland.

  11. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

    Science.gov (United States)

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

    2011-11-10

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

  12. Digital hilar tomography. Comparison with conventional technique

    International Nuclear Information System (INIS)

    Schaefer, C.B.; Braunschweig, R.; Teufl, F.; Kaiser, W.; Claussen, C.D.

    1993-01-01

    The aim of the following study was to compare conventional hilar tomography and digital hilar tomography. 20 patients were examined both with conventional and digital hilar tomography using the same tomographic technique and the identical exposure dose. All patients underwent computed tomography of the chest as a golden standard. The digital technique, especially the edge-enhanced image version, showed superior image quality. ROC-analysis by 4 readers found equal diagnostic performance without any statistical difference. Digital hilar tomography shows a superior and constant image quality and lowers the rate of re-exposure. Therefore, digital hilar tomography is the preferable method. (orig.) [de

  13. Archaeology and the World Heritage Convention

    Directory of Open Access Journals (Sweden)

    Henry Cleere

    2003-10-01

    Full Text Available International efforts to designate outstanding examples of the world's cultural and natural heritage began after the Second World War. The World Heritage Convention was signed at the General Conference of UNESCO in 1972 and the first cultural sites were selected in 1978. Now over 600 have been inscribed on the World Heritage List. The author, who is an honorary visiting professor at the Institute, acted as an advisor to the World Heritage Committee from 1992 to 2002 and here describes how the Convention came into being and discusses the representation of archaeological sites on the List.

  14. Convention on nuclear safety. Final act

    International Nuclear Information System (INIS)

    1994-01-01

    The Diplomatic Conference, which was convened by the International Atomic Energy Agency at its Headquarters from 14 to 17 June 1994, adopted the Convention on Nuclear Safety reproduced in document INFCIRC/449 and the Final Act of the Conference. The text of the Final Act of the Conference, including an annexed document entitled ''Some clarification with respect to procedural and financial arrangements, national reports, and the conduct of review meetings, envisaged in the Convention on Nuclear Safety'', is reproduced in the Attachment hereto for the information of all Member States

  15. Control of non-conventional synchronous motors

    CERN Document Server

    Louis, Jean-Paul

    2013-01-01

    Classical synchronous motors are the most effective device to drive industrial production systems and robots with precision and rapidity. However, numerous applications require efficient controls in non-conventional situations. Firstly, this is the case with synchronous motors supplied by thyristor line-commutated inverters, or with synchronous motors with faults on one or several phases. Secondly, many drive systems use non-conventional motors such as polyphase (more than three phases) synchronous motors, synchronous motors with double excitation, permanent magnet linear synchronous motors,

  16. Quantifying HER-2 expression on Circulating Tumor Cells by ACCEPT

    NARCIS (Netherlands)

    Zeune, Leonie Laura; van Dalum, Guus; Decraene, C.; Proudhon, C.; Fehm, T.; Neubauer, Hans; Rack, B.; Alunni-fabbroni, Marianna; Terstappen, L.W.M.M.; van Gils, Stephanus A.; Brune, Christoph

    2017-01-01

    Circulating tumor cells (CTCs) isolated from blood can be probed for the expression of treatment targets. Immunofluorescence is often used for both the enumeration of CTC and the determination of protein expression levels related to treatment targets. Accurate and reproducible assessment of such

  17. Alpha chain determinants on the membrane of immunoglobulin synthesizing cells

    NARCIS (Netherlands)

    Hijmans, W.; Schuit, H.R.E.; Radl, J.; Vossen, J.M.J.J.

    1974-01-01

    In a study of surface immunoglobulins (Ig) on lymphocytes from patients with paraproteinemia (1), we observed that a variable number of plasma cells not only contained intracellular Ig, but also had Ig on their surface, as shown in the vital technique of immunofluorescence. Moreover, in the bone

  18. Imunofluorescência utilizando isolados brasileiros no diagnóstico sorológico de infecção por lentivírus em caprinos Immunofluorescence using Brazilian isolates for serological diagnosis of lentivirus infection in goats

    Directory of Open Access Journals (Sweden)

    Dilmara Reischak

    2002-01-01

    immunofluorescent antibody (IFA test using Brazilian SRLV isolates for serological diagnosis of infection in goats. The IFA test was compared in its sensitivity and specificity to the AGID test in which Maedi-Visna WLC-1 strain was used as antigen. Ovine synovial secondary cell cultures infected with two goat SRLV isolates (CAEV UFRGS/Br-2 and CAEV UFRGS/Br-5 were used for the IFA. Goat serum samples (n = 239 were tested by the two tests. The AGID test detected antibodies in 129 (53.9% serum samples. A higher number of animals was considered positive for the IFA. However, different results were obtained depending on the isolate used for the antigen preparation. When CAEV UFRGS/Br-2 was used as antigen, 216 (90.3% serum samples tested positive, against 213 (89.1% with CAEV UFRGS/Br-5. There was no significant statistical difference between the antigens prepared with these two isolates. The IFA had sensitivity of 94.6% and 96.9%, and specificity of 14.5 % and 20%, when CAEV UFRGS/Br-2 and CAEV UFRGS/Br-5 were used as antigens, respectively. These results demonstrate that the IFA with antigens prepared with Brazilian SRLV isolates may play an important a role as a complementary serological test for the diagnosis of infections by these agents.

  19. Antibodies to the human T-cell lymphoma/leukemia virus type I in Dutch haemophiliacs

    NARCIS (Netherlands)

    Goudsmit, J.; Miedema, F.; Breederveld, C.; Terpstra, F.; Roos, M.; Schellekens, P.; Melief, C.

    1986-01-01

    95 Dutch haemophiliacs were tested for antibodies to membrane antigens on cells infected with human T-cell leukemia virus type I (HTLV-I-MA) by indirect immunofluorescence and to purified HTLV-I by enzyme-linked immunosorbent assay. Antibodies to HTLV-I-MA were present in 8 of 95 (8%) haemophiliacs,

  20. Abnormal A-type lamin organization in a human lung carcinoma cell line

    NARCIS (Netherlands)

    Machiels, BM; Broers, JL; Raymond, Y; de Leij, Louis; Kuijpers, HJH; Caberg, NEH; Ramaekers, Frans C. S.

    We have studied the expression of lamins A and C (A-type lamins) in a lung carcinoma cell line using type-specific monoclonal antibodies, Using immunofluorescence and immunoblotting studies it was noted that several irregularities in lamin expression exist in the cell line GLC-A1, derived from an

  1. Method and cell lines for the production of monoclonal antibodies to human glycophorin A

    Science.gov (United States)

    Bigbee, W.L.; Fong, S.S.N.; Jensen, R.H.; Vanderlaan, M.

    Cloned mouse hybridoma cell lines have been established which continuously produce antibodies that differentiate between the M and N forms of human glycophorin A. These antibodies have potential application as human blood group reagents, as markers for terminally differentiated erythroid cells and as immunofluorescent labels of somatically variant human erythrocytes.

  2. Surface Ig on rabbit lymphocytes. Rabbit B and T cells are distinct populations

    NARCIS (Netherlands)

    Bast, B J; Catty, D; Manten-Slingerland, R; Jansen, J T; Veldhuis, Dick H.; Roholl, P; Ballieux, R E

    1979-01-01

    Rabbit peripheral blood lymphocytes (PBL) were analyzed by immunofluorescence using anti-T cell conjugates and anti-Fab, anti-a1 allotype, anti-IgM and anti-IgA conjugates. In addition, T cells were demonstrated by rosetting with papain-treated homologous erythrocytes. Control experiments, using

  3. Variance in total levels of phospholipase C zeta (PLC-ζ) in human sperm may limit the applicability of quantitative immunofluorescent analysis as a diagnostic indicator of oocyte activation capability.

    Science.gov (United States)

    Kashir, Junaid; Jones, Celine; Mounce, Ginny; Ramadan, Walaa M; Lemmon, Bernadette; Heindryckx, Bjorn; de Sutter, Petra; Parrington, John; Turner, Karen; Child, Tim; McVeigh, Enda; Coward, Kevin

    2013-01-01

    To examine whether similar levels of phospholipase C zeta (PLC-ζ) protein are present in sperm from men whose ejaculates resulted in normal oocyte activation, and to examine whether a predominant pattern of PLC-ζ localization is linked to normal oocyte activation ability. Laboratory study. University laboratory. Control subjects (men with proven oocyte activation capacity; n = 16) and men whose sperm resulted in recurrent intracytoplasmic sperm injection failure (oocyte activation deficient [OAD]; n = 5). Quantitative immunofluorescent analysis of PLC-ζ protein in human sperm. Total levels of PLC-ζ fluorescence, proportions of sperm exhibiting PLC-ζ immunoreactivity, and proportions of PLC-ζ localization patterns in sperm from control and OAD men. Sperm from control subjects presented a significantly higher proportion of sperm exhibiting PLC-ζ immunofluorescence compared with infertile men diagnosed with OAD (82.6% and 27.4%, respectively). Total levels of PLC-ζ in sperm from individual control and OAD patients exhibited significant variance, with sperm from 10 out of 16 (62.5%) exhibiting levels similar to OAD samples. Predominant PLC-ζ localization patterns varied between control and OAD samples with no predictable or consistent pattern. The results indicate that sperm from control men exhibited significant variance in total levels of PLC-ζ protein, as well as significant variance in the predominant localization pattern. Such variance may hinder the diagnostic application of quantitative PLC-ζ immunofluorescent analysis. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  4. Comparative Effectiveness of Conventional Rote Learning and ...

    African Journals Online (AJOL)

    This study investigated the relative effectiveness of Mnemonics technique (MNIT) and conventional rote learning technique (CRL) on the teaching-learning of physical features (Geography). A pre-test and post-test control group design was adopted for the study. A sample of ninety SS I students was randomly selected out of ...

  5. Conflict and convention in dynamic networks.

    Science.gov (United States)

    Foley, Michael; Forber, Patrick; Smead, Rory; Riedl, Christoph

    2018-03-01

    An important way to resolve games of conflict (snowdrift, hawk-dove, chicken) involves adopting a convention: a correlated equilibrium that avoids any conflict between aggressive strategies. Dynamic networks allow individuals to resolve conflict via their network connections rather than changing their strategy. Exploring how behavioural strategies coevolve with social networks reveals new dynamics that can help explain the origins and robustness of conventions. Here, we model the emergence of conventions as correlated equilibria in dynamic networks. Our results show that networks have the tendency to break the symmetry between the two conventional solutions in a strongly biased way. Rather than the correlated equilibrium associated with ownership norms (play aggressive at home, not away), we usually see the opposite host-guest norm (play aggressive away, not at home) evolve on dynamic networks, a phenomenon common to human interaction. We also show that learning to avoid conflict can produce realistic network structures in a way different than preferential attachment models. © 2017 The Author(s).

  6. Analysis of the London dumping convention

    International Nuclear Information System (INIS)

    Nauke, M.K.

    1983-05-01

    This report gives an in-depth review of the provisions of the London Dumping Convention and of its origins in the context of the international legal framework for controlling all aspects of marine pollution. Particular attention is paid to the provisions concerning radioactive waste. (NEA) [fr

  7. The Burning Plasma Experiment conventional facilities

    International Nuclear Information System (INIS)

    Commander, J.C.

    1991-01-01

    The Burning Program Plasma Experiment (BPX) is phased to start construction of conventional facilities in July 1994, in conjunction with the conclusion of the Tokamak Fusion Test Reactor (TFTR) project. This paper deals with the conceptual design of the BPX Conventional Facilities, for which Functional and Operational Requirements (F ampersand ORs) were developed. Existing TFTR buildings and utilities will be adapted and used to satisfy the BPX Project F ampersand ORs to the maximum extent possible. However, new conventional facilities will be required to support the BPX project. These facilities include: The BPX building; Site improvements and utilities; the Field Coil Power Conversion (FCPC) building; the TFTR modifications; the Motor Generation (MG) building; Liquid Nitrogen (LN 2 ) building; and the associated Instrumentation and Control (I ampersand C) systems. The BPX building will provide for safe and efficient shielding, housing, operation, handling, maintenance and decontamination of the BPX and its support systems. Site improvements and utilities will feature a utility tunnel which will provide a space for utility services--including pulse power duct banks and liquid nitrogen coolant lines. The FCPC building will house eight additional power supplied for the Toroidal Field (TF) coils. The MG building will house the two MG sets larger than the existing TFTR MG sets. This paper also addresses the conventional facility cost estimating methodology and the rationale for the construction schedule developed. 6 figs., 1 tab

  8. Electric and Conventional Vehicle Driving Patterns

    DEFF Research Database (Denmark)

    Krogh, Benjamin Bjerre; Andersen, Ove; Torp, Kristian

    2014-01-01

    The electric vehicle (EV) is an interesting vehicle type that can reduce the dependence on fossil fuels, e.g., by using electricity from wind turbines. A significant disadvantage of EVs is a very limited range, typically less than 200 km. This paper compares EVs to conventional vehicles (CVs...

  9. Teaching effectiveness and students' performance in conventional ...

    African Journals Online (AJOL)

    There has been a proliferation of coaching centres in Lagos State. These run side-by-side conventional schools offering general education. Stakeholders in the education industry have raised questions on the relevance of these coaching centres particularly in terms of students' academic performance, teaching ...

  10. Fracture healing: direct magnification versus conventional radiography

    International Nuclear Information System (INIS)

    Link, T.M.; Kessler, T.; Lange, T.; Overbeck, J.; Fiebich, M.; Peters, P.E.

    1994-01-01

    The aim of the study was to evaluate the potential of magnification radiography in diagnosing fracture healing and assessing its complications. Seventy-three patients with fractures or who had undergone osteotomy were radiographed with both conventional (non-magnified) and magnification (5-fold) techniques. Since 10 patients were radiographed twice and 1 three times, 83 radiographs using each technique were obtained. All radiographs were analysed and the findings correlated with the patients' follow-up studies. The microfocal X-ray unit used for magnification radiography had a focal spot size of 20-130 μm. As an imaging system, digital luminescence radiography was employed with magnification, while normal film-screen systems were used with conventional radiography. Magnification radiography proved superior to conventional radiography in 47% of cases: endosteal and periosteal callus formations were seen earlier and better in 26 cases, and osseous union could be evaluated with greater certainty in 33 cases. In 49% of cases magnification radiography was equal and in 4% inferior to conventional radiography. Additionally an ''inter-observer analysis'' was carried out. Anatomical and pathological structures were classified into one of four grades. Results were significantly (P < 0.01) better using magnification radiography. We conclude that the magnification technique is a good method for monitoring fracture healing in its early stages. (orig.)

  11. James Madison and the Constitutional Convention.

    Science.gov (United States)

    Scanlon, Thomas M.

    1987-01-01

    Part 1 of this three-part article traces James Madison's life and focuses primarily on those events that prepared him for leadership in the U.S. Constitutional Convention of 1787. It describes his early love of learning, education, and public service efforts. Part 2 chronicles Madison's devotion to study and preparation prior to the Constitutional…

  12. The role of regional pollution conventions

    International Nuclear Information System (INIS)

    Haywar, P.

    1989-01-01

    Within the last 12 years a number of regional pollution conventions and action plans have been negotiated to protect the world's seas from pollution. This paper traces the development of this activity and points out the specific role of regional, as opposed to global, pollution conventions. Chief among the functions of regional conventions is the specific legal framework they provide for a particular geographical region. They also provide a forum for neighboring states to develop a coherent policy for a particular regional sea, as well as being the means of establishing regional control over potentially polluting activities. Regional agreements also constitute a suitable framework for monitoring the input of pollutants to the marine environment and assessing their effects. In addition, they provide a forum for the exchange of scientific and technical information and for developing cooperation between states. The paper concludes by summarizing the most important functions of a regional convention and suggesting that, with increasing industrialization and pollution stress, there will continue to be a need for action to be taken at the regional level

  13. Non conventional energy sources and energy conservation

    International Nuclear Information System (INIS)

    Bueno M, F.

    1995-01-01

    Geographically speaking, Mexico is in an enviable position. Sun, water, biomass and geothermal fields main non conventional energy sources with commercial applications, are presents and in some cases plentiful in national territory. Moreover the coastal tidal power which is in research stage in several countries. Non conventional energy sources are an alternative which allow us to reduce the consumption of hydrocarbons or any other type of primary energetic, are not by oneself choices for the energy conservation, but energy replacements. At the beginning of this year, CONAE created the Direction of Non conventional Energy Sources, which main objective is to promote and impulse programs inclined towards the application of systems based in renewable energy sources. The research centers represent a technological and consultative support for the CONAE. They have an infrastructure developed along several years of continuous work. The non conventional energy sources will be a reality at the same time that their cost be equal or lower than the cost for the traditional generating systems. CONAE (National Commission for Energy Conservation). (Author)

  14. Comparison of membrane bioreactor technology and conventional ...

    African Journals Online (AJOL)

    The purpose of this paper was to review the use of membrane bioreactor technology as an alternative for treating the discharged effluent from a bleached kraft mill by comparing and contrasting membrane bioreactors with conventional activated sludge systems for wastewater treatment. There are many water shortage ...

  15. The Conventional and Unconventional about Disability Conventions: A Reflective Analysis of United Nations Convention on the Rights of Persons with Disabilities

    Science.gov (United States)

    Umeasiegbu, Veronica I.; Bishop, Malachy; Mpofu, Elias

    2013-01-01

    This article presents an analysis of the United Nations Convention on the Rights of Persons with Disabilities (CRPD) in relation to prior United Nations conventions on disability and U.S. disability policy law with a view to identifying the conventional and also the incremental advances of the CRPD. Previous United Nations conventions related to…

  16. International antiterrorist conventions concerning the safety of air transport

    Directory of Open Access Journals (Sweden)

    Jacek BARCIK

    2008-01-01

    Full Text Available In this article the international law regulations are presented concerning the civilian safety of the air transport. The history concerning air terrorism and international antiterrorist conventions was described in detail, involving The Chicago Convention, The Tokyo Convention, The Hague Convention and Montreal Convention.

  17. Enhanced infectivity of bluetongue virus in cell culture by centrifugation.

    OpenAIRE

    Sundin, D R; Mecham, J O

    1989-01-01

    The effects of centrifugation of the infection of cell culture with bluetongue virus (BTV) were investigated. Baby hamster kidney cells were infected with BTV with or without centrifugation. Viral antigen was detected by immunofluorescence at 24 h in both centrifuged and noncentrifuged cultures. However, after 24 h of infection, the production of PFU in centrifuged cell cultures was 10- to 20-fold greater than that seen in cultures not centrifuged. In addition, centrifugation enhanced the dir...

  18. Are antimicrobial peptides an alternative for conventional antibiotics?

    International Nuclear Information System (INIS)

    Kamysz, W.

    2005-01-01

    Antimicrobial peptides are widespread in living organisms and constitute an important component of innate immunity to microbial infections. By the early 1980' s , more than 800 different antimicrobial peptides had been isolated from mammals, amphibians, fish, insects, plants and bacterial species. In humans, they are produced by granulocytes, macrophages and most epithelial and endothelial cells. Newly discovered antibiotics have antibacterial, antifungal, antiviral and even antiprotozoal activity. Occasionally, a single antibiotic may have a very wide spectrum of activity and may show activity towards various kinds of microorganisms. Although antimicrobial activity is the most typical function of peptides, they are also characterized by numerous other properties. They stimulate the immune system, have anti-neoplastic properties and participate in cell signalling and proliferation regulation. As antimicrobial peptides from higher eukaryotes differ structurally from conventional antibiotics produced by bacteria and fungi, they offer novel templates for pharmaceutical compounds, which could be used effectively against the increasing number of resistant microbes. (author)

  19. Detection of Streptococcus suis by in situ hybridization, indirect immunofluorescence, and peroxidase-antiperoxidase assays in formalin-fixed, paraffin-embedded tissue sections from pigs

    DEFF Research Database (Denmark)

    Boye, Mette; Feenstra, Anne Avlund; Tegtmeier, Conny

    2000-01-01

    and the immunohistochemical methods were used for detection of S. suis in formalin-fixed, paraffin-embedded tissue sections of brain, endocardium, and lung from pigs infected with S. suis. The methods developed were able to detect single cells of S. suis in situ in the respective samples, whereas no signal was observed from...

  20. The unappreciated slowness of conventional tourism

    Directory of Open Access Journals (Sweden)

    G.R. Larsen

    2016-05-01

    Full Text Available Most tourists are not consciously engaging in ‘slow travel’, but a number of travel behaviours displayed by conventional tourists can be interpreted as slow travel behaviour. Based on Danish tourists’ engagement with the distances they travel across to reach their holiday destination, this paper explores unintended slow travel behaviours displayed by these tourists. None of the tourists participating in this research were consciously doing ‘slow travel’, and yet some of their most valued holiday memories are linked to slow travel behaviours. Based on the analysis of these unintended slow travel behaviours, this paper will discuss the potential this insight might hold for promotion of slow travel. If unappreciated and unintentional slow travel behaviours could be utilised in the deliberate effort of encouraging more people to travel slow, ‘slow travel’ will be in a better position to become integrated into conventional travel behaviour.

  1. Air pollution: UNCED convention on climate change

    International Nuclear Information System (INIS)

    Pieri, M.

    1992-01-01

    In addition to United Nations papers delineating the Organization's convention on climate change and strategies concerning the protection of the earth's atmosphere, this booklet presents four papers expressing the views of Italian and American strategists. The central theme is the establishment of current global air pollution trends, the determination of suitable air pollution limits, and the preparation of feasible socio-economic strategies to allow industrialized and developing countries to work together effectively to achieve the proposed global air quality goals

  2. Non-conventional mesons at PANDA

    International Nuclear Information System (INIS)

    Giacosa, Francesco

    2015-01-01

    Non-conventional mesons, such as glueballs and tetraquarks, will be in the focus of the PANDA experiment at the FAIR facility. In this lecture we recall the basic properties of QCD and describe some features of unconventional states. We focus on the search of the not-yet discovered glueballs and the use of the extended Linear Sigma Model for this purpose, and on the already discovered but not-yet understood X, Y, Z states. (paper)

  3. Kuala Namu Convention And Exhibition Centre

    OpenAIRE

    Gustriana, Trisna

    2017-01-01

    Aerotropolis area development that is expected to accommodate the development of business and commercial appeal and this is the chance for the designer to be able to take advantage of the situation and condition of land as well as possible. So that the revolutionary changes but is able to embrace all stakeholders is the solution needed to development Aerotropolis. Kuala Namu's Convention and Exhibition Center is expected to be a solution for regional development of Kuala Namu a...

  4. The Aarhus Convention: A new regional convention on citizens' environmental rights

    International Nuclear Information System (INIS)

    Wates, J.

    2000-01-01

    The UN ECE Convention on Access to Information, Public Participation in Decision-making and Access to Justice in Environmental Matters had been adopted at Arhus, Denmark, at the Fourth Ministerial Conference in the 'Environment for Europe' process, and signed by thirty-five countries and the European Community. This paper summarises the main features of the Convention and briefly discusses its relevance to radioactive waste management issues. It then describes some of the activities currently being undertaken under the auspices of the Convention. (author)

  5. A complementary conventional analysis for channelized reservoirs

    International Nuclear Information System (INIS)

    Escobar Freddy Humberto; Montealegre M, Matilde

    2007-01-01

    Many well pressure data coming from long and narrow reservoirs which result from either fluvial deposition of faulting connote be completely interpreted by conventional analysis since some flow regimes are not conventionally recognized yet in the oil literature. This narrow geometry allows for the simultaneous development of two linear flow regimes coming from each one of the lateral sides of the system towards the well. This has been called dual linear flow regime. If the well is off-centered with regards to the two lateral boundaries, then, and of the linear flow regimes vanishes and, than, two possibilities con be presented. Firstly, if the closer lateral boundary is close to flow the unique linear flow persists along the longer lateral boundary. It has been called single linear flow. Following this, either steady or pseudo-steady states will develop. Secondly, if a constant - pressure closer lateral boundary is dealt with, then parabolic flow develops along the longer lateral boundary. Steady state has to be developed once the disturbance reaches the farther boundary. This study presents new equations for conventional analysis for the dual linear, linear and parabolic flow regimes recently introduced to the oil literature. The equations were validated by applying them to field and simulated examples

  6. Fuzzy logic control to be conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Eker, Ilyas [University of Gaziantep, Gaziantep (Turkey). Department of Electrical and Electronic Engineering; Torun, Yunis [University of Gaziantep, Gaziantep (Turkey). Technical Vocational School of Higher Education

    2006-03-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system. (author)

  7. Fuzzy logic control to be conventional method

    International Nuclear Information System (INIS)

    Eker, Ilyas; Torun, Yunis

    2006-01-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system

  8. PUBLIC POLICY VIOLATION UNDER NEW YORK CONVENTION

    Directory of Open Access Journals (Sweden)

    Michelle Ayu Chinta Kristy

    2013-04-01

    Full Text Available The increasing number of the use of arbitration in Asia has highlighted the significant influence of the recognition and enforcement of arbitral awards. The New York Convention currently becomes the most widely accepted convention to which the courts would refer when recognizing and enforcing foreign arbitral awards. This article would firstly provide a comparative study of the court’s interpretation towards public policy as mentioned under Article V (2 b of the New York Convention between non-arbitration-friendly-law Indonesia and arbitration-friendly-law China. Subsequently, it will discuss whether uniformity in interpreting and reserving public policy is required or not. Peningkatan jumlah penggunaan lembaga arbitrasi di Asia mendorong peningkatan signifikansi pengakuan dan pelaksanaan putusan arbitrasi asing. Konvensi New York saat ini menjadi konvensi yang diterima secara luas dimana dijadikan referensi oleh pengadilan dalam hal pengakuan dan pelaksanaan putusan arbitrasi asing. Artikel ini akan pertama-tama membahas studi perbandingan atas interpretasi pengadilan mengenai penggunaan kebijakan publik sebagaimana tertera pada Pasal V (2 b Konvensi New York antara Indonesia yang hukumnya tidak mendukung dan China dengan hukum yang mendukung pengakuan dan pelaksanaan putusan arbitrasi asing. Apakah keseragaman antar negara dalam menginterpretasi dan menggunakan kebijakan publik diperlukan atau tidak dibahas pada diskusi selanjutnya.

  9. Effectiveness of the Convention on Nuclear Safety

    International Nuclear Information System (INIS)

    Schwarz, G.

    2016-01-01

    The Convention on Nuclear Safety (CNS) has been established after the Chernobyl accident with the primary objective of achieving and maintaining a high level of nuclear safety worldwide, through the enhancement of national measures and international cooperation. The CNS is an incentive convention. It defines the basic safety standard which shall be met by the Contracting Parties. The verification of compliance is based on a self-assessment by the Countries and a Peer Review by the other Contracting Parties. As of July 2015, there are 78 Contracting Parties. Among the Contracting Parties of the Convention are all countries operating nuclear power plants except the Islamic Republic of Iran and Taiwan, all countries constructing nuclear power plants, all countries having nuclear power plants in long term shutdown and all countries having signed contracts for the construction of nuclear power plants. The National Reports under the CNS therefore cover almost all nuclear power plants of the world. The peer review of reports, questions and answers that are exchanged in connection with the Review Meetings provided a unique overview of nuclear safety provisions and issues in countries planning or operating nuclear power plants. This is especially important for neighbouring countries to those operating nuclear power plants.

  10. Metal ion implantation: Conventional versus immersion

    International Nuclear Information System (INIS)

    Brown, I.G.; Anders, A.; Anders, S.; Dickinson, M.R.; MacGill, R.A.

    1994-01-01

    Vacuum-arc-produced metal plasma can be used as the ion feedstock material in an ion source for doing conventional metal ion implantation, or as the immersing plasma for doing plasma immersion ion implantation. The basic plasma production method is the same in both cases; it is simple and efficient and can be used with a wide range of metals. Vacuum arc ion sources of different kinds have been developed by the authors and others and their suitability as a metal ion implantation tool has been well established. Metal plasma immersion surface processing is an emerging tool whose characteristics and applications are the subject of present research. There are a number of differences between the two techniques, both in the procedures used and in the modified surfaces created. For example, the condensibility of metal plasma results in thin film formation and subsequent energetic implantation is thus done through the deposited layer; in the usual scenario, this recoil implantation and the intermixing it produces is a feature of metal plasma immersion but not of conventional energetic ion implantation. Metal plasma immersion is more suited (but not limited) to higher doses (>10 17 cm -2 ) and lower energies (E i < tens of keV) than the usual ranges of conventional metal ion implantation. These and other differences provide these vacuum-arc-based surface modification tools with a versatility that enhances the overall technological attractiveness of both

  11. Measures to implement the Chemical Weapons Convention

    Energy Technology Data Exchange (ETDEWEB)

    Tanzman, E.; Kellman, B.

    1999-11-05

    This seminar is another excellent opportunity for those involved in preventing chemical weapons production and use to learn from each other about how the Chemical Weapons Convention (CWC) can become a foundation of arms control in Africa and around the world. The author is grateful to the staff of the Organization for the Prohibition of Chemical Weapons (OPCW) for inviting him to address this distinguished seminar. The views expressed in this paper are those of the authors alone, and do not represent the position of the government of the US nor or of any other institution. In 1993, as the process of CWC ratification was beginning, concerns arose that the complexity of integrating the treaty with national law would cause each nation to implement the Convention without regard to what other nations were doing, thereby causing inconsistencies among States Parties in how the Convention would be carried out. As a result the Manual for National Implementation of the Chemical Weapons Convention was prepared and presented it to each national delegation at the December 1993 meeting of the Preparatory Commission in The Hague. During its preparation, the Manual was reviewed by the Committee of Legal Experts on National Implementation of the Chemical Weapons Convention, a group of distinguished international jurists, law professors, legally-trained diplomats, government officials, and Parliamentarians from every region of the world, including Mica. In February 1998, the second edition of the Manual was published in order to update it in light of developments since the CWC entered into force on 29 April 1997. The second edition 1998 clarified the national implementation options to reflect post-entry-into-force thinking, added extensive references to national implementing measures that had been enacted by various States Parties, and included a prototype national implementing statute developed by the authors to provide a starting point for those whose national implementing

  12. Measures to implement the Chemical Weapons Convention

    International Nuclear Information System (INIS)

    Tanzman, E.; Kellman, B.

    1999-01-01

    This seminar is another excellent opportunity for those involved in preventing chemical weapons production and use to learn from each other about how the Chemical Weapons Convention (CWC) can become a foundation of arms control in Africa and around the world. The author is grateful to the staff of the Organization for the Prohibition of Chemical Weapons (OPCW) for inviting him to address this distinguished seminar. The views expressed in this paper are those of the authors alone, and do not represent the position of the government of the US nor or of any other institution. In 1993, as the process of CWC ratification was beginning, concerns arose that the complexity of integrating the treaty with national law would cause each nation to implement the Convention without regard to what other nations were doing, thereby causing inconsistencies among States Parties in how the Convention would be carried out. As a result the Manual for National Implementation of the Chemical Weapons Convention was prepared and presented it to each national delegation at the December 1993 meeting of the Preparatory Commission in The Hague. During its preparation, the Manual was reviewed by the Committee of Legal Experts on National Implementation of the Chemical Weapons Convention, a group of distinguished international jurists, law professors, legally-trained diplomats, government officials, and Parliamentarians from every region of the world, including Mica. In February 1998, the second edition of the Manual was published in order to update it in light of developments since the CWC entered into force on 29 April 1997. The second edition 1998 clarified the national implementation options to reflect post-entry-into-force thinking, added extensive references to national implementing measures that had been enacted by various States Parties, and included a prototype national implementing statute developed by the authors to provide a starting point for those whose national implementing

  13. Comparison of conventional methods for diagnosis of visceral leishmaniasis in children of the Center-West Region of Brazil

    Directory of Open Access Journals (Sweden)

    Yvone M. Brustoloni

    Full Text Available In Brazil, sophisticated techniques currently employed for diagnosis of visceral leishmaniasis, such as polymerase chain reaction-based assays, are only available in major research centers, whereas conventional methods are still used in many areas where the disease occurs. In the state of Mato Grosso do Sul, in the country's Center-West Region, visceral leishmaniasis has recently emerged in many cities, and duration of the disease, from the onset of symptoms to diagnosis, has been short. Considering that results of diagnostic tests may depend on the phase of the disease, we compared direct examination of bone marrow aspirates (BMAs, BMA culture, and serology by Indirect Immunofluorescence Antibody Test (IFAT for diagnosis in children, according to time of evolution (30 days and to spleen size ( 5 cm at admission. Duration of the illness did not interfere with test positivity: direct smear examination and IFAT were positive in more than 80% of patients, as was culture in around 60%. Results of positive microscopy, however, where predominant in patients with larger spleens. Thanks to the association of traditional techniques, only a few patients had to begin a treatment trial without confirming the diagnosis. Conventional methods for diagnosis of visceral leishmaniasis are still indispensable in our region, and training professionals in basic techniques should be incremented. The highest sensitivity in laboratory diagnosis among the cases investigated was that obtained with a combination of BMA direct examination and IFAT, nearing 100%.

  14. Cytomorphology of cervicovaginal melanoma: ThinPrep versus conventional Papanicolaou tests.

    Science.gov (United States)

    Setia, Namrata; Goulart, Robert A; Leiman, Gladywn; Otis, Christopher N; Modem, Rukmini; Pantanowtiz, Liron

    2010-12-31

    Primary cervicovaginal melanoma is a rare malignancy associated with a high risk of recurrence. Prior studies discussing the cytomorphology of cervicovaginal melanoma have been based primarily on review of conventional Papanicolaou (Pap) smears. The aim of this study was to evaluate cervicovaginal melanomas identified in liquid-based Pap tests, in comparison with features seen on conventional Pap smear preparation. Cases of cervicovaginal melanoma identified on Pap tests with concurrent or subsequent histopathologic confirmation were collected from the Baystate Medical Center cytopathology files and personal archives of the authors over a total period of 34 years. All cytopathology (n = 6) and the available histology slides (n = 5) were reviewed. Cases were analyzed regarding clinical, histopathologic and cytomorphological findings. A total of six cases with invasive cervicovaginal melanoma diagnosed on Pap tests were identified. Most patients were postmenopausal with contact bleeding, correlating with surface ulceration (identified in biopsy/excision material in 5/5 cases). Most cases had deeply invasive tumors (5/5: modified Breslow's thickness > 5 mm and Chung's level of invasion IV/V). Pap tests included four ThinPrep and two conventional smears. Overall, ThinPrep Pap tests exhibited a higher ratio of tumor cells to background squamous cells. While all Pap tests were bloodstained, tumor diathesis was prominent only within conventional smears. Melanoma cells were present both as clusters and scattered single cells in each Pap test type. Both the preparations contained epithelioid tumor cells, whereas spindled tumor cells were seen in only two ThinPrep cases. Prominent nucleoli and binucleation of tumor cells were seen in both the preparations. Melanin pigment was identified in only ThinPrep (3/4) cases and nuclear pseudo-inclusions in one conventional Pap smear. Cell blocks were made in three ThinPrep cases and immunocytochemistry (S-100, HMB45, Melan

  15. Cell fusion induced by ionizing radiation in various cell lines

    International Nuclear Information System (INIS)

    Khair, M.B.

    1994-07-01

    Cell fusion induced by ionizing radiation has been studied in rat's hepatocytes in vivo and in different cell lines in vitro. These cell lines were: Hela cells, V-79 fibroblasts, human and rat lymphocytes. For irradiation, 0.85 MeV fission neutrons and 14 MeV fast neutrons were used. Cell analyses were performed by fluorescent dyes using immunofluorescent microscope and flow cytometre. Our results in vivo showed that, regardless the dose-rate, a dose of 1 Gy approximately was enough to induce a significant level of cell fusion depending on neutron energy and the age of rats. The level of cell fusion was also significant in Hela cells at a dose of 0.5 Gy. Similar effect, but to a lesser extent, was observed in V-79 cells. Whereas, in lymphocytes insignificant cell fusion was noticed. The varying levels of cell-fusion in different cell lines could be attributed to the type of cells and mutual contact between cells. Furthermore irradiation did not show any influence on cell division ability in both hepatocytes and Hela cells and that fused cells were also able to divide forming a new generation of cells. (author). 36 refs., 8 figs., 10 tabs

  16. In vitro evaluation of relative biological effectiveness of 3MeV protons using γH2AX immuno-fluorescence

    International Nuclear Information System (INIS)

    Chaurasia, Rajesh K.; Desai, Utkarsha; Sirsath, K.B.; Bhat, N.N.; Sapra, B.K.; Gaur, Neeraj

    2018-01-01

    Use of charged particles for treating complicated tumors is gaining momentum. Their defined dose profile, near zero dose to normal tissue beyond tumour, skin sparing, more lethal effect than mutations, ability to focus beam with complex geometries are some of the advantages. Lack of scientific information on radiobiological efficacy, complexity and cost/maintenance of such facilities are hindering their use at present. Though a huge amount of time and resources are invested cancer treatment still primarily depends on chemotherapy and radiotherapy (γ-ray). Through this study we aim to demonstrate relative biological effectiveness of 3MeV proton beam with estimated LET of 13 keV/μm on cancerous mammalian cell line using highly reliable DNA double strand break γH2AX marker as a damage quantification tool

  17. The sustainability transition. Beyond conventional development

    Energy Technology Data Exchange (ETDEWEB)

    Raskin, P; Chadwick, M; Jackson, T; Leach, G

    1996-10-01

    This paper synthesizes findings of the first phase in SEI`s PoleStar Project - a project aimed at developing long-term strategies and policies for sustainable development. Taking a global and long-range perspective, the paper aims to describe a theoretical framework for addressing sustainability, to identify emerging issues and outline directions for future action. The paper begins by setting today`s development and environmental challenges in historical context, and describing the scenario method for envisioning and evaluating alternative futures, and identifying propitious areas for policy and action. It next summarizes a detailed scenario based on conventional development assumptions, and discusses the implications of this scenario for demographic and economic patterns, energy and water resources, land resources and agriculture, and pollution loads and the environment to the year 2050. The conventional scenario relies in part on the sectorally-oriented work discussed in Papers 3 through 6 of the PoleStar Project report series, and makes use of the PoleStar System, software designed for integrated resource, environment and socio-economic accounting and scenario analysis (described in Paper 2). The paper then examines the critical risks to social, resource and environmental systems lying ahead on the conventional development path. Finally, the paper surveys the requirements for sustainability across a number of policy dimensions, and raises key questions for the future. The PoleStar Project is proceeding to examine a range of alternative development scenarios, in the context of the work of the regionally-diverse Global Scenario Group, convened by SEI. The hope remains to offer wise counsel for a transition to an equitable, humane and sustainable future for the global community. 144 refs, 30 figs, 9 tabs

  18. The sustainability transition. Beyond conventional development

    International Nuclear Information System (INIS)

    Raskin, P.; Chadwick, M.; Jackson, T.; Leach, G.

    1996-01-01

    This paper synthesizes findings of the first phase in SEI's PoleStar Project - a project aimed at developing long-term strategies and policies for sustainable development. Taking a global and long-range perspective, the paper aims to describe a theoretical framework for addressing sustainability, to identify emerging issues and outline directions for future action. The paper begins by setting today's development and environmental challenges in historical context, and describing the scenario method for envisioning and evaluating alternative futures, and identifying propitious areas for policy and action. It next summarizes a detailed scenario based on conventional development assumptions, and discusses the implications of this scenario for demographic and economic patterns, energy and water resources, land resources and agriculture, and pollution loads and the environment to the year 2050. The conventional scenario relies in part on the sectorally-oriented work discussed in Papers 3 through 6 of the PoleStar Project report series, and makes use of the PoleStar System, software designed for integrated resource, environment and socio-economic accounting and scenario analysis (described in Paper 2). The paper then examines the critical risks to social, resource and environmental systems lying ahead on the conventional development path. Finally, the paper surveys the requirements for sustainability across a number of policy dimensions, and raises key questions for the future. The PoleStar Project is proceeding to examine a range of alternative development scenarios, in the context of the work of the regionally-diverse Global Scenario Group, convened by SEI. The hope remains to offer wise counsel for a transition to an equitable, humane and sustainable future for the global community. 144 refs, 30 figs, 9 tabs

  19. Alternative Fuels Data Center: Conventional Natural Gas Production

    Science.gov (United States)

    Conventional Natural Gas Production to someone by E-mail Share Alternative Fuels Data Center : Conventional Natural Gas Production on Facebook Tweet about Alternative Fuels Data Center: Conventional Natural Gas Production on Twitter Bookmark Alternative Fuels Data Center: Conventional Natural Gas Production

  20. Einstein Synchronisation and the Conventionality of Simultaneity

    OpenAIRE

    Mladen Domazet

    2006-01-01

    Despite a broad-range title the paper settles for the related issue of whether the Special Theory of Relativity (STR) necessarily advocates the demise of an ontological difference between past and future events, between past and future in general. In the jargon of H. Stein: are we forced, within the framework of the STR, to choose only between ‘solipsism’ and ‘determinism’ exclusively? A special emphasis is placed on the role that the conventionality of simultaneity plays in the STR with rega...

  1. Standardizing Naming Conventions in Radiation Oncology

    Energy Technology Data Exchange (ETDEWEB)

    Santanam, Lakshmi [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Hurkmans, Coen [Department of Radiation Oncology, Catharina Hospital, Eindhoven (Netherlands); Mutic, Sasa [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Vliet-Vroegindeweij, Corine van [Department of Radiation Oncology, Thomas Jefferson University Hospital, Philadelphia, PA (United States); Brame, Scott; Straube, William [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Galvin, James [Department of Radiation Oncology, Thomas Jefferson University Hospital, Philadelphia, PA (United States); Tripuraneni, Prabhakar [Department of Radiation Oncology, Scripps Clinic, LaJolla, CA (United States); Michalski, Jeff [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Bosch, Walter, E-mail: wbosch@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Advanced Technology Consortium, Image-guided Therapy QA Center, St. Louis, MO (United States)

    2012-07-15

    Purpose: The aim of this study was to report on the development of a standardized target and organ-at-risk naming convention for use in radiation therapy and to present the nomenclature for structure naming for interinstitutional data sharing, clinical trial repositories, integrated multi-institutional collaborative databases, and quality control centers. This taxonomy should also enable improved plan benchmarking between clinical institutions and vendors and facilitation of automated treatment plan quality control. Materials and Methods: The Advanced Technology Consortium, Washington University in St. Louis, Radiation Therapy Oncology Group, Dutch Radiation Oncology Society, and the Clinical Trials RT QA Harmonization Group collaborated in creating this new naming convention. The International Commission on Radiation Units and Measurements guidelines have been used to create standardized nomenclature for target volumes (clinical target volume, internal target volume, planning target volume, etc.), organs at risk, and planning organ-at-risk volumes in radiation therapy. The nomenclature also includes rules for specifying laterality and margins for various structures. The naming rules distinguish tumor and nodal planning target volumes, with correspondence to their respective tumor/nodal clinical target volumes. It also provides rules for basic structure naming, as well as an option for more detailed names. Names of nonstandard structures used mainly for plan optimization or evaluation (rings, islands of dose avoidance, islands where additional dose is needed [dose painting]) are identified separately. Results: In addition to its use in 16 ongoing Radiation Therapy Oncology Group advanced technology clinical trial protocols and several new European Organization for Research and Treatment of Cancer protocols, a pilot version of this naming convention has been evaluated using patient data sets with varying treatment sites. All structures in these data sets were

  2. 9th Structural Engineering Convention 2014

    CERN Document Server

    2015-01-01

    The book presents research papers presented by academicians, researchers, and practicing structural engineers from India and abroad in the recently held Structural Engineering Convention (SEC) 2014 at Indian Institute of Technology Delhi during 22 – 24 December 2014. The book is divided into three volumes and encompasses multidisciplinary areas within structural engineering, such as earthquake engineering and structural dynamics, structural mechanics, finite element methods, structural vibration control, advanced cementitious and composite materials, bridge engineering, and soil-structure interaction. Advances in Structural Engineering is a useful reference material for structural engineering fraternity including undergraduate and postgraduate students, academicians, researchers and practicing engineers.

  3. National Convention on Family Life Education.

    Science.gov (United States)

    1973-12-01

    This secretarial report gives brief comments on some discussion of topics at the National Convention on Family Life Education. Discussion included: 1) legalized prostitution as a means to reduce venereal disease; 2) family life education promotion by government and civic groups; 3) more authority for the Population Council; 4) more liberal abortion legislation than previously; 5) statutory notification of veneral disease by medical practitioners; 6) compensatory measures for working women with young children, and 7) the need for modernization of legislation pertaining to child health, adoption, paternity, the Persons Act, infant life preservation, drugs, age of consent, and the age of minority.

  4. Standardizing Naming Conventions in Radiation Oncology

    International Nuclear Information System (INIS)

    Santanam, Lakshmi; Hurkmans, Coen; Mutic, Sasa; Vliet-Vroegindeweij, Corine van; Brame, Scott; Straube, William; Galvin, James; Tripuraneni, Prabhakar; Michalski, Jeff; Bosch, Walter

    2012-01-01

    Purpose: The aim of this study was to report on the development of a standardized target and organ-at-risk naming convention for use in radiation therapy and to present the nomenclature for structure naming for interinstitutional data sharing, clinical trial repositories, integrated multi-institutional collaborative databases, and quality control centers. This taxonomy should also enable improved plan benchmarking between clinical institutions and vendors and facilitation of automated treatment plan quality control. Materials and Methods: The Advanced Technology Consortium, Washington University in St. Louis, Radiation Therapy Oncology Group, Dutch Radiation Oncology Society, and the Clinical Trials RT QA Harmonization Group collaborated in creating this new naming convention. The International Commission on Radiation Units and Measurements guidelines have been used to create standardized nomenclature for target volumes (clinical target volume, internal target volume, planning target volume, etc.), organs at risk, and planning organ-at-risk volumes in radiation therapy. The nomenclature also includes rules for specifying laterality and margins for various structures. The naming rules distinguish tumor and nodal planning target volumes, with correspondence to their respective tumor/nodal clinical target volumes. It also provides rules for basic structure naming, as well as an option for more detailed names. Names of nonstandard structures used mainly for plan optimization or evaluation (rings, islands of dose avoidance, islands where additional dose is needed [dose painting]) are identified separately. Results: In addition to its use in 16 ongoing Radiation Therapy Oncology Group advanced technology clinical trial protocols and several new European Organization for Research and Treatment of Cancer protocols, a pilot version of this naming convention has been evaluated using patient data sets with varying treatment sites. All structures in these data sets were

  5. Unconventional applications of conventional intrusion detection sensors

    International Nuclear Information System (INIS)

    Williams, J.D.; Matter, J.C.

    1983-01-01

    A number of conventional intrusion detection sensors exists for the detection of persons entering buildings, moving within a given volume, and crossing a perimeter isolation zone. Unconventional applications of some of these sensors have recently been investigated. Some of the applications which are discussed include detection on the edges and tops of buildings, detection in storm sewers, detection on steam and other types of large pipes, and detection of unauthorized movement within secure enclosures. The enclosures can be used around complicated control valves, electrical control panels, emergency generators, etc

  6. Standardizing naming conventions in radiation oncology.

    Science.gov (United States)

    Santanam, Lakshmi; Hurkmans, Coen; Mutic, Sasa; van Vliet-Vroegindeweij, Corine; Brame, Scott; Straube, William; Galvin, James; Tripuraneni, Prabhakar; Michalski, Jeff; Bosch, Walter

    2012-07-15

    The aim of this study was to report on the development of a standardized target and organ-at-risk naming convention for use in radiation therapy and to present the nomenclature for structure naming for interinstitutional data sharing, clinical trial repositories, integrated multi-institutional collaborative databases, and quality control centers. This taxonomy should also enable improved plan benchmarking between clinical institutions and vendors and facilitation of automated treatment plan quality control. The Advanced Technology Consortium, Washington University in St. Louis, Radiation Therapy Oncology Group, Dutch Radiation Oncology Society, and the Clinical Trials RT QA Harmonization Group collaborated in creating this new naming convention. The International Commission on Radiation Units and Measurements guidelines have been used to create standardized nomenclature for target volumes (clinical target volume, internal target volume, planning target volume, etc.), organs at risk, and planning organ-at-risk volumes in radiation therapy. The nomenclature also includes rules for specifying laterality and margins for various structures. The naming rules distinguish tumor and nodal planning target volumes, with correspondence to their respective tumor/nodal clinical target volumes. It also provides rules for basic structure naming, as well as an option for more detailed names. Names of nonstandard structures used mainly for plan optimization or evaluation (rings, islands of dose avoidance, islands where additional dose is needed [dose painting]) are identified separately. In addition to its use in 16 ongoing Radiation Therapy Oncology Group advanced technology clinical trial protocols and several new European Organization for Research and Treatment of Cancer protocols, a pilot version of this naming convention has been evaluated using patient data sets with varying treatment sites. All structures in these data sets were satisfactorily identified using this

  7. RF torch discharge combined with conventional burner

    International Nuclear Information System (INIS)

    Janca, J.; Tesar, C.

    1996-01-01

    The design of the combined flame-rf-plasma reactor and experimental examination of this reactor are presented. For the determination of the temperature in different parts of the combined burner plasma the methods of emission spectroscopy were used. The temperatures measured in the conventional burner reach the maximum temperature 1900 K but in the burner with the superimposed rf discharge the neutral gas temperature substantially increased up to 2600 K but also the plasma volume increases substantially. Consequently, the resident time of reactants in the reaction zone increases

  8. Conventional myelography - evaluation of risk and benefit

    International Nuclear Information System (INIS)

    Hentschel, F.

    1989-01-01

    While the benefit and methodic risk of conventional myelography (KMG) are known, a radiation risk of 0.04 to 0.9 annual radiation-induced cancers can be estimated for all inhabitants of the GDR, dependent on the investigated region and the technique used. An optimized technique can reduce the radiation burden to 50 or 25%. With comparable values of benefit and radiation risk spinal CT and KMG are not contradictory but complementary investigations. Alternative methods (MRT, US) must not be discussed from the standpoint of radiation burden, but according to their availability and their methodic limitations. (author)

  9. Arthritis: Conventional and Advanced Radiological Imaging

    Directory of Open Access Journals (Sweden)

    Adviye Ergun

    2014-06-01

    Full Text Available Arthritides are acute or chronic inflammation of one or more joints. The most common types of arthritis are osteoarthritis and rheumatoid arthritis, but there are more than 100 different forms. Right and early diagnosis is extremely important for the prevention of eventual structural and functional disability of the affected joint. Imaging findings, especially those of advanced level imaging, play a major role in diagnosis and monitor the progression of arthritis or its response to therapy. The objective of the review is to discuss the findings of conventional and advanced radiological imaging of most common arthritides and to present a simplified approach for their radiological evaluation.

  10. Adding intelligence to conventional industrial robots

    International Nuclear Information System (INIS)

    Harrigan, R.W.

    1993-01-01

    Remote systems are needed to accomplish many tasks such as the clean up of waste sites in which the exposure of personnel to radiation, chemical, explosive, and other hazardous constituents is unacceptable. In addition, hazardous operations which in the past have been completed by technicians are under increased scrutiny due to high costs and low productivity associated with providing protective clothing and environments. Traditional remote operations have, unfortunately, proven to also have very low productivity when compare with unencumbered human operators. However, recent advances in the integration of sensors and computing into the control of conventional remotely operated industrial equipment has shown great promise for providing systems capable of solving difficult problems

  11. The Effect of Spaceflight on Bone Cell Cultures

    Science.gov (United States)

    Landis, William J.

    1999-01-01

    Understanding the response of bone to mechanical loading (unloading) is extremely important in defining the means of adaptation of the body to a variety of environmental conditions such as during heightened physical activity or in extended explorations of space or the sea floor. The mechanisms of the adaptive response of bone are not well defined, but undoubtedly they involve changes occurring at the cellular level of bone structure. This proposal has intended to examine the hypothesis that the loading (unloading) response of bone is mediated by specific cells through modifications of their activity cytoskeletal elements, and/or elaboration of their extracellular matrices. For this purpose, this laboratory has utilized the results of a number of previous studies defining molecular biological, biochemical, morphological, and ultrastructural events of the reproducible mineralization of a primary bone cell (osteoblast) culture system under normal loading (1G gravity level). These data and the culture system then were examined following the use of the cultures in two NASA shuttle flights, STS-59 and STS-63. The cells collected from each of the flights were compared to respective synchronous ground (1G) control cells examined as the flight samples were simultaneously analyzed and to other control cells maintained at 1G until the time of shuttle launch, at which point they were terminated and studied (defined as basal cells). Each of the cell cultures was assayed in terms of metabolic markers- gene expression; synthesis and secretion of collagen and non-collagenous proteins, including certain cytoskeletal components; assembly of collagen into macrostructural arrays- formation of mineral; and interaction of collagen and mineral crystals during calcification of the cultures. The work has utilized a combination of biochemical techniques (radiolabeling, electrophoresis, fluorography, Western and Northern Blotting, and light microscopic immunofluorescence) and structural

  12. Parotid gland function following accelerated and conventionally fractionated radiotherapy

    International Nuclear Information System (INIS)

    Leslie, M.D.; Dische, S.

    1991-01-01

    The function of parotid glands in patients treated by 3 different schedules of radiotherapy was studied 9 months or more after its conclusion. All had received radiotherapy for a malignancy confined to 1 side of the head and neck region and only the gland on the side of the lesion was in the treatment volume; the contralateral gland acted as an internal control. Saliva was selectively collected from the parotid glands and the stimulated flow rate and pH of the saliva determined. Flow rates were expressed in each case as a percentage of that of the contralateral ('untreated') gland. Twelve glands that had received conventionally fractionated radiotherapy to a dose of 60-66 Gy showed a mean percentage flow of 20 percent and a significant fall in the pH of the saliva produced. Six glands that had received CHART (Continuous Hyperfractionated Accelerated RadioTherapy) and 8 conventionally fractionated radiotherapy to a dose of 35-40 Gy showed mean percentage flows of 57 and 65 percent respectively, with only slight and non-significant falls in saliva pH. The results show that in the treatment of squamous cell carcinoma in the head and neck the use of CHART can lead to considerable less late change in the function of the parotid gland. (author). 26 refs.; 5 figs.; 2 tabs

  13. Guidelines regarding National Reports under the Convention on Nuclear Safety

    International Nuclear Information System (INIS)

    2013-01-01

    These Guidelines, established by the Contracting Parties pursuant to Article 22 of the Convention on Nuclear Safety (hereinafter called the Convention), are intended to be read in conjunction with the text of the Convention. Their purpose is to provide guidance to the Contracting Parties regarding material that may be useful to include in the National Reports required under Article 5 of the Convention and thereby to facilitate the most efficient review of implementation by the Contracting Parties of their obligations under the Convention.

  14. Indonesia Interest in International Labor Organization (ILO) Convention No.189

    OpenAIRE

    Jamaan, Ahmad; Anugrah, Debora Panca

    2014-01-01

    This research aims to analyze, Indonesia Interest in ILO convention No. 189 on Decent Works for Domestic Workers. Indonesia has massive number of domestic workers caused by low quality of education. Therefore, Indonesia agreed on creation of ILO Convention No.189 in protecting their society that works as domestic workers. However, in the early of ILO Convention No.189 agreement creation in 2011, Indonesia has not ratified this Convention to 2013. If Indonesia has ratified this convention prev...

  15. Implementation of the Aarhus convention - A survey

    Directory of Open Access Journals (Sweden)

    Marina Malis Sazdovska

    2016-11-01

    Full Text Available Legislation on global and regional level in the field of environmental protection is characterized by the adoption of international conventions and agreements that attempt to regulate this matter legally. As an extremely important area, which exceeds the boundaries of nation-state and as a global environmental problem, the issues of environmental protection are a major concern to international organizations. It is directly linked to reducing the jurisdiction of the States and transfer of competences to international organizations and institutions in order to solve the problems in a global experience. In order to overcome the problems regarding the implementation of international documents, the creation of certain policies by international organizations and institutions is required to promote the idea of environmental protection as a basic mo$ o of the global world. Taking into account the recommendations of Brundtland Commission, humanity has a moral obligation to preserve natural resources for future generations. Main objective of this article is the presentation of research on the implementation of the Aarhus Convention and the proposal of measures for the creation of ideas and policies on improving access to information in the field. The research is done with the students from the faculty of Security which accessed the information in environmental matters.

  16. Future directions conventional oil supply, Western Canada

    International Nuclear Information System (INIS)

    Campbell, G.R.; Hayward, J.

    1997-01-01

    The history of the Canadian oil industry was briefly sketched and the future outlook for crude oil and natural gas liquids in western Canada was forecast. The historical review encompassed some of the significant events in history of the Canadian oil industry, including the Leduc discovery in 1947, the Swan Hills discovery in 1957, the start of commercial production from the Athabasca oil sands in 1967, the discovery of the Hibernia oilfield offshore Newfoundland in 1979, and the onset of the use of horizontal production wells in western Canada in 1987. The resource base, supply costs, and the technology that is being developed to reduce costs and to improve recovery, were reviewed. Future oil prices were predicted, taking into account the costs associated with technological developments. It was suggested that the character of the industry is undergoing a change from an industry dominated by conventional supply to a mixed industry with increasing volume of heavy oil, primary bitumen, synthetic oil and frontier supply replacing 'conventional' light crude oil. Projections into the future are subject to uncertainty both on the supply as well as on the demand side. The potential impact of technology can significantly affect demand, and technological developments can yield additional supplies which exceed current expectations. 10 figs

  17. Non-conventional energy and propulsion methods

    International Nuclear Information System (INIS)

    Valone, T.

    1991-01-01

    From the disaster of the Space Shuttle, Challenger, to the Kuwaiti oil well fires, we are reminded constantly of our dependence on dangerous, combustible fuels for energy and propulsion. Over the past ten years, there has been a considerable production of new and exciting inventions which defy conventional analysis. The term non-conventional was coined in 1980 by a Canadian engineer to designate a separate technical discipline for this type of endeavor. Since then, several conferences have been devoted solely to these inventions. Integrity Research Corp., an affiliate of the Institute, has made an effort to investigate each viable product, develop business plans for several to facilitate development and marketing, and in some cases, assign an engineering student intern to building a working prototype. Each inventor discussed in this presentation has produced a unique device for free energy generation or highly efficient force production. Included in this paper is also a short summary for non-specialists explaining the physics of free energy generation along with a working definition. The main topics of discussion include: space power, inertial propulsion, kinetobaric force, magnetic motors, thermal fluctuations, over-unity hat pumps, ambient temperature superconductivity and nuclear battery

  18. The Chemical Weapons Convention -- Legal issues

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-08-01

    The Chemical Weapons Convention (CWC) offers a unique challenge to the US system of constitutional law. Its promise of eliminating what is the most purely genocidal type of weapon from the world`s arsenals as well as of destroying the facilities for producing these weapons, brings with it a set of novel legal issues. The reservations about the CWC expressed by US business people are rooted in concern about safeguarding confidential business information and protecting the constitutional right to privacy. The chief worry is that international verification inspectors will misuse their power to enter commercial property and that trade secrets or other private information will be compromised as a result. It has been charged that the Convention is probably unconstitutional. The author categorically disagrees with that view and is aware of no scholarly writing that supports it. The purpose of this presentation is to show that CWC verification activities can be implemented in the US consistently with the traditional constitutional regard for commercial and individual privacy. First, he very briefly reviews the types of verification inspections that the CWC permits, as well as some of its specific privacy protections. Second, he explains how the Fourth Amendment right to privacy works in the context of CWC verification inspections. Finally, he reviews how verification inspections can be integrated into these constitutional requirements in the SU through a federal implementing statute.

  19. Technological advancements revitalize conventional oil sector

    International Nuclear Information System (INIS)

    Thomson, L.

    2000-01-01

    Maturing reserves in the Western Canada Sedimentary Basin is resulting in a gradual shift of focus from huge new discoveries and wildcat gushers to developing new technologies for exploration and enhanced recovery techniques of production, keeping costs down and reducing environmental impacts, as a means of keeping conventional oil plays a viable force in the oil and gas industry. The value in refocusing efforts towards technology development is given added weight by a recent announcement by the Petroleum Communication Foundation, which stated that in addition to the oil sands and offshore oil and gas developments, one of the country's largest undeveloped oil resource is the 70 per cent of discovered crude oil in western Canadian pools that cannot be recovered by current conventional production techniques. Therefore, development of new technologies to exploit these currently unrecoverable resources is a matter of high priority. To remain competitive, the new techniques must also lower the cost of recovering oil from these sources, given that the cost of oil production in Canada is already higher than that in most other competing countries

  20. Accuracy of Digital vs. Conventional Implant Impressions

    Science.gov (United States)

    Lee, Sang J.; Betensky, Rebecca A.; Gianneschi, Grace E.; Gallucci, German O.

    2015-01-01

    The accuracy of digital impressions greatly influences the clinical viability in implant restorations. The aim of this study is to compare the accuracy of gypsum models acquired from the conventional implant impression to digitally milled models created from direct digitalization by three-dimensional analysis. Thirty gypsum and 30 digitally milled models impressed directly from a reference model were prepared. The models were scanned by a laboratory scanner and 30 STL datasets from each group were imported to an inspection software. The datasets were aligned to the reference dataset by a repeated best fit algorithm and 10 specified contact locations of interest were measured in mean volumetric deviations. The areas were pooled by cusps, fossae, interproximal contacts, horizontal and vertical axes of implant position and angulation. The pooled areas were statistically analysed by comparing each group to the reference model to investigate the mean volumetric deviations accounting for accuracy and standard deviations for precision. Milled models from digital impressions had comparable accuracy to gypsum models from conventional impressions. However, differences in fossae and vertical displacement of the implant position from the gypsum and digitally milled models compared to the reference model, exhibited statistical significance (p<0.001, p=0.020 respectively). PMID:24720423

  1. The EU Arbitration Convention : An evaluating assessment of the governance and functioning of the EU Arbitration Convention

    NARCIS (Netherlands)

    Pit, Harm Mark

    2017-01-01

    The EU Arbitration Convention An evaluating assessment of the governance and functioning of the EU Arbitration Convention Summary for non-experts The EU Arbitration Convention is a convention between EU Member States to eliminate double taxation arising from – for tax purposes – transfer pricing

  2. Immunological Effects of Conventional Chemotherapy and Targeted Anticancer Agents.

    Science.gov (United States)

    Galluzzi, Lorenzo; Buqué, Aitziber; Kepp, Oliver; Zitvogel, Laurence; Kroemer, Guido

    2015-12-14

    The tremendous clinical success of checkpoint blockers illustrates the potential of reestablishing latent immunosurveillance for cancer therapy. Although largely neglected in the clinical practice, accumulating evidence indicates that the efficacy of conventional and targeted anticancer agents does not only involve direct cytostatic/cytotoxic effects, but also relies on the (re)activation of tumor-targeting immune responses. Chemotherapy can promote such responses by increasing the immunogenicity of malignant cells, or by inhibiting immunosuppressive circuitries that are established by developing neoplasms. These immunological "side" effects of chemotherapy are desirable, and their in-depth comprehension will facilitate the design of novel combinatorial regimens with improved clinical efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Diagnosis of Dengue Infection Using Conventional and Biosensor Based Techniques

    Science.gov (United States)

    Parkash, Om; Hanim Shueb, Rafidah

    2015-01-01

    Dengue is an arthropod-borne viral disease caused by four antigenically different serotypes of dengue virus. This disease is considered as a major public health concern around the world. Currently, there is no licensed vaccine or antiviral drug available for the prevention and treatment of dengue disease. Moreover, clinical features of dengue are indistinguishable from other infectious diseases such as malaria, chikungunya, rickettsia and leptospira. Therefore, prompt and accurate laboratory diagnostic test is urgently required for disease confirmation and patient triage. The traditional diagnostic techniques for the dengue virus are viral detection in cell culture, serological testing, and RNA amplification using reverse transcriptase PCR. This paper discusses the conventional laboratory methods used for the diagnosis of dengue during the acute and convalescent phase and highlights the advantages and limitations of these routine laboratory tests. Subsequently, the biosensor based assays developed using various transducers for the detection of dengue are also reviewed. PMID:26492265

  4. Conventional Treatment Options for HABs Impacted Waters

    Science.gov (United States)

    This presentation discusses (1) the removal of cyanobacterial cells through coagulation, flocculation, sedimentation and filtration, (2) the control of cyanobacterial toxins by powdered activated carbon, (3) the control of cyanobacterial toxins by chlorine, UV, ozone, chlorine di...

  5. Analysis of primary cilia in directional cell migration in fibroblasts

    DEFF Research Database (Denmark)

    Christensen, Søren Tvorup; Veland, Iben; Schwab, Albrecht

    2013-01-01

    summarize selected methods in analyzing ciliary function in directional cell migration, including immunofluorescence microscopy, scratch assay, and chemotaxis assay by micropipette addition of PDGFRα ligands to cultures of fibroblasts. These methods should be useful not only in studying cell migration....... In particular, platelet-derived growth factor receptor alpha (PDGFRα) is compartmentalized to the primary cilium to activate signaling pathways that regulate reorganization of the cytoskeleton required for lamellipodium formation and directional migration in the presence of a specific ligand gradient. We...

  6. Targeting chemotherapy-resistant leukemia by combining DNT cellular therapy with conventional chemotherapy.

    Science.gov (United States)

    Chen, Branson; Lee, Jong Bok; Kang, Hyeonjeong; Minden, Mark D; Zhang, Li

    2018-04-24

    While conventional chemotherapy is effective at eliminating the bulk of leukemic cells, chemotherapy resistance in acute myeloid leukemia (AML) is a prevalent problem that hinders conventional therapies and contributes to disease relapse, and ultimately patient death. We have recently shown that allogeneic double negative T cells (DNTs) are able to target the majority of primary AML blasts in vitro and in patient-derived xenograft models. However, some primary AML blast samples are resistant to DNT cell therapy. Given the differences in the modes of action of DNTs and chemotherapy, we hypothesize that DNT therapy can be used in combination with conventional chemotherapy to further improve their anti-leukemic effects and to target chemotherapy-resistant disease. Drug titration assays and flow-based cytotoxicity assays using ex vivo expanded allogeneic DNTs were performed on multiple AML cell lines to identify therapy-resistance. Primary AML samples were also tested to validate our in vitro findings. Further, a xenograft model was employed to demonstrate the feasibility of combining conventional chemotherapy and adoptive DNT therapy to target therapy-resistant AML. Lastly, blocking assays with neutralizing antibodies were employed to determine the mechanism by which chemotherapy increases the susceptibility of AML to DNT-mediated cytotoxicity. Here, we demonstrate that KG1a, a stem-like AML cell line that is resistant to DNTs and chemotherapy, and chemotherapy-resistant primary AML samples both became more susceptible to DNT-mediated cytotoxicity in vitro following pre-treatment with daunorubicin. Moreover, chemotherapy treatment followed by adoptive DNT cell therapy significantly decreased bone marrow engraftment of KG1a in a xenograft model. Mechanistically, daunorubicin increased the expression of NKG2D and DNAM-1 ligands on KG1a; blocking of these pathways attenuated DNT-mediated cytotoxicity. Our results demonstrate the feasibility and benefit of using DNTs as

  7. Reframing less conventional speech to disrupt conventions of "compulsory fluency": A conversation analysis approach

    Directory of Open Access Journals (Sweden)

    Camille Duque

    2018-05-01

    Full Text Available Our purpose is to illuminate compliances with, and resistances to, what we are calling "compulsory fluency" which we define as conventions for what constitutes competent speech. We achieve our purpose through a study of day-to-day communication between a woman with less conventional speech and her support providing family members and friends. Drawing from McRuer's (2006 compulsory ablebodiedness and Kafer's (2013 compulsory able-mindedness, we use "compulsory fluency" to refer to a form of articulation that is standardized and idealized and imposed on all speakers including those whose speech is less conventional. We see compulsory fluency as central to North American conceptions of personhood which are tied to individual ability to speak for one's self (Brueggemann, 2005. In this paper, we trace some North American principles for linguistic competence to outline widely held ideals of receptive and expressive language use, namely, conventions for how language should be understood and expressed. Using Critical Disability Studies (Goodley, 2013; McRuer, 2006 together with a feminist framework of relational autonomy (Nedelsky, 1989, our goal is to focus on experiences of people with less conventional speech and draw attention to power in communication as it flows in idiosyncratic and intersubjective fashion (Mackenzie & Stoljar, 2000; Westlund, 2009. In other words, we use a critical disability and feminist framing to call attention to less conventional forms of communication competence and, in this process, we challenge assumptions about what constitutes competent speech. As part of a larger qualitative study, we conduct a conversation analysis informed by Rapley and Antaki (1996 to examine day-to-day verbal, vocal and non-verbal communications of a young woman who self identifies as "having autism" - pseudonym Addison - in interaction with her support-providing family members and friends. We illustrate a multitude of Addison's compliances with

  8. Supersymmetry Parameter Analysis : SPA Convention and Project

    CERN Document Server

    Aguilar-Saavedra, J A; Allanach, Benjamin C; Arnowitt, R; Baer, H A; Bagger, J A; Balázs, C; Barger, V; Barnett, M; Bartl, Alfred; Battaglia, M; Bechtle, P; Belyaev, A; Berger, E L; Blair, G; Boos, E; Bélanger, G; Carena, M S; Choi, S Y; Deppisch, F; Desch, Klaus; Djouadi, A; Dutta, B; Dutta, S; Díaz, M A; Eberl, H; Ellis, Jonathan Richard; Erler, Jens; Fraas, H; Freitas, A; Fritzsche, T; Godbole, Rohini M; Gounaris, George J; Guasch, J; Gunion, J F; Haba, N; Haber, Howard E; Hagiwara, K; Han, L; Han, T; He, H J; Heinemeyer, S; Hesselbach, S; Hidaka, K; Hinchliffe, Ian; Hirsch, M; Hohenwarter-Sodek, K; Hollik, W; Hou, W S; Hurth, Tobias; Jack, I; Jiang, Y; Jones, D R T; Kalinowski, Jan; Kamon, T; Kane, G; Kang, S K; Kernreiter, T; Kilian, W; Kim, C S; King, S F; Kittel, O; Klasen, M; Kneur, J L; Kovarik, K; Kraml, Sabine; Krämer, M; Lafaye, R; Langacker, P; Logan, H E; Ma, W G; Majerotto, Walter; Martyn, H U; Matchev, K; Miller, D J; Mondragon, M; Moortgat-Pick, G; Moretti, S; Mori, T; Moultaka, G; Muanza, S; Mukhopadhyaya, B; Mühlleitner, M M; Nauenberg, U; Nojiri, M M; Nomura, D; Nowak, H; Okada, N; Olive, Keith A; Oller, W; Peskin, M; Plehn, T; Polesello, G; Porod, Werner; Quevedo, Fernando; Rainwater, D L; Reuter, J; Richardson, P; Rolbiecki, K; de Roeck, A; Weber, Ch.

    2006-01-01

    High-precision analyses of supersymmetry parameters aim at reconstructing the fundamental supersymmetric theory and its breaking mechanism. A well defined theoretical framework is needed when higher-order corrections are included. We propose such a scheme, Supersymmetry Parameter Analysis SPA, based on a consistent set of conventions and input parameters. A repository for computer programs is provided which connect parameters in different schemes and relate the Lagrangian parameters to physical observables at LHC and high energy e+e- linear collider experiments, i.e., masses, mixings, decay widths and production cross sections for supersymmetric particles. In addition, programs for calculating high-precision low energy observables, the density of cold dark matter (CDM) in the universe as well as the cross sections for CDM search experiments are included. The SPA scheme still requires extended efforts on both the theoretical and experimental side before data can be evaluated in the future at the level of the d...

  9. For a convention for nuclear weapon elimination

    International Nuclear Information System (INIS)

    2008-03-01

    This document contains two texts linked with the project of an international convention for the elimination of nuclear weapons (the text of this project has been sent to the UN General Secretary and is part of an international campaign to abolish nuclear weapons, ICAN). These two texts are contributions presented in London at the Global Summit for a Nuclear Weapon-free World. The first one calls into question the deterrence principle and the idea of a nuclear weapon-based security. It calls for different forms of action to promote a nuclear weapon-free world. The second text stresses the role and the responsibility of states with nuclear weapons in nuclear disarmament and in the reinforcement of the nuclear non proliferation treaty (NPT)

  10. Muzzle shunt augmentation of conventional railguns

    International Nuclear Information System (INIS)

    Parker, J.V.

    1991-01-01

    This paper reports on augmentation which is a technique for reducing the armature current and hence the armature power dissipation in a plasma armature railgun. In spite of the advantages, no large augmented railguns have been built, primarily due to the mechanical and electrical complexity introduced by the extra conductors required. it is possible to achieve some of the benefits of augmentation in a conventional railgun by diverting a fraction φ of the input current through a shunt path at the muzzle of the railgun. In particular, the relation between force and armature current is the same as that obtained in an n-turn, series-connected augmented railgun with n = 1/(1 - φ). The price of this simplification is a reduction in electrical efficiency and some additional complexity in the external electrical system

  11. Conventional radiology: fixed installations in medical environment

    International Nuclear Information System (INIS)

    2010-01-01

    This document presents the different procedures, the different types of specific hazards, the analysis of risks, their assessment and the preventive methods with regard to radioprotection in the case of fixed conventional radiology equipment in medical environment. It indicates and describes the concerned personnel, the course of procedures, the hazards, the identification of the risk associated with ionizing radiation, the risk assessment and the determination of exposure levels (definition of regulated areas, personnel categories), the strategy aimed at controlling the risk (risk reduction, technical measures concerning the installation or the personnel, teaching and information, prevention, incident), the different measures of medical monitoring, the assessment of risk control, and other risks. An appendix proposes an example of workstation assessment

  12. Technologies for the future : conventional recovery enhancement

    Energy Technology Data Exchange (ETDEWEB)

    Isaacs, E. [Alberta Energy Research Inst., Edmonton, AB (Canada)

    2005-07-01

    This conference presentation examined Alberta's oil production and water use; global finding and development costs across continents; and current trends for conventional oil. The presentation examined opportunities for testing new technologies for enhanced oil recovery (EOR) and provided several tables of data on EOR production in the United States. The evolution of United States EOR production, and the number of EOR projects in Canada were also addressed. The presentation also discussed where EOR goes from here as well as the different EOR mechanisms to alter phase behaviour and to alter relative flow. It also discussed chemical methods and major challenges for chemical EOR and examined EOR technologies needing a major push in the Western Canada Sedimentary Basin. Lessons learned from the Joffre site regarding carbon dioxide miscible flood were revealed along with how coal gasification produces substitute natural gas and carbon dioxide for EOR. Suggestions for research and technology and enhanced water management were included. tabs., figs.

  13. Limitation and reduction of conventional arms

    International Nuclear Information System (INIS)

    Chervov, N.

    1989-01-01

    We are living at a time when war between East and West---not only nuclear but also conventional war--- is totally senseless. It cannot solve any problem---political, economic, or other. From the military point of view, war between East and West is madness. Calculations show that after 20 days of conventional warfare Europe could become another Hiroshima. Therefore we must work out forms of long-term cooperation. Before it is too late, we must radically reduce our military potentials and rethink our military doctrines. The reduction by 500,000 men is for the USSR no simple solution. But that step may become a model for further actions by East and West. The West's proposal that armed forces should be reduced to the level of 95 percent of NATO's armed forces is not a solution. Both sides---the Warsaw Treaty Organization and NATO---must be deprived of the capacity to launch a sudden attack; they must be deprived of their attack potential. The USSR initiative shows the true way toward that goal. What is happening in connection with our decision is not always correctly interpreted in the West, and so I should like to draw attention to some distinctive features of the Soviet armed forces reductions and, first of all, their scale (equivalent to the Bundeswehr of the Federal Republic of Germany). With respect to Europe, Soviet troops are to be reduced in the German Democratic Republic, Czechoslovakia, Hungary, Poland, and the European part of the Soviet Union---a total of 240,000 men, 10,000 tanks, 9,500 artillery systems, and 800 combat aircraft

  14. Innovation and the Development Convention in Brazil

    Directory of Open Access Journals (Sweden)

    Fabio Stefano Erber

    2004-01-01

    means to achieving fast and stable economic growth. Nonetheless, the degree of endogenous technical innovation in Brazil remains very low. This paper explores the conjecture that the latter result is a consequence of the hegemonic view of development. The first section presents some quantitative and qualitative data to support our assertion about the innovativeness of the Brazilian economy. The second section argues that the “view of development” may be profitably treated as a “convention”, a set of beliefs shared by decision-makers and used to identify the main issues which a development strategy has to tackle and the appropriate means to address such issues. A development convention contains also a “negative” agenda — issues and solutions which should be avoided. The same section then analyses the development convention which was hegemonic from the nineties to the date of the paper (2002 and the implications of its positive and negative agendas for technological development, assuming such convention had worked as its supporters supposed it would. It argues that the theoretical results are consistent with the facts described in the first section. The last section comments the actual working of the development convention, arguing that it stressed the main technological features present in the “pure form” of the convention and concludes with a brief discussion of the role of innovation in a new development convention which seemed to be arising at that time.

  15. A simple cryo-holder facilitates specimen observation under a conventional scanning electron microscope.

    Science.gov (United States)

    Tang, Chih-Yuan; Huang, Rong-Nan; Kuo-Huang, Ling-Long; Kuo, Tai-Chih; Yang, Ya-Yun; Lin, Ching-Yeh; Jane, Wann-Neng; Chen, Shiang-Jiuun

    2012-02-01

    A pre-cryogenic holder (cryo-holder) facilitating cryo-specimen observation under a conventional scanning electron microscope (SEM) is described. This cryo-holder includes a specimen-holding unit (the stub) and a cryogenic energy-storing unit (a composite of three cylinders assembled with a screw). After cooling, the cryo-holder can continue supplying cryogenic energy to extend the observation time for the specimen in a conventional SEM. Moreover, the cryogenic energy-storing unit could retain appropriate liquid nitrogen that can evaporate to prevent frost deposition on the surface of the specimen. This device is proved feasible for various tissues and cells, and can be applied to the fields of both biology and material science. We have employed this novel cryo-holder for observation of yeast cells, trichome, and epidermal cells in the leaf of Arabidopsis thaliana, compound eyes of insects, red blood cells, filiform papillae on the surface of rat tongue, agar medium, water molecules, penicillium, etc. All results suggested that the newly designed cryo-holder is applicable for cryo-specimen observation under a conventional SEM without cooling system. Most importantly, the design of this cryo-holder is simple and easy to operate and could adapt a conventional SEM to a plain type cryo-SEM affordable for most laboratories. Copyright © 2011 Wiley Periodicals, Inc.

  16. Effects of stimulated repopulation on oral mucositis during conventional radiotherapy

    International Nuclear Information System (INIS)

    Doerr, W.; Jacubek, A.; Kummermehr, J.; Herrmann, Th.; Doelling-Jochem, I.; Eckelt, U.

    1995-01-01

    The effect of local conditioning of human oral mucosa by silver nitrate solution (3%) on epithelial proliferation rates was tested in 11 healthy volunteers by in vitro labelling of biopsies with tritiated thymidine. Compared to control biopsies from 13 volunteers, stimulation over 3 days, 3 times per day, yielded a significant (p = 0.006) increase in the epithelial labelling index (LI) from 4.75 ± 0.32% to 6.85 ± 0.65%, i.e., by 44%. The increase in the absolute number of labelled cells per mm epithelial length was dependent on the overall cell density at the various intraoral sites and varied between 45% in the maxillary vestibule and 91% at the floor of the mouth. In an analysis of variance, stimulation turned out to be the most important source causing the effect (p = 0.011 for LI and 0.015 for labelled cells per mm). In a radiotherapy trial with conventional postoperative treatment with 5 x 2 Gy/week to a total dose of 60 Gy in 6 weeks, the left buccal mucosa in 10 patients with squamous cell carcinomas of the head and neck was conditioned (3% silver nitrate, 3 times per day, 5 days before and the first 2 days of radiotherapy) while the contralateral mucosa, receiving an identical dose, served as individual control. Mucositis scores according to the EORTC/RTOG or the Dische system showed that the time course and severity of the mucosal response was almost identical in both cheeks, which is in clear contrast to a previous clinical study (Maciejewski et al. Radiother. Oncol. 22, 7-11, 1991). Differences in radiation dose intensity, i.e., weekly dose, in these studies are discussed as a tentative explanation for the different clinical findings

  17. Shortening of culture time in conventional cytogenetic dosimetry

    International Nuclear Information System (INIS)

    Lamadrid, Ana I.; Gonzalez, Jorge E.; Romero, Ivonne; Garcia, Omar; Roy, Laurence

    2008-01-01

    Conventional cytogenetic dosimetry based on chromosome aberration in metaphases is a 'gold standard' of bio-dosimetry techniques for radiation dose assessment. This method is laborious and time consuming, the culturing process requires about 48 hours to obtain a satisfactory number of lymphocytes in mitosis. The current approach to reduce the dose estimation time by cytogenetic dosimetry is the preliminary estimation of dose counting only 50 metaphases. Another possibility is to reduce the culture time. The possibility of reduce the culture time under 48 hours adding Calyculin A has been suggested recently. In the present study we tested shorter times using Calyculin A and considering the G2/M-PCC index as culture quality indicator. Peripheral blood from healthy individuals was irradiated and then maintained at 37 C degrees for 2 hours allowing to act the cellular reparation mechanisms, lymphocytes were culture in RPMI 1640 supplemented with foetal calf serum and phytohemagglutinin. Colcemid was added 24 hours after cultures started and Calyculin A was added for the last hour. The cells were collected by centrifugation between 30 to 48 hours. The cells were treated with a hypotonic solution and the fixed cells