WorldWideScience

Sample records for immune response inducing

  1. Radiation-induced augmentation of the immune response

    International Nuclear Information System (INIS)

    Anderson, R.E.; Lefkovits, I.; Troup, G.M.

    1980-01-01

    Radiation-induced augmentation of the immune response has been shown to occur both in vivo and in vitro. Evidence is presented to implicate injury to an extremely radiosensitive T cell in the expression of this phenomenon. Experiments are outlined which could be employed to support or reflect this hypothesis

  2. A Drosophila immune response against Ras-induced overgrowth

    Directory of Open Access Journals (Sweden)

    Thomas Hauling

    2014-03-01

    Full Text Available Our goal is to characterize the innate immune response against the early stage of tumor development. For this, animal models where genetic changes in specific cells and tissues can be performed in a controlled way have become increasingly important, including the fruitfly Drosophila melanogaster. Many tumor mutants in Drosophila affect the germline and, as a consequence, also the immune system itself, making it difficult to ascribe their phenotype to a specific tissue. Only during the past decade, mutations have been induced systematically in somatic cells to study the control of tumorous growth by neighboring cells and by immune cells. Here we show that upon ectopic expression of a dominant-active form of the Ras oncogene (RasV12, both imaginal discs and salivary glands are affected. Particularly, the glands increase in size, express metalloproteinases and display apoptotic markers. This leads to a strong cellular response, which has many hallmarks of the granuloma-like encapsulation reaction, usually mounted by the insect against larger foreign objects. RNA sequencing of the fat body reveals a characteristic humoral immune response. In addition we also identify genes that are specifically induced upon expression of RasV12. As a proof-of-principle, we show that one of the induced genes (santa-maria, which encodes a scavenger receptor, modulates damage to the salivary glands. The list of genes we have identified provides a rich source for further functional characterization. Our hope is that this will lead to a better understanding of the earliest stage of innate immune responses against tumors with implications for mammalian immunity.

  3. Immune markers and correlates of protection for vaccine induced immune responses

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Pedersen, Lasse Eggers; Jungersen, Gregers

    2012-01-01

    of an appropriate humoral response currently remain the best validated correlates of protective immunity after vaccination. Despite advancements in the field of immunology over the past few decades currently there are, however, no sufficiently validated immune correlates of vaccine induced protection against......-specific production of interferon-gamma (IFN-γ) has been promoted as a quantitative marker of protective cell-mediated immune responses over the past couple of decades. More recently, however, evidence from several infections has pointed towards the quality of the immune response, measured through increased levels...... of antigen-specific polyfunctional T cells capable of producing a triad of relevant cytokines, as a better correlate of sustained protective immunity against this type of infections. Also the possibilities to measure antigen-specific cytotoxic T cells (CTL) during infection or in response to vaccination...

  4. Persistence of the immune response induced by BCG vaccination

    Directory of Open Access Journals (Sweden)

    Blitz Rose

    2008-01-01

    Full Text Available Abstract Background Although BCG vaccination is recommended in most countries of the world, little is known of the persistence of BCG-induced immune responses. As novel TB vaccines may be given to boost the immunity induced by neonatal BCG vaccination, evidence concerning the persistence of the BCG vaccine-induced response would help inform decisions about when such boosting would be most effective. Methods A randomised control study of UK adolescents was carried out to investigate persistence of BCG immune responses. Adolescents were tested for interferon-gamma (IFN-γ response to Mycobacterium tuberculosis purified protein derivative (M.tb PPD in a whole blood assay before, 3 months, 12 months (n = 148 and 3 years (n = 19 after receiving teenage BCG vaccination or 14 years after receiving infant BCG vaccination (n = 16. Results A gradual reduction in magnitude of response was evident from 3 months to 1 year and from 1 year to 3 years following teenage vaccination, but responses 3 years after vaccination were still on average 6 times higher than before vaccination among vaccinees. Some individuals (11/86; 13% failed to make a detectable antigen-specific response three months after vaccination, or lost the response after 1 (11/86; 13% or 3 (3/19; 16% years. IFN-γ response to Ag85 was measured in a subgroup of adolescents and appeared to be better maintained with no decline from 3 to 12 months. A smaller group of adolescents were tested 14 years after receiving infant BCG vaccination and 13/16 (81% made a detectable IFN-γ response to M.tb PPD 14 years after infant vaccination as compared to 6/16 (38% matched unvaccinated controls (p = 0.012; teenagers vaccinated in infancy were 19 times more likely to make an IFN-γ response of > 500 pg/ml than unvaccinated teenagers. Conclusion BCG vaccination in infancy and adolescence induces immunological memory to mycobacterial antigens that is still present and measurable for at least 14 years in the

  5. Maternal immunity enhances Mycoplasma hyopneumoniae vaccination induced cell-mediated immune responses in piglets.

    Science.gov (United States)

    Bandrick, Meggan; Theis, Kara; Molitor, Thomas W

    2014-06-05

    Passively acquired maternal derived immunity (MDI) is a double-edged sword. Maternal derived antibody-mediated immunity (AMI) and cell-mediated immunity (CMI) are critical immediate defenses for the neonate; however, MDI may interfere with the induction of active immunity in the neonate, i.e. passive interference. The effect of antigen-specific MDI on vaccine-induced AMI and CMI responses to Mycoplasma hyopneumoniae (M. hyopneumoniae) was assessed in neonatal piglets. To determine whether CMI and AMI responses could be induced in piglets with MDI, piglets with high and low levels of maternal M. hyopneumoniae-specific immunity were vaccinated against M. hyopneumoniae at 7 d of age. Piglet M. hyopneumoniae-specific antibody, lymphoproliferation, and delayed type hypersensitivity (DTH) responses were measured 7 d and 14 d post vaccination. Piglets with M. hyopneumoniae-specific MDI failed to show vaccine-induced AMI responses; there was no rise in M. hyopneumoniae antibody levels following vaccination of piglets in the presence of M. hyopneumoniae-specific MDI. However, piglets with M. hyopneumoniae-specific MDI had primary (antigen-specific lymphoproliferation) and secondary (DTH) M. hyopneumoniae-specific CMI responses following vaccination. In this study neonatal M. hyopneumoniae-specific CMI was not subject to passive interference by MDI. Further, it appears that both maternal derived and endogenous CMI contribute to M. hyopneumoniae-specific CMI responses in piglets vaccinated in the face of MDI.

  6. Memory B-Cell and Antibody Responses Induced by Plasmodium falciparum Sporozoite Immunization

    NARCIS (Netherlands)

    Nahrendorf, W.; Scholzen, A.; Bijker, E.M.; Teirlinck, A.C.; Bastiaens, G.J.H.; Schats, R.; Hermsen, C.C.; Visser, L.G.; Langhorne, J.; Sauerwein, R.W.

    2014-01-01

    BACKGROUND: Immunization of healthy volunteers during receipt of chemoprophylaxis with Plasmodium falciparum sporozoites (CPS-immunization) induces sterile protection from malaria. Antibody responses have long been known to contribute to naturally acquired immunity against malaria, but their

  7. Different protein of Echinococcus granulosus stimulates dendritic induced immune response.

    Science.gov (United States)

    Wang, Yana; Wang, Qiang; Lv, Shiyu; Zhang, Shengxiang

    2015-06-01

    Cystic echinococcosis is a chronic infectious disease that results from a host/parasite interaction. Vaccination with ferritin derived from Echinococcus granulosus is a potential preventative treatment. To understand whether ferritin is capable of inducing a host immune response, we investigated the response of dendritic cells (DCs) to both recombinant ferritin protein and the hydatid fluid (HF) of E. granulosus. We evaluated the immunomodulatory potential of these antigens by performing, immunocytochemistry, electron microscopy and in vivo imaging of monocyte-derived murine DCs. During antigen stimulation of DCs, ferritin cause DCs maturation and induced higher levels of surface marker expression and activated T-cell proliferation and migration. On contrary, HF failed to induce surface marker expression and to stimulate T-cell proliferation. In response to HF, DCs produced interleukin-6 (IL-6), but no IL-12 and IL-10. DCs stimulated with ferritin produced high levels of cytokines. Overall, HF appears to induce host immunosuppression in order to ensure parasite survival via inhibits DC maturation and promotes Th2-dependent secretion of cytokines. Although ferritin also promoted DC maturation and cytokine release, it also activates CD4+T-cell proliferation, but regard of the mechanism of the Eg.ferritin induce host to eradicate E. granulosus were not clear.

  8. Skin immunization by microneedle patch overcomes statin-induced suppression of immune responses to influenza vaccine.

    Science.gov (United States)

    Vassilieva, Elena V; Wang, Shelly; Li, Song; Prausnitz, Mark R; Compans, Richard W

    2017-12-19

    Recent studies indicated that in elderly individuals, statin therapy is associated with a reduced response to influenza vaccination. The present study was designed to determine effects on the immune response to influenza vaccination induced by statin administration in a mouse model, and investigate potential approaches to improve the outcome of vaccination on the background of statin therapy. We fed middle aged BALB/c mice a high fat "western" diet (WD) alone or supplemented with atorvastatin (AT) for 14 weeks, and control mice were fed with the regular rodent diet. Mice were immunized with a single dose of subunit A/Brisbane/59/07 (H1N1) vaccine, either systemically or with dissolving microneedle patches (MNPs). We observed that a greater age-dependent decline in the hemagglutinin inhibition titers occurred in systemically-immunized mice than in MNP- immunized mice. AT dampened the antibody response in the animals vaccinated by either route of vaccine delivery. However, the MNP-vaccinated AT-treated animals had ~20 times higher total antibody levels to the influenza vaccine than the systemically vaccinated group one month postvaccination. We propose that microneedle vaccination against influenza provides an approach to ameliorate the immunosuppressive effect of statin therapy observed with systemic immunization.

  9. Immunization with avian metapneumovirus harboring chicken Fc induces higher immune responses.

    Science.gov (United States)

    Paudel, Sarita; Easwaran, Maheswaran; Jang, Hyun; Jung, Ho-Kyoung; Kim, Joo-Hun; Shin, Hyun-Jin

    2016-07-15

    In this study, we evaluated the immune responses of avian metapneumovirus harboring chicken Fc molecule. Stable Vero cells expressing chicken Fc chimera on its surface (Vero-cFc) were established, and we confirmed that aMPV grown in Vero-cFc incorporated host derived chimera Fc into the aMPV virions. Immunization of chicken with aMPV-cFc induced higher level of antibodies and inflammatory cytokines; (Interferon (IFN)-γ and Interleukin (IL)-1β) compared to those of aMPV. The increased levels of antibodies and inflammatory cytokines in chicken immunized with aMPV-cFc were statistically significantly (p<0.05) to that of aMPV and control. The aMPV-cFc group also generated the highest neutralizing antibody response. After challenges, chickens immunized with aMPV-cFc showed much less pathological signs in nasal turbinates and trachea so that we could confirm aMPV-cFc induced higher protection than that of aMPV. The greater ability of aMPV harboring chicken Fc to that of aMPV presented it as a possible vaccine candidate. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Polar lipids of Burkholderia pseudomallei induce different host immune responses.

    Directory of Open Access Journals (Sweden)

    Mercedes Gonzalez-Juarrero

    Full Text Available Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4(+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4(+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster.

  11. Polar Lipids of Burkholderia pseudomallei Induce Different Host Immune Responses

    Science.gov (United States)

    Gonzalez-Juarrero, Mercedes; Mima, Naoko; Trunck, Lily A.; Schweizer, Herbert P.; Bowen, Richard A.; Dascher, Kyle; Mwangi, Waithaka; Eckstein, Torsten M.

    2013-01-01

    Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs) and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor) molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster. PMID:24260378

  12. Metabolic and adaptive immune responses induced in mice infected ...

    African Journals Online (AJOL)

    This study investigated metabolic and immuno-inflammatory responses of mice infected with tissue-dwelling larvae of Trichinella zimbabwensis and explored the relationship between infection, metabolic parameters and Th1/Th17 immune responses. Sixty (60) female BALB/c mice aged between 6 to 8 weeks old were ...

  13. Sulfasalazine Attenuates Staphylococcal Enterotoxin B-Induced Immune Responses

    Directory of Open Access Journals (Sweden)

    Teresa Krakauer

    2015-02-01

    Full Text Available Staphylococcal enterotoxin B (SEB and related exotoxins are important virulence factors produced by Staphylococcus aureus as they cause human diseases such as food poisoning and toxic shock. These toxins bind directly to cells of the immune system resulting in hyperactivation of both T lymphocytes and monocytes/macrophages. The excessive release of proinflammatory cytokines from these cells mediates the toxic effects of SEB. This study examined the inhibitory activities of an anti-inflammatory drug, sulfasalazine, on SEB-stimulated human peripheral blood mononuclear cells (PBMC. Sulfasalazine dose-dependently inhibited tumor necrosis factor α, interleukin 1 (IL-1 β, IL-2, IL-6, interferon γ (IFNγ, and various chemotactic cytokines from SEB-stimulated human PBMC. Sulfasalazine also potently blocked SEB-induced T cell proliferation and NFκB activation. These results suggest that sulfasalazine might be useful in mitigating the toxic effects of SEB by blocking SEB-induced host inflammatory cascade and signaling pathways.

  14. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    Science.gov (United States)

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (Pvitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  15. Immune response to uv-induced tumors: transplantation immunity and lymphocyte populations exhibiting anti-tumor activity

    International Nuclear Information System (INIS)

    Streeter, P.R.

    1985-01-01

    Ultraviolet light-induced murine skin tumors were analyzed for their ability to induce tumor-specific and cross-protective transplantation immunity in immunocompetent syngeneic mice. These studies revealed that progressor UV-tumors, like regressor UV-tumors, possess tumor-specific transplantation antigens. Cross-protective transplantation immunity to UV-tumors, however, was associated with sensitization to the serum used to culture the tumor lines rather than to cross-reactive or common determinants on UV-tumors. An analysis of the cytolytic activity of lymphocytes from the spleens of mice immunized with either regressor or progressor UV-tumors revealed a striking difference between the two immune splenocyte populations. From regressor tumor-immune animals, cytolytic T (Tc) lymphocytes with specificity for the immunizing tumor were found. However, the analysis of splenic lymphocytes from progressor tumor immune animals revealed no such effector cells. To more effectively examine those lymphocytes exhibiting cytolytic activity in vitro, T lymphocyte cloning technology was used as a means of isolating homogeneous lymphocyte populations with the effector activities described above. The mechanisms where NK cells and other nonspecific effector cells could be induced in tumor-immune animals are discussed in the context of class II restricted immune responses

  16. Immunizations with hepatitis B viral antigens and a TLR7/8 agonist adjuvant induce antigen-specific immune responses in HBV-transgenic mice

    Directory of Open Access Journals (Sweden)

    Ying Wang

    2014-12-01

    Conclusions: Immunization with CL097-conjugated HBV-Ag reversed immune tolerance in HBV-Tg mice and induced antigen-specific immune responses. TLR7/8 agonists appear to be potent adjuvants for the induction of antigen-specific Th1 responses in an immune tolerant state.

  17. [The humoral immune response in mice induced by recombinant Lactococcus lactis expressing HIV-1 gag].

    Science.gov (United States)

    Zhao, Xiaofei; Zhang, Cairong; Liu, Xiaojuan; Ma, Zhenghai

    2014-11-01

    To analyze the humoral immune response induced by recombinant Lactococcus lactis expressing HIV-1 gag in mice immunized orally, intranasally, subcutaneously or in the combined way of above three. Fifty BALB/c mice were randomly divided into 5 groups, 10 mice per group. The mice were immunized consecutively three times at two week intervals with 10(9) CFU of recombinant Lactococcus lactis expressing gag through oral, intranasal, subcutaneous administration or the mix of them. The mice that were immunized orally with Lactococcus lactis containing PMG36e served as a control group. The sera of mice were collected before primary immunization and 2 weeks after each immunization to detect the gag specific IgG by ELISA. Compared with the control group, the higher titer of serum gag specific IgG was detected in the four groups immunized with recombinant Lactococcus lactis expressing gag, and it was the highest in the mixed immunization group (PLactococcus lactis expressing gag can induce humoral immune response in mice by oral, intranasal, subcutaneous injection or the mix of them, and the mixed immunization can enhance the immune effects of Lactococcus lactis vector vaccine.

  18. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response

    Directory of Open Access Journals (Sweden)

    Hong Zhong

    2018-01-01

    Full Text Available In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  19. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.

    Science.gov (United States)

    Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  20. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    International Nuclear Information System (INIS)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide; Nakagome, Kazuyuki; Harada, Hiroaki; Kawahata, Kimito; Tanaka, Ryoichi; Yamamoto, Kazuhiko; Dohi, Makoto

    2014-01-01

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4 + T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes, its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4 + T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects

  1. Perturbation of gut bacteria induces a coordinated cellular immune response in the purple sea urchin larva

    Science.gov (United States)

    CH Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P

    2016-01-01

    The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates. PMID:27192936

  2. Beryllium-induced immune response in C3H mice

    Energy Technology Data Exchange (ETDEWEB)

    Benson, J.M.; Bice, D.E.; Nikula, K.J. [and others

    1995-12-01

    Studies conducted at ITRI over the past several years have investigated whether Beagle dogs, monkeys, and mice are suitable models for human chronic beryllium-induced lung disease (CBD). Recent studies have focused on the histopathological and immunopathological changes occurring in A/J and C3H/HeJ mice acutely exposed by inhalation to Be metal. Lung lesions in both strains of mice included focal lymphocyte aggregates comprised primarily of B lymphocytes and lesser amounts of T-helper lymphocytes and microgranulomas consisting chiefly of macrophages and T-helper lymphocytes. The distribution of proliferating cells within the microgranulomas was similar to the distribution of T-helper cells. These results strongly suggested that A/J and C3H/HeJ mice responded to inhaled Be metal in a fashion similar to humans in terms of pulmonary lesions and the apparent in situ proliferation of T-helper cells. Results of these studies confirm lymphocyte involvement in the pulmonary response to inhaled Be metal.

  3. Experimentally induced spermatophore production and immune responses reveal a trade-off in crickets

    OpenAIRE

    Angela M. Kerr; Susan N. Gershman; Scott K. Sakaluk

    2010-01-01

    The energetic demands of the immune system and reproduction are often high and can lead to trade-offs between these 2 life-history traits. In decorated crickets, Gryllodes sigillatus, much of a male's reproductive effort is devoted to calling, and to the synthesis of a spermatophylax, a large, gelatinous, non--sperm-containing mass forming part of the spermatophore and consumed by the female after mating. We employed a reciprocal design in which we experimentally induced an immune response in...

  4. Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4

    Directory of Open Access Journals (Sweden)

    Chih-Yun Lai

    2017-08-01

    Full Text Available Ebola virus (EBOV, a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD is currently available, Ebola virus glycoprotein (GP is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs. Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4

  5. Serum and mucosal immune responses to an inactivated influenza virus vaccine induced by epidermal powder immunization.

    Science.gov (United States)

    Chen, D; Periwal, S B; Larrivee, K; Zuleger, C; Erickson, C A; Endres, R L; Payne, L G

    2001-09-01

    Both circulating and mucosal antibodies are considered important for protection against infection by influenza virus in humans and animals. However, current inactivated vaccines administered by intramuscular injection using a syringe and needle elicit primarily circulating antibodies. In this study, we report that epidermal powder immunization (EPI) via a unique powder delivery system elicits both serum and mucosal antibodies to an inactivated influenza virus vaccine. Serum antibody responses to influenza vaccine following EPI were enhanced by codelivery of cholera toxin (CT), a synthetic oligodeoxynucleotide containing immunostimulatory CpG motifs (CpG DNA), or the combination of these two adjuvants. In addition, secretory immunoglobulin A (sIgA) antibodies were detected in the saliva and mucosal lavages of the small intestine, trachea, and vaginal tract, although the titers were much lower than the IgG titers. The local origin of the sIgA antibodies was further shown by measuring antibodies released from cultured tracheal and small intestinal fragments and by detecting antigen-specific IgA-secreting cells in the lamina propria using ELISPOT assays. EPI with a single dose of influenza vaccine containing CT or CT and CpG DNA conferred complete protection against lethal challenges with an influenza virus isolated 30 years ago, whereas a prime and boost immunizations were required for protection in the absence of an adjuvant. The ability to elicit augmented circulating antibody and mucosal antibody responses makes EPI a promising alternative to needle injection for administering vaccines against influenza and other diseases.

  6. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  7. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    Energy Technology Data Exchange (ETDEWEB)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide; Nakagome, Kazuyuki; Harada, Hiroaki; Kawahata, Kimito; Tanaka, Ryoichi; Yamamoto, Kazuhiko [Department of Allergy and Rheumatology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Dohi, Makoto, E-mail: mdohi-tky@umin.ac.jp [Department of Allergy and Rheumatology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Institute of Respiratory Immunology, Shibuya Clinic for Respiratory Diseases and Allergology, Tokyo (Japan)

    2014-01-03

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes, its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.

  8. Intranasal immunization with protective antigen of Bacillus anthracis induces a long-term immunological memory response.

    Science.gov (United States)

    Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun

    2015-10-01

    Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Polysaccharides isolated from Açaí fruit induce innate immune responses.

    Directory of Open Access Journals (Sweden)

    Jeff Holderness

    2011-02-01

    Full Text Available The Açaí (Acai fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease.

  10. Tetranychus urticae mites do not mount an induced immune response against bacteria.

    Science.gov (United States)

    Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio

    2017-06-14

    The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.

  11. Immune responses against SARS-coronavirus nucleocapsid protein induced by DNA vaccine

    International Nuclear Information System (INIS)

    Zhao Ping; Cao Jie; Zhao Lanjuan; Qin Zhaolin; Ke Jinshan; Pan Wei; Ren Hao; Yu Jianguo; Qi Zhongtian

    2005-01-01

    The nucleocapsid (N) protein of SARS-coronavirus (SARS-CoV) is the key protein for the formation of the helical nucleocapsid during virion assembly. This protein is believed to be more conserved than other proteins of the virus, such as spike and membrane glycoprotein. In this study, the N protein of SARS-CoV was expressed in Escherichia coli DH5α and identified with pooled sera from patients in the convalescence phase of SARS. A plasmid pCI-N, encoding the full-length N gene of SARS-CoV, was constructed. Expression of the N protein was observed in COS1 cells following transfection with pCI-N. The immune responses induced by intramuscular immunization with pCI-N were evaluated in a murine model. Serum anti-N immunoglobulins and splenocytes proliferative responses against N protein were observed in immunized BALB/c mice. The major immunoglobulin G subclass recognizing N protein was immunoglobulin G2a, and stimulated splenocytes secreted high levels of gamma interferon and IL-2 in response to N protein. More importantly, the immunized mice produced strong delayed-type hypersensitivity (DTH) and CD8 + CTL responses to N protein. The study shows that N protein of SARS-CoV not only is an important B cell immunogen, but also can elicit broad-based cellular immune responses. The results indicate that the N protein may be of potential value in vaccine development for specific prophylaxis and treatment against SARS

  12. Trivalent combination vaccine induces broad heterologous immune responses to norovirus and rotavirus in mice.

    Directory of Open Access Journals (Sweden)

    Kirsi Tamminen

    Full Text Available Rotavirus (RV and norovirus (NoV are the two major causes of viral gastroenteritis (GE in children worldwide. We have developed an injectable vaccine design to prevent infection or GE induced with these enteric viruses. The trivalent combination vaccine consists of NoV capsid (VP1 derived virus-like particles (VLPs of GI-3 and GII-4 representing the two major NoV genogroups and tubular RV recombinant VP6 (rVP6, the most conserved and abundant RV protein. Each component was produced in insect cells by a recombinant baculovirus expression system and combined in vitro. The vaccine components were administered intramuscularly to BALB/c mice either separately or in the trivalent combination. High levels of NoV and RV type specific serum IgGs with high avidity (>50% as well as intestinal IgGs were detected in the immunized mice. Cross-reactive IgG antibodies were also elicited against heterologous NoV VLPs not used for immunization (GII-4 NO, GII-12 and GI-1 VLPs and to different RVs from cell cultures. NoV-specific serum antibodies blocked binding of homologous and heterologous VLPs to the putative receptors, histo-blood group antigens, suggesting broad NoV neutralizing activity of the sera. Mucosal antibodies of mice immunized with the trivalent combination vaccine inhibited RV infection in vitro. In addition, cross-reactive T cell immune responses to NoV and RV-specific antigens were detected. All the responses were sustained for up to six months. No mutual inhibition of the components in the trivalent vaccine combination was observed. In conclusion, the NoV GI and GII VLPs combination induced broader cross-reactive and potentially neutralizing immune responses than either of the VLPs alone. Therefore, trivalent vaccine might induce protective immune responses to the vast majority of circulating NoV and RV genotypes.

  13. Maize Prolamins Could Induce a Gluten-Like Cellular Immune Response in Some Celiac Disease Patients

    Science.gov (United States)

    Ortiz-Sánchez, Juan P.; Cabrera-Chávez, Francisco; Calderón de la Barca, Ana M.

    2013-01-01

    Celiac disease (CD) is an autoimmune-mediated enteropathy triggered by dietary gluten in genetically prone individuals. The current treatment for CD is a strict lifelong gluten-free diet. However, in some CD patients following a strict gluten-free diet, the symptoms do not remit. These cases may be refractory CD or due to gluten contamination; however, the lack of response could be related to other dietary ingredients, such as maize, which is one of the most common alternatives to wheat used in the gluten-free diet. In some CD patients, as a rare event, peptides from maize prolamins could induce a celiac-like immune response by similar or alternative pathogenic mechanisms to those used by wheat gluten peptides. This is supported by several shared features between wheat and maize prolamins and by some experimental results. Given that gluten peptides induce an immune response of the intestinal mucosa both in vivo and in vitro, peptides from maize prolamins could also be tested to determine whether they also induce a cellular immune response. Hypothetically, maize prolamins could be harmful for a very limited subgroup of CD patients, especially those that are non-responsive, and if it is confirmed, they should follow, in addition to a gluten-free, a maize-free diet. PMID:24152750

  14. Exposure to low infective doses of HCV induces cellular immune responses without consistently detectable viremia or seroconversion in chimpanzees

    International Nuclear Information System (INIS)

    Shata, Mohamed Tarek; Tricoche, Nancy; Perkus, Marion; Tom, Darley; Brotman, Betsy; McCormack, Patricia; Pfahler, Wolfram; Lee, Dong-Hun; Tobler, Leslie H.; Busch, Michael; Prince, Alfred M.

    2003-01-01

    In hepatitis C virus (HCV) infection, there is accumulating data suggesting the presence of cellular immune responses to HCV in exposed but seemingly uninfected populations. Some studies have suggested cross-reactive antigens rather than prior HCV exposure as the main reason for the immune responses. In this study we address this question by analyzing the immune response of chimpanzees that have been sequentially exposed to increasing doses of HCV virions. The level of viremia, as well as the immune responses to HCV at different times after virus inoculation, were examined. Our data indicate that HCV infective doses as low as 1-10 RNA (+) virions induce detectable cellular immune responses in chimpanzees without consistently detectable viremia or persistent seroconversion. However, increasing the infective doses of HCV to 100 RNA (+) virions overcame the low-inoculum-induced immune response and produced high-level viremia followed by seroconversion

  15. Protective immunization with B16 melanoma induces antibody response and not cytotoxic T cell response

    International Nuclear Information System (INIS)

    Sarzotti, M.; Sriyuktasuth, P.; Klimpel, G.R.; Cerny, J.

    1986-01-01

    C57BL/6 mice immunized with three intraperitoneal injections of syngeneic, irradiated B16 melanoma cells, became resistant to B16 tumor challenge. Immunized mice had high levels of serum antibody against a membrane antigen of B16 cells. The B16 antigen recognized by the anti-B16 sera formed a major band of 90 KD in gel electrophoresis. The anti-B16 antibody was partially protective when mixed with B16 cells and injected into normal recipient mice. Surprisingly, B16 resistance mice were incapable of generating cytotoxic T cells (CTL) specific for the B16 tumor. Both spleen and lymph node cell populations from immunized mice did not generate B16-specific CTL. Allogeneic mice (DBA/2 or C3H) were also unable to generate B16-specific CTL: however, alloreactive CTL produced in these strains of mice by immunization with C57BL/6 lymphocytes, did kill B16 target cells. Interestingly, spleen cells from syngeneic mice immunized with B16 tumor produced 6-fold more interleukin-2 (IL-2) than normal spleen cells, in vitro. These data suggest that immunization with B16 tumor activates a helper subset of T cells (for antibody and IL-2 production) but not the effector CTL response

  16. Transcutaneous immunization with a novel imiquimod nanoemulsion induces superior T cell responses and virus protection.

    Science.gov (United States)

    Lopez, Pamela Aranda; Denny, Mark; Hartmann, Ann-Kathrin; Alflen, Astrid; Probst, Hans Christian; von Stebut, Esther; Tenzer, Stefan; Schild, Hansjörg; Stassen, Michael; Langguth, Peter; Radsak, Markus P

    2017-09-01

    Transcutaneous immunization (TCI) is a novel vaccination strategy utilizing the skin associated lymphatic tissue to induce immune responses. TCI using a cytotoxic T lymphocyte (CTL) epitope and the Toll-like receptor 7 (TLR7) agonist imiquimod mounts strong CTL responses by activation and maturation of skin-derived dendritic cells (DCs) and their migration to lymph nodes. However, TCI based on the commercial formulation Aldara only induces transient CTL responses that needs further improvement for the induction of durable therapeutic immune responses. Therefore we aimed to develop a novel imiquimod solid nanoemulsion (IMI-Sol) for TCI with superior vaccination properties suited to induce high quality T cell responses for enhanced protection against infections. TCI was performed by applying a MHC class I or II restricted epitope along with IMI-Sol or Aldara (each containing 5% Imiquimod) on the shaved dorsum of C57BL/6, IL-1R, Myd88, Tlr7 or Ccr7 deficient mice. T cell responses as well as DC migration upon TCI were subsequently analyzed by flow cytometry. To determine in vivo efficacy of TCI induced immune responses, CTL responses and frequency of peptide specific T cells were evaluated on day 8 or 35 post vaccination and protection in a lymphocytic choriomeningitis virus (LCMV) infection model was assessed. TCI with the imiquimod formulation IMI-Sol displayed equal skin penetration of imiquimod compared to Aldara, but elicited superior CD8 + as well as CD4 + T cell responses. The induction of T-cell responses induced by IMI-Sol TCI was dependent on the TLR7/MyD88 pathway and independent of IL-1R. IMI-Sol TCI activated skin-derived DCs in skin-draining lymph nodes more efficiently compared to Aldara leading to enhanced protection in a LCMV infection model. Our data demonstrate that IMI-Sol TCI can overcome current limitations of previous imiquimod based TCI approaches opening new perspectives for transcutaneous vaccination strategies and allowing the use of this

  17. Evidence of a Redox-Dependent Regulation of Immune Responses to Exercise-Induced Inflammation

    Directory of Open Access Journals (Sweden)

    Alexandra Sakelliou

    2016-01-01

    Full Text Available We used thiol-based antioxidant supplementation (n-acetylcysteine, NAC to determine whether immune mobilisation following skeletal muscle microtrauma induced by exercise is redox-sensitive in healthy humans. According to a two-trial, double-blind, crossover, repeated measures design, 10 young men received either placebo or NAC (20 mg/kg/day immediately after a muscle-damaging exercise protocol (300 eccentric contractions and for eight consecutive days. Blood sampling and performance assessments were performed before exercise, after exercise, and daily throughout recovery. NAC reduced the decline of reduced glutathione in erythrocytes and the increase of plasma protein carbonyls, serum TAC and erythrocyte oxidized glutathione, and TBARS and catalase activity during recovery thereby altering postexercise redox status. The rise of muscle damage and inflammatory markers (muscle strength, creatine kinase activity, CRP, proinflammatory cytokines, and adhesion molecules was less pronounced in NAC during the first phase of recovery. The rise of leukocyte and neutrophil count was decreased by NAC after exercise. Results on immune cell subpopulations obtained by flow cytometry indicated that NAC ingestion reduced the exercise-induced rise of total macrophages, HLA+ macrophages, and 11B+ macrophages and abolished the exercise-induced upregulation of B lymphocytes. Natural killer cells declined only in PLA immediately after exercise. These results indicate that thiol-based antioxidant supplementation blunts immune cell mobilisation in response to exercise-induced inflammation suggesting that leukocyte mobilization may be under redox-dependent regulation.

  18. Rotavirus nonstructural protein 1 antagonizes innate immune response by interacting with retinoic acid inducible gene I

    Directory of Open Access Journals (Sweden)

    Qin Lan

    2011-12-01

    Full Text Available Abstract Background The nonstructural protein 1 (NSP1 of rotavirus has been reported to block interferon (IFN signaling by mediating proteasome-dependent degradation of IFN-regulatory factors (IRFs and (or the β-transducin repeat containing protein (β-TrCP. However, in addition to these targets, NSP1 may subvert innate immune responses via other mechanisms. Results The NSP1 of rotavirus OSU strain as well as the IRF3 binding domain truncated NSP1 of rotavirus SA11 strain are unable to degrade IRFs, but can still inhibit host IFN response, indicating that NSP1 may target alternative host factor(s other than IRFs. Overexpression of NSP1 can block IFN-β promoter activation induced by the retinoic acid inducible gene I (RIG-I, but does not inhibit IFN-β activation induced by the mitochondrial antiviral-signaling protein (MAVS, indicating that NSP1 may target RIG-I. Immunoprecipitation experiments show that NSP1 interacts with RIG-I independent of IRF3 binding domain. In addition, NSP1 induces down-regulation of RIG-I in a proteasome-independent way. Conclusions Our findings demonstrate that inhibition of RIG-I mediated type I IFN responses by NSP1 may contribute to the immune evasion of rotavirus.

  19. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats

    Directory of Open Access Journals (Sweden)

    Loganathan Sundareswaran

    2017-01-01

    Conclusion: S. dulcis (SD has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant.

  20. Protein Kinase G Induces an Immune Response in Cows Exposed to Mycobacterium avium Subsp. paratuberculosis

    Directory of Open Access Journals (Sweden)

    Horacio Bach

    2018-01-01

    Full Text Available To establish infection, pathogens secrete virulence factors, such as protein kinases and phosphatases, to modulate the signal transduction pathways used by host cells to initiate immune response. The protein MAP3893c is annotated in the genome sequence of Mycobacterium avium subspecies paratuberculosis (MAP, the causative agent of Johne’s disease, as the serine/threonine protein kinase G (PknG. In this work, we report that PknG is a functional kinase that is secreted within macrophages at early stages of infection. The antigen is able to induce an immune response from cattle exposed to MAP in the form of interferon gamma production after stimulation of whole blood with PknG. These findings suggest that PknG may contribute to the pathogenesis of MAP by phosphorylating macrophage signalling and/or adaptor molecules as observed with other pathogenic mycobacterial species.

  1. Sporothrix schenckii Immunization, but Not Infection, Induces Protective Th17 Responses Mediated by Circulating Memory CD4+ T Cells

    Directory of Open Access Journals (Sweden)

    Alberto García-Lozano

    2018-06-01

    Full Text Available Sporotrichosis is a chronic subcutaneous mycosis caused by the Sporothrix schenckii species complex and it is considered an emerging opportunistic infection in countries with tropical and subtropical climates. The host’s immune response has a main role in the development of this disease. However, it is unknown the features of the memory cellular immune response that could protect against the infection. Our results show that i.d. immunization in the ears of mice with inactivated S. schenckii conidia (iC combined with the cholera toxin (CT induces a cellular immune response mediated by circulating memory CD4+ T cells, which mainly produce interleukin 17 (IL-17. These cells mediate a strong delayed-type hypersensitivity (DTH reaction. Systemic and local protection against S. schenckii was mediated by circulating CD4+ T cells. In contrast, the infection induces a potent immune response in the skin mediated by CD4+ T cells, which have an effector phenotype that preferentially produce interferon gamma (IFN-γ and mediate a transitory DTH reaction. Our findings prove the potential value of the CT as a potent skin adjuvant when combined with fungal antigens, and they also have important implications for our better understanding of the differences between the memory immune response induced by the skin immunization and those induced by the infection; this knowledge enhances our understanding of how a protective immune response against a S. schenckii infection is developed.

  2. C3d enhanced DNA vaccination induced humoral immune response to glycoprotein C of pseudorabies virus

    International Nuclear Information System (INIS)

    Tong Tiezhu; Fan Huiying; Tan Yadi; Xiao Shaobo; Ling Jieyu; Chen Huanchun; Guo Aizhen

    2006-01-01

    Murine C3d were utilized to enhance immunogenicity of pseudorabies virus (PrV) gC DNA vaccination. Three copies of C3d and four copies of CR2-binding domain M28 4 were fused, respectively, to truncated gC gene encoding soluble glycoprotein C (sgC) in pcDNA3.1. BALB/c mice were, respectively, immunized with recombinant plasmids, blank vector, and inactivated vaccine. The antibody ELISA titer for sgC-C3d 3 DNA was 49-fold more than that for sgC DNA, and the neutralizing antibody obtained 8-fold rise. Protection of mice from death after lethal PrV (316 LD 5 ) challenge was augmented from 25% to 100%. Furthermore, C3d fusion increased Th2-biased immune response by inducing IL-4 production. The IL-4 level for sgC-C3d 3 DNA immunization approached that for the inactivated vaccine. Compared to C3d, M28 enhanced sgC DNA immunogenicity to a lesser extent. In conclusion, we demonstrated that murine C3d fusion significantly enhanced gC DNA immunity by directing Th1-biased to a balanced and more effective Th1/Th2 response

  3. Plasmodium berghei: immunosuppression of the cell-mediated immune response induced by nonviable antigenic preparations

    International Nuclear Information System (INIS)

    Gross, A.; Frankenburg, S.

    1989-01-01

    In this work, plasmodial antigens were examined for their ability to suppress the cellular immune response during lethal Plasmodium berghei infection. Splenic enlargement and the number and function of white spleen cells were assessed after injection of normal mice with irradiated parasitized erythrocytes (IPE) or with parasitized erythrocytes (PE) membranes. Both IPE and PE membranes caused splenomegaly and an increase in the number of splenic white cells with concurrent alteration of the relative proportions of T cells and macrophages. The percentage of T lymphocytes was fractionally diminished, but there was a marked increase in Lyt 2.2 positive (suppressor and cytotoxic) T subsets and in the number of splenic macrophage precursors. The pathological enlargement of the spleen was induced by various plasma membrane-derived antigens containing both proteins and carbohydrates. Splenocytes of mice injected with liposomes containing deoxycholate-treated PE or PE fractions showed both diminished interleukin 2 production and a decreased response to mitogen. It appears that some of the changes in the cellular immune response during P. berghei infection are a consequence of the massive provision of a wide spectrum of antigens, capable of suppressing the immune response. Thus, it may be appropriate to evaluate the possible negative effect of parasite epitopes that are candidates for vaccine

  4. Vaccination with dengue virus-like particles induces humoral and cellular immune responses in mice

    Directory of Open Access Journals (Sweden)

    Zhang Quanfu

    2011-06-01

    Full Text Available Abstract Background The incidence of dengue, an infectious disease caused by dengue virus (DENV, has dramatically increased around the world in recent decades and is becoming a severe public health threat. However, there is currently no specific treatment for dengue fever, and licensed vaccine against dengue is not available. Vaccination with virus-like particles (VLPs has shown considerable promise for many viral diseases, but the effect of DENV VLPs to induce specific immune responses has not been adequately investigated. Results By optimizing the expression plasmids, recombinant VLPs of four antigenically different DENV serotypes DENV1-4 were successfully produced in 293T cells. The vaccination effect of dengue VLPs in mice showed that monovalent VLPs of each serotype stimulated specific IgG responses and potent neutralizing antibodies against homotypic virus. Tetravalent VLPs efficiently enhanced specific IgG and neutralizing antibodies against all four serotypes of DENV. Moreover, vaccination with monovalent or tetravalent VLPs resulted in the induction of specific cytotoxic T cell responses. Conclusions Mammalian cell expressed dengue VLPs are capable to induce VLP-specific humoral and cellular immune responses in mice, and being a promising subunit vaccine candidate for prevention of dengue virus infection.

  5. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    International Nuclear Information System (INIS)

    Miyata, Ryohei; Eeden, Stephan F. van

    2011-01-01

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 μm or less, PM 10 ) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 μm or less, PM 2.5 ) and ultrafine particles (0.1 μm or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-κB and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1β, IL-6, and tumor necrosis factor-α] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-κB pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  6. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Ryohei; Eeden, Stephan F. van, E-mail: Stephan.vanEeden@hli.ubc.ca

    2011-12-15

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 {mu}m or less, PM{sub 10}) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 {mu}m or less, PM{sub 2.5}) and ultrafine particles (0.1 {mu}m or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-{kappa}B and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1{beta}, IL-6, and tumor necrosis factor-{alpha}] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-{kappa}B pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  7. Genetic immunization in the lung induces potent local and systemic immune responses

    NARCIS (Netherlands)

    Song, Kaimei; Bolton, Diane L.; Wilson, Robert L.; Camp, Jeremy V.; Bao, Saran; Mattapallil, Joseph J.; Herzenberg, Leonore A.; Herzenberg, Leonard A.; Andrews, Charla A.; Sadoff, Jerald C.; Goudsmit, Jaap; Pau, Maria Grazia; Seder, Robert A.; Kozlowski, Pamela A.; Nabel, Gary J.; Roederer, Mario; Rao, Srinivas S.

    2010-01-01

    Successful vaccination against respiratory infections requires elicitation of high levels of potent and durable humoral and cellular responses in the lower airways. To accomplish this goal, we used a fine aerosol that targets the entire lung surface through normal respiration to deliver

  8. Visible light induced changes in the immune response through an eye-brain mechanism (photoneuroimmunology).

    Science.gov (United States)

    Roberts, J E

    1995-07-01

    The immune system is susceptible to a variety of stresses. Recent work in neuroimmunology has begun to define how mood alteration, stress, the seasons, and daily rhythms can have a profound effect on immune response through hormonal modifications. Central to these factors may be light through an eye-brain hormonal modulation. In adult primates, only visible light (400-700 nm) is received by the retina. This photic energy is then transduced and delivered to the visual cortex and by an alternative pathway to the suprachiasmatic nucleus (SCN). The SCN is a part of the hypothalamic region in the brain believed to direct circadian rhythm. Visible light exposure also modulates the pituitary and pineal gland which leads to neuroendocrine changes. Melatonin, norepinephrine and acetylcholine decrease with light activation, while cortisol, serotonin, gaba and dopamine levels increase. The synthesis of vasoactive intestinal polypeptide (VIP), gastrin releasing peptide (GRP) and neuropeptide Y (NPY) in rat SCN has been shown to be modified by light. These induced neuroendocrine changes can lead to alterations in mood and circadian rhythm. All of these neuroendocrine changes can lead to immune modulation. An alternative pathway for immune modulation by light is through the skin. Visible light (400-700 nm) can penetrate epidermal and dermal layers of the skin and may directly interact with circulating lymphocytes to modulate immune function. However, even in the presence of phototoxic agents such as eosin and rose bengal, visible light did not produce suppression of contact hypersensitivity with suppresser cells. In contrast to visible light, in vivo exposure to UV-B (280-320 nm) and UV-A (320-400 nm) radiation can only alter normal human immune function by a skin mediated response. Each UV subgroup (B, A) induces an immunosuppressive response but by differing mechanisms involving the regulation of differing interleukins and growth factors. Some effects observed in humans are

  9. Sex-specific consequences of an induced immune response on reproduction in a moth.

    Science.gov (United States)

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

    2015-12-16

    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  10. Mucosal immunization using proteoliposome and cochleate structures from Neisseria meningitidis serogroup B induce mucosal and systemic responses.

    Science.gov (United States)

    Campo, Judith Del; Zayas, Caridad; Romeu, Belkis; Acevedo, Reinaldo; González, Elizabeth; Bracho, Gustavo; Cuello, Maribel; Cabrera, Osmir; Balboa, Julio; Lastre, Miriam

    2009-12-01

    Most pathogens either invade the body or establish infection in mucosal tissues and represent an enormous challenge for vaccine development by the absence of good mucosal adjuvants. A proteoliposome-derived adjuvant from Neisseria meningitidis serogroup B (AFPL1, Adjuvant Finlay Proteoliposome 1) and its derived cochleate form (Co, AFCo1) contain multiple pathogen-associated molecular patterns as immunopotentiators, and can also serve as delivery systems to elicit a Th1-type immune response. The present studies demonstrate the ability of AFPL1and AFCo1 to induce mucosal and systemic immune responses by different mucosal immunizations routes and significant adjuvant activity for antibody responses of both structures: a microparticle and a nanoparticle with a heterologous antigen. Therefore, we used female mice immunized by intragastric, intravaginal, intranasal or intramuscular routes with both structures alone or incorporated with ovalbumin (OVA). High levels of specific IgG antibody were detected in all sera and in vaginal washes, but specific IgA antibody in external secretions was only detected in mucosally immunized mice. Furthermore, antigen specific IgG1 and IgG2a isotypes were all induced. AFPL1 and AFCo1 are capable of inducing IFN-gamma responses, and chemokine secretions, like MIP-1alpha and MIP-1beta. However, AFCo1 is a better alternative to induce immune responses at mucosal level. Even when we use a heterologous antigen, the AFCo1 response was better than with AFPL1 in inducing mucosal and systemic immune responses. These results support the use of AFCo1 as a potent Th1 inducing adjuvant particularly suitable for mucosal immunization.

  11. Public speaking stress-induced neuroendocrine responses and circulating immune cell redistribution in irritable bowel syndrome.

    Science.gov (United States)

    Elsenbruch, Sigrid; Lucas, Ayscha; Holtmann, Gerald; Haag, Sebastian; Gerken, Guido; Riemenschneider, Natalie; Langhorst, Jost; Kavelaars, Annemieke; Heijnen, Cobi J; Schedlowski, Manfred

    2006-10-01

    Augmented neuroendocrine stress responses and altered immune functions may play a role in the manifestation of functional gastrointestinal (GI) disorders. We tested the hypothesis that IBS patients would demonstrate enhanced psychological and endocrine responses, as well as altered stress-induced redistribution of circulating leukocytes and lymphocytes, in response to an acute psychosocial stressor when compared with healthy controls. Responses to public speaking stress were analyzed in N = 17 IBS patients without concurrent psychiatric conditions and N = 12 healthy controls. At baseline, immediately following public speaking, and after a recovery period, state anxiety, acute GI symptoms, cardiovascular responses, serum cortisol and plasma adrenocorticotropic hormone (ACTH) were measured, and numbers of circulating leukocytes and lymphocyte subpopulations were analyzed by flow cytometry. Public speaking led to significant cardiovascular activation, a significant increase in ACTH, and a redistribution of circulating leukocytes and lymphocyte subpopulations, including significant increases in natural killer cells and cytotoxic/suppressor T cells. IBS patients demonstrated significantly greater state anxiety both at baseline and following public speaking. However, cardiovascular and endocrine responses, as well as the redistribution of circulating leukocytes and lymphocyte subpopulations after public speaking stress, did not differ for IBS patients compared with controls. In IBS patients without psychiatric comorbidity, the endocrine response as well as the circulation pattern of leukocyte subpopulations to acute psychosocial stress do not differ from healthy controls in spite of enhanced emotional responses. Future studies should discern the role of psychopathology in psychological and biological stress responses in IBS.

  12. EFFECT OF PHLEBODIUM DECUMANUM ON THE IMMUNE RESPONSE INDUCED BY TRAINING IN SEDENTARY UNIVERSITY STUDENTS

    Directory of Open Access Journals (Sweden)

    Jose A. Gonzalez-Jurado

    2011-06-01

    Full Text Available Exercise training is considered a good model to provoke different degrees of immune dysfunction affecting physical performance and some physiological responses related to oxidative stress and low grade inflammation. Phlebodium decumanum is a polypodiaceae may induce shown immunomodulating effects, specifically directed to the release of proinflammatory cytokines by macrophages in response to various stimuli, as reported different in vitro studies. The aim of this study was to evaluate the modulating effect of phlebodium decumanum, on the immune response induced by physical exercise. Thirty-one subjects (males only were randomly divided into two groups: Group PD (n = 18; age: 22.1 ± 1.81, weight 74.21 ± 8.74 kg that was treated with phlebodium decumanum; Group P (n = 13; age: 22.5 ± 1.63, weight 78 ± 12.5 kg that was treated with a placebo. Before and after one month training program performed by both groups (three times a week, the following performance parameters and immune response variables were measured: Dynamic Maximum Force; Interval-Training; Tennis test; pro-inflammatory (TNF , IL6 and anti-inflammatory (TNFα-IIrs, IL1-ra cytokines levels. Data were statistically analyzed with Mann- Whitney U test and Wilcoxon paired test (p < 0.05. Statistically significant differences were recorded within groups before and after the training program. PD group showed a significant improvement in the performance parameters (Strength Muscle Test: dorsal: p < 0.002; deltoids: p < 0.03; and pectorals: p < 0.07; Interval Training: p < 0.06; Tennis Test: p < 0.02. Cytokine levels resulted in a more positive profile in the PD group rather than in the P group, in which higher levels of IL-6 (p < 0.02 and a reduction of TNF-IIrs (p < 0.003 and IL1-ra (p < 0.03 were recorded. In this study the use of phlebodium decumanum demonstrated beneficial effects in the modulation of the immune response during physical performance

  13. Ficolins do not alter host immune responses to lipopolysaccharide-induced inflammation in vivo

    DEFF Research Database (Denmark)

    Genster, Ninette; Østrup, Olga; Schjalm, Camilla

    2017-01-01

    . Yet, the contribution of ficolins to inflammatory disease processes remains elusive. To address this, we investigated ficolin deficient mice during a lipopolysaccharide (LPS)-induced model of systemic inflammation. Although murine serum ficolin was shown to bind LPS in vitro, there was no difference...... an unaltered spleen transcriptome profile in ficolin deficient mice compared to wildtype mice. Collectively, results from this study demonstrate that ficolins are not involved in host response to LPS-induced systemic inflammation.......Ficolins are a family of pattern recognition molecules that are capable of activating the lectin pathway of complement. A limited number of reports have demonstrated a protective role of ficolins in animal models of infection. In addition, an immune modulatory role of ficolins has been suggested...

  14. Merck Ad5/HIV induces broad innate immune activation that predicts CD8⁺ T-cell responses but is attenuated by preexisting Ad5 immunity.

    Science.gov (United States)

    Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana

    2012-12-11

    To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.

  15. Immune response of cattle against fasciolopsis induced by inoculation of irradiated metacercariae of fasciola gigantic

    International Nuclear Information System (INIS)

    M-Arifin

    2006-01-01

    An experiment was carried out to study the immune response of cattle against fasciolopsis induced by inoculation of irradiated metacercariae of F. gigantic. Four groups of experimental cattle were used e.g: the first group (Vp) were inoculated by the unirradiated metacercariae as a positive control, the second group (Vi) were once inoculated with irradiated metacercariae and then challenged with the infected metacercariae three weeks later, the third group (Vii) were twice inoculated with irradiated metacercariae and then challenged with the infected metacercariae three weeks later, while the forth group (Vn), the negative control without any inoculation of metacercariae. Irradiation dose of 45 Gy was used, and each experimental animal received 700 live’s metacercariae of F. gigantic. The immune response towards fasciolopsis in cattle has been observed in the development of body weight, the number of red blood cells (RBC), the number of white blood cells (WBC), level of haemoglobin (Hb), percentages of Packed cell volume (PCV), the number of eosinophil cells, serological test by ELISA, pathology anatomic inspection and evaluation of the development of worm.The average every measurement of body weight development are Vp = 6 kg, Vi = 9 kg, Vii = 9 kg and Vn = 10 kg. The group of Vi, Vii and Vn were normal of their heart, but the group of Vp was disorder. The group of Vi, Vii and Vn were negative of adult worm’s, while the group of Vp was positive of adult worm’s. These results showed that inoculation of irradiated metacercariae F. gigantic could stimulate good immune response which was able to protect against the infectivity of the challenge in cattle. (author)

  16. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8(+) T cell priming in response to intravaginal immunization.

    Science.gov (United States)

    Seavey, Matthew M; Mosmann, Tim R

    2009-04-14

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8(+) T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APCs) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8(+) T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8(+) T cell priming after insemination or vaginal vaccination.

  17. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8+ T cell priming in response to intravaginal immunization

    Science.gov (United States)

    Seavey, Matthew M.; Mosmann, Tim R.

    2010-01-01

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8+ T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APC) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8+ T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8+ T cell priming after insemination or vaginal vaccination. PMID:19428849

  18. Perturbations in immune responses induced by concurrent subchronic exposure to arsenic and endosulfan

    International Nuclear Information System (INIS)

    Aggarwal, Manoj; Naraharisetti, Suresh Babu; Dandapat, S.; Degen, G.H.; Malik, J.K.

    2008-01-01

    The metalloid arsenic and the chlorinated insecticide endosulfan are common environmental contaminants. Humans, animals, and birds are exposed to these chemicals through water and food. Although health effects due to either arsenic or endosulfan exposure are documented, the toxicological impact of co-exposure to these environmental pollutants is unpredictable and unknown. The present study was undertaken to assess whether concurrent exposure to arsenic and endosulfan induces significant alterations in immunological functions. Day-old chicks were exposed to 3.7 ppm of arsenic via drinking water and to 30 ppm of endosulfan-mixed feed either individually or concurrently for up to 60 days. All the chicks were vaccinated with Ranikhet disease virus (F-strain; RD-F) on days 1 and 30. During the course of study and at term, parameters of cellular and humoral immunity were determined. None of the treatments altered the absolute body weight or body weight gain, except arsenic significantly reduced weight gain on day 60. Absolute, but not the relative, weights of spleen, thymus and bursa of Fabricius were significantly reduced in all the treatment groups. The metalloid and insecticide combination significantly depressed the ability of peripheral blood and splenic lymphocytes to proliferate in response to antigen RD-F and mitogen Con A. The delayed type hypersensitivity response to 2,4-dinitro-1-chlorobenzene or to PHA-P was also significantly decreased. Nitric oxide production by RD-F or lipopolysaccharide-stimulated peripheral blood and splenic mononuclear cells was significantly suppressed following concurrent exposure to arsenic and endosulfan. Furthermore, the combined exposure also decreased the antibody response to RD-F. The suppression of cellular and humoral immune responses was also evident following administration of individual compounds, and it was not exacerbated following concurrent exposure. To our knowledge, this is the first report describing the suppression

  19. Humoral Immune Response Induced by PLGA Micro Particle Coupled Newcastle Disease Virus Vaccine in Chickens

    Directory of Open Access Journals (Sweden)

    Sanganagouda K

    2014-02-01

    Full Text Available This experiment was conducted for evaluating the humoral immune responses induced by Poly Lactide-co-Glycolide Acid (PLGA microspheres coupled inactivated Newcastle Disease Virus (NDV vaccine in comparison to an ‘in-house’ prepared inactivated and a live commercial vaccine. PLG microparticles containing inactivated NDV were prepared by a double emulsion technique based on solvent evaporation method. The size of the NDV coupled PLG microparticles was determined by Electron Microscopy. NDV coupled PLG microparticles were spherical having smooth surface, hollow core inside with no pores on the surface. The experiment was conducted in four groups of chickens (n=15. The encapsulation efficiency of NDV coupled PLG microparticles was determined by protein estimation and HA activity in elute. The mean (± SE size of PLG microspheres was found to be 2.409 ± 0.65 µm. The mean percent of encapsulation efficiency of PLG microspheres coupled to NDV was assessed based on the total protein content and HA activity in elute was found to be 8.03 ± 0.50 and 12.5 ± 0.00, respectively. In conclusion, the results of the experiment showed that PLGA coupled NDV vaccine elicited stronger and prolonged humoral immune response in chickens, in comparison to the other tested vaccines, as assessed by haemagglutination inhibition and enzyme linked immuno sorbent asaay titers.

  20. Study of the integrated immune response induced by an inactivated EV71 vaccine.

    Directory of Open Access Journals (Sweden)

    Longding Liu

    Full Text Available Enterovirus 71 (EV71, a major causative agent of hand-foot-and-mouth disease (HFMD, causes outbreaks among children in the Asia-Pacific region. A vaccine is urgently needed. Based on successful pre-clinical work, phase I and II clinical trials of an inactivated EV71 vaccine, which included the participants of 288 and 660 respectively, have been conducted. In the present study, the immune response and the correlated modulation of gene expression in the peripheral blood mononuclear cells (PBMCs of 30 infants (6 to 11 months immunized with this vaccine or placebo and consented to join this study in the phase II clinical trial were analyzed. The results showed significantly greater neutralizing antibody and specific T cell responses in vaccine group after two inoculations on days 0 and 28. Additionally, more than 600 functional genes that were up- or down-regulated in PBMCs were identified by the microarray assay, and these genes included 68 genes associated with the immune response in vaccine group. These results emphasize the gene expression profile of the immune system in response to an inactivated EV71 vaccine in humans and confirmed that such an immune response was generated as the result of the positive mobilization of the immune system. Furthermore, the immune response was not accompanied by the development of a remarkable inflammatory response.NCT01391494 and NCT01512706.

  1. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats.

    Science.gov (United States)

    Sundareswaran, Loganathan; Srinivasan, Sakthivel; Wankhar, Wankupar; Sheeladevi, Rathinasamy

    Noise acts as a stressor and is reported to have impact on individual health depending on nature, type, intensity and perception. Modern medicine has no effective drugs or cure to prevent its consequences. Being an environmental stressor noise cannot be avoided; instead minimizing its exposure or consuming anti-stressor and adaptogens from plants can be considered. The present study was carried out to evaluate the anti-stressor, adaptogen and immunostimulatory activity of Scoparia dulcis against noise-induced stress in Wistar rat models. Noise stress in rats was created by broadband white noise generator, 100 dB A/4 h daily/15 days and S. dulcis (200 mg/kg b.w.) was administered orally. 8 groups of rats were used consisting of 6 animals each; 4 groups for unimmunized and 4 groups for immunized. For immunization, sheep red blood cells (5 × 10 9  cells/ml) were injected intraperitoneally. Sub-acute noise exposed rats showed a significant increase in corticosterone and IL-4 levels in both immunized and unimmunized rats whereas lymphocytes, antibody titration, soluble immune complex, IL-4 showed a marked increase with a significant decrease in IL-2, TNF-α, IFN-γ cytokines only in unimmunized rats. Immunized noise exposed rats presented increased leukocyte migration index and decreased foot pad thickness, IL-2, TNF-α, IFN-γ with no changes in the lymphocytes. S. dulcis (SD) has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  2. Immunization with Paracoccidioides brasiliensis radioattenuated yeast cells induces Th1 immune response in Balb/C mice

    International Nuclear Information System (INIS)

    Martins, Estefania M.N.; Andrade, Antero S.R.; Resende, Maria Aparecida de; Reis, Bernardo S.; Goes, Alfredo M.

    2009-01-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, the most prevalent mycosis in Latin America. To date, there is no effective vaccine. In our laboratory yeast cells of P. brasiliensis were attenuated by gamma irradiation. We defined an absorbed dose in which the pathogen loses the reproductive ability, while retaining the morphology, the synthesis and secretion of proteins and the oxidative metabolism. The immunization with these cells was able to confer protection in BALB/c mice. The aim of the present work was evaluate the immune response pathway activated in mice immunized with P. brasiliensis radioattenuated yeast cells. The protector effect was evaluated in BALB/c mice groups immunized once or twice, respectively. Each group was divided in three sub groups that were challenge 30, 45 or 60 days after the immunization. These groups were called G1A, G1B and G1C in the group immunized once and G2A, G2B and G2C in the group immunized twice. Recovery of CFUs and cytokines determination (IFN - γ, IL - 10 and IL IV 4) were performed three months post challenge. Quantitative RT-PCR was the method of choice used to quantify the expression of cytokines. The sera were collected weekly to evaluate the IgG antibody titers and the IgG1 and IgG2a pattern in the course of infection. A significant reduction in CFUs recovery was verified 90 days post challenge in mice submitted to one immunization: 73.0%, 96.0% and 76.3% for sub-groups G1A, G1B and G1C, respectively. In the group submitted to two immunizations, a remarkable increase in the protection was obtained. No CFUs was recovered from sub-groups G2B and G2C and very few CFUs (reduction of 98.6%) were recovered from the lungs of sub group G2A. In mice submitted to one immunization, Th1 and Th2 cytokines were simultaneously produced. In the group submitted to two immunizations, levels of IL-10 and IL-4 were very low, while IFN-γ production was maintained indicating that a Th1 pattern was dominant. For

  3. Immunization with Paracoccidioides brasiliensis radioattenuated yeast cells induces Th1 immune response in Balb/C mice

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Estefania M.N.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN/MG), Belo Horizonte, MG (Brazil)], e-mail: estefaniabio@yahoo.com.br, e-mail: antero@cdtn.br; Resende, Maria Aparecida de [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: maresend@mono.icb.ufmg.br; Reis, Bernardo S.; Goes, Alfredo M. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Bioquimica e Imunologia], e-mail: goes@mono.icb.ufmg.br, e-mail: brsgarbi@mono.icb.ufmg.br

    2009-07-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, the most prevalent mycosis in Latin America. To date, there is no effective vaccine. In our laboratory yeast cells of P. brasiliensis were attenuated by gamma irradiation. We defined an absorbed dose in which the pathogen loses the reproductive ability, while retaining the morphology, the synthesis and secretion of proteins and the oxidative metabolism. The immunization with these cells was able to confer protection in BALB/c mice. The aim of the present work was evaluate the immune response pathway activated in mice immunized with P. brasiliensis radioattenuated yeast cells. The protector effect was evaluated in BALB/c mice groups immunized once or twice, respectively. Each group was divided in three sub groups that were challenge 30, 45 or 60 days after the immunization. These groups were called G1A, G1B and G1C in the group immunized once and G2A, G2B and G2C in the group immunized twice. Recovery of CFUs and cytokines determination (IFN - {gamma}, IL - 10 and IL IV 4) were performed three months post challenge. Quantitative RT-PCR was the method of choice used to quantify the expression of cytokines. The sera were collected weekly to evaluate the IgG antibody titers and the IgG1 and IgG2a pattern in the course of infection. A significant reduction in CFUs recovery was verified 90 days post challenge in mice submitted to one immunization: 73.0%, 96.0% and 76.3% for sub-groups G1A, G1B and G1C, respectively. In the group submitted to two immunizations, a remarkable increase in the protection was obtained. No CFUs was recovered from sub-groups G2B and G2C and very few CFUs (reduction of 98.6%) were recovered from the lungs of sub group G2A. In mice submitted to one immunization, Th1 and Th2 cytokines were simultaneously produced. In the group submitted to two immunizations, levels of IL-10 and IL-4 were very low, while IFN-{gamma} production was maintained indicating that a Th1 pattern was

  4. The role of recombinant IL-12 in enhancing immune responses induced by hepatitis B vaccine in mice

    International Nuclear Information System (INIS)

    Lu Qun; Zhou Lixia; Zhao Yanrong; Miao Xiaoguang; Jin Jie; Ke Jinshan; Qin Xuliang; He Zheng

    2007-01-01

    Objective: To study the role played by recombinant IL-12 in enhancing the intensity and quality of the immune response to hepatitis B vaccine in mice, and investigate the possibility of adding recombinant IL-12 as adjuvants to hepatitis B therapeutic vaccine. Methods: Recombinant IL-12 was injected together with hepatitis B vaccine into mice and special anti-HBsAb in the mice and the cellular immune responses were examined. Results: Recombinant IL-12 can obviously enhance T lymphocyte multiplication activity, accelerate excretion of cytokines IFN-γ and IL-2, and increase the IgG2a antibody in mice. Conclusion: Recombinant IL-12 can remarkably strengthen the cellular immune responses induced by the hepatitis B vaccine, and modulate the immune responses toward Thl. (authors)

  5. Chimeric plant virus particles administered nasally or orally induce systemic and mucosal immune responses in mice

    DEFF Research Database (Denmark)

    Brennan, F.R.; Bellaby, T.; Helliwell, S.M.

    1999-01-01

    The humoral immune responses to the D2 peptide of fibronectin-binding protein B (FnBP) of Staphylococcus aureus, expressed on the plant virus cowpea mosaic virus (CPMV), were evaluated after mucosal delivery to mice. Intranasal immunization of these chimeric virus particles (CVPs), either alone...

  6. Sex-specific consequences of an induced immune response on reproduction in a moth

    NARCIS (Netherlands)

    Barthel, A.; Staudacher, H.; Schmalz, A.; Heckel, D.G.; Groot, A.T.

    2015-01-01

    Background Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life

  7. Targeting tumor antigens to secreted membrane vesicles in vivo induces efficient antitumor immune responses.

    Science.gov (United States)

    Zeelenberg, Ingrid S; Ostrowski, Matias; Krumeich, Sophie; Bobrie, Angélique; Jancic, Carolina; Boissonnas, Alexandre; Delcayre, Alain; Le Pecq, Jean-Bernard; Combadière, Béhazine; Amigorena, Sebastian; Théry, Clotilde

    2008-02-15

    Expression of non-self antigens by tumors can induce activation of T cells in vivo, although this activation can lead to either immunity or tolerance. CD8+ T-cell activation can be direct (if the tumor expresses MHC class I molecules) or indirect (after the capture and cross-presentation of tumor antigens by dendritic cells). The modes of tumor antigen capture by dendritic cells in vivo remain unclear. Here we examine the immunogenicity of the same model antigen secreted by live tumors either in association with membrane vesicles (exosomes) or as a soluble protein. We have artificially addressed the antigen to secreted vesicles by coupling it to the factor VIII-like C1C2 domain of milk fat globule epidermal growth factor-factor VIII (MFG-E8)/lactadherin. We show that murine fibrosarcoma tumor cells that secrete vesicle-bound antigen grow slower than tumors that secrete soluble antigen in immunocompetent, but not in immunodeficient, host mice. This growth difference is due to the induction of a more potent antigen-specific antitumor immune response in vivo by the vesicle-bound than by the soluble antigen. Finally, in vivo secretion of the vesicle-bound antigen either by tumors or by vaccination with naked DNA protects against soluble antigen-secreting tumors. We conclude that the mode of secretion can determine the immunogenicity of tumor antigens and that manipulation of the mode of antigen secretion may be used to optimize antitumor vaccination protocols.

  8. Increased innate and adaptive immune responses in induced sputum of young smokers

    Directory of Open Access Journals (Sweden)

    Agnese Kislina

    2015-01-01

    Conclusions: This study demonstrates that young smokers have early inflammatory changes in their airways that not only initiate nonspecific mechanisms recruiting neutrophils, but also involve specific immune mechanisms with recruitment of T regulatory lymphocytes. The lymphocyte response is probably adaptive.

  9. Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses

    OpenAIRE

    Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.

    2011-01-01

    The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fr...

  10. Priming of innate antimycobacterial immunity by heat-killed Listeria monocytogenes induces sterilizing response in the adult zebrafish tuberculosis model

    Directory of Open Access Journals (Sweden)

    Hanna Luukinen

    2018-01-01

    Full Text Available Mycobacterium tuberculosis remains one of the most problematic infectious agents, owing to its highly developed mechanisms to evade host immune responses combined with the increasing emergence of antibiotic resistance. Host-directed therapies aiming to optimize immune responses to improve bacterial eradication or to limit excessive inflammation are a new strategy for the treatment of tuberculosis. In this study, we have established a zebrafish-Mycobacterium marinum natural host-pathogen model system to study induced protective immune responses in mycobacterial infection. We show that priming adult zebrafish with heat-killed Listeria monocytogenes (HKLm at 1 day prior to M. marinum infection leads to significantly decreased mycobacterial loads in the infected zebrafish. Using rag1−/− fish, we show that the protective immunity conferred by HKLm priming can be induced through innate immunity alone. At 24 h post-infection, HKLm priming leads to a significant increase in the expression levels of macrophage-expressed gene 1 (mpeg1, tumor necrosis factor α (tnfa and nitric oxide synthase 2b (nos2b, whereas superoxide dismutase 2 (sod2 expression is downregulated, implying that HKLm priming increases the number of macrophages and boosts intracellular killing mechanisms. The protective effects of HKLm are abolished when the injected material is pretreated with nucleases or proteinase K. Importantly, HKLm priming significantly increases the frequency of clearance of M. marinum infection by evoking sterilizing immunity (25 vs 3.7%, P=0.0021. In this study, immune priming is successfully used to induce sterilizing immunity against mycobacterial infection. This model provides a promising new platform for elucidating the mechanisms underlying sterilizing immunity and to develop host-directed treatment or prevention strategies against tuberculosis. This article has an associated First Person interview with the first author of the paper.

  11. Cell-mediated immune responses in the head-associated lymphoid tissues induced to a live attenuated avian coronavirus vaccine.

    Science.gov (United States)

    Gurjar, Rucha S; Gulley, Stephen L; van Ginkel, Frederik W

    2013-12-01

    Humoral immunity is important for controlling viral diseases of poultry, but recent studies have indicated that cytotoxic T cells also play an important role in the immune response to infectious bronchitis virus (IBV). To better understand the cell mediated immune responses to IBV in the mucosal and systemic immune compartments chickens were ocularly vaccinated with IBV. This induced a lymphocyte expansion in head-associated lymphoid tissues (HALT) and to a lesser extent in the spleen, followed by a rapid decline, probably due to homing of lymphocytes out of these organs and contraction of the lymphocyte population. This interpretation was supported by observations that changes in mononuclear cells were mirrored by that in CD3(+)CD44(+) T cell abundance, which presumably represent T effector cells. Increased interferon gamma (IFN-γ) expression was observed in the mucosal immune compartment, i.e., HALT, after primary vaccination, but shifted to the systemic immune compartment after boosting. In contrast, the expression of cytotoxicity-associated genes, i.e., granzyme A (GZMA) and perforin mRNA, remained associated with the HALT after boosting. Thus, an Ark-type IBV ocular vaccine induces a central memory IFN-γ response in the spleen while the cytotoxic effector memory response, as measured by GZMA and perforin mRNA expression, remains associated with CALT after boosting. Copyright © 2013. Published by Elsevier Ltd.

  12. Bifidobacterium longum CECT 7347 modulates immune responses in a gliadin-induced enteropathy animal model.

    Directory of Open Access Journals (Sweden)

    José Moisés Laparra

    Full Text Available Coeliac disease (CD is an autoimmune disorder triggered by gluten proteins (gliadin that involves innate and adaptive immunity. In this study, we hypothesise that the administration of Bifidobacterium longum CECT 7347, previously selected for reducing gliadin immunotoxic effects in vitro, could exert protective effects in an animal model of gliadin-induced enteropathy. The effects of this bacterium were evaluated in newborn rats fed gliadin alone or sensitised with interferon (IFN-γ and fed gliadin. Jejunal tissue sections were collected for histological, NFκB mRNA expression and cytokine production analyses. Leukocyte populations and T-cell subsets were analysed in peripheral blood samples. The possible translocation of the bacterium to different organs was determined by plate counting and the composition of the colonic microbiota was quantified by real-time PCR. Feeding gliadin alone reduced enterocyte height and peripheral CD4+ cells, but increased CD4+/Foxp3+ T and CD8+ cells, while the simultaneous administration of B. longum CECT 7347 exerted opposite effects. Animals sensitised with IFN-γ and fed gliadin showed high cellular infiltration, reduced villi width and enterocyte height. Sensitised animals also exhibited increased NFκB mRNA expression and TNF-α production in tissue sections. B. longum CECT 7347 administration increased NFκB expression and IL-10, but reduced TNF-α, production in the enteropathy model. In sensitised gliadin-fed animals, CD4+, CD4+/Foxp3+ and CD8+ T cells increased, whereas the administration of B. longum CECT 7347 reduced CD4+ and CD4+/Foxp3+ cell populations and increased CD8+ T cell populations. The bifidobacterial strain administered represented between 75-95% of the total bifidobacteria isolated from all treated groups, and translocation to organs was not detected. These findings indicate that B. longum attenuates the production of inflammatory cytokines and the CD4+ T-cell mediated immune response in

  13. Acute adaptive immune response correlates with late radiation-induced pulmonary fibrosis in mice

    International Nuclear Information System (INIS)

    Paun, Alexandra; Kunwar, Amit; Haston, Christina K

    2015-01-01

    The lung response to radiation exposure can involve an immediate or early reaction to the radiation challenge, including cell death and an initial immune reaction, and can be followed by a tissue injury response, of pneumonitis or fibrosis, to this acute reaction. Herein, we aimed to determine whether markers of the initial immune response, measured within days of radiation exposure, are correlated with the lung tissue injury responses occurring weeks later. Inbred strains of mice known to be susceptible (KK/HIJ, C57BL/6J, 129S1/SvImJ) or resistant (C3H/HeJ, A/J, AKR/J) to radiation-induced pulmonary fibrosis and to vary in time to onset of respiratory distress post thoracic irradiation (from 10–23 weeks) were studied. Mice were untreated (controls) or received 18 Gy whole thorax irradiation and were euthanized at 6 h, 1d or 7 d after radiation treatment. Pulmonary CD4+ lymphocytes, bronchoalveolar cell profile & cytokine level, and serum cytokine levels were assayed. Thoracic irradiation and inbred strain background significantly affected the numbers of CD4+ cells in the lungs and the bronchoalveolar lavage cell differential of exposed mice. At the 7 day timepoint greater numbers of pulmonary Th1 and Th17 lymphocytes and reduced lavage interleukin17 and interferonγ levels were significant predictors of late stage fibrosis. Lavage levels of interleukin-10, measured at the 7 day timepoint, were inversely correlated with fibrosis score (R = −0.80, p = 0.05), while serum levels of interleukin-17 in control mice significantly correlated with post irradiation survival time (R = 0.81, p = 0.04). Lavage macrophage, lymphocyte or neutrophil counts were not significantly correlated with either of fibrosis score or time to respiratory distress in the six mouse strains. Specific cytokine and lymphocyte levels, but not strain dependent lavage cell profiles, were predictive of later radiation-induced lung injury in this panel of inbred strains. The online version of this

  14. Experimental demonstration of a parasite-induced immune response in wild birds: Darwin's finches and introduced nest flies.

    Science.gov (United States)

    Koop, Jennifer A H; Owen, Jeb P; Knutie, Sarah A; Aguilar, Maria A; Clayton, Dale H

    2013-08-01

    Ecological immunology aims to explain variation among hosts in the strength and efficacy of immunological defenses. However, a shortcoming has been the failure to link host immune responses to actual parasites under natural conditions. Here, we present one of the first experimental demonstrations of a parasite-induced immune response in a wild bird population. The recently introduced ectoparasitic nest fly Philornis downsi severely impacts the fitness of Darwin's finches and other land birds in the Galápagos Islands. An earlier study showed that female medium ground finches (Geospiza fortis) had P. downsi-binding antibodies correlating with presumed variation in fly exposure over time. In the current study, we experimentally manipulated fly abundance to test whether the fly does, in fact, cause changes in antibody levels. We manipulated P. downsi abundance in nests and quantified P. downsi-binding antibody levels of medium ground finch mothers, fathers, and nestlings. We also quantified host behaviors, such as preening, which can integrate with antibody-mediated defenses against ectoparasites. Philornis downsi-binding antibody levels were significantly higher among mothers at parasitized nests, compared to mothers at (fumigated) nonparasitized nests. Mothers with higher antibody levels tended to have fewer parasites in their nests, suggesting that antibodies play a role in defense against parasites. Mothers showed no behavioral changes that would enhance the effectiveness of the immune response. Neither adult males, nor nestlings, had P. downsi-induced immunological or behavioral responses that would enhance defense against flies. None of the parasitized nests fledged any offspring, despite the immune response by mothers. Thus, this study shows that, while the immune response of mothers appeared to be defensive, it was not sufficient to rescue current reproductive fitness. This study further shows the importance of testing the fitness consequences of immune

  15. The impact of shift work induced chronic circadian disruption on IL-6 and TNF-α immune responses

    Directory of Open Access Journals (Sweden)

    Spallek Michael

    2010-07-01

    Full Text Available Abstract AIM Sleep disturbances induce proinflammatory immune responses, which might increase cardiovascular disease risk. So far the effects of acute sleep deprivation and chronic sleep illnesses on the immune system have been investigated. The particular impact of shift work induced chronic circadian disruption on specific immune responses has not been addressed so far. Methods Pittsburgh-Sleep-Quality-Index (PSQI questionnaire and blood sampling was performed by 225 shift workers and 137 daytime workers. As possible markers the proinflammatory cytokines IL-6 and TNF-α and lymphocyte cell count were investigated. A medical examination was performed and biometrical data including age, gender, height, weight, waist and hip circumference and smoking habits were collected by a structured interview. Results Shift workers had a significantly higher mean PSQI score than day workers (6.73 vs. 4.66; p Conclusion Shift work induces chronic sleep debt. Our data reveals that chronic sleep debt might not always lead to an activation of the immune system, as we did not observe differences in lymphocyte count or level of IL-6 or TNF-α serum concentration between shift workers and day workers. Therefore chronic sleep restriction might be eased by a long-term compensating immune regulation which (in healthy protects against an overstimulation of proinflammatory immune mechanisms and moderates metabolic changes, as they are known from short-term sleep deprivation or sleep related breathing disorders.

  16. Duox2-induced innate immune responses in the respiratory epithelium and intranasal delivery of Duox2 DNA using polymer that mediates immunization.

    Science.gov (United States)

    Jeon, Yung Jin; Kim, Hyun Jik

    2018-05-01

    Respiratory mucosa especially nasal epithelium is well known as the first-line barrier of air-borne pathogens. High levels of reactive oxygen species (ROS) are detected in in vitro cultured human epithelial cells and in vivo lung. With identification of NADPH oxidase (Nox) system of respiratory epithelium, the antimicrobial role of ROS has been studied. Duox2 is the most abundant Nox isoform and produces the regulated amount of ROS in respiratory epithelium. Duox2-derived ROS are involved in antiviral innate immune responses but more studies are needed to verify the mechanism. In respiratory epithelium, Duox2-derived ROS is critical for recognition of virus through families retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) at the early stage of antiviral innate immune responses. Various secreted interferons (IFNs) play essential roles for antiviral host defense by downstream cell signaling, and transcription of IFN-stimulated genes is started to suppress viral replication. Type I and type III IFNs are verified more responsible for influenza A virus (IAV) infection in respiratory epithelium and Duox2 is required to regulate IFN-related immune responses. Transient overexpression of Duox2 using cationic polymer polyethylenimine (PEI) induces secretion of type I and type III IFNs and significantly attenuated IAV replication in respiratory epithelium. Here, we discuss Duox2-mediated antiviral innate immune responses and the role of Duox2 as a mucosal vaccine to resist respiratory viral infection.

  17. Radiation Therapy Induces Macrophages to Suppress Immune Responses Against Pancreatic Tumors in Mice

    Science.gov (United States)

    Seifert, Lena; Werba, Gregor; Tiwari, Shaun; Ly, Nancy Ngoc Giao; Nguy, Susanna; Alothman, Sara; Alqunaibit, Dalia; Avanzi, Antonina; Daley, Donnele; Barilla, Rocky; Tippens, Daniel; Torres-Hernandez, Alejandro; Hundeyin, Mautin; Mani, Vishnu R.; Hajdu, Cristina; Pellicciotta, Ilenia; Oh, Philmo; Du, Kevin; Miller, George

    2016-01-01

    Background & Aims The role of radiation therapy in the treatment of patients with pancreatic ductal adenocarcinoma (PDA) is controversial. Randomized controlled trials investigating the efficacy of radiation therapy in patients with locally advanced unresectable PDA have reported mixed results, with effects ranging from modest benefit to worse outcome, compared with control therapies. We investigated whether radiation causes inflammatory cells to acquire an immune-suppressive phenotype that limits the therapeutic effects of radiation on invasive PDAs and accelerates progression of pre-invasive foci. Methods We investigated the effects of radiation in p48Cre;LSL-KrasG12D (KC) and p48Cre;LSLKrasG12D;LSL-Trp53R172H (KPC) mice, as well as in C57BL/6 mice with orthotopic tumors grown from FC1242 cells derived from KPC mice. Some mice were given neutralizing antibodies against macrophage colony stimulating factor 1 (CSF1 or MCSF) or F4/80. Pancreata were exposed to doses of radiation ranging from 2–12 Gy and analyzed by flow cytometry. Results Pancreata of KC mice exposed to radiation had a higher frequency of advanced pancreatic intraepithelial lesions and more foci of invasive cancer than pancreata of unexposed mice (controls); radiation reduced survival time by more than 6 months. A greater proportion of macrophages from invasive and pre-invasive pancreatic tumors had an immune-suppressive, M2-like phenotype, compared with control mice. Pancreata from mice exposed to radiation had fewer CD8+ T cells than controls and greater numbers of CD4+ T cells of T-helper 2 and T-regulatory cell phenotypes. Adoptive transfer of T cells from irradiated PDA to tumors of control mice accelerated tumor growth. Radiation induced production of MCSF by PDA cells. An antibody against MCSF prevented radiation from altering the phenotype of macrophages in tumors, increasing the anti-tumor T-cell response and slowing tumor growth. Conclusions Radiation exposure causes macrophages in PDAs

  18. Failure of orally administered attenuated goose parvovirus strain B to induce a humoral immune response in adult geese.

    Science.gov (United States)

    Kisary, J; Kelemen, M

    1981-01-01

    Two-month-old geese responded with the production of virus neutralising antibodies against virulent goose parvovirus strain B administered either per os or intramuscularly. They were shedding the virus within a short period after exposure. Humoral immune response in geese of the same age was induced by the attenuated goose parvovirus strain B only by intramuscular injection but not with per os administration.

  19. Previous 60-Co radiation from Paratrygon aiereba mucus induces the production of highly responsive antibodies and a better immune response in mice

    Energy Technology Data Exchange (ETDEWEB)

    Thomazi, Gabriela Ortega Coelho; Alves, Glaucie Jussilane; Turíbio, Thompson de Oliveira; Rocha, André Moreira; Aires, Raquel da Silva; Jácome, Larissa Barros Silvestre; Spencer, Patrick Jack, E-mail: gabiortegacoelho@usp.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil). Centro de Biotecnologia; Costa, Andrea da; Rodrigues, Jaqueline Pollizeli; Galisteo Júnior, Andrés Jimenez; Andrade Júnior, Heitor Franco de, E-mail: hfandrad@usp.br, E-mail: raquelaires@itpacporto.com.br [Universidade de São Paulo (USP), São Paulo, SP (Brazil). Laboratório de Protozoologia; Seibert, Carla Simone, E-mail: seibertcs@uft.edu.br [Universidade Federal do Tocantins (UFT), Porto Nacional, TO (Brazil)

    2017-07-01

    Wounds from stinging freshwater stingrays are painful, difficult to heal and cause extensive necrosis and systemic phenomena. The treatment is symptomatic, of low efficiency and there is no therapy, which causes more suffering to the injured. This study aimed to evaluate the immune response induced by the native or irradiated by 60-Co gamma from Paratrygon aiereba mucus. IPEN’s Committee on Ethics in the Use of Animals (n.º126/2013) and lanes captured under license from the Chico Mendes Institute for Biodiversity Conservation (n.º6781-1/2014) approved this research. For the assays, sera from Swiss mice previously immunized against native or irradiated mucus were used. The proliferation of splenic B cells in response to mucus was evaluated by the In Vitro Induced Antibody Production method and serum and splenic cytokines were also quantified. Our data demonstrate that the irradiated mucus of P. aiereba induces greater production of antibodies and more immunological memory in the mice. Spleen cells from animals immunized against irradiated mucus produced IFN-γ, TNF-α and IL-10, and serum TNF-α (immunized group against irradiated mucus) and IL-6 and IL-17 (immunized group against native mucus). The results corroborate the use of ionizing radiation, with production of highly responsive antibodies and better immune response, besides proving that Paratrygon aiereba mucus is capable of stimulating cellular and humoral adaptive immune response, contributing to the continuity of associated investigations. (author)

  20. Previous 60-Co radiation from Paratrygon aiereba mucus induces the production of highly responsive antibodies and a better immune response in mice

    International Nuclear Information System (INIS)

    Thomazi, Gabriela Ortega Coelho; Alves, Glaucie Jussilane; Turíbio, Thompson de Oliveira; Rocha, André Moreira; Aires, Raquel da Silva; Jácome, Larissa Barros Silvestre; Spencer, Patrick Jack

    2017-01-01

    Wounds from stinging freshwater stingrays are painful, difficult to heal and cause extensive necrosis and systemic phenomena. The treatment is symptomatic, of low efficiency and there is no therapy, which causes more suffering to the injured. This study aimed to evaluate the immune response induced by the native or irradiated by 60-Co gamma from Paratrygon aiereba mucus. IPEN’s Committee on Ethics in the Use of Animals (n.º126/2013) and lanes captured under license from the Chico Mendes Institute for Biodiversity Conservation (n.º6781-1/2014) approved this research. For the assays, sera from Swiss mice previously immunized against native or irradiated mucus were used. The proliferation of splenic B cells in response to mucus was evaluated by the In Vitro Induced Antibody Production method and serum and splenic cytokines were also quantified. Our data demonstrate that the irradiated mucus of P. aiereba induces greater production of antibodies and more immunological memory in the mice. Spleen cells from animals immunized against irradiated mucus produced IFN-γ, TNF-α and IL-10, and serum TNF-α (immunized group against irradiated mucus) and IL-6 and IL-17 (immunized group against native mucus). The results corroborate the use of ionizing radiation, with production of highly responsive antibodies and better immune response, besides proving that Paratrygon aiereba mucus is capable of stimulating cellular and humoral adaptive immune response, contributing to the continuity of associated investigations. (author)

  1. Strains of bacterial species induce a greatly varied acute adaptive immune response: The contribution of the accessory genome.

    Directory of Open Access Journals (Sweden)

    Uri Sela

    2018-01-01

    Full Text Available A fundamental question in human susceptibility to bacterial infections is to what extent variability is a function of differences in the pathogen species or in individual humans. To focus on the pathogen species, we compared in the same individual the human adaptive T and B cell immune response to multiple strains of two major human pathogens, Staphylococcus aureus and Streptococcus pyogenes. We found wide variability in the acute adaptive immune response induced by various strains of a species, with a unique combination of activation within the two arms of the adaptive response. Further, this was also accompanied by a dramatic difference in the intensity of the specific protective T helper (Th response. Importantly, the same immune response differences induced by the individual strains were maintained across multiple healthy human donors. A comparison of isogenic phage KO strains, demonstrated that of the pangenome, prophages were the major contributor to inter-strain immune heterogeneity, as the T cell response to the remaining "core genome" was noticeably blunted. Therefore, these findings extend and modify the notion of an adaptive response to a pathogenic bacterium, by implying that the adaptive immune response signature of a bacterial species should be defined either per strain or alternatively to the species' 'core genome', common to all of its strains. Further, our results demonstrate that the acquired immune response variation is as wide among different strains within a single pathogenic species as it is among different humans, and therefore may explain in part the clinical heterogeneity observed in patients infected with the same species.

  2. Immunization of Mice with a Live Transconjugant Shigella Hybrid Strain Induced Th1 and Th17 Cell-Mediated Immune Responses and Confirmed Passive Protection Against Heterologous Shigellae.

    Science.gov (United States)

    Nag, D; Koley, H; Sinha, R; Mukherjee, P; Sarkar, C; Withey, J H; Gachhui, R

    2016-02-01

    An avirulent, live transconjugant Shigella hybrid (LTSHΔstx) strain was constructed in our earlier study by introducing a plasmid vector, pPR1347, into a Shiga toxin gene deleted Shigella dysenteriae 1. Three successive oral administrations of LTSHΔstx to female adult mice produced comprehensive passive heterologous protection in their offspring against challenge with wild-type shigellae. Production of NO and different cytokines such asIL-12p70, IL-1β and IL-23 in peritoneal mice macrophages indicated that LTSHΔstx induced innate and adaptive immunity in mice. Furthermore, production of IFN-γ, IL-10 and IL-17 in LTSH-primed splenic CD4+ T cell suggested that LTSHΔstx may induce Th1 and Th17 cell-mediated immune responses. Exponential increase of the serum IgG and IgA titre against whole shigellae was observed in immunized adult mice during and after the immunization with the highest peak on day 35. Antigen-specific sIgA was also determined from intestinal lavage of immunized mice. The stomach extracts of neonates from immunized mice, mainly containing mother's milk, contained significant levels of anti-LTSHΔstx immunoglobulin. These studies suggest that the LTSHΔstx could be a new live oral vaccine candidate against shigellosis in the near future. © 2015 The Foundation for the Scandinavian Journal of Immunology.

  3. An immunoproteomic approach revealing peptides from Sporothrix brasiliensis that induce a cellular immune response in subcutaneous sporotrichosis.

    Science.gov (United States)

    de Almeida, José Roberto Fogaça; Jannuzzi, Grasielle Pereira; Kaihami, Gilberto Hideo; Breda, Leandro Carvalho Dantas; Ferreira, Karen Spadari; de Almeida, Sandro Rogério

    2018-03-08

    Sporothrix brasiliensis is the most virulent fungus of the Sporothrix complex and is the main species recovered in the sporotrichosis zoonotic hyperendemic area in Rio de Janeiro. A vaccine against S. brasiliensis could improve the current sporotrichosis situation. Here, we show 3 peptides from S. brasiliensis immunogenic proteins that have a higher likelihood for engaging MHC-class II molecules. We investigated the efficiency of the peptides as vaccines for preventing subcutaneous sporotrichosis. In this study, we observed a decrease in lesion diameters in peptide-immunized mice, showing that the peptides could induce a protective immune response against subcutaneous sporotrichosis. ZR8 peptide is from the GP70 protein, the main antigen of the Sporothrix complex, and was the best potential vaccine candidate by increasing CD4 + T cells and higher levels of IFN-γ, IL-17A and IL-1β characterizing a strong cellular immune response. This immune environment induced a higher number of neutrophils in lesions that are associated with fungus clearance. These results indicated that the ZR8 peptide induces a protective immune response against subcutaneous sporotrichosis and is a vaccine candidate against S. brasiliensis infection.

  4. Streptozotocin induced oxidative stress, innate immune system responses and behavioral abnormalities in male mice.

    Science.gov (United States)

    Amiri, Shayan; Haj-Mirzaian, Arya; Momeny, Majid; Amini-Khoei, Hossein; Rahimi-Balaei, Maryam; Poursaman, Simin; Rastegar, Mojgan; Nikoui, Vahid; Mokhtari, Tahmineh; Ghazi-Khansari, Mahmoud; Hosseini, Mir-Jamal

    2017-01-06

    Recent evidence indicates the involvement of inflammatory factors and mitochondrial dysfunction in the etiology of psychiatric disorders such as anxiety and depression. To investigate the possible role of mitochondrial-induced sterile inflammation in the co-occurrence of anxiety and depression, in this study, we treated adult male mice with the intracerebroventricular (i.c.v.) infusion of a single low dose of streptozotocin (STZ, 0.2mg/mouse). Using valid and qualified behavioral tests for the assessment of depressive and anxiety-like behaviors, we showed that STZ-treated mice exhibited behaviors relevant to anxiety and depression 24h following STZ treatment. We observed that the co-occurrence of anxiety and depressive-like behaviors in animals were associated with abnormal mitochondrial function, nitric oxide overproduction and, the increased activity of cytosolic phospholipase A 2 (cPLA 2 ) in the hippocampus. Further, STZ-treated mice had a significant upregulation of genes associated with the innate immune system such as toll-like receptors 2 and 4. Pathological evaluations showed no sign of neurodegeneration in the hippocampus of STZ-treated mice. Results of this study revealed that behavioral abnormalities provoked by STZ, as a cytotoxic agent that targets mitochondria and energy metabolism, are associated with abnormal mitochondrial activity and, consequently the initiation of innate-inflammatory responses in the hippocampus. Our findings highlight the role of mitochondria and innate immunity in the formation of sterile inflammation and behaviors relevant to anxiety and depression. Also, we have shown that STZ injection (i.c.v.) might be an animal model for depression and anxiety disorders based on sterile inflammation. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Immune response to UV-induced tumors: mediation of progressor tumor rejection by natural killer cells

    International Nuclear Information System (INIS)

    Streeter, P.R.; Fortner, G.W.

    1986-01-01

    Skin tumors induced in mice by chronic ultraviolet (UV) irradiation are highly antigenic and can induce a state of transplantation immunity in syngeneic animals. In the present study, the authors compared the in vitro cytolytic activity of splenic lymphocytes from mice immunized with either regressor or progressor UV-tumors. The results of this comparison implicated tumor-specific cytolytic T (Tc) lymphocytes in rejection of regressor UV-tumors, and revealed that immunization with the progressor UV-tumor 2237 failed to elicit detectable levels of progressor tumor-specific Tc cells even as the tumors rejected. Following in vitro resensitization of spleen cells from either regressor or progressor tumor immune animals, the authors found NK-like lymphocytes with anti-tumor activity. As the authors had not detected cells with this activity in splenic lymphocyte preparations prior to in vitro resensitization, the authors examined lymphocytes from the local tumor environment during the course of progressor tumor rejection for this activity. This analysis revealed NK lymphocytes exhibiting significant levels of cytolytic activity against UV-tumors. These results implicate NK cells as potential effector cells in the rejection of progressor UV-tumors by immune animals, and suggests that these cells may be regulated by T lymphocytes

  6. Recombinant Lactobacillus plantarum induces immune responses to cancer testis antigen NY-ESO-1 and maturation of dendritic cells

    Science.gov (United States)

    Mobergslien, Anne; Vasovic, Vlada; Mathiesen, Geir; Fredriksen, Lasse; Westby, Phuong; Eijsink, Vincent GH; Peng, Qian; Sioud, Mouldy

    2015-01-01

    Given their safe use in humans and inherent adjuvanticity, Lactic Acid Bacteria may offer several advantages over other mucosal delivery strategies for cancer vaccines. The objective of this study is to evaluate the immune responses in mice after oral immunization with Lactobacillus (L) plantarum WCFS1 expressing a cell-wall anchored tumor antigen NY-ESO-1. And to investigate the immunostimulatory potency of this new candidate vaccine on human dendritic cells (DCs). L. plantarum displaying NY-ESO-1 induced NY-ESO-1 specific antibodies and T-cell responses in mice. By contrast, L. plantarum displaying conserved proteins such as heat shock protein-27 and galectin-1, did not induce immunity, suggesting that immune tolerance to self-proteins cannot be broken by oral administration of L. plantarum. With respect to immunomodulation, immature DCs incubated with wild type or L. plantarum-NY-ESO-1 upregulated the expression of co-stimulatory molecules and secreted a large amount of interleukin (IL)-12, TNF-α, but not IL-4. Moreover, they upregulated the expression of immunosuppressive factors such as IL-10 and indoleamine 2,3-dioxygenase. Although L. plantarum-matured DCs expressed inhibitory molecules, they stimulated allogeneic T cells in-vitro. Collectively, the data indicate that L. plantarum-NY-ESO-1 can evoke antigen-specific immunity upon oral administration and induce DC maturation, raising the potential of its use in cancer immunotherapies. PMID:26185907

  7. Immune responses to metastases

    International Nuclear Information System (INIS)

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.

    1987-01-01

    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors

  8. Two doses of bovine viral diarrhea virus DNA vaccine delivered by electroporation induce long-term protective immune responses.

    Science.gov (United States)

    van Drunen Littel-van den Hurk, Sylvia; Lawman, Zoe; Snider, Marlene; Wilson, Don; van den Hurk, Jan V; Ellefsen, Barry; Hannaman, Drew

    2013-02-01

    Bovine viral diarrhea virus (BVDV) is a pathogen of major importance in cattle, so there is a need for new effective vaccines. DNA vaccines induce balanced immune responses and are relatively inexpensive and thus promising for both human and veterinary applications. In this study, newborn calves with maternal antibodies were vaccinated intramuscularly (i.m.) with a BVDV E2 DNA vaccine with the TriGrid Delivery System for i.m. delivery (TDS-IM). Two doses of this vaccine spaced 6 or 12 weeks apart were sufficient to induce significant virus-neutralizing antibody titers, numbers of activated T cells, and reduction in viral shedding and clinical presentations after BVDV-2 challenge. In contrast to the placebo-treated animals, the vaccinated calves did not lose any weight, which is an excellent indicator of the well-being of an animal and has a significant economic impact. Furthermore, the interval between the two vaccinations did not influence the magnitude of the immune responses or degree of clinical protection, and a third immunization was not necessary or beneficial. Since electroporation may enhance not only the magnitude but also the duration of immunity after DNA immunization, the interval between vaccination and challenge was extended in a second trial, which showed that two doses of this E2 DNA vaccine again significantly reduced clinical disease against BVDV for several months. These results are promising and support this technology for use against infectious diseases in cattle and large species, including humans, in general.

  9. Innate immune responses induced by lipopolysaccharide and lipoteichoic acid in primary goat mammary epithelial cells.

    Science.gov (United States)

    Bulgari, Omar; Dong, Xianwen; Roca, Alfred L; Caroli, Anna M; Loor, Juan J

    2017-01-01

    Innate immune responses induced by in vitro stimulation of primary mammary epithelial cells (MEC) using Gram-negative lipopolysaccharide (LPS) and Gram-positive lipoteichoic acid (LTA) bacterial cell wall components are well- characterized in bovine species. The objective of the current study was to characterize the downstream regulation of the inflammatory response induced by Toll-like receptors in primary goat MEC (pgMEC). We performed quantitative real-time RT-PCR (qPCR) to measure mRNA levels of 9 genes involved in transcriptional regulation or antibacterial activity: Toll-like receptor 2 ( TLR2 ), Toll-like receptor 4 ( TLR4 ), prostaglandin-endoperoxide synthase 2 ( PTGS2 ), interferon induced protein with tetratricopeptide repeats 3 ( IFIT3 ), interferon regulatory factor 3 ( IRF3 ), myeloid differentiation primary response 88 ( MYD88 ), nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 ( NFKB1 ), Toll interacting protein ( TOLLIP ), and lactoferrin ( LTF ). Furthermore, we analyzed 7 cytokines involved in Toll-like receptor signaling pathways: C-C motif chemokine ligand 2 ( CCL2 ), C-C motif chemokine ligand 5 ( CCL5 ), C-X-C motif chemokine ligand 6 ( CXCL6 ), interleukin 8 ( CXCL8 ), interleukin 1 beta ( IL1B ), interleukin 6 ( IL6 ), and tumor necrosis factor alpha ( TNF ). Stimulation of pgMEC with LPS for 3 h led to an increase in expression of CCL2 , CXCL6 , IL6 , CXCL8 , PTGS2 , IFIT3 , MYD88 , NFKB1 , and TLR4 ( P  < 0.05). Except for IL6 , and PTGS2 , the same genes had greater expression than controls at 6 h post-LPS ( P  < 0.05). Expression of CCL5 , PTGS2 , IFIT3 , NFKB1 , TLR4 , and TOLLIP was greater than controls after 3 h of incubation with LTA ( P  < 0.05). Compared to controls, stimulation with LTA for 6 h led to greater expression of PTGS2 , IFIT3 , NFKB1 , and TOLLIP ( P  < 0.05) whereas the expression of CXCL6 , CXCL8 , and TLR4 was lower ( P  < 0.05). At 3 h incubation with both toxins

  10. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100-Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    NARCIS (Netherlands)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery

  11. Sustained and transient oscillations and chaos induced by delayed antiviral immune response in an immunosuppressive infection model.

    Science.gov (United States)

    Shu, Hongying; Wang, Lin; Watmough, James

    2014-01-01

    Sustained and transient oscillations are frequently observed in clinical data for immune responses in viral infections such as human immunodeficiency virus, hepatitis B virus, and hepatitis C virus. To account for these oscillations, we incorporate the time lag needed for the expansion of immune cells into an immunosuppressive infection model. It is shown that the delayed antiviral immune response can induce sustained periodic oscillations, transient oscillations and even sustained aperiodic oscillations (chaos). Both local and global Hopf bifurcation theorems are applied to show the existence of periodic solutions, which are illustrated by bifurcation diagrams and numerical simulations. Two types of bistability are shown to be possible: (i) a stable equilibrium can coexist with another stable equilibrium, and (ii) a stable equilibrium can coexist with a stable periodic solution.

  12. HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin

    Science.gov (United States)

    Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago

    2014-01-01

    AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN

  13. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    Science.gov (United States)

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Mycoplasma hyopneumoniae and Mycoplasma flocculare differential domains from orthologous surface proteins induce distinct cellular immune responses in mice.

    Science.gov (United States)

    Leal, Fernanda Munhoz Dos Anjos; Virginio, Veridiana Gomes; Martello, Carolina Lumertz; Paes, Jéssica Andrade; Borges, Thiago J; Jaeger, Natália; Bonorino, Cristina; Ferreira, Henrique Bunselmeyer

    2016-07-15

    Mycoplasma hyopneumoniae and Mycoplasma flocculare are two genetically close species found in the swine respiratory tract. Despite their similarities, while M. hyopneumoniae is the causative agent of porcine enzootic pneumonia, M. flocculare is a commensal bacterium. Genomic and transcriptional comparative analyses so far failed to explain the difference in pathogenicity between these two species. We then hypothesized that such difference might be, at least in part, explained by amino acid sequence and immunological or functional differences between ortholog surface proteins. In line with that, it was verified that approximately 85% of the ortholog surface proteins from M. hyopneumoniae 7448 and M. flocculare present one or more differential domains. To experimentally assess possible immunological implications of this kind of difference, the extracellular differential domains from one pair of orthologous surface proteins (MHP7448_0612, from M. hyopneumoniae, and MF_00357, from M. flocculare) were expressed in E. coli and used to immunize mice. The recombinant polypeptides (rMHP61267-169 and rMF35767-196, respectively) induced distinct cellular immune responses. While, rMHP61267-169 induced both Th1 and Th2 responses, rMF35767-196 induced just an early pro-inflammatory response. These results indicate that immunological properties determined by differential domains in orthologous surface protein might play a role in pathogenicity, contributing to elicit specific and differential immune responses against each species. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. New gorilla adenovirus vaccine vectors induce potent immune responses and protection in a mouse malaria model.

    Science.gov (United States)

    Limbach, Keith; Stefaniak, Maureen; Chen, Ping; Patterson, Noelle B; Liao, Grant; Weng, Shaojie; Krepkiy, Svetlana; Ekberg, Greg; Torano, Holly; Ettyreddy, Damodar; Gowda, Kalpana; Sonawane, Sharvari; Belmonte, Arnel; Abot, Esteban; Sedegah, Martha; Hollingdale, Michael R; Moormann, Ann; Vulule, John; Villasante, Eileen; Richie, Thomas L; Brough, Douglas E; Bruder, Joseph T

    2017-07-03

    A DNA-human Ad5 (HuAd5) prime-boost malaria vaccine has been shown to protect volunteers against a controlled human malaria infection. The potency of this vaccine, however, appeared to be affected by the presence of pre-existing immunity against the HuAd5 vector. Since HuAd5 seroprevalence is very high in malaria-endemic areas of the world, HuAd5 may not be the most appropriate malaria vaccine vector. This report describes the evaluation of the seroprevalence, immunogenicity and efficacy of three newly identified gorilla adenoviruses, GC44, GC45 and GC46, as potential malaria vaccine vectors. The seroprevalence of GC44, GC45 and GC46 is very low, and the three vectors are not efficiently neutralized by human sera from Kenya and Ghana, two countries where malaria is endemic. In mice, a single administration of GC44, GC45 and GC46 vectors expressing a murine malaria gene, Plasmodium yoelii circumsporozoite protein (PyCSP), induced robust PyCSP-specific T cell and antibody responses that were at least as high as a comparable HuAd5-PyCSP vector. Efficacy studies in a murine malaria model indicated that a prime-boost regimen with DNA-PyCSP and GC-PyCSP vectors can protect mice against a malaria challenge. Moreover, these studies indicated that a DNA-GC46-PyCSP vaccine regimen was significantly more efficacious than a DNA-HuAd5-PyCSP regimen. These data suggest that these gorilla-based adenovectors have key performance characteristics for an effective malaria vaccine. The superior performance of GC46 over HuAd5 highlights its potential for clinical development.

  16. Uropathogenic E. coli induce different immune response in testicular and peritoneal macrophages: implications for testicular immune privilege.

    Directory of Open Access Journals (Sweden)

    Sudhanshu Bhushan

    Full Text Available Infertility affects one in seven couples and ascending bacterial infections of the male genitourinary tract by Escherichia coli are an important cause of male factor infertility. Thus understanding mechanisms by which immunocompetent cells such as testicular macrophages (TM respond to infection and how bacterial pathogens manipulate defense pathways is of importance. Whole genome expression profiling of TM and peritoneal macrophages (PM infected with uropathogenic E. coli (UPEC revealed major differences in regulated genes. However, a multitude of genes implicated in calcium signaling pathways was a common feature which indicated a role of calcium-dependent nuclear factor of activated T cells (NFAT signaling. UPEC-dependent NFAT activation was confirmed in both cultured TM and in TM in an in vivo UPEC infectious rat orchitis model. Elevated expression of NFATC2-regulated anti-inflammatory cytokines was found in TM (IL-4, IL-13 and PM (IL-3, IL-4, IL-13. NFATC2 is activated by rapid influx of calcium, an activity delineated to the pore forming toxin alpha-hemolysin by bacterial mutant analysis. Alpha-hemolysin suppressed IL-6 and TNF-α cytokine release from PM and caused differential activation of MAP kinase and AP-1 signaling pathways in TM and PM leading to reciprocal expression of key pro-inflammatory cytokines in PM (IL-1α, IL-1β, IL-6 downregulated and TM (IL-1β, IL-6 upregulated. In addition, unlike PM, LPS-treated TM were refractory to NFκB activation shown by the absence of degradation of IκBα and lack of pro-inflammatory cytokine secretion (IL-6, TNF-α. Taken together, these results suggest a mechanism to the conundrum by which TM initiate immune responses to bacteria, while maintaining testicular immune privilege with its ability to tolerate neo-autoantigens expressed on developing spermatogenic cells.

  17. Colorectal irradiation induced immune response: 'toll like receptors' therapeutic manipulation

    International Nuclear Information System (INIS)

    Lacave-Lapalun, Jean-Victor

    2013-01-01

    Exposure of the abdomino-pelvic sphere to ionizing radiation is associated with a high incidence of complications. Radiation therapy may cause short and / or long-term harmful effects. In the most severe cases and in the absence of heavy treatments, the appearance of ulcers may induce the death of patients. Clinical trials are being conducted with Mesenchymal Stem Cells (MSC) to cure theses complications. Others studies indicate that the injection of bacterial motifs limits the radiotoxicity in the intestine. They stimulate receptors (Toll-Like- Receptors (TLR)) located on the surface of epithelial and intestinal immune cells. The first aim of this doctoral work is to characterize the effects of TLR stimulation on immunity and tissue repair using a model of localized colorectal irradiation at 20 Gy (acute effects of radiotherapy) on a rat. The thesis then aims to potentiate the effects of the MSC treatment when adding TLR ligands upon localized colorectal irradiation at 27 Gy (accidental complications). This work, using a 20 Gy exposure, show that TLR stimulation improves homeostasis (normalization of T cells, induction of regulatory T cells (Treg) and macrophages 'anti-inflammatory' M2). On the 27 Gy colorectal model, the injection of TLR ligand before CSM transplant improves the immune climate by reducing pro-inflammatory cytokines and inducting Treg and M2 cells. These modulations could contribute to improving the implantation and effectiveness of CSM. The observations have all shown that the stimulation of immunity is an approach to minimize radiation-induced lesions. (author) [fr

  18. Mechanical stress induces neuroendocrine and immune responses of sea cucumber ( Apostichopus japonicus)

    Science.gov (United States)

    Tan, Jie; Li, Fenghui; Sun, Huiling; Gao, Fei; Yan, Jingping; Gai, Chunlei; Chen, Aihua; Wang, Qingyin

    2015-04-01

    Grading procedure in routine sea cucumber hatchery production is thought to affect juvenile sea cucumber immunological response. The present study investigated the impact of a 3-min mechanical perturbation mimicking the grading procedure on neuroendocrine and immune parameters of the sea cucumber Apostichopus japonicus. During the application of stress, concentrations of noradrenaline and dopamine in coelomic fluid increased significantly, indicating that the mechanical perturbation resulted in a transient state of stress in sea cucumbers. Coelomocytes concentration in coelomic fluid increased transiently after the beginning of stressing, and reached the maximum in 1 h. Whereas, coelomocytes phagocytosis at 3 min, superoxide anion production from 3 min to 0.5 h, acid phosphatase activity at 0.5 h, and phenoloxidase activity from 3 min to 0.5 h were all significantly down-regulated. All of the immune parameters recovered to baseline levels after the experiment was conducted for 8 h, and an immunostimulation occurred after the stress considering the phagocytosis and acid phosphatase activity. The results suggested that, as in other marine invertebrates, neuroendocrine/immune connections exist in sea cucumber A. japonicus. Mechanical stress can elicit a profound influence on sea cucumber neuroendocrine system. Neuroendocrine messengers act in turn to modulate the immunity functions. Therefore, these effects should be considered for developing better husbandry procedures.

  19. The Mycoplasma hyopneumoniae recombinant heat shock protein P42 induces an immune response in pigs under field conditions.

    Science.gov (United States)

    Jorge, Sérgio; de Oliveira, Natasha Rodrigues; Marchioro, Silvana Beutinger; Fisch, Andressa; Gomes, Charles Klazer; Hartleben, Cláudia Pinho; Conceição, Fabricio Rochedo; Dellagostin, Odir Antonio

    2014-09-01

    Enzootic pneumonia (EP), resulting from Mycoplasma hyopneumoniae infection is one of the most prevalent diseases in pigs and is a major cause of economic losses to the swine industry worldwide. EP is often controlled by vaccination with inactivated, adjuvanted whole-cell bacterin. However, these bacterins provide only partial protection and do not prevent M. hyopneumoniae colonization. Attempts to develop vaccines that are more efficient have made use of the recombinant DNA technology. The objective of this study was to assess the potential of recombinant M. hyopneumoniae heat shock protein P42 in vaccine preparations against EP, using piglets housed under field conditions in a M. hyopneumoniae-positive farm. The cellular and humoral immune responses were elicited after a single intramuscular inoculation of rP42 in an oil-based adjuvant, or in conjunction with whole-cell vaccine preparation. The production of INF-γ and IL-10 cytokines was quantified in the supernatant of the cultured mononuclear cells. The rP42 emulsified in oil-based adjuvant was able to trigger a strong humoral immune response. Further, it induced a cellular immune response, accompanied by the production of antibodies that reacted with the native M. hyopneumoniae protein. The rP42 mediated induction of cellular and humoral immune response in the host suggests that rP42 emulsified in an oil-based adjuvant holds promise as an effective recombinant subunit vaccine against EP. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Immune responses induced by recombinant Bacillus subtilis expressing the spike protein of transmissible gastroenteritis virus in pigs.

    Science.gov (United States)

    Mou, Chunxiao; Zhu, Liqi; Xing, Xianping; Lin, Jian; Yang, Qian

    2016-07-01

    Transmissible gastroenteritis (TGE) causes severe diarrhea in suckling piglets, results in enormous economic loss in swine-producing areas of the world. To develop an effective, safe, and convenient vaccine for the prevention of TGE, we have constructed a recombinant Bacillus subtilis strain (B. subtilis CotGSG) displaying the transmissible gastroenteritis virus (TGEV) spike (S) protein and discussed its immune function to intestinal submucosal dendritic cells (DCs). Our results showed that the recombinant B. subtilis had the ability to recruit more DCs to sample B. subtilis CotGSG, migrate to MLNs, and induce immune responses. Immunized piglets with B. subtilis CotGSG could significantly elevate the specific SIgA titers in feces, IgG titers and neutralizing antibodies in serum. Collectively, our results suggested that recombinant B. subtilis CotGSG expressing the TGEV S protein could effectively induce immune responses via DCs, and provided a perspective on potential novel strategy and approach that may be applicable to the development of the next generation of TGEV vaccines. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Two complex, adenovirus-based vaccines that together induce immune responses to all four dengue virus serotypes.

    Science.gov (United States)

    Holman, David H; Wang, Danher; Raviprakash, Kanakatte; Raja, Nicholas U; Luo, Min; Zhang, Jianghui; Porter, Kevin R; Dong, John Y

    2007-02-01

    Dengue virus infections can cause hemorrhagic fever, shock, encephalitis, and even death. Worldwide, approximately 2.5 billion people live in dengue-infested regions with about 100 million new cases each year, although many of these infections are believed to be silent. There are four antigenically distinct serotypes of dengue virus; thus, immunity from one serotype will not cross-protect from infection with the other three. The difficulties that hamper vaccine development include requirements of the natural conformation of the envelope glycoprotein to induce neutralizing immune responses and the necessity of presenting antigens of all four serotypes. Currently, the only way to meet these requirements is to use a mixture of four serotypes of live attenuated dengue viruses, but safety remains a major problem. In this study, we have developed the basis for a tetravalent dengue vaccine using a novel complex adenovirus platform that is capable of expressing multiple antigens de novo. This dengue vaccine is constructed as a pair of vectors that each expresses the premembrane and envelope genes of two different dengue virus serotypes. Upon vaccination, the vaccine expressed high levels of the dengue virus antigens in cells to mimic a natural infection and induced both humoral and cellular immune responses against multiple serotypes of dengue virus in an animal model. Further analyses show the humoral responses were indeed neutralizing against all four serotypes. Our studies demonstrate the concept of mimicking infections to induce immune responses by synthesizing dengue virus membrane antigens de novo and the feasibility of developing an effective tetravalent dengue vaccine by vector-mediated expression of glycoproteins of the four serotypes.

  2. Aryl Hydrocarbon Receptor (AhR Modulates Cockroach Allergen-Induced Immune Responses through Active TGFβ1 Release

    Directory of Open Access Journals (Sweden)

    Yufeng Zhou

    2014-01-01

    Full Text Available Background. Aryl hydrocarbon receptor (AhR, a multifunctional regulator that senses and responds to environmental stimuli, plays a role in normal cell development and immune regulation. Recent evidence supports a significant link between environmental exposure and AhR in the development of allergic diseases. We sought to investigate whether AhR plays a role in mediating cockroach allergen-induced allergic immune responses. Methods. AhR expression in human lung fibroblasts from asthmatic and healthy individuals and in cockroach extract (CRE treated human lung fibroblasts (WI-38 was examined. The role of AhR in modulating CRE induced TGFβ1 production was investigated by using AhR agonist, TCDD, antagonist CH122319, and knockdown of AhR. The role of latent TGFβ1 binding protein-1 (LTBP1 in mediating TCDD induced active TGFβ1 release was also examined. Results. AhR expression was higher in airway fibroblasts from asthmatic subjects as compared to healthy controls. AhR in fibroblasts was activated by TCDD with an increased expression of cyp1a1 and cyp1b1. Increased AhR expression was observed in CRE-treated fibroblasts. Importantly, CRE induced TGFβ1 production in fibroblasts was significantly enhanced by TCDD but inhibited by CH122319. Reduced TGFβ1 production was further confirmed in fibroblasts with AhR knockdown. Moreover, AhR knockdown inhibited CRE induced fibroblast differentiation. Furthermore, TCDD induced active TGFβ1 release was significantly inhibited by LTBP1 knockdown. Conclusion. These results provide evidence for the role of AhR in modulating cockroach allergen-induced immune responses through controlling the active TGFβ1 release, suggesting a possible synergistic effect between exposure to allergens and environmental chemicals on the development of allergic diseases.

  3. Mechanism study of tumor-specific immune responses induced by laser immunotherapy

    Science.gov (United States)

    Li, Xiaosong; Zhou, Feifan; Le, Henry; Wolf, Roman F.; Howard, Eric; Nordquist, Robert E.; Hode, Tomas; Liu, Hong; Chen, Wei R.

    2011-03-01

    Laser immunotherapy (LIT) has shown its efficacy against late-stage, metastatic cancers, both in pre-clinical studies and clinical pilot trials. However, the possible mechanism of LIT is still not fully understood. In our previous studies, we have shown that LIT induces tumor-specific antibodies that strongly bind to the target tumors. Tumor resistance in cured animals demonstrated long-term immunological effect of LIT. Successful transfer of adoptive immunity using spleen cells from LIT-cured animals indicated a long-term immunological memory of the host system. In clinical trials for the treatment of late-stage melanoma patients and breast cancer patients, the similar long-term, systemic effects have also been observed. To further study the immunological mechanism of LIT, immuno-histochemical analysis of patient tumor samples has performed before and after LIT treatment. Our results showed strong evidence that LIT significantly increases the infiltration of immune cells in the target tumors. Specifically, LIT appeared to drive the infiltrating immune cell populations in the direction of CD4, CD8 and CD68 T-cells. It is possible that activation and enhancement of both humeral and cellular arms of the host immune system are achievable by the treatment of LIT. These special features of LIT have contributed to the success of patient treatment. The underlying mechanism of LIT appears to be an in-situ autologous whole-cell cancer vaccination, using all components of tumors as sources of tumor antigens. Our preliminary mechanistic studies and future in-depth studies will contribute to the understanding and development of LIT as an effective modality for the treatment of late stage cancer patients who are facing severely limited options.

  4. Pre-existing vector immunity does not prevent replication deficient adenovirus from inducing efficient CD8 T-cell memory and recall responses

    DEFF Research Database (Denmark)

    Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech; Holst, Peter Johannes

    2012-01-01

    directed against epitopes in the adenoviral vector seemed to correlate with repression of the induced response in re-vaccinated B-cell deficient mice. More importantly, despite a repressed primary effector CD8 T-cell response in Ad5-immune animals subjected to vaccination, memory T cells were generated...... that provided the foundation for an efficient recall response and protection upon subsequent viral challenge. Furthermore, the transgene specific response could be efficiently boosted by homologous re-immunization. Taken together, these studies indicate that adenoviral vectors can be used to induce efficient CD......8 T-cell memory even in individuals with pre-existing vector immunity....

  5. Enhancement of immune response induced by DNA vaccine cocktail expressing complete LACK and TSA genes against Leishmania major.

    Science.gov (United States)

    Ghaffarifar, Fatemeh; Jorjani, Ogholniaz; Sharifi, Zohreh; Dalimi, Abdolhossein; Hassan, Zuhair M; Tabatabaie, Fatemeh; Khoshzaban, Fariba; Hezarjaribi, Hajar Ziaei

    2013-04-01

    Leishmaniasis is an important disease in humans. Leishmania homologue of receptor for Activated C Kinase (LACK) and thiol specific antioxidant (TSA) as immuno-dominant antigens of Leishmania major are considered the most promising molecules for a DNA vaccine. We constructed a DNA cocktail, containing plasmids encoding LACK and TSA genes of Leishmania major and evaluated the immune response and survival rate in BALB/c mice. IgG and Interferon gamma values were noticeably increased in the immunized group with DNA cocktail vaccine, which were significantly higher than those in the single-gene vaccinated and control groups (p 0.05). The immunized mice with the cocktail DNA vaccine presented a considerable reduction in diameter of lesion compared to other groups and a significant difference was observed (p < 0.05) in this regard. The survival time of the immunized mice with the cocktail DNA vaccine was significantly higher than that in the other groups (p < 0.05) after their being challenged with Leishmania major. The findings of this study indicated that the cocktail DNA vaccine increased the cellular response and survival rate and induced protection against infection with Leishmania in the mice. © 2012 The Authors © 2012 APMIS.

  6. Pathogens Inactivated by Low-Energy-Electron Irradiation Maintain Antigenic Properties and Induce Protective Immune Responses

    Science.gov (United States)

    Fertey, Jasmin; Bayer, Lea; Grunwald, Thomas; Pohl, Alexandra; Beckmann, Jana; Gotzmann, Gaby; Casado, Javier Portillo; Schönfelder, Jessy; Rögner, Frank-Holm; Wetzel, Christiane; Thoma, Martin; Bailer, Susanne M.; Hiller, Ekkehard; Rupp, Steffen; Ulbert, Sebastian

    2016-01-01

    Inactivated vaccines are commonly produced by incubating pathogens with chemicals such as formaldehyde or β-propiolactone. This is a time-consuming process, the inactivation efficiency displays high variability and extensive downstream procedures are often required. Moreover, application of chemicals alters the antigenic components of the viruses or bacteria, resulting in reduced antibody specificity and therefore stimulation of a less effective immune response. An alternative method for inactivation of pathogens is ionizing radiation. It acts very fast and predominantly damages nucleic acids, conserving most of the antigenic structures. However, currently used irradiation technologies (mostly gamma-rays and high energy electrons) require large and complex shielding constructions to protect the environment from radioactivity or X-rays generated during the process. This excludes them from direct integration into biological production facilities. Here, low-energy electron irradiation (LEEI) is presented as an alternative inactivation method for pathogens in liquid solutions. LEEI can be used in normal laboratories, including good manufacturing practice (GMP)- or high biosafety level (BSL)-environments, as only minor shielding is necessary. We show that LEEI efficiently inactivates different viruses (influenza A (H3N8), porcine reproductive and respiratory syndrome virus (PRRSV), equine herpesvirus 1 (EHV-1)) and bacteria (Escherichia coli) and maintains their antigenicity. Moreover, LEEI-inactivated influenza A viruses elicit protective immune responses in animals, as analyzed by virus neutralization assays and viral load determination upon challenge. These results have implications for novel ways of developing and manufacturing inactivated vaccines with improved efficacy. PMID:27886076

  7. SOYBEAN AND CASEIN HYDROLYSATES INDUCE GRAPEVINE IMMUNE RESPONSES AND RESISTANCE AGAINST PLASMOPARA VITICOLA

    Directory of Open Access Journals (Sweden)

    Nihed eLachhab

    2014-12-01

    Full Text Available Plasmopara viticola, the causal agent of grapevine downy mildew, is one of the most devastating grape pathogen in Europe and North America. Although phytochemicals are used to control pathogen infections, the appearance of resistant strains and the concern for possible adverse effects on environment and human health are increasing the search for alternative strategies. In the present investigation, we successfully tested two protein hydrolysates from soybean (soy and casein (cas to trigger grapevine resistance against P. viticola. On Vitis vinifera cv. Marselan plants, the application of soy and cas reduced the infected leaf surface by 76 and 63%, as compared to the control, respectively. Since both hydrolysates might trigger the plant immunity, we investigated their ability to elicit grapevine defence responses. On grapevine cell suspensions, a different free cytosolic calcium signature was recorded for each hydrolysate, whereas a similar transient phosphorylation of two MAP kinases of 45 and 49 kDa was observed. These signalling events were followed by transcriptome reprogramming, including the up-regulation of defence genes encoding pathogenesis-related (PR proteins and the stilbene synthase enzyme responsible for the biosynthesis of resveratrol, the main grapevine phytoalexin. Liquid chromatography analyses confirmed the production of resveratrol and its dimer metabolites, δ- and ε-viniferins. Overall, soy effects were more pronounced as compared to the cas one. Both hydrolysates proved to act as elicitors to enhance grapevine immunity against pathogen attack.

  8. Pathogen-induced maternal effects result in enhanced immune responsiveness across generations.

    Science.gov (United States)

    Rosengaus, Rebeca B; Hays, Nicole; Biro, Colette; Kemos, James; Zaman, Muizz; Murray, Joseph; Gezahegn, Bruck; Smith, Wendy

    2017-05-01

    Parental investment theory postulates that adults can accurately perceive cues from their surroundings, anticipate the needs of future offspring based on those cues, and selectively allocate nongenetic resources to their progeny. Such context-dependent parental contributions can result in phenotypically variable offspring. Consistent with these predictions, we show that bacterially exposed Manduca sexta mothers oviposited significantly more variable embryos (as measured by mass, volume, hatching time, and hatching success) relative to naïve and control mothers. By using an in vivo "clearance of infection" assay, we also show that challenged larvae born to heat-killed- or live- Serratia -injected mothers, supported lower microbial loads and cleared the infection faster than progeny of control mothers. Our data support the notion that mothers can anticipate the future pathogenic risks and immunological needs of their unborn offspring, providing progeny with enhanced immune protection likely through transgenerational immune priming. Although the inclusion of live Serratia into oocytes does not appear to be the mechanism by which mothers confer protection to their young, other mechanisms, including epigenetic modifications in the progeny due to maternal pathogenic stress, may be at play. The adaptive nature of maternal effects in the face of pathogenic stress provides insights into parental investment, resource allocation, and life-history theories and highlights the significant role that pathogen-induced maternal effects play as generators and modulators of evolutionary change.

  9. Recombinant Forms of Leishmania amazonensis Excreted/Secreted Promastigote Surface Antigen (PSA Induce Protective Immune Responses in Dogs.

    Directory of Open Access Journals (Sweden)

    Elodie Petitdidier

    2016-05-01

    Full Text Available Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA, from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA or its carboxy terminal part LaPSA-12S (Cter-rPSA, combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates.

  10. The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses.

    Science.gov (United States)

    Takahama, Michihiro; Fukuda, Mitsunori; Ohbayashi, Norihiko; Kozaki, Tatsuya; Misawa, Takuma; Okamoto, Toru; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya

    2017-09-19

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5), in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING), the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses

    Directory of Open Access Journals (Sweden)

    Michihiro Takahama

    2017-09-01

    Full Text Available Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5, in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING, the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis.

  12. Induced ER-chaperones regulate a novel receptor-like kinase to mediate a viral innate immune response

    Science.gov (United States)

    Caplan, Jeffrey L.; Zhu, Xiaohong; Mamillapalli, Padmavathi; Marathe, Rajendra; Anandalakshmi, Radhamani; Dinesh-Kumar, S. P.

    2009-01-01

    Summary The plant innate immune response requires a rapid, global reprogramming of cellular processes. Here we employed two complementary proteomic methods, two-dimensional differential in-gel electrophoresis (2D-DIGE) and iTRAQ, to identify differentially regulated proteins early during a defense response. Besides defense-related proteins, the constituents of the largest category of up-regulated proteins were cytoplasmic- and endoplasmic reticulum (ER)-residing molecular chaperones. Silencing of ER-resident protein disulfide isomerases, NbERp57 and NbP5, and the calreticulins, NbCRT2 and NbCRT3, lead to a partial loss of N immune receptor-mediated defense against Tobacco mosaic virus (TMV). Furthermore, NbCRT2 and NbCRT3 are required for the expression of a novel induced receptor-like kinase (IRK). IRK is a plasma membrane-localized protein required for the N-mediated hypersensitive response programmed cell death (HR-PCD) and resistance to TMV. These data support a model in which ER-resident chaperones are required for the accumulation of membrane bound or secreted proteins that are necessary for innate immunity. PMID:19917500

  13. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    Science.gov (United States)

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  14. A Recombinant HAV Expressing a Neutralization Epitope of HEV Induces Immune Response against HAV and HEV in Mice.

    Science.gov (United States)

    Xiang, Kui; Kusov, Yuri; Ying, Guan; Yan, Wang; Shan, Yi; Jinyuan, Wu; Na, Yin; Yan, Zhou; Hongjun, Li; Maosheng, Sun

    2017-09-15

    Hepatitis A virus (HAV) and hepatitis E virus (HEV) are causative agents of acute viral hepatitis transmitted via the fecal-oral route. Both viruses place a heavy burden on the public health and economy of developing countries. To test the possibility that HAV could be used as an expression vector for the development of a combination vaccine against hepatitis A and E infections, recombinant HAV-HEp148 was created as a vector to express an HEV neutralization epitope (HEp148) located at aa 459-606 of the HEV capsid protein. The recombinant virus expressed the HEp148 protein in a partially dimerized state in HAV-susceptible cells. Immunization with the HAV-HEp148 virus induced a strong HAV- and HEV-specific immune response in mice. Thus, the present study demonstrates a novel approach to the development of a combined hepatitis A and E vaccine.

  15. A cell wall protein-based vaccine candidate induce protective immune response against Sporothrix schenckii infection.

    Science.gov (United States)

    Portuondo, Deivys Leandro; Batista-Duharte, Alexander; Ferreira, Lucas Souza; Martínez, Damiana Téllez; Polesi, Marisa Campos; Duarte, Roberta Aparecida; de Paula E Silva, Ana Carolina Alves; Marcos, Caroline Maria; Almeida, Ana Marisa Fusco de; Carlos, Iracilda Zeppone

    2016-02-01

    Sporotrichosis is a subcutaneous mycosis caused by several closely related thermo-dimorphic fungi of the Sporothrix schenckii species complex, affecting humans and other mammals. In the last few years, new strategies have been proposed for controlling sporotrichosis owning to concerns about its growing incidence in humans, cats, and dogs in Brazil, as well as the toxicity and limited efficacy of conventional antifungal drugs. In this study, we assessed the immunogenicity and protective properties of two aluminum hydroxide (AH)-adsorbed S. schenckii cell wall protein (ssCWP)-based vaccine formulations in a mouse model of systemic S. schenckii infection. Fractioning by SDS-PAGE revealed nine protein bands, two of which were functionally characterized: a 44kDa peptide hydrolase and a 47kDa enolase, which was predicted to be an adhesin. Sera from immunized mice recognized the 47kDa enolase and another unidentified 71kDa protein, whereas serum from S. schenckii-infected mice recognized both these proteins plus another unidentified 9.4kDa protein. Furthermore, opsonization with the anti-ssCWP sera led to markedly increased phagocytosis and was able to strongly inhibit the fungus' adhesion to fibroblasts. Immunization with the higher-dose AH-adjuvanted formulation led to increased ex vivo release of IL-12, IFN-γ, IL-4, and IL-17, whereas only IL-12 and IFN-γ were induced by the higher-dose non-adjuvanted formulation. Lastly, passive transference of the higher-dose AH-adjuvanted formulation's anti-ssCWP serum was able to afford in vivo protection in a subsequent challenge with S. schenckii, becoming a viable vaccine candidate for further testing. Copyright © 2015 Elsevier GmbH. All rights reserved.

  16. Transgenic expression of soluble human CD5 enhances experimentally-induced autoimmune and anti-tumoral immune responses.

    Directory of Open Access Journals (Sweden)

    Rafael Fenutría

    Full Text Available CD5 is a lymphoid-specific transmembrane glycoprotein constitutively expressed on thymocytes and mature T and B1a lymphocytes. Current data support the view that CD5 is a negative regulator of antigen-specific receptor-mediated signaling in these cells, and that this would likely be achieved through interaction with CD5 ligand/s (CD5L of still undefined nature expressed on immune or accessory cells. To determine the functional consequence of loss of CD5/CD5L interaction in vivo, a new transgenic mouse line was generated (shCD5EμTg, expressing a circulating soluble form of human CD5 (shCD5 as a decoy to impair membrane-bound CD5 function. These shCD5EμTg mice showed an enhanced response to autologous antigens, as deduced from the presentation of more severe forms of experimentally inducible autoimmune disease (collagen-induced arthritis, CIA; and experimental autoimmune encephalitis, EAE, as well as an increased anti-tumoral response in non-orthotopic cancer models (B16 melanoma. This enhancement of the immune response was in agreement with the finding of significantly reduced proportions of spleen and lymph node Treg cells (CD4+CD25+FoxP3+, and of peritoneal IL-10-producing and CD5+ B cells, as well as an increased proportion of spleen NKT cells in shCD5EμTg mice. Similar changes in lymphocyte subpopulations were observed in wild-type mice following repeated administration of exogenous recombinant shCD5 protein. These data reveal the relevant role played by CD5/CD5L interactions on the homeostasis of some functionally relevant lymphocyte subpopulations and the modulation of immune responses to autologous antigens.

  17. MicroRNA-302 Cluster Downregulates Enterovirus 71-Induced Innate Immune Response by Targeting KPNA2.

    Science.gov (United States)

    Peng, Nanfang; Yang, Xuecheng; Zhu, Chengliang; Zhou, Li; Yu, Haisheng; Li, Mengqi; Lin, Yong; Wang, Xueyu; Li, Qian; She, Yinglong; Wang, Jun; Zhao, Qian; Lu, Mengji; Zhu, Ying; Liu, Shi

    2018-05-18

    Enterovirus 71 (EV71) induces significantly elevated levels of cytokines and chemokines, leading to local or systemic inflammation and severe complications. As shown in our previous study, microRNA (miR) 302c regulates influenza A virus-induced IFN expression by targeting NF-κB-inducing kinase. However, little is known about the role of the miR-302 cluster in EV71-mediated proinflammatory responses. In this study, we found that the miR-302 cluster controls EV71-induced cytokine expression. Further studies demonstrated that karyopherin α2 (KPNA2) is a direct target of the miR-302 cluster. Interestingly, we also found that EV71 infection upregulates KPNA2 expression by downregulating miR-302 cluster expression. Upon investigating the mechanisms behind this event, we found that KPNA2 intracellularly associates with JNK1/JNK2 and p38, leading to translocation of those transcription factors from the cytosol into the nucleus. In EV71-infected patients, miR-302 cluster expression was downregulated and KPNA2 expression was upregulated compared with controls, and their expression levels were closely correlated. Taken together, our work establishes a link between the miR-302/ KPNA2 axis and EV71-induced cytokine expression and represents a promising target for future antiviral therapy. Copyright © 2018 by The American Association of Immunologists, Inc.

  18. Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

    Directory of Open Access Journals (Sweden)

    Gopala K. Mannala

    2017-12-01

    Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

  19. A recombinant canine distemper virus expressing a modified rabies virus glycoprotein induces immune responses in mice.

    Science.gov (United States)

    Li, Zhili; Wang, Jigui; Yuan, Daoli; Wang, Shuang; Sun, Jiazeng; Yi, Bao; Hou, Qiang; Mao, Yaping; Liu, Weiquan

    2015-06-01

    Canine distemper virus (CDV) and rabies virus (RV) are two important pathogens of the dog. CDV, a member of the morbillivirus genus, has shown promise as an expression vector. The glycoprotein from RV is a main contributor to protective immunity and capable of eliciting the production of virus-neutralizing antibodies. In this study, we recovered an attenuated strain of canine distemper virus and constructed a recombinant virus, rCDV-RV-G, expressing a modified (R333Q) rabies virus glycoprotein (RV-G) of RV Flury strain LEP. RV-G expression by the recombinant viruses was confirmed. Furthermore, G was proved to be incorporated into the surface of CDV particles. While replication of the recombinant virus was slightly reduced compared with the parental CDV, it stably expressed the RV-G over ten serial passages. Inoculation of mice induced specific neutralizing antibodies against both RV-G and CDV. Therefore, the rCDV-RV-G has the potential as a vaccine that may be used to control rabies virus infection in dogs and other animals.

  20. Enhanced cellular immune response against SIV Gag induced by immunization with DNA vaccines expressing assembly and release-defective SIV Gag proteins

    International Nuclear Information System (INIS)

    Bu Zhigao; Ye Ling; Compans, Richard W.; Yang Chinglai

    2003-01-01

    Codon-optimized genes were synthesized for the SIVmac239 Gag, a mutant Gag with mutations in the major homology region, and a chimeric Gag containing a protein destruction signal at the N-terminus of Gag. The mutant and chimeric Gag were expressed at levels comparable to that observed for the wild-type Gag protein but their stability and release into the medium were found to be significantly reduced. Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T cell responses than the DNA vector encoding the wild-type SIV Gag. Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to 10-fold higher than those induced by the DNA construct for the wild-type Gag. These results indicate that mutations disrupting assembly and/or stability of the SIV Gag protein effectively enhance its immunogenicity when expressed from DNA vaccines

  1. Maternal inflammation induces immune activation of fetal microglia and leads to disrupted microglia immune responses, behavior, and learning performance in adulthood.

    Science.gov (United States)

    Schaafsma, Wandert; Basterra, Laura Bozal; Jacobs, Sabrina; Brouwer, Nieske; Meerlo, Peter; Schaafsma, Anne; Boddeke, Erik W G M; Eggen, Bart J L

    2017-10-01

    Maternal inflammation during pregnancy can have detrimental effects on embryonic development that persist during adulthood. However, the underlying mechanisms and insights in the responsible cell types are still largely unknown. Here we report the effect of maternal inflammation on fetal microglia, the innate immune cells of the central nervous system (CNS). In mice, a challenge with LPS during late gestation stages (days 15-16-17) induced a pro-inflammatory response in fetal microglia. Adult whole brain microglia of mice that were exposed to LPS during embryonic development displayed a persistent reduction in pro-inflammatory activation in response to a re-challenge with LPS. In contrast, hippocampal microglia of these mice displayed an increased inflammatory response to an LPS re-challenge. In addition, a reduced expression of brain-derived neurotrophic factor (BDNF) was observed in hippocampal microglia of LPS-offspring. Microglia-derived BDNF has been shown to be important for learning and memory processes. In line with these observations, behavioral- and learning tasks with mice that were exposed to maternal inflammation revealed reduced home cage activity, reduced anxiety and reduced learning performance in a T-maze. These data show that exposure to maternal inflammation during late gestation results in long term changes in microglia responsiveness during adulthood, which is different in nature in hippocampus compared to total brain microglia. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Potential Role of Carvedilol in the Cardiac Immune Response Induced by Experimental Infection with Trypanosoma cruzi

    Directory of Open Access Journals (Sweden)

    Aline Luciano Horta

    2017-01-01

    Full Text Available Trypanosoma cruzi causes a cardiac infection characterized by an inflammatory imbalance that could become the inciting factor of the illness. To this end, we evaluated the role of carvedilol, a beta-blocker with potential immunomodulatory properties, on the immune response in C57BL/6 mice infected with VL-10 strain of T. cruzi in the acute phase. Animals (n=40 were grouped: (i not infected, (ii infected, (iii infected + carvedilol, and (iv not infected + carvedilol. We analyzed parameters related to parasitemia, plasma levels of TNF, IL-10, and CCL2, and cardiac histopathology after the administration of carvedilol for 30 days. We did not observe differences in the maximum peaks of parasitemia in the day of their detection among the groups. The plasma TNF was elevated at 60 days of infection in mice treated or not with carvedilol. However, we observed a decreased CCL2 level and increased IL-10 levels in those infected animals treated with carvedilol, which impacted the reduction of the inflammatory infiltration in cardiac tissue. For this experimental model, carvedilol therapy was not able to alter the levels of circulating parasites but modulates the pattern of CCL2 and IL-10 mediators when the VL10 strain of T. cruzi was used in C57BL6 mice.

  3. Human Norovirus and Its Surrogates Induce Plant Immune Response in Arabidopsis thaliana and Lactuca sativa.

    Science.gov (United States)

    Markland, Sarah M; Bais, Harsh; Kniel, Kalmia E

    2017-08-01

    Human norovirus is the leading cause of foodborne illness worldwide with the majority of outbreaks linked to fresh produce and leafy greens. It is essential that we thoroughly understand the type of relationship and interactions that take place between plants and human norovirus to better utilize control strategies to reduce transmission of norovirus in the field onto plants harvested for human consumption. In this study the expression of gene markers for the salicylic acid (SA) and jasmonic acid (JA) plant defense pathways was measured and compared in romaine lettuce (Lactuca sativa) and Arabidopsis thaliana Col-0 plants that were inoculated with Murine Norovirus-1, Tulane Virus, human norovirus GII.4, or Hank's Balanced Salt Solution (control). Genes involving both the SA and JA pathways were expressed in both romaine lettuce and A. thaliana for all three viruses, as well as controls. Studies, including gene expression of SA- and JA-deficient A. thaliana mutant lines, suggest that the JA pathway is more likely involved in the plant immune response to human norovirus. This research provides the first pieces of information regarding how foodborne viruses interact with plants in the preharvest environment.

  4. Inflammasome Activation Is Critical to the Protective Immune Response during Chemically Induced Squamous Cell Carcinoma

    Science.gov (United States)

    Gasparoto, Thais Helena; de Oliveira, Carine Ervolino; de Freitas, Luisa Thomazini; Pinheiro, Claudia Ramos; Hori, Juliana Issa; Garlet, Gustavo Pompermaier; Cavassani, Karen Angélica; Schillaci, Roxana; da Silva, João Santana; Zamboni, Dario Simões; Campanelli, Ana Paula

    2014-01-01

    Chronic inflammation affects most stages of tumorigenesis, including initiation, promotion, malignant differentiation, invasion and metastasis. Inflammasomes have been described as involved with persistent inflammation and are known to exert both pro and antitumour effects. We evaluated the influence of apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and caspase (CASP)-1 in the antitumor immune response using a multistage model of squamous cell carcinoma (SCC) development. Absence of ASC and CASP-1 resulted in an earlier incidence and increased number of papilloma. Loss of inflammassome function in mice resulted in decreased presence of natural killer (NK), dendritic (DC), CD4+, CD8+ and CD45RB+ T cells in the tumor lesions as well as in lymph nodes (LN) compared with WT mice. Increased percentage of CD4+CD25+Foxp3+ T cells was associated with association with inflammasome loss of function. Moreover, significant differences were also found with neutrophils and macrophage infiltrating the lesions. Myeloperoxidase (MPO), but not elastase (ELA), activity oscillated among the groups during the SCC development. Levels of proinflammatory cytokines IL-1β, IL-18, Tumor Necrosis Factor (TNF)-α and Interferon (IFN)-γ were decreased in the tumor microenvironment in the absence of inflammasome proteins. These observations suggest a link between inflammasome function and SCC tumorigenesis, indicating an important role for inflammasome activation in the control of SCC development. PMID:25268644

  5. Inflammasome activation is critical to the protective immune response during chemically induced squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Thais Helena Gasparoto

    Full Text Available Chronic inflammation affects most stages of tumorigenesis, including initiation, promotion, malignant differentiation, invasion and metastasis. Inflammasomes have been described as involved with persistent inflammation and are known to exert both pro and antitumour effects. We evaluated the influence of apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC and caspase (CASP-1 in the antitumor immune response using a multistage model of squamous cell carcinoma (SCC development. Absence of ASC and CASP-1 resulted in an earlier incidence and increased number of papilloma. Loss of inflammassome function in mice resulted in decreased presence of natural killer (NK, dendritic (DC, CD4(+, CD8(+ and CD45RB(+ T cells in the tumor lesions as well as in lymph nodes (LN compared with WT mice. Increased percentage of CD4(+CD25(+Foxp3(+ T cells was associated with association with inflammasome loss of function. Moreover, significant differences were also found with neutrophils and macrophage infiltrating the lesions. Myeloperoxidase (MPO, but not elastase (ELA, activity oscillated among the groups during the SCC development. Levels of proinflammatory cytokines IL-1β, IL-18, Tumor Necrosis Factor (TNF-α and Interferon (IFN-γ were decreased in the tumor microenvironment in the absence of inflammasome proteins. These observations suggest a link between inflammasome function and SCC tumorigenesis, indicating an important role for inflammasome activation in the control of SCC development.

  6. Isocitrate dehydrogenase of Helicobacter pylori potentially induces humoral immune response in subjects with peptic ulcer disease and gastritis.

    Directory of Open Access Journals (Sweden)

    M Abid Hussain

    Full Text Available BACKGROUND: H. pylori causes gastritis and peptic ulcers and is a risk factor for the development of gastric carcinoma. Many of the proteins such as urease, porins, flagellins and toxins such as lipo-polysaccharides have been identified as potential virulence factors which induce proinflammatory reaction. We report immunogenic potentials of isocitrate dehydrogenase (ICD, an important house keeping protein of H. pylori. METHODOLOGY/PRINCIPAL FINDINGS: Amino acid sequences of H. pylori ICD were subjected to in silico analysis for regions with predictably high antigenic indexes. Also, computational modelling of the H. pylori ICD as juxtaposed to the E. coli ICD was carried out to determine levels of structure similarity and the availability of surface exposed motifs, if any. The icd gene was cloned, expressed and purified to a very high homogeneity. Humoral response directed against H. pylori ICD was detected through an enzyme linked immunosorbent assay (ELISA in 82 human subjects comprising of 58 patients with H. pylori associated gastritis or ulcer disease and 24 asymptomatic healthy controls. The H. pylori ICD elicited potentially high humoral immune response and revealed high antibody titers in sera corresponding to endoscopically-confirmed gastritis and ulcer disease subjects. However, urea-breath-test negative healthy control samples and asymptomatic control samples did not reveal any detectable immune responses. The ELISA for proinflammatory cytokine IL-8 did not exhibit any significant proinflammatory activity of ICD. CONCLUSIONS/SIGNIFICANCE: ICD of H. pylori is an immunogen which interacts with the host immune system subsequent to a possible autolytic-release and thereby significantly elicits humoral responses in individuals with invasive H. pylori infection. However, ICD could not significantly stimulate IL8 induction in a cultured macrophage cell line (THP1 and therefore, may not be a notable proinflammatory agent.

  7. Peptide fragments induce a more rapid immune response than intact proteins in earthworms.

    Science.gov (United States)

    Hanusová, R; Tucková, L; Halada, P; Bezouska, K; Bilej, M

    1999-01-01

    The effect of in vivo proteolytic processing of protein antigen was studied in Eisenia foetida earthworms. Parenteral administration of the protein antigen induces elevated levels of an antigen-binding protein (ABP) which recognizes the protein used for stimulation. When the protein antigen is administered simultaneously with nontoxic serine proteinase inhibitor, ABP levels remain close to background. On the other hand, the in vivo adaptive response of earthworms to peptide fragments obtained by coelomic fluid digestion of the foreign antigen occurs even in the presence of proteinase inhibitor and, moreover, is significantly faster as compared to the response to intact antigen. These findings confirm the role of proteolytic processing in earthworms. MALDI mass spectrometric analysis of the fragments after coelomic fluid digestion has revealed the presence of the peptide fragments with molecular weights in the mass range 700-1100 Da.

  8. Murine immune response induced by Leishmania major during the implantation of paraffin tablets.

    Science.gov (United States)

    Reis, Maria Letícia Costa; Ferreira, Vanessa Martins; Zhang, Xia; Gonçalves, Ricardo; Vieira, Leda Quércia; Tafuri, Washington Luiz; Mosser, David M; Tafuri, Wagner Luiz

    2010-11-01

    We carried out a model of chronic inflammation using a subcutaneous paraffin tablet in mice experimentally infected with Leishmania major. It was previously reported that the parasite load following paraffin implantation occurred at a peak of 21 days in both BALB/c and C57BL/6 mice. At the present study, we have investigated what cytokines and chemokines are directly related to the parasite load in C57BL/6 mice. All mice were divided in four groups: mice implanted with paraffin tablets; mice experimentally infected with L. major; mice implanted with paraffin tablets and experimentally infected with L. major; and mice submitted only to the surgery were used for the Real-Time Polymerase Chain Reaction (RT-PCR) controls. Fragments of skin tissue and the tissue surrounding the paraffin tablets (inflammatory capsule) were collected for histopathology and RT-PCR studies. By 21 days, a diffuse chronic inflammatory reaction was mainly observed in the deep dermis where macrophages parasitized with Leishmania amastigotes were also found. RT-PCR analysis has shown that BALB/c mice showed strong IL-4 and IL-10 mRNA expression than controls with very little expression of IFN-γ. In contrast, both IFN-γ and IL-10 mRNA was found in higher levels in C57BL/6 animals. Moreover, in C57BL/6 mice the expression of chemokines mRNA of CCL3/MIP-1α was more highly expressed than CCL2/MCP-1. We conclude that the Th1 immune response C57BL/6 did not change to a Th2 response, even though C57BL/6 animals presented higher parasitism than BALB/c mice 21 days after infection and paraffin implantation.

  9. Oral Immunization with Recombinant Norwalk Virus-Like Particles Induces a Systemic and Mucosal Immune Response in Mice

    OpenAIRE

    Ball, Judith M.; Hardy, Michele E.; Atmar, Robert L.; Conner, Margaret E.; Estes, Mary K.

    1998-01-01

    Recombinant Norwalk virus-like particles (rNV VLPs) produced in insect cells were evaluated as an oral immunogen in CD1 and BALB/c mice by monitoring rNV-specific serum total and subclass immunoglobulin G (IgG) and intestinal IgA responses. Dose and kinetics of response were evaluated in the presence and absence of the mucosal adjuvant cholera toxin (CT). rNV-specific serum IgG and intestinal IgA were detected in the absence of CT, and the number of responders was not significantly different ...

  10. Oral Immunization with Recombinant Norwalk Virus-Like Particles Induces a Systemic and Mucosal Immune Response in Mice

    Science.gov (United States)

    Ball, Judith M.; Hardy, Michele E.; Atmar, Robert L.; Conner, Margaret E.; Estes, Mary K.

    1998-01-01

    Recombinant Norwalk virus-like particles (rNV VLPs) produced in insect cells were evaluated as an oral immunogen in CD1 and BALB/c mice by monitoring rNV-specific serum total and subclass immunoglobulin G (IgG) and intestinal IgA responses. Dose and kinetics of response were evaluated in the presence and absence of the mucosal adjuvant cholera toxin (CT). rNV-specific serum IgG and intestinal IgA were detected in the absence of CT, and the number of responders was not significantly different from that of mice administered VLPs with CT at most doses. The use of CT was associated with induction of higher levels of IgG in serum; this effect was greater at higher doses of VLPs. IgG in serum was detected in the majority of animals by 9 days postimmunization (dpi), and intestinal IgA responses were detected by 24 dpi. In the absence of CT, IgG2b was the dominant IgG subclass response in both mouse strains. Thus, nonreplicating rNV VLPs are immunogenic when administered orally in the absence of any delivery system or mucosal adjuvant. These studies demonstrate that rNV VLPs are an excellent model to study the oral delivery of antigen, and they are a potential mucosal vaccine for NV infections. PMID:9445035

  11. The Bacterial Species Campylobacter jejuni Induce Diverse Innate Immune Responses in Human and Avian Intestinal Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Daniel A. John

    2017-09-01

    Full Text Available Campylobacter remain the major cause of human gastroenteritis in the Developed World causing a significant burden to health services. Campylobacter are pathogens in humans and chickens, although differences in mechanistic understanding are incomplete, in part because phenotypic strain diversity creates inconsistent findings. Here, we took Campylobacter jejuni isolates (n = 100 from multi-locus sequence typed collections to assess their pathogenic diversity, through their inflammatory, cytotoxicity, adhesion, invasion and signaling responses in a high-throughput model using avian and human intestinal epithelial cells. C. jejuni induced IL-8 and CXCLi1/2 in human and avian epithelial cells, respectively, in a MAP kinase-dependent manner. In contrast, IL-10 responses in both cell types were PI 3-kinase/Akt-dependent. C. jejuni strains showed diverse levels of invasion with high invasion dependent on MAP kinase signaling in both cell lines. C. jejuni induced diverse cytotoxic responses in both cell lines with cdt-positive isolates showing significantly higher toxicity. Blockade of endocytic pathways suggested that invasion by C. jejuni was clathrin- and dynamin-dependent but caveolae- independent in both cells. In contrast, IL-8 (and CXCLi1/2 production was dependent on clathrin, dynamin, and caveolae. This study is important because of its scale, and the data produced, suggesting that avian and human epithelial cells use similar innate immune pathways where the magnitude of the response is determined by the phenotypic diversity of the Campylobacter species.

  12. Topoisomerase II Inhibitors Induce DNA Damage-Dependent Interferon Responses Circumventing Ebola Virus Immune Evasion

    Directory of Open Access Journals (Sweden)

    Priya Luthra

    2017-04-01

    Full Text Available Ebola virus (EBOV protein VP35 inhibits production of interferon alpha/beta (IFN by blocking RIG-I-like receptor signaling pathways, thereby promoting virus replication and pathogenesis. A high-throughput screening assay, developed to identify compounds that either inhibit or bypass VP35 IFN-antagonist function, identified five DNA intercalators as reproducible hits from a library of bioactive compounds. Four, including doxorubicin and daunorubicin, are anthracycline antibiotics that inhibit topoisomerase II and are used clinically as chemotherapeutic drugs. These compounds were demonstrated to induce IFN responses in an ATM kinase-dependent manner and to also trigger the DNA-sensing cGAS-STING pathway of IFN induction. These compounds also suppress EBOV replication in vitro and induce IFN in the presence of IFN-antagonist proteins from multiple negative-sense RNA viruses. These findings provide new insights into signaling pathways activated by important chemotherapy drugs and identify a novel therapeutic approach for IFN induction that may be exploited to inhibit RNA virus replication.

  13. Alphavirus Replicon DNA Vectors Expressing Ebola GP and VP40 Antigens Induce Humoral and Cellular Immune Responses in Mice

    Directory of Open Access Journals (Sweden)

    Shoufeng Ren

    2018-01-01

    Full Text Available Ebola virus (EBOV causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP is the major protective antigen of EBOV, and can generate virus-like particles (VLPs by co-expression with matrix protein (VP40. In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV replicon vector DREP to express EBOV GP and matrix viral protein (VP40. EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40. Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention.

  14. Idiotypes as immunogens: facing the challenge of inducing strong therapeutic immune responses against the variable region of immunoglobulins

    International Nuclear Information System (INIS)

    López-Requena, Alejandro; Burrone, Oscar R.; Cesco-Gaspere, Michela

    2012-01-01

    Idiotype (Id)-based immunotherapy has been exploited as cancer treatment option. Conceived as therapy for malignancies bearing idiotypic antigens, it has been also extended to solid tumors because of the capacity of anti-idiotypic antibodies to mimic Id-unrelated antigens. In both these two settings, efforts are being made to overcome the poor immune responsiveness often experienced when using self immunoglobulins as immunogens. Despite bearing a unique gene combination, and thus particular epitopes, it is normally difficult to stimulate the immune response against antibody variable regions. Different strategies are currently used to strengthen Id immunogenicity, such as concomitant use of immune-stimulating molecules, design of Id-containing immunogenic recombinant proteins, specific targeting of relevant immune cells, and genetic immunization. This review focuses on the role of anti-Id vaccination in cancer management and on the current developments used to foster anti-idiotypic B and T cell responses.

  15. Idiotypes as immunogens: facing the challenge of inducing strong therapeutic immune responses against the variable region of immunoglobulins

    Energy Technology Data Exchange (ETDEWEB)

    López-Requena, Alejandro [Molecular Immunology Group, International Centre for Genetic Engineering and Biotechnology, Trieste (Italy); Immunobiology Division, Center of Molecular Immunology, Havana (Cuba); Bioengineering Research Institute, Biotech Pharmaceutical Co., Ltd, Beijing (China); Burrone, Oscar R.; Cesco-Gaspere, Michela, E-mail: cescogaspere@gmail.com [Molecular Immunology Group, International Centre for Genetic Engineering and Biotechnology, Trieste (Italy)

    2012-11-09

    Idiotype (Id)-based immunotherapy has been exploited as cancer treatment option. Conceived as therapy for malignancies bearing idiotypic antigens, it has been also extended to solid tumors because of the capacity of anti-idiotypic antibodies to mimic Id-unrelated antigens. In both these two settings, efforts are being made to overcome the poor immune responsiveness often experienced when using self immunoglobulins as immunogens. Despite bearing a unique gene combination, and thus particular epitopes, it is normally difficult to stimulate the immune response against antibody variable regions. Different strategies are currently used to strengthen Id immunogenicity, such as concomitant use of immune-stimulating molecules, design of Id-containing immunogenic recombinant proteins, specific targeting of relevant immune cells, and genetic immunization. This review focuses on the role of anti-Id vaccination in cancer management and on the current developments used to foster anti-idiotypic B and T cell responses.

  16. In Vivo Screening of Chemically Modified RNA duplexes for their Ability to Induce Innate Immune Responses

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Bramsen, Jesper Bertram; Kjems, Jørgen

    RNAs include the 2´-5´ oligoadenylate synthetase system, the protein kinase R, RIG-I and Toll-like receptor activated pathways all resulting in antiviral defence mechanism. We have previously shown that antiviral innate immune reactions against double stranded RNAs could be detected in vivo as partial...

  17. Duck enteritis virus glycoprotein D and B DNA vaccines induce immune responses and immunoprotection in Pekin ducks.

    Science.gov (United States)

    Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

    2014-01-01

    DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.

  18. Interleukin 37 limits monosodium urate crystal-induced innate immune responses in human and murine models of gout.

    Science.gov (United States)

    Liu, Lei; Xue, Yu; Zhu, Yingfeng; Xuan, Dandan; Yang, Xue; Liang, Minrui; Wang, Juan; Zhu, Xiaoxia; Zhang, Jiong; Zou, Hejian

    2016-11-18

    Interleukin (IL)-37 has emerged as a fundamental inhibitor of innate immunity. Acute gout is a self-limiting inflammatory response to monosodium urate (MSU) crystals. In the current study, we assessed the preventive and therapeutic effect of recombinant human IL-37 (rhIL-37) in human and murine gout models. We investigated the expression of IL-37 in patients with active and inactive gouty arthritis and assessed the effect of rhIL-37 in human and murine gout models: a human monocyte cell line (THP-1) and human synovial cells (containing macrophage-like and fibroblast-like synoviocytes) exposed to MSU crystals, a peritoneal murine model of gout and a murine gouty arthritis model. After inhibition of Mer receptor tyrosine kinase (Mertk), levels of IL-1β, IL-8 and chemokine (C-C motif) ligand 2 (CCL-2) were detected by ELISA and expression of mammalian homologs of the drosophila Mad gene 3 (Smad), suppressor of cytokine signaling 3 (SOCS3), NACHT-LRR-PYD-containing protein 3 (NLRP3), and IL-8R of THP-1 were assessed by qPCR and western blot to explore the molecular mechanisms. Our studies strongly indicated that rhIL-37 played a potent immunosuppressive role in the pathogenesis of experimental gout models both in vitro and in vivo, by downregulating proinflammatory cytokines and chemokines, markedly reducing neutrophil and monocyte recruitment, and mitigating pathological joint inflammation. In our studies, rhIL-37 suppressed MSU-induced innate immune responses by enhancing expression of Smad3 and IL-1R8 to trigger multiple intracellular switches to block inflammation, including inhibition of NLRP3 and activation of SOCS3. Mertk signaling participated in rhIL-37 inhibitory pathways in gout models. By inhibition of Mertk, the anti-inflammatory effect of rhIL-37 was partly abrogated, and IL-1R8, Smad3 and S​OCS3 expression were suppressed, whereas NLRP3 expression was reactivated. Our studies reveal that IL-37 limits runaway inflammation initiated by MSU crystal-induced

  19. Effect of simultaneous vaccination with H1N1 and GAD-alum on GAD65-induced immune response.

    Science.gov (United States)

    Tavira, Beatriz; Cheramy, Mikael; Axelsson, Stina; Åkerman, Linda; Ludvigsson, Johnny; Casas, Rosaura

    2017-07-01

    A European Phase III trial of GAD formulated with aluminium hydroxide (GAD-alum) failed to reach its primary endpoint (preservation of stimulated C-peptide secretion from baseline to 15 months in type 1 diabetes patients), but subgroup analysis showed a clinical effect when participants from Nordic countries were excluded, raising concern as to whether the mass vaccination of the Swedish and Finnish populations with the Pandemrix influenza vaccine could have influenced the study outcomes. In the current study, we aimed to assess whether Pandemrix vaccination affects the specific immune responses induced by GAD-alum and the C-peptide response. In this secondary analysis, we analysed data acquired from the Swedish participants in the Phase III GAD-alum trial who received subcutaneous GAD-alum vaccination (two doses, n = 43; four doses, n = 46) or placebo (n = 48). GAD autoantibodies (GADA) and H1N1 autoantibodies, GAD 65 -induced cytokine secretion and change in fasting and stimulated C-peptide levels from baseline to 15 months were analysed with respect to the relative time between H1N1 vaccination and the first injection of GAD-alum. GADA levels at 15 months were associated with the relative time between GAD-alum and Pandemrix administration in participants who received two doses of the GAD-alum vaccine (p = 0.015, r = 0.4). Both in participants treated with two doses and four doses of GAD-alum, GADA levels were higher when the relative time between vaccines was ≥210 days (p < 0.05). In the group that received two doses of GAD-alum, levels of several GAD 65 -induced cytokines were higher in participants who received the H1N1 vaccination and the first GAD-alum injection at least 150 days apart, and the change in fasting and stimulated C-peptide at 15 months was associated with the relative time between vaccines. Neither of these effects were observed in individuals who received four doses of GAD-alum. In individuals who received two doses of GAD

  20. Fibroblast and T cells conditioned media induce maturation dendritic cell and promote T helper immune response

    Directory of Open Access Journals (Sweden)

    Masoumeh Asadi

    2012-06-01

    Full Text Available Dendritic cells (DCs induce pathogen-specific T cell responses. We comprehensively studied the effects of addition of maturation stimulus, fibroblasts (fibroblast conditioned medium, PHA activated T cells (T cell conditioned medium, and mixture of fibroblast & PHA activated T cells (FCM-TCCM conditioned media on maturation of DCs. Monocytes were cultured with GM-CSF and IL-4 for five days. Maturation factors included MCM and TNF-α as control group. FCM and TCCM, or FCM-TCCM supernatant were considered as the treatment group. Tumor antigens were added at day five. Matured DCs were harvested at day seven. Phenotypic and functional analyses were carried out using anti (CD14, CD80, CD86, CD83 and HLA-DR monoclonal antibodies. Phagocytic activity, mixed lymphocyte reaction (MLR and cytokine production were also evaluated. At the end of culturing period, significantly fully matured DCs with large amount cytoplasm and copious dendritic projections were found in the presence of MCM, TNF-α with or without FCM, TCCM, FCM as well as TCCM. Flow cytometric analysis revealed that expression of CD14 decreased in particular in treated DCs, at the 5th day and expression of CD80, CD86 and HLA-DR was higher when FCM, TCCM, FCM plus TCCM were added to maturation factor. This study demonstrated that DCs matured with these methods had optimum function in comparison with either factor alone.

  1. Involvement of CD8+ T cell-mediated immune responses in LcrV DNA vaccine induced protection against lethal Yersinia pestis challenge.

    Science.gov (United States)

    Wang, Shixia; Goguen, Jon D; Li, Fusheng; Lu, Shan

    2011-09-09

    Yersinia pestis (Y. pestis) is the causative pathogen of plague, a highly fatal disease for which an effective vaccine, especially against mucosal transmission, is still not available. Like many bacterial infections, antigen-specific antibody responses have been traditionally considered critical, if not solely responsible, for vaccine-induced protection against Y. pestis. Studies in recent years have suggested the importance of T cell immune responses against Y. pestis infection but information is still limited about the details of Y. pestis antigen-specific T cell immune responses. In current report, studies are conducted to identify the presence of CD8+ T cell epitopes in LcrV protein, the leading antigen of plague vaccine development. Furthermore, depletion of CD8+ T cells in LcrV DNA vaccinated Balb/C mice led to reduced protection against lethal intranasal challenge of Y. pestis. These findings establish that an LcrV DNA vaccine is able to elicit CD8+ T cell immune responses against specific epitopes of this key plague antigen and that a CD8+ T cell immune response is involved in LcrV DNA vaccine-elicited protection. Future studies in plague vaccine development will need to examine if the presence of detectable T cell immune responses, in particular CD8+ T-cell immune responses, will enhance the protection against Y. pestis in higher animal species or humans. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. Immune Response and Partial Protection against Heterologous Foot-and-Mouth Disease Virus Induced by Dendrimer Peptides in Cattle

    Directory of Open Access Journals (Sweden)

    I. Soria

    2018-01-01

    Full Text Available Synthetic peptides mimicking protective B- and T-cell epitopes are good candidates for safer, more effective FMD vaccines. Nevertheless, previous studies of immunization with linear peptides showed that they failed to induce solid protection in cattle. Dendrimeric peptides displaying two or four copies of a peptide corresponding to the B-cell epitope VP1 [136–154] of type O FMDV (O/UKG/11/2001 linked through thioether bonds to a single copy of the T-cell epitope 3A [21–35] (termed B2T and B4T, resp. afforded protection in vaccinated pigs. In this work, we show that dendrimeric peptides B2T and B4T can elicit specific humoral responses in cattle and confer partial protection against the challenge with a heterologous type O virus (O1/Campos/Bra/58. This protective response correlated with the induction of specific T-cells as well as with an anamnestic antibody response upon virus challenge, as shown by the detection of virus-specific antibody-secreting cells (ASC in lymphoid tissues distal from the inoculation point.

  3. Sm29, but not Sm22.6 retains its ability to induce a protective immune response in mice previously exposed to a Schistosoma mansoni infection.

    Directory of Open Access Journals (Sweden)

    Clarice Carvalho Alves

    2015-02-01

    Full Text Available BACKGROUND: A vaccine against schistosomiasis would have a great impact in disease elimination. Sm29 and Sm22.6 are two parasite tegument proteins which represent promising antigens to compose a vaccine. These antigens have been associated with resistance to infection and reinfection in individuals living in endemic area for the disease and induced partial protection when evaluated in immunization trials using naïve mice. METHODOLOGY/PRINCIPALS FINDINGS: In this study we evaluated rSm29 and rSm22.6 ability to induce protection in Balb/c mice that had been previously infected with S. mansoni and further treated with Praziquantel. Our results demonstrate that three doses of the vaccine containing rSm29 were necessary to elicit significant protection (26%-48%. Immunization of mice with rSm29 induced a significant production of IL-2, IFN-γ, IL-17, IL-4; significant production of specific antibodies; increased percentage of CD4+ central memory cells in comparison with infected and treated saline group and increased percentage of CD4+ effector memory cells in comparison with naïve Balb/c mice immunized with rSm29. On the other hand, although immunization with Sm22.6 induced a robust immune response, it failed to induce protection. CONCLUSION/SIGNIFICANCE: Our results demonstrate that rSm29 retains its ability to induce protection in previously infected animals, reinforcing its potential as a vaccine candidate.

  4. Acupuncture Induces a Pro-Inflammatory Immune Response Intensified by a Conditioning-Expectation Effect

    DEFF Research Database (Denmark)

    Karst, M; Schneidewind, D; Schneinichen, D

    2010-01-01

    BACKGROUND: In a previous study it has been shown that acupuncture activates the respiratory burst (RB) of neutrophils as measured by the differences to baseline of the mean channel number of fluorescence intensity (mfi) in volunteers. Since this result could have been affected by a placebo effect......, a study has been designed that controls for the different facets of placebo mechanisms such as expectancy, suggestibility, and conditioning. PARTICIPANTS AND METHODS: 60 healthy volunteers were randomized either to acupuncture of the acupoint Large Intestine 11 (LI 11) (groups 1 and 2) or relaxation...... (group 3) twice a week for 4 weeks. Only acupuncture group 1 and the relaxation group were provided with the additional suggestion that the treatment may strengthen the immune system. RESULTS: The repeated measurement analysis for differences of follow-ups to baseline showed significantly different...

  5. Acupuncture induces a pro-inflammatory immune response intensified by a conditioning-expectation effect

    DEFF Research Database (Denmark)

    Karst, M.; Schneidewind, D.; Scheinchen, D.

    2010-01-01

    BACKGROUND: In a previous study it has been shown that acupuncture activates the respiratory burst (RB) of neutrophils as measured by the differences to baseline of the mean channel number of fluorescence intensity (mfi) in volunteers. Since this result could have been affected by a placebo effect......, a study has been designed that controls for the different facets of placebo mechanisms such as expectancy, suggestibility, and conditioning. PARTICIPANTS AND METHODS: 60 healthy volunteers were randomized either to acupuncture of the acupoint Large Intestine 11 (LI 11) (groups 1 and 2) or relaxation...... (group 3) twice a week for 4 weeks. Only acupuncture group 1 and the relaxation group were provided with the additional suggestion that the treatment may strengthen the immune system. RESULTS: The repeated measurement analysis for differences of follow-ups to baseline showed significantly different...

  6. TU-CD-303-03: Localized Radiation Can Induce Systemic Anti-Cancer Immune and Non-Immune Responses and How We Might Utilize It

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, M. [National Institutes of Health (United States)

    2015-06-15

    Recent advances in cancer research have shed new light on the complex processes of how therapeutic radiation initiates changes at cellular, tissue, and system levels that may lead to clinical effects. These new advances may transform the way we use radiation to combat certain types of cancers. For the past two decades many technological advancements in radiation therapy have been largely based on the hypothesis that direct radiation-induced DNA double strand breaks cause cell death and thus tumor control and normal tissue damage. However, new insights have elucidated that in addition to causing cellular DNA damage, localized therapeutic radiation also initiates cascades of complex downstream biological responses in tissue that extend far beyond where therapeutic radiation dose is directly deposited. For instance, studies show that irradiated dying tumor cells release tumor antigens that can lead the immune system to a systemic anti-cancer attack throughout the body of cancer patient; targeted irradiation to solid tumor also increases the migration of tumor cells already in bloodstream, the seeds of potential metastasis. Some of the new insights may explain the long ago discovered but still unexplained non-localized radiation effects (bystander effect and abscopal effect) and the efficacy of spatially fractionated radiation therapy (microbeam radiation therapy and GRID therapy) where many “hot” and “cold” spots are intentionally created throughout the treatment volume. Better understanding of the mechanisms behind the non-localized radiation effects creates tremendous opportunities to develop new and integrated cancer treatment strategies that are based on radiotherapy, immunology, and chemotherapy. However, in the multidisciplinary effort to advance new radiobiology, there are also tremendous challenges including a lack of multidisciplinary researchers and imaging technologies for the microscopic radiation-induced responses. A better grasp of the essence of

  7. TU-CD-303-03: Localized Radiation Can Induce Systemic Anti-Cancer Immune and Non-Immune Responses and How We Might Utilize It

    International Nuclear Information System (INIS)

    Ahmed, M.

    2015-01-01

    Recent advances in cancer research have shed new light on the complex processes of how therapeutic radiation initiates changes at cellular, tissue, and system levels that may lead to clinical effects. These new advances may transform the way we use radiation to combat certain types of cancers. For the past two decades many technological advancements in radiation therapy have been largely based on the hypothesis that direct radiation-induced DNA double strand breaks cause cell death and thus tumor control and normal tissue damage. However, new insights have elucidated that in addition to causing cellular DNA damage, localized therapeutic radiation also initiates cascades of complex downstream biological responses in tissue that extend far beyond where therapeutic radiation dose is directly deposited. For instance, studies show that irradiated dying tumor cells release tumor antigens that can lead the immune system to a systemic anti-cancer attack throughout the body of cancer patient; targeted irradiation to solid tumor also increases the migration of tumor cells already in bloodstream, the seeds of potential metastasis. Some of the new insights may explain the long ago discovered but still unexplained non-localized radiation effects (bystander effect and abscopal effect) and the efficacy of spatially fractionated radiation therapy (microbeam radiation therapy and GRID therapy) where many “hot” and “cold” spots are intentionally created throughout the treatment volume. Better understanding of the mechanisms behind the non-localized radiation effects creates tremendous opportunities to develop new and integrated cancer treatment strategies that are based on radiotherapy, immunology, and chemotherapy. However, in the multidisciplinary effort to advance new radiobiology, there are also tremendous challenges including a lack of multidisciplinary researchers and imaging technologies for the microscopic radiation-induced responses. A better grasp of the essence of

  8. Phleum pratense pollen starch granules induce humoral and cell-mediated immune responses in a rat model of allergy.

    Science.gov (United States)

    Motta, A; Peltre, G; Dormans, J A M A; Withagen, C E T; Lacroix, G; Bois, F; Steerenberg, P A

    2004-02-01

    Timothy grass (Phleum pratense) pollen allergens are an important cause of allergic symptoms. However, pollen grains are too large to penetrate the deeper airways. Grass pollen is known to release allergen-bearing starch granules (SG) upon contact with water. These granules can create an inhalable allergenic aerosol capable of triggering an early asthmatic response and are implicated in thunderstorm-associated asthma. We studied the humoral (IgE) and bronchial lymph node cells reactivities to SG from timothy grass pollen in pollen-sensitized rats. Brown-Norway rats were sensitized (day 0) and challenged (day 21) intratracheally with intact pollen and kept immunized by pollen intranasal instillation by 4 weeks intervals during 3 months. Blood and bronchial lymph nodes were collected 7 days after the last intranasal challenge. SG were purified from fresh timothy grass pollen using 5 microm mesh filters. To determine the humoral response (IgE) to SG, we developed an original ELISA inhibition test, based on competition between pollen allergens and purified SG. The cell-mediated response to SG in the bronchial lymph node cells was determined by measuring the uptake of [3H]thymidine in a proliferation assay. An antibody response to SG was induced, and purified SG were able to inhibit the IgE ELISA absorbance by 45%. Pollen extract and intact pollen gave inhibitions of 55% and 52%, respectively. A cell-mediated response was also found, as pollen extract, intact pollen and SG triggered proliferation of bronchial lymph node cells. It was confirmed that timothy grass pollen contains allergen-loaded SG, which are released upon contact with water. These granules were shown to be recognized by pollen-sensitized rats sera and to trigger lymph node cell proliferation in these rats. These data provide new arguments supporting the implication of grass pollen SG in allergic asthma.

  9. Coagulin-L ameliorates TLR4 induced oxidative damage and immune response by regulating mitochondria and NOX-derived ROS

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Sukka Santosh [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Chauhan, Parul [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Maurya, Preeti [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Academy of Scientific and Innovative Research, New Delhi 110025 (India); Saini, Deepika [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Yadav, Prem Prakash, E-mail: pp_yadav@cdri.res.in [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Barthwal, Manoj Kumar, E-mail: manojbarthwal@cdri.res.in [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India)

    2016-10-15

    Withanolides possess diverse biological and pharmacological activity but their immunomodulatory function is less realized. Hence, coagulin-L, a withanolide isolated from Withania coagulans Dunal has been studied for such an effect in human and murine cells, and mice model. Coagulin-L (1, 3, 10 μM) exhibited immunomodulatory effect by suppressing TLR4 induced immune mediators such as cytokines (GMCSF, IFNα, IFNγ, IL-1α, IL-1Rα, IL-1β, IL-2, IL-2R, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12 (p40/p70), IL-13, IL-15, IL-17), chemokines (IL-8/CXCL8, MIG/CXCL9, IP-10/CXCL10, KC, MCP-1/CCL2, MIP-1α/CCL3, MIP-1β/CCL4, RANTES/CCL5, eotaxin/CCL11), growth factors (FGF-basic, VEGF), nitric oxide and intracellular superoxide. Mechanistically, coagulin-L abrogated LPS induced total and mitochondrial ROS generation, NOX2, NOX4 mRNA expression, IRAK and MAPK (p38, JNK, ERK) activation. Coagulin-L also attenuated IκBα degradation, which prevented NFκB downstream iNOS expression and pro-inflammatory cytokine release. Furthermore, coagulin-L (10, 25, 50 mg/kg, p.o.), undermined the LPS (10 mg/kg, i.p.) induced endotoxemia response in mice as evinced from diminished cytokine release, nitric oxide, aortic p38 MAPK activation and endothelial tissue impairment besides suppressing NOX2 and NOX4 expression in liver and aorta. Moreover, coagulin-L also alleviated the ROS mediated oxidative damage which was assessed through protein carbonyl, lipid hydroperoxide, 8-isoprostane and 8-hydroxy-2-deoxyguanosine quantification. To extend, coagulin-L also suppressed carrageenan-induced paw edema and thioglycollate-induced peritonitis in mice. Therefore, coagulin-L can be of therapeutic importance in pathological conditions induced by oxidative damage. - Highlights: • Coagulin-L demonstrates immunomodulatory effects in vivo and in vitro by modulating ROS. • Coagulin-L modulates TH1/TH2/TH17 immunokines. • Coagulin-L exerts immunomodulatory effect by regulating TLR4-IRAK- ROS

  10. Poly (I:C) enhances the anti-tumor activity of canine parvovirus NS1 protein by inducing a potent anti-tumor immune response.

    Science.gov (United States)

    Gupta, Shishir Kumar; Yadav, Pavan Kumar; Tiwari, A K; Gandham, Ravi Kumar; Sahoo, A P

    2016-09-01

    The canine parvovirus NS1 (CPV2.NS1) protein selectively induces apoptosis in the malignant cells. However, for an effective in vivo tumor treatment strategy, an oncolytic agent also needs to induce a potent anti-tumor immune response. In the present study, we used poly (I:C), a TLR3 ligand, as an adjuvant along with CPV2.NS1 to find out if the combination can enhance the oncolytic activity by inducing a potent anti-tumor immune response. The 4T1 mammary carcinoma cells were used to induce mammary tumor in Balb/c mice. The results suggested that poly (I:C), when given along with CPV2.NS1, not only significantly reduced the tumor growth but also augmented the immune response against tumor antigen(s) as indicated by the increase in blood CD4+ and CD8+ counts and infiltration of immune cells in the tumor tissue. Further, blood serum analysis of the cytokines revealed that Th1 cytokines (IFN-γ and IL-2) were significantly upregulated in the treatment group indicating activation of cell-mediated immune response. The present study reports the efficacy of CPV2.NS1 along with poly (I:C) not only in inhibiting the mammary tumor growth but also in generating an active anti-tumor immune response without any visible toxicity. The results of our study may help in developing CPV2.NS1 and poly (I: C) combination as a cancer therapeutic regime to treat various malignancies.

  11. Comparative Assessment of Induced Immune Responses Following Intramuscular Immunization with Fusion and Cocktail of LeIF, LACK and TSA Genes Against Cutaneous Leishmaniasis in BALB/c Mice.

    Science.gov (United States)

    Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

    2018-02-01

    In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.

  12. Immune responses induced by co-infection with Capillaria hepatica in Clonorchis sinensis-infected rats.

    Science.gov (United States)

    Moon, E-K; Lee, S-H; Goo, T W; Quan, F-S

    2018-07-01

    Clonorchis sinensis and Capillaria hepatica are zoonotic parasites that mainly infect the liver and cause serious liver disorders. However, immunological parameters induced by co-infection with these parasites remain unknown. In this study, for the first time, we investigated immunological profiles induced by co-infection with C. hepatica (CH) in C. sinensis (CS)-infected rats (Sprague-Dawley). Rats were infected primarily with 50 metacercariae of C. sinensis; 4 weeks later, they were subsequently infected with 1000 infective C. hepatica eggs. Significantly higher levels of C. sinensis- or C. hepatica-specific IgG antibodies were found in the sera of rats. Interestingly, no cross-reacting antibody was observed between C. sinensis and C. hepatica infections. Significantly raised eosinophil levels were found in the blood of C. sinensis/C. hepatica co-infected rats (CS + CH) compared to the blood of rats infected singly with C. sinensis. Co-infected rats showed significantly higher levels of lymphocyte proliferation and cytokine production compared to a single C. sinensis infection. The worm burden of C. sinensis was significantly reduced in co-infected rats compared to the single C. sinensis infection. These results indicate that the eosinophils, lymphocyte proliferation and cytokine production induced by subsequent infection with C. hepatica in C. sinensis-infected rats might contribute to the observed C. sinensis worm reduction.

  13. Immersion infection of germ-free zebrafish with Listeria monocytogenes induces transient expression of innate immune response genes

    Directory of Open Access Journals (Sweden)

    Ying eShan

    2015-04-01

    Full Text Available Zebrafish, Denio rerio, could be an alternative to other classic animal models for human infectious diseases to examine the processes of microbial infections and host-pathogen interactions in vivo because of their small body dimension but large clutch size. We established germ-free zebrafish infection models of Listeria monocytogenes through different routes of infection: oral immersion and injection via yolk sac, brain ventricle and blood island. Immersion of zebrafish larva even with 1010CFU/mL L. monocytogenes EGDe strain in egg water was unable to cause mortality, but GFP-expressing bacteria in the gut lumen could be observed in frozen sections. Several selected maker genes of the innate immune system, including cyp1a, irg1l, il1b and mmp9, were significantly induced by oral immersion not only with strain EGDe, but also with strain M7 and L. innocua, though to a lesser degree (P < 0.01. Such induction appears to be transient with peak at 48 h post-infection, but returned to basal level at 72 h post-infection. Of the three injection routes, mortality after infection by yolk sac was 80% in early stage of infection. Few eggs could survive and hatch. Injection into zebrafish embryos via brain ventricle or blood island led to progressive lethal infection. L. mocytogenes EGDe showed steady replication in the fish embryos and was far more pathogenic than strain M7, which is consistent with findings in the murine model. We conclude that zebrafish could serve as susceptible and microscopically visible infection models for L. monocytogenes via different routes and could be applied to further studies on the interactions between bacterial virulence factors and host immune responses.

  14. Characterization of onion lectin (Allium cepa agglutinin) as an immunomodulatory protein inducing Th1-type immune response in vitro.

    Science.gov (United States)

    Prasanna, Vaddi K; Venkatesh, Yeldur P

    2015-06-01

    Onion (Allium cepa), a bulb crop of economic importance, is known to have many health benefits. The major objective of the present study is to address the immunomodulatory properties of onion lectin (A. cepa agglutinin; ACA). ACA was purified from onion extract by D-mannose-agarose chromatography (yield: ~1 mg/kg). ACA is non-glycosylated and showed a molecular mass of ~12 kDa under reducing/non-reducing SDS-PAGE; glutaraldehyde cross-linking indicated that ACA is a non-covalent tetramer of ~12 kDa subunits. Its N-terminal sequence (RNVLLNNEGL; UniProt KB Accn. C0HJM8) showed 70-90% homology to mannose-specific Allium agglutinins. ACA showed specific hemagglutination activity of 8200 units/mg and is stable in the pH range 6-10 and up to 45° C. The immunomodulatory activity of ACA was assessed using the macrophage cell line, RAW264.7 and rat peritoneal macrophages; at 0.1 μg/well, it showed a significant increase (6-8-fold vs. control) in the production of nitric oxide at 24h, and significantly stimulated (2-4-fold vs. control) the production of pro-inflammatory cytokines (TNF-α and IL-12) at 24h. ACA (0.1 μg/well) enhanced the proliferation of murine thymocytes by ~4 fold (vs. control) at 24h; however, ACA does not proliferate B cell-enriched rat splenocytes. Further, it significantly elevated the expression levels of cytokines (IFN-γ and IL-2) over the control in murine thymocytes. Taken together, purified ACA induces a Th1-type immune response in vitro. Though present in low amounts, ACA may contribute to the immune-boosting potential of the popular spice onion since considerable amounts are consumed on a daily basis universally. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Positive regulation of humoral and innate immune responses induced by inactivated Avian Influenza Virus vaccine in broiler chickens.

    Science.gov (United States)

    Abdallah, Fatma; Hassanin, Ola

    2015-12-01

    Avian Influenza (AI) vaccines are widely used for mammals and birds in a trial to eliminate the Avian Influenza virus (AIV) infection from the world. However and up till now the virus is still existed via modulation of its antigenic structure to evade the pressure of host immune responses. For a complete understanding of the immune responses following AI vaccination in chickens, the modulations of the chickens humoral immune responses and interferon-alpha signaling pathway, as a fundamental part of the innate immune responses, were investigated. In our study, we measured the humoral immune response using hemagglutination-inhibition (HI) and enzyme-linked immunosorbent assay (ELISA) tests. In addition, chicken interferon-alpha pathway components was measured at RNA levels using Quantitative Real-time PCR (qRT-PCR) following one dose of inactivated H5N1 influenza vaccine at 14 days of age. In this study, the protective levels of humoral antibody responses were observed at 14, 21 and 28 days following immunization with inactivated (Re-1/H5N1) AI vaccine. In the chicken spleen cells, up regulation in the chicken interferon-alpha pathway components (MX1 & IRF7) was existed as early as 48 h post vaccination and remained until 28 days post vaccination at the endogenous state. However, after the recall with ex-vivo stimulation, the up regulation was more pronounced in the transcriptional factor (IRF7) compared to the antiviral gene (MX1) at 28 days post vaccination. So far, from our results it appears that the inactivated H5N1 vaccine can trigger the chicken interferon-alpha signaling pathway as well as it can elicit protective humoral antibody responses.

  16. Nano-Pulse Stimulation induces immunogenic cell death in human papillomavirus-transformed tumors and initiates an adaptive immune response.

    Directory of Open Access Journals (Sweden)

    Joseph G Skeate

    Full Text Available Nano-Pulse Stimulation (NPS is a non-thermal pulsed electric field modality that has been shown to have cancer therapeutic effects. Here we applied NPS treatment to the human papillomavirus type 16 (HPV 16-transformed C3.43 mouse tumor cell model and showed that it is effective at eliminating primary tumors through the induction of immunogenic cell death while subsequently increasing the number of tumor-infiltrating lymphocytes within the tumor microenvironment. In vitro NPS treatment of C3.43 cells resulted in a doubling of activated caspase 3/7 along with the translocation of phosphatidylserine (PS to the outer leaflet of the plasma membrane, indicating programmed cell death activity. Tumor-bearing mice receiving standard NPS treatment showed an initial decrease in tumor volume followed by clearing of tumors in most mice, and a significant increase in overall survival. Intra-tumor analysis of mice that were unable to clear tumors showed an inverse correlation between the number of tumor infiltrating lymphocytes and the size of the tumor. Approximately half of the mice that cleared established tumors were protected against tumor re-challenge on the opposite flank. Selective depletion of CD8+ T cells eliminated this protection, suggesting that NPS treatment induces an adaptive immune response generating CD8+ T cells that recognize tumor antigen(s associated with the C3.43 tumor model. This method may be utilized in the future to not only ablate primary tumors, but also to induce an anti-tumor response driven by effector CD8+ T cells capable of protecting individuals from disease recurrence.

  17. Nano-Pulse Stimulation induces immunogenic cell death in human papillomavirus-transformed tumors and initiates an adaptive immune response.

    Science.gov (United States)

    Skeate, Joseph G; Da Silva, Diane M; Chavez-Juan, Elena; Anand, Snjezana; Nuccitelli, Richard; Kast, W Martin

    2018-01-01

    Nano-Pulse Stimulation (NPS) is a non-thermal pulsed electric field modality that has been shown to have cancer therapeutic effects. Here we applied NPS treatment to the human papillomavirus type 16 (HPV 16)-transformed C3.43 mouse tumor cell model and showed that it is effective at eliminating primary tumors through the induction of immunogenic cell death while subsequently increasing the number of tumor-infiltrating lymphocytes within the tumor microenvironment. In vitro NPS treatment of C3.43 cells resulted in a doubling of activated caspase 3/7 along with the translocation of phosphatidylserine (PS) to the outer leaflet of the plasma membrane, indicating programmed cell death activity. Tumor-bearing mice receiving standard NPS treatment showed an initial decrease in tumor volume followed by clearing of tumors in most mice, and a significant increase in overall survival. Intra-tumor analysis of mice that were unable to clear tumors showed an inverse correlation between the number of tumor infiltrating lymphocytes and the size of the tumor. Approximately half of the mice that cleared established tumors were protected against tumor re-challenge on the opposite flank. Selective depletion of CD8+ T cells eliminated this protection, suggesting that NPS treatment induces an adaptive immune response generating CD8+ T cells that recognize tumor antigen(s) associated with the C3.43 tumor model. This method may be utilized in the future to not only ablate primary tumors, but also to induce an anti-tumor response driven by effector CD8+ T cells capable of protecting individuals from disease recurrence.

  18. Humoral and cellular immune response in mice induced by the classical swine fever virus E2 protein fused to the porcine CD154 antigen.

    Science.gov (United States)

    Sordo, Yusmel; Suárez, Marisela; Caraballo, Rosalina; Sardina, Talía; Brown, Emma; Duarte, Carlos; Lugo, Joanna; Gil, Lázaro; Perez, Danny; Oliva, Ayme; Vargas, Milagros; Santana, Elaine; Valdés, Rodolfo; Rodríguez, María Pilar

    2018-03-01

    The development of subunit vaccines against classical swine fever is a desirable goal, because it allows discrimination between vaccinated and infected animals. In this study, humoral and cellular immune response elicited in inbred BALB/c mice by immunization with a recombinant classical swine fever virus (CSFV) E2 protein fused to porcine CD154 antigen (E2CD154) was assessed. This model was used as a predictor of immune response in swine. Mice were immunized with E2CD154 emulsified in Montanide ISA50V2 or dissolved in saline on days 1 and 21. Another group received E2His antigen, without CD154, in the same adjuvant. Montanide ISA50V2 or saline served as negative controls for each experimental group. Animals immunized with 12.5 and 2.5 μg/dose of E2CD154 developed the highest titers (>1:2000) of CSFV neutralizing antibodies. Moreover, CSFV specific splenocyte gamma-interferon production, measured after seven and twenty-eight days of immunization, was significantly higher in mice immunized with 12.5 μg of E2CD154. As a conclusion, E2CD154 emulsified in Montanide ISA50 V2 was able to induce a potent humoral and an early cellular immune response in inbred BALB/c mice. Therefore, this immunogen might be an appropriate candidate to elicit immune response in swine, control CSF disease and to eliminate CSFV in swine. Copyright © 2018 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  19. IMMUNE RESPONSE TO EXTRACELLULAR MATRIX COLLAGEN IN CHRONIC HEPATITIS C INDUCED LIVER FIBROSIS

    OpenAIRE

    Borg, Brian B.; Seetharam, Anil; Subramanian, Vijay; Ilias, Haseeb; Lisker–Melman, Mauricio; Korenblat, Kevin; Anderson, Christopher; Shenoy, Surendra; Chapman, William C.; Crippin, Jeffrey S.; Mohanakumar, Thalachallour

    2011-01-01

    Hepatitis C Virus (HCV) infection and recurrence post-transplant (OLT) is associated with extracellular matrix (ECM) components remodeling, particularly collagen (Col), leading to fibrosis. Our aim was to determine whether development of antibodies (Abs) to self antigen Col in HCV infection correlates with fibrosis stage and peripheral cytokine response. Chronic HCV patients, those with recurrence after OLT undergoing biopsy and healthy control subjects were enrolled. HCV subjects (n=70) were...

  20. Pre-existing vector immunity does not prevent replication deficient adenovirus from inducing efficient CD8 T-cell memory and recall responses.

    Directory of Open Access Journals (Sweden)

    Maria Abildgaard Steffensen

    Full Text Available Adenoviral vectors have shown a great potential for vaccine development due to their inherent ability to induce potent and protective CD8 T-cell responses. However, a critical issue regarding the use of these vectors is the existence of inhibitory immunity against the most commonly used Ad5 vector in a large part of the human population. We have recently developed an improved adenoviral vaccine vector system in which the vector expresses the transgene tethered to the MHC class II associated invariant chain (Ii. To further evaluate the potential of this system, the concept of pre-existing inhibitory immunity to adenoviral vectors was revisited to investigate whether the inhibition previously seen with the Ad5 vector also applied to the optimized vector system. We found this to be the case, and antibodies dominated as the mechanism underlying inhibitory vector immunity. However, presence of CD8 T cells directed against epitopes in the adenoviral vector seemed to correlate with repression of the induced response in re-vaccinated B-cell deficient mice. More importantly, despite a repressed primary effector CD8 T-cell response in Ad5-immune animals subjected to vaccination, memory T cells were generated that provided the foundation for an efficient recall response and protection upon subsequent viral challenge. Furthermore, the transgene specific response could be efficiently boosted by homologous re-immunization. Taken together, these studies indicate that adenoviral vectors can be used to induce efficient CD8 T-cell memory even in individuals with pre-existing vector immunity.

  1. Bee venom phospholipase A2 induces a primary type 2 response that is dependent on the receptor ST2 and confers protective immunity.

    Science.gov (United States)

    Palm, Noah W; Rosenstein, Rachel K; Yu, Shuang; Schenten, Dominik D; Florsheim, Esther; Medzhitov, Ruslan

    2013-11-14

    Venoms consist of toxic components that are delivered to their victims via bites or stings. Venoms also represent a major class of allergens in humans. Phospholipase A2 (PLA2) is a conserved component of venoms from multiple species and is the major allergen in bee venom. Here we examined how bee venom PLA2 is sensed by the innate immune system and induces a type 2 immune response in mice. We found that bee venom PLA2 induced a T helper type 2 (Th2) cell-type response and group 2 innate lymphoid cell activation via the enzymatic cleavage of membrane phospholipids and release of interleukin-33. Furthermore, we showed that the IgE response to PLA2 could protect mice from future challenge with a near-lethal dose of PLA2. These data suggest that the innate immune system can detect the activity of a conserved component of venoms and induce a protective immune response against a venom toxin. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Vaccination with lipid core peptides fails to induce epitope-specific T cell responses but confers non-specific protective immunity in a malaria model.

    Directory of Open Access Journals (Sweden)

    Simon H Apte

    Full Text Available Vaccines against many pathogens for which conventional approaches have failed remain an unmet public health priority. Synthetic peptide-based vaccines offer an attractive alternative to whole protein and whole organism vaccines, particularly for complex pathogens that cause chronic infection. Previously, we have reported a promising lipid core peptide (LCP vaccine delivery system that incorporates the antigen, carrier, and adjuvant in a single molecular entity. LCP vaccines have been used to deliver several peptide subunit-based vaccine candidates and induced high titre functional antibodies and protected against Group A streptococcus in mice. Herein, we have evaluated whether LCP constructs incorporating defined CD4(+ and/or CD8(+ T cell epitopes could induce epitope-specific T cell responses and protect against pathogen challenge in a rodent malaria model. We show that LCP vaccines failed to induce an expansion of antigen-specific CD8(+ T cells following primary immunization or by boosting. We further demonstrated that the LCP vaccines induced a non-specific type 2 polarized cytokine response, rather than an epitope-specific canonical CD8(+ T cell type 1 response. Cytotoxic responses of unknown specificity were also induced. These non-specific responses were able to protect against parasite challenge. These data demonstrate that vaccination with lipid core peptides fails to induce canonical epitope-specific T cell responses, at least in our rodent model, but can nonetheless confer non-specific protective immunity against Plasmodium parasite challenge.

  3. T-Cell Mediated Immune Responses Induced in ret Transgenic Mouse Model of Malignant Melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Abschuetz, Oliver [Skin Cancer Unit, German Cancer Research Center (DKFZ), Heidelberg and Department of Dermatology, Venereology and Allergology, University Medical Center Mannheim, Ruprecht-Karl University of Heidelberg, Mannheim , Heidelberg 69120 (Germany); Osen, Wolfram [Division of Translational Immunology, German Cancer Center, Heidelberg 69120 (Germany); Frank, Kathrin [Skin Cancer Unit, German Cancer Research Center (DKFZ), Heidelberg and Department of Dermatology, Venereology and Allergology, University Medical Center Mannheim, Ruprecht-Karl University of Heidelberg, Mannheim , Heidelberg 69120 (Germany); Kato, Masashi [Unit of Environmental Health Sciences, Department of Biomedical Sciences, College of Life and Health Sciences, Chubu University, Aichi 487-8501 (Japan); Schadendorf, Dirk [Department of Dermatology, University Hospital Essen, Essen 45122 (Germany); Umansky, Viktor, E-mail: v.umansky@dkfz.de [Skin Cancer Unit, German Cancer Research Center (DKFZ), Heidelberg and Department of Dermatology, Venereology and Allergology, University Medical Center Mannheim, Ruprecht-Karl University of Heidelberg, Mannheim , Heidelberg 69120 (Germany)

    2012-04-26

    Poor response of human malignant melanoma to currently available treatments requires a development of innovative therapeutic strategies. Their evaluation should be based on animal models that resemble human melanoma with respect to genetics, histopathology and clinical features. Here we used a transgenic mouse model of spontaneous skin melanoma, in which the ret transgene is expressed in melanocytes under the control of metallothionein-I promoter. After a short latency, around 25% mice develop macroscopic skin melanoma metastasizing to lymph nodes, bone marrow, lungs and brain, whereas other transgenic mice showed only metastatic lesions without visible skin tumors. We found that tumor lesions expressed melanoma associated antigens (MAA) tyrosinase, tyrosinase related protein (TRP)-1, TRP-2 and gp100, which could be applied as targets for the immunotherapy. Upon peptide vaccination, ret transgenic mice without macroscopic melanomas were able to generate T cell responses not only against a strong model antigen ovalbumin but also against typical MAA TRP-2. Although mice bearing macroscopic primary tumors could also display an antigen-specific T cell reactivity, it was significantly down-regulated as compared to tumor-free transgenic mice or non-transgenic littermates. We suggest that ret transgenic mice could be used as a pre-clinical model for the evaluation of novel strategies of melanoma immunotherapy.

  4. Recombinant proteins of Zaire ebolavirus induce potent humoral and cellular immune responses and protect against live virus infection in mice.

    Science.gov (United States)

    Lehrer, Axel T; Wong, Teri-Ann S; Lieberman, Michael M; Humphreys, Tom; Clements, David E; Bakken, Russell R; Hart, Mary Kate; Pratt, William D; Dye, John M

    2018-05-24

    Infections with filoviruses in humans are highly virulent, causing hemorrhagic fevers which result in up to 90% mortality. In addition to natural infections, the ability to use these viruses as bioterrorist weapons is of significant concern. Currently, there are no licensed vaccines or therapeutics available to combat these infections. The pathogenesis of disease involves the dysregulation of the host's immune system, which results in impairment of the innate and adaptive immune responses, with subsequent development of lymphopenia, thrombocytopenia, hemorrhage, and death. Questions remain with regard to the few survivors of infection, who manage to mount an effective adaptive immune response. These questions concern the humoral and cellular components of this response, and whether such a response can be elicited by an appropriate prophylactic vaccine. The data reported herein describe the production and evaluation of a recombinant subunit Ebola virus vaccine candidate consisting of insect cell expressed Zaire ebolavirus (EBOV) surface glycoprotein (GP) and the matrix proteins VP24 and VP40. The recombinant subunit proteins are shown to be highly immunogenic in mice, yielding both humoral and cellular responses, as well as highly efficacious, providing up to 100% protection against a lethal challenge with live virus. These results demonstrate proof of concept for such a recombinant non-replicating vaccine candidate in the mouse model of EBOV which helps to elucidate immune correlates of protection and warrants further development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. SjCRT, a recombinant Schistosoma japonicum calreticulin, induces maturation of dendritic cells and a Th1-polarized immune response in mice

    Directory of Open Access Journals (Sweden)

    Lizhen Ma

    2017-11-01

    Full Text Available Abstract Background It is well known that immunization of radiation-attenuated (RA schistosoma cercariae or schistosomula can induce high levels of protective immunity against schistosoma cercariae reinfection in many animals. Many studies have shown that the Th1 cellular immune response is crucial for the protective effect elicited by RA schistosomula. However, the molecular mechanism of this strong protective immunity remains unclear. Methods The expression profiles of Schistosoma japonicum calreticulin (SjCRT in RA and normal schistosoma-derived cells were investigated by flow cytometry. The effect of recombinant SjCRT (rSjCRT on mouse dendritic cells (DCs was determined by FACS, ELISA and RT-PCR analysis. We also analyzed the effects of SjCRT on the activation of spleen cells from mice immunized with rSjCRT by detecting lymphocyte proliferation and the cytokine profiles of splenocytes. Results We found that the expression level of SjCRT in the cells from RA larvae was significantly higher than that in cells from normal schistosomula at early stages of development (day 4. The results of effect of rSjCRT on mouse DCs showed that rSjCRT could induce phenotypic and functional maturation of DCs, and SjCRT bound to the surface of DCs through the CD91 receptor and could be engulfed by DCs. The results of activation of splenocytes from mice immunized with rSjCRT also demonstrate that rSjCRT can effectively stimulate the proliferative response of splenic lymphocytes, elicit splenocytes from immunized mice to secrete high levels of IFN-γ, TNF-α and IL-4, and activate CD4+ T cells to produce high levels of IFN-γ. Conclusion SjCRT is one of the immunostimulatory molecules released from RA schistosomula cells, might play a crucial role in conferring a Th1-polarized immune response induced by RA cercariae/schistosomula in mice, and is a candidate molecule responsible for the high levels of protective immunity induced by RA schistosomula.

  6. Modulation of the innate immune responses in the striped ...

    African Journals Online (AJOL)

    Thus, most of the innate non-specific immune responses are inducible though they are constitutive of fish immune system exhibiting a basal level of activity even in the absence of pathogen challenge. Keywords: Aeromonas hydrophila, Experimental challenge, Innate immune response, Striped snakehead murrel ...

  7. Dicarbonyl Induced Structural Perturbations Make Histone H1 Highly Immunogenic and Generate an Auto-Immune Response in Cancer.

    Directory of Open Access Journals (Sweden)

    Abdul Rouf Mir

    Full Text Available Increased oxidative stress under hyperglycemic conditions, through the interaction of AGEs with RAGE receptors and via activation of interleukin mediated transcription signalling, has been reported in cancer. Proteins modifications are being explored for their roles in the development and progression of cancer and autoantibody response against them is gaining interest as a probe for early detection of the disease. This study has analysed the changes in histone H1 upon modification by methylglyoxal (MG and its implications in auto-immunopathogenesis of cancer. Modified histone showed modifications in the aromatic residues, changed tyrosine microenvironment, intermolecular cross linking and generation of AGEs. It showed masking of hydrophobic patches and a hypsochromic shift in the in ANS specific fluorescence. MG aggressively oxidized histone H1 leading to the accumulation of reactive carbonyls. Far UV CD measurements showed di-carbonyl induced enhancement of the alpha structure and the induction of beta sheet conformation; and thermal denaturation (Tm studies confirmed the thermal stability of the modified histone. FTIR analysis showed amide I band shift, generation of a carboxyethyl group and N-Cα vibrations in the modified histone. LCMS analysis confirmed the formation of Nε-(carboxyethyllysine and electron microscopic studies revealed the amorphous aggregate formation. The modified histone showed altered cooperative binding with DNA. Modified H1 induced high titre antibodies in rabbits and the IgG isolated form sera of rabbits immunized with modified H1 exhibited specific binding with its immunogen in Western Blot analysis. IgG isolated from the sera of patients with lung cancer, prostate cancer, breast cancer and cancer of head and neck region showed better recognition for neo-epitopes on the modified histone, reflecting the presence of circulating autoantibodies in cancer. Since reports suggest a link between AGE-RAGE axis and

  8. Epitope-based vaccines with the Anaplasma marginale MSP1a functional motif induce a balanced humoral and cellular immune response in mice.

    Directory of Open Access Journals (Sweden)

    Paula S Santos

    Full Text Available Bovine anaplasmosis is a hemoparasitic disease that causes considerable economic loss to the dairy and beef industries. Cattle immunized with the Anaplasma marginale MSP1 outer membrane protein complex presents a protective humoral immune response; however, its efficacy is variable. Immunodominant epitopes seem to be a key-limiting factor for the adaptive immunity. We have successfully demonstrated that critical motifs of the MSP1a functional epitope are essential for antibody recognition of infected animal sera, but its protective immunity is yet to be tested. We have evaluated two synthetic vaccine formulations against A. marginale, using epitope-based approach in mice. Mice infection with bovine anaplasmosis was demonstrated by qPCR analysis of erythrocytes after 15-day exposure. A proof-of-concept was obtained in this murine model, in which peptides conjugated to bovine serum albumin were used for immunization in three 15-day intervals by intraperitoneal injections before challenging with live bacteria. Blood samples were analyzed for the presence of specific IgG2a and IgG1 antibodies, as well as for the rickettsemia analysis. A panel containing the cytokines' transcriptional profile for innate and adaptive immune responses was carried out through qPCR. Immunized BALB/c mice challenged with A. marginale presented stable body weight, reduced number of infected erythrocytes, and no mortality; and among control groups mortality rates ranged from 15% to 29%. Additionally, vaccines have significantly induced higher IgG2a than IgG1 response, followed by increased expression of pro-inflammatory cytokines. This is a successful demonstration of epitope-based vaccines, and protection against anaplasmosis may be associated with elicitation of effector functions of humoral and cellular immune responses in murine model.

  9. Pathogen recognition in the innate immune response.

    Science.gov (United States)

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  10. Coxsackievirus A 16 infection does not interfere with the specific immune response induced by an enterovirus 71 inactivated vaccine in rhesus monkeys.

    Science.gov (United States)

    Wang, Jingjing; Qi, Sudong; Zhang, Xiaolong; Zhang, Ying; Liu, Longding; Che, Yanchun; He, Zhanlong; Zhao, Yuan; Lu, Shuaiyao; Yu, Wenhai; Li, Qihan

    2014-07-31

    Hand, foot and mouth disease is usually caused by enterovirus 71 (EV71) and coxsackievirus A 16 (CA16), which are members of the Picornaviridae family. In the present study, the characteristics of the immune response induced by an EV71 inactivated vaccine (made from human diploid cells) were explored in the presence of CA16 infection, based on the previously established neonatal rhesus monkey model. The typical clinical manifestations, including body temperature, viral viremia and virus shedding in the mouth, pharynx and feces, were characterized. A specific neutralizing antibody assay showed that the specific immune response induced by the EV71 inactivated vaccine was active against EV71 but not against CA16. No remarkable fluctuation in proinflammatory cytokine release was identified in the serum of immunized monkeys with EV71 vaccine and CA16 infections subsequently. The results showed that the specific immune response induced by the EV71 inactivated vaccine is effective against EV71 infection but is not affected by CA16 infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. 255Gy irradiated tachyzoites of Toxoplasma gondii induce intestinal immune response in C57BL/6J immunized by oral route

    Energy Technology Data Exchange (ETDEWEB)

    Galisteo Junior, Andres Jimenez; Alves, Janaina Baptista [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil). Lab. de Biologia Molecular]. E-mail: galisteo@usp.br; Hiramoto, Roberto Mitsuyoshi [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil). Secao de Parasitoses Sistemicas]. E-mail: hiramoto@usp.br; Carmo, Claudia Villano do; Andrade Junior, Heitor Franco de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil). Lab. de Protozoologia]. E-mail: hfandrad@usp.br

    2005-07-01

    Toxoplasmosis, a prevalent widespread infection in man and animals, occurs mainly through ingestion of water and food contaminated with oocyst from cat feces, causing usually benign disease in humans, except in intrauterine fetal infection or in immunodeficient patients. We study the oral route for the development of a vaccine for toxoplasmosis, using parasites irradiated with 60 Cobalt, as an alternative for vaccine development to this worldwide parasitic infection. We evaluated the development of immunity at serum or mucosal levels, and their efficiency in protect the mice against challenge with oral cysts of the ME-49 strain. C57Bl/6j isogenic mice were immunized by oral route with 10{sup 7} 255 Gy irradiated tachyzoites from RH strain, at several protocols using milk as anti-peptic adjuvant and alum hydroxide as antacid. The preparations of irradiated tachyzoites induced production of serum IgG and IgA in immunized mice, as determined by ELISA, with IgG2a as the dominant subclass, similar to chronic infection. Their use with adjuvant allowed the excretion of significant amounts of IgA in stools also IgG, despite a lesser extent. All oral preparations induced some quantitative protection against challenge, which was similar to the parenteral route only isolated alum hydroxide was used as adjuvant. All these data support the possibility of the development of an oral vaccine against toxoplasmosis, using irradiated tachyzoites, which would be possible tool in near future for use in field baits, for immunizing either domestic or wild felids. (author)

  12. 255Gy irradiated tachyzoites of Toxoplasma gondii induce intestinal immune response in C57BL/6J immunized by oral route

    International Nuclear Information System (INIS)

    Galisteo Junior, Andres Jimenez; Alves, Janaina Baptista; Hiramoto, Roberto Mitsuyoshi; Carmo, Claudia Villano do; Andrade Junior, Heitor Franco de

    2005-01-01

    Toxoplasmosis, a prevalent widespread infection in man and animals, occurs mainly through ingestion of water and food contaminated with oocyst from cat feces, causing usually benign disease in humans, except in intrauterine fetal infection or in immunodeficient patients. We study the oral route for the development of a vaccine for toxoplasmosis, using parasites irradiated with 60 Cobalt, as an alternative for vaccine development to this worldwide parasitic infection. We evaluated the development of immunity at serum or mucosal levels, and their efficiency in protect the mice against challenge with oral cysts of the ME-49 strain. C57Bl/6j isogenic mice were immunized by oral route with 10 7 255 Gy irradiated tachyzoites from RH strain, at several protocols using milk as anti-peptic adjuvant and alum hydroxide as antacid. The preparations of irradiated tachyzoites induced production of serum IgG and IgA in immunized mice, as determined by ELISA, with IgG2a as the dominant subclass, similar to chronic infection. Their use with adjuvant allowed the excretion of significant amounts of IgA in stools also IgG, despite a lesser extent. All oral preparations induced some quantitative protection against challenge, which was similar to the parenteral route only isolated alum hydroxide was used as adjuvant. All these data support the possibility of the development of an oral vaccine against toxoplasmosis, using irradiated tachyzoites, which would be possible tool in near future for use in field baits, for immunizing either domestic or wild felids. (author)

  13. DDA/TDB liposomes containing soluble Leishmania major antigens induced a mixed Th1/Th2 immune response in BALB/c mice

    Directory of Open Access Journals (Sweden)

    Mansure Hojatizade

    2017-04-01

    Full Text Available Objective(s: Leishmaniasis is a complex parasitic disease that represents a major public health problem. Despite numerous attempts over the past decades, yet there is no effective vaccine against human leishmaniasis probably due to the lack of suitable adjuvants. In this study, a first generation liposomal-based Leishmania vaccine was developed using soluble Leishmania major antigens (SLA and á, Ü-trehalose6, 6'-dibehenat (TDB as an immunostimulatory adjuvant. In this liposome structure, the cationic lipid Dimethyldioctadecylammonium (DDA provides intrinsic adjuvant activity and cholesterol was added as a membrane stabilizer. Liposomes containing SLA were prepared.Materials and Methods: BALB/c mice were subcutaneously (sc immunized with Lip (DDA/TDB/CHOL-SLA+, Lip (DDA/TDB-SLA+, Lip (DDA-SLA+, Lip (DDA/CHOL-SLA+, SLA or Tris-HCl buffer. Immunization was done every two weeks for three weeks. The immunized mice were then challenged sc in the left footpad with 1×106 stationary phase L. major promastigotes (50 ìl, at 2 weeks after last booster injection.Results: mice immunized with any of the liposomal formulations containing SLA (Lip-SLA+, substantially increased footpad swelling and parasite loads of foot and spleen with no significant difference compared to Tris-HCl buffer or SLA alone. Lip-SLA+ formulations induced a mixed Th1/Th2 immune response characterized by IFN-ã and IL-4 production as well as high levels of IgG1 anti-Leishmania antibody. Conclusion: immunization with liposomes containing DDA and/or TDB in combination with SLA induces a mixed Th1/Th2 immune response and is not an appropriate strategy for preferential induction of a Th1 response and protection against leishmaniasis.

  14. Antibody and T cell responses induced in chickens immunized with avian influenza virus N1 and NP DNA vaccine with chicken IL-15 and IL-18.

    Science.gov (United States)

    Lim, Kian-Lam; Jazayeri, Seyed Davoud; Yeap, Swee Keong; Mohamed Alitheen, Noorjahan Banu; Bejo, Mohd Hair; Ideris, Aini; Omar, Abdul Rahman

    2013-12-01

    We had examined the immunogenicity of a series of plasmid DNAs which include neuraminidase (NA) and nucleoprotein (NP) genes from avian influenza virus (AIV). The interleukin-15 (IL-15) and interleukin-18 (IL-18) as genetic adjuvants were used for immunization in combination with the N1 and NP AIV genes. In the first trial, 8 groups of chickens were established with 10 specific-pathogen-free (SPF) chickens per group while, in the second trial 7 SPF chickens per group were used. The overall N1 enzyme-linked immunosorbent assay (ELISA) titer in chickens immunized with the pDis/N1+pDis/IL-15 was higher compared to the chickens immunized with the pDis/N1 and this suggesting that chicken IL-15 could play a role in enhancing the humoral immune response. Besides that, the chickens that were immunized at 14-day-old (Trial 2) showed a higher N1 antibody titer compared to the chickens that were immunized at 1-day-old (Trial 1). Despite the delayed in NP antibody responses, the chickens co-administrated with IL-15 were able to induce earlier and higher antibody response compared to the pDis/NP and pDis/NP+pDis/IL-18 inoculated groups. The pDis/N1+pDis/IL-15 inoculated chickens also induced higher CD8+ T cells increase than the pDis/N1 group in both trials (P0.05) in inducing CD4+ and CD8+ T cells when co-administered with the pDis/IL-18 in both trials in comparison to the pDis/NP. Our data suggest that the pDis/N1+pDis/IL-15 combination has the potential to be used as a DNA vaccine against AIV in chickens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Activated Α7nachr Improves Postoperative Cognitive Dysfunction and Intestinal Injury Induced by Cardiopulmonary Bypass in Rats: Inhibition of the Proinflammatory Response Through the Th17 Immune Response

    Directory of Open Access Journals (Sweden)

    Keyan Chen

    2018-04-01

    Full Text Available Backgrund/Aims: To investigate the effects of activated α7 nicotinic acetylcholine receptor (α7nAChR on postoperative cognitive dysfunction (POCD and intestinal injury induced by cardiopulmonary bypass (CPB and its relationship with the Th17 response in order to provide a theoretical basis for organ protection and targeted drug therapy during the perioperative period. Methods: Sprague-Dawley rat models of CPB were established. Rat intestinal and brain injuries were observed after CPB using hematoxylin and eosin staining. Cell apoptosis was determined using terminal deoxynucleotidyl transferase dUTP nick end labeling. Inflammatory factors and markers of brain injury in rat serum were measured using enzyme-linked immunosorbent assay. The expression levels of Bcl-2, Bax, caspase-3, ZO-1, occludin, AQP4, RORγT, and α7nAchR were examined using western blotting. Transcription factor RORγT expression was determined using real-time fluorescent quantitative polymerase chain reaction. Th17 cells in the peripheral blood and spleen were determined using flow cytometry. α7nAchR knockout rats were established. The Th17 response in the peripheral blood and spleen of α7nAchR knockout rats was further verified using flow cytometry. Results: CPB can induce POCD and intestinal injury in rats. α7nAchR activation markedly reduced intestinal injury, POCD, neuronal apoptosis, proinflammatory factor expression, and number of CD4+IL-17+ cells. α7nAchR knockout significantly increased serum D-lactic acid, FABP2, S-100β, NSE, TNF-α, IL-6, and IL-17 secretion. The number of CD4+IL-17+ cells was also significantly increased. Conclusion: α7nAchR activation markedly ameliorates the intestinal injury and POCD induced by CPB. Inhibition of the Th17 immune response can reduce the proinflammatory response, which could provide a new method for clinical perioperative organ protection and targeted drug therapy.

  16. Oral administration of type-II collagen peptide 250-270 suppresses specific cellular and humoral immune response in collagen-induced arthritis.

    Science.gov (United States)

    Zhu, Ping; Li, Xiao-Yan; Wang, Hong-Kun; Jia, Jun-Feng; Zheng, Zhao-Hui; Ding, Jin; Fan, Chun-Mei

    2007-01-01

    Oral antigen is an attractive approach for the treatment of autoimmune and inflammatory diseases. Establishment of immune markers and methods in evaluating the effects of antigen-specific cellular and humoral immune responses will help the application of oral tolerance in the treatment of human diseases. The present article observed the effects of chicken collagen II (CII), the recombinant polymerized human collagen II 250-270 (rhCII 250-270) peptide and synthesized human CII 250-270 (syCII 250-270) peptide on the induction of antigen-specific autoimmune response in rheumatoid arthritis (RA) peripheral blood mononuclear cells (PBMC) and on the specific cellular and humoral immune response in collagen-induced arthritis (CIA) and mice fed with CII (250-270) prior to immunization with CII. In the study, proliferation, activation and intracellular cytokine production of antigen-specific T lymphocytes were simultaneously analyzed by bromodeoxyuridine (BrdU) incorporation and flow cytometry at the single-cell level. The antigen-specific antibody and antibody-forming cells were detected by ELISA and ELISPOT, respectively. CII (250-270) was found to have stimulated the response of specific lymphocytes in PBMC from RA patients, including the increase expression of surface activation antigen marker CD69 and CD25, and DNA synthesis. Mice, fed with CII (250-270) before CII immunization, had significantly lower arthritic scores than the mice immunized with CII alone, and the body weight of the former increased during the study period. Furthermore, the specific T cell activity, proliferation and secretion of interferon (IFN)-gamma in spleen cells were actively suppressed in CII (250-270)-fed mice, and the serum anti-CII, anti-CII (250-270) antibody activities and the frequency of specific antibody-forming spleen cells were significantly lower in CII (250-270)-fed mice than in mice immunized with CII alone. These observations suggest that oral administration of CII (250-270) can

  17. Testing the ability of viral haemorrhagic septicaemia virus to evade the protective immune response induced in rainbow trout by DNA vaccination

    DEFF Research Database (Denmark)

    Sepulveda, Dagoberto; Lorenzen, Niels

    2013-01-01

    , this work aims to evaluate whether VHSV is able to evade the protective immune response induced by the DNA vaccination. Earlier studies have demonstrated that VHSV can evade the neutralizing effect of monoclonal antibodies by mutations in the glycoprotein gene. One approach of the present study is therefore...... to try to isolate VHSV variants which can escape the neutralizing activity of serum from fish immunized with the DNA vaccine. To do so, a highly pathogenic VHSV isolate (DK3592B) will be repeatedly passaged in fish cell cultures in the presence of neutralizing fish serum. Another approach comprises...

  18. Immune response to H pylori

    Science.gov (United States)

    Suarez, Giovanni; Reyes, Victor E; Beswick, Ellen J

    2006-01-01

    The gastric mucosa separates the underlying tissue from the vast array of antigens that traffic through the stomach lumen. While the extreme pH of this environment is essential in aiding the activation of enzymes and food digestion, it also renders the gastric epithelium free from bacterial colonization, with the exception of one important human pathogen, H pylori. This bacterium has developed mechanisms to survive the harsh environment of the stomach, actively move through the mucosal layer, attach to the epithelium, evade immune responses, and achieve persistent colonization. While a hallmark of this infection is a marked inflammatory response with the infiltration of various immune cells into the infected gastric mucosa, the host immune response is unable to clear the infection and may actually contribute to the associated pathogenesis. Here, we review the host responses involved during infection with H pylori and how they are influenced by this bacterium. PMID:17007009

  19. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    Science.gov (United States)

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

  20. Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

    Science.gov (United States)

    Baril, Martin; Es-Saad, Salwa; Chatel-Chaix, Laurent; Fink, Karin; Pham, Tram; Raymond, Valérie-Ann; Audette, Karine; Guenier, Anne-Sophie; Duchaine, Jean; Servant, Marc; Bilodeau, Marc; Cohen, Eric; Grandvaux, Nathalie; Lamarre, Daniel

    2013-01-01

    To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1) promoter following Sendai virus (SeV) infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I)-like receptor (RLR)-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1) upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3) inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

  1. Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

    Directory of Open Access Journals (Sweden)

    Martin Baril

    Full Text Available To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1 promoter following Sendai virus (SeV infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I-like receptor (RLR-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1 upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3 inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

  2. Local oral immunization with synthetic peptides induces a dual mucosal IgG and salivary IgA antibody response and prevents colonization of Streptococcus mutans.

    Science.gov (United States)

    Lehner, T; Haron, J; Bergmeier, L A; Mehlert, A; Beard, R; Dodd, M; Mielnik, B; Moore, S

    1989-01-01

    A small cell surface antigen of Streptococcus mutans was partially sequenced and the amino terminal peptides of 11, 15 and 20 amino acid residues and a dimer of the 15 and 20 residues peptides were synthesized. The synthetic peptides (SP) were used in topical oral immunization of the gingivomucosal epithelium of macaque monkeys. Sequential examination for antibodies over a period of up to 30 weeks revealed that six applications of the linear or cyclized SP11 and a random SP11 induced negligible or very low antibody levels. In contrast, the SP17 (SP15 with added cysteine at each terminus), SP21 (SP20 with one cysteine) and the dimer (SP35) induced significant anti-SP as well as anti-native streptococcal antibodies in the gingival fluid and in saliva. The functional significance of this immune response was examined by studying its effect on oral colonization of S. mutans following feeding of a carbohydrate-rich diet. Whereas control animals, sham-immunized with a random SP of 11 residues, showed increased colonization of the teeth by S. mutans, there was no colonization or a significant reduction in colonization of animals immunized with the cyclized SP17, linear SP21 or dimerized SP35. These experiments suggest that local immunization with SP derived from the sequences of a streptococcal cell surface antigen induce a dual local immune response of gingival IgG and salivary IgA antibodies against the SP and native SA. These antibodies may be involved in preventing colonization of S. mutans, which is the principal agent in the development of dental caries. PMID:2759661

  3. Vaccination with a HSV-2 UL24 mutant induces a protective immune response in murine and guinea pig vaginal infection models.

    Science.gov (United States)

    Visalli, Robert J; Natuk, Robert J; Kowalski, Jacek; Guo, Min; Blakeney, Susan; Gangolli, Seema; Cooper, David

    2014-03-10

    The rational design and development of genetically attenuated HSV-2 mutant viruses represent an attractive approach for developing both prophylactic and therapeutic vaccines for genital herpes. Previously, HSV-2 UL24 was shown to be a virulence determinant in both murine and guinea pig vaginal infection models. An UL24-βgluc insertion mutant produced syncytial plaques and replicated to nearly wild type levels in tissue culture, but induced little or no pathological effects in recipient mice or guinea pigs following vaginal infection. Here we report that immunization of mice or guinea pigs with high or low doses of UL24-βgluc elicited a highly protective immune response. UL24-βgluc immunization via the vaginal or intramuscular routes was demonstrated to protect mice from a lethal vaginal challenge with wild type HSV-2. Moreover, antigen re-stimulated splenic lymphocytes harvested from immunized mice exhibited both HSV-2 specific CTL activity and IFN-γ expression. Humoral anti-HSV-2 responses in serum were Th1-polarized (IgG2a>IgG1) and contained high-titer anti-HSV-2 neutralizing activity. Guinea pigs vaccinated subcutaneously with UL24-βgluc or the more virulent parental strain (186) were challenged with a heterologous HSV-2 strain (MS). Acute disease scores were nearly indistinguishable in guinea pigs immunized with either virus. Recurrent disease scores were reduced in UL24-βgluc immunized animals but not to the same extent as those immunized with strain 186. In addition, challenge virus was not detected in 75% of guinea pigs subcutaneously immunized with UL24-βgluc. In conclusion, disruption of the UL24 gene is a prime target for the development of a genetically attenuated live HSV-2 vaccine. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Nasally administered Lactobacillus rhamnosus strains differentially modulate respiratory antiviral immune responses and induce protection against respiratory syncytial virus infection.

    Science.gov (United States)

    Tomosada, Yohsuke; Chiba, Eriko; Zelaya, Hortensia; Takahashi, Takuya; Tsukida, Kohichiro; Kitazawa, Haruki; Alvarez, Susana; Villena, Julio

    2013-08-15

    Some studies have shown that nasally administered immunobiotics had the potential to improve the outcome of influenza virus infection. However, the capacity of immunobiotics to improve protection against respiratory syncytial virus (RSV) infection was not investigated before. The aims of this study were: a) to evaluate whether the nasal administration of Lactobacillus rhamnosus CRL1505 (Lr05) and L. rhamnosus CRL1506 (Lr06) are able to improve respiratory antiviral defenses and beneficially modulate the immune response triggered by TLR3/RIG-I activation; b) to investigate whether viability of Lr05 or Lr06 is indispensable to modulate respiratory immunity and; c) to evaluate the capacity of Lr05 and Lr06 to improve the resistance of infant mice against RSV infection. Nasally administered Lr05 and Lr06 differentially modulated the TLR3/RIG-I-triggered antiviral respiratory immune response. Lr06 administration significantly modulated the production of IFN-α, IFN-β and IL-6 in the response to poly(I:C) challenge, while nasal priming with Lr05 was more effective to improve levels of IFN-γ and IL-10. Both viable Lr05 and Lr06 strains increased the resistance of infant mice to RSV infection while only heat-killed Lr05 showed a protective effect similar to those observed with viable strains. The present work demonstrated that nasal administration of immunobiotics is able to beneficially modulate the immune response triggered by TLR3/RIG-I activation in the respiratory tract and to increase the resistance of mice to the challenge with RSV. Comparative studies using two Lactobacillus rhamnosus strains of the same origin and with similar technological properties showed that each strain has an specific immunoregulatory effect in the respiratory tract and that they differentially modulate the immune response after poly(I:C) or RSV challenges, conferring different degree of protection and using distinct immune mechanisms. We also demonstrated in this work that it is possible

  5. Immune response induced by oral delivery of Bacillus subtilis spores expressing enolase of Clonorchis sinensis in grass carps (Ctenopharyngodon idellus).

    Science.gov (United States)

    Jiang, Hongye; Chen, Tingjin; Sun, Hengchang; Tang, Zeli; Yu, Jinyun; Lin, Zhipeng; Ren, Pengli; Zhou, Xinyi; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2017-01-01

    Clonorchiasis, caused by the consumption of raw or undercooked freshwater fish containing infective metacercariae of Clonorchis sinensisis (C.sinensis), remains a common public health problem. New effective prevention strategies are still urgent to control this food-borne infectious disease. The previous studies suggested Bacillus subtilis (B. subtilis) spores was an ideal vaccines delivery system, and the C.sinensis enolase (CsENO) was a potential vaccine candidate against clonorchiasis. In the current study, we detected CsENO-specific IgM levels by ELISA in sera, intestinal mucus and skin mucus in grass carps (Ctenopharyngodon idella) through oral administration with B. subtilis spores surface expressing CsENO. In addition, immune-related genes expression was also measured by qRT-PCR. Grass carps orally treated with B. subtilis spores or normal forages were used as controls. The results of ELISA manifested that specific IgM levels of grass carps in CsENO group in sera, intestine mucus and skin mucus almost significantly increased from week 4 post the first oral administration when compared to the two control groups. The levels of specific IgM reached its peak in intestine mucus firstly, then in sera, and last in skin mucus. qRT-PCR results showed that 5 immune-related genes expression had different degree of rising trend in CsENO group when compared to the two control groups. Our study demonstrated that orally administrated with B. subtilis spores expressing CsENO induced innate and adaptive immunity, systemic and local mucosal immunity, and humoral and cellular immunity. Our work may pave the way to clarify the exact mechanisms of protective efficacy elicited by B. subtilis spores expressing CsENO and provide new ideas for vaccine development against C. sinensis infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Intradermal Immunization of Leishmania donovani Centrin Knock-Out Parasites in Combination with Salivary Protein LJM19 from Sand Fly Vector Induces a Durable Protective Immune Response in Hamsters.

    Directory of Open Access Journals (Sweden)

    Jacqueline Araújo Fiuza

    2016-01-01

    Full Text Available Visceral leishmaniasis (VL is a neglected tropical disease and is fatal if untreated. There is no vaccine available against leishmaniasis. The majority of patients with cutaneous leishmaniasis (CL or VL develop a long-term protective immunity after cure from infection, which indicates that development of an effective vaccine against leishmaniasis is possible. Such protection may also be achieved by immunization with live attenuated parasites that do not cause disease. We have previously reported a protective response in mice, hamsters and dogs with Leishmania donovani centrin gene knock-out parasites (LdCen-/-, a live attenuated parasite with a cell division specific centrin1 gene deletion. In this study we have explored the effects of salivary protein LJM19 as an adjuvant and intradermal (ID route of immunization on the efficacy of LdCen-/- parasites as a vaccine against virulent L. donovani.To explore the potential of a combination of LdCen-/- parasites and salivary protein LJM19 as vaccine antigens, LdCen-/- ID immunization followed by ID challenge with virulent L. donovani were performed in hamsters in a 9-month follow up study. We determined parasite burden (serial dilution, antibody production (ELISA and cytokine expression (qPCR in these animals. Compared to controls, animals immunized with LdCen-/- + LJM19 induced a strong antibody response, a reduction in spleen and liver parasite burden and a higher expression of pro-inflammatory cytokines after immunization and one month post-challenge. Additionally, a low parasite load in lymph nodes, spleen and liver, and a non-inflamed spleen was observed in immunized animals 9 months after the challenge infection.Our results demonstrate that an ID vaccination using LdCen-/-parasites in combination with sand fly salivary protein LJM19 has the capability to confer long lasting protection against visceral leishmaniasis that is comparable to intravenous or intracardial immunization.

  7. Effects of amoxicillin, ceftiofur, doxycycline, tiamulin and tulathromycin on pig humoral immune responses induced by erysipelas vaccination.

    Science.gov (United States)

    Pomorska-Mól, M; Kwit, K; Wierzchosławski, K; Dors, A; Pejsak, Z

    2016-05-28

    It addition to their antimicrobial properties, antibiotics can influence the host immune system (modulation of cytokine secretion, antibody production and T-cell proliferation). In the present study, the authors studied the effects of therapeutic doses of amoxicillin (AMX), ceftiofur (CEF), doxycycline (DOXY), tiamulin (TIAM) and tulathromycin (TUL) on the postvaccinal immune response after pigs had been vaccinated against erysipelas. Because humoral immunity is considered as the most important in the protection against swine erysipelas, the present study focused on the interactions between antibiotics and postvaccinal humoral immunity. One hundred and five, eight-week-old pigs of both sexes were used. Specific antibodies to the Erysipelothrix rhusiopathiae antigen were determined using a commercial ELISA test. In pigs treated with DOXY or CEF or TIAM, a significant reduction in the number of positive pigs was observed four and six weeks after the second dose of vaccine, compared with the remaining vaccinated groups. In pigs treated with CEF, the ELISA score was significantly lower than in non-treated vaccinated pigs. While in vaccinated pigs treated with AMX or TUL, the ELISA score was significantly higher than in pigs treated with the remaining antibiotics and than in non-treated vaccinated controls. The results of the present study indicate that vaccination of pigs against erysipelas in the presence of antibiotics may result in a decrease (CEF, DOXY, TIAM) or enhancement (AMX, TUL) in the production of specific antibodies. British Veterinary Association.

  8. Immunization with the conjugate vaccine Vi-CRM₁₉₇ against Salmonella typhi induces Vi-specific mucosal and systemic immune responses in mice.

    Science.gov (United States)

    Fiorino, Fabio; Ciabattini, Annalisa; Rondini, Simona; Pozzi, Gianni; Martin, Laura B; Medaglini, Donata

    2012-09-21

    Typhoid fever is a public health problem, especially among young children in developing countries. To address this need, a glycoconjugate vaccine Vi-CRM₁₉₇, composed of the polysaccharide antigen Vi covalently conjugated to the non-toxic mutant of diphtheria toxin CRM₁₉₇, is under development. Here, we assessed the antibody and cellular responses, both local and systemic, following subcutaneous injection of Vi-CRM₁₉₇. The glycoconjugate elicited Vi-specific serum IgG titers significantly higher than unconjugated Vi, with prevalence of IgG1 that persisted for at least 60 days after immunization. Vi-specific IgG, but not IgA, were present in intestinal washes. Lymphocytes proliferation after restimulation with Vi-CRM₁₉₇ was observed in spleen and mesenteric lymph nodes. These data confirm the immunogenicity of Vi-CRM₁₉₇ and demonstrate that the vaccine-specific antibody and cellular immune responses are present also in the intestinal tract, thus strengthening the suitability of Vi-CRM₁₉₇ as a promising candidate vaccine against Salmonella Typhi. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. MCL Plays an Anti-Inflammatory Role in Mycobacterium tuberculosis-Induced Immune Response by Inhibiting NF-κB and NLRP3 Inflammasome Activation

    Directory of Open Access Journals (Sweden)

    Qingwen Zhang

    2017-01-01

    Full Text Available Mycobacterium tuberculosis (Mtb remains a significant menace to global health as it induces granulomatous lung lesions and systemic inflammatory responses during active tuberculosis (TB. Micheliolide (MCL, a sesquiterpene lactone, was recently reported to have a function of relieving LPS-induced inflammatory response, but the regulative role of MCL on the immunopathology of TB still remains unknown. In this experiment, we examined the inhibitory effect of MCL on Mtb-induced inflammatory response in mouse macrophage-like cell line Raw264.7 by downregulating the activation of nuclear factor kappa B (NF-κB and NLRP3 inflammasome. Evidences showed that MCL decreased the secretion of Mtb-induced inflammatory cytokines (IL-1β and TNF-α in a dose-dependent manner. Meanwhile, MCL dramatically suppressed Mtb-induced activation of iNOS and COX2 as well as subsequent production of NO. Furthermore, MCL inhibited Mtb-induced phosphorylation of Akt (Ser 473 in Raw264.7. According to our results, MCL plays an important role in modulating Mtb-induced inflammatory response through PI3K/Akt/NF-κB pathway and subsequently downregulating the activation of NLRP3 inflammasome. Therefore, MCL may represent as a potential drug candidate in the adjuvant treatment of TB by regulating host immune response.

  10. The effect of adjuvants on the immune response induced by a DBL4e-ID4 VAR2CSA based Plasmodium falciparum vaccine against placental malaria

    DEFF Research Database (Denmark)

    Pinto, V V; Salanti, A; Joergensen, L M

    2012-01-01

    720, Alhydrogel(®) and CAF01. Antibodies induced against DBL4¿-ID4 in combination with these adjuvants inhibited parasite binding to CSA from 82% to 99%. Although, different epitope recognition patterns were obtained for the different formulations, all adjuvant combinations induced strong Th1 and Th2......¿-ID4 to induce binding-inhibitory antibodies when formulated with adjuvants approved for human use. We have characterized the immune response of DBL4¿-ID4 in combination with Freund's complete and incomplete adjuvant and with three adjuvants currently being used in clinical trials: Montanide(®) ISA...... type responses, resulting in IgG with similar binding strength, with to the DBL4¿-ID4 antigen. These results demonstrate that the DBL4¿-ID4 antigen is highly immunogenic and that binding inhibitory antibodies are induced when formulated with any of the tested adjuvants....

  11. Persistent Low-Level Replication of SIVΔnef Drives Maturation of Antibody and CD8 T Cell Responses to Induce Protective Immunity against Vaginal SIV Infection.

    Directory of Open Access Journals (Sweden)

    Sama Adnan

    2016-12-01

    Full Text Available Defining the correlates of immune protection conferred by SIVΔnef, the most effective vaccine against SIV challenge, could enable the design of a protective vaccine against HIV infection. Here we provide a comprehensive assessment of immune responses that protect against SIV infection through detailed analyses of cellular and humoral immune responses in the blood and tissues of rhesus macaques vaccinated with SIVΔnef and then vaginally challenged with wild-type SIV. Despite the presence of robust cellular immune responses, animals at 5 weeks after vaccination displayed only transient viral suppression of challenge virus, whereas all macaques challenged at weeks 20 and 40 post-SIVΔnef vaccination were protected, as defined by either apparent sterile protection or significant suppression of viremia in infected animals. Multiple parameters of CD8 T cell function temporally correlated with maturation of protection, including polyfunctionality, phenotypic differentiation, and redistribution to gut and lymphoid tissues. Importantly, we also demonstrate the induction of a tissue-resident memory population of SIV-specific CD8 T cells in the vaginal mucosa, which was dependent on ongoing low-level antigenic stimulation. Moreover, we show that vaginal and serum antibody titers inversely correlated with post-challenge peak viral load, and we correlate the accumulation and affinity maturation of the antibody response to the duration of the vaccination period as well as to the SIVΔnef antigenic load. In conclusion, maturation of SIVΔnef-induced CD8 T cell and antibody responses, both propelled by viral persistence in the gut mucosa and secondary lymphoid tissues, results in protective immune responses that are able to interrupt viral transmission at mucosal portals of entry as well as potential sites of viral dissemination.

  12. Persistent Low-Level Replication of SIVΔnef Drives Maturation of Antibody and CD8 T Cell Responses to Induce Protective Immunity against Vaginal SIV Infection.

    Science.gov (United States)

    Adnan, Sama; Reeves, R Keith; Gillis, Jacqueline; Wong, Fay E; Yu, Yi; Camp, Jeremy V; Li, Qingsheng; Connole, Michelle; Li, Yuan; Piatak, Michael; Lifson, Jeffrey D; Li, Wenjun; Keele, Brandon F; Kozlowski, Pamela A; Desrosiers, Ronald C; Haase, Ashley T; Johnson, R Paul

    2016-12-01

    Defining the correlates of immune protection conferred by SIVΔnef, the most effective vaccine against SIV challenge, could enable the design of a protective vaccine against HIV infection. Here we provide a comprehensive assessment of immune responses that protect against SIV infection through detailed analyses of cellular and humoral immune responses in the blood and tissues of rhesus macaques vaccinated with SIVΔnef and then vaginally challenged with wild-type SIV. Despite the presence of robust cellular immune responses, animals at 5 weeks after vaccination displayed only transient viral suppression of challenge virus, whereas all macaques challenged at weeks 20 and 40 post-SIVΔnef vaccination were protected, as defined by either apparent sterile protection or significant suppression of viremia in infected animals. Multiple parameters of CD8 T cell function temporally correlated with maturation of protection, including polyfunctionality, phenotypic differentiation, and redistribution to gut and lymphoid tissues. Importantly, we also demonstrate the induction of a tissue-resident memory population of SIV-specific CD8 T cells in the vaginal mucosa, which was dependent on ongoing low-level antigenic stimulation. Moreover, we show that vaginal and serum antibody titers inversely correlated with post-challenge peak viral load, and we correlate the accumulation and affinity maturation of the antibody response to the duration of the vaccination period as well as to the SIVΔnef antigenic load. In conclusion, maturation of SIVΔnef-induced CD8 T cell and antibody responses, both propelled by viral persistence in the gut mucosa and secondary lymphoid tissues, results in protective immune responses that are able to interrupt viral transmission at mucosal portals of entry as well as potential sites of viral dissemination.

  13. PSMA-targeted polyinosine/polycytosine vector induces prostate tumor regression and invokes an antitumor immune response in mice.

    Science.gov (United States)

    Langut, Yael; Talhami, Alaa; Mamidi, Samarasimhareddy; Shir, Alexei; Zigler, Maya; Joubran, Salim; Sagalov, Anna; Flashner-Abramson, Efrat; Edinger, Nufar; Klein, Shoshana; Levitzki, Alexander

    2017-12-26

    There is an urgent need for an effective treatment for metastatic prostate cancer (PC). Prostate tumors invariably overexpress prostate surface membrane antigen (PSMA). We designed a nonviral vector, PEI-PEG-DUPA (PPD), comprising polyethylenimine-polyethyleneglycol (PEI-PEG) tethered to the PSMA ligand, 2-[3-(1, 3-dicarboxy propyl)ureido] pentanedioic acid (DUPA), to treat PC. The purpose of PEI is to bind polyinosinic/polycytosinic acid (polyIC) and allow endosomal release, while DUPA targets PC cells. PolyIC activates multiple pathways that lead to tumor cell death and to the activation of bystander effects that harness the immune system against the tumor, attacking nontargeted neighboring tumor cells and reducing the probability of acquired resistance and disease recurrence. Targeting polyIC directly to tumor cells avoids the toxicity associated with systemic delivery. PPD selectively delivered polyIC into PSMA-overexpressing PC cells, inducing apoptosis, cytokine secretion, and the recruitment of human peripheral blood mononuclear cells (PBMCs). PSMA-overexpressing tumors in nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mice with partially reconstituted immune systems were significantly shrunken following PPD/polyIC treatment, in all cases. Half of the tumors showed complete regression. PPD/polyIC invokes antitumor immunity, but unlike many immunotherapies does not need to be personalized for each patient. The potent antitumor effects of PPD/polyIC should spur its development for clinical use.

  14. Intra-amniotic Ureaplasma parvum-Induced Maternal and Fetal Inflammation and Immune Responses in Rhesus Macaques.

    Science.gov (United States)

    Senthamaraikannan, Paranthaman; Presicce, Pietro; Rueda, Cesar M; Maneenil, Gunlawadee; Schmidt, Augusto F; Miller, Lisa A; Waites, Ken B; Jobe, Alan H; Kallapur, Suhas G; Chougnet, Claire A

    2016-11-15

     Although Ureaplasma species are the most common organisms associated with prematurity, their effects on the maternal and fetal immune system remain poorly characterized.  Rhesus macaque dams at approximately 80% gestation were injected intra-amniotically with 10 7 colony-forming units of Ureaplasma parvum or saline (control). Fetuses were delivered surgically 3 or 7 days later. We performed comprehensive assessments of inflammation and immune effects in multiple fetal and maternal tissues.  Although U. parvum grew well in amniotic fluid, there was minimal chorioamnionitis. U. parvum colonized the fetal lung, but fetal systemic microbial invasion was limited. Fetal lung inflammation was mild, with elevations in CXCL8, tumor necrosis factor (TNF) α, and CCL2 levels in alveolar washes at day 7. Inflammation was not detected in the fetal brain. Significantly, U. parvum decreased regulatory T cells (Tregs) and activated interferon γ production in these Tregs in the fetus. It was detected in uterine tissue by day 7 and induced mild inflammation and increased expression of connexin 43, a gap junction protein involved with labor.  U. parvum colonized the amniotic fluid and caused uterine inflammation, but without overt chorioamnionitis. It caused mild fetal lung inflammation but had a more profound effect on the fetal immune system, decreasing Tregs and polarizing them toward a T-helper 1 phenotype. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  15. Elongation Factor Tu and Heat Shock Protein 70 Are Membrane-Associated Proteins from Mycoplasma ovipneumoniae Capable of Inducing Strong Immune Response in Mice.

    Directory of Open Access Journals (Sweden)

    Fei Jiang

    Full Text Available Chronic non-progressive pneumonia, a disease that has become a worldwide epidemic has caused considerable loss to sheep industry. Mycoplasma ovipneumoniae (M. ovipneumoniae is the causative agent of interstitial pneumonia in sheep, goat and bighorn. We here have identified by immunogold and immunoblotting that elongation factor Tu (EF-Tu and heat shock protein 70 (HSP 70 are membrane-associated proteins on M. ovipneumonaiea. We have evaluated the humoral and cellular immune responses in vivo by immunizing BALB/c mice with both purified recombinant proteins rEF-Tu and rHSP70. The sera of both rEF-Tu and rHSP70 treated BALB/c mice demonstrated increased levels of IgG, IFN-γ, TNF-α, IL-12(p70, IL-4, IL-5 and IL-6. In addition, ELISPOT assay showed significant increase in IFN-γ+ secreting lymphocytes in the rHSP70 group when compared to other groups. Collectively our study reveals that rHSP70 induces a significantly better cellular immune response in mice, and may act as a Th1 cytokine-like adjuvant in immune response induction. Finally, growth inhibition test (GIT of M. ovipneumoniae strain Y98 showed that sera from rHSP70 or rEF-Tu-immunized mice inhibited in vitro growth of M. ovipneumoniae. Our data strongly suggest that EF-Tu and HSP70 of M. ovipneumoniae are membrane-associated proteins capable of inducing antibody production, and cytokine secretion. Therefore, these two proteins may be potential candidates for vaccine development against M. ovipneumoniae infection in sheep.

  16. Immunization with Tc52 or its amino terminal domain adjuvanted with c-di-AMP induces Th17+Th1 specific immune responses and confers protection against Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Marina N Matos

    2017-02-01

    Full Text Available The development of new adjuvants enables fine modulation of the elicited immune responses. Ideally, the use of one or more adjuvants should result in the induction of a protective immune response against the specific pathogen. We have evaluated the immune response and protection against Trypanosoma cruzi infection in mice vaccinated with recombinant Tc52 or its N- and C-terminal domains (NTc52 and CTc52 adjuvanted either with the STING (Stimulator of Interferon Genes agonist cyclic di-AMP (c-di-AMP, a pegylated derivative of α-galactosylceramide (αGC-PEG, or oligodeoxynucleotides containing unmethylated CpG motifs (ODN-CpG. All groups immunized with the recombinant proteins plus adjuvant: Tc52+c-di-AMP, NTc52+c-di-AMP, CTc52+c-di-AMP, NTc52+c-di-AMP+αGC-PEG, NTc52+CpG, developed significantly higher anti-Tc52 IgG titers than controls. Groups immunized with c-di-AMP and Tc52, NTc52 or CTc52 showed the highest Tc52-specific IgA titers in nasal lavages. All groups immunized with the recombinant proteins plus adjuvant developed a strong specific cellular immune response in splenocytes and lymph node cells with significant differences for groups immunized with c-di-AMP and Tc52, NTc52 or CTc52. These groups also showed high levels of Tc52-specific IL-17 and IFN-γ producing cells, while NTc52+CpG group only showed significant difference with control in IFN-γ producing cells. Groups immunized with c-di-AMP and Tc52, NTc52 or CTc52 developed predominantly a Th17 and Th1immune response, whereas for NTc52+CpG it was a dominant Th1 response. It was previously described that αGC-PEG inhibits Th17 differentiation by activating NKT cells. Thus, in this work we have also included a group immunized with both adjuvants (NTc52+c-di-AMP+αGC-PEG with the aim to modulate the Th17 response induced by c-di-AMP. This group showed a significant reduction in the number of Tc52-specific IL-17 producing splenocytes, as compared to the group NTc52+c-di-AMP, which has

  17. A Schistosoma japonicum chimeric protein with a novel adjuvant induced a polarized Th1 immune response and protection against liver egg burdens

    Directory of Open Access Journals (Sweden)

    Xue Xiangyang

    2009-05-01

    Full Text Available Abstract Background Schitosomiasis japonica is still a significant public health problem in China. A protective vaccine for human or animal use represents an important strategy for long-term control of this disease. Due to the complex life cycle of schistosomes, different vaccine design approaches may be necessary, including polyvalent subunit vaccines. In this study, we constructed four chimeric proteins (designated SjGP-1~4 via fusion of Sj26GST and four individual paramyosin fragments. We tested these four proteins as vaccine candidates, and investigated the effect of deviating immune response on protection roles in mice. Methods The immunogencity and protection efficacy of chimeric proteins were evaluated in mice. Next, the chimeric protein SjGP-3 was selected and formulated in various adjuvants, including CFA, ISA 206, IMS 1312 and ISA 70M. The titers of antigen-specific IgG, IgE and IgG subclass were measured. The effect of adjuvant on cytokine production and percentages of CD3+CD8-IFN-γ+ cells and CD3+CD8-IL-4+ cells were analyzed at different time points. Worm burdens and liver egg counts in different adjuvant groups were counted to evaluate the protection efficacy against cercarial challenge. Results Immunization of mice with chimeric proteins provided various levels of protection. Among the four proteins, SjGP-3 induced the highest level of protection, and showed enhanced protective efficacy compared with its individual component Sj26GST. Because of this, SjGP-3 was further formulated in various adjuvants to investigate the effect of adjuvant on immune deviation. The results revealed that SjGP-3 formulated in veterinary adjuvant ISA 70M induced a lasting polarized Th1 immune response, whereas the other adjuvants, including CFA, ISA 206 and IMS 1312, generated a moderate mixed Th1/Th2 response after immunization but all except for IMS 1312 shifted to Th2 response after onset of eggs. More importantly, the SjGP-3/70M formulation induced

  18. Fractional laser exposure induces neutrophil infiltration (N1 phenotype into the tumor and stimulates systemic anti-tumor immune response.

    Directory of Open Access Journals (Sweden)

    Masayoshi Kawakubo

    Full Text Available Ablative fractional photothermolysis (aFP using a CO2 laser generates multiple small diameter tissue lesions within the irradiation field. aFP is commonly used for a wide variety of dermatological indications, including treatment of photodamaged skin and dyschromia, drug delivery and modification of scars due to acne, surgical procedures and burns. In this study we explore the utility of aFP for treating oncological indications, including induction of local tumor regression and inducing anti-tumor immunity, which is in marked contrast to current indications of aFP.We used a fractional CO2 laser to treat a tumor established by BALB/c colon carcinoma cell line (CT26.CL25, which expressed a tumor antigen, beta-galactosidase (beta-gal. aFP treated tumors grew significantly slower as compared to untreated controls. Complete remission after a single aFP treatment was observed in 47% of the mice. All survival mice from the tumor inoculation rejected re-inoculation of the CT26.CL25 colon carcinoma cells and moreover 80% of the survival mice rejected CT26 wild type colon carcinoma cells, which are parental cells of CT26.CL25 cells. Histologic section of the FP-treated tumors showed infiltrating neutrophil in the tumor early after aFP treatment. Flow cytometric analysis of tumor-infiltrating lymphocytes showed aFP treatment abrogated the increase in regulatory T lymphocyte (Treg, which suppresses anti-tumor immunity and elicited the expansion of epitope-specific CD8+ T lymphocytes, which were required to mediate the tumor-suppressing effect of aFP.We have demonstrated that aFP is able to induce a systemic anti-tumor adaptive immunity preventing tumor recurrence in a murine colon carcinoma in a mouse model. This study demonstrates a potential role of aFP treatments in oncology and further studies should be performed.

  19. Trichomonas vaginalis α-Actinin 2 Modulates Host Immune Responses by Inducing Tolerogenic Dendritic Cells via IL-10 Production from Regulatory T Cells.

    Science.gov (United States)

    Lee, Hye-Yeon; Kim, Juri; Ryu, Jae-Sook; Park, Soon-Jung

    2017-08-01

    Trichomonas vaginalis is a pathogen that triggers severe immune responses in hosts. T. vaginalis α-actinin 2, Tvα-actinin 2, has been used to diagnose trichomoniasis. This study was undertaken to examine the role of Tvα-actinin 2 as an antigenic molecule to induce immune responses from humans. Western blot analysis using anti-Tvα-actinin 2 antibodies indicated its presence in the secreted proteins of T. vaginalis. ELISA was employed to measure cytokine production by vaginal epithelial cells, prostate cells, mouse dendritic cells (DCs), or T cells stimulated with T. vaginalis or Tvα-actinin 2 protein. Both T. vaginalis and rTvα-actinin 2 induced cytokine production from epithelial cell lines, including IL-10. Moreover, CD4+CD25- regulatory T cells (Treg cells) incubated with rTvα-actinin 2-treated DCs produced high levels of IL-10. These data indicate that Tvα-actinin 2 modulates immune responses via IL-10 production by Treg cells.

  20. Immune response induced by Epstein-Barr virus and Mycobacterium avium subsp. paratuberculosis peptides in current and past infectious mononucleosis: a risk for multiple sclerosis?

    Science.gov (United States)

    Mameli, G; Madeddu, G; Cossu, D; Galleri, G; Manetti, R; Babudieri, S; Mura, M Stella; Sechi, L A

    2016-01-01

    Infectious mononucleosis (IM) caused by Epstein-Barr virus (EBV) has been associated with increased risk of multiple sclerosis (MS). However, the mechanism linking these pathologies is unclear. Different reports indicate the association of EBV, and recently Mycobacterium avium subsp. paratuberculosis (MAP), with MS. For a better understanding of the role of these pathogens, the host response induced by selected antigenic peptides in subjects with a history of IM that significantly increases the risk of MS was investigated. Both humoral and cell-mediated response against peptides able to induce a specific immune activation in MS patients deriving from lytic and latent EBV antigens BOLF1(305-320), EBNA1(400-413), from MAP MAP_4027(18-32), MAP_0106c(121-132) and from human proteins IRF5(424-434) and MBP(85-98) in subjects with current and past IM were examined. EBNA1 and MAP_0106c peptides were able to induce a humoral immune response in subjects with a history of clinical IM in an independent manner. Moreover, these peptides were capable of inducing pro-inflammatory cytokine interferon γ by CD4+ and CD8+ T lymphocytes and interleukin 6 and tumour necrosis factor α by CD14+ monocyte cells. Our results highlight that EBV and MAP may be involved independently in the same causal process leading to MS in subjects with a history of IM. © 2015 EAN.

  1. Innate Immune Responses in Leprosy

    Science.gov (United States)

    Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes

    2018-01-01

    Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852

  2. Cell-mediated and humoral immune responses induced by scarification vaccination of human volunteers with a new lot of the live vaccine strain of Francisella tularensis.

    Science.gov (United States)

    Waag, D M; Galloway, A; Sandstrom, G; Bolt, C R; England, M J; Nelson, G O; Williams, J C

    1992-01-01

    Tularemia is a disease caused by the facultative intracellular bacterium Francisella tularensis. We evaluated a new lot of live F. tularensis vaccine for its immunogenicity in human volunteers. Scarification vaccination induced humoral and cell-mediated immune responses. Indications of a positive immune response after vaccination included an increase in specific antibody levels, which were measured by enzyme-linked immunosorbent and immunoblot assays, and the ability of peripheral blood lymphocytes to respond to whole F. tularensis bacteria as recall antigens. Vaccination caused a significant rise (P less than 0.05) in immunoglobulin A (IgA), IgG, and IgM titers. Lymphocyte stimulation indices were significantly increased (P less than 0.01) in vaccinees 14 days after vaccination. These data verify that this new lot of live F. tularensis vaccine is immunogenic. Images PMID:1400988

  3. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    Science.gov (United States)

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

    2003-05-01

    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  4. Arsenic-induced dose-dependent modulation of the NF-κB/IL-6 axis in thymocytes triggers differential immune responses

    International Nuclear Information System (INIS)

    Choudhury, Sreetama; Gupta, Payal; Ghosh, Sayan; Mukherjee, Sudeshna; Chakraborty, Priyanka; Chatterji, Urmi; Chattopadhyay, Sreya

    2016-01-01

    Highlights: • We for the first time explicitly show that arsenic exposure causes morphological damage to the thymus and results in heightened death of thymocytes. • Our data suggests that arsenic-induced apoptosis occurs due to increase in cellular oxidative and nitrosative stress. • We have for the first time established a non-classical role of NF-κB, correlating it with increase in FoxP3 expression. • The % of CD4+ CD25+ T cells were high and expression of FoxP3 has also increased at higher doses of arsenic indicating an nTreg bias. - Abstract: Arsenic contamination of drinking water is a matter of global concern. Arsenic intake impairs immune responses and leads to a variety of pathological conditions including cancer. In order to understand the intricate tuning of immune responses elicited by chronic exposure to arsenic, a mouse model was established by subjecting mice to different environmentally relevant concentrations of arsenic in drinking water for 30 days. Detailed study of the thymus, a primary immune organ, revealed arsenic-mediated tissue damage in both histological specimens and scanning electron micrographs. Analysis of molecular markers of apoptosis by Western blot revealed a dose-dependent activation of the apoptotic cascade. Enzymatic assays supported oxidative stress as an instigator of cell death. Interestingly, assessment of inflammatory responses revealed disparity in the NF-κB/IL-6/STAT3 axis, where it was found that in animals consuming higher amounts of arsenic NF-κB activation did not lead to the classical IL-6 upregulation response. This deviation from the canonical pathway was accompanied with a significant rise in numbers of CD4+ CD25+ FoxP3 expressing cells in the thymus. The cytokine profile of the animals exposed to higher doses of arsenic also indicated an immune-suppressed milieu, thus validating that arsenic shapes the immune environment in context to its dose of exposure and that at higher doses it leads to immune

  5. Biodegradable nanoparticle-entrapped vaccine induces cross-protective immune response against a virulent heterologous respiratory viral infection in pigs.

    Directory of Open Access Journals (Sweden)

    Varun Dwivedi

    Full Text Available Biodegradable nanoparticle-based vaccine development research is unexplored in large animals and humans. In this study, we illustrated the efficacy of nanoparticle-entrapped UV-killed virus vaccine against an economically important respiratory viral disease of pigs called porcine reproductive and respiratory syndrome virus (PRRSV. We entrapped PLGA [poly (lactide-co-glycolides] nanoparticles with killed PRRSV antigens (Nano-KAg and detected its phagocytosis by pig alveolar macrophages. Single doses of Nano-KAg vaccine administered intranasally to pigs upregulated innate and PRRSV specific adaptive responses. In a virulent heterologous PRRSV challenge study, Nano-KAg vaccine significantly reduced the lung pathology and viremia, and the viral load in the lungs. Immunologically, enhanced innate and adaptive immune cell population and associated cytokines with decreased secretion of immunosuppressive mediators were observed at both mucosal sites and blood. In summary, we demonstrated the benefits of intranasal delivery of nanoparticle-based viral vaccine in eliciting cross-protective immune response in pigs, a potential large animal model.

  6. Enhancement of the immune response and protection induced by probiotic lactic acid bacteria against furunculosis in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Balcázar, José Luis; de Blas, Ignacio; Ruiz-Zarzuela, Imanol; Vendrell, Daniel; Gironés, Olivia; Muzquiz, José Luis

    2007-10-01

    We analysed the effect of probiotic strains on the cellular and humoral immune responses of rainbow trout (Oncorhynchus mykiss), and their capacity to prevent furunculosis during a challenge trial. Probiotic strains (Lactococcus lactis ssp. lactis CLFP 100, Leuconostoc mesenteroides CLFP 196, and Lactobacillus sakei CLFP 202) were administered orally to fish for 2 weeks at 10(6) CFU g(-1) of feed. In comparison to untreated control fish, the phagocytic activity of head kidney leukocytes and the alternative complement activity in serum were significantly greater in all probiotic groups at the end of the second week. With the exception of the group fed with Lactobacillus sakei, superoxide anion production was also significantly increased in the probiotic groups. Analysis of lysozyme activity did not exhibit any significant difference in the probiotic and control groups. Fifteen days after the start of the probiotic feeding, fish were challenged with Aeromonas salmonicida ssp. salmonicida. The fish supplemented with probiotics exhibited survival rates ranging from 97.8% to 100%, whereas survival was 65.6% in fish not treated with the probiotics. These results demonstrate that probiotic supplementation to fish can reduce the severity of furunculosis, and suggest that this reduction may be associated with enhanced humoral and cellular immune response.

  7. The immune receptor Trem1 cooperates with diminished DNA damage response to induce preleukemic stem cell expansion.

    Science.gov (United States)

    Du, W; Amarachintha, S; Wilson, A; Pang, Q

    2017-02-01

    Fanconi anemia (FA) is an inherited bone marrow failure syndrome with extremely high risk of leukemic transformation. Here we investigate the relationship between DNA damage response (DDR) and leukemogenesis using the Fanca knockout mouse model. We found that chronic exposure of the Fanca -/- hematopoietic stem cells to DNA crosslinking agent mitomycin C in vivo leads to diminished DDR, and the emergence/expansion of pre-leukemia stem cells (pre-LSCs). Surprisingly, although genetic correction of Fanca deficiency in the pre-LSCs restores DDR and reduces genomic instability, but fails to prevent pre-LSC expansion or delay leukemia development in irradiated recipients. Furthermore, we identified transcription program underlying dysregulated DDR and cell migration, myeloid proliferation, and immune response in the Fanca -/- pre-LSCs. Forced expression of the downregulated DNA repair genes, Rad51c or Trp53i13, in the Fanca -/- pre-LSCs partially rescues DDR but has no effect on leukemia, whereas shRNA knockdown of the upregulated immune receptor genes Trem1 or Pilrb improves leukemia-related survival, but not DDR or genomic instability. Furthermore, Trem1 cooperates with diminished DDR in vivo to promote Fanca -/- pre-LSC expansion and leukemia development. Our study implicates diminishing DDR as a root cause of FA leukemogenesis, which subsequently collaborates with other signaling pathways for leukemogenic transformation.

  8. In vivo effects of monoclonal anti-L3T4 antibody on immune responsiveness of mice infected with Schistosoma mansoni. Reduction of irradiated cercariae-induced resistance

    International Nuclear Information System (INIS)

    Kelly, E.A.; Colley, D.G.

    1988-01-01

    Mice can be partially protected against challenge infections of Schistosoma mansoni cercariae by either single or multiple exposure to irradiated cercariae (x-cerc). The participation of L3T4+ lymphocytes on this resistance phenomenon was evaluated by selectively depleting this cell population through in vivo administration of mAb anti-L3T4 at three different times in relationship to the challenge infections. Treatment with anti-L3T4 before challenge such that depletion was effective during the time of cercarial skin penetration and dermal/s.c. residence significantly reduced the level of resistance induced by x-cerc sensitization. When treatment was delayed until after challenge, depletion of L3T4+ cells coincided with either the lung or post-lung/liver phases of schistosomular migration, and normal levels of x-cerc-induced resistance were induced. In contrast to once-immunized mice, mice hyperimmunized by five exposures to x-cerc and then depleted of L3T4+ cells at the time of challenge still expressed resistance to the challenge. These data suggest that when mice are sensitized only once with x-cerc the challenge infection provides a necessary immunologic boost which requires L3T4+ cells for effective expression of resistance. The requirement for this anamnestic effect by the challenge infection can be circumvented by hyperimmunization. Evaluation of the immune response of one-time sensitized or hyperimmunized mice demonstrated that cellular Ag-specific proliferative responses and mitogen-induced lymphokine production were abrogated after any of the various in vivo regimens of anti-L3T4 antibody. In contrast, immunoblot analysis of humoral responsiveness revealed a correlation between the expression of resistance and the ability of sera from immunized and anti-L3T4 treated mice to recognize a 75-kDa parasite antigenic component

  9. Modulation of immune response by bacterial lipopolysaccharides

    Directory of Open Access Journals (Sweden)

    Gustavo Aldapa-Vega

    2016-08-01

    Full Text Available Lipopolysaccharide (LPS is a molecule that is profusely found on the outer membrane of Gram-negative bacteria and is also a potent stimulator of the immune response. As the main molecule on the bacterial surface, is also the most biologically active. The immune response of the host is activated by the recognition of LPS through Toll-like receptor 4 (TLR4 and this receptor-ligand interaction is closely linked to LPS structure. Microorganisms have evolved systems to control the expression and structure of LPS, producing structural variants that are used for modulating the host immune responses during infection. Examples of this include Helicobacter pylori, Francisella tularensis, Chlamydia trachomatis and Salmonella spp. High concentrations of LPS can cause fever, increased heart rate and lead to septic shock and death. However, at relatively low concentrations some LPS are highly active immunomodulators, which can induce non-specific resistance to invading microorganisms. The elucidation of the molecular and cellular mechanisms involved in the recognition of LPS and its structural variants has been fundamental to understand inflammation and is currently a pivotal field of research to understand the innate immune response, inflammation, the complex host-pathogen relationship and has important implications for the rational development of new immunomodulators and adjuvants.

  10. Immune Responses Involved in Mycobacterium Tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Roghayeh Teimourpour

    2016-09-01

    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the causative agent of tuberculosis (TB. Approximately one-third of the world's population is infected with M. tuberculosis. Despite the availability of drug and vaccine, it remains one of the leading causes of death in humans especially in developing countries. Epidemiological studies have indicated that only 10-30% of people exposed to tubercle bacillus are infected with M. tuberculosis, and at least 90% of the infected people finally do not acquire TB. The studies have indicated that the host efficient immune system has essential roles in the control of TB infection such that the highest rate of mortality and morbidity is seen in immunocompromised patients such as people infected with HIV. M. tuberculosis is an obligatory intracellular bacterium. It enters the body mainly through the respiratory tract and alveolar macrophages combat this pathogen most commonly. In addition to alveolar macrophages, various T-cell subpopulations need to be activated to overcome this bacterium's resistance to the host defense systems. CD4+ T cells, through production of several cytokines such as IFN-γ and TNF-α, and CD8+ T cells, through cytotoxic activities and induction of apoptosis in infected cells, play critical roles in inducing appropriate immune responses against M. tuberculosis. Although cell-mediated immunity is the cornerstone of host responses against TB and the recent studies have provided evidence for the importance of humoral and innate immune system in the control of TB, a profound understanding of the immune responses would provide a basis for development of new generations of vaccines and drugs. The present study addresses immune responses involved in M. tuberculosis infection.

  11. Neonatal Immunization with a Single IL-4/Antigen Dose Induces Increased Antibody Responses after Challenge Infection with Equine Herpesvirus Type 1 (EHV-1 at Weanling Age.

    Directory of Open Access Journals (Sweden)

    Bettina Wagner

    Full Text Available Neonatal foals respond poorly to conventional vaccines. These vaccines typically target T-helper (Th cell dependent B-cell activation. However, Th2-cell immunity is impaired in foals during the first three months of life. In contrast, neonatal basophils are potent interleukin-4 (IL-4 producers. The purpose of this study was to develop a novel vaccine triggering the natural capacity of neonatal basophils to secrete IL-4 and to evaluate if vaccination resulted in B-cell activation and antibody production against EHV-1 glycoprotein C (gC. Neonatal vaccination was performed by oral biotinylated IgE (IgE-bio treatment at birth followed by intramuscular injection of a single dose of streptavidin-conjugated gC/IL-4 fusion protein (Sav-gC/IL-4 for crosslinking of receptor-bound IgE-bio (group 1. Neonates in group 2 received the intramuscular Sav-gC/IL-4 vaccine only. Group 3 remained non-vaccinated at birth. After vaccination, gC antibody production was not detectable. The ability of the vaccine to induce protection was evaluated by an EHV-1 challenge infection after weaning at 7 months of age. Groups 1 and 2 responded to EHV-1 infection with an earlier onset and overall significantly increased anti-gC serum antibody responses compared to control group 3. In addition, group 1 weanlings had a decreased initial fever peak after infection indicating partial protection from EHV-1 infection. This suggested that the neonatal vaccination induced a memory B-cell response at birth that was recalled at weanling age after EHV-1 challenge. In conclusion, early stimulation of neonatal immunity via the innate arm of the immune system can induce partial protection and increased antibody responses against EHV-1.

  12. DMPD: Heterogeneity of TLR-induced responses in dendritic cells: from innate toadaptive immunity. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available daptive immunity. Re F, Strominger JL. Immunobiology. 2004;209(1-2):191-8. (.png) (.svg) (.html) (.csml) Sho...toadaptive immunity. Authors Re F, Strominger JL. Publication Immunobiology. 2004;209(1-2):191-8. Pathway -

  13. Effect of cold water-induced stress on immune response, pathology and fertility in mice during Chlamydia muridarum genital infection.

    Science.gov (United States)

    Belay, Tesfaye; Woart, Anthony; Graffeo, Vincent

    2017-07-31

    Genital infection by Chlamydia trachomatis is the most common bacterial sexually transmitted disease worldwide. It causes serious reproductive health complications, including pelvic inflammatory disease and infertility. Stress is implicated as a risk factor for various infections; however, its effect on chlamydia genital infection is unknown. We previously showed that repeated exposure of mice to cold water results in increased severity of chlamydia genital infection. In this study, cold water-induced stress resulted in (i) elevated levels of norepinephrine (NE) and epinephrine in the spleen and genital tract of stressed mice; (ii) elevated IL-1β, TNF-α, IL-6 and nitric oxide production in macrophage-rich peritoneal cells of mice; (iii) supplement of NE in vitro exerts an immunosuppressive effect on splenic T-cell production of cytokines; (iv) decreased C. muridarum shedding in the genital tract of β1Adr/β2Adr receptor KO mice; and (v) a higher rate of infertility in infected mice. These results suggest that cold water stress induces the production of catecholamines, which may play a critical role in the modulation of the immune system leading to increased intensity of C. muridarum genital infection. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Evaluation of the immune response induced by DNA vaccines expressing MIF and MCD-1 genes of Trichinella spiralis in BALB/c mice.

    Science.gov (United States)

    Tang, F; Xu, L; Yan, R; Song, X; Li, X

    2012-12-01

    Plasmids expressing macrophage migration inhibitory factor (MIF) of Trichinella spiralis (TsMIF), multi-cystatin-like domain protein (MCD-1) of T. spiralis (TsMCD-1), or co-expressing TsMIF and TsMCD-1 were constructed with a pVAX1 vector. Their ability to generate a protective immune response against T. spiralis infection was evaluated in BALB/c mice. Groups of mice were immunized twice at 2-week intervals with 100 μg of recombinant plasmids pVAX1-Tsmif, pVAX1-Tsmcd-1 or pVAX1-Tsmif-Tsmcd-1. Control animals were immunized with phosphate-buffered saline (PBS) or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17) and CD4+/CD8+ T cells were monitored. Challenge infection was performed 2 weeks following the second immunization and worm burden was assayed at 35 days post-challenge. Vaccination with pVAX1-Tsmif induced moderate serum IFN-γ and increases of CD4+ and CD8+ T cells, but no specific immunoglobulin antibody response. Vaccination with pVAX1-Tsmcd-1 induced a predominant Th1 antibody (IgG2a and IgG2b) response and strong levels of serum IFN-γ, and increases of CD4+ T cells. Importantly, co-expression of TsMIF and TsMCD-1 in DNA immunization produced more serum IFN-γ and markedly enhanced CD4+ and CD8+ T cells than the single DNA vaccine of the two genes. Challenge infection demonstrated that immunization with pVAX1-Tsmif-Tsmcd-1 reduced worm burdens (by 23.17%; P < 0.05).

  15. Challenges of Generating and Maintaining Protective Vaccine-Induced Immune Responses for Foot-and-Mouth Disease Virus in Pigs

    Science.gov (United States)

    Lyons, Nicholas A.; Lyoo, Young S.; King, Donald P.; Paton, David J.

    2016-01-01

    Vaccination can play a central role in the control of outbreaks of foot-and-mouth disease (FMD) by reducing both the impact of clinical disease and the extent of virus transmission between susceptible animals. Recent incursions of exotic FMD virus lineages into several East Asian countries have highlighted the difficulties of generating and maintaining an adequate immune response in vaccinated pigs. Factors that impact vaccine performance include (i) the potency, antigenic payload, and formulation of a vaccine; (ii) the antigenic match between the vaccine and the heterologous circulating field strain; and (iii) the regime (timing, frequency, and herd-level coverage) used to administer the vaccine. This review collates data from studies that have evaluated the performance of foot-and-mouth disease virus vaccines at the individual and population level in pigs and identifies research priorities that could provide new insights to improve vaccination in the future. PMID:27965966

  16. Decreased HIV-specific T-regulatory responses are associated with effective DC-vaccine induced immunity.

    Directory of Open Access Journals (Sweden)

    Vedran Brezar

    2015-03-01

    Full Text Available The role of regulatory T cells (Tregs in vaccination has been poorly investigated. We have reported that vaccination with ex vivo-generated dendritic-cells (DC loaded with HIV-lipopeptides (LIPO-5-DC vaccine in HIV-infected patients was well tolerated and highly immunogenic. These responses and their relation to viral replication following analytical treatment interruption (ATI were variable. Here, we investigated whether the presence of HIV-specific Tregs might explain these differences. Co-expression of CD25, CD134, CD39 and FoxP3 was used to delineate both antigen-specific Tregs and effectors T cells (Teffs. Median LIPO-5 specific-CD25+CD134+ polyfunctional T cells increased from 0.1% (IQR 0-0.3 before vaccination (week -4 to 2.1% (IQR 1.1-3.9 at week 16 following 4 immunizations (p=0.001 and were inversely correlated with maximum viral load following ATI (r=-0.77, p=0.001. Vaccinees who displayed lower levels of HIV-specific CD4+CD134+CD25+CD39+FoxP3+ Tregs responded better to the LIPO-5-DC vaccine. After vaccination, the frequency of HIV-specific Tregs decreased (from 69.3 at week -4 to 31.7% at week 16 and inversely correlated with HIV-specific IFN-γ-producing cells (r=-0.64, p=0.002. We show that therapeutic immunization skewed the HIV-specific response from regulatory to effector phenotype which impacts on the magnitude of viral replication following ATI.

  17. A novel fusion protein domain III-capsid from dengue-2, in a highly aggregated form, induces a functional immune response and protection in mice

    International Nuclear Information System (INIS)

    Valdes, Iris; Bernardo, Lidice; Gil, Lazaro; Pavon, Alekis; Lazo, Laura; Lopez, Carlos; Romero, Yaremis; Menendez, Ivon; Falcon, Viviana; Betancourt, Lazaro; Martin, Jorge; Chinea, Glay; Silva, Ricardo; Guzman, Maria G.; Guillen, Gerardo; Hermida, Lisset

    2009-01-01

    Based on the immunogenicity of domain III from the Envelope protein of dengue virus as well as the proven protective capacity of the capsid antigen, we have designed a novel domain III-capsid chimeric protein with the goal of obtaining a molecule potentially able to induce both humoral and cell-mediated immunity (CMI). After expression of the recombinant gene in Escherichia coli, the domain III moiety retained its antigenicity as evaluated with anti-dengue sera. In order to explore alternatives for modulating the immunogenicity of the protein, it was mixed with oligodeoxynucleotides in order to obtain particulated aggregates and then immunologically evaluated in mice in comparison with non-aggregated controls. Although the humoral immune response induced by both forms of the protein was equivalent, the aggregated variant resulted in a much stronger CMI as measured by in vitro IFN-γ secretion and protection experiments, mediated by CD4 + and CD8 + cells. The present work provides additional evidence in support for a crucial role of CMI in protection against dengue virus and describes a novel vaccine candidate against the disease based on a recombinant protein that can stimulate both arms of the acquired immune system.

  18. Purinergic signalling links mechanical breath profile and alveolar mechanics with the pro-inflammatory innate immune response causing ventilation-induced lung injury.

    Science.gov (United States)

    Hasan, Djo; Blankman, Paul; Nieman, Gary F

    2017-09-01

    Severe pulmonary infection or vigorous cyclic deformation of the alveolar epithelial type I (AT I) cells by mechanical ventilation leads to massive extracellular ATP release. High levels of extracellular ATP saturate the ATP hydrolysis enzymes CD39 and CD73 resulting in persistent high ATP levels despite the conversion to adenosine. Above a certain level, extracellular ATP molecules act as danger-associated molecular patterns (DAMPs) and activate the pro-inflammatory response of the innate immunity through purinergic receptors on the surface of the immune cells. This results in lung tissue inflammation, capillary leakage, interstitial and alveolar oedema and lung injury reducing the production of surfactant by the damaged AT II cells and deactivating the surfactant function by the concomitant extravasated serum proteins through capillary leakage followed by a substantial increase in alveolar surface tension and alveolar collapse. The resulting inhomogeneous ventilation of the lungs is an important mechanism in the development of ventilation-induced lung injury. The high levels of extracellular ATP and the upregulation of ecto-enzymes and soluble enzymes that hydrolyse ATP to adenosine (CD39 and CD73) increase the extracellular adenosine levels that inhibit the innate and adaptive immune responses rendering the host susceptible to infection by invading microorganisms. Moreover, high levels of extracellular adenosine increase the expression, the production and the activation of pro-fibrotic proteins (such as TGF-β, α-SMA, etc.) followed by the establishment of lung fibrosis.

  19. M cell-targeting strategy facilitates mucosal immune response and enhances protection against CVB3-induced viral myocarditis elicited by chitosan-DNA vaccine.

    Science.gov (United States)

    Ye, Ting; Yue, Yan; Fan, Xiangmei; Dong, Chunsheng; Xu, Wei; Xiong, Sidong

    2014-07-31

    Efficient delivery of antigen to mucosal associated lymphoid tissue is a first and critical step for successful induction of mucosal immunity by vaccines. Considering its potential transcytotic capability, M cell has become a more and more attractive target for mucosal vaccines. In this research, we designed an M cell-targeting strategy by which mucosal delivery system chitosan (CS) was endowed with M cell-targeting ability via conjugating with a CPE30 peptide, C terminal 30 amino acids of clostridium perfringens enterotoxin (CPE), and then evaluated its immune-enhancing ability in the context of coxsackievirus B3 (CVB3)-specific mucosal vaccine consisting of CS and a plasmid encoding CVB3 predominant antigen VP1. It had shown that similar to CS-pVP1, M cell-targeting CPE30-CS-pVP1 vaccine appeared a uniform spherical shape with about 300 nm diameter and +22 mV zeta potential, and could efficiently protect DNA from DNase I digestion. Mice were orally immunized with 4 doses of CPE30-CS-pVP1 containing 50 μg pVP1 at 2-week intervals and challenged with CVB3 4 weeks after the last immunization. Compared with CS-pVP1 vaccine, CPE30-CS-pVP1 vaccine had no obvious impact on CVB3-specific serum IgG level and splenic T cell immune responses, but significantly increased specific fecal SIgA level and augmented mucosal T cell immune responses. Consequently, much milder myocarditis and lower viral load were witnessed in CPE30-CS-pVP1 immunized group. The enhanced immunogenicity and immunoprotection were associated with the M cell-targeting ability of CPE30-CS-pVP1 which improved its mucosal uptake and transcytosis. Our findings indicated that CPE30-CS-pVP1 may represent a novel prophylactic vaccine against CVB3-induced myocarditis, and this M cell-targeting strategy indeed could be applied as a promising and universal platform for mucosal vaccine development. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Eosinophils in mucosal immune responses

    Science.gov (United States)

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  1. Evaluation of mucosal and systemic immune responses elicited by GPI-0100- adjuvanted influenza vaccine delivered by different immunization strategies.

    Directory of Open Access Journals (Sweden)

    Heng Liu

    Full Text Available Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN or the intrapulmonary (IPL route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses.

  2. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    Science.gov (United States)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  3. Hepatitis C Virus Sensing by Human Trophoblasts Induces Innate Immune Responses and Recruitment of Maternal NK Cells: Potential Implications for Limiting Vertical Transmission.

    Science.gov (United States)

    Giugliano, Silvia; Petroff, Margaret G; Warren, Bryce D; Jasti, Susmita; Linscheid, Caitlin; Ward, Ashley; Kramer, Anita; Dobrinskikh, Evgenia; Sheiko, Melissa A; Gale, Michael; Golden-Mason, Lucy; Winn, Virginia D; Rosen, Hugo R

    2015-10-15

    Hepatitis C virus (HCV) is the world's most common blood-borne viral infection for which there is no vaccine. The rates of vertical transmission range between 3 and 6% with odds 90% higher in the presence of HIV coinfection. Prevention of vertical transmission is not possible because of lack of an approved therapy for use in pregnancy or an effective vaccine. Recently, HCV has been identified as an independent risk factor for preterm delivery, perinatal mortality, and other complications. In this study, we characterized the immune responses that contribute to the control of viral infection at the maternal-fetal interface (MFI) in the early gestational stages. In this study, we show that primary human trophoblast cells and an extravillous trophoblast cell line (HTR8), from first and second trimester of pregnancy, express receptors relevant for HCV binding/entry and are permissive for HCV uptake. We found that HCV-RNA sensing by human trophoblast cells induces robust upregulation of type I/III IFNs and secretion of multiple chemokines that elicit recruitment and activation of decidual NK cells. Furthermore, we observed that HCV-RNA transfection induces a proapoptotic response within HTR8 that could affect the morphology of the placenta. To our knowledge, for the first time, we demonstrate that HCV-RNA sensing by human trophoblast cells elicits a strong antiviral response that alters the recruitment and activation of innate immune cells at the MFI. This work provides a paradigm shift in our understanding of HCV-specific immunity at the MFI as well as novel insights into mechanisms that limit vertical transmission but may paradoxically lead to virus-related pregnancy complications. Copyright © 2015 by The American Association of Immunologists, Inc.

  4. A Salmonella typhimurium ghost vaccine induces cytokine expression in vitro and immune responses in vivo and protects rats against homologous and heterologous challenges.

    Directory of Open Access Journals (Sweden)

    Nagarajan Vinod

    Full Text Available Salmonella enteritidis and Salmonella typhimurium are important food-borne bacterial pathogens, which are responsible for diarrhea and gastroenteritis in humans and animals. In this study, S. typhimurium bacterial ghost (STG was generated based on minimum inhibitory concentration (MIC of sodium hydroxide (NaOH. Experimental studies performed using in vitro and in vivo experimental model systems to characterize effects of STG as a vaccine candidate. When compared with murine macrophages (RAW 264.7 exposed to PBS buffer (98.1%, the macrophages exposed to formalin-killed inactivated cells (FKC, live wild-type bacterial cells and NaOH-induced STG at 1 × 108 CFU/mL showed 85.6%, 66.5% and 84.6% cell viability, respectively. It suggests that STG significantly reduces the cytotoxic effect of wild-type bacterial cells. Furthermore, STG is an excellent inducer for mRNAs of pro-inflammatory cytokine (TNF-α, IL-1β and factor (iNOS, anti-inflammatory cytokine (IL-10 and dual activities (IL-6 in the stimulated macrophage cells. In vivo, STG vaccine induced humoral and cellular immune responses and protection against homologous and heterologous challenges in rats. Furthermore, the immunogenicity and protective efficacy of STG vaccine were compared with those of FKC and non-vaccinated PBS control groups. The vaccinated rats from STG group exhibited higher levels of serum IgG antibody responses, serum bactericidal antibodies, and CD4+ and CD8+ T-cell populations than those of the FKC and PBS control groups. Most importantly, after challenge with homologous and heterologous strains, the bacterial loads in the STG group were markedly lower than the FKC and PBS control groups. In conclusion, these findings suggest that the STG vaccine induces protective immunity against homologous and heterologous challenges.

  5. Cellular immune responses to respiratory viruses

    NARCIS (Netherlands)

    van Helden, M.J.G.

    2011-01-01

    When a respiratory virus successfully infects the lungs, cascades of immune responses are initiated aimed to remove the pathogen. Immediate non-specific protection is provided by the innate immune system and this reduces the viral load during the first days of infection. The adaptive immune response

  6. A novel therapeutic hepatitis B vaccine induces cellular and humoral immune responses and breaks tolerance in hepatitis B virus (HBV) transgenic mice.

    Science.gov (United States)

    Buchmann, Pascale; Dembek, Claudia; Kuklick, Larissa; Jäger, Clemens; Tedjokusumo, Raindy; von Freyend, Miriam John; Drebber, Uta; Janowicz, Zbigniew; Melber, Karl; Protzer, Ulrike

    2013-02-06

    Therapeutic vaccines are currently being developed for chronic hepatitis B and C. As an alternative to long-term antiviral treatment or to support only partially effective therapy, they should activate the patient's immune system effectively to fight and finally control the virus. A paradigm of therapeutic vaccination is the potent induction of T-cell responses against key viral antigens - besides activation of a humoral immune response. We have evaluated the potential of a novel vaccine formulation comprising particulate hepatitis B surface (HBsAg) and core antigen (HBcAg), and the saponin-based ISCOMATRIX™ adjuvant for its ability to stimulate T and B cell responses in C57BL/6 mice and its ability to break tolerance in syngeneic HBV transgenic (HBVtg) mice. In C57BL/6 mice, the vaccine induced multifunctional HBsAg- and HBcAg-specific CD8+ T cells detected by staining for IFNγ, TNFα and IL-2, as well as high antibody titers against both antigens. Vaccination of HBVtg animals induced potent HBsAg- and HBcAg-specific CD8+ T-cell responses in spleens and HBcAg-specific CD8+ T-cell responses in livers as well as anti-HBs seroconversion two weeks post injection. Vaccination further reduced HBcAg expression in livers of HBVtg mice without causing liver damage. In summary, this study demonstrates therapeutic efficacy of a novel vaccine formulation in a mouse model of immunotolerant, chronic HBV infection. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Innate Immune Response and Off-Target Mis-splicing Are Common Morpholino-Induced Side Effects in Xenopus.

    Science.gov (United States)

    Gentsch, George E; Spruce, Thomas; Monteiro, Rita S; Owens, Nick D L; Martin, Stephen R; Smith, James C

    2018-03-12

    Antisense morpholino oligomers (MOs) have been indispensable tools for developmental biologists to transiently knock down (KD) genes rather than to knock them out (KO). Here we report on the implications of genetic KO versus MO-mediated KD of the mesoderm-specifying Brachyury paralogs in the frog Xenopus tropicalis. While both KO and KD embryos fail to activate the same core gene regulatory network, resulting in virtually identical morphological defects, embryos injected with control or target MOs also show a systemic GC content-dependent immune response and many off-target splicing defects. Optimization of MO dosage and increasing incubation temperatures can mitigate, but not eliminate, these MO side effects, which are consistent with the high affinity measured between MO and off-target sequence in vitro. We conclude that while MOs can be useful to profile loss-of-function phenotypes at a molecular level, careful attention must be paid to their immunogenic and off-target side effects. Copyright © 2018 The Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

  8. Prime-booster vaccination of cattle with an influenza viral vector Brucella abortus vaccine induces a long-term protective immune response against Brucella abortus infection.

    Science.gov (United States)

    Tabynov, Kaissar; Yespembetov, Bolat; Ryskeldinova, Sholpan; Zinina, Nadezhda; Kydyrbayev, Zhailaubay; Kozhamkulov, Yerken; Inkarbekov, Dulat; Sansyzbay, Abylai

    2016-01-20

    This study analyzed the duration of the antigen-specific humoral and T-cell immune responses and protectiveness of a recently-developed influenza viral vector Brucella abortus (Flu-BA) vaccine expressing Brucella proteins Omp16 and L7/L12 and containing the adjuvant Montadine Gel01 in cattle. At 1 month post-booster vaccination (BV), both humoral (up to 3 months post-BV; GMT IgG ELISA titer 214±55 to 857±136, with a prevalence of IgG2a over IgG1 isotype antibodies) and T-cell immune responses were observed in vaccinated heifers (n=35) compared to control animals (n=35, injected with adjuvant/PBS only). A pronounced T-cell immune response was induced and maintained for 12 months post-BV, as indicated by the lymphocyte stimulation index (2.7±0.4 to 10.1±0.9 cpm) and production of IFN-γ (13.7±1.7 to 40.0±3.0 ng/ml) at 3, 6, 9, and 12 months post-BV. Prime-boost vaccination provided significant protection against B. abortus infection at 3, 6, 9 and 12 months (study duration) post-BV (7 heifers per time point; alpha=0.03-0.01 vs. control group). Between 57.1 and 71.4% of vaccinated animals showed no signs of B. abortus infection (or Brucella isolation) at 3, 6, 9 and 12 months post-BV; the severity of infection, as indicated by the index of infection (P=0.0003 to Brucella colonization (P=0.03 to abortus infection was also observed among pregnant vaccinated heifers (alpha=0.03), as well as their fetuses and calves (alpha=0.01), for 12 months post-BV. Additionally, 71.4% of vaccinated heifers calved successfully whereas all pregnant control animals aborted (alpha=0.01). Prime-boost vaccination of cattle with Flu-BA induces an antigen-specific humoral and pronounced T cell immune response and most importantly provides good protectiveness, even in pregnant heifers, for at least 12 months post-BV. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Trans-sialidase-based vaccine candidate protects against Trypanosoma cruzi infection, not only inducing an effector immune response but also affecting cells with regulatory/suppressor phenotype

    Science.gov (United States)

    Prochetto, Estefanía; Roldán, Carolina; Bontempi, Iván A.; Bertona, Daiana; Peverengo, Luz; Vicco, Miguel H.; Rodeles, Luz M.; Pérez, Ana R.; Marcipar, Iván S.; Cabrera, Gabriel

    2017-01-01

    Prophylactic and/or therapeutic vaccines have an important potential to control Trypanosoma cruzi (T. cruzi)infection. The involvement of regulatory/suppressor immune cells after an immunization treatment and T. cruzi infection has never been addressed. Here we show that a new trans-sialidase-based immunogen (TSf) was able to confer protection, correlating not only with beneficial changes in effector immune parameters, but also influencing populations of cells related to immune control. Regarding the effector response, mice immunized with TSf showed a TS-specific antibody response, significant delayed-type hypersensitivity (DTH) reactivity and increased production of IFN-γ by CD8+ splenocytes. After a challenge with T. cruzi, TSf-immunized mice showed 90% survival and low parasitemia as compared with 40% survival and high parasitemia in PBS-immunized mice. In relation to the regulatory/suppressor arm of the immune system, after T. cruzi infection TSf-immunized mice showed an increase in spleen CD4+ Foxp3+ regulatory T cells (Treg) as compared to PBS-inoculated and infected mice. Moreover, although T. cruzi infection elicited a notable increase in myeloid derived suppressor cells (MDSC) in the spleen of PBS-inoculated mice, TSf-immunized mice showed a significantly lower increase of MDSC. Results presented herein highlight the need of studying the immune response as a whole when a vaccine candidate is rationally tested. PMID:28938533

  10. Obesity promotes prolonged ovalbumin-induced airway inflammation modulating T helper type 1 (Th1), Th2 and Th17 immune responses in BALB/c mice.

    Science.gov (United States)

    Silva, F M C; Oliveira, E E; Gouveia, A C C; Brugiolo, A S S; Alves, C C; Correa, J O A; Gameiro, J; Mattes, J; Teixeira, H C; Ferreira, A P

    2017-07-01

    Clinical and epidemiological studies indicate that obesity affects the development and phenotype of asthma by inducing inflammatory mechanisms in addition to eosinophilic inflammation. The aim of this study was to assess the effect of obesity on allergic airway inflammation and T helper type 2 (Th2) immune responses using an experimental model of asthma in BALB/c mice. Mice fed a high-fat diet (HFD) for 10 weeks were sensitized and challenged with ovalbumin (OVA), and analyses were performed at 24 and 48 h after the last OVA challenge. Obesity induced an increase of inducible nitric oxide synthase (iNOS)-expressing macrophages and neutrophils which peaked at 48 h after the last OVA challenge, and was associated with higher levels of interleukin (IL)-4, IL-9, IL-17A, leptin and interferon (IFN)-γ in the lungs. Higher goblet cell hyperplasia was associated with elevated mast cell influx into the lungs and trachea in the obese allergic mice. In contrast, early eosinophil influx and lower levels of IL-25, thymic stromal lymphopoietin (TSLP), CCL11 and OVA-specific immunoglobulin (IgE) were observed in the obese allergic mice in comparison to non-obese allergic mice. Moreover, obese mice showed higher numbers of mast cells regardless of OVA challenge. These results indicate that obesity affects allergic airway inflammation through mechanisms involving mast cell influx and the release of TSLP and IL-25, which favoured a delayed immune response with an exacerbated Th1, Th2 and Th17 profile. In this scenario, an intense mixed inflammatory granulocyte influx, classically activated macrophage accumulation and intense mucus production may contribute to a refractory therapeutic response and exacerbate asthma severity. © 2017 British Society for Immunology.

  11. The Immune Response of Maternally Immune Chicks to Vaccination ...

    African Journals Online (AJOL)

    The Immune Response of Maternally Immune Chicks to Vaccination with Newcastle Disease Virus. ... G A El-Tayeb, M Y El-Ttegani, I E Hajer, M A Mohammed ... This study was conducted to determine the persistence of maternally derived antibodies (MDA) to Newcastle disease virus (NDV) in newly hatched chicks and the ...

  12. Intranasal administration of a therapeutic HIV vaccine (Vacc-4x induces dose-dependent systemic and mucosal immune responses in a randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Kristin Brekke

    Full Text Available Vacc-4x, a Gag p24-based therapeutic HIV vaccine, has been shown to reduce viral load set-points after intradermal administration. In this randomized controlled pilot study we investigate intranasal administration of Vacc-4x with Endocine as adjuvant.Safety and immunogenicity were tested in patients on effective ART. They were randomized to low, medium or high dose Vacc-4x or adjuvant alone, administered four times at weekly intervals with no booster. Vacc-4x-specific T cell responses were measured in vitro by proliferation and in vivo by a single DTH skin test at the end of study. Nasal and rectal mucosal secretions were analyzed for Vacc-4x-specific antibodies by ELISA. Immune regulation induced by Vacc-4x was assessed by functional blockade of the regulatory cytokines IL-10 and TGF-β.Vacc-4x proliferative T cell responses increased only among the vaccinated (p ≤ 0.031. The low dose group showed the greatest increase in Vacc-4x CD8+T cell responses (p = 0.037 and developed larger DTH (p = 0.005 than the adjuvant group. Rectal (distal Vacc-4x IgA and IgG antibodies also increased (p = 0.043 in this group. In contrast, the high dose generated higher nasal (local Vacc-4x IgA (p = 0.028 and serum IgG (p = 0.030 antibodies than the adjuvant. Irrespective of dose, increased Vacc-4x CD4+T cell responses were associated with low proliferation (r = -0.82, p < 0.001 and high regulation (r = 0.61, p = 0.010 at baseline.Intranasal administration of Vacc-4x with Endocine was safe and induced dose-dependent vaccine-specific T cell responses and both mucosal and systemic humoral responses. The clinical significance of dose, immune regulation and mucosal immunity warrants further investigation.ClinicalTrials.gov NCT01473810.

  13. Novel engineered HIV-1 East African Clade-A gp160 plasmid construct induces strong humoral and cell-mediated immune responses in vivo

    International Nuclear Information System (INIS)

    Muthumani, Karuppiah; Zhang Donghui; Dayes, Nathanael S.; Hwang, Daniel S.; Calarota, Sandra A.; Choo, Andrew Y.; Boyer, Jean D.; Weiner, David B.

    2003-01-01

    HIV-1 sequences are highly diverse due to the inaccuracy of the viral reverse transcriptase. This diversity has been studied and used to categorize HIV isolates into subtypes or clades, which are geographically distinct. To develop effective vaccines against HIV-1, immunogens representing different subtypes may be important for induction of cross-protective immunity, but little data exist describing and comparing the immunogenicity induced by different subtype-based vaccines. This issue is further complicated by poor expression of HIV structural antigens due to rev dependence. One costly approach is to codon optimize each subtype construct to be examined. Interestingly, cis-acting transcriptional elements (CTE) can also by pass rev restriction by a rev independent export pathway. We reasoned that rev+CTE constructs might have advantages for such expression studies. A subtype A envelope sequence from a viral isolate from east Africa was cloned into a eukaryotic expression vector under the control of the CMV-IE promoter. The utility of inclusion of the Mason-Pfizer monkey virus (MPV)-CTE with/without rev for driving envelope expression and immunogenicity was examined. Expression of envelope (gp120) was confirmed by immunoblot analysis and by pseudotype virus infectivity assays. The presence of rev and the CTE together increased envelope expression and viral infection. Furthermore the CTE+rev construct was significantly more immunogenic then CTE alone vector. Isotype analysis and cytokine profiles showed strong Th1 response in plasmid-immunized mice, which also demonstrated the superior nature of the rev+CTE construct. These responses were of similar or greater magnitude to a codon-optimized construct. The resulting cellular immune responses were highly cross-reactive with a HIV-1 envelope subtype B antigen. This study suggests a simple strategy for improving the expression and immunogenicity of HIV subtype-specific envelope antigens as plasmid or vector

  14. Glycoprotein from street rabies virus BD06 induces early and robust immune responses when expressed from a non-replicative adenovirus recombinant.

    Science.gov (United States)

    Wang, Shuchao; Sun, Chenglong; Zhang, Shoufeng; Zhang, Xiaozhuo; Liu, Ye; Wang, Ying; Zhang, Fei; Wu, Xianfu; Hu, Rongliang

    2015-09-01

    The rabies virus (RABV) glycoprotein (G) is responsible for inducing neutralizing antibodies against rabies virus. Development of recombinant vaccines using the G genes from attenuated strains rather than street viruses is a regular practice. In contrast to this scenario, we generated three human adenovirus type 5 recombinants using the G genes from the vaccine strains SRV9 and Flury-LEP, and the street RABV strain BD06 (nrAd5-SRV9-G, nrAd5-Flury-LEP-G, and nrAd5-BD06-G). These recombinants were non-replicative, but could grow up to ~10(8) TCID50/ml in helper HEK293AD cells. Expression of the G protein was verified by immunostaining, quantitative PCR and cytometry. Animal experiments revealed that immunization with nrAd5-BD06-G can induce a higher seroconversion rate, a higher neutralizing antibody level, and a longer survival time after rabies virus challenge in mice when compared with the other two recombinants. Moreover, the expression of granulocyte-macrophage colony-stimulating factor (GM-CSF) was significantly higher in mice immunized with nrAd5-BD06-G, which might also contribute to the increased protection. These results show that the use of street RABV G for non-replicative systems may be an alternative for developing effective recombinant rabies vaccines.

  15. The role of epidermal cytokines in the generation of cutaneous immune reactions and ultraviolet radiation-induced immune suppression

    International Nuclear Information System (INIS)

    Ullrich, S.E.

    1995-01-01

    The immune suppression generated by UV exposure is a major risk factor for skin cancer patients. This finding has fuelled efforts to understand the mechanisms involved in the immune suppression induced by exposure to UV radiation. This article reviews the recent findings on the role of epidermal cytokines in the generation of an immune response and their role in the induction of immune suppression induced by UV exposure. (UK)

  16. Silver nanoparticles and dissolved silver activate contrasting immune responses and stress-induced heat shock protein expression in sea urchin.

    Science.gov (United States)

    Magesky, Adriano; de Oliveira Ribeiro, Ciro A; Beaulieu, Lucie; Pelletier, Émilien

    2017-07-01

    Using immune cells of sea urchin Strongylocentrotus droebachiensis in early development as a model, the cellular protective mechanisms against ionic and poly(allylamine)-coated silver nanoparticle (AgNPs; 14 ± 6 nm) treatments at 100 μg L -1 were investigated. Oxidative stress, heat shock protein expression, and pigment production by spherulocytes were determined as well as AgNP translocation pathways and their multiple effects on circulating coelomocytes. Sea urchins showed an increasing resilience to Ag over time because ionic Ag is accumulated in a steady way, although nanoAg levels dropped between 48 h and 96 h. A clotting reaction emerged on tissues injured by dissolved Ag (present as chloro-complexes in seawater) between 12 h and 48 h. Silver contamination and nutritional state influenced the production of reactive oxygen species. After passing through coelomic sinuses and gut, AgNPs were found in coelomocytes. Inside blood vessels, apoptosis-like processes appeared in coelomocytes highly contaminated by poly(allylamine)-coated AgNPs. Increasing levels of Ag accumulated by urchins once exposed to AgNPs pointed to a Trojan-horse mechanism operating over 12-d exposure. However, under short-term treatments, physical interactions of poly(allylamine)-coated AgNPs with cell structures might be, at some point, predominant and responsible for the highest levels of stress-related proteins detected. The present study is the first report detailing nano-translocation in a marine organism and multiple mechanisms by which sea urchin cells can deal with toxic AgNPs. Environ Toxicol Chem 2017;36:1872-1886. © 2016 SETAC. © 2016 SETAC.

  17. An alphavirus vector overcomes the presence of neutralizing antibodies and elevated numbers of Tregs to induce immune responses in humans with advanced cancer.

    Science.gov (United States)

    Morse, Michael A; Hobeika, Amy C; Osada, Takuya; Berglund, Peter; Hubby, Bolyn; Negri, Sarah; Niedzwiecki, Donna; Devi, Gayathri R; Burnett, Bruce K; Clay, Timothy M; Smith, Jonathan; Lyerly, H Kim

    2010-09-01

    Therapeutic anticancer vaccines are designed to boost patients' immune responses to tumors. One approach is to use a viral vector to deliver antigen to in situ DCs, which then activate tumor-specific T cell and antibody responses. However, vector-specific neutralizing antibodies and suppressive cell populations such as Tregs remain great challenges to the efficacy of this approach. We report here that an alphavirus vector, packaged in virus-like replicon particles (VRP) and capable of efficiently infecting DCs, could be repeatedly administered to patients with metastatic cancer expressing the tumor antigen carcinoembryonic antigen (CEA) and that it overcame high titers of neutralizing antibodies and elevated Treg levels to induce clinically relevant CEA-specific T cell and antibody responses. The CEA-specific antibodies mediated antibody-dependent cellular cytotoxicity against tumor cells from human colorectal cancer metastases. In addition, patients with CEA-specific T cell responses exhibited longer overall survival. These data suggest that VRP-based vectors can overcome the presence of neutralizing antibodies to break tolerance to self antigen and may be clinically useful for immunotherapy in the setting of tumor-induced immunosuppression.

  18. Novel chimeric virus-like particles vaccine displaying MERS-CoV receptor-binding domain induce specific humoral and cellular immune response in mice.

    Science.gov (United States)

    Wang, Chong; Zheng, Xuexing; Gai, Weiwei; Wong, Gary; Wang, Hualei; Jin, Hongli; Feng, Na; Zhao, Yongkun; Zhang, Weijiao; Li, Nan; Zhao, Guoxing; Li, Junfu; Yan, Jinghua; Gao, Yuwei; Hu, Guixue; Yang, Songtao; Xia, Xianzhu

    2017-04-01

    Middle East respiratory syndrome coronavirus (MERS-CoV) has continued spreading since its emergence in 2012 with a mortality rate of 35.6%, and is a potential pandemic threat. Prophylactics and therapies are urgently needed to address this public health problem. We report here the efficacy of a vaccine consisting of chimeric virus-like particles (VLP) expressing the receptor binding domain (RBD) of MERS-CoV. In this study, a fusion of the canine parvovirus (CPV) VP2 structural protein gene with the RBD of MERS-CoV can self-assemble into chimeric, spherical VLP (sVLP). sVLP retained certain parvovirus characteristics, such as the ability to agglutinate pig erythrocytes, and structural morphology similar to CPV virions. Immunization with sVLP induced RBD-specific humoral and cellular immune responses in mice. sVLP-specific antisera from these animals were able to prevent pseudotyped MERS-CoV entry into susceptible cells, with neutralizing antibody titers reaching 1: 320. IFN-γ, IL-4 and IL-2 secreting cells induced by the RBD were detected in the splenocytes of vaccinated mice by ELISpot. Furthermore, mice inoculated with sVLP or an adjuvanted sVLP vaccine elicited T-helper 1 (Th1) and T-helper 2 (Th2) cell-mediated immunity. Our study demonstrates that sVLP displaying the RBD of MERS-CoV are promising prophylactic candidates against MERS-CoV in a potential outbreak situation. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Restimulation-induced T-cell death through NTB-A/SAP signaling pathway is impaired in tuberculosis patients with depressed immune responses.

    Science.gov (United States)

    Hernández Del Pino, Rodrigo E; Pellegrini, Joaquín M; Rovetta, Ana I; Peña, Delfina; Álvarez, Guadalupe I; Rolandelli, Agustín; Musella, Rosa M; Palmero, Domingo J; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E

    2017-09-01

    Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T- and B-cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25 high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T-cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype.

  20. Immune oncology, immune responsiveness and the theory of everything.

    Science.gov (United States)

    Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue

    2018-06-05

    Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

  1. Unlipidated Outer Membrane Protein Omp16 (U-Omp16) from Brucella spp. as Nasal Adjuvant Induces a Th1 Immune Response and Modulates the Th2 Allergic Response to Cow’s Milk Proteins

    Science.gov (United States)

    Ibañez, Andrés E.; Smaldini, Paola; Coria, Lorena M.; Delpino, María V.; Pacífico, Lucila G. G.; Oliveira, Sergio C.; Risso, Gabriela S.; Pasquevich, Karina A.; Fossati, Carlos Alberto; Giambartolomei, Guillermo H.; Docena, Guillermo H.; Cassataro, Juliana

    2013-01-01

    The discovery of novel mucosal adjuvants will help to develop new formulations to control infectious and allergic diseases. In this work we demonstrate that U-Omp16 from Brucella spp. delivered by the nasal route (i.n.) induced an inflammatory immune response in bronchoalveolar lavage (BAL) and lung tissues. Nasal co-administration of U-Omp16 with the model antigen (Ag) ovalbumin (OVA) increased the amount of Ag in lung tissues and induced OVA-specific systemic IgG and T helper (Th) 1 immune responses. The usefulness of U-Omp16 was also assessed in a mouse model of food allergy. U-Omp16 i.n. administration during sensitization ameliorated the hypersensitivity responses of sensitized mice upon oral exposure to Cow’s Milk Protein (CMP), decreased clinical signs, reduced anti-CMP IgE serum antibodies and modulated the Th2 response in favor of Th1 immunity. Thus, U-Omp16 could be used as a broad Th1 mucosal adjuvant for different Ag formulations. PMID:23861971

  2. Tumour cell lysate-loaded dendritic cell vaccine induces biochemical and memory immune response in castration-resistant prostate cancer patients.

    Science.gov (United States)

    Reyes, D; Salazar, L; Espinoza, E; Pereda, C; Castellón, E; Valdevenito, R; Huidobro, C; Inés Becker, M; Lladser, A; López, M N; Salazar-Onfray, F

    2013-09-17

    Recently, we produced a tumour antigen-presenting cells (TAPCells) vaccine using a melanoma cell lysate, called TRIMEL, as an antigen source and an activation factor. Tumour antigen-presenting cells induced immunological responses and increased melanoma patient survival. Herein, we investigated the effect of TAPCells loaded with prostate cancer cell lysates (PCCL) as an antigen source, and TRIMEL as a dendritic cell (DC) activation factor; which were co-injected with the Concholepas concholepas haemocyanin (CCH) as an adjuvant on castration-resistant prostate cancer (CRPC) patients. The lysate mix capacity, for inducing T-cell activation, was analysed by flow cytometry and Elispot. Delayed-type hypersensitivity (DTH) reaction against PCCL, frequency of CD8(+) memory T cells (Tm) in blood and prostate-specific antigen (PSA) levels in serum were measured in treated patients. The lysate mix induced functional mature DCs that were capable of activating PCCL-specific T cells. No relevant adverse reactions were observed. Six out of 14 patients showed a significant decrease in levels of PSA. DTH(+) patients showed a prolonged PSA doubling-time after treatment. Expansion of functional central and effector CD8(+) Tm were detected. Treatment of CRPC patients with lysate-loaded TAPCells and CCH as an adjuvant is safe: generating biochemical and memory immune responses. However, the limited number of cases requires confirmation in a phase II clinical trial.

  3. Gastrointestinal immune responses in HIV infected subjects

    Directory of Open Access Journals (Sweden)

    LRR Castello-Branco

    1996-06-01

    Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.

  4. Multiple linear B-cell epitopes of classical swine fever virus glycoprotein E2 expressed in E.coli as multiple epitope vaccine induces a protective immune response

    Directory of Open Access Journals (Sweden)

    Wei Jian-Chao

    2011-07-01

    Full Text Available Abstract Classical swine fever is a highly contagious disease of swine caused by classical swine fever virus, an OIE list A pathogen. Epitope-based vaccines is one of the current focuses in the development of new vaccines against classical swine fever virus (CSFV. Two B-cell linear epitopes rE2-ba from the E2 glycoprotein of CSFV, rE2-a (CFRREKPFPHRMDCVTTTVENED, aa844-865 and rE2-b (CKEDYRYAISSTNEIGLLGAGGLT, aa693-716, were constructed and heterologously expressed in Escherichia coli as multiple epitope vaccine. Fifteen 6-week-old specified-pathogen-free (SPF piglets were intramuscularly immunized with epitopes twice at 2-week intervals. All epitope-vaccinated pigs could mount an anamnestic response after booster vaccination with neutralizing antibody titers ranging from 1:16 to 1:256. At this time, the pigs were subjected to challenge infection with a dose of 1 × 106 TCID50 virulent CSFV strain. After challenge infection, all of the rE2-ba-immunized pigs were alive and without symptoms or signs of CSF. In contrast, the control pigs continuously exhibited signs of CSF and had to be euthanized because of severe clinical symptoms at 5 days post challenge infection. The data from in vivo experiments shown that the multiple epitope rE2-ba shown a greater protection (similar to that of HCLV vaccine than that of mono-epitope peptide(rE2-a or rE2-b. Therefore, The results demonstrated that this multiple epitope peptide expressed in a prokaryotic system can be used as a potential DIVA (differentiating infected from vaccinated animals vaccine. The E.coli-expressed E2 multiple B-cell linear epitopes retains correct immunogenicity and is able to induce a protective immune response against CSFV infection.

  5. Prior DNA immunization enhances immune response to dominant and subdominant viral epitopes induced by a fowlpox-based SIVmac vaccine in long-term slow-progressor macaques infected with SIVmac251

    International Nuclear Information System (INIS)

    Radaelli, Antonia; Nacsa, Janos; Tsai, W.-P.; Edghill-Smith, Yvette; Zanotto, Carlo; Elli, Veronica; Venzon, David; Tryniszewska, Elzbieta; Markham, Phil; Mazzara, Gail P.; Panicali, Dennis; Morghen, Carlo De Giuli; Franchini, Genoveffa

    2003-01-01

    A therapeutic vaccine for individuals infected with HIV-1 and treated with antiretroviral therapy (ART) should be able to replenish virus-specific CD4+ T-cells and broaden the virus-specific CD8+ T-cell response in order to maintain CD8+ T-cell function and minimize viral immune escape after ART cessation. Because a combination of DNA and recombinant poxvirus vaccine modalities induces high levels of virus-specific CD4+ T-cell response and broadens the cytolytic activity in naive macaques, we investigated whether the same results could be obtained in SIVmac251-infected macaques. The macaques studied here were long-term nonprogressors that naturally contained viremia but were nevertheless treated with a combination of antiviral drugs to assess more carefully the effect of vaccination in the context of ART. The combination of a DNA expressing the gag and pol genes (DNA-SIV-gp) of SIVmac239 followed by a recombinant fowlpox expressing the same SIVmac genes (FP-SIV-gp) was significantly more immunogenic than two immunizations of FP-SIV-gp in SIVmac251-infected macaques treated with ART. The DNA/FP combination significantly expanded and broadened Gag-specific T-cell responses measured by tetramer staining, ELISPOT, and intracellular cytokine staining and measurement of ex vivo cytolytic function. Importantly, the combination of these vaccine modalities also induced a sizeable expansion in most macaques of Gag-specific CD8-(CD4+) T-cells able to produce TNF-α. Hopefully, this modality of vaccine combination may be useful in the clinical management of HIV-1-infected individuals

  6. Co-delivery of PLGA encapsulated invariant NKT cell agonist with antigenic protein induce strong T cell-mediated antitumor immune responses

    NARCIS (Netherlands)

    Dolen, Y.; Kreutz, M.; Gileadi, U.; Tel, J.; Vasaturo, A.; Dinther, E.A.W. van; Hout-Kuijer, M.A. van; Cerundolo, V.; Figdor, C.G.

    2016-01-01

    Antitumor immunity can be enhanced by the coordinated release and delivery of antigens and immune-stimulating agents to antigen-presenting cells via biodegradable vaccine carriers. So far, encapsulation of TLR ligands and tumor-associated antigens augmented cytotoxic T cell (CTLs) responses. Here,

  7. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  8. Transurethral instillation with fusion protein MrpH.FimH induces protective innate immune responses against uropathogenic Escherichia coli and Proteus mirabilis.

    Science.gov (United States)

    Habibi, Mehri; Asadi Karam, Mohammad Reza; Bouzari, Saeid

    2016-06-01

    Urinary tract infections (UTIs) are among the most common infections in human. Innate immunity recognizes pathogen-associated molecular patterns (PAMPs) by Toll-like receptors (TLRs) to activate responses against pathogens. Recently, we demonstrated that MrpH.FimH fusion protein consisting of MrpH from Proteus mirabilis and FimH from Uropathogenic Escherichia coli (UPEC) results in the higher immunogenicity and protection, as compared with FimH and MrpH alone. In this study, we evaluated the innate immunity and adjuvant properties induced by fusion MrpH.FimH through in vitro and in vivo methods. FimH and MrpH.FimH were able to induce significantly higher IL-8 and IL-6 responses than untreated or MrpH alone in cell lines tested. The neutrophil count was significantly higher in the fusion group than other groups. After 6 h, IL-8 and IL-6 production reached a peak, with a significant decline at 24 h post-instillation in both bladder and kidney tissues. Mice instilled with the fusion and challenged with UPEC or P. mirabilis showed a significant decrease in the number of bacteria in bladder and kidney compared to control mice. The results of these studies demonstrate that the use of recombinant fusion protein encoding TLR-4 ligand represents an effective vaccination strategy that does not require the use of a commercial adjuvant. Furthermore, MrpH.FimH was presented as a promising vaccine candidate against UTIs caused by UPEC and P. mirabilis. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  9. Curcumin attenuates the scurfy-induced immune disorder, a model of IPEX syndrome, with inhibiting Th1/Th2/Th17 responses in mice.

    Science.gov (United States)

    Lee, Gihyun; Chung, Hwan-Suck; Lee, Kyeseok; Lee, Hyeonhoon; Kim, Minhwan; Bae, Hyunsu

    2017-09-15

    Immunodysregulation polyendocrinopathy enteropathy X-linked syndrome (IPEX) is a lethal autoimmune disease caused by mutations in the Foxp3 gene scurfin (scurfy). Immunosuppressive therapy for IPEX patients has been generally ineffective and has caused severe side effects, however curcumin has shown immune regulation properties for inflammatory diseases, such as rheumatoid arthritis, psoriasis, and inflammatory bowel diseases without side effects. The aim of this study was to investigate whether curcumin would attenuate symptoms of IPEX in mouse model and would prolong its survival period. C57BL/6 mice were separated into scurfy or wild-type litter mate groups by genotyping, and each group subsequently was separated into 2 subgroups that were fed a 1% curcumin containing or normal diet from the last day of breast-feeding. After weaning, pups were fed either a 1% curcumin containing or normal diet until all scurfy mice die for survival data. To elucidate immune cell proportions in spleen and lymph nodes, cells were analyzed by flowcytometry. Cellular cytokine production was accessed to investigate the effects of curcumin in T cell differentiation in vitro. Scurfy mice fed a 1% curcumin diet survived 4.0-fold longer compared to scurfy (92.5 days) mice fed a normal diet (23 days). A curcumin diet decreased all of the Th1/Th2/Th17 cell populations and attenuated diverse symptoms such as splenomegaly in scurfy mice. In vitro experiments showed that curcumin treatment directly decreased the Th1/Th2/Th17 cytokine production of IFN-γ, IL-4, and IL-17A in CD4 + T cells. Curcumin diet attenuated the scurfy-induced immune disorder, a model of IPEX syndrome, by inhibiting Th1/Th2/Th17 responses in mice. These results have implications for improving clinical therapy for patients with IPEX and other T cell related autoimmune diseases. Copyright © 2017 Elsevier GmbH. All rights reserved.

  10. Synergistic immune responses induced by endogenous retrovirus and herpesvirus antigens result in increased production of inflammatory cytokines in multiple sclerosis patients

    DEFF Research Database (Denmark)

    Brudek, T; Christensen, T; Hansen, H J

    2008-01-01

    Human endogenous retroviruses (HERV) and herpesviruses are increasingly associated with the pathogenesis of the neurological inflammatory disease multiple sclerosis (MS). Herpesviruses are capable of HERV activation and simultaneous presence of HERV and herpesvirus antigens have a synergistic...... effect on cell-mediated immune responses, which tend to be higher in MS patients in comparison with healthy individuals. Here, we investigate whether these synergistic immune responses are reflected in changes in the production of proinflammatory cytokines. Using enzyme-linked immunosorbent assays...

  11. Pleurodeles Waltl Humoral Immune Response under Spaceflight Conditions

    Science.gov (United States)

    Bascove, Matthieu; Touche, Nadege; Frippiat, Jean-Pol

    2008-06-01

    The immune system is an important regulatory mechanism affected by spaceflights. In a previous work, we performed a first study of the humoral immune response induced by the immunization of Pleurodeles waltl during a 5 months stay onboard the Mir space station. This analysis indicated that heavy-chain variable domains of specific IgM are encoded by genes of the VHII and VHVI families. However, the contributions of these two families to IgM heavy-chains are different in flown animals [1]. To better understand this immune response modification, we have now determined how individual VH genes have been used to build specific IgM binding sites in animals immunized on earth or in space. This new study revealed quantitative and qualitative modifications in VH genes expression. These data confirm that a spaceflight might affect the humoral response.

  12. Signalling through C-type lectin receptors: shaping immune responses

    NARCIS (Netherlands)

    Geijtenbeek, Teunis B. H.; Gringhuis, Sonja I.

    2009-01-01

    C-type lectin receptors (CLRs) expressed by dendritic cells are crucial for tailoring immune responses to pathogens. Following pathogen binding, CLRs trigger distinct signalling pathways that induce the expression of specific cytokines which determine T cell polarization fates. Some CLRs can induce

  13. Maternal inflammation induces immune activation of fetal microglia and leads to disrupted microglia immune responses, behavior, and learning performance in adulthood

    NARCIS (Netherlands)

    Schaafsma, Wandert; Basterra, Laura Bozal; Jacobs, Sabrina; Brouwer, Nieske; Meerlo, Peter; Schaafsma, Anne; Boddeke, Erik W. G. M.; Eggen, Bart J. L.

    2017-01-01

    Maternal inflammation during pregnancy can have detrimental effects on embryonic development that persist during adulthood. However, the underlying mechanisms and insights in the responsible cell types are still largely unknown. Here we report the effect of maternal inflammation on fetal microglia,

  14. Immune responses and parasitological observations induced during probiotic treatment with medicinal Trichuris suis ova in a healthy volunteer

    DEFF Research Database (Denmark)

    Williams, Andrew R; Dige, Anders; Rasmussen, Tue Kruse

    2017-01-01

    Ingestion of eggs (ova) of the porcine nematode parasite Trichuris suis (TSO) may reduce the severity of autoimmune disorders, however the development of TSO treatment as a useful therapy for autoimmune diseases is hampered by a lack of knowledge on the development of the parasite and the nature...... was also reflected to some extent in the peripheral circulation. These results, together with the first definitive observations that T. suis can mature to adult size and reproduce in humans, shed new light on the interaction between the human immune system and probiotic helminth treatment, which should...

  15. Immune response against the coiled coil domain of Sjögren's syndrome associated autoantigen Ro52 induces salivary gland dysfunction.

    Science.gov (United States)

    Sroka, Magdalena; Bagavant, Harini; Biswas, Indranil; Ballard, Abigail; Deshmukh, Umesh S

    2018-01-31

    The structural domains of Ro52, termed the RING, B-box, coiled coil (CC) and B30.2/SPRY are targets of anti-Ro52 in multiple autoimmune disorders. In Sjögren's syndrome patients, the presence of anti-Ro52 is associated with higher disease severity, and in mice, they induce salivary gland hypofunction. This study was undertaken to investigate whether immune responses against different domains of Ro52, influences salivary gland disease in mice. Female NZM2758 mice were immunised with Ro52 domains expressed as recombinant fusion proteins with maltose binding protein (MBP) [MBP-RING-B-box, MBP-CC, MBP-CC(ΔC19), MBP-B30.2/SPRY]. Sera from immunised mice were studied for IgG antibodies to Ro52 by immunoprecipitation, and to salivary gland cells by immunofluorescence. Pilocarpine-induced saliva production was measured to evaluate salivary gland function. Submandibular glands were investigated by histopathology for inflammation and by immune-histochemistry for IgG deposition. Mice immunised with different Ro52-domains had comparable reactivity to Ro52 and to salivary gland cells. However, only mice immunised with the CC domain and its C-terminal truncated version CC(ΔC19) showed a significant drop in saliva production. None of the mice developed severe salivary gland inflammation. The salivary gland hypofunction significantly correlated with increased intra-lobar IgG deposits in the submandibular salivary glands. Our data demonstrate that epitope specificity of anti-Ro52 antibodies plays a critical role in the induction of glandular dysfunction. Clearly, screening Sjögren's syndrome patients for relative levels of Ro52 domain specific antibodies will be more informative for associating anti-Ro52 with clinical measures of the disorder.

  16. Immunomodulator-based enhancement of anti smallpox immune responses.

    Science.gov (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  17. Work stress and innate immune response.

    Science.gov (United States)

    Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L

    2011-01-01

    Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.

  18. SIGNALING MECHANISMS IN SEPSIS-INDUCED IMMUNE DYSFUNCTION

    OpenAIRE

    Hasan, Zirak

    2013-01-01

    Sepsis and subsequent organ failure remain the major cause of mortality in intensive care units in spite of significant research efforts. The lung is the most vulnerable organ affected by early hyper-inflammatory immune response in septic patients. On the other hand, the septic insult induces immune dysfunction in later phases of sepsis which in turn increases susceptibility to infections. The aim of this thesis was to investigate early and late inflammatory mechanisms in abdominal sepsis ind...

  19. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    Science.gov (United States)

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  20. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    Directory of Open Access Journals (Sweden)

    Oana Marcu

    2011-01-01

    Full Text Available Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  1. Alleviation of collagen-induced arthritis by the benzoxathiole derivative BOT-4-one in mice: Implication of the Th1- and Th17-cell-mediated immune responses.

    Science.gov (United States)

    Kim, Byung-Hak; Yoon, Bo Ruem; Kim, Eun Kyoung; Noh, Kum Hee; Kwon, Sun-Ho; Yi, Eun Hee; Lee, Hyun Gyu; Choi, Jung Sook; Kang, Seong Wook; Park, In-Chul; Lee, Won-Woo; Ye, Sang-Kyu

    2016-06-15

    Autoimmune rheumatoid arthritis is characterized by chronic inflammation and hyperplasia in the synovial joints. Although the cause of rheumatoid arthritis is largely unknown, substantial evidence has supported the importance of immune cells and inflammatory cytokines in the initiation and progression of this disease. Herein, we demonstrated that the benzoxathiole derivative 2-cyclohexylimino-6-methyl-6,7-dihydro-5H-benzo[1,3]oxathiol-4-one (BOT-4-one) alleviated type II collagen-induced arthritis in a mouse model. The levels of pro-inflammatory cytokines are elevated in both human patients with rheumatoid arthritis and mice with collagen-induced arthritis. BOT-4-one treatment reduced the levels of pro-inflammatory cytokines in mice and endotoxin-stimulated macrophages. BOT-4-one treatment suppressed the polarization of Th1- and Th17-cell subsets by inhibiting the expression and production of their lineage-specific master transcription factors and cytokines, as well as activation of signal transducer and activator of transcription proteins. In addition, BOT-4-one inhibited mitogen-activated protein kinase and NF-kappaB signaling as well as the transcriptional activities and DNA-binding of transcription factors, including activator protein-1, cAMP response element-binding protein and NF-kappaB. Our results suggest that BOT-4-one may have therapeutic potential for the treatment of chronic inflammation associated with autoimmune rheumatoid arthritis. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. DNA Damage Response and Immune Defence: Links and Mechanisms

    Directory of Open Access Journals (Sweden)

    Björn Schumacher

    2016-08-01

    Full Text Available DNA damage plays a causal role in numerous human pathologies including cancer, premature aging and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signalling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signalling. We highlight evidence gained into (i which molecular and cellular pathways of DDR activate immune signalling, (ii how DNA damage drives chronic inflammation, and (iii how chronic inflammation causes DNA damage and pathology in humans.

  3. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    Science.gov (United States)

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Immunization with a DNA Vaccine Cocktail Induces a Th1 Response and Protects Mice Against Mycobacterium avium subsp. paratuberculosis Challenge

    Science.gov (United States)

    Several novel antigens of Mycobacterium avium subsp. paratuberculosis have been studied as vaccine components and their immunogenicity has been evaluated. Previously, we reported that 85 antigen complex (85A, 85B, and 85C), superoxide dismutase (SOD), and 35kDa protein could induce significant lymph...

  5. Immunohistochemical characterisation of the local immune response in azoxymethane-induced colon tumours in the BDIX inbred rat strain

    DEFF Research Database (Denmark)

    Kobæk Larsen, Morten; Diederichsen, Axel Cosmus Pyndt; Agger, Ralf

    2004-01-01

    by four weekly subcutaneous azoxymethane injections in inbred rats of the BDIX/OrlIco strain in two separate studies. Azoxymethane-induced tumours show many similarities to spontaneously occurring human colon carcinomas with respect to histopathological appearance. In our studies, the overall inflammatory...

  6. Antimicrobial peptides in innate immune responses

    DEFF Research Database (Denmark)

    Sorensen, O.E.; Borregaard, N.; Cole, A.M.

    2008-01-01

    Antimicrobial peptides (AMPs) are ancient effector molecules in the innate immune response of eukaryotes. These peptides are important for the antimicrobial efficacy of phagocytes and for the innate immune response mounted by epithelia of humans and other mammals. AMPs are generated either by de...... novo synthesis or by proteolytic cleavage from antimicrobially inactive proproteins. Studies of human diseases and animal studies have given important clues to the in vivo role of AMPs. It is now evident that dysregulation of the generation of AMPs in innate immune responses plays a role in certain...

  7. Co-administration of plasmid expressing IL-12 with 14-kDa Schistosoma mansoni fatty acid-binding protein cDNA alters immune response profiles and fails to enhance protection induced by Sm14 DNA vaccine alone.

    Science.gov (United States)

    Fonseca, Cristina T; Pacífico, Lucila G G; Barsante, Michele M; Rassi, Tatiana; Cassali, Geovanni D; Oliveira, Sérgio C

    2006-08-01

    Schistosomiasis is an endemic disease that affects 200 million people worldwide. DNA-based vaccine is a promising strategy to induce protective immunity against schistosomiasis, since both humoral and cellular immune responses are involved in parasite elimination. In this study, we evaluated the ability of Sm14 cDNA alone or in association with a plasmid expressing murine interleukin (IL)-12 to induce protection against challenge infection. Mice were immunized with four doses of the DNA vaccine and the levels of protection were determined by worm burden recovery after challenge infection. Specific antibody production to rSm14 was determined by ELISA, and cytokine production was measured in splenocyte culture supernatants stimulated with rSm14 and in bronchoalveolar lavage of vaccinated mice after challenge infection. DNA immunization with pCI/Sm14 alone induced 40.5% of worm reduction. However, the use of pCI/IL-12 as adjuvant to pCI/Sm14 immunization failed to enhance protection against challenge infection. Protection induced by pCI/Sm14 immunization correlates with specific IgG antibody production against Sm14, Th1 type of immune response with high levels of interferon (IFN)-gamma and low levels of IL-4 in splenocyte culture supernatants and in bronchoalveolar lavage after challenge infection. IL-12 co-administration with pCI/Sm14 induced a significant production of nitric oxide in splenocyte culture supernatants and also lymphocyte suppression, with reduced percentage of T cells producing IFN-gamma and tumor necrosis factor-alpha.

  8. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans

    2017-12-01

    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  9. A virosomal formulated Her-2/neu multi-peptide vaccine induces Her-2/neu-specific immune responses in patients with metastatic breast cancer: a phase I study.

    Science.gov (United States)

    Wiedermann, Ursula; Wiltschke, C; Jasinska, J; Kundi, M; Zurbriggen, R; Garner-Spitzer, E; Bartsch, R; Steger, G; Pehamberger, H; Scheiner, O; Zielinski, C C

    2010-02-01

    We have previously shown in mice that vaccination with three Her-2-peptides representing B-cell epitopes of the extracellular domain of Her-2/neu induces Her-2/neu-specific IgG antibodies with strong anti-tumor activity in vitro and in vivo. We have now finalized a phase I clinical trial with an anti-Her-2/neu vaccine-construct of immunopotentiating reconstituted influenza virosomes with the three peptides in patients with metastatic breast cancer (MBC). Ten MBC patients with low protein overexpression of Her-2/neu of MBC (+ or ++ upon immunohistochemistry, FISH negative) and positive hormone receptor status were enrolled in a single center phase I study. The virosomal formulated vaccine, consisting of 10 microg/peptide, was intramuscularly applied three times on days 1, 28, and 56. The primary endpoint of the study, which lasted 12 weeks, was safety, the secondary endpoint immunogenicity. Local erythema at the injection site was the only vaccine-related side effect occurring in four patients. In 8 of 10 patients an increase in peptide-specific antibody titer measured by ELISA was found. Importantly, the induced antibodies were also directed against the native Her-2/neu protein. Cellular immune responses, as measured by in vitro production of IL-2, IFN-c, and TNF-a of PBMCs showed a marked increase after vaccination in the majority of vaccinees. Notably, the number of CD4+CD25+Foxp3+T regulatory cells, which were significantly increased compared to healthy controls prior to vaccination, was markedly reduced following vaccination. In all, the immunological responses after vaccination indicated that the patients in stage IV of disease were immunocompetent and susceptible to vaccination. The Her-2/neu multipeptide vaccine was safe, well tolerated and effective in overcoming immunological tolerance to Her-2/neu. The induction of anti-Her-2-specific antibodies could result in clinical benefit comparable to passive anti-Her-2 antibody therapy.

  10. 2,4-Thiazolidinedione Treatment Improves the Innate Immune Response in Dairy Goats with Induced Subclinical Mastitis

    Directory of Open Access Journals (Sweden)

    Fernanda Rosa

    2017-01-01

    Full Text Available Mastitis is a major disease in dairy cows resulting in significant economic losses. In vitro works suggest that ruminants peroxisome proliferator-activated receptor gamma (PPARγ can aid in improving the response to mastitis and can control milk fat synthesis. The objectives of the present experiment were to test if treatment with the putative PPARγ agonist 2,4-thiazolidinedione (TZD improves (1 the response to subclinical mastitis and (2 milk fat production. Lactating goats received daily injections of 8 mg/kg BW of TZD or saline for 3 weeks. After one week of TZD injection, half of the goats in each group received intramammary infusion of Strep. uberis or saline in both halves for a total of 4 groups (n=6/group. TZD treatment did not affect milk fat but had positive effect on milk somatic cells count, blood nonesterified fatty acids, inflammatory markers, and liver function. TZD significantly increased myeloperoxidase but did not affect leukocytes phagocytosis or insulin. TZD increased adipocytes size and had minor effect on expression of PPARγ target genes in mammary epithelial cells but not in adipose tissue. Overall, TZD ameliorated the response to intramammary infection but the effect on milk fat synthesis and expression of related transcripts was less than expected.

  11. The Impact of Ultraviolet Radiation on Immune Responses (invited paper)

    International Nuclear Information System (INIS)

    Norval, M.

    2000-01-01

    In addition to its genotoxic and mutagenic effects, UV has the capacity to suppress immune responses. The mechanism involved is complex, beginning with chromophores located in the skin which absorb UV, this leading in turn to changes in the production of a range of immune mediators locally and systemically which then induce phenotypic and functional alterations in antigen presentation. The cascade ends with the promotion of a subset of T-cells downregulating cell-mediated immunity. The possible consequences of this immunomodulation for the control of tumours and infectious diseases require careful evaluation from laboratory and human studies. (author)

  12. Rivastigmine alleviates experimentally induced colitis in mice and rats by acting at central and peripheral sites to modulate immune responses.

    Directory of Open Access Journals (Sweden)

    Helena Shifrin

    Full Text Available The cholinergic anti-inflammatory system and α7 nicotinic receptors in macrophages have been proposed to play a role in neuroimmunomodulation and in the etiology of ulcerative colitis. We investigated the ability of a cholinesterase (ChE inhibitor rivastigmine, to improve the pathology of ulcerative colitis by increasing the concentration of extracellular acetylcholine in the brain and periphery. In combination with carbachol (10 µM, rivastigmine (1 µM significantly decreased the release of nitric oxide, TNF-α, IL-1β and IL-6 from lipopolysaccharide-activated RAW 264.7 macrophages and this effect was abolished by α7 nicotinic receptor blockade by bungarotoxin. Rivastigmine (1 mg/kg but not (0.5 mg/kg, injected subcutaneously once daily in BALB/c mice with colitis induced by 4% dextran sodium sulphate (DSS, reduced the disease activity index (DAI by 60% and damage to colon structure. Rivastigmine (1 mg/kg also reduced myeloperoxidase activity and IL-6 by >60%, and the infiltration of CD11b expressing cells by 80%. These effects were accompanied by significantly greater ChE inhibition in cortex, brain stem, plasma and colon than that after 0.5 mg/kg. Co-administration of rivastigmine (1 mg/kg with the muscarinic antagonist scopolamine significantly increased the number of CD11b expressing cells in the colon but did not change DAI compared to those treated with rivastigmine alone. Rivastigmine 1 and 2 mg given rectally to rats with colitis induced by rectal administration of 30 mg dintrobezene sulfonic acid (DNBS also caused a dose related reduction in ChE activity in blood and colon, the number of ulcers and area of ulceration, levels of TNF-α and in MPO activity. The study revealed that the ChE inhibitor rivastigmine is able to reduce gastro-intestinal inflammation by actions at various sites at which it preserves ACh. These include ACh released from vagal nerve endings that activates alpha7 nicotinic receptors on circulating macrophages

  13. A novel vaccine p846 encoding Rv3615c, Mtb10.4, and Rv2660c elicits robust immune response and alleviates lung injury induced by Mycobacterium infection.

    Science.gov (United States)

    Kong, Hongmei; Dong, Chunsheng; Xiong, Sidong

    2014-01-01

    Development of effective anti-tuberculosis (TB) vaccines is one of the important steps to improve control of TB. Cell-mediated immune response significantly affects the control of M. tuberculosis infection. Thus, vaccines able to elicit strong cellular immune response hold special advantages against TB. In this study, three well-defined mycobacterial antigens (Rv3615c, Mtb10.4 [Rv0228], and Rv2660c) were engineered as a novel triple-antigen fusion DNA vaccine p846. The p846 vaccine consists of a high density of CD4(+) and CD8(+) T-cell epitopes. Intramuscular immunization of p846 induced robust T cells mediated immune response comparable to that of bacillus Calmette-Guérin (BCG) vaccination but more effective than that of individual antigen vaccination. After mycobacterial challenge, p846 immunization decreased bacterial burden at least 15-fold compared with individual antigen-based vaccination. Notably, the lungs of mice immunized with p846 exhibited fewer inflammatory cell infiltrates and less damage than those of control group mice. Our data demonstrate that the potential of p846 vaccine to protect against TB and the feasibility of this design strategy for further TB vaccine development.

  14. Echovirus 6 Infects Human Exocrine and Endocrine Pancreatic Cells and Induces Pro-Inflammatory Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Luis Sarmiento

    2017-01-01

    Full Text Available Human enteroviruses (HEV, especially coxsackievirus serotype B (CVB and echovirus (E, have been associated with diseases of both the exocrine and endocrine pancreas, but so far evidence on HEV infection in human pancreas has been reported only in islets and ductal cells. This study aimed to investigate the capability of echovirus strains to infect human exocrine and endocrine pancreatic cells. Infection of explanted human islets and exocrine cells with seven field strains of E6 caused cytopathic effect, virus titer increase and production of HEV protein VP1 in both cell types. Virus particles were found in islets and acinar cells infected with E6. No cytopathic effect or infectious progeny production was observed in exocrine cells exposed to the beta cell-tropic strains of E16 and E30. Endocrine cells responded to E6, E16 and E30 by upregulating the transcription of interferon-induced with helicase C domain 1 (IF1H1, 2'-5'-oligoadenylate synthetase 1 (OAS1, interferon-β (IFN-β, chemokine (C–X–C motif ligand 10 (CXCL10 and chemokine (C–C motif ligand 5 (CCL5. Echovirus 6, but not E16 or E30, led to increased transcription of these genes in exocrine cells. These data demonstrate for the first time that human exocrine cells represent a target for E6 infection and suggest that certain HEV serotypes can replicate in human pancreatic exocrine cells, while the pancreatic endocrine cells are permissive to a wider range of HEV.

  15. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...

  16. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    These findings indicate that the vaccine induced both a humoral and cellular ... Keywords: Hepatitis B virus, Plasmid DNA, Vaccine, Spleen cytokines, Humoral and cellular immune responses ... produced in mice. ... were performed and HBsAg specific IgM and IgG ..... and protection elicited against Plasmodium berghei.

  17. Gene expression profiling of Gram-negative bacteria-induced inflammation in human whole blood: The role of complement and CD14-mediated innate immune response

    Directory of Open Access Journals (Sweden)

    Corinna Lau

    2015-09-01

    Full Text Available Non-sterile pathogen-induced sepsis and sterile inflammation like in trauma or ischemia–reperfusion injury may both coincide with the life threatening systemic inflammatory response syndrome and multi-organ failure. Consequently, there is an urgent need for specific biomarkers in order to distinguish sepsis from sterile conditions. The overall aim of this study was to uncover putative sepsis biomarkers and biomarker pathways, as well as to test the efficacy of combined inhibition of innate immunity key players complement and Toll-like receptor co-receptor CD14 as a possible therapeutic regimen for sepsis. We performed whole blood gene expression analyses using microarray in order to profile Gram-negative bacteria-induced inflammatory responses in an ex vivo human whole blood model. The experiments were performed in the presence or absence of inhibitors of complement proteins (C3 and CD88 (C5a receptor 1 and CD14, alone or in combination. In addition, we used blood from a C5-deficient donor. Anti-coagulated whole blood was challenged with heat-inactivated Escherichia coli for 2 h, total RNA was isolated and microarray analyses were performed on the Affymetrix GeneChip Gene 1.0 ST Array platform. The initial experiments were performed in duplicates using blood from two healthy donors. C5-deficiency is very rare, and only one donor could be recruited. In order to increase statistical power, a technical replicate of the C5-deficient samples was run. Subsequently, log2-transformed intensities were processed by robust multichip analysis and filtered using a threshold of four. In total, 73 microarray chips were run and analyzed. The normalized and filtered raw data have been deposited in NCBI's Gene Expression Omnibus (GEO and are accessible with GEO Series accession number GSE55537. Linear models for microarray data were applied to estimate fold changes between data sets and the respective multiple testing adjusted p-values (FDR q-values. The

  18. Linear ubiquitination signals in adaptive immune responses.

    Science.gov (United States)

    Ikeda, Fumiyo

    2015-07-01

    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Cross-serotype immunity induced by immunization with a conserved rhinovirus capsid protein.

    Directory of Open Access Journals (Sweden)

    Nicholas Glanville

    Full Text Available Human rhinovirus (RV infections are the principle cause of common colds and precipitate asthma and COPD exacerbations. There is currently no RV vaccine, largely due to the existence of ∼150 strains. We aimed to define highly conserved areas of the RV proteome and test their usefulness as candidate antigens for a broadly cross-reactive vaccine, using a mouse infection model. Regions of the VP0 (VP4+VP2 capsid protein were identified as having high homology across RVs. Immunization with a recombinant VP0 combined with a Th1 promoting adjuvant induced systemic, antigen specific, cross-serotype, cellular and humoral immune responses. Similar cross-reactive responses were observed in the lungs of immunized mice after infection with heterologous RV strains. Immunization enhanced the generation of heterosubtypic neutralizing antibodies and lung memory T cells, and caused more rapid virus clearance. Conserved domains of the RV capsid therefore induce cross-reactive immune responses and represent candidates for a subunit RV vaccine.

  20. Candida albicans infection of Caenorhabditis elegans induces antifungal immune defenses.

    Directory of Open Access Journals (Sweden)

    Read Pukkila-Worley

    2011-06-01

    Full Text Available Candida albicans yeast cells are found in the intestine of most humans, yet this opportunist can invade host tissues and cause life-threatening infections in susceptible individuals. To better understand the host factors that underlie susceptibility to candidiasis, we developed a new model to study antifungal innate immunity. We demonstrate that the yeast form of C. albicans establishes an intestinal infection in Caenorhabditis elegans, whereas heat-killed yeast are avirulent. Genome-wide, transcription-profiling analysis of C. elegans infected with C. albicans yeast showed that exposure to C. albicans stimulated a rapid host response involving 313 genes (124 upregulated and 189 downregulated, ~1.6% of the genome many of which encode antimicrobial, secreted or detoxification proteins. Interestingly, the host genes affected by C. albicans exposure overlapped only to a small extent with the distinct transcriptional responses to the pathogenic bacteria Pseudomonas aeruginosa or Staphylococcus aureus, indicating that there is a high degree of immune specificity toward different bacterial species and C. albicans. Furthermore, genes induced by P. aeruginosa and S. aureus were strongly over-represented among the genes downregulated during C. albicans infection, suggesting that in response to fungal pathogens, nematodes selectively repress the transcription of antibacterial immune effectors. A similar phenomenon is well known in the plant immune response, but has not been described previously in metazoans. Finally, 56% of the genes induced by live C. albicans were also upregulated by heat-killed yeast. These data suggest that a large part of the transcriptional response to C. albicans is mediated through "pattern recognition," an ancient immune surveillance mechanism able to detect conserved microbial molecules (so-called pathogen-associated molecular patterns or PAMPs. This study provides new information on the evolution and regulation of the innate

  1. Malaria-induced immune thrombocytopenia

    DEFF Research Database (Denmark)

    Sørensen, P G; Mickley, H; Schmidt, K G

    1984-01-01

    On return from Liberia, a previously healthy 36-year-old man showed signs of malaria accompanied by severe haemolysis and slight thrombocytopenia. We found evidence of a platelet-associated IgG being responsible for the thrombocytopenia, inasmuch as the direct platelet suspension immunofluorescen...

  2. Radiation-induced effects and the immune system in cancer

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Punit; Asea, Alexzander, E-mail: aasea@msm.edu [Department of Microbiology, Biochemistry and Immunology, Morehouse School of Medicine, Atlanta, GA (United States)

    2012-12-17

    Chemotherapy and radiation therapy (RT) are standard therapeutic modalities for patients with cancers, and could induce various tumor cell death modalities, releasing tumor-derived antigens as well as danger signals that could either be captured for triggering anti-tumor immune response. Historic studies examining tissue and cellular responses to RT have predominantly focused on damage caused to proliferating malignant cells leading to their death. However, there is increasing evidence that RT also leads to significant alterations in the tumor microenvironment, particularly with respect to effects on immune cells and infiltrating tumors. This review will focus on immunologic consequences of RT and discuss the therapeutic reprogramming of immune responses in tumors and how it regulates efficacy and durability to RT.

  3. Salecan protected against concanavalin A-induced acute liver injury by modulating T cell immune responses and NMR-based metabolic profiles

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Qi; Xu, Xi, E-mail: xuxi@njust.edu.cn; Yang, Xiao; Weng, Dan; Wang, Junsong; Zhang, Jianfa

    2017-02-15

    Salecan, a water-soluble extracellular β-glucan produced by Agrobacterium sp. ZX09, has been reported to exhibit a wide range of biological effects. The aims of the present study were to investigate the protective effect of salecan against Concanavalin A (ConA)-induced hepatitis, a well-established animal model of immune-mediated liver injury, and to search for possible mechanisms. C57BL/6 mice were pretreated with salecan followed by ConA injection. Salecan treatment significantly reduced ConA-induced acute liver injury, and suppressed the expression and secretion of inflammatory cytokines including interferon (IFN)-γ, interleukin (IL)-6 and IL-1β in ConA-induced liver injury model. The high expression levels of chemokines and adhesion molecules such as MIP-1α, MIP-1β, ICAM-1, MCP-1 and RANTES in the liver induced by ConA were also down-regulated after salecan treatment. Salecan inhibited the infiltration and activation of inflammatory cells, especially T cells, in the liver induced by ConA. Moreover, salecan reversed the metabolic profiles of ConA-treated mice towards the control group by partly recovering the metabolic perturbations induced by ConA. Our results suggest the preventive and therapeutic potential of salecan in immune-mediated hepatitis. - Highlights: • Salecan treatment significantly reduced ConA-induced liver injury. • Salecan suppressed the expression and secretion of inflammatory cytokines. • Salecan decreased the expression of chemokines and adhesion molecules in liver. • Salecan inhibited the infiltration and activation of T cells induced by ConA. • Salecan partly recovered the metabolic perturbations induced by ConA.

  4. Plant innate immunity induced by flagellin suppresses the hypersensitive response in non-host plants elicited by Pseudomonas syringae pv. averrhoi.

    Directory of Open Access Journals (Sweden)

    Chia-Fong Wei

    Full Text Available A new pathogen, Pseudomonas syringae pv. averrhoi (Pav, which causes bacterial spot disease on carambola was identified in Taiwan in 1997. Many strains of this pathovar have been isolated from different locations and several varieties of hosts. Some of these strains, such as HL1, are nonmotile and elicit a strong hypersensitive response (HR in nonhost tobacco leaves, while other strains, such as PA5, are motile and elicit a weak HR. Based on the image from a transmission electron microscope, the results showed that HL1 is flagellum-deficient and PA5 has normal flagella. Here we cloned and analyzed the fliC gene and glycosylation island from Pav HL1 and PA5. The amino acid sequences of FliC from HL1 and PA5 are identical to P. s. pvs. tabaci (Pta, glycinea and phaseolicola and share very high similarity with other pathovars of P. syringae. In contrast to the flagellin mutant PtaΔfliC, PA5ΔfliC grows as well as wild type in the host plant, but it elicits stronger HR than wild type does in non-host plants. Furthermore, the purified Pav flagellin, but not the divergent flagellin from Agrobacterium tumefaciens, is able to impair the HR induced by PA5ΔfliC. PA5Δfgt1 possessing nonglycosylated flagella behaved as its wild type in both bacterial growth in host and HR elicitation. Flagellin was infiltrated into tobacco leaves either simultaneously with flagellum-deficient HL1 or prior to the inoculation of wild type HL1, and both treatments impaired the HR induced by HL1. Moreover, the HR elicited by PA5 and PA5ΔfliC was enhanced by the addition of cycloheximide, suggesting that the flagellin is one of the PAMPs (pathogen-associated molecular patterns contributed to induce the PAMP-triggered immunity (PTI. Taken together, the results shown in this study reveal that flagellin in Pav is capable of suppressing HR via PTI induction during an incompatible interaction.

  5. Plant Innate Immunity Induced by Flagellin Suppresses the Hypersensitive Response in Non-Host Plants Elicited by Pseudomonas syringae pv. averrhoi

    Science.gov (United States)

    Wei, Chia-Fong; Hsu, Shih-Tien; Deng, Wen-Ling; Wen, Yu-Der; Huang, Hsiou-Chen

    2012-01-01

    A new pathogen, Pseudomonas syringae pv. averrhoi (Pav), which causes bacterial spot disease on carambola was identified in Taiwan in 1997. Many strains of this pathovar have been isolated from different locations and several varieties of hosts. Some of these strains, such as HL1, are nonmotile and elicit a strong hypersensitive response (HR) in nonhost tobacco leaves, while other strains, such as PA5, are motile and elicit a weak HR. Based on the image from a transmission electron microscope, the results showed that HL1 is flagellum-deficient and PA5 has normal flagella. Here we cloned and analyzed the fliC gene and glycosylation island from Pav HL1 and PA5. The amino acid sequences of FliC from HL1 and PA5 are identical to P. s. pvs. tabaci (Pta), glycinea and phaseolicola and share very high similarity with other pathovars of P. syringae. In contrast to the flagellin mutant PtaΔfliC, PA5ΔfliC grows as well as wild type in the host plant, but it elicits stronger HR than wild type does in non-host plants. Furthermore, the purified Pav flagellin, but not the divergent flagellin from Agrobacterium tumefaciens, is able to impair the HR induced by PA5ΔfliC. PA5Δfgt1 possessing nonglycosylated flagella behaved as its wild type in both bacterial growth in host and HR elicitation. Flagellin was infiltrated into tobacco leaves either simultaneously with flagellum-deficient HL1 or prior to the inoculation of wild type HL1, and both treatments impaired the HR induced by HL1. Moreover, the HR elicited by PA5 and PA5ΔfliC was enhanced by the addition of cycloheximide, suggesting that the flagellin is one of the PAMPs (pathogen-associated molecular patterns) contributed to induce the PAMP-triggered immunity (PTI). Taken together, the results shown in this study reveal that flagellin in Pav is capable of suppressing HR via PTI induction during an incompatible interaction. PMID:22911741

  6. Immunomodulator-based enhancement of anti smallpox immune responses.

    Directory of Open Access Journals (Sweden)

    Osmarie Martínez

    Full Text Available The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists, and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein.We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation.The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections.These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  7. Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    Science.gov (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833

  8. Characterization of recombinant B. abortus strain RB51SOD towards understanding the uncorrelated innate and adaptive immune responses induced by RB51SOD compared to its parent vaccine strain RB51

    Directory of Open Access Journals (Sweden)

    Jianguo eZhu

    2011-11-01

    Full Text Available Brucella abortus is a Gram-negative, facultative intracellular pathogen for several mammals, including humans. Live attenuated B. abortus strain RB51 is currently the official vaccine used against bovine brucellosis in the United States and several other countries. Overexpression of protective B. abortus antigen Cu/Zn superoxide dismutase (SOD in a recombinant strain of RB51 (strain RB51SOD significantly increases its vaccine efficacy against virulent B. abortus challenge in a mouse model. An attempt has been made to better understand the mechanism of the enhanced protective immunity of RB51SOD compared to its parent strain RB51. We previously reported that RB51SOD stimulated enhanced Th1 immune response. In this study, we further found that T effector cells derived from RB51SOD-immunized mice exhibited significantly higher cytotoxic T lymphocyte (CTL activity than T effector cells derived from RB51-immunized mice against virulent B. abortus-infected target cells. Meanwhile, the macrophage responses to these two strains were also studied. Compared to RB51, RB51SOD cells had a lower survival rate in macrophages and induced lower levels of macrophage apoptosis and necrosis. The decreased survival of RB51SOD cells correlates with the higher sensitivity of RB51SOD, compared to RB51, to the bactericidal action of either Polymyxin B or sodium dodecyl sulfate (SDS. Furthermore, a physical damage to the outer membrane of RB51SOD was observed by electron microscopy. Possibly due to the physical damage, overexpressed Cu/Zn SOD in RB51SOD was found to be released into the bacterial cell culture medium. Therefore, the stronger adaptive immunity induced by RB51SOD did not correlate with the low level of innate immunity induced by RB51SOD compared to RB51. This unique and apparently contradictory profile is likely associated with the differences in outer membrane integrity and Cu/Zn SOD release.

  9. The mucosal Immune Response Induced in Chicks Immunized with LactobaciUus casei anchoring NDV HN Protein%锚定NDVHN蛋白重组干酪乳杆菌诱导雏鸡黏膜免疫应答

    Institute of Scientific and Technical Information of China (English)

    孙景秀; 王桂华; 侯喜林; 余丽芸; 田斌; 侯瑞峰; 朱娉慧; 周婷婷; 齐浩

    2012-01-01

    以干酪乳杆菌作为呈递抗原活载体,表达新城疫病毒保护性抗原HN蛋白。重组于酪乳杆菌表达外源蛋白后,经SDS-PAGE、Westernblot及间接免疫荧光分析,表明目的蛋白表达并展示到乳酸菌表面。将重组菌及空质粒菌株分别滴鼻、点眼免疫雏鸡,于不同时间检测血清样品中特异性IgG;于三免后不同时间采集雏鸡的泪液、气管洗液、胆汁和肠洗液样品,采用间接ELISA方法检测样品的特异性sIgA;用MTY法检测免疫鸡脾淋巴细胞增殖情况,结果显示重组干酪乳杆菌表达系统能刺激动物黏膜免疫反应和系统免疫反应。%Neweasfle disease virus (NDV) HN antigen was expressed by the recombinant Lactobacillus casei. The HN protein was surface-displayed on the L.casei verified by Immunofluorescence Microscopy, SDS-PAGE and Western blot. Intranasal and eye dropping immunized chicks was performed with the recombinant strain L. casei harboring pLA-HN or pLA. Specific anti-HN IgG antibody in the serum and specific anti-HN secret immunoglobulin A(sIgA) antibody in the lung and intestine fluid, tear and bile of chicken were detected by indirect ELISA.T-cell proliferation responses were investigated by MTT test. The results demonstrated that the recombinant L.casei could induce the mucosal and systemic immunity.

  10. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    Science.gov (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  11. The immune response to sand fly salivary proteins and its influence on Leishmania immunity

    Directory of Open Access Journals (Sweden)

    Regis eGomes

    2012-05-01

    Full Text Available Leishmaniasis is a vector-borne disease transmitted by bites of phlebotomine sand flies. During Leishmania transmission, sand fly saliva is co-inoculated with parasites into the skin of the mammalian host. Sand fly saliva consists of roughly thirty different salivary proteins, many with known roles linked to blood feeding facilitation. Apart from the anti-hemostatic capacity of saliva, several sand fly salivary proteins have been shown to be immunogenic upon multiple contacts with a mammalian host. Immunization with single immunogenic salivary proteins or exposure to uninfected bites can produce protective immune responses against leishmaniasis. These sand fly salivary proteins induce cellular immune responses and/or antibodies. Antibodies to saliva are not required for protection in a mouse model against leishmaniasis. A strong body of evidence points to the role for saliva-specific T cells producing IFN-γ in the form of a delayed-type hypersensitivity reaction at the bite site as the main protective response. Herein, we review immunity to sand fly salivary proteins in the context of its vector-parasite-host combinations and vaccine potential, as well as some recent advances to shed light on the mechanism of how an immune response to sand fly saliva protects against leishmaniasis.

  12. Safety and persistence of the humoral and cellular immune responses induced by 2 doses of an AS03-adjuvanted A(H1N1)pdm09 pandemic influenza vaccine administered to infants, children and adolescents: Two open, uncontrolled studies.

    Science.gov (United States)

    Garcia-Sicilia, José; Arístegui, Javier; Omeñaca, Félix; Carmona, Alfonso; Tejedor, Juan C; Merino, José M; García-Corbeira, Pilar; Walravens, Karl; Bambure, Vinod; Moris, Philippe; Caplanusi, Adrian; Gillard, Paul; Dieussaert, Ilse

    2015-01-01

    In children, 2 AS03-adjuvanted A(H1N1)pdm09 vaccine doses given 21 days apart were previously shown to induce a high humoral immune response and to have an acceptable safety profile up to 42 days following the first vaccination. Here, we analyzed the persistence data from 2 open-label studies, which assessed the safety, and humoral and cell-mediated immune responses induced by 2 doses of this vaccine. The first study was a phase II, randomized trial conducted in 104 children aged 6-35 months vaccinated with the A(H1N1)pdm09 vaccine containing 1.9 µg haemagglutinin antigen (HA) and AS03B (5.93 mg tocopherol) and the second study, a phase III, non-randomized trial conducted in 210 children and adolescents aged 3-17 years vaccinated with the A(H1N1)pdm09 vaccine containing 3.75 µg HA and AS03A (11.86 mg tocopherol). Approximately one year after the first dose, all children with available data were seropositive for haemagglutinin inhibition and neutralising antibody titres, but a decline in geometric mean antibody titres was noted. The vaccine induced a cell-mediated immune response in terms of antigen-specific CD4(+) T-cells, which persisted up to one year post-vaccination. The vaccine did not raise any safety concern, though these trials were not designed to detect rare events. In conclusion, 2 doses of the AS03-adjuvanted A(H1N1)pdm09 vaccine at 2 different dosages had a clinically acceptable safety profile, and induced high and persistent humoral and cell-mediated immune responses in children aged 6-35 months and 3-17 years. These studies have been registered at www.clinicaltrials.gov NCT00971321 and NCT00964158.

  13. [Mechanisms of retroviral immunosuppressive domain-induced immune modulation].

    Science.gov (United States)

    Blinov, V M; Krasnov, G S; Shargunov, A V; Shurdov, M A; Zverev, V V

    2013-01-01

    Immunosuppressive domains (ISD) of viral envelope glycoproteins provide highly pathogenic phenotypes of various retroviruses. ISD interaction with immune cells leads to an inhibition of a response. In the 1980s it was shown that the fragment of ISD comprising of 17 amino acids (named CKS-17) is carrying out such immune modulation. However the underlying mechanisms were not known. The years of thorough research allowed to identify the regulation of Ras-Raf-MEK-MAPK and PI3K-AKT-mTOR cellular pathways as a result of ISD interaction with immune cells. By the way, this leads to decrease of secretion of stimulatory cytokines (e.g., IL-12) and increase of inhibitory, anti-inflammatory ones (e.g., IL-10). One of the receptor tyrosine kinases inducing signal in these pathways acts as the primary target of ISD while other key regulators--cAMP and diacylglycerol (DAG), act as secondary messengers of signal transduction. Immunosuppressive-like domains can be found not only in retroviruses; the presence of ISD within Ebola viral envelope glycoproteins caused extremely hard clinical course of virus-induced hemorrhagic fever. A number of retroviral-origin fragments encoding ISD can be found in the human genome. These regions are expressed in the placenta within genes of syncytins providing a tolerance of mother's immune system to an embryo. The present review is devoted to molecular aspects of retroviral ISD-induced modulation of host immune system.

  14. Inducible immune proteins in the dampwood termite Zootermopsis angusticollis

    Science.gov (United States)

    Rosengaus, Rebeca B.; Cornelisse, Tara; Guschanski, Katerina; Traniello, James F. A.

    2007-01-01

    Dampwood termites, Zootermopsis angusticollis (Isoptera: Termopsidae), mount an immune response to resist microbial infection. Here we report on results of a novel analysis that allowed us to electrophoretically assess changes in hemolymph proteins in the same individual before and after exposure to a pathogen. We demonstrate that contact with a sublethal concentration of the entomopathogenic fungus Metarhizium anisopliae (Deuteromycotina:Hypomycetes) induces the production of protective proteins in nymphs, pseudergates (false workers), and soldiers. Termites exposed to an immunizing dosage of fungal conidia consistently showed an enhancement of constitutive proteins (62-85 kDa) in the hemolymph as well as an induction of novel proteins (28-48 kDa) relative to preimmunization levels. No significant differences in protein banding patterns relative to baseline levels in control and naïve termites were observed. Incubating excised and eluted induced proteins produced by immunized pseudergates or immunized soldiers with conidia significantly reduced the germination of the fungus. The fungistatic effect of eluted proteins differed significantly among five colonies examined. Our results show that the upregulation of protective proteins in the hemolymph underscores the in vivo immune response we previously recorded in Z. angusticollis.

  15. Bovine anaplasmosis with emphasis on immune responses and protection

    International Nuclear Information System (INIS)

    Ristic, M.

    1980-01-01

    Anaplasmosis is an infectious and transmissible disease manifested by progressive anaemia and the appearance of other characteristic disease symptoms. It is a world-wide tick-borne disease of cattle and some wild ruminants caused by the rickettsia Anaplasma marginale. By drawing on information obtained from studies of plasmodial cell cultures, a method has recently been developed for short-term in vitro cultivation of A. marginale. An attenuated Anaplasma organism capable of growth in both ovine and bovine erythrocytes was used to demonstrate that the in vitro system provided the necessary requirements for active transfer of the organism from cell to cell. Organismal antigens are found in the erythrocytes of infected animals, whereas soluble antigens are derived from their erythrocytes and serum. Serums from convalescing animals interact with these antigens in agglutination, complement fixation, fluorescent antibody and precipitation tests. Passive transfer of sera from immune to susceptible cattle, however, does not seem to confer protection against the infection and development of the disease. Studies that employed various tests for measuring cell-mediated immune (CMI) responses (leukocyte migration inhibition, blast transformation and cytotoxicity), in association with information collected simultaneously on antibody activity, have shown that both humoral and cellular immune responses are needed for the development of protective immunity in anaplasmosis. It was further shown that an active replication of Anaplasma is essential for induction of these two types of immune responses. Consequently, live virulent and attenuated immunogens fulfil requirements for induction of protective immunity. With the virulent agent, however, development of protective immunity is preceded by induction of auto-immune responses apparently associated with pathogenesis of anaemia in anaplasmosis. Inactivated immunogens derived from blood of infected cattle and used in combination with

  16. Temperature effects on vaccine induced immunity to viruses in fish

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Rasmussen, Jesper Skou

    a problem in terms of inducing a protective immune response by vaccination in aquaculture, since it is often desirable to vaccinate fish during autumn, winter, or spring. In experimental vaccination trials with rainbow trout (Oncorhynchus mykiss) using a DNA-vaccine encoding the viral glycoprotein of viral...... haemorrhagic septicaemia virus (VHSV), non-specific as well as specific immune mechanisms seemed to be delayed at low temperature. At five weeks post vaccination fish kept at 5C had no detectable response of neutralising antibodies while two thirds of the fish kept at 15C had sero-converted. While protective...... immunity was still established at both temperatures, specificity analysis suggested that protection at the lower temperature was mainly due to non-specific innate antiviral mechanisms, which appeared to last longer at low temperature. This was presumably related to a prolonged persistence of the vaccine...

  17. Stress proteins and the immune response.

    Science.gov (United States)

    Moseley, P

    2000-07-25

    The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

  18. Immune Response to Dengue and Zika.

    Science.gov (United States)

    Ngono, Annie Elong; Shresta, Sujan

    2018-04-26

    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  19. MF59- and Al(OH3-adjuvanted Staphylococcus aureus (4C-Staph vaccines induce sustained protective humoral and cellular immune responses, with a critical role for effector CD4 T cells at low antibody titers.

    Directory of Open Access Journals (Sweden)

    Elisabetta eMonaci

    2015-09-01

    Full Text Available Staphylococcus aureus (S. aureus is an important opportunistic pathogen that may cause invasive life-threatening infections like sepsis and pneumonia. Due to increasing antibiotic-resistance, the development of an effective vaccine against S. aureus is needed. Although a correlate of protection against staphylococcal diseases is not yet established, several findings suggest that both antibodies and CD4 T cells might contribute to optimal immunity. In this study, we show that adjuvanting a multivalent vaccine (4C-Staph with MF59, an oil-in-water emulsion licensed in human vaccines, further potentiated antigen-specific IgG titers and CD4 T cell responses compared to alum and conferred protection in the peritonitis model of S. aureus infection. Moreover, we showed that MF59- and alum-adjuvanted 4C-Staph vaccines induced persistent antigen-specific humoral and T cell responses, and protected mice from infection up to 4 months after immunization. Furthermore, 4C-Staph formulated with MF59 was used to investigate which immune compartment is involved in vaccine-induced protection. Using CD4 T cell-depleted mice or B cell deficient mice, we demonstrated that both T and B cell responses contributed to 4C-Staph vaccine-mediated protective immunity. However, the role of CD4 T cells seemed more evident in the presence of low antibody responses. This study provides preclinical data further supporting the use of the adjuvanted 4C-Staph vaccines against S. aureus diseases, and provides critical insights on the correlates of protective immunity necessary to combat this pathogen.

  20. Immune Response in Mussels To Environmental Pollution.

    Science.gov (United States)

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  1. Active immunization with the peptide epitope vaccine Aβ3-10-KLH induces a Th2-polarized anti-Aβ antibody response and decreases amyloid plaques in APP/PS1 transgenic mice.

    Science.gov (United States)

    Ding, Li; Meng, Yuan; Zhang, Hui-Yi; Yin, Wen-Chao; Yan, Yi; Cao, Yun-Peng

    2016-11-10

    Active amyloid-β (Aβ) immunotherapy is effective in preventing Aβ deposition, facilitating plaque clearance, and improving cognitive functions in mouse models of Alzheimer's disease (AD). Developing a safe and effective AD vaccine requires a delicate balance between inducing adequate humoral immune responses and avoiding T cell-mediated autoimmune responses. In this study, we designed 2 peptide epitope vaccines, Aβ3-10-KLH and 5Aβ3-10, prepared respectively by coupling Aβ3-10 to the immunogenic carrier protein keyhole limpet hemocyanin (KLH) or by joining 5 Aβ3-10 epitopes linearly in tandem. Young APP/PS1 mice were immunized subcutaneously with Aβ3-10-KLH or 5Aβ3-10 mixed with Freund's adjuvant, and the immunopotencies of these Aβ3-10 peptide vaccines were tested. Aβ3-10-KLH elicited a robust Th2-polarized anti-Aβ antibody response and inhibited Aβ deposition in APP/PS1 mice. However, 5Aβ3-10 did not induce an effective humoral immune response. These results indicated that Aβ3-10-KLH may be a safe and efficient vaccine for AD and that conjugating the antigen to a carrier protein may be more effective than linking multiple peptide antigens in tandem in applications for antibody production and vaccine preparation. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    Science.gov (United States)

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  3. Leptin and leptin-related gene polymorphisms, obesity, and influenza A/H1N1 vaccine-induced immune responses in older individuals.

    Science.gov (United States)

    Ovsyannikova, Inna G; White, Sarah J; Larrabee, Beth R; Grill, Diane E; Jacobson, Robert M; Poland, Gregory A

    2014-02-07

    Obesity is a risk factor for complicated influenza A/H1N1 disease and poor vaccine immunogenicity. Leptin, an adipocyte-derived hormone/cytokine, has many immune regulatory functions and therefore could explain susceptibility to infections and poor vaccine outcomes. We recruited 159 healthy adults (50-74 years old) who were immunized with inactivated TIV influenza vaccine that contained A/California/7/2009/H1N1 virus. We found a strong correlation between leptin concentration and BMI (r=0.55, pGHRL genes that were associated with leptin levels and four SNPs in the PTPN1/LEPR/STAT3 genes associated with peripheral blood TREC levels (p<0.05). Heterozygosity of the synonymous variant rs2230604 in the PTPN1 gene was associated with a significantly lower (531 vs. 259, p=0.005) TREC level, as compared to the homozygous major variant. We also found eight SNPs in the LEP/PPARG/CRP genes associated with variations in influenza-specific HAI and B-cell responses (p<0.05). Our results suggest that specific allelic variations in the leptin-related genes may influence adaptive immune responses to influenza vaccine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Adrenaline influence on the immune response. I

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.

    1981-01-01

    The intervention of adrenaline in the immunoregulation was investigated through the modification of the anti-SRBC PFC response of mice after its i.p. administration (4 μg) at various intervals before SRBC antigen. When the interval was less than 24 h, adrenaline accelerated the immune kinetics. This modification was apparent on both direct and indirect PFC, as well as on naive and immune mice. However, mice treated from 2 days showed a suppression of the response. The adrenaline affect subsisted on the adoptive response of spleen cells drug-treated either in vivo or in vitro. The mitogenic response after in vitro PHA or LPS stimulation of spleen cells from adrenaline-treated mice indicated that the T-cells were the drug target. The physiological role of the adrenaline and immunological influences of acute stress are discussed in the paper. The stress was provided by gamma irradiation. (Auth.)

  5. Humoral immune response to AAV

    Directory of Open Access Journals (Sweden)

    Roberto eCalcedo

    2013-10-01

    Full Text Available Adeno-associated virus (AAV is a member of the family parvoviridae that has been widely used as a vector for gene therapy because of its safety profile, its ability to transduce both dividing and non-dividing cells, and its low immunogenicity. AAV has been detected in many different tissues of several animal species but has not been associated with any disease. As a result of natural infections, antibodies to AAV can be found in many animals including humans. It has been shown that pre-existing AAV antibodies can modulate the safety and efficacy of AAV vector-mediated gene therapy by blocking vector transduction or by redirecting distribution of AAV vectors to tissues other than the target organ. This review will summarize antibody responses against natural AAV infections, as well as AAV gene therapy vectors and their impact in the clinical development of AAV vectors for gene therapy. We will also review and discuss the various methods used for AAV antibody detection and strategies to overcome neutralizing antibodies in AAV-mediated gene therapy.

  6. Immune Response Induced by an Immunodominant 60 kDa Glycoprotein of the Cell Wall of Sporothrix schenckii in Two Mice Strains with Experimental Sporotrichosis

    Directory of Open Access Journals (Sweden)

    Carlos A. Alba-Fierro

    2016-01-01

    Full Text Available Cell wall (CW components of fungus Sporothrix schenckii are the major inductors antigens of immune responses. The immunodominant 60 kDa glycoprotein (gp60 has been shown to be associated with the virulence of this fungus but its role in experimental sporotrichosis is unknown. In this work, the immunological effects of CW-purified gp60 were investigated in a model of experimental subcutaneous sporotrichosis in normal and gp60-preimmunized C57BL/6 and BALB/c mice strains which were then infected with S. schenckii conidia. Results showed that both mice strains use different cytokine profiles in order to fight S. schenckii infection; C57BL/6 mice seem to use a Th17 response while BALB/c mice tend to depend on a Th1 profile. Preimmunization with gp60 showed a downregulatory effect on the immune response since cytokines levels were diminished in both strains. There were no significant differences in the magnitude of dorsoplantar inflammation between gp60-preimmunized and nonimmunized mice of both strains. However, skin lesions due to the infection in gp60-preimmunized mice were more severe in BALB/c than in C57BL/6 mice, suggesting that the antigen exerts a higher downregulatory effect on the Th1 response.

  7. Immune Response Induced by an Immunodominant 60 kDa Glycoprotein of the Cell Wall of Sporothrix schenckii in Two Mice Strains with Experimental Sporotrichosis.

    Science.gov (United States)

    Alba-Fierro, Carlos A; Pérez-Torres, Armando; Toriello, Conchita; Pulido-Camarillo, Evelyn; López-Romero, Everardo; Romo-Lozano, Yolanda; Gutiérrez-Sánchez, Gerardo; Ruiz-Baca, Estela

    2016-01-01

    Cell wall (CW) components of fungus Sporothrix schenckii are the major inductors antigens of immune responses. The immunodominant 60 kDa glycoprotein (gp60) has been shown to be associated with the virulence of this fungus but its role in experimental sporotrichosis is unknown. In this work, the immunological effects of CW-purified gp60 were investigated in a model of experimental subcutaneous sporotrichosis in normal and gp60-preimmunized C57BL/6 and BALB/c mice strains which were then infected with S. schenckii conidia. Results showed that both mice strains use different cytokine profiles in order to fight S. schenckii infection; C57BL/6 mice seem to use a Th17 response while BALB/c mice tend to depend on a Th1 profile. Preimmunization with gp60 showed a downregulatory effect on the immune response since cytokines levels were diminished in both strains. There were no significant differences in the magnitude of dorsoplantar inflammation between gp60-preimmunized and nonimmunized mice of both strains. However, skin lesions due to the infection in gp60-preimmunized mice were more severe in BALB/c than in C57BL/6 mice, suggesting that the antigen exerts a higher downregulatory effect on the Th1 response.

  8. Immune Response to Lipoproteins in Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Sonia Samson

    2012-01-01

    Full Text Available Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  9. Ovine model for studying pulmonary immune responses

    International Nuclear Information System (INIS)

    Joel, D.D.; Chanana, A.D.

    1984-01-01

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with 125 I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables

  10. Ovine model for studying pulmonary immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Joel, D.D.; Chanana, A.D.

    1984-11-25

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  11. Indoleamine 2,3-dioxygenase-expressing leukemic dendritic cells impair a leukemia-specific immune response by inducing potent T regulatory cells.

    Science.gov (United States)

    Curti, Antonio; Trabanelli, Sara; Onofri, Chiara; Aluigi, Michela; Salvestrini, Valentina; Ocadlikova, Darina; Evangelisti, Cecilia; Rutella, Sergio; De Cristofaro, Raimondo; Ottaviani, Emanuela; Baccarani, Michele; Lemoli, Roberto M

    2010-12-01

    The immunoregulatory enzyme indoleamine 2,3-dioxygenase, which catalyzes the conversion of tryptophan into kynurenine, is expressed in a significant subset of patients with acute myeloid leukemia, resulting in the inhibition of T-cell proliferation and the induction of regulatory T cells. Acute myeloid leukemia cells can be differentiated into dendritic cells, which have increased immunogenicity and have been proposed as vaccines against leukemia. Leukemic dendritic cells were generated from acute myeloid leukemia cells and used as stimulators in functional assays, including the induction of regulatory T cells. Indoleamine 2,3-dioxygenase expression in leukemic dendritic cells was evaluated at molecular, protein and enzymatic levels. We demonstrate that, after differentiation into dendritic cells, both indoleamine 2,3-dioxygenase-negative and indoleamine 2,3-dioxygenase-positive acute myeloid leukemia samples show induction and up-regulation of indoleamine 2,3-dioxygenase gene and protein, respectively. Indoleamine 2,3-dioxygenase-positive acute myeloid leukemia dendritic cells catabolize tryptophan into kynurenine metabolite and inhibit T-cell proliferation through an indoleamine 2,3-dioxygenase-dependent mechanism. Moreover, indoleamine 2,3-dioxygenase-positive leukemic dendritic cells increase the number of allogeneic and autologous CD4(+)CD25(+) Foxp3(+) T cells and this effect is completely abrogated by the indoleamine 2,3-dioxygenase-inhibitor, 1-methyl tryptophan. Purified CD4(+)CD25(+) T cells obtained from co-culture with indoleamine 2,3-dioxygenase-positive leukemic dendritic cells act as regulatory T cells as they inhibit naive T-cell proliferation and impair the complete maturation of normal dendritic cells. Importantly, leukemic dendritic cell-induced regulatory T cells are capable of in vitro suppression of a leukemia-specific T cell-mediated immune response, directed against the leukemia-associated antigen, Wilms' tumor protein. These data identify

  12. The role of probiotics and prebiotics inducing gut immunity

    Directory of Open Access Journals (Sweden)

    Angelica Thomaz Vieira

    2013-12-01

    Full Text Available The gut immune system is influenced by many factors, including dietary components and commensal bacteria. Nutrients that affect gut immunity and strategies that restore a healthy gut microbial community by affecting the microbial composition are being developed as new therapeutic approaches to treat several inflammatory diseases. Although probiotics (live microorganisms and prebiotics (food components have shown promise as treatments for several diseases in both clinical and animal studies, an understanding of the molecular mechanisms behind the direct and indirect effects on the gut immune response will facilitate better and possibly more efficient therapy for diseases. In this review, we will first describe the concept of prebiotics, probiotics and symbiotics and cover the most recently well-established scientific findings regarding the direct and indirect mechanisms by which these dietary approaches can influence gut immunity. Emphasis will be placed on the relationship of diet, the microbiota and the gut immune system. Second, we will highlight recent results from our group, which suggest a new dietary manipulation that includes the use of nutrient products (organic selenium and Lithothamnium muelleri and probiotics (Saccharomyces boulardii UFMG 905 and Bifidobacterium sp. that can stimulate and manipulate the gut immune response, inducing intestinal homeostasis. Furthermore, the purpose of this review is to discuss and translate all of this knowledge into therapeutic strategies and into treatment for extra-intestinal compartment pathologies. We will conclude by discussing perspectives and molecular advances regarding the use of prebiotics or probiotics as new therapeutic strategies that manipulate the microbial composition and the gut immune responses of the host.

  13. Effect of produced water on cod (Gadus morhua) immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Hamoutene, D.; Mabrouk, G.; Samuelson, S.; Mansour, A.; Lee, K. [Fisheries and Oceans Canada, Dartmouth, NS (Canada). Maritimes Region, Ocean Sciences Division; Volkoff, H.; Parrish, C. [Memorial Univ. of Newfoundland, St. John' s, NL (Canada); Mathieu, A. [Oceans Ltd., St. John' s, NL (Canada)

    2007-07-01

    Studies have shown that produced water (PW) discharged from North Sea offshore platforms affects the biota at greater distances from operational platforms than originally presumed. According to PW dispersion simulations, dilution by at least 240 times occurs within 50-100 m, and up to 9000 times by 20 km from the discharge. In this study, the effect of PW on cod immunity was investigated by exposing fish to 0, 100 ppm (x 10,000 dilution) or 200 ppm (x 500) of PW for 76 days. Immune responses were evaluated at the end of the exposure. Fish from the 3 groups were injected with Aeromonas salmonicida lipopolysaccharides (LPS). Blood cell observation and flow cytometry were used to investigate the serum cortisol levels and gill histology along with ratios and respiratory burst (RB) responses of both circulating and head-kidney white blood cells (WBCs). The study revealed that baseline immunity and stress response were not affected by PW, other than an irritant-induced change in gill cells found in treated cod. In all groups, LPS injection resulted in a pronounced decrease in RB of head-kidney cells and an increase in serum cortisol and protein levels. However, the group exposed to 200 ppm of PW exhibited the most significant changes. LPS injection was also shown to influence WBC ratios, but further studies are needed to determine if this impact is stronger in fish exposed to PW. This study suggested an effect of PW on cod immunity after immune challenge with LPS.

  14. Cofactor Independent Phosphoglycerate Mutase of Brugia malayi Induces a Mixed Th1/Th2 Type Immune Response and Inhibits Larval Development in the Host

    Directory of Open Access Journals (Sweden)

    Prashant K. Singh

    2014-01-01

    Full Text Available Lymphatic filariasis is a major debilitating disease, endemic in 72 countries putting more than 1.39 billion people at risk and 120 million are already infected. Despite the significant progress in chemotherapeutic advancements, there is still need for other measures like development of an effective vaccine or discovery of novel drug targets. In this study, structural and immunological characterization of independent phosphoglycerate mutase of filarial parasite Brugia malayi was carried out. Protein was found to be expressed in all major parasite life stages and as an excretory secretory product of adult parasites. Bm-iPGM also reacted to all the categories of human bancroftian patient’s sera including endemic normals. In vivo immunological behaviour of protein was determined in immunized BALB/c mice followed by prophylactic analysis in BALB/c mice and Mastomys coucha. Immunization with Bm-iPGM led to generation of a mixed Th1/Th2 type immune response offering 58.2% protection against larval challenge in BALB/c and 65–68% protection in M. coucha. In vitro studies confirmed participation of anti-Bm-iPGM antibodies in killing of B. malayi infective larvae and microfilariae through ADCC mechanism. The present findings reveal potential immunoprotective nature of Bm-iPGM advocating its worth as an antifilarial vaccine candidate.

  15. Epicutaneous Immunization with Type II Collagen Inhibits both Onset and Progression of Chronic Collagen-Induced Arthritis

    OpenAIRE

    Strid, Jessica; Tan, Lee Aun; Strobel, Stephan; Londei, Marco; Callard, Robin

    2007-01-01

    Epicutaneous immunization is a potential non-invasive technique for antigen-specific immune-modulation. Topical application of protein antigens to barrier-disrupted skin induces potent antigen-specific immunity with a strong Th2-bias. In this study, we investigate whether the autoimmune inflammatory response of chronic collagen-induced arthritis (CCIA) in DBA/1-TCR-beta Tg mice can be modified by epicutaneous immunization. We show that epicutaneous immunization with type II collagen (CII) inh...

  16. Enhanced mucosal immune responses induced by a combined candidate mucosal vaccine based on Hepatitis A virus and Hepatitis E virus structural proteins linked to tuftsin.

    Science.gov (United States)

    Gao, Yan; Su, Qiudong; Yi, Yao; Jia, Zhiyuan; Wang, Hao; Lu, Xuexin; Qiu, Feng; Bi, Shengli

    2015-01-01

    Hepatitis A virus (HAV) and Hepatitis E virus (HEV) are the most common causes of infectious hepatitis. These viruses are spread largely by the fecal-oral route and lead to clinically important disease in developing countries. To evaluate the potential of targeting hepatitis A and E infection simultaneously, a combined mucosal candidate vaccine was developed with the partial open reading frame 2 (ORF2) sequence (aa 368-607) of HEV (HE-ORF2) and partial virus protein 1 (VP1) sequence (aa 1-198) of HAV (HA-VP1), which included the viral neutralization epitopes. Tuftsin is an immunostimulatory peptide which can enhance the immunogenicity of a protein by targeting it to macrophages and dendritic cells. Here, we developed a novel combined protein vaccine by conjugating tuftsin to HE-ORF2 and HA-VP1 and used synthetic CpG oligodeoxynucleotides (ODNs) as the adjuvant. Subsequent experiments in BALB/c mice demonstrated that tuftsin enhanced the serum-specific IgG and IgA antibodies against HEV and HAV at the intestinal, vaginal and pulmonary interface when delivered intranasally. Moreover, mice from the intranasally immunized tuftsin group (HE-ORF2-tuftsin + HA-VP1-tuftsin + CpG) showed higher levels of IFN-γ-secreting splenocytes (Th1 response) and ratio of CD4+/CD8+ T cells than those of the no-tuftsin group (HE-ORF2 + HA-VP1 + CpG). Thus, the tuftsin group generated stronger humoral and cellular immune responses compared with the no-tuftsin group. Moreover, enhanced responses to the combined protein vaccine were obtained by intranasal immunization compared with intramuscular injection. By integrating HE-ORF2, HA-VP1 and tuftsin in a vaccine, this study validated an important concept for further development of a combined mucosal vaccine against hepatitis A and E infection.

  17. Vaccination of pigs with attenuated Lawsonia intracellularis induced acute phase protein responses and primed cell-mediated immunity without reduction in bacterial shedding after challenge

    DEFF Research Database (Denmark)

    Riber, Ulla; Heegaard, Peter M. H.; Hvass, Henriette Cordes

    2015-01-01

    achievedby this vaccine. We therefore undertook a detailed characterization of immune responses to L. intracel-lularis infection in vaccinated pigs (VAC) compared to previously infected pigs (RE) in order to pinpointimmunological determinants of protection.Results: The VAC pigs shed L. intracellularis......nomically important diseases in modern pig production worldwide. The Enterisol®Ileitis vaccine havebeen shown to reduce clinical disease and to increase weight gain, however, while the natural infectionwith L. intracellularis can provide complete protection against re-infection, this has not been...... response was diminished and L. intracellularis specific IgG responseswere delayed and reduced compared to non-vaccinated pigs. On the other hand L. intracellularis specificIFN- responses tended to develop faster in the VAC group compared to controls.Conclusion: Although vaccinated and non-vaccinated pigs...

  18. The host immune response to Clostridium difficile infection

    Science.gov (United States)

    2013-01-01

    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  19. The immune system strikes back: cellular immune responses against indoleamine 2,3-dioxygenase

    DEFF Research Database (Denmark)

    Sørensen, Rikke Baek; Berge-Hansen, Linda; Junker, Niels

    2009-01-01

    BACKGROUND: The enzyme indoleamine 2,3-dioxygenase (IDO) exerts an well established immunosuppressive function in cancer. IDO is expressed within the tumor itself as well as in antigen-presenting cells in tumor-draining lymph nodes, where it promotes the establishment of peripheral immune tolerance...... to tumor antigens. In the present study, we tested the notion whether IDO itself may be subject to immune responses. METHODS AND FINDINGS: The presence of naturally occurring IDO-specific CD8 T cells in cancer patients was determined by MHC/peptide stainings as well as ELISPOT. Antigen specific cytotoxic T...... of the major immune suppressive cell populations. CONCLUSION: IDO may serve as an important and widely applicable target for anti-cancer immunotherapeutic strategies. Furthermore, as emerging evidence suggests that IDO constitutes a significant counter-regulatory mechanism induced by pro-inflammatory signals...

  20. Multiscale modeling of mucosal immune responses

    Science.gov (United States)

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  1. Multiscale modeling of mucosal immune responses.

    Science.gov (United States)

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  2. Salmonella enterica Induces And Subverts The Plant Immune System

    Directory of Open Access Journals (Sweden)

    Ana Victoria Garcia

    2014-04-01

    Full Text Available Infections with Salmonella enterica belong to the most prominent causes of food poisoning and infected fruits and vegetables represent important vectors for salmonellosis. Whereas it was shown that plants raise defense responses against Salmonella, these bacteria persist and proliferate in various plant tissues. Recent reports shed light into the molecular interaction between plants and Salmonella, highlighting the defense pathways induced and the means used by the bacteria to escape the plant immune system and accomplish colonization. It was recently shown that plants detect Salmonella pathogen-associated molecular patterns (PAMPs, such as the flagellin peptide flg22, and activate hallmarks of the defense program known as PAMP-triggered immunity (PTI. Interestingly, certain Salmonella strains carry mutations in the flg22 domain triggering PTI, suggesting that a strategy of Salmonella is to escape plant detection by mutating PAMP motifs. Another strategy may rely on the type III secretion system (T3SS as T3SS mutants were found to induce stronger plant defense responses than wild type bacteria. Although Salmonella effector delivery into plant cells has not been shown, expression of Salmonella effectors in plant tissues shows that these bacteria also possess powerful means to manipulate the plant immune system. Altogether, the data gathered suggest that Salmonella triggers PTI in plants and evolved strategies to avoid or subvert plant immunity.

  3. Salmonella enterica induces and subverts the plant immune system

    KAUST Repository

    García, Ana V.

    2014-04-04

    Infections with Salmonella enterica belong to the most prominent causes of food poisoning and infected fruits and vegetables represent important vectors for salmonellosis. Although it was shown that plants raise defense responses against Salmonella, these bacteria persist and proliferate in various plant tissues. Recent reports shed light into the molecular interaction between plants and Salmonella, highlighting the defense pathways induced and the means used by the bacteria to escape the plant immune system and accomplish colonization. It was recently shown that plants detect Salmonella pathogen-associated molecular patterns (PAMPs), such as the flagellin peptide flg22, and activate hallmarks of the defense program known as PAMP-triggered immunity (PTI). Interestingly, certain Salmonella strains carry mutations in the flg22 domain triggering PTI, suggesting that a strategy of Salmonella is to escape plant detection by mutating PAMP motifs. Another strategy may rely on the type III secretion system (T3SS) as T3SS mutants were found to induce stronger plant defense responses than wild type bacteria. Although Salmonella effector delivery into plant cells has not been shown, expression of Salmonella effectors in plant tissues shows that these bacteria also possess powerful means to manipulate the plant immune system. Altogether, these data suggest that Salmonella triggers PTI in plants and evolved strategies to avoid or subvert plant immunity. 2014 Garca and Hirt.

  4. Quantitating cellular immune responses to cancer vaccines.

    Science.gov (United States)

    Lyerly, H Kim

    2003-06-01

    While the future of immunotherapy in the treatment of cancer is promising, it is difficult to compare the various approaches because monitoring assays have not been standardized in approach or technique. Common assays for measuring the immune response need to be established so that these assays can one day serve as surrogate markers for clinical response. Assays that accurately detect and quantitate T-cell-mediated, antigen-specific immune responses are particularly desired. However, to date, increases in the number of cytotoxic T cells through immunization have not been correlated with clinical tumor regression. Ideally, then, a T-cell assay not only needs to be sensitive, specific, reliable, reproducible, simple, and quick to perform, it must also demonstrate close correlation with clinical outcome. Assays currently used to measure T-cell response are delayed-type hypersensitivity testing, flow cytometry using peptide major histocompatibility complex tetramers, lymphoproliferation assay, enzyme-linked immunosorbant assay, enzyme-linked immunospot assay, cytokine flow cytometry, direct cytotoxicity assay, measurement of cytokine mRNA by quantitative reverse transcriptase polymerase chain reaction, and limiting dilution analysis. The purpose of this review is to describe the attributes of each test and compare their advantages and disadvantages.

  5. Flavobacterium psychrophilum - Experimental challenge and immune response

    DEFF Research Database (Denmark)

    Henriksen, Maya Maria Mihályi

    the immune system of the fry is not fully developed. Theoretically, the infection pressure could be subdued by vaccinating larger fish, but no commercial vaccine is yet available. Diagnostic methods are well described and the disease is treated with antibiotics. To prevent disease outbreaks and subsequent......-time PCR (RT-PCR) was used to examine the immune response in the head kidney during the first eight days after infection, and enzyme-linked immunosorbent assay (ELISA) was used to evaluate the production of antibodies 50 days post-exposure. A pro-inflammatory response was observed in both groups infected...... of edemas, but in both cases the tissue was regenerating after 192 hours. However, when the fish had been exposed to both H2O2 and F. psychrophilum, the damage was still evident at this time point. The relative pathogen load measured as 16S rRNA was highest at the first sampling and decreased steadily...

  6. Structure-based stabilization of HIV-1 gp120 enhances humoral immune responses to the induced co-receptor binding site.

    Directory of Open Access Journals (Sweden)

    Barna Dey

    2009-05-01

    Full Text Available The human immunodeficiency virus type 1 (HIV-1 exterior envelope glycoprotein, gp120, possesses conserved binding sites for interaction with the primary virus receptor, CD4, and also for the co-receptor, generally CCR5. Although gp120 is a major target for virus-specific neutralizing antibodies, the gp120 variable elements and its malleable nature contribute to evasion of effective host-neutralizing antibodies. To understand the conformational character and immunogenicity of the gp120 receptor binding sites as potential vaccine targets, we introduced structure-based modifications to stabilize gp120 core proteins (deleted of the gp120 major variable regions into the conformation recognized by both receptors. Thermodynamic analysis of the re-engineered core with selected ligands revealed significant stabilization of the receptor-binding regions. Stabilization of the co-receptor-binding region was associated with a marked increase in on-rate of ligand binding to this site as determined by surface plasmon resonance. Rabbit immunization studies showed that the conformational stabilization of core proteins, along with increased ligand affinity, was associated with strikingly enhanced humoral immune responses against the co-receptor-binding site. These results demonstrate that structure-based approaches can be exploited to stabilize a conformational site in a large functional protein to enhance immunogenic responses specific for that region.

  7. Protein-coated nanoparticles are internalized by the epithelial cells of the female reproductive tract and induce systemic and mucosal immune responses.

    Directory of Open Access Journals (Sweden)

    Savannah E Howe

    Full Text Available The female reproductive tract (FRT includes the oviducts (fallopian tubes, uterus, cervix and vagina. A layer of columnar epithelium separates the endocervix and uterus from the outside environment, while the vagina is lined with stratified squamous epithelium. The mucosa of the FRT is exposed to antigens originating from microflora, and occasionally from infectious microorganisms. Whether epithelial cells (ECs of the FRT take up (sample the lumen antigens is not known. To address this question, we examined the uptake of 20-40 nm nanoparticles (NPs applied vaginally to mice which were not treated with hormones, epithelial disruptors, or adjuvants. We found that 20 and 40 nm NPs are quickly internalized by ECs of the upper FRT and within one hour could be observed in the lymphatic ducts that drain the FRT, as well as in the ileac lymph nodes (ILNs and the mesenteric lymph nodes (MLNs. Chicken ovalbumin (Ova conjugated to 20 nm NPs (NP-Ova when administered vaginally reaches the internal milieu in an immunologically relevant form; thus vaginal immunization of mice with NP-Ova induces systemic IgG to Ova antigen. Most importantly, vaginal immunization primes the intestinal mucosa for secretion of sIgA. Sub-cutaneous (s.c boosting immunization with Ova in complete Freund's adjuvant (CFA further elevates the systemic (IgG1 and IgG2c as well as mucosal (IgG1 and sIgA antibody titers. These findings suggest that the modes of antigen uptake at mucosal surfaces and pathways of antigen transport are more complex than previously appreciated.

  8. Induced immune response of Escherichia coli BL21 expressing recombinant MSP1a and MSP1b proteins of Anaplasma marginale

    Directory of Open Access Journals (Sweden)

    Katia Tamekuni

    2009-11-01

    Full Text Available This work aims to evaluate the potential of immunization with E. coli BL21 expressing the recombinant rMSP1a and rMSP1b proteins of Anaplasma marginale. E. coli BL21 was transformed with recombinant plasmids pET102/msp1α and pET101/msp1β, and rMSP1a and rMSP1b were expressed after induction by IPTG. BALB/c mice were vaccinated with formolized BL21/rMSP1a and BL21/rMSP1b, and the production in mice sera of whole IgG was determined by ELISA. The mice immunized with BL21/rMSP1a showed a better humoral response for whole IgG when compared to the mice immunized with BL21/rMSP1b; these mice exhibited a small response after the second vaccination. Sera of mice immunized with BL21/rMSP1a reacted via western blot with BL21 and rMSP1a, with molecular masses varying from 70 to 105 kDa. Sera of mice immunized with BL21/rMSP1b reacted with BL21 and rMSP1b with a molecular mass of 100 kDa. These results demonstrate that BL21 containing rMSP1a and rMSP1b in the outer membrane were able to produce an immune response in mice, reinforcing its use in vaccine models against bovine anaplasmosis.Esse trabalho avaliou o potencial de imunização de Escherichia coli BL21 expressando as proteínas recombinantes rMSP1a e rMSP1b de Anaplasma marginale. A E. coli BL21 foi transformada com os plasmídios recombinantes pET102/msp1α e pET101/msp1β e as proteínas rMSP1a e rMSP1b foram expressas após indução com IPTG. Camundongos BALB/c foram vacinados com BL21/rMSP1a e BL21/rMSP1b formolisadas, e a produção de IgG total foi determinada pelo teste de ELISA nos soros dos camundongos imunizados. Os camundongos imunizados com a BL21/rMSP1a mostraram uma melhor resposta humoral para IgG total, comparada à resposta apresentada pelos camundongos imunizados com BL21/rMSP1b; estes camundongos exibiram uma menor resposta após a segunda vacinação. Soros de camundongos imunizados BL21/rMSP1a reagiram pelo western blot com BL21 e rMSP1a, com massa molecular variando de 70 a

  9. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

    Science.gov (United States)

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

    2015-03-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Directory of Open Access Journals (Sweden)

    Paola Di Meglio

    2011-02-01

    Full Text Available IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A and common (G allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  11. The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

    Science.gov (United States)

    Di Meglio, Paola; Di Cesare, Antonella; Laggner, Ute; Chu, Chung-Ching; Napolitano, Luca; Villanova, Federica; Tosi, Isabella; Capon, Francesca; Trembath, Richard C; Peris, Ketty; Nestle, Frank O

    2011-02-22

    IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A) and common (G) allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

  12. Allergen-induced activation of natural killer cells represents an early-life immune response in the development of allergic asthma.

    Science.gov (United States)

    Altman, Matthew C; Whalen, Elizabeth; Togias, Alkis; O'Connor, George T; Bacharier, Leonard B; Bloomberg, Gordon R; Kattan, Meyer; Wood, Robert A; Presnell, Scott; LeBeau, Petra; Jaffee, Katy; Visness, Cynthia M; Busse, William W; Gern, James E

    2018-03-05

    Childhood asthma in inner-city populations is a major public health burden, and understanding early-life immune mechanisms that promote asthma onset is key to disease prevention. Children with asthma demonstrate a high prevalence of aeroallergen sensitization and T H 2-type inflammation; however, the early-life immune events that lead to T H 2 skewing and disease development are unknown. We sought to use RNA sequencing of PBMCs collected at age 2 years to determine networks of immune responses that occur in children with allergy and asthma. In an inner-city birth cohort with high asthma risk, we compared gene expression using RNA sequencing in PBMCs collected at age 2 years between children with 2 or more aeroallergen sensitizations, including dust mite, cockroach, or both, by age 3 years and asthma by age 7 years (cases) and matched control subjects who did not have any aeroallergen sensitization or asthma by age 7 years. PBMCs from the cases showed higher levels of expression of natural killer (NK) cell-related genes. After cockroach or dust mite allergen but not tetanus antigen stimulation, PBMCs from the cases compared with the control subjects showed differential expression of 244 genes. This gene set included upregulation of a densely interconnected NK cell-like gene network reflecting a pattern of cell activation and induction of inflammatory signaling molecules, including the key T H 2-type cytokines IL9, IL13, and CCL17, as well as a dendritic cell-like gene network, including upregulation of CD1 lipid antigen presentation molecules. The NK cell-like response was reproducible in an independent group of children with later-onset allergic sensitization and asthma and was found to be specific to only those children with both aeroallergen sensitization and asthma. These findings provide important mechanistic insight into an early-life immune pathway involved in T H 2 polarization, leading to the development of allergic asthma. Copyright © 2018 American

  13. Comparison of immune responses against foot-and-mouth disease virus induced by fusion proteins using the swine IgG heavy chain constant region or β-galactosidase as a carrier of immunogenic epitopes

    International Nuclear Information System (INIS)

    Li Guangjin; Chen Weizao; Yan Weiyao; Zhao Kai; Liu Mingqiu; Zhang Jun; Fei Liang; Xu Quanxing; Sheng Zutian; Lu Yonggan; Zheng Zhaoxin

    2004-01-01

    Previously, we demonstrated that a fusion protein (Gal-FMDV) consisting of β-galactosidase and an immunogenic peptide, amino acids (141-160)-(21-40)-(141-160), of foot-and-mouth disease virus (FMDV) VP1 protein induced protective immune responses in guinea pigs and swine. We now designed a new potential recombinant protein vaccine against FMDV in swine. The immunogenic peptide, amino acids (141-160)-(21-40)-(141-160) from the VP1 protein of serotype O FMDV, was fused to the carboxy terminus of a swine immunoglobulin G single heavy chain constant region and expressed in Escherichia coli. The expressed fusion protein (IgG-FMDV) was purified and emulsified with oil adjuvant. Vaccination twice at an interval of 3 weeks with the emulsified IgG-FMDV fusion protein induced an FMDV-specific spleen proliferative T-cell response in guinea pigs and elicited high levels of neutralizing antibody in guinea pigs and swine. All of the immunized animals were efficiently protected against FMDV challenge. There was no significant difference between IgG-FMDV and Gal-FMDV in eliciting immunity after vaccination twice in swine. However, when evaluating the efficacy of a single inoculation of the fusion proteins, we found that IgG-FMDV could elicit a protective immune response in swine, while Gal-FMDV only elicited a weak neutralizing activity and could not protect the swine against FMDV challenge. Our results suggest that the IgG-FMDV fusion protein is a promising vaccine candidate for FMD in swine

  14. Cocoa Diet and Antibody Immune Response in Preclinical Studies

    Directory of Open Access Journals (Sweden)

    Mariona Camps-Bossacoma

    2017-06-01

    Full Text Available The ability of cocoa to interact with the immune system in vitro and in vivo has been described. In the latter context, a cocoa-enriched diet in healthy rats was able to modify the immune system’s functionality. This fact could be observed in the composition and functionality of lymphoid tissues, such as the thymus, spleen, and lymph nodes. Consequently, immune effector mechanisms, such as antibody synthesis, were modified. A cocoa-enriched diet in young rats was able to attenuate the serum levels of immunoglobulin (Ig G, IgM, and IgA and also the intestinal IgM and IgA secretion. Moreover, in immunized rats, the intake of cocoa decreased specific IgG1, IgG2a, IgG2c, and IgM concentrations in serum. This immune-regulator potential was then tested in disease models in which antibodies play a pathogenic role. A cocoa-enriched diet was able to partially prevent the synthesis of autoantibodies in a model of autoimmune arthritis in rats and was also able to protect against IgE and T helper 2-related antibody synthesis in two rat models of allergy. Likewise, a cocoa-enriched diet prevented an oral sensitization process in young rats. In this review, we will focus on the influence of cocoa on the acquired branch of the immune function. Therefore, we will focus on how a cocoa diet influences lymphocyte function both in the systemic and intestinal immune system. Likewise, its potential role in preventing some antibody-induced immune diseases is also included. Although further studies must characterize the particular cocoa components responsible for such effects and nutritional studies in humans need to be carried out, cocoa has potential as a nutraceutical agent in some hypersensitivity status.

  15. Alternative inactivated poliovirus vaccines adjuvanted with Quillaja brasiliensis or Quil-a saponins are equally effective in inducing specific immune responses.

    Directory of Open Access Journals (Sweden)

    Fernanda de Costa

    Full Text Available Inactivated polio vaccines (IPV have an important role at the final stages of poliomyelitis eradication programs, reducing the risks associated with the use of attenuated polio vaccine (OPV. An affordable option to enhance vaccine immunogenicity and reduce costs of IPV may be the use of an effective and renewable adjuvant. In the present study, the adjuvant activity of aqueous extract (AE and saponin fraction QB-90 from Quillaja brasiliensis using poliovirus antigen as model were analyzed and compared to a preparation adjuvanted with Quil-A, a well-known saponin-based commercial adjuvant. Experimental vaccines were prepared with viral antigen plus saline (control, Quil-A (50 µg, AE (400 µg or QB-90 (50 µg. Sera from inoculated mice were collected at days 0, 28, 42 and 56 post-inoculation of the first dose of vaccine. Serum levels of specific IgG, IgG1 and IgG2a were significantly enhanced by AE, QB-90 and Quil-A compared to control group on day 56. The magnitude of enhancement was statistically equivalent for QB-90 and Quil-A. The cellular response was evaluated through DTH and analysis of IFN-γ and IL-2 mRNA levels using in vitro reestimulated splenocytes. Results indicated that AE and QB-90 were capable of stimulating the generation of Th1 cells against the administered antigen to the same extent as Quil-A. Mucosal immune response was enhanced by the vaccine adjuvanted with QB-90 as demonstrated by increases of specific IgA titers in bile, feces and vaginal washings, yielding comparable or higher titers than Quil-A. The results obtained indicate that saponins from Q. brasiliensis are potent adjuvants of specific cellular and humoral immune responses and represent a viable option to Quil-A.

  16. Flagella-induced immunity against experimental cholera in adult rabbits.

    Science.gov (United States)

    Yancey, R J; Willis, D L; Berry, L J

    1979-07-01

    The adult rabbit ligated ileal loop model was used to evaluate the prophylactic potential of a crude flagellar (CF) vaccine produced from the classical. Inaba strain CA401. A greater than 1,000-fold increase in the challenge inoculum was required to induce an intestinal fluid response in actively immunized adult rabbits equivalent to that produced in unimmunized animals. Similar protection was afforded against challenge with classical and El Tor biotypes of both Inaba and Ogawa serotypes. Highly virulent 35S-labeled vibrios were inhibited in their ability to associated with the intestinal mucosa of CF-immunized rabbits. The protection conferred by CF immunization was found to be superior to that of a commercial bivalent vaccine and also to that of glutaraldehyde-treated cholera toxoid. The critical immunogenic component of CF appears to be a flagella-derived protein. The immunogenicity of CF was destroyed by heat treatment, and absorption of CF-immune serum with aflagellated mutant vibrios did not diminish its ability to confer a high level of passive protection. The intestinal protection of CF-immunized rabbits was completely reversed by the introduction of both goat anti-rabbit immunoglobulins A and G, but by neither alone.

  17. Inflammation and Immune Response in COPD: Where Do We Stand?

    Directory of Open Access Journals (Sweden)

    Nikoletta Rovina

    2013-01-01

    Full Text Available Increasing evidence indicates that chronic inflammatory and immune responses play key roles in the development and progression of COPD. Recent data provide evidence for a role in the NLRP3 inflammasome in the airway inflammation observed in COPD. Cigarette smoke activates innate immune cells by triggering pattern recognition receptors (PRRs to release “danger signal”. These signals act as ligands to Toll-like receptors (TLRs, triggering the production of cytokines and inducing innate inflammation. In smokers who develop COPD there appears to be a specific pattern of inflammation in the airways and parenchyma as a result of both innate and adaptive immune responses, with the predominance of CD8+ and CD4+ cells, and in the more severe disease, with the presence of lymphoid follicles containing B lymphocytes and T cells. Furthermore, viral and bacterial infections interfere with the chronic inflammation seen in stable COPD and exacerbations via pathogen-associated molecular patterns (PAMPs. Finally, autoimmunity is another novel aspect that may play a critical role in the pathogenesis of COPD. This review is un update of the currently discussed roles of inflammatory and immune responses in the pathogenesis of COPD.

  18. Plasma metabolomic profiles and immune responses of piglets after weaning and challenge with E. coli

    DEFF Research Database (Denmark)

    Sugiharto, Sugiharto; Hedemann, Mette Skou; Lauridsen, Charlotte

    2014-01-01

    Background The processes of weaning and exposure to pathogenic bacteria induce stress responses, which may alter the metabolism. In this study, we investigated the changes in plasma metabolites and immune responses in piglets in response to the stress induced by weaning and Escherichia coli chall...

  19. Immune Response among Patients Exposed to Molds

    Directory of Open Access Journals (Sweden)

    Jordan N. Fink

    2009-12-01

    Full Text Available Macrocyclic trichothecenes, mycotoxins produced by Stachybotrys chartarum, have been implicated in adverse reactions in individuals exposed to mold-contaminated environments. Cellular and humoral immune responses and the presence of trichothecenes were evaluated in patients with mold-related health complaints. Patients underwent history, physical examination, skin prick/puncture tests with mold extracts, immunological evaluations and their sera were analyzed for trichothecenes. T-cell proliferation, macrocyclic trichothecenes, and mold specific IgG and IgA levels were not significantly different than controls; however 70% of the patients had positive skin tests to molds. Thus, IgE mediated or other non-immune mechanisms could be the cause of their symptoms.

  20. Manipulations of the immune response in the chicken

    International Nuclear Information System (INIS)

    Bixler, G.S. Jr.

    1978-01-01

    The chicken with its dissociation of immune responses in cell-mediated immunity, dependent on the thymus, and humoral immunity, dependent on the bursa of Fabricius, provides a unique model for studying the two components of the immune system. While there are methods of obtaining selective, profound deficiency of humoral immunity, in this species, methods for obtaining a consistent, profound selective deficiency of cell-mediated immunity have been lacking. Oxisuran, 2[(methylsulfinyl)acetal] pyridine, has been reported to have the unique ability to differentially suppress cell-mediated immunity in several species of mammals without a concomitant reduction in antibody forming capacity. The effect of this compound on two parameters of cell-mediated immune responses in chickens was investigated. In further attempts to create a deficiency of both cell-mediated and humoral immunity, the effects of a combination of cyclophosphamide treatment and x-irradiation early in life on immune responses were studied

  1. A specific primed immune response in Drosophila is dependent on phagocytes.

    Directory of Open Access Journals (Sweden)

    Linh N Pham

    2007-03-01

    Full Text Available Drosophila melanogaster, like other invertebrates, relies solely on its innate immune response to fight invading microbes; by definition, innate immunity lacks adaptive characteristics. However, we show here that priming Drosophila with a sublethal dose of Streptococcus pneumoniae protects against an otherwise-lethal second challenge of S. pneumoniae. This protective effect exhibits coarse specificity for S. pneumoniae and persists for the life of the fly. Although not all microbial challenges induced this specific primed response, we find that a similar specific protection can be elicited by Beauveria bassiana, a natural fly pathogen. To characterize this primed response, we focused on S. pneumoniae-induced protection. The mechanism underlying this protective effect requires phagocytes and the Toll pathway. However, activation of the Toll pathway is not sufficient for priming-induced protection. This work contradicts the paradigm that insect immune responses cannot adapt and will promote the search for similar responses overlooked in organisms with an adaptive immune response.

  2. Immunization of chickens with an agonistic monoclonal anti-chicken CD40 antibody-hapten complex: rapid and robust IgG response induced by a single subcutaneous injection.

    Science.gov (United States)

    Chen, Chang-Hsin; Abi-Ghanem, Daad; Waghela, Suryakant D; Chou, Wen-Ko; Farnell, Morgan B; Mwangi, Waithaka; Berghman, Luc R

    2012-04-30

    Producing diagnostic antibodies in chicken egg yolk represents an alternate animal system that offers many advantages including high productivity at low cost. Despite being an excellent counterpart to mammalian antibodies, chicken IgG from yolk still represents an underused resource. The potential of agonistic monoclonal anti-CD40 antibodies (mAb) as a powerful immunological adjuvant has been demonstrated in mammals, but not in chickens. We recently reported an agonistic anti-chicken CD40 mAb (designated mAb 2C5) and showed that it may have potential as an immunological adjuvant. In this study, we examined the efficacy of targeting a short peptide to chicken CD40 [expressed by the antigen-presenting cells (APCs)] in enhancing an effective IgG response in chickens. For this purpose, an immune complex consisting of one streptavidin molecule, two directionally biotinylated mAb 2C5 molecules, and two biotinylated peptide molecules was produced. Chickens were immunized subcutaneously with doses of this complex ranging from 10 to 90 μg per injection once, and relative quantification of the peptide-specific IgG response showed that the mAb 2C5-based complex was able to elicit a strong IgG response as early as four days post-immunization. This demonstrates that CD40-targeting antigen to chicken APCs can significantly enhance antibody responses and induce immunoglobulin isotype-switching. This immunization strategy holds promise for rapid production of hapten-specific IgG in chickens. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Effect of oral administration of Lactobacillus paracasei L9 on mouse systemic immunity and the immune response in the intestine

    Directory of Open Access Journals (Sweden)

    Zhu Yuanbo

    2016-01-01

    Full Text Available A probiotic strain Lactobacillus paracasei L9,which was isolated from human intestine, was investigated for its immunomodulatory activity in vivo. Results showed that L9 improved systemic immunity by enhancing the phagocytic activity of peritoneal macrophages, the proliferation ratio of splenocytes, the IgG level in the serum and the level of IgA in the mucosa. Further, L9induced theTh1-polarized immune response by elevating the IFN-γ/IL-4 ratio in the mucosa. This effect was confirmed by the enhanced IL-12-inducing activity of macrophages after in vitro stimulation of L9. Also detected was increased expression of TLR-2mRNA in the mucosa. We predict that L9 could enhance innate immunity by activating TLR-2 in the mucosa, and enhance acquired immunity by promoting Th1 polarization through induced production of IL-12 by macrophages.

  4. Anterior Chamber-Associated Immune Deviation (ACAID: An Acute Response to Ocular Insult Protects from Future Immune-Mediated Damage?

    Directory of Open Access Journals (Sweden)

    Robert E. Cone

    2009-01-01

    Full Text Available The “immune privilege” that inhibits immune defense mechanisms that could lead to damage to sensitive ocular tissue is based on the expression of immunosuppressive factors on ocular tissue and in ocular fluids. In addition to this environmental protection, the injection of antigen into the anterior chamber or infection in the anterior chamber induces a systemic suppression of potentially damaging cell-mediated and humoral responses to the antigen. Here we discuss evidence that suggests that Anterior Chamber-Associated Immune Deviation (ACAID a is initiated by an ocular response to moderate inflammation that leads to a systemic immunoregulatory response. Injection into the anterior chamber induces a rise in TNF-α and MCP-1 in aqueous humor and an infiltration of circulating F4/80 + monocytes that home to the iris. The induction of ACAID is dependent on this infiltration of circulating monocytes that eventually emigrate to the thymus and spleen where they induce regulatory T cells that inhibit the inductive or effector phases of a cell-mediated immune response. ACAID therefore protects the eye from the collateral damage of an immune response to infection by suppressing a future potentially damaging response to infection.

  5. Curcumin prevents human dendritic cell response to immune stimulants

    International Nuclear Information System (INIS)

    Shirley, Shawna A.; Montpetit, Alison J.; Lockey, R.F.; Mohapatra, Shyam S.

    2008-01-01

    Curcumin, a compound found in the Indian spice turmeric, has anti-inflammatory and immunomodulatory properties, though the mechanism remains unclear. Dendritic cells (DCs) are important to generating an immune response and the effect of curcumin on human DCs has not been explored. The role curcumin in the DC response to bacterial and viral infection was investigated in vitro using LPS and Poly I:C as models of infection. CD14 + monocytes, isolated from human peripheral blood, were cultured in GM-CSF- and IL-4-supplemented medium to generate immature DCs. Cultures were incubated with curcumin, stimulated with LPS or Poly I:C and functional assays were performed. Curcumin prevents DCs from responding to immunostimulants and inducing CD4 + T cell proliferation by blocking maturation marker, cytokine and chemokine expression and reducing both migration and endocytosis. These data suggest a therapeutic role for curcumin as an immune suppressant

  6. TLR2 and TLR4 signaling pathways are required for recombinant Brucella abortus BCSP31-induced cytokine production, functional upregulation of mouse macrophages, and the Th1 immune response in vivo and in vitro.

    Science.gov (United States)

    Li, Jia-Yun; Liu, Yuan; Gao, Xiao-Xue; Gao, Xiang; Cai, Hong

    2014-09-01

    Brucella abortus is a zoonotic Gram-negative pathogen that causes brucelosis in ruminants and humans. Toll-like receptors (TLRs) recognize Brucella abortus and initiate antigen-presenting cell activities that affect both innate and adaptive immunity. In this study, we focused on recombinant Brucella cell-surface protein 31 (rBCSP31) to determine its effects on mouse macrophages. Our results demonstrated that rBCSP31 induced TNF-α, IL-6 and IL-12p40 production, which depended on the activation of mitogen-activated protein kinases (MAPKs) by stimulating the rapid phosphorylation of p38 and JNK and the activation of transcription factor NF-κB in macrophages. In addition, continuous exposure (>24 h) of RAW264.7 cells to rBCSP31 significantly enhanced IFN-γ-induced expression of MHC-II and the ability to present rBCSP31 peptide to CD4(+) T cells. Furthermore, we found that rBCSP31 could interact with both TLR2 and TLR4. The rBCSP31-induced cytokine production by macrophages from TLR2(-/-) and TLR4(-/-) mice was lower than that from C57BL/6 macrophages, and the activation of NF-κB and MAPKs was attenuated in macrophages from TLR2(-/-) and TLR4(-/-) mice. In addition, CD4(+) T cells from C57BL/6 mice immunized with rBCSP31 produced higher levels of IFN-γ and IL-2 compared with CD4(+) T cells from TLR2(-/-) and TLR4(-/-) mice. Macrophages from immunized C57BL/6 mice produced higher levels of IL-12p40 than those from TLR2(-/-) and TLR4(-/-) mice. Furthermore, immunization with rBCSP31 provided better protection in C57BL/6 mice than in TLR2(-/-) and TLR4(-/-) mice after B. abortus 2308 challenge. These results indicate that rBCSP31 is a TLR2 and TLR4 agonist that induces cytokine production, upregulates macrophage function and induces the Th1 immune response.

  7. MECHANISMS OF IMMUNE RESPONSES IN CNIDARIANS

    Directory of Open Access Journals (Sweden)

    Iván Darío Ocampo

    2015-05-01

    Full Text Available The immune system maintains the integrity of the organisms through a complex network of molecules, cells, and tissues that recognize internal or external antigenic substances to neutralized and eliminate them. The mechanisms of immune response have evolved in a modular fashion, where members of a given module interact strongly among them, but weakly with members of other modules, providing robustness and evolvability to the immune system. Ancestral modules are the raw material for the generation of new modules through evolution. Thus, the study of immune systems in basal metazoans such as cnidarians seeks to determine the basic tool kit from which the metazoans started to construct their immune systems. In addition, understanding the immune mechanisms in cnidarians contributes to decipher the etiopathology of coral diseases of infectious nature that are affecting coral reefs worldwide. RESUMEN El sistema inmune mantiene la integridad de los organismos vivos por medio de una red compleja de moléculas, células y tejidos que reconocen sustancias antigénicas internas o externas para neutralizarlas y eliminarlas. Los mecanismos de respuesta inmune han evolucionado de una manera modular, en donde miembros de un módulo dado interactúan fuertemente entre sí, pero débilmente con componentes de otros módulos, otorgando así robustez y potencial evolutivo al sistema inmune. Módulos ancestrales representan el material básico para la generación de nuevos módulos durante el proceso evolutivo. Así, el estudio de sistemas inmunes en metazoarios basales como los cnidarios busca determinar cuales son los módulos ancestrales a partir de los cuales se constituyen los sistemas inmunes de animales derivados. Adicionalmente, el entendimiento de los mecanismos de respuesta inmune en cnidarios eventualmente contribuirá a descifrar la etiopatología de las enfermedades de corales de carácter infeccioso que está afectando los corales en el mundo.

  8. Evaluation of Protective Immune Responses Induced by Recombinant TrxLp and ENO2 Proteins against Toxoplasma gondii Infection in BALB/c Mice

    Directory of Open Access Journals (Sweden)

    Meng Wang

    2016-01-01

    Full Text Available Toxoplasma gondii is an obligate intracellular parasitic protozoan that can infect almost all species of warm-blooded animals. As any chemical-based drugs could not act against the tissue cyst stage of T. gondii, vaccination may be one of the ideal control strategies. In the present study, two new vaccine candidates, named TgENO2 and TgTrxLp, were purified from Escherichia coli with pET-30a(+ expression system and then were injected into BALB/c mice to evaluate the protective efficacy against acute and chronic toxoplasmosis. The results showed that both the recombinant proteins, either alone or in combination, could elicit strong humoral and cellular immune responses with a higher level of IgG antibodies, IFN-γ, IL-2, CD4+, and CD8+ T cells as compared to those in mice from control groups. After acute challenge with tachyzoites of the GJS strain, mice immunized with rTgTrxLp (8±2.77 d, rTgENO2 (7.4±1.81 d, and rTgTrxLp + rTgENO2 (8.38±4.57 d proteins showed significantly longer survival time than those that received Freund’s adjuvant (6.78±2.08 d and PBS (6.38±4.65 d (χ2 = 9.687, df = 4, P=0.046. The protective immunity of rTgTrxLp, rTgENO2, and rTgTrxLp + rTgENO2 proteins against chronic T. gondii infection showed 69.77%, 58.14%, and 20.93% brain cyst reduction as compared to mice that received PBS. The present study suggested that both TgENO2 and TgTrxLp were potential candidates for the development of multicomponent vaccines against toxoplasmosis.

  9. CD28 Aptamers as Powerful Immune Response Modulators

    Directory of Open Access Journals (Sweden)

    Fernando Pastor

    2013-01-01

    Full Text Available CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7, precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy.

  10. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    Science.gov (United States)

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  11. immune response can measuring immunity to hiv during ...

    African Journals Online (AJOL)

    2005-11-01

    Nov 1, 2005 ... inhibitors (PIs), have resulted in significant suppression of viral replication. ... thymus, with the potential for immune reconstitution when ..... HIV-exposed but uninfected Gambian women [published erratum appears in. Nat Med ...

  12. Chicken Immune Response after In Ovo Immunization with Chimeric TLR5 Activating Flagellin of Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Katarzyna A Radomska

    Full Text Available Campylobacter jejuni is the main cause of bacterial food-borne diseases in developed countries. Chickens are the most important source of human infection. Vaccination of poultry is an attractive strategy to reduce the number of C. jejuni in the intestinal tract of chickens. We investigated the immunogenicity and protective efficacy of a recombinant C. jejuni flagellin-based subunit vaccine with intrinsic adjuvant activity. Toll-like receptor activation assays demonstrated the purity and TLR5 stimulating (adjuvant activity of the vaccine. The antigen (20-40 μg was administered in ovo to 18 day-old chicken embryos. Serum samples and intestinal content were assessed for antigen-specific systemic and mucosal humoral immune responses. In ovo vaccination resulted in the successful generation of IgY and IgM serum antibodies against the flagellin-based subunit vaccine as determined by ELISA and Western blotting. Vaccination did not induce significant amounts of flagellin-specific secretory IgA in the chicken intestine. Challenge of chickens with C. jejuni yielded similar intestinal colonization levels for vaccinated and control animals. Our results indicate that in ovo delivery of recombinant C. jejuni flagellin subunit vaccine is a feasible approach to yield a systemic humoral immune response in chickens but that a mucosal immune response may be needed to reduce C. jejuni colonization.

  13. [Comparison of immune response after oral and intranasal immunization with recombinant Lactobacillus casei expressing ETEC F41].

    Science.gov (United States)

    Liu, Jiankui; Wei, Chunhua; Hou, Xilin; Wang, Guihua; Yu, Liyun

    2009-04-01

    In order to represent a promising strategy for mucosal vaccination, oral or intranasal immunization of Specific Pathogen Free (SPF) BALB/c mice were performed. The mucosal immunity, systemic immune and protective immune responses were compared after immunization with the recombinant Lactobacillus casei (L. casei) harboring enterotoxigenic Escherichia coli (ETEC) F41. The recombinant fusion proteins were detected by Western blot. Surface localization of the fusion protein was verified by immunofluorescence microscopy and flow cytometry. Six-week-old female SPF BALB/c mice (160 heads) were divided into 4 groups for immunization and control. Oral and intranasal immunization of mice was performed with the recombinant strain L. casei harboring pLA-F41 or pLA. For oral immunization, the mice were inoculated daily on days 0 to 4, 7 to 11, 21 to 25, and 49 to 53. A lighter schedule was used for nasal immunization (days 0 to 2, 7 to 9, 21 and 49). Specific anti-F41 IgG antibody in the serum and specific anti-F41 secret immunoglobulin A (sIgA) antibody in the lung, intestines, vagina fluid and feces of mice were detected by indirect ELISA. The mice orally or intranasally immunized with pLA-F41/L. casei and pLA/IL. casei were challenged with standard-type ETEC F41 (C83919) (2 x 10(3) LD50). Mice immunized with pLA-F41/L. casei could produce remarkable anti-F41 antibody level. More than 90% survived in oral immunization group whereas more than 85% survived in intranasal immunization group after challenged with C83919, all dead in the control group. Ninety percent of the pups survived in oral immunization group whereas 80% survived in intranasal immunization group after challenged with C83919, but only a 5% survival rate for pups that were either immunized with a control pLA vector or unimmunized. Oral or intranasal immunization with recombinant L. casei displaying ETEC F41 antigens on the surface induced effective and similar systemic and mucosal immune responses against the

  14. Red Seaweeds Sarcodiotheca gaudichaudii and Chondrus crispus down Regulate Virulence Factors of Salmonella Enteritidis and Induce Immune Responses in Caenorhabditis elegans.

    Science.gov (United States)

    Kulshreshtha, Garima; Borza, Tudor; Rathgeber, Bruce; Stratton, Glenn S; Thomas, Nikhil A; Critchley, Alan; Hafting, Jeff; Prithiviraj, Balakrishnan

    2016-01-01

    Red seaweeds are a rich source of unique bioactive compounds and secondary metabolites that are known to improve human and animal health. S. Enteritidis is a broad range host pathogen, which contaminates chicken and poultry products that end into the human food chain. Worldwide, Salmonella outbreaks have become an important economic and public health concern. Moreover, the development of resistance in Salmonella serovars toward multiple drugs highlights the need for alternative control strategies. This study evaluated the antimicrobial property of red seaweeds extracts against Salmonella Enteritidis using the Caenorhabditis elegans infection model. Six red seaweed species were tested for their antimicrobial activity against S. Enteritidis and two, Sarcodiotheca gaudichaudii (SG) and Chondrus crispus (CC), were found to exhibit such properties. Spread plate assay revealed that SG and CC (1%, w/v) significantly reduced the growth of S. Enteritidis. Seaweed water extracts (SWE) of SG and CC, at concentrations from 0.4 to 2 mg/ml, significantly reduced the growth of S. Enteritidis (log CFU 4.5-5.3 and log 5.7-6.0, respectively). However, methanolic extracts of CC and SG did not affect the growth of S. Enteritidis. Addition of SWE (0.2 mg/ml, CC and SG) significantly decreased biofilm formation and reduced the motility of S. Enteritidis. Quantitative real-time PCR analyses showed that SWE (CC and SG) suppressed the expression of quorum sensing gene sdiA and of Salmonella Pathogenesis Island-1 (SPI-1) associated genes sipA and invF, indicating that SWE might reduce the invasion of S. Enteritidis in the host by attenuating virulence factors. Furthermore, CC and SG water extracts significantly improved the survival of infected C. elegans by impairing the ability of S. Enteritidis to colonize the digestive tract of the nematode and by enhancing the expression of C. elegans immune responsive genes. As the innate immune response pathways of C. elegans and mammals show a high

  15. Red seaweeds Sarcodiotheca gaudichaudii and Chondrus crispus down regulate virulence factors of Salmonella Enteritidis and induce immune responses in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Garima eKulshreshtha

    2016-03-01

    Full Text Available Red seaweeds are a rich source of unique bioactive compounds and secondary metabolites that are known to improve human and animal health. S. Enteritidis is a broad range host pathogen, which contaminates chicken and poultry products that end into the human food chain. Worldwide, Salmonella outbreaks have become an important economic and public health concern. Moreover, the development of resistance in Salmonella serovars towards multiple drugs highlights the need for alternative control strategies. This study evaluated the antimicrobial property of red seaweeds extracts against Salmonella Enteritidis using the Caenorhabditis elegans infection model. Six red seaweed species were tested for their antimicrobial activity against S. Enteritidis. Spread plate assay revealed that Sarcodiotheca gaudichaudii (SG and Chondrus crispus (CC (1%, w/v significantly reduced the growth of S. Enteritidis. Seaweed water extracts (SWE of SG and CC, at concentrations from 0.4 mg/ml to 2 mg/ml, significantly reduced the growth of S. Enteritidis (log CFU 4.5-5.3 and log 5.7-6.0, respectively. However, methanolic extracts of CC and SG did not affect the growth of S. Enteritidis. Addition of SWE (0.2 mg/ml, CC and SG significantly decreased biofilm formation and reduced the motility of S. Enteritidis. Quantitative real-time PCR analyses showed that SWE (CC and SG suppressed the expression of quorum sensing gene sdiA and of Salmonella Pathogenesis Island-1 (SPI-1 associated genes sipA and invF, indicating that SWE might reduce the invasion of S. Enteritidis in the host by attenuating virulence factors. Furthermore, CC and SG water extracts significantly improved the survival of infected C. elegans by impairing the ability of S. Enteritidis to colonize the digestive tract of the nematode and by enhancing the expression of C. elegans immune responsive genes. As the innate immune response pathways of C. elegans and mammals show a high degree of conservation, these results

  16. Adenovirus Vector-Derived VA-RNA-Mediated Innate Immune Responses

    Directory of Open Access Journals (Sweden)

    Hiroyuki Mizuguchi

    2011-07-01

    Full Text Available The major limitation of the clinical use of replication-incompetent adenovirus (Ad vectors is the interference by innate immune responses, including induction of inflammatory cytokines and interferons (IFN, following in vivo application of Ad vectors. Ad vector-induced production of inflammatory cytokines and IFNs also results in severe organ damage and efficient induction of acquired immune responses against Ad proteins and transgene products. Ad vector-induced innate immune responses are triggered by the recognition of Ad components by pattern recognition receptors (PRRs. In order to reduce the side effects by Ad vector-induced innate immune responses and to develop safer Ad vectors, it is crucial to clarify which PRRs and which Ad components are involved in Ad vector-induced innate immune responses. Our group previously demonstrated that myeloid differentiating factor 88 (MyD88 and toll-like receptor 9 (TLR9 play crucial roles in the Ad vector-induced inflammatory cytokine production in mouse bone marrow-derived dendritic cells. Furthermore, our group recently found that virus associated-RNAs (VA-RNAs, which are about 160 nucleotide-long non-coding small RNAs encoded in the Ad genome, are involved in IFN production through the IFN-β promoter stimulator-1 (IPS-1-mediated signaling pathway following Ad vector transduction. The aim of this review is to highlight the Ad vector-induced innate immune responses following transduction, especially VA-RNA-mediated innate immune responses. Our findings on the mechanism of Ad vector-induced innate immune responses should make an important contribution to the development of safer Ad vectors, such as an Ad vector lacking expression of VA-RNAs.

  17. Early-life inflammation, immune response and ageing.

    Science.gov (United States)

    Khan, Imroze; Agashe, Deepa; Rolff, Jens

    2017-03-15

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).

  18. Drug-induced immune hemolytic anemia

    Science.gov (United States)

    Immune hemolytic anemia secondary to drugs; Anemia - immune hemolytic - secondary to drugs ... Drugs that can cause this type of hemolytic anemia include: Cephalosporins (a class of antibiotics), most common ...

  19. Enhancement of Immune Memory Responses to Respiratory Infection

    Science.gov (United States)

    2017-08-01

    AWARD NUMBER: W81XWH-16-1-0360 TITLE: Enhancement of Immune Memory Responses to Respiratory Infection PRINCIPAL INVESTIGATORs: Dr Min Chen PhD...5a. CONTRACT NUMBER Enhancement of Immune Memory Responses to Respiratory Infection 5b. GRANT NUMBER W81XWH-16-1-0360 5c. PROGRAM ELEMENT NUMBER...entitled “ENHANCEMENT OF IMMUNE MEMORY RESPONSES TO RESPIRATORY INFECTION: AUTOPHAGY IN MEMORY B-CELLS RESPONSE TO INFLUENZA VACCINE (AMBRIV

  20. Immune responses of Helicoverpa armigera to different kinds of pathogens

    Directory of Open Access Journals (Sweden)

    Zhao Xiao-Fan

    2010-03-01

    Full Text Available Abstract Background Insects react against pathogens through innate immunity. The cotton bollworm Helicoverpa armigera (H. armigera is an important defoliator and an extremely destructive pest insect of many crops. The elucidation of the mechanism of the immune response of H. armigera to various pathogens can provide a theoretical basis for new approaches to biologically control this pest. Results Four kinds of pathogens Bacillus thuringiensis, Klebsiella pneumoniae, Candida albicans, and Autographa californica multiple nucleocapsid nucleopolyhedrovirus harbored green fluorescence protein and polyhedron (AcMNPV-GFP were used to challenge the insect. The cellular and humoral immune responses to the pathogens were analyzed in the challenged H. armigera. The results show that in the five kinds of haemocytes, only granulocytes phagocytized the Gram-negative and Gram-positive bacteria and fungi. All haemocytes can be infected by AcMNPV. Fourteen immune-related genes including pattern recognition receptors (PRRs such as peptidoglycan recognition proteins (HaPGRP and HaPGRP C and Gram-Negative Bacteria-Binding Protein (HaGNBP, and antimicrobial peptides (AMPs such as cecropin-1, 2 and 3 (HaCec-1, 2 and 3, lysozyme (HaLys, attacin (HaAtt, gallerimycin-like (HaGall, gloverin-like (HaGlo, moricin-like (HaMor, cobatoxin-like (HaCob, galiomicin-like (HaGali, and immune inducible protein (HaIip appeared in different expression profiles to different pathogen infections. The transcripts of 13 immune related genes (except HaPGRPC are obviously up-regulated by Gram-positive bacteria. HaCec-1 and 3, HaMor, HaAtt, HaLys, HaIip, HaPGRP and HaGNBP are greatly up-regulated after fungal infection. HaGNBP, HaCec-2, HaGall, HaGlo, HaMor, HaCob, HaGali obviously increased in Gram-negative bacterial infection. Only five genes, HaGNBP, HaCec-1, HaGali, HaGlo, and HaLys, are weakly up-regulated after viral infection. The AMP transcripts had higher expression levels than the

  1. A human type 5 adenovirus-based tuberculosis vaccine induces robust T cell responses in humans despite preexisting anti-adenovirus immunity.

    Science.gov (United States)

    Smaill, Fiona; Jeyanathan, Mangalakumari; Smieja, Marek; Medina, Maria Fe; Thanthrige-Don, Niroshan; Zganiacz, Anna; Yin, Cindy; Heriazon, Armando; Damjanovic, Daniela; Puri, Laura; Hamid, Jemila; Xie, Feng; Foley, Ronan; Bramson, Jonathan; Gauldie, Jack; Xing, Zhou

    2013-10-02

    There is an urgent need to develop new tuberculosis (TB) vaccines to safely and effectively boost Bacille Calmette-Guérin (BCG)-triggered T cell immunity in humans. AdHu5Ag85A is a recombinant human type 5 adenovirus (AdHu5)-based TB vaccine with demonstrated efficacy in a number of animal species, yet it remains to be translated to human applications. In this phase 1 study, we evaluated the safety and immunogenicity of AdHu5Ag85A in both BCG-naïve and previously BCG-immunized healthy adults. Intramuscular immunization of AdHu5Ag85A was safe and well tolerated in both trial volunteer groups. Moreover, although AdHu5Ag85A was immunogenic in both trial volunteer groups, it much more potently boosted polyfunctional CD4(+) and CD8(+) T cell immunity in previously BCG-vaccinated volunteers. Furthermore, despite prevalent preexisting anti-AdHu5 humoral immunity in most of the trial volunteers, we found little evidence that such preexisting anti-AdHu5 immunity significantly dampened the potency of AdHu5Ag85A vaccine. This study supports further clinical investigations of the AdHu5Ag85A vaccine for human applications. It also suggests that the widely perceived negative effect of preexisting anti-AdHu5 immunity may not be universally applied to all AdHu5-based vaccines against different types of human pathogens.

  2. The role of radiotherapy for the induction of antitumor immune responses

    International Nuclear Information System (INIS)

    Multhoff, G.; Helmholtz-Zentrum Muenchen; Gaipl, U.S.; Niedermann, G.

    2012-01-01

    Effective radiotherapy is aimed to control the growth of the primary carcinoma and to induce a long-term specific antitumor immune response against the primary tumor, recurrence and metastases. The contribution covers the following issues: T cells and tumor specific immune responses, dendritic cells (DCs) start adaptive immune responses, NK (natural killer) cells for HLA independent tumor control, abscopal effects of radiotherapy, combination of radiotherapy and immune therapy, radiotherapy contribution to the induction of immunogenic cell death, combinability of radiotherapy and DC activation, combinability of radiotherapy and NK cell therapy. It turns out that the combination of radio-chemotherapy and immune therapy can change the microenvironment initiating antitumor immune reactions that inhibit the recurrence risk and the development of metastases.

  3. Study of the immune response to thyroglobulin through a model of experimental autoimmune thyroiditis

    International Nuclear Information System (INIS)

    Santos Castro, M. dos.

    1981-01-01

    The cellular and humoral immune response to thyroglobulin of different species was studied in guinea pigs. The experiments described suggested that the immune system can be activated against self-determinants. Human and pork thyroglobulin were able to induce the experimental thyroiditis as well as some immune responses, such as in vitro proliferative response, delayed hypersensitivity and antibodies. Although guinea pig thyroglobulin was unable to induce specific T-lymphocyte proliferation in vitro, delayed hypersensitivity response and antibodies, it was very efficient in inducing the autoimmune thyroiditis. On the contrary, bovine thyroglobulin did not induce experimental autoimmune thyroiditis despite producing good responses as determined by similar in vitro proliferative response, delayed hypersensitivity and on the humoral level. These results suggest that the assays utilised were not able to evaluate the relevant immune response to genesis of the thyroiditis. The determinant selection mechanisms operating in these immune responses are probably selecting determinants not responsible for self-recognition in vivo. It was suggested that the macrophage could be the cell responsible for the presentation of these determinants to the lymphocyte in an immunogenic form. (Author) [pt

  4. Zoospore exudates from Phytophthora nicotianae affect immune responses in Arabidopsis.

    Science.gov (United States)

    Kong, Ping; McDowell, John M; Hong, Chuanxue

    2017-01-01

    Zoospore exudates play important roles in promoting zoospore communication, homing and germination during plant infection by Phytophthora. However, it is not clear whether exudates affect plant immunity. Zoospore-free fluid (ZFF) and zoospores of P. nicotianae were investigated comparatively for effects on resistance of Arabidopsis thaliana Col-0 and mutants that affect signaling mediated by salicylic acid (SA) and jasmonic acid (JA): eds16 (enhanced disease susceptibility16), pad4 (phytoalexin deficient4), and npr1 (nonexpressor of pathogenesis-related genes1). Col-0 attracted more zoospores and had severe tissue damage when flooded with a zoospore suspension in ZFF. Mutants treated with ZFF alone developed disease symptoms similar to those inoculated with zoospores and requirements of EDS16 and PAD4 for plant responses to zoospores and the exudates was apparent. Zoospore and ZFFs also induced expression of the PR1 and PDF1.2 marker genes for defense regulated by SA and JA, respectively. However, ZFF affected more JA defense signaling, down regulating PR1 when SA signaling or synthesis is deficient, which may be responsible for Arabidopsis mutant plants more susceptible to infection by high concentration of P. nicotianae zoospores. These results suggest that zoospore exudates can function as virulence factors and inducers of plant immune responses during plant infection by Phytophthora.

  5. Zoospore exudates from Phytophthora nicotianae affect immune responses in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Ping Kong

    Full Text Available Zoospore exudates play important roles in promoting zoospore communication, homing and germination during plant infection by Phytophthora. However, it is not clear whether exudates affect plant immunity. Zoospore-free fluid (ZFF and zoospores of P. nicotianae were investigated comparatively for effects on resistance of Arabidopsis thaliana Col-0 and mutants that affect signaling mediated by salicylic acid (SA and jasmonic acid (JA: eds16 (enhanced disease susceptibility16, pad4 (phytoalexin deficient4, and npr1 (nonexpressor of pathogenesis-related genes1. Col-0 attracted more zoospores and had severe tissue damage when flooded with a zoospore suspension in ZFF. Mutants treated with ZFF alone developed disease symptoms similar to those inoculated with zoospores and requirements of EDS16 and PAD4 for plant responses to zoospores and the exudates was apparent. Zoospore and ZFFs also induced expression of the PR1 and PDF1.2 marker genes for defense regulated by SA and JA, respectively. However, ZFF affected more JA defense signaling, down regulating PR1 when SA signaling or synthesis is deficient, which may be responsible for Arabidopsis mutant plants more susceptible to infection by high concentration of P. nicotianae zoospores. These results suggest that zoospore exudates can function as virulence factors and inducers of plant immune responses during plant infection by Phytophthora.

  6. Immune responses to hair dyes containing toluene-2,5-diamine

    DEFF Research Database (Denmark)

    Schmidt, J D; Johansen, J D; Nielsen, M M

    2014-01-01

    BACKGROUND: Toluene-2,5-diamine (PTD) is the most frequently used dye in oxidative hair dyes on the Scandinavian market. However, little is known about immune responses to PTD-containing oxidative hair dyes. OBJECTIVES: To study immune responses induced by PTD-containing hair dyes in mice. METHODS......: Immune responses against two different permanent hair dye products containing 1·60% (w/w) and 0·48% (w/w) PTD within the colour gel, and various concentrations of pure PTD were studied. The local inflammatory response was measured by ear swelling and cell infiltration, and T- and B-cell infiltration...... and proliferation was determined in the draining lymph nodes. RESULTS: Concentration-dependent immune responses were seen to PTD both in the skin and draining lymph nodes. The hair dye containing 1·60% PTD induced strong local inflammation and caused T- and B-cell infiltration and proliferation as well...

  7. Adrenaline influence on the immune response. II

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.

    1981-01-01

    Experiments were carried out to specify the adrenaline target among the immunocompetent cells. Adrenaline administered for some hours exerted opposite effects on the natural PFC and RFC: the first were enhanced and the second significantly reduced. These paradoxical results were interpreted as a consequence of the inhibition of the suppressor T-cells in the resting status. Adrenaline appeared to act on the sensitive cells through beta- rather than through alpha-receptors. Further experiments on the adrenaline influence on the syngeneic barrier phenomenon and on the cellular balance at its termination seemed to indicate that adrenaline was directly inhibitory for the Ts but not for their precursors. These results are discussed in the light of the cellular networks regulating the immune response. Irradiated mice were compared with non-irradiated mice as described in the previous article. (Auth.)

  8. Population-expression models of immune response

    International Nuclear Information System (INIS)

    Stromberg, Sean P; Antia, Rustom; Nemenman, Ilya

    2013-01-01

    The immune response to a pathogen has two basic features. The first is the expansion of a few pathogen-specific cells to form a population large enough to control the pathogen. The second is the process of differentiation of cells from an initial naive phenotype to an effector phenotype which controls the pathogen, and subsequently to a memory phenotype that is maintained and responsible for long-term protection. The expansion and the differentiation have been considered largely independently. Changes in cell populations are typically described using ecologically based ordinary differential equation models. In contrast, differentiation of single cells is studied within systems biology and is frequently modeled by considering changes in gene and protein expression in individual cells. Recent advances in experimental systems biology make available for the first time data to allow the coupling of population and high dimensional expression data of immune cells during infections. Here we describe and develop population-expression models which integrate these two processes into systems biology on the multicellular level. When translated into mathematical equations, these models result in non-conservative, non-local advection-diffusion equations. We describe situations where the population-expression approach can make correct inference from data while previous modeling approaches based on common simplifying assumptions would fail. We also explore how model reduction techniques can be used to build population-expression models, minimizing the complexity of the model while keeping the essential features of the system. While we consider problems in immunology in this paper, we expect population-expression models to be more broadly applicable. (paper)

  9. μ-opioid Receptor-Mediated Alterations of Allergen-Induced Immune Responses of Bronchial Lymph Node Cells in a Murine Model of Stress Asthma

    Directory of Open Access Journals (Sweden)

    Kaori Okuyama

    2012-01-01

    Conclusions: Restraint stress aggravated allergic airway inflammation in association with alterations in local immunity characterized by greater Th2-associated cytokine production and a reduced development of regulatory T cells, mediated by MORs.

  10. Hepatitis B and hepatitis C viruses: a review of viral genomes, viral induced host immune responses, genotypic distributions and worldwide epidemiology

    Directory of Open Access Journals (Sweden)

    Umar Saeed

    2014-04-01

    Full Text Available Hepatitis B and hepatitis C viruses (HCV are frequently propagating blood borne pathogens in global community. Viral hepatitis is primarily associated with severe health complications, such as liver cirrhosis, hepatocellular carcinoma, hepatic fibrosis and steatosis. A literature review was conducted on hepatitis B virus (HBV, HBV genome, genotypic distribution and global epidemiology of HBV, HCV, HCV genome, HCV and host immune responses, HCV genotypic distribution and global epidemiology. The valued information was subjected for review. HBV has strict tissue tropism to liver. The virus infecting hepatocytes produces large amount of hepatitis B surface antigen particles which lack the DNA. It has capability to integrate into host genome. It has been found that genotype C is most emerging genotype associated with more severe liver diseases (cirrhosis. The approximate prevalence rate of genotype C is 27.7% which represents a major threat to future generations. Approximately 8% of population is chronic carrier of HBV in developing countries. The chronic carrier rate of HBV is 2%-7% in Middle East, Eastern and Southern Europe, South America and Japan. Among HCV infected individuals, 15% usually have natural tendency to overcome acute viral infection, where as 85% of individuals were unable to control HCV infection. The internal ribosomal entry site contains highly conserved structures important for binding and appropriate positioning of viral genome inside the host cell. HCV infects only in 1%-10% of hepatocytes, but production of tumor necrosis factor alpha (from CD8+ cells and interferon-gamma cause destruction of both infected cells and non-infected surrounding cells. Almost 11 genotypes and above 100 subtypes of HCV exists worldwide with different geographical distribution. Many efforts are still needed to minimize global burden of these infections. For the complete eradication of HBV (just like small pox and polio via vaccination strategies

  11. Sex hormones and the immune response in humans

    NARCIS (Netherlands)

    Bouman, Annechien; Heineman, Maas Jan; Faas, Marijke M.

    2005-01-01

    In addition to their effects on sexual differentiation and reproduction, sex hormones appear to influence the immune system. This results in a sexual dimorphism in the immune response in humans: for instance, females produce more vigorous cellular and more vigorous humoral immune reactions, are more

  12. Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour

    International Nuclear Information System (INIS)

    Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.

    1996-01-01

    Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)

  13. Interferon-inducible transmembrane proteins of the innate immune response act as membrane organizers by influencing clathrin and v-ATPase localization and function.

    Science.gov (United States)

    Wee, Yin Shen; Roundy, Kirstin M; Weis, Janis J; Weis, John H

    2012-12-01

    The innate response interferon-inducible transmembrane (Ifitm) proteins have been characterized as influencing proliferation, signaling complexes and restricting virus infections. Treatment of cells lacking these proteins (IfitmDel) with IFN-β resulted in the loss of clathrin from membrane compartments and the inhibition of clathrin-mediated phagocytosis, suggesting a molecular interaction between clathrin and Ifitm proteins. The pH of endosomes of IfitmDel cells, with or without IFN activation, was neutralized, suggesting the function of the vacular ATPase proton pumps in such cells was compromised. Co-immunoprecipitation of Ifitm3 with Atp6v0b demonstrated a direct interaction between the Ifitm proteins and the v-ATPase. These data suggest that the Ifitm proteins help stabilize v-ATPase complexes in cellular membranes which, in turn, facilitates the appropriate subcellular localization of clathrin.

  14. Reversibility of alcohol-induced immune depression

    DEFF Research Database (Denmark)

    Tønnesen, H; Kaiser, A H; Nielsen, B B

    1992-01-01

    Alcohol abusers have suppressed cellular immune function. The aim of the study was to investigate the time of sobriety required to normalize immune function. Delayed hypersensitivity was investigated during disulfiram controlled abstinence in ten heavy alcoholics and in seven moderate drinkers...... months of abstinence. The results suggest that while 2 weeks of abstinence from alcohol will improve the depressed cellular immunity, 2 months of sobriety is necessary to normalize it....

  15. Non specific immune response in the African catfish ...

    African Journals Online (AJOL)

    Non specific immune response in the African catfish, Heterobranchus longifilis fed diets fortified with ethanolic extracts of selected traditional medicinal plants and disease resistance against Pseudomonas aeruginosa.

  16. Sex differences in immune responses: Hormonal effects, antagonistic selection, and evolutionary consequences.

    Science.gov (United States)

    Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis

    2017-02-01

    Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Long-Term Protective Immune Response Elicited by Vaccination with an Expression Genomic Library of Toxoplasma gondii

    OpenAIRE

    Fachado, Alberto; Rodriguez, Alexandro; Molina, Judith; Silvério, Jaline C.; Marino, Ana P. M. P.; Pinto, Luzia M. O.; Angel, Sergio O.; Infante, Juan F.; Traub-Cseko, Yara; Amendoeira, Regina R.; Lannes-Vieira, Joseli

    2003-01-01

    Immunization of BALB/c mice with an expression genomic library of Toxoplasma gondii induces a Th1-type immune response, with recognition of several T. gondii proteins (21 to 117 kDa) and long-term protective immunity against a lethal challenge. These results support further investigations to achieve a multicomponent anti-T. gondii DNA vaccine.

  18. Inducible cell death in plant immunity

    DEFF Research Database (Denmark)

    Hofius, Daniel; Tsitsigiannis, Dimitrios I; Jones, Jonathan D G

    2006-01-01

    Programmed cell death (PCD) occurs during vegetative and reproductive plant growth, as typified by autumnal leaf senescence and the terminal differentiation of the endosperm of cereals which provide our major source of food. PCD also occurs in response to environmental stress and pathogen attack......, and these inducible PCD forms are intensively studied due their experimental tractability. In general, evidence exists for plant cell death pathways which have similarities to the apoptotic, autophagic and necrotic forms described in yeast and metazoans. Recent research aiming to understand these pathways...

  19. The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi

    Directory of Open Access Journals (Sweden)

    Paul T. King

    2015-01-01

    Full Text Available Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management.

  20. Immune response and anamnestic immune response in children after a 3-dose primary hepatitis b vaccination

    International Nuclear Information System (INIS)

    Afzal, M.F.; Sultan, M.A.; Saleemi, A.I.

    2017-01-01

    Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response and anamnestic immune response in children, 9 months-10 years of age, after a 3-dose primary Hepatitis B vaccination. Methods: This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, docu mented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum anti-HBsAb by ELIZA was measured. Children with anti-HBs titers =10 mIU/mL were considered to be immune. Those with anti-HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Results: Of the 200 children, protective antibody response was found in 58 percent. Median serological response was 18.60 (range 2.82-65.15). Antibody levels were found to have a statistically significant (p-value 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vaccine was administered to all non-responders, with each registering a statistically significant (p-value 0.00) anamnestic response. Conclusion: The vaccination schedule with short dosage interval was unable to provide

  1. Stimulation of dendritic cells enhances immune response after photodynamic therapy

    Science.gov (United States)

    Mroz, Pawel; Castano, Ana P.; Hamblin, Michael R.

    2009-02-01

    Photodynamic therapy (PDT) involves the administration of photosensitizers followed by illumination of the primary tumor with red light producing reactive oxygen species that cause vascular shutdown and tumor cell necrosis and apoptosis. Anti-tumor immunity is stimulated after PDT due to the acute inflammatory response, priming of the immune system to recognize tumor-associated antigens (TAA). The induction of specific CD8+ Tlymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. This process is however, often sub-optimal, in part due to tumor-induced DC dysfunction. Instead of DC that can become mature and activated and have a potent antigen-presenting and immune stimulating phenotype, immature dendritic cells (iDC) are often found in tumors and are part of an immunosuppressive milieu including regulatory T-cells and immunosuppressive cytokines such as TGF-beta and IL10. We here report on the use of a potent DC activating agent, an oligonucleotide (ODN) that contains a non-methylated CpG motif and acts as an agonist of toll like receptor (TLR) 9. TLR activation is a danger signal to notify the immune system of the presence of invading pathogens. CpG-ODN (but not scrambled non-CpG ODN) increased bone-marrow DC activation after exposure to PDT-killed tumor cells, and significantly increased tumor response to PDT and mouse survival after peri-tumoral administration. CpG may be a valuable immunoadjuvant to PDT especially for tumors that produce DC dysfunction.

  2. Radiation, Inflammation, and Immune Responses in Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Multhoff, Gabriele [Department of Radiation Oncology, Klinikum rechts der Isar, Technische Universität München, Munich (Germany); Helmholtz Zentrum München, Clinical Cooperation Group Innate Immunity in Tumor Biology, Munich (Germany); Radons, Jürgen, E-mail: raj10062@web.de [multimmune GmbH, Munich (Germany)

    2012-06-04

    Chronic inflammation has emerged as one of the hallmarks of cancer. Inflammation also plays a pivotal role in modulating radiation responsiveness of tumors. As discussed in this review, ionizing radiation (IR) leads to activation of several transcription factors modulating the expression of numerous mediators in tumor cells and cells of the microenvironment promoting cancer development. Novel therapeutic approaches thus aim to interfere with the activity or expression of these factors, either in single-agent or combinatorial treatment or as supplements of the existing therapeutic concepts. Among them, NF-κB, STAT-3, and HIF-1 play a crucial role in radiation-induced inflammatory responses embedded in a complex inflammatory network. A great variety of classical or novel drugs including nutraceuticals such as plant phytochemicals have the capacity to interfere with the inflammatory network in cancer and are considered as putative radiosensitizers. Thus, targeting the inflammatory signaling pathways induced by IR offers the opportunity to improve the clinical outcome of radiation therapy by enhancing radiosensitivity and decreasing putative metabolic effects. Since inflammation and sex steroids also impact tumorigenesis, a therapeutic approach targeting glucocorticoid receptors and radiation-induced production of tumorigenic factors might be effective in sensitizing certain tumors to IR.

  3. Radiation, Inflammation, and Immune Responses in Cancer

    International Nuclear Information System (INIS)

    Multhoff, Gabriele; Radons, Jürgen

    2012-01-01

    Chronic inflammation has emerged as one of the hallmarks of cancer. Inflammation also plays a pivotal role in modulating radiation responsiveness of tumors. As discussed in this review, ionizing radiation (IR) leads to activation of several transcription factors modulating the expression of numerous mediators in tumor cells and cells of the microenvironment promoting cancer development. Novel therapeutic approaches thus aim to interfere with the activity or expression of these factors, either in single-agent or combinatorial treatment or as supplements of the existing therapeutic concepts. Among them, NF-κB, STAT-3, and HIF-1 play a crucial role in radiation-induced inflammatory responses embedded in a complex inflammatory network. A great variety of classical or novel drugs including nutraceuticals such as plant phytochemicals have the capacity to interfere with the inflammatory network in cancer and are considered as putative radiosensitizers. Thus, targeting the inflammatory signaling pathways induced by IR offers the opportunity to improve the clinical outcome of radiation therapy by enhancing radiosensitivity and decreasing putative metabolic effects. Since inflammation and sex steroids also impact tumorigenesis, a therapeutic approach targeting glucocorticoid receptors and radiation-induced production of tumorigenic factors might be effective in sensitizing certain tumors to IR.

  4. Impact of Enterobius vermicularis infection and mebendazole treatment on intestinal microbiota and host immune response

    OpenAIRE

    Yang, Chin-An; Liang, Chao; Lin, Chia-Li; Hsiao, Chiung-Tzu; Peng, Ching-Tien; Lin, Hung-Chih; Chang, Jan-Gowth

    2017-01-01

    Background Previous studies on the association of enterobiasis and chronic inflammatory diseases have revealed contradictory results. The interaction of Enterobius vermicularis infection in particular with gut microbiota and induced immune responses has never been thoroughly examined. Methodology/Findings In order to answer the question of whether exposure to pinworm and mebendazole can shift the intestinal microbial composition and immune responses, we recruited 109 (30 pinworm-negative, 79 ...

  5. Viral evasion of DNA-stimulated innate immune responses

    Science.gov (United States)

    Christensen, Maria H; Paludan, Søren R

    2017-01-01

    Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP–AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. PMID:26972769

  6. Viral evasion of DNA-stimulated innate immune responses.

    Science.gov (United States)

    Christensen, Maria H; Paludan, Søren R

    2017-01-01

    Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP-AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway.

  7. The Smc5/6 Complex Restricts HBV when Localized to ND10 without Inducing an Innate Immune Response and Is Counteracted by the HBV X Protein Shortly after Infection

    Science.gov (United States)

    Daffis, Stephane; Ramakrishnan, Dhivya; Burdette, Dara; Peiser, Leanne; Salas, Eduardo; Ramos, Hilario; Yu, Mei; Cheng, Guofeng; Strubin, Michel; Delaney IV, William E.; Fletcher, Simon P.

    2017-01-01

    The structural maintenance of chromosome 5/6 complex (Smc5/6) is a restriction factor that represses hepatitis B virus (HBV) transcription. HBV counters this restriction by expressing HBV X protein (HBx), which targets Smc5/6 for degradation. However, the mechanism by which Smc5/6 suppresses HBV transcription and how HBx is initially expressed is not known. In this study we characterized viral kinetics and the host response during HBV infection of primary human hepatocytes (PHH) to address these unresolved questions. We determined that Smc5/6 localizes with Nuclear Domain 10 (ND10) in PHH. Co-localization has functional implications since depletion of ND10 structural components alters the nuclear distribution of Smc6 and induces HBV gene expression in the absence of HBx. We also found that HBV infection and replication does not induce a prominent global host transcriptional response in PHH, either shortly after infection when Smc5/6 is present, or at later times post-infection when Smc5/6 has been degraded. Notably, HBV and an HBx-negative virus establish high level infection in PHH without inducing expression of interferon-stimulated genes or production of interferons or other cytokines. Our study also revealed that Smc5/6 is degraded in the majority of infected PHH by the time cccDNA transcription could be detected and that HBx RNA is present in cell culture-derived virus preparations as well as HBV patient plasma. Collectively, these data indicate that Smc5/6 is an intrinsic antiviral restriction factor that suppresses HBV transcription when localized to ND10 without inducing a detectable innate immune response. Our data also suggest that HBx protein may be initially expressed by delivery of extracellular HBx RNA into HBV-infected cells. PMID:28095508

  8. Respons imun humoral pada pulpitis (Humoral immune response on pulpitis)

    OpenAIRE

    Widodo, Trijoedani

    2005-01-01

    Pulpitis is an inflammation process on dental pulp tissue, and usually as the continuous of caries. The microorganism in the caries is a potential immunogenic triggering the immune respons, both humoral and celluler immune responses. The aim of this research is to explain the humoral immune response changes in the dental pulp tissues of pulpitis. This research was done on three group samples: Irreversible pulpitis, Reversible pulpitis and sound teeth as the control group. The result showed th...

  9. The specificity of targeted vaccines for APC surface molecules influences the immune response phenotype.

    Directory of Open Access Journals (Sweden)

    Gunnveig Grødeland

    Full Text Available Different diseases require different immune responses for efficient protection. Thus, prophylactic vaccines should prime the immune system for the particular type of response needed for protection against a given infectious agent. We have here tested fusion DNA vaccines which encode proteins that bivalently target influenza hemagglutinins (HA to different surface molecules on antigen presenting cells (APC. We demonstrate that targeting to MHC class II molecules predominantly induced an antibody/Th2 response, whereas targeting to CCR1/3/5 predominantly induced a CD8(+/Th1 T cell response. With respect to antibodies, the polarizing effect was even more pronounced upon intramuscular (i.m delivery as compared to intradermal (i.d. vaccination. Despite these differences in induced immune responses, both vaccines protected against a viral challenge with influenza H1N1. Substitution of HA with ovalbumin (OVA demonstrated that polarization of immune responses, as a consequence of APC targeting specificity, could be extended to other antigens. Taken together, the results demonstrate that vaccination can be tailor-made to induce a particular phenotype of adaptive immune responses by specifically targeting different surface molecules on APCs.

  10. Innate immune response development in nestling tree swallows

    Science.gov (United States)

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  11. Oral delivery of Bacillus subtilis spore expressing enolase of Clonorchis sinensis in rat model: induce systemic and local mucosal immune responses and has no side effect on liver function.

    Science.gov (United States)

    Yu, Jinyun; Chen, Tingjin; Xie, Zhizhi; Liang, Pei; Qu, Honglin; Shang, Mei; Mao, Qiang; Ning, Dan; Tang, Zeli; Shi, Mengchen; Zhou, Lina; Huang, Yan; Yu, Xinbing

    2015-07-01

    Caused by the consumption of raw or undercooked freshwater fish containing infective metacercariae of Clonorchis sinensis, human clonorchiasis remains a major public health problem in China. In previous study, we had expressed enolase from C. sinensis (CsENO) on the surface of Bacillus subtilis spore and the recombinant spore induced a pronounced protection in terms of reduced worm burden and eggs per gram feces, suggesting B. subtilis spore as an ideal vehicle for antigen delivery by oral treatment and CsENO as a promising vaccine candidate against clonorchiasis. In the current study, we detected CsENO-specific IgG and IgA levels both in serum and in intestinal mucus from rats orally administrated with B. subtilis spore surface expressing CsENO by ELISA. Lysozyme levels in serum and in intestinal mucus were analyzed too. In addition, IgA-secreting cells in intestine epithelium of the rats were detected by immunohistochemistry assay. The intestinal villi lengths of duodenum, jejunum, and ileum were also measured. Rats orally treated with B. subtilis spore or normal saline were used as controls. Our results showed that, compared with the control groups, oral administration of B. subtilis spore expressing CsENO induced both systemic and local mucosal immune response. The recombinant spores also enhanced non-specific immune response in rats. The spores had no side effect on liver function. Moreover, it might facilitate food utilization and digestion of the rats. Our work will pave the way to clarify the involved mechanisms of protective efficacy elicited by B. subtilis spore expressing CsENO and encourage us to carry out more assessment trails of the oral treated spore to develop vaccine against clonorchiasis.

  12. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    Science.gov (United States)

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  13. Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells

    International Nuclear Information System (INIS)

    Ronald Sluyter; Kylie S Yuen; Gary M Halliday

    2001-01-01

    There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc

  14. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    Science.gov (United States)

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  15. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  16. F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response.

    Science.gov (United States)

    Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric

    2015-10-21

    Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.

  17. Role of IL-12 and IFN-γ in immune response to toxoplasma gondii infection

    International Nuclear Information System (INIS)

    Moawad, M.A.F.; ElGawish, M.A.M.

    2004-01-01

    Interlenkin 12 (IL-12) is a potent immunoregulatory molecule that is critically involved in a wide range of diseases. In several murine models of intracellular infection, endogenous IL-12 has been shown to be crucial for the generation of a protective Th1 response in a primary infection for a intracellular pathogens. Interferon-gamma (IFN-γ) is also an important mediator of cellular immunity against microbial pathogens and tumor cells due to its potent capacity to activate macrophages for enhanced cytotoxicity. The aim of the present study is to evaluate the immune response to toxoplasma gondii after primary inflection (infected groups and secondary infection (re-infected groups for over 19 weeks (the time of the experiment). the evaluation was assessed by measurements of levels of IL-12 and IFN-γ using ELISA technique in the sera of these infected rats. The results demonstrated that the primary immune response induced a fluctuation in the levels of IL-12 in the sera of infected rats, which reached maximum value of 122.6 ±1.4 pg/ml after 15 weeks of primary infection. While, in the challenged groups (secondary immune response, re-infected groups) the levels of IL-12 were generally lower than that of the primary immune response. On the other hand, IFN-γ levels increased significantly in the secondary immune response (re-infected groups) as compared to primary immune response 9 infected groups) In conclusion, the results suggest that IL-12 might have a role in the defense mechanism against intracellular infection with T-gondii especially in primary immune response than in the secondary immune response. This is in contrast to IFN-γ that takes the up-hand in secondary immune response to T-gondii infection

  18. Tetraspanins in the immune response against cancer

    NARCIS (Netherlands)

    Veenbergen, S.; van Spriel, A.B.

    2011-01-01

    The role of the immune system in the defense against cancer, a process termed tumor immunosurveillance, has been extensively studied. Evidence is accumulating that the molecular organization of proteins and lipids in the plasma membrane of immune cells is of critical importance. Tetraspanin proteins

  19. Frequent adaptive immune responses against arginase-1

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Mortensen, Rasmus Erik Johansson; Hansen, Morten

    2018-01-01

    The enzyme arginase-1 reduces the availability of arginine to tumor-infiltrating immune cells, thus reducing T-cell functionality in the tumor milieu. Arginase-1 is expressed by some cancer cells and by immune inhibitory cells, such as myeloid-derived suppressor cells (MDSCs) and tumor-associated...

  20. Long-chain inulin for stimulating an immune response

    NARCIS (Netherlands)

    de Vos, Paulus; Vogt, Leonie

    2017-01-01

    The invention relates to a long chain inulin for influencing the immune response against a pathogen. The invention also relates to a combination comprising a long chain inulin and a vaccine for influencing the immune response against a pathogen, wherein the long chain inulin is orally administrated.

  1. Risk factors for discordant immune response among HIV-infected ...

    African Journals Online (AJOL)

    Risk factors for discordant immune response among HIV-infected patients initiating antiretroviral therapy: A retrospective cohort study. ... Multivariate logistic regression models were used to estimate adjusted odds ratios (AORs) to determine associations between discordant immune response and clinical and demographic ...

  2. Importins and Exportins Regulating Allergic Immune Responses

    Directory of Open Access Journals (Sweden)

    Ankita Aggarwal

    2014-01-01

    Full Text Available Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS present on cargo molecules to be imported while nuclear export signals (NES on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  3. Immune responses to influenza virus and its correlation to age and inherited factors

    Directory of Open Access Journals (Sweden)

    Azadeh Bahadoran

    2016-11-01

    Full Text Available Influenza viruses belong to the family Orthomyxoviridae of enveloped viruses and are an important cause of respiratory infections worldwide. The influenza virus is able to infect a wide variety species as diverse as poultry, marine, pigs, horses and humans. Upon infection with influenza virus the innate immunity plays a critical role in efficient and rapid control of viral infections as well as in adaptive immunity initiation. The humoral immune system produces antibodies against different influenza antigens, of which the HA-specific antibody is the most important for neutralization of the virus and thus prevention of illness. Cell mediated immunity including CD4+ helper T cells and CD8+ cytotoxic T cells are the other arms of adaptive immunity induced upon influenza virus infection. The complex inherited factors and age related changes are associated with the host immune responses. Here, we review the different components of immune responses against influenza virus. Additionally, the correlation of the immune response to age and inherited factors has been discussed. These determinations lead to a better understanding of the limitations of immune responses for developing improved vaccines to control influenza virus infection.

  4. Randomized controlled trial of oral omega-3 PUFA in solar-simulated radiation-induced suppression of human cutaneous immune responses1-3

    OpenAIRE

    Pilkington, Suzanne M.; Massey, Karen A.; Bennett, Susan P.; Al-Aasswad, Naser M I; Roshdy, Khaled; Gibbs, Neil K.; Friedmann, Peter S.; Nicolaou, Anna; Rhodes, Lesley E.

    2013-01-01

    BACKGROUND: Skin cancer is a major public health concern, and the majority of cases are caused by solar ultraviolet radiation (UVR) exposure, which suppresses skin immunity. Omega-3 (n-3) PUFAs protect against photoimmunosuppression and skin cancer in mice, but the impact in humans is unknown.OBJECTIVES: We hypothesized that EPA-rich n-3 PUFA would abrogate photoimmunosuppression in humans. Therefore, a nutritional study was performed to assess the effect on UVR suppression of cutaneous cell-...

  5. Yersinia type III effectors perturb host innate immune responses

    Science.gov (United States)

    Pha, Khavong; Navarro, Lorena

    2016-01-01

    The innate immune system is the first line of defense against invading pathogens. Innate immune cells recognize molecular patterns from the pathogen and mount a response to resolve the infection. The production of proinflammatory cytokines and reactive oxygen species, phagocytosis, and induced programmed cell death are processes initiated by innate immune cells in order to combat invading pathogens. However, pathogens have evolved various virulence mechanisms to subvert these responses. One strategy utilized by Gram-negative bacterial pathogens is the deployment of a complex machine termed the type III secretion system (T3SS). The T3SS is composed of a syringe-like needle structure and the effector proteins that are injected directly into a target host cell to disrupt a cellular response. The three human pathogenic Yersinia spp. (Y. pestis, Y. enterocolitica, and Y. pseudotuberculosis) are Gram-negative bacteria that share in common a 70 kb virulence plasmid which encodes the T3SS. Translocation of the Yersinia effector proteins (YopE, YopH, YopT, YopM, YpkA/YopO, and YopP/J) into the target host cell results in disruption of the actin cytoskeleton to inhibit phagocytosis, downregulation of proinflammatory cytokine/chemokine production, and induction of cellular apoptosis of the target cell. Over the past 25 years, studies on the Yersinia effector proteins have unveiled tremendous knowledge of how the effectors enhance Yersinia virulence. Recently, the long awaited crystal structure of YpkA has been solved providing further insights into the activation of the YpkA kinase domain. Multisite autophosphorylation by YpkA to activate its kinase domain was also shown and postulated to serve as a mechanism to bypass regulation by host phosphatases. In addition, novel Yersinia effector protein targets, such as caspase-1, and signaling pathways including activation of the inflammasome were identified. In this review, we summarize the recent discoveries made on Yersinia

  6. The effect of ghrelin upon the early immune response in lean and obese mice during sepsis.

    Directory of Open Access Journals (Sweden)

    Daniel Siegl

    Full Text Available It is well established that obesity-related hormones can have modulatory effects associated with the immune response. Ghrelin, a hormone mainly derived from endocrine cells of the gastric mucosa, regulates appetite, energy expenditure and body weight counteracting leptin, a hormone mainly derived from adipocytes. Additionally, receptors of both have been detected on immune cells and demonstrated an immune regulatory function during sepsis.In the present study, the effect of peripheral ghrelin administration on early immune response and survival was investigated with lean mice and mice with diet-induced obesity using cecal ligation and puncture to induce sepsis.In the obese group, we found that ghrelin treatment improved survival, ameliorated hypothermia, and increased hyperleptinemia as compared to the lean controls. We also observed that ghrelin treatment divergently regulated serum IL-1ß and TNF-α concentrations in both lean and obese septic mice. Ghrelin treatment initially decreased but later resulted in increased bacteriaemia in lean mice while having no impact upon obese mice. Similarly, ghrelin treatment increased early neutrophil oxidative burst while causing a decrease 48 hours after sepsis inducement.In conclusion, as the immune response to sepsis temporally changes, ghrelin treatment differentially mediates this response. Specifically, we observed that ghrelin conferred protective effects during the early phase of sepsis, but during the later phase deteriorated immune response and outcome. These adverse effects were more pronounced upon lean mice as compared to obese mice.

  7. pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity

    Directory of Open Access Journals (Sweden)

    Eiji Yuba

    2017-11-01

    Full Text Available (1 Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2 Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3 Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4 Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

  8. Immunization of neonatal mice with LAMP/p55 HIV gag DNA elicits robust immune responses that last to adulthood

    International Nuclear Information System (INIS)

    Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia; Piubelli, Orlando; Alves de Brito, Cyro; Fusaro, Ana Elisa; Eurico de Alencar, Liciana Xavier; August, Thomas; Torres Azevedo Marques, Ernesto; Silva Duarte, Alberto Jose da; Sato, Maria Notomi

    2010-01-01

    Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses, as measured by the breadth of the Gag peptide-specific IFN-γ, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.

  9. Immune response induction in the central nervous system

    DEFF Research Database (Denmark)

    Owens, Trevor; Babcock, Alicia

    2002-01-01

    The primary function of the immune response is protection of the host against infection with pathogens, including viruses. Since viruses can infect any tissue of the body, including the central nervous system (CNS), it is logical that cells of the immune system should equally have access to all...... tissues. Nevertheless, the brain and spinal cord are noted for their lack of immune presence. Relative to other organ systems, the CNS appears immunologically privileged. Furthermore, when immune responses do occur in the CNS, they are frequently associated with deleterious effects such as inflammatory...

  10. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.

    Science.gov (United States)

    Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-12-24

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  11. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis

    Directory of Open Access Journals (Sweden)

    Maxime W. Lemieux

    2017-12-01

    Full Text Available In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  12. The innate immune response during urinary tract infection and pyelonephritis.

    Science.gov (United States)

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  13. An immune response in the bumblebee, Bombus terrestris leads to increased food consumption

    Directory of Open Access Journals (Sweden)

    Mallon Eamonn B

    2006-07-01

    Full Text Available Abstract Background The concept of a costly immune system that must be traded off against other important physiological systems is fundamental to the burgeoning field of ecological immunity. Bumblebees have become one of the central models in this field. Although previous work has demonstrated costs of immunity in numerous life history traits, estimates of the more direct costs of bumblebee immunity have yet to be made. Results Here we show a 7.5% increase in energy consumption in response to non-pathogenic immune stimulation. Conclusion This increase in energy consumption along with other results suggests that immunity is one of the most important physiological systems, with other systems being sacrificed for its continuing efficiency. This increased consumption and maintained activity contrasts with the sickness-induced anorexia and reduced activity found in vertebrates.

  14. IL-10 polymorphism and cell-mediated immune response to Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Öhman, H.; Tiitinen, A; Halttunen, M.

    2006-01-01

    Chlamydia trachomatis infection induces an inflammatory response that is crucial in resolving acute infection but may also play a key role in the pathogenesis of C trachomatis associated infertility. The immune response is linked to cytokine secretion pattern which is influenced by the host genetic...

  15. MHC class II-associated invariant chain linkage of antigen dramatically improves cell-mediated immunity induced by adenovirus vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Mandrup Jensen, Camilla Maria; Orskov, Cathrine

    2008-01-01

    The ideal vaccine induces a potent protective immune response, which should be rapidly induced, long-standing, and of broad specificity. Recombinant adenoviral vectors induce potent Ab and CD8+ T cell responses against transgenic Ags within weeks of administration, and they are among the most...

  16. Immune responses induced in rabbits after oral administration of bovine serum albumin in combination with different adjuvants (herb extracts, aluminium hydroxide and platinum nanoparticles

    Directory of Open Access Journals (Sweden)

    G. Bižanov

    2016-12-01

    Full Text Available The aim of the current study was to evaluate the immunostimulatory activity of 10 different herbal extracts from Vitex agnus-castus, Vinca major, Aloe arborescens and the polyherbal product containing extracts from Sambucus nigra, Primula versis, Pinus alba, Gentiana lutea, Cetraria islandica, Eucaliptus globulus, Citrus limon and aluminium hydroxide, as well as platinum nanoparticles. Rabbits were immunized three times orally with bovine serum albumin (BSA in combination with the components mentioned above. BSA-specific IgA antibodies in saliva and IgG antibodies in serum were examined by ELISA. It was found that the rabbits immunized with BSA in combination with either platinum nanoparticles or aluminium hydroxide had higher titres of BSA-specific IgA antibodies in their saliva at day 56 of observation. Likewise, rabbits treated with BSA and Vinca major or Aloe arborescens extracts showed higher levels of BSA-specific IgG antibodies in the serum at the end of observation. These results suggest that some plant extracts, aluminium hydroxide and platinum nanoparticles components could be used as oral adjuvants or as immunomodulators for rabbits.

  17. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    OpenAIRE

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-01-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The...

  18. Interplay between behavioural thermoregulation and immune response in mealworms.

    Science.gov (United States)

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Effects of BRAF mutations and BRAF inhibition on immune responses to melanoma

    Science.gov (United States)

    Ilieva, Kristina M.; Correa, Isabel; Josephs, Debra H.; Karagiannis, Panagiotis; Egbuniwe, Isioma U.; Cafferkey, Michiala J.; Spicer, James F.; Harries, Mark; Nestle, Frank O.; Lacy, Katie E.; Karagiannis, Sophia N.

    2014-01-01

    Malignant melanoma is associated with poor clinical prognosis; however, novel molecular and immune therapies are now improving patient outcomes. Almost 50% of melanomas harbor targetable activating mutations of BRAF which promote RAS-RAF-MEK-ERK pathway activation and melanoma proliferation. Recent evidence also indicates that melanomas bearing mutant BRAF may also have altered immune responses, suggesting additional avenues for treatment of this patient group. The small molecule inhibitors selective for mutant BRAF induce significant but short-lived clinical responses in a proportion of patients, but also lead to immune stimulatory bystander events, which then subside with the emergence of resistance to inhibition. Simultaneous BRAF and MEK inhibition, and especially combination of BRAF inhibitors with new immunotherapies such as checkpoint blockade antibodies, may further enhance immune activation, or counteract immunosuppressive signals. Pre-clinical evaluation and ongoing clinical trials should provide novel insights into the role of immunity in the therapy of BRAF-mutant melanoma. PMID:25385327

  20. Functional characterization of Foxp3-specific spontaneous immune responses

    DEFF Research Database (Denmark)

    Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann

    2013-01-01

    Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....

  1. The Role of the Immune Response in Merkel Cell Carcinoma

    International Nuclear Information System (INIS)

    Triozzi, Pierre L.; Fernandez, Anthony P.

    2013-01-01

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies

  2. The Role of the Immune Response in Merkel Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Triozzi, Pierre L., E-mail: triozzp@ccf.org [Taussig Cancer Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States); Fernandez, Anthony P. [Departments of Dermatology and Anatomic Pathology, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States)

    2013-02-28

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies.

  3. Nanovectorized radiotherapy: a new strategy to induce anti-tumor immunity

    International Nuclear Information System (INIS)

    Vanpouille-Box, Claire; Hindré, François

    2012-01-01

    Recent experimental findings show that activation of the host immune system is required for the success of chemo- and radiotherapy. However, clinically apparent tumors have already developed multiple mechanisms to escape anti-tumor immunity. The fact that tumors are able to induce a state of tolerance and immunosuppression is a major obstacle in immunotherapy. Hence, there is an overwhelming need to develop new strategies that overcome this state of immune tolerance and induce an anti-tumor immune response both at primary and metastatic sites. Nanovectorized radiotherapy that combines ionizing radiation and nanodevices, is one strategy that could boost the quality and magnitude of an immune response in a predictable and designable fashion. The potential benefits of this emerging treatment may be based on the unique combination of immunostimulatory properties of nanoparticles with the ability of ionizing radiation to induce immunogenic tumor cell death. In this review, we will discuss available data and propose that the nanovectorized radiotherapy could be a powerful new strategy to induce anti-tumor immunity required for positive patient outcome.

  4. Nanovectorized radiotherapy, a new strategy to induce anti-tumor immunity

    Directory of Open Access Journals (Sweden)

    Claire eVanpouille-Box

    2012-10-01

    Full Text Available Recent experimental findings show that activation of the host immune system is required for the success of chemo- and radio-therapy. However, clinically-apparent tumors have already developed multiple mechanisms to escape anti-tumor immunity. The fact that tumors are able to induce a state of tolerance and immunosuppression is a major obstacle in immunotherapy. Hence, there is an overwhelming need to develop new strategies that overcome this state of immune tolerance and induce an anti-tumor immune response both at primary and metastatic sites. Nanovectorized radiotherapy that combines ionizing radiation and nano-devices, is one strategy that could boost the quality and magnitude of an immune response in a predictable and designable fashion. The potential benefits of this emerging treatment may be based on the unique combination of immuno-stimulatory properties of nanoparticles with the ability of ionizing radiation to induce immunogenic tumor cell death. In this review, we will discuss available data and propose that the nanovectorized radiotherapy could be a powerful new strategy to induce anti-tumor immunity required for positive patient outcome.

  5. Heavy metal pollution disturbs immune response in wild ant populations

    International Nuclear Information System (INIS)

    Sorvari, Jouni; Rantala, Liisa M.; Rantala, Markus J.; Hakkarainen, Harri; Eeva, Tapio

    2007-01-01

    Concern about the effects of environmental contaminants on immune function in both humans and wildlife is growing and practically nothing is known about this impact on terrestrial invertebrates, even though they are known to easily accumulate pollutants. We studied the effect of industrial heavy metal contamination on immune defense of a free-living wood ant (Formica aquilonia). To find out whether ants show an adapted immune function in a polluted environment, we compared encapsulation responses between local and translocated colonies. Local colonies showed higher heavy metal levels than the translocated ones but the encapsulation response was similar between the two groups, indicating that the immune system of local ants has not adapted to high contamination level. The encapsulation response was elevated in moderate whereas suppressed in high heavy metal levels suggesting higher risk for infections in heavily polluted areas. - Heavy metal pollution affects immune function in ants

  6. A T-cell response to a liver-stage Plasmodium antigen is not boosted by repeated sporozoite immunizations

    Science.gov (United States)

    Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.

    2013-01-01

    Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242

  7. Mycobacterium tuberculosis co-operonic PE32/PPE65 proteins alter host immune responses by hampering Th1 response

    Directory of Open Access Journals (Sweden)

    Mohd eKhubaib

    2016-05-01

    Full Text Available PE/PPE genes, present in cluster with ESAT-6 like genes, are suspected to have a role in antigenic variation and virulence of Mycobacterium tuberculosis. Their roles in immune evasion and immune modulation of host are also well documented. We present evidence that PE32/PPE65 present within the RD8 region are co-operonic, co-transcribed and co-translated, and play role in modulating host immune responses. Experiments with macrophage cell lines revealed that this protein complex suppresses pro-inflammatory cytokines such as TNF-α and IL-6 whereas also inducing high expression of anti-inflammatory IL-10. Immunization of mice with these recombinant proteins dampens an effective Th1 response as evident from reduced frequency of IFN-g and IL-2 producing CD4+ and CD8+ T cells. IgG sub-typing from serum of immunized mice revealed high levels of IgG1 when compared with IgG2a and IgG2b. Further IgG1/IgG2a ratio clearly demonstrated that the protein complex manipulates the host immune response favourable to the pathogen. Our results demonstrate that the co-transcribed and co-translated PE32 and PPE65 antigens are involved specifically in modulating anti-mycobacterial host immune response by hampering Th1 response.

  8. Platelet activating factor receptor binding plays a critical role in jet fuel-induced immune suppression

    International Nuclear Information System (INIS)

    Ramos, Gerardo; Kazimi, Nasser; Nghiem, Dat X.; Walterscheid, Jeffrey P.; Ullrich, Stephen E.

    2004-01-01

    Applying military jet fuel (JP-8) or commercial jet fuel (Jet-A) to the skin of mice suppresses the immune response in a dose-dependant manner. The release of biological response modifiers, particularly prostaglandin E 2 (PGE 2 ), is a critical step in activating immune suppression. Previous studies have shown that injecting selective cyclooxygenase-2 inhibitors into jet fuel-treated mice blocks immune suppression. Because the inflammatory phospholipid mediator, platelet-activating factor (PAF), up-regulates cyclooxygenase-2 production and PGE 2 synthesis by keratinocytes, we tested the hypothesis that PAF-receptor binding plays a role in jet fuel-induced immune suppression. Treating keratinocyte cultures with PAF and/or jet fuel (JP-8 and Jet-A) stimulates PGE 2 secretion. Jet fuel-induced PGE 2 production was suppressed by treating the keratinocytes with specific PAF-receptor antagonists. Injecting mice with PAF, or treating the skin of the mice with JP-8, or Jet-A, induced immune suppression. Jet fuel-induced immune suppression was blocked when the jet fuel-treated mice were injected with PAF-receptor antagonists before treatment. Jet fuel treatment has been reported to activate oxidative stress and treating the mice with anti-oxidants (Vitamins C, or E or beta-hydroxy toluene), before jet fuel application, interfered with immune suppression. These findings confirm previous studies showing that PAF-receptor binding can modulate immune function. Furthermore, they suggest that PAF-receptor binding may be an early event in the induction of immune suppression by immunotoxic environmental agents that target the skin

  9. Oral Methylated N-Aryl Chitosan Derivatives for Inducing Immune ...

    African Journals Online (AJOL)

    received OVA in TM65CM50CS were significantly (p < 0.05) higher than those that ... enhancing paracellular permeability but showed no immune responses, while ... However, poor immunogenicity ... soluble in dilute acidic solutions below pH.

  10. Hepatitis B Virus Vaccine immune response in Egyptian children 15 ...

    African Journals Online (AJOL)

    Egypt J Pediatr Allergy Immunol 2015;13(2):45-48. 45. Hepatitis B Virus Vaccine immune response in Egyptian children 15-17 years after primary immunization; should we provide a booster dose? INTRODUCTION. Hepatitis B virus (HBV) infection is a global public health problem. With approximately 350 million hepatitis B ...

  11. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    Purpose: To evaluate the immunogenicity and types of immune response of a quality-controlled modified recombinant hepatitis B surface antigen (HBsAg) plasmid encoding HBsAg in mice. Methods: The characterized plasmid DNA was used in the immunization of Balb/c mice. Three groups of mice were intramuscularly ...

  12. Modulation of the immune response by emotional stress

    NARCIS (Netherlands)

    Croiset, G; Heijnen, C J; Veldhuis, H D; de Wied, D; Ballieux, R E

    1987-01-01

    The influence of mild, emotional stress was investigated for its effect on the immune system by subjecting rats to the one-trial-learning passive avoidance test. The reactivity of the immune system was tested by determining the proliferative response after mitogenic stimulation in vitro as well as

  13. Reprogramming Antitumor Immune Responses with microRNAs

    Science.gov (United States)

    2013-10-01

    disease, including cancer etiology (4) and the generation and inhibition of antitumor immune responses (5–9). Biologically active miRNAs bind to MREs...breast, colorectal, lung, pancreatic , and thyroid carcinomas and in liquid tumors including lymphomas and some acute myeloid leukemias (9, 35). The...immunity [9], underscoring the potential of targeting this major microenvironmental compartment. Accumulating evidence suggests that chronic

  14. The sterile immune response during hepatic ischemia/reperfusion

    NARCIS (Netherlands)

    van Golen, Rowan F.; van Gulik, Thomas M.; Heger, Michal

    2012-01-01

    Hepatic ischemia and reperfusion elicits an immune response that lacks a microbial constituent yet poses a potentially lethal threat to the host. In this sterile setting, the immune system is alarmed by endogenous danger signals that are release by stressed and dying liver cells. The detection of

  15. Immune and stress responses in oysters with insights on adaptation.

    Science.gov (United States)

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Cell-Mediated and Humoral Immune Responses after Immunization of Calves with a Recombinant Multiantigenic Mycobacterium avium subsp. paratuberculosis Subunit Vaccine at Different Ages

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Aagaard, Claus; Stockmarr, Anders

    2013-01-01

    and 12 relative to the first vaccination. Vaccine-induced immune responses, the gamma interferon (IFN-γ) cytokine secretion and antibody responses, were followed for 20 weeks. In general, the specific responses were significantly elevated in all three vaccination groups after the first booster...

  17. Models for Immune Response and Immune Evasion in MSI Cancer and Lynch Syndrome

    OpenAIRE

    Özcan, Mine

    2017-01-01

    Microsatellite-unstable (MSI) cancers occurring in the context of the hereditary Lynch syndrome or as sporadic cancers elicit pronounced tumor-specific immune responses. The pronounced immune response was shown to be closely associated with frameshift peptides (FSP) that are generated as a result of deficiency in DNA mismatch repair system leading to insertion/deletion mutations in coding microsatellites (cMS). FSP neoantigens are long antigenic amino acid stretches that bear m...

  18. Predictors of responses to immune checkpoint blockade in advanced melanoma

    DEFF Research Database (Denmark)

    Jacquelot, N; Roberti, M P; Enot, D P

    2017-01-01

    Immune checkpoint blockers (ICB) have become pivotal therapies in the clinical armamentarium against metastatic melanoma (MMel). Given the frequency of immune related adverse events and increasing use of ICB, predictors of response to CTLA-4 and/or PD-1 blockade represent unmet clinical needs....... Using a systems biology-based approach to an assessment of 779 paired blood and tumor markers in 37 stage III MMel patients, we analyzed association between blood immune parameters and the functional immune reactivity of tumor-infiltrating cells after ex vivo exposure to ICB. Based on this assay, we...

  19. Mechanisms underlying UV-induced immune suppression

    International Nuclear Information System (INIS)

    Ullrich, Stephen E.

    2005-01-01

    Skin cancer is the most prevalent form of human neoplasia. Estimates suggest that in excess of one million new cases of skin cancer will be diagnosed this year alone in the United States (www.cancer.org/statistics). Fortunately, because of their highly visible location, skin cancers are more rapidly diagnosed and more ea